CA1313830C - Glyphosate-resistant plants - Google Patents

Abstract

07-21(381)A GLYPHOSATE-RESISTANT PLANT CELLS Abstract of the Disclosure This invention involves a cloning or expression vector comprising a gene which encodes 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) polypeptide which, when expressed in a plant cell contains a chloroplast transit peptide which allows the polypeptide, or an enzymatically active portion thereof, to be transported from the cytoplasm of the plant cell into a chloroplast in the plant cell, and confers a substantial degree of glyphosate resistance upon the plant cell and plants regenerated therefrom. The EPSPS coding sequence may be ligated to a strong promoter, such as the 35S promoter from cauliflower mosaic virus, to create a chimeric gene. Such genes can be inserted into plant transformation vectors, and subsequently introduced into plant cells. Plant cells transformed using such genes and plants regenerated therefrom have been shown to exhibit a substantial degree of glyphosate resistance.

Description

-1- 07-21(381)A

BACKGROUN~ OF THE INVEPITIO~ .
The present invent:ion relates to the fields of genetic engineering, biochemistry, and plant biology.
N-phosphonomethylg:Lycine has the ~ollowing structure:

o H O OH
Il I 11 /
HO - C - CEI2 - N - CH2 - P ~
OH
This molecule is an acid, which can dissociate in aqueous solution to form phytotoxicant anions.
Several anionic forms are known. As used herein, the name "glyphosate" refers to the acid and its anions. A
mi~ture containing glyphosate as the active ingred-ient, formulated as its isopropylamine sal-t, is sold as a herbicide by Monsanto Company under the trademark ROUNDUP~. N~merous other salts also have herbicidal properties, as exemplified by U.S. Patent No.
3,799,758 (Franz 1974) and various other patents.
Compositions comprising N-phosphonomethylglycine and salt-forming cations which increase the solubility of the N-phosphonomethylylycine in water are preferred.
Those skilled in the art recognize that the scientific literature contains numerous papers suggesting severaI modes of action ~or inhibitlon o~
plant growth by gIyphosate. one proposed mode suggests that gl~phosate inhibits an enzyme called 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS);

- , ...

~31383~

-2- 07-21(381)A

see, e.g., Amrhein 1980, Steinrucken .L980, Mousdale 1984, and Rubin 1982 tnote: a complete list of references is contained below, after the Examples~.
The EPSPS enzyme reportedly catalyzes the conversion of shikimate-3-phosphate into 5-enolpyxuvyl-shikimate-3-phosphate, an intermediate in the biochemical pathway for creating three essential aromatic amino acids (tyrosine, phenylalanine, and tryptophan)i see, e.g., Mousdale 198g. ~ogers 1983 reports that overproduction of EPSPS in E. coli contributes to glyphosate resistance in those cells.
At least one resea.rcher has attempted to create glyphosate-resistank bacterial cells by manipulating a bacterial gene which encodes an EPSPS
enzyme. ~s described in U.S. Patent 4,535,060 (Comai; assigned to Calgene, Inc.; filing date January 5, 1983) and in Comai 1983, a culture of Salmonella bacteria was contacted with a mutagen (ethyl methanesulfonate). The bacteria were screened for glyphosate resistance, and a relatively resistant cuIture was selected. This culture was analyzed, and detexmined to have a mutant form of EPSPS with a substitu~ed amino acid, as reported in Stalker 1985. U. S. Patent 4,535,060 suggested that the mutant E~SPS gene could be inserted into plant cells to create glyphosate-resistant ~GlyR~ plant cells.
In addition, it has been reported that glyphosate tolerant plant c~lls can be selected which overproduce EPSPS in the presence of low levels of ~lyphosate (Nafziger et al, 1984 and Smart et al, 1985). ~ow-ever, none of the experiments havè demonstrated that such a method would be efficacious in differentiated plants.

~313~0 -3- 07-21(3~1)A

After the fillng date of U. S. Patent 4,535,060, methods and vectors were described which could be used to insert foreign genes into plant cells (see, e.g., Fraley 1983, Herrera-Estrella 1983, Bevan 1983, and PCT applications WO 84/02919 and 02920). In PCT
application WO 84/02913, methods were also described for creating chimeric genes having bacterial EPSPS
coding sequences controlled by regulatory sequences derived from genes which are active in plant cells.
Using these vectors and methodology, bacterial genes such as the mutant Salmonella EPSPS gene mentioned above can be manipulated and expressed in plant cells.
The object of this invention is to provide a method of genetically transforming plant cells which causes the cells and plants regenerated therefrom to become resistant to glyphosa-te and the herbicidal salts thereof.

SUMMARY OF THE INVENTION
-This invention involves a cloning or expression vector comprising a gene which encodes 5-enolpyruvylshikimate~3-phosphate synthase (EPSPS) polypeptide which, when expressed in a plant cell contains a chloroplast transit peptide which allows the polypeptide, or an enzymatically active portion thereof, to be transported from the cytoplasm of the plant cell into a chloroplast in the plant cell, and confers a substantial degree of gl~phosate resistance upon the plant cell and plants regenerated therefrom.
The EPSPS coding sequence may be ligated to . 30 a strong promoter, such as the 35S promoter from cauliflower mosaic vi~us, to create a chimeric gene.
Such genes can be inserted into plant transformation :~3~3~3~

_ 4 _ 07-21(381)A
vectors, and subsequently introduced into plant cells.
plant cells transormed usiny such genes and plants regenerated therefrom have been shown to exhibit a substantial degree of glyphosate resistance.
In accordance with an embodiment oE the present invention there is providecl a chemeric plant gene which comprises: a promoter sequence which Eunctions in plant cells; a coding sequence which causes the production of RNA, encoding a chloroplast transit peptide/5-enolpyruvylshikimate-3-phosphate synthase fusion poly-peptide, which chloroplast transit peptide permits the fusion polypeptide to be imported into a chloroplast o a plant cell; and a 3' non-translated region which encodes a polyandenylation siqnal which functions in plant cells to cause the addition of polyadenylate nucleotides to the 3' end of the RNA; the promoter being heterologous with respect to the coding sequence and adapted to cause sufficient expression of the fusion polypeptide to enhance the glyphosate resistance of a plant cell trans-formed with the gene, In accordance with another embodiment of the present invention there is provided plasmid pMoN546, ATCC accession number 53213.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 depicts the major steps used in one preferred embodiment of this invention.
FIGURE 2 depicts the creation of plasmid pMoN546, a plant transormation vector which contains a chimeric CaMV/EPSPS gene. It also deplcts the structure cf pGV31.11-SE, a disarmed Ti plasmid with vir genes which help insert the CaMV/EPSPS gene from pMoN546 into plant chromosomes, FIGURE 3 indicates the DNA sequence and the amino acid sequence of the chloroplast transit peptide - .

~3~3g3~
~ 4A - 07-21(381)A
from the petunia EPSPS gene and enzyme, FIGURE 4 shows the nucleotide, amino acid sequence and restriction map for the ~ull-length cDNA of petunia EPSPS.
FIG~RE 5 shows the plasmid map Eor pMON316.
FIG~RE 6 shows the restriction maps or the EPSPS gene of petunia and ~rabidopsis.
FIGURE 7 shows the plasmid map for pMON9721.

DETAILED DESCRI PTION OF THE INVENTION
The present invention embraces a cloning or expression vector which contains a gene which encodes a form of EPSPS which can effectively confer glypho-sate resistance (GlyRl on plant cells and plants re-generated theref rom . The EPSPS gene encodes a poly-peptide which contains a chloroplast transit peptide (CTP), which enables the EPSPS polypeptide (or an active portion thereof) to be transported into a chloro-plast inside the plant cell. suitable plants for the practice of the present invention include, but are ~ , . .
:;. ,,~, ..;.

. .

~3:~383~

-5-- 07-21(381)~

not limited to, soybean, cotton, alfalfa, canola, flax, tomato, sugar beet, sunflower, po-tato, tobacco, corn, wheat, rice and lettuce.
Those skilled in the art reco~lize that -the scientific literature contains numerous papers stating that EPSPS activity (shikimic: acid pathway) is present both in the chloroplast and in the cytoplasm. Indeed, prior to the present invention it was unknown whether the cloned EPSPS would be needed in the cytoplasm or chloroplasts in order to confer glyphosate resistance.
Contrary, to the teaching of U.S. Patent 4,535,060 it has now been found that the EPSPS gene should contain a chloroplast transit peptide. While chloroplasts contain DNA which is believed to be expressed in polypeptides within the chloroplasts, the EPSPS polypeptide is en-coded by chromosomal DNA rather than chloroplast DNA.
The EPSPS gene is transcribed into mRNA in the nucleus and the mRNA is translated into a precusor polypeptide (CTP/mature EPSPS) in the cytoplasm. The precusor polypeptide lor a portion thereo*) is transported into the chloroplast.
Promoters which are known ox found to cause transcription of the EPSPS gene in plant cells can be used in the present invention. Such promoters may be obtained from plants or viruses and includ~, but are not necessarily limite~ to, the 35S and l9S promoters of cauliflower mosaic virus and promo~ers isolated from plant genes such as EPSPS, ssRUBISCO genes and promoters obtained from T-DNA genes of Ayxobacterium tumefaclens such as nopaline and mannopine synthases.
The particular promotex selected should be capable of causing sufficient e~pression to result in the 1313831[
-6- 07-21(381)A

production of an effective amount of EPSPS polypeptide to render the plant cells and plants regenerated there~rom substantially resistant to glyphosate.
Those skilled in the art will recognize that the amount of EPSPS polypeptide needed to induce resistance may vary with the type of plant. The degree of expression needed may vary with the EPSPS coding sequence used. A mutant EPSPS may require lower expression than a less-tolerant wild-type EPSPS se~uence.
The CaMV 35S promoter is stronger than the natural EPSPS promoter in at least some types of plants, i.e. it causes the formation of larger ~uantities of mRNA from chimeric genes compared to the natural EPSPS promoter. The high stren~th of the chimeric CaMV 35S/EPSPS gene is of great value in using the EPSPS gene as a selectable marker in the labor atory. However, when a chimeric gene is used to transform regenerated plants for food production, the level of production of EPSPS enzyme may be undesirably high, since it diverts nucleotides, amino acids, and s~bstrates away from other desired biochemical path-ways in the cells. Therefore, to create a chimeric gene with the optimal level of expression of EPSPS
it may be desirable to diminish the strength of the chimeric CaMV 35S/EPSPS gene. This can be done by various methods such as (1) random or site-specific mutagenesis of the region prior to the transcription start site; (2) insertion of a transcription termin-ator in the 5' non-translated region of the gene; ~3) insertion of a spurious start codon in front o~ the EPSPS start codon; or (4~ insertion of a coding sequence with a start codon and a stop codon in front of the EPSPS start codon, to create a dicistronic coding se~lence.

131 38~0 -7- 07-21(381)A

The promoters used in the EPSPS genes of this invention may be further modified if desired to alker their expression characteristics. For example, the Ca~V 35S promoter may be ligated ~o the portion of the ssRUBISCO gene which represses the expression of ssRUBISCO in the absence of light, to create a promoter which is active in leaves but not in roots. The re-sulting chimeric promoter may be used as described herein. As used her~in, the phrase "CaMV 35S" promoter includes variations of CaMV 35S promoter, e.g., promoters derived by means of ligation with operator regions, random or controlled mutagenesis, etc.
The RNA produced by the EPSPS gene also contains a 5' non~translated leader sequence. This sequence may be derived from any gene and may be specifically modified so as to increase translation of the mRNA. The 5' non-translated regions may be derived from viral RNAs, other suitable eukaryotic genes or a synthetic gene sequence. It may ~e part of the 5' end of the non-translated region of the coding sequence for the EPSPS polypeptide or de-rived from an unrelated promoter or coding sequence as discussed above.
The EPSPS gene of the present invention encodes an CTP/EPSPS fusion polypeptlde. After the CTP/EPSPS polypeptide from a gene of this invention is translated from mRNA i~ the cytoplasm of the transformed plant cell, it is bel~eved to be processed in the same manner as the natural EPSPS polypeptide.
The CTP leader sequence causes the polypeptide to be imported into chloroplasts, and the CTP leader sequence encoded by the plant-derived EPSPS gene is believed to be removed from ~he remainder of the polypeptide so that ~3~38~
-8- 07-21(381)A

an active portion of the EPSPS polypeptide exists and functions inside the chloroplast.
Suitable CTP's for use in the present inven-tion may be obtained from various sources. Most preferably, the CTP is obtained from the endogenous EPSPS gene uf the subject plaLnt to the transformed.
Alternately, one may often us'e a CTP from an EPSPS
gene of another plant. ~lthough there is little homology between the CTP sequences of the EPSPS
gene and the ssRUBISCO gene (see, ~.g., Broglie (1983), one may find that non-homologous CTPs may function in particular embodiments. Suitable CTP sequences for use in the present invention can be easily determined by assaying the chloroplast uptake of an EP~PS polypeptide comprising the C1'P of interest as described in Example 18 hereinafter.
The sequence encoding a EPSPS polypeptide can be obtained from numerous sources. Suitable sources include bacteria, fungi and plants. EPSPS coding sequences from other sources can be obtained using the full-length petunia cDNA (see Figure 4) or a suitable fragment thereof as a hybridization probe as described in Examples 1 and 14-17.
All peptide structures represented in the following description are shown in conventional format wherein the amino group at the N-terminus appears to the left and the carboxyl group at the C-terminus at ~he right. Likewise, amino acid nomenclature for the naturally occurring amino acids found in protein is as follows: alanine (Ala;A), asparagine (Asn;N), aspartic acid ~Asp;D), arginine ~Arg;~), cysteine (Cys;C), glutamic acid (Glu;E), glutamine (Gln;Q), glycine ~Gly;G), hi~tidine ~His;H~, isoleucine (Ile;I), leucine (Leu;L~, lysine (Lys;K), 13~3~
-9- 01-21(381)A

methionine (Met;M), phenylalanine (Phe;F), proline (Pro;P), serine (Ser;S), threonine ~Thr;T~, tryptophan tTrp;W), tyrosine (Tyr;Y), and valine (Val;V).
Those skilled in the art wil]. recognize that mutant and variant forms of EPSPS ma~ be made by a variety of processes. For example, cloning or e.Ypression vectors may be rnutagenized to alter one or more amino acid residues in a ~PSPS protein. This may be done on a random basis (e.g., by subjecting the host cells to mu~agenic agents such as X-rays, ul~ra-violet ligh-t, or various chemicals), or by means involving an exact predicted substitution of bases in a DNA sequence.
Alternately, one may select for a microbial source such as bacteria and fungi or a plant source having a mutant EPSPS exhibiting increased resistance to glyphosate.
The 3' non-translated region contains a poly~
adenylation signal which functions in plants to cause the addition of polyadenylate nucleotides to the 3' end of the EPSPS mRNA. In cases where the EPSPS seguence is derived from a plant source one can use the 3' non-translated region naturally associated with the particular EPSPS gene. Examples of other suitable 3' regions are ~he 3' transcribed, non-translated regions containing the polyadenylation signal of the nopaline synthase (NOS) gene of the A~robacterium tumor-inducing (Ti) plasmid or the conglycinin (7S~ storage protein gene.
The EPSPS gene of the present invention is inserted into the genome of a plant by any suitable method. Suitable plant transformation vectors include those derived from a Ti plasmid of Aqrobacterium tumefaciens as well as ~hose described in, e.g. ~errera-. __ Estrella 1983 r Bevan 19~3, Klee 1985 and EP0 publication 120,516 (Schilperoort et al.~. In addition to plant :L31~83~

