CA2033692A1 - Energy transfer systems - Google Patents
Energy transfer systemsInfo
- Publication number
- CA2033692A1 CA2033692A1 CA002033692A CA2033692A CA2033692A1 CA 2033692 A1 CA2033692 A1 CA 2033692A1 CA 002033692 A CA002033692 A CA 002033692A CA 2033692 A CA2033692 A CA 2033692A CA 2033692 A1 CA2033692 A1 CA 2033692A1
- Authority
- CA
- Canada
- Prior art keywords
- lumazine
- optionally substituted
- alkyl group
- represent
- deoxyribosyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H23/00—Compounds containing boron, silicon, or a metal, e.g. chelates, vitamin B12
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D475/00—Heterocyclic compounds containing pteridine ring systems
- C07D475/02—Heterocyclic compounds containing pteridine ring systems with an oxygen atom directly attached in position 4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/531—Production of immunochemical test materials
- G01N33/532—Production of labelled immunochemicals
- G01N33/533—Production of labelled immunochemicals with fluorescent label
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S436/00—Chemistry: analytical and immunological testing
- Y10S436/80—Fluorescent dyes, e.g. rhodamine
Abstract
Abstract Energy-transfer systems which can be used, inter alia, for measuring distances within or between different molecules are described.
Description
2~33~2 The detection and the identification of DNA or RNA can be effected by hybridisations with corresponding complementary nucleotide strands. These hybridisations take place with very high specificity and therefore have a high potential for the diagnosis and detection of diseases (Methods Enzymology 68, 373 [1979]).
One technique for carrying out such hybridisation experiments is the so-called Southern Blot method (J. Mol. Biol. 98, 503 [1975~), which, however, is rather complicated and has the further disadvantage that, as a rule, radioactiveisotopes, e.g. 32p, are used in this technique. This is why many efforts have to been made on lhe one hand to simplify the technique of the hybridisation methods, and on the other hand to replace the radioactivity by suitable non-radioactive reporter molecules.
One possibility for both simplifying the hybridisation technique and, at the same time, replacing the radioactivity is provided by fluorescent systems where an energy transfer takes place from a donor to an acceptor. Such energy-transfer systems were predicted by Forster (Ann. Phys. 2, 55 [1948]). At the same time, Forster (supra) produced a relation between the efficiency of energy transfer and the distance between donor and acceptor (so-called Forster equation). If the emission band of the donor overlaps the absorption band of ;
the acceptor, energy can be transferred from the donor to the acceptor, and the `
efficiency of this energy transfer decreases with the 6th power of the distance between donor and acceptor. In other words, the intensity of energy transfer increases as the distance between donor and acceptor decreases.
Since then, energy-transfer measurements have become a useful tool for measuring distances both within and between various molecules (Stryer, Ann.
Rev. Biochem. 47, 819 [1987]). Such measurements of distance via the efficiency of energy transfer between donor and acceptor molecules are suitable for immunoassays and for DNA Hybridisation assays (J. Biol. Chem. 251, a~172 [1976]; Anal. Biochem. 108, 176 [1980]; Clin. Chem. 29, 1582 [1983];
Lo/10. 12.90 2~33~
Chemiluminescent and Fluorescent Probes for DNA-Hybridisation Systems [1985]; Kingsburg, D.T. and Falkow S., Eds., 345 356, Academic Press, New York).
The present invention relates to novel energy-transfer systems which are 5 suitable for measuring distances both within and between various molecules and which consist of two organic compounds, one of which is a chromophore of the lumazine type and the other, with which it interacts, is a ruthenium complex.
These energy-transfer systems can also, in the wider sense, be defined as lo donor-acceptor energy-transfer systems. The donor cornponent is to be understood to mean, in general, those compounds which are able to absorb light from an energy source and then release it to an acceptor. By acceptor is generally meant those compounds which are able to absorb this energy released by the donor.
Such acceptors are, according to the present invention, Ru complexes.
The energy absorption takes place via the long wavelength metal to ligand charge transfer (MLCT) band of these Ru complexes. The term "metal to ligand charge transfer" (MLCT) band designates the transition from a d electron of the Ru (II) ion to a ~* electron of the ligand system of the ruthenium complex. In this connection, see also Crosby, J. Chem. Education 60, 791-796 [1983].
Suitable chromophores of the lumazine type (Lu) are lumazine derivatives and similar ~ systems of the general formula o ~NJ~ R3 0~ N J~ N~O
in which Rl and R2 each represent an H atom, an optionally substituted Cl lo-~5 alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted Cl lo-aikyl group, and R4 represents an optionally substituted Cl lo-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula 2~33~
One technique for carrying out such hybridisation experiments is the so-called Southern Blot method (J. Mol. Biol. 98, 503 [1975~), which, however, is rather complicated and has the further disadvantage that, as a rule, radioactiveisotopes, e.g. 32p, are used in this technique. This is why many efforts have to been made on lhe one hand to simplify the technique of the hybridisation methods, and on the other hand to replace the radioactivity by suitable non-radioactive reporter molecules.
One possibility for both simplifying the hybridisation technique and, at the same time, replacing the radioactivity is provided by fluorescent systems where an energy transfer takes place from a donor to an acceptor. Such energy-transfer systems were predicted by Forster (Ann. Phys. 2, 55 [1948]). At the same time, Forster (supra) produced a relation between the efficiency of energy transfer and the distance between donor and acceptor (so-called Forster equation). If the emission band of the donor overlaps the absorption band of ;
the acceptor, energy can be transferred from the donor to the acceptor, and the `
efficiency of this energy transfer decreases with the 6th power of the distance between donor and acceptor. In other words, the intensity of energy transfer increases as the distance between donor and acceptor decreases.
Since then, energy-transfer measurements have become a useful tool for measuring distances both within and between various molecules (Stryer, Ann.
Rev. Biochem. 47, 819 [1987]). Such measurements of distance via the efficiency of energy transfer between donor and acceptor molecules are suitable for immunoassays and for DNA Hybridisation assays (J. Biol. Chem. 251, a~172 [1976]; Anal. Biochem. 108, 176 [1980]; Clin. Chem. 29, 1582 [1983];
Lo/10. 12.90 2~33~
Chemiluminescent and Fluorescent Probes for DNA-Hybridisation Systems [1985]; Kingsburg, D.T. and Falkow S., Eds., 345 356, Academic Press, New York).
The present invention relates to novel energy-transfer systems which are 5 suitable for measuring distances both within and between various molecules and which consist of two organic compounds, one of which is a chromophore of the lumazine type and the other, with which it interacts, is a ruthenium complex.
These energy-transfer systems can also, in the wider sense, be defined as lo donor-acceptor energy-transfer systems. The donor cornponent is to be understood to mean, in general, those compounds which are able to absorb light from an energy source and then release it to an acceptor. By acceptor is generally meant those compounds which are able to absorb this energy released by the donor.
Such acceptors are, according to the present invention, Ru complexes.
The energy absorption takes place via the long wavelength metal to ligand charge transfer (MLCT) band of these Ru complexes. The term "metal to ligand charge transfer" (MLCT) band designates the transition from a d electron of the Ru (II) ion to a ~* electron of the ligand system of the ruthenium complex. In this connection, see also Crosby, J. Chem. Education 60, 791-796 [1983].
Suitable chromophores of the lumazine type (Lu) are lumazine derivatives and similar ~ systems of the general formula o ~NJ~ R3 0~ N J~ N~O
in which Rl and R2 each represent an H atom, an optionally substituted Cl lo-~5 alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted Cl lo-aikyl group, and R4 represents an optionally substituted Cl lo-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula 2~33~
R8~ J~N~P~5 11 0~ j N F~6 in which Rs and R6 each represent an optionally substituted Cl lo-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydraxyl compound, for example of a C-nucleoside derivative as described in J. Org. Chem. 54, 3927 (1989).
By analogous hydroxyl compounds are meant con pounds with one or more hydroxyl groups via which covalent coupling to other molecules can be brought about. By lumazine derivatives are meant both the cc and the ,B
anomers. The determination of configuration of the oc- and ~-anomers is based 10 upon lH-NMR as published in the relevant scientific literature (Chem. Ber.
106, 1401-1417 [1973], Liebigs Ann. Chem. 1217-1234 [1977]). New investigations of ours using X-ray analysis however showed that the formerly designated cc-anomere is in reality the ,B-anomer and vice versa.
The ruthenium complexes are compounds of the general formula Ru2+ Ll L2L3 III
~here the ligands Ll, L2 and L3 are identical or different and represent charge-transfer units, and the ligand L3 is substituted by a group A-X where A
represents an alkylene group which can also carry sulphonamide, thioether, ether, carboxyl or carboxamide functionalities, and X represents an aldehyde-, 20 carboxyl-, hydroxyl-, amino- or thiocyanate group, halogen or a phosphite or phosphate group or a modified phosphate group, for example a phosphonate or thiophosphate group, or any other suitable functionality.