-10- 07-21(381)A

transformation vectors derived from the Ti or root-i~ducing (Ri) plasmids of Agrobacterium, alternative methods can be used to insert the EPSPS genes of this invention in~o plant cells. Such methods may involve, for example, liposomes, electroporation, chemicals which increase free DN~ uptake, a~d the use of viruses or pollen as vectors. If desired, more than one EPSPS gene may be inserted into th~ chromosomes of a plant, by methods such as repeating the trans-formation and selection cycle more than once.
EPSPS genes which e~code an e~zyme with a Functional chloroplast transit peptide (which is preferably removed ~rom the mature EPSPS polypep-tide) also provide useful selectable marker genes for plant cell transformation, when transformed and untransformed cells are contac-ted with appropriate concentrations o~ glyphosate (which can be routinely determined for any type of plaIlt). The conferrabl.e trait of ~lyphosate resistance may be particularly useful with certain types of plants (such as alfalfa, soybean, and other legumes) which do not exhibit clear selectability using other selectable marker genes (such as kanamycin, methotrexate, or hygromycin resistance.genes).
In addition, glyphos~te-resistant plant cells that have been transformed with EPSPS genes can be regenerated into differentiated plants using standard nutrient media supplemented with selected shoot-inducing or root-inducing hormones, using methods described i~ PCT W084/02920 or other methods known to those skilled in the art.
As used herein, a EPSPS gene "con~ers a sub-stantial degree of glyphosate resistance upon a plant :~3~383(~

~ 07-21(381~A

celll' if it allows a selectable fraction of a culture of transformed plant cells to survive a concentration of glyphosa~e which kills essentially all untransformed cells ~rom the same type of plant under the same conditions.
As used herein, a "cloning or expression vector" refers to a DNA or RNA molecule that is capable of replicating in one or more types of microbial cells. Vectors include plasmids, cosmids, viral DNA or RNA, minichromosomes, etc.
As used herein, "replicated from" includes indirect replication (e. g., replication of inter-mediate vectors), as well as replication directly from plant DNA or mRNA. It also includes DNA that is synthesized (e. g., by the method of Adams 1983) using a sequence of bases that is published or determined experimentally.
The following examples further demonstrate several preferred embodiments of this invention.
Those skilled in the art will recognize numerous equivalents to the specific embodiments described herein. Such equivalents are intended to be within the scope of the claims.

13~383~
-12- 07-21 ( 3al )A

EXAMPLES

EXAMPLE 1: CREATION OF EPSPS VECTORS
.~
A. Creation of MP4-G Cell Li_e The starting cell l:ine, designated a~ the MP4 line, was derived from a ~itchell diploid petunia (see, e.g., Ausubel 1980). The MP4 cells were sus-pended in Murashige and Skoog (MS) culture media, (GIBCO, Grand Island, N~ Y.) All transfer involved the transfer of 10 ml of suspension culture into 50 ml of fresh media. Cultivation periods until the next trans~er ranged from 10 to 14 days, and were based on visual indications that the culture was approaching saturation.
Approximat~ly 10 ml of saturated suspension culture (containing about 5X106 cells were trans-ferred into 50 ml of MS media containing 0.5 mM
glyphosate (Monsanto Agric. Products Co., St. Louis, Missouri). The sodium salt of glyphosate was used throughout the experiments described hereinO The large majority sf cells were unable to reproduce in the presence of the glyphosate. The cells which survived (estimated to be less than 1% of the starting population) were cultured in 0.5 mM glyphosa-te and transferred to fresh media co~taining glyphosate every 10 to 14 days.
After two transfers, the surviving cells were tran~ferred into fresh media containing 1.0 mM
glyphosate. After two transfers at 1.O mM, the surviving cells were transferred sequ~ntially into 2.5 mM glyphosate, 5.0 mM glyphosate, and 10 mM glypho-sate.

' ' '' `

.

~3~3~3Q

-13- 07-21~ 3al )~

T~le MP~-G cells were subsequently sllown (by a Southern blot) to have about 15~20 copies of the EPSPS gene, due to a genetic process called "gene amplification" Isee, e.g., Schimke 19~?). Although spontaneous mutations might have occurred during the replic~tion of any cell, there is no indication that any muta-tion or other modification of the EPSPS gene occurred during the gene amplification process. The only known difference between the MP4 and the MP4-G
cells is that the MP4-G cells conta.in multiple copies of an EPSPS gene and possibly other genes located near it on the chromosomes of the cells.
B. Purification and Sequencinq of EPSPS E~zyme Petunia cells from the MP4-G cell line were harv~sted by vacuum filtration~ frozen under liquid N~, and ground to a powder in a Waring blender.
The powder was suspended into 0.2 M tris-HCl, pH 7.8, containing 1 mM EDT~ and 7.5% w/v polyvinyl-poly-pyrrolidone. The suspension was centrifu~ed at about 20,000 G for 10 min to remove cell debris. Nucleic acids were precipitated from the supernatant by addition of 0.1 volume of 1.4% protamine sulfate and discarded.
~he crude protein suspension was purified by five sequential steps (see Mousdale 1984 and Steinrucken 1985) which involved: (1) ammonium sulfate precipitation; (2) diethylaminoethyl cellulose ion exchange chromatography; (3) hydroxyapatite chromatography; (4) sizing on a phenylagarose gel; and (5) sizing on a*Sephacryl S-200 gel.
The purified EPSPS polypep~ide was degraded into a series of individual amino acids by Edman degradation by a Model 470A Protein Sequencer ~Applied Biosystems Inc., Foster City, C~), using the methods described in Hunkapiller 19~3a. Each amino acid , * Trade maxk .. - . . . , :.. ..
.

:L311 3831~
-14- 07-21(381)A

derivative was analyzed by reverse phase high perfor-mance liquid chromatography, as described by Hunka-piller 1983b, using a cyanopropyl column with over 22,000 theoretical plates (IBM Instruments, Walling-ford CT). A partial amino acid sequence for petunia EPSPS is shown in Table 1.

, ~ 3~383~
15~ 07-21(381)A

TABI~ l PETUNIA EPSPS SEQUENCES

89 lO ll12 13 Amino acid:Gln Pro Ile LysGlu Ile mRNA strand: 5'~CAP CCN A W GAP CAP A W
C C
A A
Complementary DNA strand: 3'-GTQ GGN TAA TTQ CTQ TAA
G G
U U
Synthetic D~A Probes:

EPSPl: 3'-GTQ GGP TAP TTQ CTQ TA
EPSP2: 3'-GTQ GGQ TAP TTQ CTQ TA
EPSP3: 3'-GTQ GGN TAT TTQ CTQ TA

Exact mRNA Sequence:
5'-CAA CCC AUU AAA GAG AW

C. Synthesls of Probes Using the genetic code, the amino acid sequence indicated in Table 1 was used to determine the possible DNA codons which ara capable of coding for each indicated amino acid. Using this informa-ti9n; three different probe mixtures were created and designated as EPSR-1, EPSP-2, and EPSP-3, as shown in Table 1. In this table, A, T, U, C, and G represent th~ n~cleotide bases: adenine, thymine, uracil, cytosine and guanine. The letters P, Q, and N are variables; .N represents any of the bases; P represents : : purines (A or G); Q represents pyrimidines IU, T, or C).

.
. .

~3~383~

-16- 07-21(381)A

~ 11 oligonucleotides were synthesized by the method of Adams 1983. Whenever an indeter~inate nucleotide position (P, Q, or N) was reached, a mixture of appropriate nucl~otides was added to the reaction mixture. Pxobes were labeled 20 pmol at a time sllortly before use with 100 uCi y-[32P]~ATP
~Amersham) and 1~ units of polynucleotid~ kinas~ in 50 mM Tris-~Cl, pH 7.5, 10 mM MgCl2, 5 mM DTT, 0.1 mM
EDT~, and 0.1 mM spermidine. Afker incubation ~or 1 hr a-t 37C, the probes were repurified on either a 20% acrylamide, 8 M urea gel or by passage over a 5 ml column o~ ~ephadex G25 in 0.1 M NaCl, 10 mM
Tris-~Cl, pH 7.5, 1 mM EDTA.

D. PreParation of mRNA and Preliminary Testinq of Probes (a) Poly-A mRNA
Total RNA was isolated from the MP4 (glyphosate sensitive) and MP4-G (glyphosate resistant) cell lines as described by Goldberg 1981.
Total RNA was further sedimented through a CsCl cushion as described by Depicker 1982. Poly-A mRNA
was selected by oligo-dT cellulose chromatography.
The yield of poly-A RNA was 1.1 micrograms (~g) per gram of MP4 cells and 2.5 ~g/gm of MP4 G cells.

~5 (b) Gel Processing of RNA
Ten ~g of poly~A ~NA from the MP4 or MP4-G
cell lines was precipitated with ethanol and re-suspended in 1 x MOPS buffer ~20 mM morpholino propane sul~onic acid, p~ 7.0, 5 mM sodium acetate and 1 mM
EDTA, pH 8.0) containing 50% formamide and 2.2 M
formaldehyde. RNA was denatured by heatiny at 65~C
for 10 min. One-fifth volume of a loading buffer Trade mark .. ... ..
" ~, 13~383~

-17- 07-21(381)A

containing 50% glycerol, 1 mM EDT~, 0.4% bromophenol blue and 0.4% x~Ilene cyanol was then added. RNA was fractionated on a 1.3% agarose gel containing 1.1 M
formaldehyde until bromophenol blue was near the bottom. HaeIII-digested ~X174 DNA, labelled with 32p, was run as a size standard. The DNA markers indicated approximate sizes for the RNA ~ands.

(c) Transfer of RNA to Nitrocellulose ~NA was transferrecl to nitrocellulose (#BA85, Schleicher & Schuell, Keene, NH) by blotting the gels overnight using 20X SSC (lX SSC is 0.15 M
NaCl, 0.015 M sodium citrate, pH 7.0) as ~he transfer buffer. After transfer, filters were air-dried and baked in a vacuum oven for 2-3 hrs at 80C.

(d) Preliminary Hybridization with Radioactive Probes Filters were prehybridized in 6 x SSC, 10 x Denhardt's solution (1 x Denhardt's solution is 0.02%
ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin), 0.5% NP-40, and 200 ~g/ml E. coli transfer RNA at 50C for 4 hrs. Hybridization was carried out in the fresh solution containing 2 x 106 cpm/ml of either ~PSP-1 or EPSP-2 probe for 48 hrs at 32C. The EPSP-3 probe was not tested since it contained a codon (ATA) that is rarely used in the petunia genome. ~ybridization temperature (32qC) used in each case was 10C below the dissociation temperature (Td) calculated for the oligonucleotide with the lowest GC content in a mixture. The Td of the probe was approximated by the formula 2C x (A
Tj ~ 4C x (G ~ C).

131383~
18- 07-21~381)A

(e) Filter Washing The filters were washed twice Eor 15 20 min at room temperature in 6 x SSC and then for 5 min at 37C with gentle shaking. Filters were then wrapped in plastic film and autoradiographed for 12-14 hrs at -70C with two intensifying screens. The filters were then washed again for 5 min with gentle shaking at a temperature 5C higher than previously used.
The filters were autoradioyraphed again for 12-14 hrs.
The autoradiographs indicated khat the probe EPSP-l hybridized to an RNA of approximately 1.9 kb in the lane containing the poly-A RNA from the MP4-G cell line. No hybridization to this RNA was detected in the lane containing the poly-A RNA from the MP4 cell line. This result was a~tributed to overproduction of EPSPS mRNA by the MP4-G cell line. The probe EPSP-2, which differs from EPSP-l by a single nucleotide, showed barely detectable hybridization to the 1.9 kb mRNA of the MP4-G cell line but hybridized strongly to a 1.0 kb mRNA from both cell lines.
However, the 1.0 kb DNA was not sufficient to encode a polypeptide of 50,000 daltons, and it is believed that one of the sequences in the EPSP-2 probe hybrid-ized to an entirely different sequence in the library.
These r~sults suggested that degenera-te probe mixture EPSP-l contained the correct sequence for EPSPS. This mixture was used in all subsequent degenerate probe hybridization experiments.

E. Preparation of A~t 10 cDNA 1lbrary ~a3 Materials Used AMV reverse transcriptase was purchased from Seikagaku America, Inc., St. Petersburg, Florida;
the large fragment of ~A polymerase I (Klenow poly-~3~3~

-19- 07-21(381)A

merase) was from New England Nuclea.r, Boston, MA; S1 nuclease and tRNA were from Slgma; AcA 34 column bed resin was from LK~, Gaithersbury, M~; EcoRI, EcoRI
methylase and EcoRI linkers were from New England Biolabs, Beverly MA; RNasin (ribonuclease inhibitor) was from Promega Biotech, Maclison, Wisc. and all radioactive compounds were from Amersham, Arlington Hts., IL.
The A~tlO vector (ATCC No. 40179) and associated E. coli cell lines were supplied by Thanh Huynh and Ronald Davis at Stanford University Medical School (see EIuynh 1985). This vector has three important characteristics: (1) it has a unique EcoRI
insertion site, which avoids the need to remove a center portion of DNA from the phage DNA before inserting new DNA; (2) DNA ranging in size from zero to about 8,000 bases can be cloned using this vector;
and, (3) a library can be processed using E. coli MA150 cells (ATCC No. 53104) to remove clones which do not have DNA inserts.

(b) cDNA First Strand Synthesis Poly-A mRNA ~as prepared as descxibed in Example l.D.a, and resuspended in 50 mM Tris (pH 8.5), 10 mM MgCl2, 4 mM DTT, 40 mM KCl, 500 ~M of d(AGCT)TP, 10 ~g/ml dTl2 18 primer, and 27.5 units/ml RNasin.
In a 120 ~l reaction volume, 70 units reverse transcriptase were added per 5 ~g of poly-A RMA. One reaction tube contained a~32P-dCTP (5 uCi/120 ~l raaction) to allow monitoring of cDNA siæe and yield and to provide a first strand label to monitor later reactions. In order to disrupt mRNA secondary structure, mRNA in ~2 was incubated at 70C for 3 min and the tube was chilled on ice. Reverse .

~3~383~

-20~ 07-21(381~A

transcrip~ase was added and the cDNA synthesis was carried out at 42C for 60 min. The reaction was terminated by the addi-tion of EDTA to 50 mM. cDNA
yield was monitored by TCA precipitations of samples S removed at the start of the reaction and after 60 min. Following cDN~ s~nthesis, the cDNA existed as a cDNA-RNA hybrid. The cDNA-RNA hybrid was denatured by heating the mixture in a boiling water bath for 1.5 min, and cooled on ice.

(c) Second Strand DNA S~n-thesis Single-stranded cDNA was allowed to self~
prima for second strand synthesis. Both Klenow polymerase and reverse transcriptase were used to convert ss cDNA to ds cDNA. Klenow polymerase is employed irst since its 3'-5' exonuclease repair unction is believed ~o be able to digest non-flush DNA ends generated by self-priming and can then extend these flush ends with its polymerase activity. Reverse transcriptase is used in addition to Klenow polymerase, because reverse transcriptase is believed to be less likely to stop prematurely once it has bound to a template stxand. The Klenow polymerase reaction was in a final 100 ~l volume excludi~g enzyme. The reaction mix included 50 mM
HEPES, p~ 6.9, 10 mM MgCl2, 50 mM KCl, 500 ~M o each dNTP and cDNA. To begin t~e reaction, 20 to 40 units of Klenow polymerase (usually less than 5 ~l~ were added and the tubes incubated at 15C for 5 hrs. The reaction was terminated by the addition of E~TA to 50 mM. The mix was extracted with phenol and the nucleic acids were precipitated, centrifuged and dried.

~3~3~,3~

-21- 07-21(381)A

The reverse transcriptase reaction to further e~tend the a~ti-complemen-tary DNA strand was performed as described for the reaction to originally synthesize cDNA, except dT1 o- 18 primer and RNasin were absent, and 32 units of reverse transcriptase were used in a 120 ~1 reaction. The reaction was termin-ated by the addition of EDTA to 50 mM. The mixture was extracted with an equal volume of phenol and the nucleic acid was precipitated, centrifuged and dried.

(d) Sl Nuclease Treatment 200 ~l of 2 x Sl buffer (l x S1 buffer is 30 mM sodium acetate, pH 4.4, 250 mM NaCl, 1 mM
ZnCl2), 175 ~1 of H~0 and 525 units of Sl nuclease were added to the tubes containing 125 ~l of the second strand s~nthesls reaction product. The tubes were incubated at 37C for 30 min and the reaction was terminated by addition of EDTA to 50 mM. The mixture was extracted with an equal volume of phenol/chloroform (1:1). The a~ueous phase was extracted with ether to remove residual phenol. The - DNA was precipitated with e-thanol and air dried.

(e) EcoRI Methylation Reaction Since the ds cDNAs were copied from a large variety of mRNAs, many of the ds cDNAs probably contained internal EcoRI restriction sites. It was desired to protect such cleavage sites from EcoRI
cleavagel to enable the use of blunt-ended EcoRI
linkers which were subsequently cleaved with EcoRI
to create cohesive overhangs at the termini.
In an effort to prevent the undesired cleavage of internal EcoRI sites, the ds cDNA was methylated using EcoRI methylase. D~A pellets were ~3~3~3~

-22- 07-21(381)A

dissolved in 40 ~l oE 50 mM Tris p~ 7.5, 1 mM EDTA, 5 mM DTT. Four ~l of 100 uM S-adenosyl-L-methionine and 2 ~1 (80 units) of EcoRI methylase were added.
Tubes were incubated at 37C for 15 min and then at 70C for 10 minutes to klll the methylase.
It was subsequently discovered that the methylation reaction described below was unsuccessful in preventing EcoRI cleavage at an int0rnal site within the EPSPS coding region, apparently because of inactive methylase reagent. The cleavage of ~he internal EcoRI site required additional steps to isolate a full~length cDNA, as described below. To avoid those additional steps if another library is created, the methylation reagents and reaction con ditions should be used simultaneously on the cDNA and on control fragments of DNA, and protection of -the control fragments should be confirmed by EcoRI diges-tion before digestion is performed on the cDNA.

(f) DNA Polymerase I Fill-In Reaction To the tube containing 45 ~l of cDNA (pre-pared as described above) were added 5 ~l of 0.1 M
MgCl2, 5 ul of 0.2 mM d(ACGT)TP and 10 units of DNA
polymerase I. The tube was incubated at room tempera-ture for 10 min. The reaction was terminated by the addition of EDTA to 25 mM. One microgram of uncut AgtlO DNA was added as carrier and the mix was extrac-ted with phenol/chloroform (1:1~. The ~ucleic acid in the mix was precipitated with phenol/chloroform (1:1~.
The nucleic acid in the mix was precipitated with ethanol, centrifuged and dried.

~.3~383~

-23 07-21(381)A

(g~ Ligation of EcoRI Linkers to Methylated ds cDNA
Approximately ~00 pmoles of EcoRI linkers (5'CGGAATTCCG3') were dissolved in 9 ~l of 20 mM
Tris, pH 8.0, 10 mM MgCl, 10 ~M DTT containing 50 uCi of ~-32P~ATP (5000 Ci/mmole~ ~md 2 units of T4 polynucleotide kinase. The oligonucleotides were incubated at 37C for 30 minutes to allow them to anneal to each othex, creatinq do~le~stranded, blunt-ended linkers. 2 units of T4 polynucleotlde kinase and 1 ~1 of 10 mM ATP were added and incubated at 37C for an additional 30 min. The linkers were stored at -20C. The methylated DNA pellet was resuspended in tubes containing 400 pmoles of the kinased linkers. Ligation of the EcoRI linkers to the methyla~ed DNA was carried out by adding 1 ~l of T4 ligase and incubating the reaction mixture at 12-14C
for 2 days.

(h) Digestion with EcoRI to Create Cohesive Termini To ll ~l of the reaction product from Example l.E.(g), 10 ~1 o~ a solution containing 50 mM
Tris, pH 7.5, lO mM MgSO4, 200 mM NaCl were added.
T4 DNA ligase was heat inactivated by incubation at 70C for 10 min. Forty units of EcoRI were added and the incubation was carried out at 37C for 3 hr. The reaction was terminated by addition of EDTA to 50 mM. The sample was clarified by centrifugation and applied to an AcA 34 column.

~i3 AcA 34 Column Chromatography Free linkers (those not ligated to ds cDNA) were removed from ds cDNA with attached linkers, to prevent them from interfering with the insertion of the desired ds cDNAs into the cloning vectors. AcA 34 13138~

-24- 07-21(381)A

resin (a mixture of acrylamide and agarose beads, normally used for sizlng) preswollen in 2 mM citrate buffer and 0.04% sodium azide in water, was added to the 1 ml mark of a 1 ml plastic syringe plugged with glass wool. The colu~nn was el~uilibra-ted with 10 mM
Tris-HCl pH 7.5, 1 mM EDTA, 400 mM NaCl. The ds cDNA
mixtures with ligated linkers and free linkers (~45 ~1) was brought to 400 mM NaCl. 1 ~l of 0.5% bromo-phenol blue dye (BPB) was addled, and the sample was applied to the column which was run in equilibration buffer at room temperature. Ten 200 ~l frac-tions were collected. The BPB dye normally eluted from the column in the si~th tube or later. Tubes 1 and 2 were combined and used as the source of ds cDNA for cloning.

~j) Assembly of AgtlO clones The ds cDNA was mixed with 1 ~g of EcoRI-cut AgtlO DNA, precipitated with ethanol, and cen-trifuged.
After washing the pellet once with 70% ethanol, the DNA pellet was air dried and resuspen~ed in 4.5 ~l of 10 mM Tris-HCl pH 7.5, 10 mM MgCl2, 50 mM NaCl. To anneal and ligate the cDNA inserts to the left and right arms of the AgtlO DNA, the mixture was heated at 70C for 3 min., then at 50C for 15 rnin. The mixture was chilled on ice, and 0.5 ~l each of 10 mM ATP, 0.1 M DTT, and sufficient T4 DNA ligase to ensure at least 90% completion were added. The reaction was incubated at 14C overnight, which allowed the insertio~ of ~he ds cD~A into the EcoRI site of the AgtlO DNA. The resulting DNA was packaged into phage particles in vitro using the me~hod described by Scherer 1981.
-(k) Removal of Phages Without Inserts Insertion of a cDNA into the EcoRI site of . --~3~3~3~

-25- 07-21(381)A

AgtlO results in inactivation of the C1 gene. AgtlO
phages with inactivated Cl genes (i.e., with inserts) replicate normally in E. co]i MA150 cells. By contrast, AgtlO phages without inserts are unable to replicate in the MA150 strain of E. col:L. This provides a method of removing AgtlO clones which do not have inserts.
The phages in the library were first repli-cated in E. coli C600 (M+R-) cells which modified -the AgtlO ~NA to protect it from the E. coll MAl50 restric-tion system. A relatively sm,~ll number of E. coliC600 cells were infected and then plated with a 20 fold excess o MA150 (M~R+) cells. The primary infec-tion thus occurred in the M+R- cells where all the phages will grow, but successive rounds of replication occurred in ~the MA150 cells which prevented the replication of phages without inserts. The amplified phage library was collected from the plates, and after removal of agar and other contaminants by centrifuga-tion, the recombinant phages were ready to use in screening experiments.

F. Screenln~ of cDNA Llbraryi_Selection o PMON9531 Approximately 6000 phages (each plate) were spread on lO cm x lO cm s~uare plates of solid NZY
agar (Maniatis 1982~ with 0.7% agarose. A translucent lawn of E. coli MA150 cells was growing on the plates.
Areas where the phages infected and killed the E. coli cells were indicated by clear areas called "plaques", which were visible against the lawn of bacteria after an overnight incubation of the plates at 37C. Six plates were prepared in this ma~ner. The plaques were pressed against pre-cut nitrocellulose filters or about 30 min. This formed a symmetrical replica of the plagues. To affix the ~ 3~3~3~
-26- 07-21(381)A

phage DNA, the filters were treated with 0.5 M NaOH
and 2.5 M NaCl for 5 min. The filters were then treated se~uentially with 1.0 M Tris-HCl, pH 7.5 and 0.5 M Tris-HCl, pH 7.5 containing 2.5 M NaC1 to neutralize the NaO~. They were then soaked in chloroform to remove bacterial debris. They were then air-dried and baked under a vacuum at 80C for 2 hr, and allowed to cool to room temperature. The filters were th~n hybridized with 32P-labelled EPSP-1 probe (2 x 106 cpm/filter) as described in Example l.D(e). After 48 hr of hybridization, the filters were washed in 6 x SSC at xoom temperature twice for 20 min and then at 37C for 5 min. These washes removed non-specifically bound probe molecules, while probe molecules wi-th the exact corresponding sequence (which was unknown at the time) remained bound to the phage DNA on the filter. The filters were analyzed by autoradiography af-ter the final wash. After the first screening step, seven positively hybridizing signals appeared as black spots on the autoradiograms.
These plaques were removed from the plates and replated on the fresh plates at a density o 100-200 plaques/plate. These plates were screened using the procedure descri~ed above~ Four positively hybrid-izing phages were selected. DNA was isolated ~rom each of these four clones and digested with EcoRI to determine the sizes of the cDNA inserts. The clone containing the largest cDNA insert, approximately 330 bp, was selected, and designated AE3. The cDNA insert from AE3 was i~serted into plasmid pUC9 (Vieixa 1981), and the resulting plasmid was designated pMON9~31.
To provide confirmation that the pMON9531 clone contained the desired EPSPS sequence, the insert was removed ~rom the pMON9531 clone by ~3~383(~

~27- 07-21(381)A

digestion with EcoRI. This DNA fragment was then sequenced by the chemical degradation method of Maxam 1977. The amino acid sequence deduced from the nucleotide sequence corresponded to the EPSPS partial amino acid sequence shown in Table 1.

G Creation of AF7 Genomic DNA Clone In order to obtain the entire EPSPS gene, chromosomal DNA ~rom the MP4-G cells line was digested with BamHI and cloned into a phage vector to create a library, which was screened using the partial EPSPS sequence from pMON9531 as a probe.