As used herein, the term "Cl lo-alkyl" represents a straight-chain or branched, optionally substituted alkyl chain which contains 1-10 C atoms, such 25 as, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec.butyl, tert.butyl, n-pentyl, n-hexyl, etc. Preferred alkyl groups are methyl groups.
By substituted alkyl groups are meant those which do not have an adverse effect on the energy-transfer ability.
2~3~
Examp~es of charg~transfer units L1, L2 and L3 are bipyridyl, bathophen-anthroline or benzobathophenanthroline, each of which can optionally be substituted.
The alkylene group A can be straight-chain or branched. A is very particularly preferably a -(CH2)4- or -(CH2)s-group and X is an -O~I group.
Preferred energy-transfer systems according to the invention are DNA or RNA sequences which contain covalently bonded chromophores of the lumazine type and which are covalently linked either in modified form, preferably in amino-modified form, or in unmodified form directly or via a lo spacer group by reaction with a ruthenium complex of the formula III.
Covalent bonding at the 5' end of the DNA or RNA sequences, at the 3' end or within the DNA or RNA sequences, which are appropriately modified for this purpose, is preferred.
According to the present invention, the chromophores of the lumazine type can be incorporated at the end of the DNA or RNA sequence or within the DNA or RNA sequence in place of a nucleoside, it being possible for the incorporation to take place in a desired manner. However, it is also possible for several, preferably 2-8, consecutive chromophores of the lumazine t,vpe to be incorporated at the end of the DNA or RNA sequence, or within the DNA or RNA sequence, in place of suitable nucleosides. It would also be conceivable to modify the chromophores of the lumazine type in such a way that they can also be bonded to appropriately modified bases or to the sugar-phosphate backbone.
Particularly preferred energy-transfer systems according to the invention 25 are:
Ru2+ L1 L2 L3 dtLuGTTGACAAGAATCCTCACAATACC) 3', Ru2+ Ll L2 L3 d(GTLuGACAAGAATCCTCACAATACC) 3', Ru2+ Ll L2 L3 d(GTTGALuAAGAATCCTCACAATACC) 3', Ru2+ L1 L2 L3 d(GTTGACAALuAATCCTCACAATACC) 3' and Rù2+ Ll L2 L3 d(LuLuLuLuLuGTTGACAAGAATCCTCACAATACC) 3' where the ruthenium complex (Ru complex) of the general formula III is linked via a very stable phosphodiester linkage to the DNA, and the chromophores of the lumazine type are 1-(2'-deoxy-a-D-ribofuranosyl)-6,7-dimethyl-lumazine (Lu) (see Figure 1).
2~3~2 The chromophores of the lumazine type and ruthenium complexes of the formula m can, however, also be used incorporated in different DNA or RNA sequences as energy-transfer systems. However, they can also be used incorporated in peptides or polypeptides as energy-transfer systems. Equally 5 conceivable is use in other types of molecules.
The term "DNA or l~ sequences" represents natural or synthetically prepared, unmodified or modified l~NA or RNA sequences.
The ruthenium complexes of the general formula III can be prepared as described in European Patent Application, Publication No. 178450.
o The coupling of the ruthenium complexes of the general formula III to the DNA or RNA sequences which contain one or more chromophores of the lumazine type is carried out in a manner known per se. A possible way of coupling to the modified DNA or RNA comprises treating the ruthenium complex of the formula III and the modified DNA or RNA sequence with a water-soluble carbodiimide derivative, for example with N-cyclohexyl-N'-(2-morpholinoethyl)carbodiimide-methyl-p-toluenesulphonate. A particularly preferred coupling agent is 1,1,3,3-tetramethyl-2-succinyluronium tetrafluoro-borate (1:1), called "TSU" hereinafter (the aforementioned "TSU" can be prepared as described in published Japanese Patent Application No. 166730/86).
The coupling is preferably carried out in a solvent mixture, for example composed of DMF, dioxane or water. ~t has been found, surprisingly, that activation of carboxyl functionalities with TSU takes places even in the presence of water.
However, the coupling can also be carried out directly, for example via a ~5 phosphodiester linkage which is formed in a solvent, such as acetonitrile orabsolute pyridine. For a direct coupling, the ruthenium complexes are converted into a form suitable for the coupling, preferably into phosphor-amidite, H-phosphonate or activated phosphate functionalities.
The phosphoramidite derivatives of the ruthenium complexes can be prepared in situ for the coupling in the oligonucleotide synthesis (Bannwarth and Schmidt, Tetrahedron Letters 30,1513 (1989)).
The ruthenium complexes in the form of the H phosphonates can be obtained by reaction between the ruthenium complex which has been derivatised with a hydroxyalkyl group and trisimidazoylphosphine (Frohler et 2~3~
al., Nucleic Acid Research 14, 5399 (1986)) or salicylchlorophosphine as reagent(Marugg et al., Tetrahedron Letters, 2271 (1986)) and subsequent hydrolysis. Thepreparation can be carried out as shown in Figure 6. The H-phosphonates obtained in this way can be used in a known manner in the synthesis of oligonucleotides (Garreg et al., Chemica Scripta 25, 280 (1985)).
The preparation of the DNA or RNA sequences which have one or more chromophores of the lumazine type incorporated in place of one or more nucleosides or additionally contained at one end of the DNA or l~NA sequence is carried out in a manner known per se. The chromophores of the lumazine type are converted into a form suitable for the coupling, preferably into phosphoramidite, H-phosphonate or activated phosphate functionalities. The coupling is preferably carried out on the growing DNA or RNA fragment during the synthesis. The synthesis can be carried out both in liquid phase and on a solid phase, as described, for example, in ~cience 230, 2~1 (1985), Chimia 41, 302 or in "Oligonucleotide Synthesis: A practical Approach", IRL Press, Oxford, UK, M.J. Gait, Ed. (1984).
Particularly preferred DNA sequences in which one or more chromo-phores of the lumazine type are incorporated in place of one or more nucleosides or additionally at the 5' end are:
d(GTLuGACAAGAATCCTCACAATACC) 3', d(GTTGALuAAGAATCCTCACAATACC) 3', d(GTTGACAALuAATCCTCACAATACC) 3', d~LuGTTGACAAGAATCCTCACAATACC) 3' and d(LuLuLuLuLuGTTGACAAGAATCCTCACAATAC~) 3' in ~hich Lu represents 1-(2'-deoxy-a-D-ribofuranosyl)-6,7-dimethyl-lumazine.
The present invention also relates to these DNA or RNA sequences.
The present invention likewise relates to the lumazine derivatives and similar ~c systems of the general formula o R1~ N ~N ~,R3 od` N N O
2~33~
in which R1 and R2 each represent an H atom, an optionally substituted C1 lo-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1 lo-alkyl group; and R4 represents an optionally substituted Cl lo-5 alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula o N J~, o~ N N ~6 in which Rs and R6 each represent an optionally substituted Cl lo-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an -~
l0 analogous hydroxyl compound, for example of a C-nucleoside derivative as described in J. Org. Chem. 54, 3927 (1989).
In a preferred embodiment, the lumazine derivative has the following formula:
o HN~ ~ 11-1 l5 in which Rl and R2 represent an optionally substituted Cl lo-alkyl group, preferably a methyl group; and R3 represents 1'-ribosyl or 1'-(2'-deoxyribosyl).
A particularly preferred lumazine derivative is 1-(2'-deoxy-a-D-ribo-furanosyl)-6,7-dimethyl-lumazine (see compound 1 in Figure 2).
The abovementioned lumazine derivatives can be prepared as described ~o by Ritzmann and Pfleiderer in Chem. Ber. 106,1401 (1973) or in a manner analogous thereto.
The present invention furthermore relates to phosphoramidites and H-phosphonates of the abovementioned lumazine derivatives, which are suitable for the solid-phase or solution syntheses of oligo- or polyn~lcleotides.
A particularly preferred phosphoramidite of the present invention is 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-((2-cyanoethyl)-N,N-diisopropylphosphoramidite)-6,7-dimethyl-lumazine (see compound 3 in Figure 2).
The abovementioned phosphoramidites or H-phosphonates of the lumazine derivatives can be prepared by reacting, by known methods, above-mentioned lumazine derivatives which are protected at the 5' end. It is preferable for the 5' end of the lumazine derivative first to be protected by a 4',~dimethoxytrityl group, and for the resulting compound then to be reacted lo with 2-cyanoethoxy-bis-diisopropylaminophosphine in the presence of diisopropylammonium tetrazolide to give the corresponding phosphor-amidite of the lumazine derivative. The particularly preferred phosphor-amidite, which has already been mentioned herein, 1-(5'-0-4,4'-dimethoxy-trityl-2'-deoxy-o~-D-ribofuranosyl-3'-0-((2-cyanoethyl)-N,N-diisopropyl-phosphoramidite)-6,7-dimethyl-lumazine 3 can be prepared as shown in Figure 2.