(a) Preparation o~ MP4-G Chromosomal,DNA Fragments MG4-G cslls were frozen and pulverized in a mortar with crushed glass in the presence of liquid nitrogen. The powdered cells were mixed with 8 ml/g of cold lysis buffer containing 8.0M urea, 0.35 M
NaCl, 0.05M Tris-HCL(pH 7.5), 0.02 M EDTA, 2%
sarkosyl and 5% phenol. The mixture was stirred with a glass rod to hreak up large clumps. An equal volume of a 3.1 mixtur~ of phenol and chloroform containing 5% isoamyl alcohol was added. Sodium dodecyl sulfate (SDS) was added to a final concentration of 0.5%. The mixture was swirled on a rotating platform for 10 15 minutes at room tempe-rature. The phases were separated by centrifugationat 6,000 x g for 15 minutes. The phenol/chloroform extraction was repeated. Sodium acetate was added to the aqueous phase to a final concentration of 0.15 M
and the DNA was precipitated with ethanol. The DNA
was collected by centrifugation, dissolved in 1 x TE
(lOmM Tris-HCl, pH 8.0, 1 mM EDTA) and banded in a CsCl-ethidium bromide gradient. The DNA was ~3~3~3~

-28~ 07~21(381)A

collected by puncturing the side of the tube with a 16 gauge needle. The ethidi~n bromide was extracted with CsCl-saturated isopropanol, and the DNA was dialyzed extensively against :L x TE. Approxima~ely 400 ~g of DNA was isola-ted from 12 g of cells.
MP4-G chromosomal DNA (10 ~g~ was digested to completion with 30 units oE BamHI in a buffer containing 10 mM Tris, pH 7.8, 1 mM DTT, lOmM MgC12, 50 mM NaCl for 2 hours at 37C. The DNA was extracted with phenol followed by extraction with chloroform and precipitated with ethanol. The DNA
fragments were suspended in 1 x TE at a concentration of 0.5 ~g/~l.

(b) Cloning of MP4-G Chromosomal DNA Fragments in AMG14 DNA from phage A~G14 (obtained from Dr.
Maynard Olson of the Washington University School of Medicine, St. Louis, Missouri~ was prepared by the method described in Maniatis 1982. 150 ~g of DNA was digested to completion with BamHI in a buffer containing lOmM Tris-HCl, pH 7.8, 1 mM DTT, 10 ~M
MgC12, 50 mM NaC1. The completion of the digest was checked by electrophoresis through 0.5% agarose gel.
The phage DNA was then extracted twice with phenol-chlorofonm-isoantyl alcohol ~25:24:1) and precipiated with ethanol. ~he DNA was resuspended in 1 x TE at a concentration of 150 ~g/ml. MgC12 was added to 10 mM and incubated at 42C for 1 hr to allow the coh~sive ends of ADNA to reanneal.
Annealing was checked by agarose gel electrophoresis.
After annealing, DNA was layered over a 38 ml 110-40%, w/v~ sucrose gradient in a Beckman SW27 ultracentrifuge tu~e. ~he gradient solutions were prepared in a buffer containing 1 M NaCl, 20 mM

~313~3~
29- 07-21(381)A

Tris-HCl (pH 8.0), 5 mM EDTA. 75 ~g of DNA was loaded onto each gradient. The samples were centrifuged at 26,000 rpm or 24 hours at 15C in a Beckman SW 27 rotor. Fractions (O.S ml) were collected from the top of the centrifuge tube and analyzed for the presence of DNA by gel electrophoresis. The frackions contain-ing the annealed left and right arms of ADNA were pooled together, dialyzed against TE and ethanol-precipitated. The precipitate was washed with 70%
ethanol and dried. The DNA was dissolved in TE at a concentration of 500 ~g/ml.
The purified arms of the vector DNA and the BamHI fragments of MP4-G DNA were mi~ed at a molar ratio of 4:1 and 2:1 and ligated using TfDNA ligase in a ligase buffer containing 66 mM Tris-HCl, pH 7.5,5 mM
MgCl, 5 mM DTT and 1 mM ATP. Ligations was carried out overnight at 15C. Ligation was checked by agarose gel eletrophoresis. Ligated phase DNA carry-ing inserts of MP4~GDNA were packaged into phage capsids in vitro using commercially available packag-ing extracts (Promega Biotech, Madison, WI~.
The packaged phage were plated on 10 cm x 10 cm square plates of NZY agar in 0.7% agarose at a density of approximately 6000 plaques per plate using E. coli C600 cells. After overnight incubation at 37C, the pla~ues had formed, and the plates were removed from the incubator and chilled at 4C for at least an hour. The agar plates were pressed against nitrocellulose filters for 30 minutes to transfer phages to the filters, and the phage DNA was affixed to the filters as described previously. Each filter was hybridized for 40 hours at 42C with approximately 1.0 x 106 cpm/filter of the 330 bp cDNA
insert isolated from the pMQN9531 clone, which had .

~3l3~63~
-30- 07-21(381)A

been nick-translated, using the procedure described in Maniatis 1982. The specific activity of the probe was 2-3 x 1o8 cpm/~g of DNA. Hybridization was carried out in a solu-tion containing 50% formamide, 5x SSC, 5x Denhardt's solution, 200 ~g/ml t~NA and 0.1% SDS. Filters were washed in 1 x SSC, 0.2% SDS
at 50C and autoradiographed. Se~eral positive signals were observed, and maltched with plaques on the corresponding plate. The selected plaques were lifted, suspended in SM buffe!r, and plated on NYZ
agar. The replica plate screening process was repeated at lower densities ~mtil all the plagues on the plates showe~ positive signals. One isolate was selected for further analysi.s and was designated as the AF7 phage clone.

Creation of p~ON9543 and pMON9556 The VNA from ~F7 was digested (separately) with BamHI, BglII, EcoRI, and ~indIII. The DNA was hybridized with a nick translated EPSPS sequence from pMON9531 in a Southern blot procedure. This indicated that the complementary sequence from AF7 was on a 4.8 kb BglII fragment. This fragment was inserted into plasmid pUC9 (Vieira 1982), replicated, nick translated, and used to probe the petunia cDNA
library, using hybridization conditions as described in Example l.G, using 106 cpm per filter. A cDNA
clone with a sequence that bound to the AF7 se~uence was identified, and desi~nated as pMON9543.
DNA sequence analysis (Maxam 19773 indicated that pMON9543 did not contain the stop codon or the 3' non translated region of the EPSPS gene. Therefore, the EPSPS sequence was removed from pMON9543, nick ~3~3~
31- 07-21(381)A

translated, and used as a probe to screen the cDNA
library again. A clone which hybridized with the EPSPS sequence was identified and designated as pMON9556. DNA sequence analysis indicated that the insert in this clone contained the entire 3' region of the EPSPS gene, including a polyadenylated tail. The 5' EcoRI end of ~his insert matched the 3' EcoRI end of the EPSPS insert in pMON9531. An entire EPSPS
coding sequence was created by ligating the EPSPS
inserts from pMON9531 and pMON9556.

I. Creation of pMON546 Vector with CaMV 35S/EPSPS Gene The EPSPS insert in pMON9531 was modified by site-directed mutagenesis (Zoller et al, 1983) using an M13 vector (Messing 1981 and 1982) to create a BglII site in the 5' non-translated region of the EPSPS gene. The modified EPSPS sequence was isolated by ~coRI and BglII digestion, and inserted into a plant transformation vector, pMON530, to obtain pMON536, as shown in Figure 2. pMON530, a derivative of pMON505 carrying the 35S-NOS cassette, was created by transferring the 2.3 kb StuI-HindIII fragment of pMON316 into pMON526. Plasmid pMON316 ~see Figure 5) is a co~integrating type intermediate vector with unique cleavage sites or the restriction endonucleases BglII, ClaI, KpnI, XhoI and EcoRI
located between the 5' leader and the NOS
polyadenyla-tion signals. The cleavage sites provide for the insertion of coding se~uences carrying their own translational initiation signals immediately adjacent to the CaMV 35S transcript leader sequence.
The 316 plasmid retains all of the properties of pMON2~0 including spectinomycin resistance for selection in E. col and A. tumefaclens as well 383~

~32- 07-21(381~A

as a chimeric kanamycin gene (NOS/NPTII/NOS) for selection of transformed plant tissue and the nopaline synthase gene for ready scoring of transormants and inheritance in progeny. Plasmid pMON526 is a simple derivative of pMON505 in which the SmaI site was removed by digestion with XmaI, treatment with Klenow polymexase and ligation. The resultant plasmid, pMON530 (Figure 2) rekains the properties o pMONSOS and the 35S~NOS expression cassette now contains a uni~ue cleavage site for SmaI between the promoter and poly-adenylation signals. The 1.62 kb EcoRI EcoRI fragment from pMON9556 was then inserted into pMON536 to obtain pMON546. Since pMON530 already contained a 35S
promoter from a cauliflower mosaic virus ~CaMV) next to the BglII site, this created a chimeric CaMV/EPSPS gene in pMON546.
As shown in Figure 2, plasmid pMONS46 contained (1) the CaMV 35S/EPSPS gene; ~2) a select-able marXer gene for kanamycin resistance (KanR);
~3) a nopaline synthase (NOS) gene as a scorable marker; and (4) a right T-DNA border, which effec~ively caused the entire plasmid to be treated as a "transfer DNA" (T-DNA~ region by A. tumefaciens cells. This plasmid was inserted into A. tumefaciens cells which contained a helper plasmid, pGV3111SE. The helper plasmid encodes certain enzymes which are necessary to cause DNA from pMON546 to be inserted into plant cell chromosomes. It also contains a kanamycin resistance gene which functions in bacteria.
A culture of A. tumefaciens containing pMON546 and p&~3111-SE was deposited with the American Type Culture Collection (ATCC) and was assigned ATCC
accession number 53213~ If desired, either one of these ~3~3~3~

-33- 07-21(381~A

plasmids may be isolated from this cu:Lture of cells using standard methodology. For example, these cells may be cult~red with E. coll cells which contain a mobilization plasmid, such as pRK2013 (Ditta 1980).
Cells which become Spc/strR~ kanS will contain pMON546, while cells which become KanR, spc/strS will contain pGV3111-SE.

EXAMPLE 2: GLYR PETUNIA CELLS
Leaf disks wi-th diameters of 6 mm (1/4 inch) were taken from surface--sterilized petunia leaves. They were cultivated on MS104 agar medium for 2 days to promote partial cell wall formation at tha wound surfaces. They were then submerged in a culture of A tumefaciens cells containing both pMON546 and GV3111-SE which had been grown overnight in Luria broth at 28C, and shaken gently. The cells were removed from the bacterial suspension, blotted dry, and incubated upside dow~ on filter paper placed over "nurse" cultures of tobacco cells, a6 described in Horsch 1981. After 2 or 3 days, the disks were transferred to petri dishes containing MS media with 500 ~g/ml carbenicillin and 0, 0.1, 0.25, or 0.5 mM glyphosate (sodium salt~, with no nurse cultures.
Control tissue was created using A ~umefa-ciens cells containing the helper plasmid pGV3111 SE
and a different plant transformation vector, pMON505, which contained a T-DNA region with a NOS/NPTII/NOS
kanamycin resistance gene and a NOS selectable marker gene identical to pMON546, but without the CaYV/EPSPS
gene.
Within 10 days after transfer to the media containing glyphosa-te, actively growing callus tissue appeared on the periphry of all disks on the control ~3~3~

-34- 07-21(381)A

plate containing no gl~phosate. On media containing 0.1 mM glyphosate, there was little det~ctable difference bet~een the control disks and the transformed tissue.
At 0.25 mM glyphosate, there was very little growth of callus from control disks, while substan-tial growth of transformed tissue occurred. At 0.5 mM gl~phosate, there was no callus growth from the control disks, while a significant number of calli grew from the transformed disks. This confirms thak the CaMV/EPSPS
gene conferred glyphosate resistance upon the transformed cells.

EXAMPLE 3: GlyR Tobacco Cells Leaf disks were excised from tobacco plants (N tabacum), and treated as described above with A. tumeaciens cells containing p~ON546 ~or pMON505, for control cells) and helper plasmid pGV3111-SE. The cells transformed with the CaMV/EPSPS
gene created substantial amounts of callus tissue on 0.5 mM glyphosate, whereas the cells which did not contain that gene did not create any detectable callus tissue.

EXAMPLE 4: GlY Soy_ean Cells Sterile hypocotyl piece~ of Gl~cine canescens, a type of soybean, were inected with the A. t~efaciens strain containing the chimeric EPSPS
gen~ as described in Example 2. Nurse culture plates were made which contained a medium of 10% of the normal level of MS salts ~GIBCO), ~5 vitamins, 3 g/l sucrose, 2 mg/l napthalene acetic acid, 1 mg/l benzyladenine, and 0.5 m~ arginine. The pH was adjusted to 5.7 before autoclaving.

~3~3~3~

-35- 07-21~381)~

The infected soybean hypocotyls were incubated a-t 26C for two days and transferred to a similar medium (except that the MS salts were not diluted) and additionally containing 500 mg/l carbenicillin, 100 mg/l cefotaxime and 100 mg/1 kanamycin. Under these conditions, only transformed soybean callus was able to gxow.
Control tissue was produced using A. tumefaciens cells containing the helper Ti plasmid _ pTiT37-SE and a plant transforma-tion vector pMON200. See Fraley e-t al, Biotechnology Vol. 3, 1985, described herein. The co-integrate pTiT37-SE
contained a T-DNA region with a NOS/NPTII/NOS
kanamycin resistance gene and a NOS scorable marker gene identical to pMON200, but without the CaMV 35S/EPSPS/NOS gene.
This disarmed nopaline-type Ti plasmid was created from pTiT37 in a manner analogous to that described by Fraley et al. (1985) for creating the pTiB6S3-SE disarmed octopine-type Ti plasmid. The general procedure is to replace most of the pTiT37 T-DNA with a selectable marker and pBR322 and LI~
segments from pMON2UO to provide a region of homology for recombination with pMON200 and derivatives. This replacement results in the deletion of the rightmost approximately 80 percent o~ the T-DNA including the phytohormone biosynthetic genes, nopaline synthase gene and the right border of the T-DNA.

The source of the pTiT37 sequences was the plasmid MINI-Ti described by deFramond et al.
(Bio/Technolo~y }: 262, 1983). This plasmid is a convenient source; however, thP~e same Ti plasmid segments could be obtained directly from the pTiT37 or ~31383~

-36- 07-21~381 related pTiC58 plasmid or from subclones of these plasmids isolated by others such as those described by Hepburn et al. ~J. Mol. Appl. Genetics 2: 211-224, 1983) or Zahm e-t al. (Mol Gen Gene-t 194: 188-194, 19~4) Plasmid MINI-Ti is a derivati~e of pBR325 carrying the pTiT37 KpnI fragments 13b, 4 and 11 (deFramond et al., 1983) which are analogous to the pTiC58 KpnI fragments 13, 3 and 12 (Depicker et al., Plasmid 3: 193 211, 1980). The internal T-DNA sequences including the phytohormone biosynthetic yenes and right border were removed from mini-Ti by digestion with HindIII and religation to produce pMON284. The pMON284 plasmid contains a unique KpnI site which was converted to a BamHI site by cleavage with KpnI and insertion of the following synthetic linker:

5'- CGGATCCGGTAC
CATGGCCTAGGC

which contains a BamHI site (5'-GGATCC) in the the center of the linker. A plasmid that contains this linker was isolated and called pMON293.

The pMON293 plasmid carries the ~ollowing pTiT37 fragments adjacent to each other in inverted orientation with respect to their orientation in the Ti plasmid and joined through a BamHI linker. ~irst is the KpnI site at the right end of -the 13b fragment.
This fragment contains the left border of the pTiT37 T-DNA. Then comes the left end of the 13b fragment joined to the BamHI linker. Joined to this is the right end of the KpnI 11 fragment. This fragme~t ~3~3~

-37- 07-21(381)A

contalns Ti plasmid located to the right of the T-DNA
and ends with a HindIII site tha-t is the right end of the pTiC58 ~indIlI 2 fragment (Depicker et al., 1980). This is joined to -the pBR325 derivative plasmid which also is fused to the KpnI site at the right end of the KpnX 13b fragment.
To introduce homology to pMON200 and a kanamycin resistance selectable marker for A. tumefaciens between the pTiT37 segments, we constructed plasmid pMON292. Plasmid pMON292 is a derivative of pMON113 which consists of the 2.6 kb pBR322 PvuII to ~indIII ~ragment joined to the 1.7 kb BglII (nucleotide 1617) to HindIII (nucleotide 3390, Barker et al., Plant Mol. Biology 2: 335, 1983) fragment of octopine type T-DNA of pTiA6. This segment, called the LI~, has been previously described by Fraley et al. (1985). The BglII site was made flush ended by treatment with Klenow polymerase before ligation with the pBR322 segment.

Plasmid pMON113 was cleaved with HindIII, treated with Klenow polymerase and joined to the 1.2 kb AvaII fragment of Tn903 Oka et al J. Mol. Biol.
147:217 (1981~ (601) that had been treated with Klenow polymerase, ligated to synthetic BamEI
linkers, digested with Ba~HI and treated again with Klenow polymerase. The resulting plasmid carrying the Tn903 kanamycin resistance determinant adjacent to the LIH segment was called pMON292.

The pMON200 homology region and bacterial kanamycin resistance marker were inserted between the pTiT37 segments by mixing pMON292 linearized by cleavage with ~incII with two fragments derived from ~3~3~3~

' 38~ 07-21(3~1)A

pMON293: a 2.5 kb PvuII-BamHI fragment and a 4.5 kb fragment isolated after cleavage with HindIII, Klenow polym~rase treatment, and cleavage with BamEII. The resulting plasmid, pMON313, carries the following fragments in chis order. First, is the BamHI linker followed by a 4.5 kb KpnI-HindIII fragment derived from the right side of pTiT37 KpnI fragment 11. This is joined to the 750 bp Hinc:[I-HindIII segment of pBR322 followed by the 1.2 ~ Tn903 se~ment encoding kanamycin resis-~ance. This :is followed by the LIH
(HindIII-BglII segment and the PvuII-HincII segment of pBR322 that carries the origin of replication.
Next, there is a 2.5 kb PvuII to KpnI fragment from the left end of the pTiT37 KpnI 13b fragment which contains the left border of the T-DNA.
Finally, this is joined to the starting ~amHI linker.

To introduce this DNA in-to Agrobackerium, pMON313 was cleaved with BamHI and mixed with pRK290 DNA that had been cleaved wi-th BglII and treated with DNA ligase. A derivative of pRK290 carrying the pMON313 plasmid was isolated and called pMON318 Plasmid pMON318 was introduced into Agrobacterium tumefaciens strain A208 which carries pTiT37 and a chromosomal chloramphenicol resistance by standard bacterial mating methods using pRK2013 as a helper. This method and subsequent selec~ion for the replacement of the T-DNA with -the engineered T-DNA
segment carried in pMON318 was exactly as described by Fraley et al. (1985) for the selection of ~he disarmed octopine-type pTiBZS3-sE plasmid.
The resultant disarmed pTiT37-SE plasmid contains the vir region intact and retains the left 13~3~

-39- 07-21(331)A

T-DNA border and approximately 1 kb of the T-DNA.
This region of the T-DNA has not been reported to encode a transcript ~Joos e-t al., Cell 32: 1057-1067, 1983. This is ollowed by the pBR322 se~nent and LI~
and then the Tn903 kanamycin resistance. The Tn903 segment is joined to a 750 bp segment of pBR322 that is joined to the left end of the pTiT37 analogue of the pTiC58 HindIII 2 fragment (Depicker et al., 1980)~
This fragment is located outside the right end of the pTiT37 T-DNA. The result is that over 90% of the T-DNA including the phytohormone biosynthetic genes responsible for crown gall disease production and right border are absent from the pTiT37-SE plasmid.

The pTiT37-SE plasmid is carried in a derivative of strain A~08 that was selected for grow-th in 25 ~g/ml chloramphenicol and this strain with the disarmed plasmid is called A208-S~ or AS~. The A208-SE strain is used as ~ recipient for the pMON200 intermediate vecto.r in the triple mating procedure in exactly the s~me manner as the 3111-SE strain (Fraley et al., 1985~. This results in a co-integrate h~brid T-DNA consisting of the following from left to right: the pTiT37 left border and approximately 1 kb of seguence just inside the border, the pBR322 HincII to PvuII segment, the pTiA6 BglII to ~indIII
LIH region, the pMO~200 synthetic multi-linker, the NOS/NPTII~NOS kanamycin resistance gene for selection in plants, the Tn7 spectinomycin/streptomycin resistance determinant, the nopaline synthase gene as a scorable marker for plant cells, the right border of the pTiT37 T-DNA. The DNA between the two border sequences just described and any other DNA inserted into the analogous region of pMON200 and derivatives ~3~3~3!~
'~0 07-21(381)~

are transferred to plant cells during the trans-formation procedure.
After 14-17 days, soybean callus transformed with either the vector alone (pMON200 plasmid) or with the vector containing a chimeric EP5PS gene was transferred to petri dishes containing MS medium and 0, O.5 mM or 1.0 mM glyphosate.
Within 18-20 days after transfer to the media containing glyphosate, actively growing callus tis6ue appeared in all di.shes containing no glyphosate.
on medium containing 0.5 mM glyphosate there was little yrowth in the dishes containing control callus, i.e., the callus contain the pMON200 vector alone, while some callus colonies containing the chimeric EPSPS
gene described hereinbefore in Figure 2 showed definite growth. At 1.0 mM glyphosate, there was no callus growth from the control tissues and again, some growth of the transformed callus containing the chimeric EPSPS gene. This confirms that the CaMV 35S/EPSPS/NOS gene conferred ~lyphosate resistance on the soybean cells.

EXAMPLE 5: Gly Cotton Cells A plant transformation vector similar to pMON546 is prepared following -the general procedure outlined in Example 1 except that the CTP/EPSPS coding sequence is obtained from cotton. Seeds of co~ton (cultivator Delta Pine 50) are surface sterilized using sodium hypochlorite and gexminated ln itro on a basal medium in the dark. Aftar 2 weeks h~pocotyls and cotyledons are cut into pieces and innoculated with a tumorous strain of A. tumefaclens containing the above described transformation vector and helper plasmid pGV3111. After 3 days coculture , ~3~3~3~

-41- 07-21(381~A

on MS basal medium, the explants are transferred to the same medium with 500 mg/l carbenicillin to kill the bacteria. After 2 to ~ weeks, tumor tissue is transferred to the same medium containing 0.5 mM
glyphosate.
Control tissue was produced using tumorous A. tumefaciens cells containing the helper plasmid pGV3111 and pMON200. Tissue transformed with the above-described transformation vector demonstrates glyphosate resistance by continuing growth while growth of pMON200 transformed tissue (control) and non-transformed tissue i5 inhibited.

EXAMPLE 6~ Gly _Oll Seed Rape cells A plant transformation vector similar to pMON546 is prepared following the procedure outlined in Example 1 except that the CTP/EPSPS coding sequence is obtained from rape plant such as ~rassica _~e~ (see Example 17).
The four terminal intervals from B. napus ~0 plants (growth chamber grown in soil~ are surface sterilized in sodium hypochlorite and cut into 5 mm sections. The upper surface of each piece is inoculated with an overnight liquid culture of A. tumefaciens containing the above described transformation vector and helper plasmid pTiT37-SE and incubated for 2 to 3 days on nurse culture plates containing 1/10 MS medium with 1 mg/l BA. The explants are then transferred to MS
medium containing 1 mg/l B~, 500 mg/l carbenicillin and 100 mg/l kanamycin. After 3 to 6 weeks, leaf tissue from transgenic shoots that have developed is transferred to the same medium but with 0.5 mM gl~phosate instead of the kanc~mycin to test for tolerance.
Co~trol tissue is prepared using A. tumefaciens :~13~

-42- 07-21(381)A

cells containing helper plasmid pTiT37-SE and vector pMON200. Transgenic tissue that expresses EPSPS are able to grow in the presence of glyphosate while transformed and non transformed controls are inhibited.

EXAMPLE 7: Gly Flax _ells A plant transformation vector similar to pMON546 is prepared following the procedure outlined in Examples 1, and 14 17 except that the CTP/EPSPS
coding sequence is obtained from flax.
Flax seeds are surface-sterilized with 70%
ethanol, 25% Chlorox and rinsed with sterile distilled water. The seeds are placed on solid MS medium and allowed to germinate in the light for 5 7 days. The hypocotyls are removed aseptically and inoculated with A. tumefaciens cells containing the above~described transformation vector and helper plasmid pTiB6S3 SE or pTiT37~SE and permitted to co-culture for 2 days on MS medium containing 1 mg/1 benzylaminopurine, 0.02 mg/l naphthalene acetic acid and 4% sucrose.
The hypocotyls are then placed on MS medium suppleme~ted with 400 mg/l kanamycin and 500 mg/l carbenicillin. After 2 weeks, selection for transformed callus and shoots are evident. Tha original explant begins to turn brown and the non-transformed initially formed shoots bleach white. Theselected callus and shoots are green and opine positive.
Control tissue is prepared using A. tumefaciens cells containing helper plasmid pTiB6S3-SE or pTiT3~SE
and vector pMON200. Selected callus transformed with the above-described EPSPS vector demonstrates resistance to glyphosate at concentrations between 5.0 and 20.0 mM.
Control tissue bleaches and dies at these glyphosate levels.

13~3~3~
-43- 07-21(381)A

EXAMPLE 8: Isolation of Mutant EPSPS qene from E. coli Cells of E. coli ATCC 11303 were transferred to medium A and incubated at 37C.

~DIUM_A

10 X MOPS medium 50 ml 50% glucose solution 2 ml 100 mM aminomethyl phosphonat:e 2 ml ~hiamine (5mg/ml), pH 7.41 ml 100 mM Glyphosate (sodium salt) 2 ml Deioni~ed water to 500 ml 10 X MO~S medium:
Per 500 ml 1 M MOPS (209.3g/1, pH 7.4200 ml 1 M Tricin~/89.6g/1, pH 7.4)20 ml 0.01 M FeS04,7H20 (278.01 mg/lOOml) 5 ml 1.9 M NH4C1 (50.18g/500ml)25 ml .276 M K2S04 ~4.81g/lOOml)5 ml O.S mM CaC12, 2~20 ~7.35mg/lOOml) 5 ml 0.528 M MgC12 (10.73g/lOOml)5 ml 5 M NaCl (292.2g/13 50 ml 0.5% L-Methionine (500mg/lOOml~ 5 ml micronutrients* . 5 ~1 * Micronutrients in 25 ml H~O
ZnS04 (2.88mg/ml) 25 ~1 MnC12 (1.58mg/ml) 250 ~1 CuS04 (1.6 m~/ml) 25 ~1 CoC12 ~7.14m~ml) 25 ~1 H3B03 (2.47mg/ml) 250 ~1 MH4M07024 1(3.71mg/ml) 25 ~1 lL 3 ~ 3 ~

-44- 07-21(381)A

After a wPek, a culture was obtained which could grow rapidly in the presence of high concentrations of glyphosate in the growth medium (10 mM or higher).
Analysis of the E~SPS activity in the extracts of this culture and comparison of its glyphosate sensitivity with that of wild type E. coli revealed that the mutant organism had an altered EPSPS. The glyphosate sensitivity of EPSPS of mutant cells was significantly different from that of wild type.
This mutant bacterium was designated E. coli 11303 SM 1.
The aroA yene encodin~ EPSPS from this mutant bacterium was isolated as follows.
Isolation of aroA gene encoding EPSPS from E. coli 11303 SM-l: The DNA from this bacterium was isolated (Marmur, J. (1961) J. Mol. Biol. 3:208-218~.
Southern hybridization using E. coli K-12 aroA gene (Rogers et al., 1983) as the probe established that the aroA gene in the mutant bacterium was on a 3.5 Kb BglII-HindIII fra~ment. This fragment was cloned into the vector pKC7 (Rao, R.N. & Rogers, S. G. (1979), Gene, F. 7-9-82) and the resulting plasmid was used for trans-formation of E. col . Transformed colonies were screened or their ability to grow in these conditions and were shown to contain the 3.5Kb BglII-HindIII insert by hybridization with the E. coli K~12 aroA gene. This clone was designated pMON9538. An Ndel-EcoRI fragment of this insert which contains greater than 86% of the aroA gene from the mutant bacterium was cloned into an expression vector (pMON6012, a derivative of pMON6001 described below) generating a hybrid EPSPS coding sequence carrying the E. coli K-12 aroA coding sequence of E. coli K-12 and 11303 SM-lo This clone was designated pMON9540. The EPSPS produced by this hybrid aroA gene retained its glyphosate tolerance, ~3~3~