The present invention furthermore relates to lumazine derivatives which allow lumazines to be incorporated at the 3' end of oligonucleotides in solid-phase synthesis.
~o A particularly preferred lumazine derivative of the present invention is 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine (see compound 16 in Figure 5).
The abovementioned compound can be prepared by reacting, by known methods, the lumazine derivative 2 protected at the 5' end with a 4,4'-dimethoxytrityl group. The protected lumazine derivative is preferably reacted with succinic anhydride with activation, and the product is isolated as salt of the acid. 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-oc-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine can be prepared as shown in Figure 5.
The present invention furthermore relates to controlled pore glass (CPG), which is normally used as support material in solid-phase synthesis, which has been modified with lumazine derivatives (see compound 17 in Figure 5).
Other support materials which can be used for the modification, such as, for example, silica gel, can likewise be utilised (F. Chow; T. Kempe; G. Palm;
Nucleic Acids Res. 9, ?807 [1981]).
2~3~
g A wide variety of radicals can be incorporated at the 3' end of an oligo-nucleotide by the linkage of the CPG material to nucleosides and derivatives thereof. In the preferred embodiment of the present invention, the support material is linked to a luma~ine derivative which is suitable for the further synthesis of an oligonucleotide.
The functionally modified CPG is prepared in a manner known per se by coupling the 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine 16 to CPG material suitable for the linkage. In the preferred embodiment, the functionalised support material is prepared as o shown in Figure 5 by activation of 16 with mesitylene^2-sulphonyl chloride (MsCl) and 1-methyl-imidazole (MeIm).
The support obtained in this way can be used to introduce lumazine derivatives at the 3' end of oligo- or polynucleotides. This has the advantage that, for example, energy-transfer systems are possible between oligonucleo-tides which are equipped with donor or acceptor at different ends of the oligonucleotides.
Particularly preferred energy-transfer systems according to the invention having these properties are:
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydraxyl compound, for example of a C-nucleoside derivative as described in J. Org. Chem. 54, 3927 (1989).
By analogous hydroxyl compounds are meant con pounds with one or more hydroxyl groups via which covalent coupling to other molecules can be brought about. By lumazine derivatives are meant both the cc and the ,B
anomers. The determination of configuration of the oc- and ~-anomers is based 10 upon lH-NMR as published in the relevant scientific literature (Chem. Ber.
106, 1401-1417 [1973], Liebigs Ann. Chem. 1217-1234 [1977]). New investigations of ours using X-ray analysis however showed that the formerly designated cc-anomere is in reality the ,B-anomer and vice versa.
The ruthenium complexes are compounds of the general formula Ru2+ Ll L2L3 III
~here the ligands Ll, L2 and L3 are identical or different and represent charge-transfer units, and the ligand L3 is substituted by a group A-X where A
represents an alkylene group which can also carry sulphonamide, thioether, ether, carboxyl or carboxamide functionalities, and X represents an aldehyde-, 20 carboxyl-, hydroxyl-, amino- or thiocyanate group, halogen or a phosphite or phosphate group or a modified phosphate group, for example a phosphonate or thiophosphate group, or any other suitable functionality.
As used herein, the term "Cl lo-alkyl" represents a straight-chain or branched, optionally substituted alkyl chain which contains 1-10 C atoms, such 25 as, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec.butyl, tert.butyl, n-pentyl, n-hexyl, etc. Preferred alkyl groups are methyl groups.
By substituted alkyl groups are meant those which do not have an adverse effect on the energy-transfer ability.
2~3~
Examp~es of charg~transfer units L1, L2 and L3 are bipyridyl, bathophen-anthroline or benzobathophenanthroline, each of which can optionally be substituted.
The alkylene group A can be straight-chain or branched. A is very particularly preferably a -(CH2)4- or -(CH2)s-group and X is an -O~I group.
Preferred energy-transfer systems according to the invention are DNA or RNA sequences which contain covalently bonded chromophores of the lumazine type and which are covalently linked either in modified form, preferably in amino-modified form, or in unmodified form directly or via a lo spacer group by reaction with a ruthenium complex of the formula III.
Covalent bonding at the 5' end of the DNA or RNA sequences, at the 3' end or within the DNA or RNA sequences, which are appropriately modified for this purpose, is preferred.
According to the present invention, the chromophores of the lumazine type can be incorporated at the end of the DNA or RNA sequence or within the DNA or RNA sequence in place of a nucleoside, it being possible for the incorporation to take place in a desired manner. However, it is also possible for several, preferably 2-8, consecutive chromophores of the lumazine t,vpe to be incorporated at the end of the DNA or RNA sequence, or within the DNA or RNA sequence, in place of suitable nucleosides. It would also be conceivable to modify the chromophores of the lumazine type in such a way that they can also be bonded to appropriately modified bases or to the sugar-phosphate backbone.
Particularly preferred energy-transfer systems according to the invention 25 are:
Ru2+ L1 L2 L3 dtLuGTTGACAAGAATCCTCACAATACC) 3', Ru2+ Ll L2 L3 d(GTLuGACAAGAATCCTCACAATACC) 3', Ru2+ Ll L2 L3 d(GTTGALuAAGAATCCTCACAATACC) 3', Ru2+ L1 L2 L3 d(GTTGACAALuAATCCTCACAATACC) 3' and Rù2+ Ll L2 L3 d(LuLuLuLuLuGTTGACAAGAATCCTCACAATACC) 3' where the ruthenium complex (Ru complex) of the general formula III is linked via a very stable phosphodiester linkage to the DNA, and the chromophores of the lumazine type are 1-(2'-deoxy-a-D-ribofuranosyl)-6,7-dimethyl-lumazine (Lu) (see Figure 1).
2~3~2 The chromophores of the lumazine type and ruthenium complexes of the formula m can, however, also be used incorporated in different DNA or RNA sequences as energy-transfer systems. However, they can also be used incorporated in peptides or polypeptides as energy-transfer systems. Equally 5 conceivable is use in other types of molecules.
The term "DNA or l~ sequences" represents natural or synthetically prepared, unmodified or modified l~NA or RNA sequences.
The ruthenium complexes of the general formula III can be prepared as described in European Patent Application, Publication No. 178450.
o The coupling of the ruthenium complexes of the general formula III to the DNA or RNA sequences which contain one or more chromophores of the lumazine type is carried out in a manner known per se. A possible way of coupling to the modified DNA or RNA comprises treating the ruthenium complex of the formula III and the modified DNA or RNA sequence with a water-soluble carbodiimide derivative, for example with N-cyclohexyl-N'-(2-morpholinoethyl)carbodiimide-methyl-p-toluenesulphonate. A particularly preferred coupling agent is 1,1,3,3-tetramethyl-2-succinyluronium tetrafluoro-borate (1:1), called "TSU" hereinafter (the aforementioned "TSU" can be prepared as described in published Japanese Patent Application No. 166730/86).
The coupling is preferably carried out in a solvent mixture, for example composed of DMF, dioxane or water. ~t has been found, surprisingly, that activation of carboxyl functionalities with TSU takes places even in the presence of water.
However, the coupling can also be carried out directly, for example via a ~5 phosphodiester linkage which is formed in a solvent, such as acetonitrile orabsolute pyridine. For a direct coupling, the ruthenium complexes are converted into a form suitable for the coupling, preferably into phosphor-amidite, H-phosphonate or activated phosphate functionalities.
The phosphoramidite derivatives of the ruthenium complexes can be prepared in situ for the coupling in the oligonucleotide synthesis (Bannwarth and Schmidt, Tetrahedron Letters 30,1513 (1989)).
The ruthenium complexes in the form of the H phosphonates can be obtained by reaction between the ruthenium complex which has been derivatised with a hydroxyalkyl group and trisimidazoylphosphine (Frohler et 2~3~
al., Nucleic Acid Research 14, 5399 (1986)) or salicylchlorophosphine as reagent(Marugg et al., Tetrahedron Letters, 2271 (1986)) and subsequent hydrolysis. Thepreparation can be carried out as shown in Figure 6. The H-phosphonates obtained in this way can be used in a known manner in the synthesis of oligonucleotides (Garreg et al., Chemica Scripta 25, 280 (1985)).