-45- 07~21(381)A

suggesting that the mutation conferring glyphosate tolerance to EPSPS in 11303 SM-1 wa~ localized within amino acids ~3-427. The E. coli mutant EPSPS gene was incorporated into plant trans~ormation vector with and without a chloroplast transit peptide in the following manner.
Plasmid pMON6001 is a derivative of pBR327 (Soberon et al., 1980) carrying the E. coli K12 EPSPS
coding sequence expressed from two tandem copies of a synthetic phage lambda pL promoter. Plasmid pMON6001 was constructed in the following manner. First, pMON4 (Rogers et al., 1983) was digested with ClaI and the 2.5 kb fragment was inserted into a pB~327 that has also been cleaved with ClaI. The resulting plasmid, pMON8, contains the EPSPS coding sequence reading in the same direction as the beta-lactamase gene of pBR327.
To construct pMON25, a derivative of pMON8 with unique restriction endonuclease sites located adjacent to the E. coli EPSPS coding se~uence, the following steps were taken. A deletion derivative of pMON4 was made by cleavage with BstEII and religation. The resultant plasmid, pMON7 lacks the 2 kb BstEII fragment of pMON4.
Next, a 150 bp Hinfl to NdeI fragment whish encodes the 5' end of the EPSPS open reading was isolated after diges~ion of pMON7 with ~deI and HinfI and electroel-tution following electrophoretic separation on an acrylamide gel. This piece was added to the purified 4.5 kb BamHI-NdeI fragment o~ pMON8 which contains the 3' portion of the EPSPS coding sequence and a synthetic linker with the seguence:

5'-GATCCAGATCTGTTGTAAGGAGTCTAGACCATGG
GTCTAGACAACATTCCTCAGATCTGGTACCTTA

. .

~3~3~3 )I

-46- 07-21(381)A

The resulting plasmid p~ON25 contains the EPSPS coding sequence preceded by unique BamHI and BglII sites, a synthetic ribosome blnding site, and unique XbaI and NcoI sites the latter of which contains the ATG trans-lational initiator signal of the coding sequence.
To construct pMON6001, pMON25 was digested with BamHI and mixed with a synthetic DNA fragment containing a partial phage lambda pL sequence (Adams and Galluppi., 1986) containing BamHI sticky ends:

5'-~ATCCTATCTCTGGCGGTGTTGACATAAA'rACCACTGGCGGTGATACTCAGCACATCG
GATAGAGACCGCCAC M CTGTATTTATGGTGACCGCCACTATCACTCGTGTAGCCTAG

The resulting plasmid pMON6001 carries two copies of the synthetic phage lambda pL promoter frasments as direct repeats in the BamHI site of pMON25 in the correct orientation to promote transcription of the EPSPS coding sequence. The BglII-HindIII fragment from pMON6001 which contains the E. coli K-12 aroA gene was inserted int~ a pEMBL18+ vector and a EcoRI site was insPrted at aa27 by site directed mutagenesis. This clone with the new EcoRI site wa6 called pMON6530. The Ndel-BglII fragment (which includes the new EcoRI sit~) from pMON6530 was cloned into the NdeI-~glII digested pMON9540 to give pMON6531.
Plasmid p~ON6012 is a simple derivative of ~5 pMON6001 created by cleavage of pMON6001 and EcoRI, treatment with large Klenow fragment of E. coli DNA pol~merase and ligation. This gave rise to pMON6010 which contains no EcoRI cleavage site~
Plamid pMO~6012 was then created by digestion of pMO~6010 with PvuII and insertion of a synthetic EcoRI linker:
5'-CCGGAATTCCGG
GGCCTTAAGGCC

3 ~

-47- 07-21(381~A

into the unique PvuII site near the end of the EPSPS
coding sequence.
The 330bp EcoRI fra~nent of pMON9531 (was cloned into M13 mp9 creating a new plasmid M8017.
Site direc~ed mutagenesis wa~, performed to introduce a BglII site in the leader se~lence just 5' of the chloxoplast transit peptide using the mutagenesis pximer 5'~CCATTCTTGAAAGATCl'AAAGATTGAGGA

10 The mutageni2ed clone obtained is designated M13 M8020.
The BglII-EcoRI fragment was cloned into BglII-EcoRI
digested pMON530 creating pMON536. pMON530 is a pMON505 derivative (Horsch & Klee, 1985) carrylng the 35S-NOS casse~te created by transferring the 2.3 kb StuI-~IindIII fragment of pMON316 into pMON526. Plasmid pMON526 is a simple derivative of pMON505 in which the SmaI site was removed by digestion with XmaI, ~reatment with Klenow pol~merase and ligation. The xesultant plasmid, pMON530 (Fig. 2~ retains the properties of pMON505 and the 35S-NOS expression cassette now con-tains a unique cleavage site for SmaI between the promoter and polyadenylation signals. The EcoRI
fragment containing the aroA gene from pMON6031 was cloned into the EcoRI site of pMON536 creating pMON542.
The BglII-EcoRI fragment o pMON9540 which encodes the hybrid K12~SMl EPSPS without the CTP was cloned into the BglII and EcoRI sites of pMON530 to create pMON8078.
Transformation of tobacco cells using p~ON542 (construct with CTP) as previously described i~ Example 3 resulted in glyphosate resistance. Conversely, transfor-mation of tobacco with pMONB07B (construct without CTP) failed to confer ~l~phosate resistance.

~3~3~0 -4~- 07-~1(3al)A

EXAMPLE 9: GlyR Po-tato Cells Potato - Shoot -tips of vlrus-free Russet Burbank are subcultured on media con-taining MS major and minor salts, 0.17 g/l sodium dihygrogen phosphata, 0.4 mg/l thiamine hydxochloride, 0.1 g/1 inositol, 3% sucrose, 1. 5 g/l *Gelrite (Kelco, Co. ) at pH 5 . 6 .
Cultures are grown at 24C in a 16 hour pho-toperiod.
Shoots are used approxima-tely 3-4 weeks ater subcul-turing. Stem in-ternodes are cut into approximately 8 mm lengths and split lengthwise, -then the cut surface is smeared with Agrobacterium carryi~g binary vector pMON542 and helper plasmid pTiT37-SE which had been streaked on an LB agar plate and grown for a few days.
Stem sections are placed cut side down on the surface of the medium containing MS salts, MS organics, 3%
sucrose, 2.25 mg/l BA, 01186 mg/l NAA, 10 mg/l GA, 1.5 g/l Gelrite at pH 5.6. After 4 days, the stem explants are transferred to the same medium but wi-th carbenicillin at 500 mg/l and kanamycin as the selective agent at O or 300 mg/l. Two weeks after inoculation, the explants are moved onto medium of the same composition but without NAA. Kanamycin at 300 mg/l was sufficient to prevent swelling and callusing of the infected explants without killing the tissue.
The transformed tissue appears as small outgrowths usually on the end of the explant. Transformed tissue exhibits substantial resistance to glyphosate.

EXAMPL~ 10. GlyR Sunflower Cells The following procedures are utilized to obtain transformed sunflower tissue and shoots. Tumors are incited on sterile sunflower seedlings. Sunflower seeds are surface sterilized with 40% Chlorox and sterile distilled water rinses. The seeds are germinated on an *Trade mark ,, ~

~3~ 3~

-49~ 07-21~381)A

agar medium containing B5 salts, 0.5% sucrose and 0.8%
agar. Seven-day old seedlings are inoculated with overnight cultures of A~robacterium strains carrying pTis6s3-sE by scoring the internoda or stabbing the internode with a syringe and using ano-ther syringe to introduce the bacteria into the wound. Tumors form in 2-3 weeks. The tumors are removed from the s~edlings and grown independently on MS medium without hormones.
Transformed callus and shoots are also obtained following a different procedure. Seeds are surface sterilized and placed on the germination medium above.
Germination is carried out in -the light for 10 days.
Hypocotyl segments, 2-3 mm are, excised and inoculated with Agrobacterium strains containing engineered constructs. The hypocotyls are co-cultured for 2 days on a medium containing MS salts and vitamins, 5 g/l KN03, 100 mg/l inositol~ 40 mg/l adenine sulfate, 500 mg/l casamino acids, 1 mg/l NAA, 1 mg/l B~, 0.1 mg/l GA3, 30 mg/l sucrose and 8 gm/l agar. After co-culture, the hypocotyls are placed on the same medium ~ut containing 300 mg/l kanamycin and 500 mg/l carbeni-cillin. After 2 weeks, the hypocotyls inoculated with strains containing the kanamycin resistance gene produce callus and regenerates on medium containing kanamycin while other hypocotyls do not.
A. tumefaciens containing binary vectors pMON546 and helper plasmid pTiB6S3-SE are used to pxoduce tumors and callus and regenerated plants. The tumors exhibit tolerance to glyphosate at concentra-tions which bleach and kill control tumors which donot contain the glyphosate resistance gene. Non tumorous callus like~ise show tolerance to levels of glyphosate which kill callus without the glyphosate resistance gene. Transformed sunflower plants ~3~ 3~3~

-50- 07~21(3 demonstrate tolerance to glyphosate sprayed at concentrations which kill wild type plants~

EXAMPLE 11: GlyR Petunia Plants Transformed petunia plants were produced by regeneration rom the transformed leaf disks of Example 2, by the procedure described in ~orsch et al 1985. The transformed plants obtained contained the pMON546 vector, described hereinbefore, which contains the CaMV 35S promoter fused to the wild-type petunia EPSPS gene.
Four individual representative transgenic seedlings were selected, grown and tested in the testing procedure described below, along with four individual non-transformed (wild-type~ petunia seedlings.
The plants were grown in a growth medium in a growth chamber at 26C with 12 hours of light per day. The plants were fertilized weekly with a soluble fertilizer and watered as needed~ The plants were sprayed at a uniform and reproducible delivery rate herbicide by use of an automated track sprayer.
The glyphosate solution used was measured as pounds of glyphosate acid equivalents per acre, mixed as the glyphosate isopropylamine salt, with an ionic surfactant.
Four individual wild-type (non-transformedj petunia plants were selected for use as control plants. Four individual transformed plants containing the pMON546 vector were selected by kanamycin resistance as described in ~orsch et al 1985.
The control plants and the transformed ~3~3~3~

51- 07-21(381)A

plants were sprayed with tha isopropylamine salt of glyphosate at the application level listed in Table 2 below; the experimental results obtained are also summarized in Table 2.

,.

~3~3~3~

-52- 07-21(381~A

Table_2 Plant Response to Glv~b~te S~3~

Pla~ ye~ Gly~hosa-te Dosle* Visual APPearance Control 0.4 ~/acre plants showed rapid chlorosis and bleaching, wilted and died Control 0.8 ~/acre completely dead, plants showed very rapid chlorosis and bleaching, wilted and died Chimeric EPSPS 0.8 #/acre growing well, transformants slight chlorosis in new leaves which are growing with normal morphology, plants appear healthy and 20 started to flower * Acid Equivalent 13~3830 -53- 07-21(381)A

As indicated in Table 2, the control plants were killed when sprayed with 0.4 pounds/acre of glyphosate. In contrast, the petunia plants which were transformed were healthy and viable after S spraying with 0.~ pounds/acre. The transformed plants are more resistant to glyphosate exposure than the non-transformed control plants.

EXA~LE 12: GlyR Tomato Plant_ Transformed tomato plants, VF36 variety are produced from sterile seedlings as described below.
Sterile seedlings of VF36 tomato are grown on water agar. EIypocotyls and cotyledons are excised and cultured for 2 days on MS medium containing B5 vitamins, 30 g/l sucrose and 1 mg/l benzyladenine and 0.1 mg/l indole acetic acid. The seedlings are then infected with the A. tumefaciens vector containing the chimeric EPSPS gene described in Example 2, by immersing for about 30 seconds in a culture of A. tumefaciens containing the chimeric EPSP s~nthase gene that had been diluted to 107 bacteria/ml. Explants are obtained by cutting sections from the seedlings. The explants are blotted dry and incubated as described previously in Example 2 except that the medium contains only 10% of standard cOncentratiQn of MS salts. After 2 days of coculture, the explants are transferred to selective medium containing 100 ug/ml kanamycin. Transformed tomato plants grow from the explants. Leaves from these plants are tested for gl~phosat resistance using a leaf callus assay described below.

~3~g30 54- 07-21(381)A

Tomato leaf fra~ments from plants containing vector alone (pMON200) or the pMON546 chimeric EPSPS gene are incubated on callus medium described above containing 0.5 mM glyphvsate. Aft~r 10 days the control leaves are completely inhi~ited and showed no signs of callus growth; the leaves from plants transformad with the chimeric EPSPS gene vector produced callus.

EXAMPLE 13: GlyR Tobacco Plants Transformed tobacco plants (Samsun variety) were produced and grown by the method described in ~xample 4, substituting transformed tobacco leaf disks for transformed petunla leaf disks.
Tobacco plants were tested for glyphosate resistance using the method described for tomato plants in Example 5. Tobacco lea fragme~ts from plants containing vector alone (pMON200~ or the pMON546 chimeric EPSPS gene were incubated on callus medium containing 0.5 mM glyphosate.
After 10 days the control tobacco leaves were completely inhibited and showed no signs of callus growth; the leaves from plants transformed with the chimeric EPSPS that the chimeric petunia EPSPS gene confers gl~phosate resis~ance to tobacco plants.

EXAMPLE 14: Isolation of Petunia EPSPS Genomic Clone _ _ _ _ _ _ _ In order to isolate the entire petunia EPSPS gene, the library of petunia genomic DNA was constructed as described in E~ample l-G. Briefly, the chromosomal DNA from the MP4-G cell line was ~33.3~

-55- 07-21(381)A

digested with BamHI and cloned in-to a phage vector, AMG14, to create a library. As described in Example 1-&, one phage clone AF7 was isolated which contains a 4.8 kb BglII fragment that was complementary to pMON9531 cDN~ clone. To isolate the remainder of the yene, the genomic library was screened again using as probe the 1.6 kb cDNA insert from pMON9556. The plating of the library and the h~bridization procedures were done as descxibed in Example l-G. Several positive signals were obtained. One isolate was selected for furkher analysis and was designated as the AF10 phage clone.
The DNA rom AF10 was digested separately with BamHI, BgllI, EcoRI and HindIII. The DNA was hybridized with nick-translated EPSPS sequences from pMON9531 and pMON9556 in a Southern blot procedure.
This indicated that the complementary sequences from AF10 were on 4.8 kb, 2.0 kb and 3.8 kb BglII
fragments. DNA sequence analysis of these fragments indicates that these three fragments together contain the entire gene which spans approximately 9 kb of petunia DNA and is interrupted by seven introns (Figure 6). The promotor fragment of the EPSPS gene contained in the genomic clone, AF10, can be used to express the chimeric EPSPS cDNA or genomic sequences. The fragments containing the introns may also be used to construct additional chimeric EPSPS
genes to obtain enhanced levels of the mRNA.

EXAMPLE 150 Isolation of Arabidopsis thaliana Genomlc Clone An Arabidopsis thaliana genomic bank was constructed by cloning size fractionated (15-20 kb), MboI partially digested DNA into BamHI cut lambda ., , ~3~3~s~
-56- 07-21~381)A

EMBL3. Approximately 10,000 plaques of phage from this library were screened with a nick-translated petunia EPSPS probe ~pMON9566). A strongly hybridizing plaque, E1, was purified. Southern blots of the EPSPS probe to phage ])NA digests identified two fragments which hybridized very strongly. The first of these was a 1.0 kb HindIII Eragrnent and the other was a 700 bp BamHI fragment. Both of these fragmen-ts were subcloned into pUCll9 and the DNA sequences of the inserts determined.
The se~uence data indicated that -the phage did contain the Arabidopsis EPSPS gene. The enzyme is highly homologous to the petunia enzyme over the ar,ea for which sequence was available. The Bar~HI
fragment was used as a hybridization probe against the phage and Arabidopsis genomic DNA to identify restriction endonuclease fragments suitable for cloning the entire gene. Two BglII fragments of 6.0 and 3.2 kb were identified from the E1 phage clone which, together, contain the entire EPSPS gene.
Figure 6 summarizes the organization of the Arabidopsis clone and compares it to khe organization of the Petunia EPSPS ~ene.
The DNA encoding tha amillO terminus of the protein is within the 6.0 kb BglII fragment. The exact translational start site can be determined by comparison of the amino acid sequence deduced from the nucleotide se~uence to that of thè petunia enzyme, Site directed mutagenesis can then be used to introduce a unique EcoRI site immediately upstream of the translational start codon. The entire gene can then be isolated as an EcoRI fragment, This EcoRI fragment can be inserted into the exprassion ~3~3~3~

~57- 07-21(381)A

vector, pMON530, and the resulting vector used to overexpress the Arabidopsis EPSPS enzyme in plants.

EXAM~r E 16: _Isolation of Tomato EPSP_cDNA Clone A cDNA library was constructed from RNA
isolated from mature pistils of tomato lLycoperslcum esculentum variety VF36) by the methods of Hu~nh et.
al (in: DNA Cloning Techni~ues A Practical Approach, IRL Press, D. Glover ed., 1985) and Gubler and Hoffman (Gene 25:263-269, 1985). The library was plated on E. coli strain BNN102 and filter replicas were made. The filters were hybr.idized with the 1.9 kb BglII/ClaI fragment of pMON9563 that had been labeled with 32p (Feinberg and Vogelstein (Anal.
Biochem. 132:6-13, 1983). Hybridizing plaques were isolated and rescreened by the same me-thod to verify the presence of EPSPS cDNA. The full length tomato EPSPS cDNA was present on two EcoRI fragm~nts of 250 and 1700 bp in one o~ the cDNA clones (P1). The 250 bp fragment was cloned into the EcoRI site of pUC119 forming pMON9596. The 1700 bp fragment was cloned into pUCl9 forming pMON9589. The insert of pMON9596 was sequenced using a dideoxy sequencing kit purchased from Amersham to determine the sequence surrounding the start codon to facilitate mutagenesis. A BglII
site was e~gineered 13 bases upstream of the translation start codon of pMON9596 by the method of Xunkel (Proc. Natl. ~cad. Sci. USA 82:488-492, 1985) using the chemically synthesized oligonucleotide:
GCCATTTCTTGTGAAAAAGATCTTCAGTTTTTC
The insert of the resulting plasmid, pr~ON9710, was se~uenced to verify the correct mutation. The 70 bp BglII/EcoRI fragment of pMON9710 was inserted into ,, , ' ~3~ ~83~

-58- 07-21(381)A

pMON316 which had been digested with ~glII and EcoRI
creating pMONg720. The 1700 bp EcoRI fragment of pMON9589 was inserted into the EcoRI site of pMON9720 in the correct orientation to reconstitute the EPSPS
coding region resulting in pMON9721 (see Figure 7~.
This plas~id was inserted in-to A. tumefaciens cells which contained a helper plasmid, pGV3111-SE. The helper plasmid encodes certain enzymes which are necessary to cause DNA from pMON9721 to be inser~ed in~o plant cell chromosomes.
It a7so contains a kanamycin resistance gene which functions in bacteria. A. tumeaciens cells containing pMON9721 are used in plant transforma-tion experiments to produce glyphosate resistant cells and plants as previously described in Example 12.

EXAMPLE 17: Isolation of Brasicca napus cDNA Clone Total RNA was isolated from Brassica napus (cultivar Westar) flowers as follows. Flowers were fro2en in liquid nitrogen. After liquid nitrogen had 20 ~ evaporated, flowers were homogenized in extraction buffer (1% tris~isopropylnapthalene sulfonic acid, 6%
p-aminosalicylic acid, 100 mM Tris HCl, p~ 7.6, ~0 ~M
EGTA, pH 7.5, 100 mM NaCl, 1% SDS and 50 mM
2-mercaptoethanol) and then extracted with equal volume of a 1.1 mi2ture of phenol/chloroform. The nucleic acids in the aqueous phase were precipitated with ethanol. The precipitate was dissolved in water and the RNA was precipitated twice with LiCl to a final concentration o 2M. The inal RNA pellet was dissolved in water and the RNA was precipitated with ethanol. PolyA RNA was selected by olig-dT cellulose chromatography. The yield o polyA RNA was 1.0 ~L3~3830 -59- 07-21(381)A

~g/gram of flowers.
The library was constructed using polyA
RNA from Brassica napus flowers and the method used is described in Example 16. The yield in the library was 90,000 plaques/3 ~g polyA RNA. The library was plaked at a density of 5000 plaques/plate. The phage DNA was transferred to nitrocellulose filters. The filters were hybridized under low stringency in 35%
formamide, 5 X SSC, 300 ~g/ml tRNA, 0.1% SDS a~ 37C.
The insert from pMON9556 was labeled with 32p by nick-translation and added to the hybridization solution at 2 x 106 cpm/ml. The filters were washed in 2 x SSC at room temperature twice for 15 min each and once at 37C for 30 min. A number of positively hybridizing phage were obtained. These phage were picked and rescreened twice at lower plaque densities.
The positively hybridizing phage were selected and those containing a full length B. napus EPSPS cDNA clone were chosen for further analysis. The full length B. napus EPSPS cDNA clone will be modified and inserted into a plant expression vector, pMON530, to create a chimeric CaMV 3SS/B. napus EPSPS gene.

EXAMPLE 18: Petunia EPSPS Chloroplast Uptake Requires CTP Sequence A full-length cDNA clone of EPSPS from P._h~brida was obtained as de~cribed in ~xample 1.
This cDNA clone contains 27 nucleotides of the 5' untranslated leader, 1.5 kb which codes for the 72 amino acid transit peptide plus 444 amino acids of the mature enzyme, and 0.4 kb of the entire 3' flanking sequence. The full-length EPSPS

~3~3~3~

-60- 07-21(381)A

cDNA was cloned as a 2.1 kb BglII-SAlI ragment into the BamHI/SalI sites of the plasmid pGEMl to give plasmid pMON6140 and into RGEM2 to give pMON6145. The EPSPS coding region is transcribed 5' to 3' from the T7 and SP6 promoters, respectively.
Plasmid DNA (pMON6140 and pMON6145) con-taining the full-length EPSPS cDNA was linearized at a unique P w I site loca-ted in the 3' untranslated region. The linearized plasmid DNA was transcribed ln vltro (uncapped) with SP6 and T7 polymerase essentially as described in Rrieg et al, 1984. The standard reaction buffer contained 40 mM Tris-HCl (pE 7.9), 6 mM MgC12, 10 mM
dithiothreitol, 2 mM spermidine, 80U RMasin ribonuclease inhibitor, 0.5 mM each of ATP, GTP, CTP and UTP, in a final reaction volume of 100 ~1.
The final RNA pellet was resuspended in 20 ~l of sterile water and stored at -80C. A standard translation reaction contained 100 ~1 of nuclease-treated rabbit reticulocyte lysate, 5.7 ~1 of a 19-amino acid mixture (minus methionine) at 1 mM each, 5.7 ~l of RNA (total RNA transcripts derived from 0.63 ~g of plasmid DNA), 16 ~l RNasin (20U/~l) ribonuclease i~hibitor, and 58.3 ~l of [35S]methionina (14-15m~i/ml). The in vitro translation reac~ion was run at 30C for 90 min.
The translation products were stored frozen at Intact chloroplasts were isolated from lettuce ~ sativa, var. longifolia) by centrifugation in Percoll/ficoll gradients as modified from Bartlett et al ~1982). The final pellet of intact chloroplasts was suspended in 0.5 ml of ~3~13~3~

-61- 07-21(3~1)A

sterile 330 mM sorbitol in 50 mM ~epes~KOH, pH 7.7, assayed for chlorophyll (Arnon, 1949), and adjusted to the final chlorophyll concentration of 4 mg/ml (using sorbitol/Hepes). The yield of intact chloroplasts from a single head of lettuce was 3 6mg chlorophyll. These chloroplasts were deemed homogeneous based on phase contrast and transmission electron-microscopy.
A typ:ical 300 ~l uptake experiment contained 5 mM ATP, 8.3 mM unlabeled methionine, 322 mM sorbitol, 58.3 mM Hepes-KOH (pH 8.0), 50 ~1 reticulocyte lysate translation products, and intact chloroplasts from L sativa (200 ~g chlorophyll).
The uptake mixture was gently rocked at room temperature (in 10 x 75 mm glass tubes) directly in front of a fiber optic illuminator set at maximum light intensity (150 Watt bulb). Aliquots of the uptake mix (50 125 ~l) were removed at various times and fractionated over 100 ~1 silicone-oil gradients ~0 (in 150 ~1 polyethylene tubes~ by centrifugation at 11,000 X g for 30 sec. Under these conditions, the intact chloroplasts form a pellet under the silicone-oil layer and the incubation medium (containing the reticulocyte lysate~ floats on the surface. After centrifugation, the silicone-~il gradients were immediately frozen in dry ice. The chloroplast pellet was then resuspended in 50-100 ~l of lysis buffer-(10 mM Hepes-KO~ pH 7.5, 1 mM PMSF, 1 mM benzamidine, 5 mM -amino-n-caproic acid, and 30 ~g/ml aprotinin) and centrifuged at 15,000 X g for 20 mi~ to pellet the thylakoid membranes. The clear supernatant (stromal proteins) from this spin, and an aliquot of the reticulocyte lysate incubation medium from each uptake experiment, ~3~ 3~

-62- 07-~1(3~

were mixed with ~n equal volum~ of 2X NaDodSO4-P~GE
sample buffer for electrp~loresis (see below~.
NaDodSO4-P~GE was carried out according to Laemmli (1970) in 12% (w/v) acrylamide ~lab gels (60 mm X
1.5 mm) with 3% (w/v) acrylamide staclcin~ gels (5 mm X
1.5 mm). The gels were fixed in 30% methanol and 10%
acetic acid, dried under vacuum, and taken for direct autoradiography with*Kodak XAR-5 X-ray film.
Quantitation of bands on the X-ray film was performed using a Hoefer GS-300 scanning densitometer interfaced Wit}l a Spectra-Physics SP~100 recording/comp-lter integrator.
To verify that precusor EPSPS (+CTP) is taken up and processed by chloroplasts, the total translation products containing ~35~methionine-labeled pre-EPSPS were incubated with freshly isolated, intact chloroplasts from L. sativa. The pre-EPSPS (~CTP) was rapidly translocated into chloroplasts and cleaved to the mature EPSPS of Mr4~ kDa. The NaDodSO4-P~GE autoradiograph revealed the disappearance of the precursor EPSPS from the incubation medium, and the subsequent appearance of a lower molecular weight, mature form in the chloroplast fraction. Some of the mature EPSPS
was also present in the incubation medium at 15 minutes due to chloroplast lysis. Post-uptake treatment of the incubation mixture with trypsin and chymotrypsin showed that the pre-EPSPS in the incubation medium was completely degraded, whereas the mature EPSPS in the chloroplast fraction was Eully protected. These results in~icate that EPSPS
was translocated across the chloroplast envelope into a protease inaccessible space.
Furthermore, subfractionation of the reisolated * Trade mark ~13~3~

-63 07 21(381)A

chloroplasts indicated that the mature EPSPS was localized in the stromal, as opposed to thylakoid~ fraction. Based on nucleotide sequence, -the predicted molecular weight for the mature P~
hybrida EPSPS is 47,790 daltons~ The Mr~48 kDa polypeptide localized in the reisolated chloroplast fraction co-migrated during NaDodS04-PAGE with the purified mature EPSPS of P. _ybrlda.
In order to show that the CTP is reguired for uptake, the mature enzyme (lacking the CTP) is isolated from the chloroplast stroma after an initial 15 minute uptake experiment. A mixture of stromal proteins (containing the labeled mature enzyme) was diluted with unlabeled reticulocyte lysate and used in a second uptake experiment with intact chloroplasts. The mature EPSPS (lac~ing the CTP) was not translocated into chloroplasts, or bound to the outer-envelope membrane, during a 15 minute incubation. As a control eXperiment, we found that the rate of uptake of pre EPSPS into chloroplasts was unaffected by the addition of stromal proteins to the incubation mixture. From these data it is concluded that the CTP of EPSPS is required for uptake of the enzyme into chloroplasts.