The preparation of the DNA or RNA sequences which have one or more chromophores of the lumazine type incorporated in place of one or more nucleosides or additionally contained at one end of the DNA or l~NA sequence is carried out in a manner known per se. The chromophores of the lumazine type are converted into a form suitable for the coupling, preferably into phosphoramidite, H-phosphonate or activated phosphate functionalities. The coupling is preferably carried out on the growing DNA or RNA fragment during the synthesis. The synthesis can be carried out both in liquid phase and on a solid phase, as described, for example, in ~cience 230, 2~1 (1985), Chimia 41, 302 or in "Oligonucleotide Synthesis: A practical Approach", IRL Press, Oxford, UK, M.J. Gait, Ed. (1984).
Particularly preferred DNA sequences in which one or more chromo-phores of the lumazine type are incorporated in place of one or more nucleosides or additionally at the 5' end are:
d(GTLuGACAAGAATCCTCACAATACC) 3', d(GTTGALuAAGAATCCTCACAATACC) 3', d(GTTGACAALuAATCCTCACAATACC) 3', d~LuGTTGACAAGAATCCTCACAATACC) 3' and d(LuLuLuLuLuGTTGACAAGAATCCTCACAATAC~) 3' in ~hich Lu represents 1-(2'-deoxy-a-D-ribofuranosyl)-6,7-dimethyl-lumazine.
The present invention also relates to these DNA or RNA sequences.
The present invention likewise relates to the lumazine derivatives and similar ~c systems of the general formula o R1~ N ~N ~,R3 od` N N O
2~33~
in which R1 and R2 each represent an H atom, an optionally substituted C1 lo-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1 lo-alkyl group; and R4 represents an optionally substituted Cl lo-5 alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula o N J~, o~ N N ~6 in which Rs and R6 each represent an optionally substituted Cl lo-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an -~
l0 analogous hydroxyl compound, for example of a C-nucleoside derivative as described in J. Org. Chem. 54, 3927 (1989).
In a preferred embodiment, the lumazine derivative has the following formula:
o HN~ ~ 11-1 l5 in which Rl and R2 represent an optionally substituted Cl lo-alkyl group, preferably a methyl group; and R3 represents 1'-ribosyl or 1'-(2'-deoxyribosyl).
A particularly preferred lumazine derivative is 1-(2'-deoxy-a-D-ribo-furanosyl)-6,7-dimethyl-lumazine (see compound 1 in Figure 2).
The abovementioned lumazine derivatives can be prepared as described ~o by Ritzmann and Pfleiderer in Chem. Ber. 106,1401 (1973) or in a manner analogous thereto.
The present invention furthermore relates to phosphoramidites and H-phosphonates of the abovementioned lumazine derivatives, which are suitable for the solid-phase or solution syntheses of oligo- or polyn~lcleotides.
A particularly preferred phosphoramidite of the present invention is 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-((2-cyanoethyl)-N,N-diisopropylphosphoramidite)-6,7-dimethyl-lumazine (see compound 3 in Figure 2).
The abovementioned phosphoramidites or H-phosphonates of the lumazine derivatives can be prepared by reacting, by known methods, above-mentioned lumazine derivatives which are protected at the 5' end. It is preferable for the 5' end of the lumazine derivative first to be protected by a 4',~dimethoxytrityl group, and for the resulting compound then to be reacted lo with 2-cyanoethoxy-bis-diisopropylaminophosphine in the presence of diisopropylammonium tetrazolide to give the corresponding phosphor-amidite of the lumazine derivative. The particularly preferred phosphor-amidite, which has already been mentioned herein, 1-(5'-0-4,4'-dimethoxy-trityl-2'-deoxy-o~-D-ribofuranosyl-3'-0-((2-cyanoethyl)-N,N-diisopropyl-phosphoramidite)-6,7-dimethyl-lumazine 3 can be prepared as shown in Figure 2.
The present invention furthermore relates to lumazine derivatives which allow lumazines to be incorporated at the 3' end of oligonucleotides in solid-phase synthesis.
~o A particularly preferred lumazine derivative of the present invention is 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine (see compound 16 in Figure 5).
The abovementioned compound can be prepared by reacting, by known methods, the lumazine derivative 2 protected at the 5' end with a 4,4'-dimethoxytrityl group. The protected lumazine derivative is preferably reacted with succinic anhydride with activation, and the product is isolated as salt of the acid. 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-oc-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine can be prepared as shown in Figure 5.
The present invention furthermore relates to controlled pore glass (CPG), which is normally used as support material in solid-phase synthesis, which has been modified with lumazine derivatives (see compound 17 in Figure 5).
Other support materials which can be used for the modification, such as, for example, silica gel, can likewise be utilised (F. Chow; T. Kempe; G. Palm;
Nucleic Acids Res. 9, ?807 [1981]).
2~3~
g A wide variety of radicals can be incorporated at the 3' end of an oligo-nucleotide by the linkage of the CPG material to nucleosides and derivatives thereof. In the preferred embodiment of the present invention, the support material is linked to a luma~ine derivative which is suitable for the further synthesis of an oligonucleotide.
The functionally modified CPG is prepared in a manner known per se by coupling the 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine 16 to CPG material suitable for the linkage. In the preferred embodiment, the functionalised support material is prepared as o shown in Figure 5 by activation of 16 with mesitylene^2-sulphonyl chloride (MsCl) and 1-methyl-imidazole (MeIm).
The support obtained in this way can be used to introduce lumazine derivatives at the 3' end of oligo- or polynucleotides. This has the advantage that, for example, energy-transfer systems are possible between oligonucleo-tides which are equipped with donor or acceptor at different ends of the oligonucleotides.
Particularly preferred energy-transfer systems according to the invention having these properties are:
5'-d(TGGGATAGGTGGATTAT-LuLuLuLu) 3' 5'-d(CTACTGGGATAGGTGGA-LuLuLuLu) 3' 5'-d(TCAACGTATGl~CACCG-LuLuLuLu) 3' Surprisingly, it has emerged that the chromophores of the lumazine type according to the present invention are suitable for transferring light from a nitrogen laser to ruthenium complexes of the formula m.
The combinations of chromophore of the lumazine type/ruthenium complex of the formula III thus represent energy-transfer systems (with the chromophore of the lumazine type as donor and the ruthenium complex of the formula III as acceptor) which are extremely suitable for measurements of distances within one or between different molecules because, as already stated in the introduction, the Forster equation means that there is strict correlationbetween energy transfer and the distance between donor and acceptor.
Such measurements of distance can be used to determine molecular associations between various molecules, for example between DNA or RNA
sequences and proteins/peptides when one type of molecule is equipped with 2~3~2 the donor and the other with the accep~or. This can be used to detect inter-actions of these molecules and for detecting the presence or absence of molecules. These detections are particularly suitable for diagnostic assays, such as, for example, immunoassays, receptor screening assays and DNA probe 5 assays.
A coupling of the Ru complexes of the formula III to proteins/peptides has been described in European Patent Application, Publication No. 178 450.
The modification of lumazine 2'-deoxyribosides at the 5' end with an amino functionality can be carried out in analogy to that of thymidine (Helv. Chim.
Acta 71,1517 [1988]). The coupling of chromophores of the lumazine type to proteins/ peptides via carboxamide linkages is to be brought about in this way.
This means that the energy-transfer system according to the invention between a chromophore of the lumazine type and an Ru complex of the formula III can be used in those assays in which distances between proteins/
peptides play a part, such as, for example, in immunoassays.
Receptor screening assays can also be designed on this basis.
The incorporation of the energy-transfer system in the same molecule allows measurements of distance to be carried out within one molecule. The incorporation of the components of the energy-transfer system in different molecules also allows, however, measurements of distance between different molecules to be carried out. Systems of this type represent the preferred energy-transfer systems according to the invention.
In addition, the said donors, especially the lumazine derivatives according to the invention, are suitable for replacing the dye laser in the ~5 combination of nitrogen and dye laser used for excitation of the ruthenium complexes.
The methodology of the time-resolved fluorescence technique is described, for example, in German Offenlegungsschrift 2628158 or the above-mentioned European Patent Application No. 85.1113777.9 (Publication No.
178450).
The examples and figures which follow illustrate the present invention without restricting it.
Figure 1 shows the structure of the 5' end of compound 11 (Example 4).
2~33~
Figure 2 shows diagrammatically the preparation of 1-(5'-0~,4'-dimethoxytrityl-2'-deoxy-cc-D-ribofuranosyl-3'-0-((2-cyanoethyl)-N,N-diiso-propyl-phosphoramidite)-6,7-dimethyl-lumazine 3.
Figure 3 shows diagrammatically the synthesis of various DNA sequences 5 which have one or more chromophores of the lumazine type incorporated in place of one or more nucleosides or additionally contained at the 5' end of the DNA sequence.
Figure 4 shows the analysis by gel electrophoresis of compounds 4-9 (Example 3) and 10-15 (Example 4).
o ~igure 5 shows diagrammatically the synthesis of 1-(5'-0-4,4'-dimethoxy-trityl-2'-deoxy-a-D-ribofuranosyl-3'-O-succinyl)-6,7-dimethyl-lumazine and of the support modified with lumazine.