EXAMPLE 19: CTP of Petunia EPSPS Facilitates Chloroplast UPtake of Heterologous Proteln The following EPSPS experiments show that the CTP can target a heterologous protein to the stroma compartment. The 72-amino-acid transit peptide of EPSPS was fused to the mature ssRUBISCO
from wheat. The mature wheat ssRUBISCO cDNA

~3~3~

-64- 07-21~381)A

(Broglie et al 1983) was obtained as an SphI/PstI
fragment of ~0.6 kb. This SphI/PstI fragment contains the entire mature wheat ssRUBISCO coding region of 128 amino acids (beginning at the N-Terminal methionine) and 200 bp of the~ 3' untranslated region. Tha mature ssRUBISCO cDNA fragment was fused behind the P. hybri.da E,PSPS CTP cDNA fragment.
This fusion was done by joining an EcoRI/SphI
ragment of pMON6242 with the! wheat ssRUBISCO cDNA.
The construct pMON6242 is a clerivative of pMON6140 and contains P. hybrida EPSPS with an engineered consensus cleavage site for ssRUBISCO. The cleavage site of pMON6140 EPSPS (ser-val-ala-thr-ala-gln/lys) was changed to gly-gly-arg-val-ser-cys/met in pMON6242. This change introduces an in-frame SphI
site which allows CTP switching between ssRUBISCO
and EPSPS. The construct pMON6242 has previously been cloned into pGEM-2 and shown to give a chimeric precursor enzyme which is transported into chloroplasts ln vitro and proteolytically processed in the correct fashion.
The EcoRI/SphI fragment from pMON6242 was fused to the SphI site from wheat ssRUBISCO and cloned into plasmid pIBI to give pMON6149. In vitro transcription/txanslation of pMON6149 gave a single polypeptide of the predicted molecular weight for the fusion protein (~23 kD). Chloroplast import assays ln vitro showed that the chimeric protein was transported into the stroma and proteolytically cleaved to a final product of ~15 kD (tha ssRUBISCO
has a molecular weight of 15 kD).
These results show that the EPSPS CTP alone confers sufficient information to target a heterologous protein to the chloroplast stroma.

i3~38~

-65- 07-21(381)A

REFERENCES
_ _ _ Adams, S. P. et al. ~1983) J. Amer. Chern. Soc. 105 661 Amrhein, N. et al. (1980) Nat.urwlssenschafter 67 356-357.
Arnon, D.I. (1949) Plant Physiol. 24,1-15 Ausu~el, F. et al ~lg80) Plant Mol. Bio. Newsle-tter 1:
26-32.
Barinaga, M. R. et al. (1981) "Methods for the Transfer of DNA, RNA and Protein to Nitrocellulose and Diazotized Paper Solid Supports", p~. by Schleicher and Schuell Inc., Keene ~.
Bartlett, S. G., Grossman, A.R. ~ Chua N.H. (1982) in Methods in Chloroplast Molecular Biology, Elsevier Biomedical Press, New York, pp 1081-1091.
Bevan, M. et al. (1983) Nature 304: 184.
Broglie, R. et al. (1983) Bio/Technology 1: 55 61.
Comai, ~. et al. (1983) Science 221- 370-371.
Davis, R.W. et al. (1980) Advanced Bacterial Genetics, Cold Spring Harbor Labs, NY.
DeCleene, M. and DeLey, J. (1976) Bot. Revlew 42:
389-466.
DePicker, A. et al. (1982) J. Mol. Appl. Gen. 1: 561.
Ditta, G. et al (1980) Pro. Natl. Acad. Sci. Usa 77:7347 Edelman, M., Hallick, R. B. & Chua, N. H. (Elsevier Biomedical Press, New York), pp. 1081-1091.
Fraley, R. T. et al. (1983~ Proc. Natl. Acad. Sci. USA
80: 4803.
Goldberg, R. B. et al., (1981) Devel. Bio. 83:
20].-217.
Hernals~eens, J. P. et al. (1985), EMBO Journal 3:
3039-3041.

~ 3~3~30 -66- 07-21(381)A

Herrera-Estrella, L. et al. (1983) Nature 303: 209 Hooykaas-Van Slogteren, G.M.S. et al. (1984) Nature 311: 763-764.
Horsch, R. B. and Jones, G.E. (1980) In Vltro 16:
103-108.
Horsch, R. B. et al. (1985) Science 227: 1229-1231.
Horsch, R. B. and Klee, H. J. ~1986) Proc. Natl. Acad.
Sci. USA 83, 4428-4432.
Hunkapiller, M.W. et al. (1983a) Methods En~ymol. 91:
399-413.
Hunkapiller, M.W. et al. (1983b) Methods Enzymol. 91:
486-493.
Huynh, T.V. et al, (1985) in DNA Cloninq Techni~ues:
A Practical Approach, D. Glover (ed.), IRL Press, Oxford, England Krieg, P.A. & Melton, D. A. (1984) Nucleic Acids Res.
12; 7057-7070.
Laemmli, U. K. ~1970) Nature 227, 680-685.
Lizardi, P.M. (1982) "Bi~ding and Recovery of DNA and RNA using NA-45 DEAE Membrane." Schleicher and Schuell, Inc., Keene, NH.
Maniatis, T. et al. (1982) Molecular Cloning: A
Laborato~y~Manual, Cold Spring Harbor Labs, NY.
Maxam, A. M. and W. Gilbert (1977) P.~.A.S. U S.A.
74: 560-564.
Meagher, R. B. et al. (1977) Virology 80: 362-375.
Messing, J. et al. (1981). Nucleic Res. 9: 309-321.
Messing, J. and ~. Vieira (1982), Gene 19: 69-276.
Mousdale, D. M. and Coggins, J. R. ~1984) Planta 160:
78~83.
Nafæiger, E. D., et al (1984), Plant Physiol, 76, 571.
Mousdale r D. M. and Coggins, J. R. (1985) Planta 163:
241-294.

~31383~

-67- 07-21(381)A

Rogers, S. G. et al. (1983) A~pl. Envir. Microbio. 46:
37-43.
Rubin, J. et al. (1982) Plant Phys. 70: 833-839.
Scherer, et al. (1981~ Developmental Bio.86: 438-447.
Schimke, R. T., ed. (1982) _ene Amplification, Cold Spring Harbor Labs.
Smart, C. C., et al (1985), J. Biol. Chem, 30, 16338.
Southern, E.M. (1975) J._Mol Biol. 98: 503 517.
Stalker, D. M. et al. (1985) J. Biol. Chem. 260:
4724-4728.
Steinrucken, H. and Amrhein, N. (1980) _ochem & Biophys. Res. Comm. 94: 1207-1212.
Vieira, J. et al. (1982), Gene 19: 259~268.
Steinrucken, H. et al. (1985) Arch. Biochem._Biophys.
(in press).
Young, R. A. and R. W. Davis. (1983), Proc. Natl.
Acad. Sci., USA 80: 1194-1198.
-Zoller, M. ~. et al, (1983~, Methods En~y~_l., 100,468.

Claims (52)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:

1. A chimeric plant gene which comprises:
(a) a promoter sequence which functions in plant cells;
(b) a coding sequence which causes the production of RNA, encoding a chloroplast transit peptide/5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) fusion polypeptide, which chloroplast transit peptide permits the fusion polypeptide to be imported into a chloroplast of a plant cell; and (c) a 3' non-translated region which encodes a polyadenylation signal which functions in plant cells to cause the addition of polyadenylate nucleotides to the 3' end of the RNA;
the promoter being heterologous with respect to the coding sequence and adapted to cause sufficient expression of the fusion polypeptide to enhance the glyphosate resistance of a plant cell transformed with the gene.

2. A chimeric gene of Claim 1 in which the promoter sequence is a plant virus promoter sequence.

3. A chimeric gene of Claim 2 in which the promoter sequence is a promoter sequence from cauliflower mosaic virus (CaMV).

4. A chimeric gene of Claim 3 in which the promoter sequence is the CaMV35S promoter sequence.

5. A chimeric gene of Claim 1 in which the coding sequence encodes a mutant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS).

6. A chimeric gene of Claim 1 in which the EPSPS
coding sequence encodes an EPSPS from an organism selected from the group consisting of bacteria, fungi and plants.

7. A chimeric gene of Claim 1 in which the chloro-plast transit peptide is from a plant EPSPS gene.

8. A cloning or expression vector comprising a chimeric plant gene of Claim 1.

9. A cloning or expression vector of Claim 8 in which the chimeric plant gene encodes a chloroplast transit peptide of a plant EPSPS gene.

10. A cloning or expression vector of Claim 9 in which the chimeric plant gene comprises a promoter sequence from a plant virus.

11. A cloning or expression vector of Claim 10 in which the promoter sequence is a promoter sequence from cauliflower mosaic virus (CaMV).

12 . A cloning or expression vector of Claim 11 in which the promoter sequence is the CaMV35S promoter sequence.

13 . A cloning or expression vector of Claim 8 in which the chimeric plant gene comprises a coding sequence encoding a mutant 5-enolpyruvylshikimate-3-phosphate synthase.

14 . A cloning or expression vector of Claim 8 in which the coding sequence encodes an EPSPS from an organism selected from the group consisting of bacteria, fungi and plants.

15. A plant transformation vector which comprises a chimeric gene of Claim 1.

16 . A plant transformation vector of Claim 15 in which the chimeric plant gene encodes a chloroplast transit peptide of a plant EPSPS gene.

17 . A plant transformation vector of Claim 15 in which the chimeric plant gene comprises a promoter sequence from a plant virus.

18. A plant transformation vector of Claim 17 in which the promoter sequence is a promoter sequence from cauliflower mosaic virus (CaMV).

19 . A plant transformation vector of Claim 18 in which the promoter sequence is the CaMV35S promoter sequence.

20. A plant transformation vector of Claim 15 in which the chimeric plant gene comprises a coding sequence encoding a mutant 5-enolpyruvylshikimate-3-phosphate synthase.

21 . A plant transformation vector of Claim 15 in which the coding sequence encodes an EPSPS from an organism selected from the group consisting of bacteria, fungi and plants.

22. A glyphosate resistant plant cell comprising a chimeric plant gene of Claim 1 .

23. A glyphosate-resistant plant cell of Claim 22 in which the promoter sequence is a plant virus promoter sequence.

24. A glyphosate-resistant plant cell of Claim 23 in which the promoter sequence is a promoter sequence from cauliflower mosaic virus (CaMV).

25. A glyphosate-resistant plant cell of Claim 24 in which the promoter sequence is the CaMV35S promoter sequence.

26. A glyphosate-resistant plant cell of Claim 22 in which the coding sequence encodes a mutant 5-enolpyruvylshikimate-3-phosphate synthase.

27. A glyphosate-resistant plant cell of Claim 22 in which the coding sequence encodes an EPSPS from an organism selected from the group consisting of bacteria, fungi and plants.

28. A glyphosate resistant plant cell of Claim 22 in which the chloroplast transit peptide is from a plant EPSPS gene.

29. A method for producing a glyphosate-resistant dicotyledonous plant which comprises:
(a) transforming plant cells using an Agrobacterium transformation vector comprising a chimeric plant gene of Claim 1; and (b) regenerating glyphosate-resistant plants from said transformed plant cells.

30. A method of Claim 29 in which the chimeric plant gene comprises a plant virus promoter sequence.

31. A method of Claim 30 in which the promoter sequence is a promoter sequence from cauliflower mosaic virus (CaMV).

32. A method of Claim 31 in which the promoter sequence is the CaMV35S promoter sequence.

33. A method of Claim 29 in which the chimeric gene com-prises a coding sequence encoding a mutant 5-enolpyruvylshiki-mate-3-phosphate synthase.

34. A method of Claim 29 in which the coding sequence encodes an EPSPS from an organism selected from the group consisting of bacteria, fungi and plants.

35. A method of Claim 29 in which the coding sequence encodes the chloroplast transit peptide from a plant EPSPS gene.

36. A method for producing a glyphosate-resistant plant cell which comprises transforming the plant cell with a plant transformation vector of Claim 15.

.

37. A method of Claim 36 in which the chimeric gene comprises a promoter sequence from a plant virus.

38. A method of Claim 37 in which the promoter sequence is a promoter sequence from cauliflower mosaic virus (CaMV).

39. A method of Claim 38 in which the promoter sequence is the CaMV35S promoter sequence.

40. A method of Claim 36 in which the chimeric gene comprises a coding sequence encoding a mutant 5-enolpyruvyl-shikimate-3-phosphate synthase.

41. A method of Claim 36 in which the coding sequence encodes an EPSPS from an organism selected from the group consisting of bacteria, fungi and plants.

42. A method of Claim 36 in which the coding sequence encodes the chloroplast transit peptide from a plant EPSPS gene.

43. A glyphosate-resistant tomato cell of Claim 22.

44. A glyphosate-resistant tobacco cell of Claim 22.

45. A glyphosate-resistant oil seed rape cell of Claim 22.

46. A glyphosate-resistant flax cell of Claim 22.

47. A glyphosate-resistant soybean cell of Claim 22.

48. A glyphosate-resistant sunflower cell of Claim 22.

49. A glyphosate-resistant sugar beet cell of Claim 22.

50. A glyphosate-resistant alfalfa cell of Claim 22.

51. A glyphosate-resistant cotton cell of Claim 22.

52. Plasmid pMON546, ATCC accession number 53213.