Figure 6 shows the synthesis of ~he Ru complex H-phosphonate.
I:igure 7 shows the oligonucl~otide sequences 20-25 and their use in energy transfer systems.
Figure 8 shows the oligonucleotide sequences ~Q, ~, ~, 24 and 25 and their use in energy transfer systems.
Examples All the solvents were of extra high purity. The phosphoramidite of the ruthenium (bathophenanthroline) complex was prepared in situ as described by W. Bannwarth and D. Schmidt (Tetrahedron Lett. 30, 1513, 1989). DNA
syntheses were carried out on solid supports (Adams et al., J. Am. Chem. Soc.
105, 661 [1983]) by means of phosphoramidite chemistry using published rnethods, for example that of Sinha et al., Nudeic Acids Res. 12, 453g (1984) orBannwarth, Chimia 41, 302 (1987). Time-resolved fluorescence measurements were carried out in a volume of 100 ,ul using a published apparatus (European Patent Application, Publication No. 17~450). Short column chromatography (CC) was carried out as described by Hunt and Rigby (Chem. Ind., London, 1868 [1967]) with silica gel 60 (0.063-0.040 mm, Merck). 1-(2'-Deoxy-a-D-ribofurano-syl)-6,7-dimethyl-lumazine 1 was prepared as described by Ritzmann and Pfleiderer in Chem. Ber. 106, 1401 (1973).
~3~
Example 1 1 -(5'-0-4,4'-Dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl)-6,7-dimethyl-lumazine 2 0.15 mmol (45 mg) of compound 1 was taken up in abs. pyridine and evaporated twice. It was then again dissolved in abs. pyridine (5 ml), 0.25 mmol (85 mg) of 4,4'-dimethoxytrityl chloride was added, and the mixture was stirred at room temperature (RT). After 1 h, 1 ml of methanol was added and, after a further 15 min, the mixture was poured into saturated NaHC03 lo solution and extracted three times with 30 ml of methylene chloride (CH2C12)each time. The combined organic phases were dried over Na2S04, filtered to remove desiccant and concentrated. The residue was fractionated on 10 g of silica gel by short column chromatography using 100 ml of CH2C12/Et3N (99/1) and 100 ml of CH2C12/MeOH/Et3N (97/2/1). The pure product fractions were collected and concentrated. The residue was dissolved in 5 ml of chloroform and precipitated by dropwise addition to 150 ml of n-pentane. The precipitate was collected and dried and provided 65 mg (48.3 %) of pure product.
Example 2 1-(5'-0~,4'-Dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl 3'-0-((2-cyanoethyl)-N,N-diisopropyl-phosphoramidite)-6,7-dimethyl-lumazine 3 0.3 mmol (183 mg) of compound 2 (Example 1) was taken up in 15 ml of MeCN (abs.) and evaporated. The residue was then taken up again in 15 ml of MeCN, 0.6 mmol (180 mg) of 2-cyanoethoxy-bis-diisopropylaminophosphine and 0.3 mmol (51 mg) of diisopropylammonium tetrazolide were added and the mixture was stirred for 2 h. The mixture was then poured into 100 ml of saturated NaHC03 solution and extracted three times with 30 ml of CH2cl2.
The combined organic phases were dried over Na2S04, filtered to remove desiccant and concentrated. The residue was fractionated on 10 g of silica gel by short column chromatography using 100 ml of CH2C12/E~t3N (99/1) and 100 ml of CH2Cl2/Et3N (98/2). The pure product fractions provided 170 mg (70%) of pure product.
2~3~
Example 3 Synthesis of d(GTIGACAAGAATCCTCACAATACC) 3 ~, d(GTLuGACAAGAATCCTCACAATACC) 3 Z, d(Gl-rGAL-lAAGAATCCTCACAATACC) 3~ ~, d(Gl-rGACAALuAATCCTCACAATACC) 3 d(LuGTTGACAAGAATCCTCACAATACC) 3~ 8 and d(LuLuLuLuLuGl rGACAAGAATCCTCACAATACC) 3~ 2.
_. _ The synthesis was started with controlled pore glass as solid support o which was functionalised with 180 mg of C (4.87 ~,lmol) (Fig. 3). The chain extensions were carried out using 40 mg in each case of the appropriate ~-cyanoethylphosphoramidite until the lumazine deoxyriboside _ (Example 2) was incorporated. Each time a lumazine deoxyriboside phosphoramidite 3 was incorporated, 30 mg of solid support material with the corresponding sequence were separated off and the synthesis was continued as shown in Figure 3. 20 mg of 3 were used for each chain extension with this amidite. 8 mg of each protected sequence still coupled to the solid support material were separated off and, after elimination of protective groups with ammonia, fractionated on a 20% polyacrylamide gel under denaturing conditions (Figure 4).
Example 4 Synthesis of Ru complex-d(GTTGACAAGAATCCTCACAATACC) 3 ~2, Ru complex-d(GTLuGACAAGAATCCTCACAATACC) 3~ ~, Ru complex-d(GTTGALuAAGAATCCTCACAATACC) 3- ~, Ru complex-d(GTTGACAALuAATCCTCACAATACC) 3 ~, Ru complex-d(LuGTTGACAAGAATCCTCACAATACC) 3 11 and Ru complex-d(LuLuLuLuLuGTTGACAAGAATCCTCACAATACC) 3 15 _ After elimination of the dimethoxytrityl protective group, the batho-phenanthroline-ruthenium(II) complex was coupled in the form of its in si~u prepared phosphoramidite to the compounds 4-9 tExample 3) tBannwarth and Schmidt, Tetrahedron Letters 30,1513 (1989)). The compounds 10 15 were then obtained in impure form by treatment with conc. ammonia. Figure 4 shows the analysis of these compounds by 20~ polyacrylamide gel electrophoresis.
~33~
Compounds 10 15 were obtained in pure form either by re~rersed-phase HPLC or by preparative gel electrophoresis and subsequent electroelution.
Example 5 Fluorescence measurements with compounds 11 15 ts~ determine the efficiency 5 of energy transfer The fluorescence intensities of compounds 11-15 were measured using the time-resolved fluorescence technique. Compounds 11 15 were excited by pulses of light from a nitrogen laser (0.7 ns at 337 nm), and the fluorescent light was measured using a photomultiplier.
The measured fluorescence intensity IF at 618 nm (emission wavelength of the ruthenium complex) can be described by the surn of 3 components:
IF--IF1 + IF2 + IF3-IF1 is the lumazine fluorescence intensity at 618 nm. IF2 represents the emission of the Ru complex caused by direct excitation, and IF3 designates the 15 contribution to the fluorescence intensity from the energy transfer. Since IF1 is virtually zero, the measured fluorescence intensity can be written as follows:
IF ~ IF2 + IF3-The table which follows lists the efficiencies (E) of energy transfer for compounds 11 15. These were calculated using the formula E = .100 [%]
Compound E (%) ~5 11 15.0 12 12.6 13 5.4 14 4.1 77.0 2 ~ 3 ~ ~ ~ r~
The table reveals a correlation between the efficiency of energy transfer and the distance between donor (chromophore of the lumazine type) and acceptor (ruthenium complex). In addition, the transfer efficiency can be increased by incorporating several donors, as shown by compound 15.
Example 6 Synthesis of 5' d(TGGGATAGGTGGATIAT-LuLuLuLu) 3' 20 A. Synthesis of 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine 16.
o 0.29 mmol (175 mg) of compound 2 (Example 1) was taken up in dry pyridine and evaporated several times. The residue was taken up in 5 ml of dry CH2Cl2, and 0.91 mmol (91 mg) of succinic anhydride, 0.33 mmol (41 mg) of DMAP and 0.91 mmol (126 ,Ll) of Et3N were added, and the mixture was stirred at room temperature for five hours. The mixture was poured into 10 ml of 1%
strength acetic acid and extracted three times with 50 ml of CH2Cl2 each time.
The combined organic phases were dried and concentrated. The residue was purified by column chromatography on 20 g of silica gel using CH2C12/Et3N
(99/1) and an increasing ethanol gradient (1, 3 and 5%). Pure fractions were collected and concentrated. I~e product (TLC; Rf: 0.32; CH2C12/MeOH 9/1) was dissolved in 5 ml of CH2C12/1% NEt3 and precipitated in 350 ml of n-pentane.
The precipitate was collected and dried. Yield: 165 mg (79%) of 16 as triethyl-ammonium salt.
B. Functionalisation of the CPG support with 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-o~-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine 16 to 2s give compound 17.
2.5 g of the CPG support and 0.18 mmol (130 mg~ of compound 16 were evaporated in 10 ml of dry pyridine several times. The residue was taken up in 10 ml of dry pyridine, and 4.6 mmol (1.0 g) of mesitylen~2-sulphonyl chloride and 4 mmol (0.4 ml) of l-methylimidazole were added. The mixture was 30 shaken occasionally during the reaction time (18 hours). The mixture was filtered and washed with pyridine and ether. Unreacted amino groups were blocked by addition of 15 ml of a solution of 1 g of DMAP, 2 ml of Ac20 and 2 ml of lutidine. After 30 minutes the solution was filtered and the functionalised support was washed with pyridine and ether and dried. UV
~3~
measurement of the eliminated DMTr group (499 nm) revealed that the loading on the support 17 was 27 ~lmol/g.
C. Synthesis of the oligonucleotide 3'-derivatised with lumazine 5' d(TGGGATAGGTG&ATTATLuLuLuLu) 3' 20.
The oligonucleotide was synthesized using the support 17 prepared in part B. and using the lumazine phosphoramidite 3 from Example 2. For this, 1.08 llmol (40 mg) of the support were coupled with 24 ~lrnol (20 mg) of the compound 3 and 240 ,umol (17 mg) of tetrazole in 0.5 ml of dry MeCN in a standard reaction cycle. After the incorporation of the lumazine chromophores lo on the 3' end, the synthesis was continued with normal phosphoramidites.
After deprotection with NH3, the oligonucleotide 20 was isolated by electroelution after preparative gel electrophoresis.
Example 7 Synthesis of Ru complex-d(ATAATCCACCTATCCCAGTAGGAGAAAT) 3' 21 A. Synthesis of the H-phosphonate of the bathophenanthroline-Ru(III) complex 18.
Process A:
0.8 mmol (17 ,ul) of PCl3 was added by syringe to a solution of 2.7 mmol (180 mg) of imidazole and 2.8 mmol (380 ~Ll) of Et3N in 10 ml of dry MeCN
within 5 minutes under argon, and the mixture was stirred at room temperature (RT) for 30 minutes. Separately, 0.1 mmol (126 mg) of the Ru complex was evaporated with dry MeCN and taken up in 10 ml of MeCN and then added to the mixture containing the trisimidazoylphosphine. The 2S mixture was stirred at RT for 2 h and then poured into 100 ml of 0.1 M TEAA
pH 7.0 and extracted with CH2Cl2 (3x50 ml). The combined organic phases were dried over Na2SO4. The residue from evaporation was digested with ether and then washed. 120 mg (86%) of the H-phosphonate 18 were obtained after drying.
2 ~
Process B:
0.1 mmol (126 mg) of the Ru complex was evaporated with MeCN and dissolved in 5 ml of dry MeCN and 1 ml of dry pyridine, and a solution of 0.5 mmol (101 mg) of salicylchlorophosphine in 2 ml of dry MeCN was added.
s This reaction mixture was stirred at RT for 1.5 h, poured into 50 ml of 0.1 ~vI
TEAA and worked up as described in process A. Yield. 120 mg (86%) of the H-phosphonate 18.
B. Coupling of Ru complex H-phosphonates to oligonucleotides.
The oligonucleotide with the sequence d(ATAATCCACCTATCCCAGT-Iû AGGAGAAAT) 3' was prepared in a known manner and left on the supportwith the 5' end deprotected. 26 ~lmol (36 mg) of compound 18 were evaporated with dry MeCN and dissolved in 1 ml of dry pyridine. 0.5 ml of this solution was added at the same time as 7.3 ,ul of pivaloyl chloride dissolved in 0.5 ml of dry MeCN to 0.4 ~,lmol of the oligonucleotide d(ATAATCCACCTAT-15 CCCAC~TAGGAGAAAT) 3' bound to the support. After a coupling time of 4minutes, the support was washed and again reacted with the same amount of reagents. This was followed by oxidation with 1 ml of 0.2 M I2/THF and 1 ml of Et3N/H20/T~ (1:8:1, v/v) and washing steps with Me~:N and ether. 10 mg of the support were treated with 700 ~,ll of conc. ammonia at 67C for two hours 20 for the deprotection. Polyacrylamide gel electrophoresis showed complete conversion of the initial oligonucleotide into the oligonucleotide 21 labelled with the Ru complex.
Example 8 Fluorescence measurements with compounds 20-25 to determine the efficiency ~5 of energy transfer In order to determine the energy transfer between lumazine and Ru complex which are each linked to different molecules, the oligonucleotides 20 and 23 and the oligonucleotide 21 labelled with Ru complex were hybridised 30 on a synthetic template 22 and the energy transfer was determined.
The oligonucleotides 24 and 25 were employed as negative controls (no energy transfer) (see Fig. 7). To characterise the energy transfer, the following table lists the ratios of the measured fluorescence intensities IF and IF2 of the 2 ~ 3 3 ~ ~ r~
tested oligonucleotides. Ihe definitions used for IF and IF2 in this connection are those of Example 5.
Hybrid IF/IF2 22/21/25 1.0 22/21/24 1.1 22/21/23 1.9 22/21/20 2.2 In the cases where oligonucleotides 24 and 25 were used (as negative 0 controls), no energy transfer was observed (IF/IF2 ~ 1). Where there was appropriate hybridisation (hybrid 22/21/20 and 22/21/ ~), energy transfer was possible and was indicated by doubling of the signalling intensity for the fluorescent light from the energy transfer (IF/IF2 - 2).
Thus measurement of the energy transfer made it possible to state clearly whether hybridisation of the two donor/accelptor oligonucleotides took place on a target which was sought, in this case a DNA sequence.
The same sequences 21-25 were used to determine the energy transfer between two separate molecules without the necessity for the latter, as described above, to be attached by a third molecule (Fig. 8). This made use onlyof the specificity of recognition between the two compounds of the energy-transfer system. In the present case, the oligonucleotides 21/20 and 21/23 hybridised with one another because of their base composition, and formed with their chromophores an energy-transfer system. By contrast, the oligo-nudeotide 24 labelled with a chromophore was unable to hybridise with 21.
Although the oligonudeotide 25 hybridised with 2~, it did not carry a chromo-phore which was required for an energy-transfer system. As the table below shows, the fluorescence measurements revealed the expected energy transfers only with the pairs 21/20 and 21/~ while the other two pairs 21/24 and 21/25 showed no transfers (controls).
Hybrid IF/IF2 21/23 1.8 21/24 1.0 21/25 1.0
The combinations of chromophore of the lumazine type/ruthenium complex of the formula III thus represent energy-transfer systems (with the chromophore of the lumazine type as donor and the ruthenium complex of the formula III as acceptor) which are extremely suitable for measurements of distances within one or between different molecules because, as already stated in the introduction, the Forster equation means that there is strict correlationbetween energy transfer and the distance between donor and acceptor.
Such measurements of distance can be used to determine molecular associations between various molecules, for example between DNA or RNA
sequences and proteins/peptides when one type of molecule is equipped with 2~3~2 the donor and the other with the accep~or. This can be used to detect inter-actions of these molecules and for detecting the presence or absence of molecules. These detections are particularly suitable for diagnostic assays, such as, for example, immunoassays, receptor screening assays and DNA probe 5 assays.
A coupling of the Ru complexes of the formula III to proteins/peptides has been described in European Patent Application, Publication No. 178 450.
The modification of lumazine 2'-deoxyribosides at the 5' end with an amino functionality can be carried out in analogy to that of thymidine (Helv. Chim.
Acta 71,1517 [1988]). The coupling of chromophores of the lumazine type to proteins/ peptides via carboxamide linkages is to be brought about in this way.
This means that the energy-transfer system according to the invention between a chromophore of the lumazine type and an Ru complex of the formula III can be used in those assays in which distances between proteins/
peptides play a part, such as, for example, in immunoassays.
Receptor screening assays can also be designed on this basis.
The incorporation of the energy-transfer system in the same molecule allows measurements of distance to be carried out within one molecule. The incorporation of the components of the energy-transfer system in different molecules also allows, however, measurements of distance between different molecules to be carried out. Systems of this type represent the preferred energy-transfer systems according to the invention.
In addition, the said donors, especially the lumazine derivatives according to the invention, are suitable for replacing the dye laser in the ~5 combination of nitrogen and dye laser used for excitation of the ruthenium complexes.
The methodology of the time-resolved fluorescence technique is described, for example, in German Offenlegungsschrift 2628158 or the above-mentioned European Patent Application No. 85.1113777.9 (Publication No.
178450).
The examples and figures which follow illustrate the present invention without restricting it.
Figure 1 shows the structure of the 5' end of compound 11 (Example 4).
2~33~
Figure 2 shows diagrammatically the preparation of 1-(5'-0~,4'-dimethoxytrityl-2'-deoxy-cc-D-ribofuranosyl-3'-0-((2-cyanoethyl)-N,N-diiso-propyl-phosphoramidite)-6,7-dimethyl-lumazine 3.
Figure 3 shows diagrammatically the synthesis of various DNA sequences 5 which have one or more chromophores of the lumazine type incorporated in place of one or more nucleosides or additionally contained at the 5' end of the DNA sequence.
Figure 4 shows the analysis by gel electrophoresis of compounds 4-9 (Example 3) and 10-15 (Example 4).
o ~igure 5 shows diagrammatically the synthesis of 1-(5'-0-4,4'-dimethoxy-trityl-2'-deoxy-a-D-ribofuranosyl-3'-O-succinyl)-6,7-dimethyl-lumazine and of the support modified with lumazine.
Figure 6 shows the synthesis of ~he Ru complex H-phosphonate.
I:igure 7 shows the oligonucl~otide sequences 20-25 and their use in energy transfer systems.
Figure 8 shows the oligonucleotide sequences ~Q, ~, ~, 24 and 25 and their use in energy transfer systems.
Examples All the solvents were of extra high purity. The phosphoramidite of the ruthenium (bathophenanthroline) complex was prepared in situ as described by W. Bannwarth and D. Schmidt (Tetrahedron Lett. 30, 1513, 1989). DNA
syntheses were carried out on solid supports (Adams et al., J. Am. Chem. Soc.
105, 661 [1983]) by means of phosphoramidite chemistry using published rnethods, for example that of Sinha et al., Nudeic Acids Res. 12, 453g (1984) orBannwarth, Chimia 41, 302 (1987). Time-resolved fluorescence measurements were carried out in a volume of 100 ,ul using a published apparatus (European Patent Application, Publication No. 17~450). Short column chromatography (CC) was carried out as described by Hunt and Rigby (Chem. Ind., London, 1868 [1967]) with silica gel 60 (0.063-0.040 mm, Merck). 1-(2'-Deoxy-a-D-ribofurano-syl)-6,7-dimethyl-lumazine 1 was prepared as described by Ritzmann and Pfleiderer in Chem. Ber. 106, 1401 (1973).
~3~
Example 1 1 -(5'-0-4,4'-Dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl)-6,7-dimethyl-lumazine 2 0.15 mmol (45 mg) of compound 1 was taken up in abs. pyridine and evaporated twice. It was then again dissolved in abs. pyridine (5 ml), 0.25 mmol (85 mg) of 4,4'-dimethoxytrityl chloride was added, and the mixture was stirred at room temperature (RT). After 1 h, 1 ml of methanol was added and, after a further 15 min, the mixture was poured into saturated NaHC03 lo solution and extracted three times with 30 ml of methylene chloride (CH2C12)each time. The combined organic phases were dried over Na2S04, filtered to remove desiccant and concentrated. The residue was fractionated on 10 g of silica gel by short column chromatography using 100 ml of CH2C12/Et3N (99/1) and 100 ml of CH2C12/MeOH/Et3N (97/2/1). The pure product fractions were collected and concentrated. The residue was dissolved in 5 ml of chloroform and precipitated by dropwise addition to 150 ml of n-pentane. The precipitate was collected and dried and provided 65 mg (48.3 %) of pure product.
Example 2 1-(5'-0~,4'-Dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl 3'-0-((2-cyanoethyl)-N,N-diisopropyl-phosphoramidite)-6,7-dimethyl-lumazine 3 0.3 mmol (183 mg) of compound 2 (Example 1) was taken up in 15 ml of MeCN (abs.) and evaporated. The residue was then taken up again in 15 ml of MeCN, 0.6 mmol (180 mg) of 2-cyanoethoxy-bis-diisopropylaminophosphine and 0.3 mmol (51 mg) of diisopropylammonium tetrazolide were added and the mixture was stirred for 2 h. The mixture was then poured into 100 ml of saturated NaHC03 solution and extracted three times with 30 ml of CH2cl2.
The combined organic phases were dried over Na2S04, filtered to remove desiccant and concentrated. The residue was fractionated on 10 g of silica gel by short column chromatography using 100 ml of CH2C12/E~t3N (99/1) and 100 ml of CH2Cl2/Et3N (98/2). The pure product fractions provided 170 mg (70%) of pure product.
2~3~
Example 3 Synthesis of d(GTIGACAAGAATCCTCACAATACC) 3 ~, d(GTLuGACAAGAATCCTCACAATACC) 3 Z, d(Gl-rGAL-lAAGAATCCTCACAATACC) 3~ ~, d(Gl-rGACAALuAATCCTCACAATACC) 3 d(LuGTTGACAAGAATCCTCACAATACC) 3~ 8 and d(LuLuLuLuLuGl rGACAAGAATCCTCACAATACC) 3~ 2.
_. _ The synthesis was started with controlled pore glass as solid support o which was functionalised with 180 mg of C (4.87 ~,lmol) (Fig. 3). The chain extensions were carried out using 40 mg in each case of the appropriate ~-cyanoethylphosphoramidite until the lumazine deoxyriboside _ (Example 2) was incorporated. Each time a lumazine deoxyriboside phosphoramidite 3 was incorporated, 30 mg of solid support material with the corresponding sequence were separated off and the synthesis was continued as shown in Figure 3. 20 mg of 3 were used for each chain extension with this amidite. 8 mg of each protected sequence still coupled to the solid support material were separated off and, after elimination of protective groups with ammonia, fractionated on a 20% polyacrylamide gel under denaturing conditions (Figure 4).
Example 4 Synthesis of Ru complex-d(GTTGACAAGAATCCTCACAATACC) 3 ~2, Ru complex-d(GTLuGACAAGAATCCTCACAATACC) 3~ ~, Ru complex-d(GTTGALuAAGAATCCTCACAATACC) 3- ~, Ru complex-d(GTTGACAALuAATCCTCACAATACC) 3 ~, Ru complex-d(LuGTTGACAAGAATCCTCACAATACC) 3 11 and Ru complex-d(LuLuLuLuLuGTTGACAAGAATCCTCACAATACC) 3 15 _ After elimination of the dimethoxytrityl protective group, the batho-phenanthroline-ruthenium(II) complex was coupled in the form of its in si~u prepared phosphoramidite to the compounds 4-9 tExample 3) tBannwarth and Schmidt, Tetrahedron Letters 30,1513 (1989)). The compounds 10 15 were then obtained in impure form by treatment with conc. ammonia. Figure 4 shows the analysis of these compounds by 20~ polyacrylamide gel electrophoresis.
~33~
Compounds 10 15 were obtained in pure form either by re~rersed-phase HPLC or by preparative gel electrophoresis and subsequent electroelution.
Example 5 Fluorescence measurements with compounds 11 15 ts~ determine the efficiency 5 of energy transfer The fluorescence intensities of compounds 11-15 were measured using the time-resolved fluorescence technique. Compounds 11 15 were excited by pulses of light from a nitrogen laser (0.7 ns at 337 nm), and the fluorescent light was measured using a photomultiplier.
The measured fluorescence intensity IF at 618 nm (emission wavelength of the ruthenium complex) can be described by the surn of 3 components:
IF--IF1 + IF2 + IF3-IF1 is the lumazine fluorescence intensity at 618 nm. IF2 represents the emission of the Ru complex caused by direct excitation, and IF3 designates the 15 contribution to the fluorescence intensity from the energy transfer. Since IF1 is virtually zero, the measured fluorescence intensity can be written as follows:
IF ~ IF2 + IF3-The table which follows lists the efficiencies (E) of energy transfer for compounds 11 15. These were calculated using the formula E = .100 [%]
Compound E (%) ~5 11 15.0 12 12.6 13 5.4 14 4.1 77.0 2 ~ 3 ~ ~ ~ r~
The table reveals a correlation between the efficiency of energy transfer and the distance between donor (chromophore of the lumazine type) and acceptor (ruthenium complex). In addition, the transfer efficiency can be increased by incorporating several donors, as shown by compound 15.
Example 6 Synthesis of 5' d(TGGGATAGGTGGATIAT-LuLuLuLu) 3' 20 A. Synthesis of 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-a-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine 16.
o 0.29 mmol (175 mg) of compound 2 (Example 1) was taken up in dry pyridine and evaporated several times. The residue was taken up in 5 ml of dry CH2Cl2, and 0.91 mmol (91 mg) of succinic anhydride, 0.33 mmol (41 mg) of DMAP and 0.91 mmol (126 ,Ll) of Et3N were added, and the mixture was stirred at room temperature for five hours. The mixture was poured into 10 ml of 1%
strength acetic acid and extracted three times with 50 ml of CH2Cl2 each time.
The combined organic phases were dried and concentrated. The residue was purified by column chromatography on 20 g of silica gel using CH2C12/Et3N
(99/1) and an increasing ethanol gradient (1, 3 and 5%). Pure fractions were collected and concentrated. I~e product (TLC; Rf: 0.32; CH2C12/MeOH 9/1) was dissolved in 5 ml of CH2C12/1% NEt3 and precipitated in 350 ml of n-pentane.
The precipitate was collected and dried. Yield: 165 mg (79%) of 16 as triethyl-ammonium salt.
B. Functionalisation of the CPG support with 1-(5'-0-4,4'-dimethoxytrityl-2'-deoxy-o~-D-ribofuranosyl-3'-0-succinyl)-6,7-dimethyl-lumazine 16 to 2s give compound 17.
2.5 g of the CPG support and 0.18 mmol (130 mg~ of compound 16 were evaporated in 10 ml of dry pyridine several times. The residue was taken up in 10 ml of dry pyridine, and 4.6 mmol (1.0 g) of mesitylen~2-sulphonyl chloride and 4 mmol (0.4 ml) of l-methylimidazole were added. The mixture was 30 shaken occasionally during the reaction time (18 hours). The mixture was filtered and washed with pyridine and ether. Unreacted amino groups were blocked by addition of 15 ml of a solution of 1 g of DMAP, 2 ml of Ac20 and 2 ml of lutidine. After 30 minutes the solution was filtered and the functionalised support was washed with pyridine and ether and dried. UV
~3~
measurement of the eliminated DMTr group (499 nm) revealed that the loading on the support 17 was 27 ~lmol/g.
C. Synthesis of the oligonucleotide 3'-derivatised with lumazine 5' d(TGGGATAGGTG&ATTATLuLuLuLu) 3' 20.
The oligonucleotide was synthesized using the support 17 prepared in part B. and using the lumazine phosphoramidite 3 from Example 2. For this, 1.08 llmol (40 mg) of the support were coupled with 24 ~lrnol (20 mg) of the compound 3 and 240 ,umol (17 mg) of tetrazole in 0.5 ml of dry MeCN in a standard reaction cycle. After the incorporation of the lumazine chromophores lo on the 3' end, the synthesis was continued with normal phosphoramidites.
After deprotection with NH3, the oligonucleotide 20 was isolated by electroelution after preparative gel electrophoresis.
Example 7 Synthesis of Ru complex-d(ATAATCCACCTATCCCAGTAGGAGAAAT) 3' 21 A. Synthesis of the H-phosphonate of the bathophenanthroline-Ru(III) complex 18.
Process A:
0.8 mmol (17 ,ul) of PCl3 was added by syringe to a solution of 2.7 mmol (180 mg) of imidazole and 2.8 mmol (380 ~Ll) of Et3N in 10 ml of dry MeCN
within 5 minutes under argon, and the mixture was stirred at room temperature (RT) for 30 minutes. Separately, 0.1 mmol (126 mg) of the Ru complex was evaporated with dry MeCN and taken up in 10 ml of MeCN and then added to the mixture containing the trisimidazoylphosphine. The 2S mixture was stirred at RT for 2 h and then poured into 100 ml of 0.1 M TEAA
pH 7.0 and extracted with CH2Cl2 (3x50 ml). The combined organic phases were dried over Na2SO4. The residue from evaporation was digested with ether and then washed. 120 mg (86%) of the H-phosphonate 18 were obtained after drying.
2 ~
Process B:
0.1 mmol (126 mg) of the Ru complex was evaporated with MeCN and dissolved in 5 ml of dry MeCN and 1 ml of dry pyridine, and a solution of 0.5 mmol (101 mg) of salicylchlorophosphine in 2 ml of dry MeCN was added.
s This reaction mixture was stirred at RT for 1.5 h, poured into 50 ml of 0.1 ~vI
TEAA and worked up as described in process A. Yield. 120 mg (86%) of the H-phosphonate 18.
B. Coupling of Ru complex H-phosphonates to oligonucleotides.
The oligonucleotide with the sequence d(ATAATCCACCTATCCCAGT-Iû AGGAGAAAT) 3' was prepared in a known manner and left on the supportwith the 5' end deprotected. 26 ~lmol (36 mg) of compound 18 were evaporated with dry MeCN and dissolved in 1 ml of dry pyridine. 0.5 ml of this solution was added at the same time as 7.3 ,ul of pivaloyl chloride dissolved in 0.5 ml of dry MeCN to 0.4 ~,lmol of the oligonucleotide d(ATAATCCACCTAT-15 CCCAC~TAGGAGAAAT) 3' bound to the support. After a coupling time of 4minutes, the support was washed and again reacted with the same amount of reagents. This was followed by oxidation with 1 ml of 0.2 M I2/THF and 1 ml of Et3N/H20/T~ (1:8:1, v/v) and washing steps with Me~:N and ether. 10 mg of the support were treated with 700 ~,ll of conc. ammonia at 67C for two hours 20 for the deprotection. Polyacrylamide gel electrophoresis showed complete conversion of the initial oligonucleotide into the oligonucleotide 21 labelled with the Ru complex.
Example 8 Fluorescence measurements with compounds 20-25 to determine the efficiency ~5 of energy transfer In order to determine the energy transfer between lumazine and Ru complex which are each linked to different molecules, the oligonucleotides 20 and 23 and the oligonucleotide 21 labelled with Ru complex were hybridised 30 on a synthetic template 22 and the energy transfer was determined.
The oligonucleotides 24 and 25 were employed as negative controls (no energy transfer) (see Fig. 7). To characterise the energy transfer, the following table lists the ratios of the measured fluorescence intensities IF and IF2 of the 2 ~ 3 3 ~ ~ r~
tested oligonucleotides. Ihe definitions used for IF and IF2 in this connection are those of Example 5.
Hybrid IF/IF2 22/21/25 1.0 22/21/24 1.1 22/21/23 1.9 22/21/20 2.2 In the cases where oligonucleotides 24 and 25 were used (as negative 0 controls), no energy transfer was observed (IF/IF2 ~ 1). Where there was appropriate hybridisation (hybrid 22/21/20 and 22/21/ ~), energy transfer was possible and was indicated by doubling of the signalling intensity for the fluorescent light from the energy transfer (IF/IF2 - 2).
Thus measurement of the energy transfer made it possible to state clearly whether hybridisation of the two donor/accelptor oligonucleotides took place on a target which was sought, in this case a DNA sequence.
The same sequences 21-25 were used to determine the energy transfer between two separate molecules without the necessity for the latter, as described above, to be attached by a third molecule (Fig. 8). This made use onlyof the specificity of recognition between the two compounds of the energy-transfer system. In the present case, the oligonucleotides 21/20 and 21/23 hybridised with one another because of their base composition, and formed with their chromophores an energy-transfer system. By contrast, the oligo-nudeotide 24 labelled with a chromophore was unable to hybridise with 21.
Although the oligonudeotide 25 hybridised with 2~, it did not carry a chromo-phore which was required for an energy-transfer system. As the table below shows, the fluorescence measurements revealed the expected energy transfers only with the pairs 21/20 and 21/~ while the other two pairs 21/24 and 21/25 showed no transfers (controls).
Hybrid IF/IF2 21/23 1.8 21/24 1.0 21/25 1.0
Claims (21)
1. Energy-transfer systems consisting of two organic compounds, one of which is a chromophore of the lumazine type and the other, with which it interacts, is an Ru complex.
2. Energy-transfer systems according to Claim 1, characterised in that the chromophore of the lumazine type is a lumazine derivative of the general formula I
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
3. Energy-transfer systems according to Claim 1 or 2, characterised in that the ruthenium complex is a compound of the general formula Ru2+ L1 L2 L3 III
where the ligands L1, L2 and L3 are identical or different and represent charge-transfer units, and the ligand L3 is substituted by a group A-X where A
represents an alkylene group which can also carry sulphonamide, thioether, ether, carboxyl or carboxamide functionalities, and X represents an aldehyde, carboxyl, hydroxyl, amino or thiocyanate group, halogen or a phosphite or phosphate group or a modified phosphate group, for example a phosphonate or thiophosphate group, or any other suitable functionality.
where the ligands L1, L2 and L3 are identical or different and represent charge-transfer units, and the ligand L3 is substituted by a group A-X where A
represents an alkylene group which can also carry sulphonamide, thioether, ether, carboxyl or carboxamide functionalities, and X represents an aldehyde, carboxyl, hydroxyl, amino or thiocyanate group, halogen or a phosphite or phosphate group or a modified phosphate group, for example a phosphonate or thiophosphate group, or any other suitable functionality.
4. Energy-transfer systems according to any of Claims 1-3, characterised in that the chromophore of the lumazine type is a lumazine derivative of the general formula I in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents are optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
5. Energy-transfer systems according to any of Claims 1-3, characterised in that the chromophore of the lumazine type is a lumazine derivative of the general formula II in which R5 and R6 represent an optionally substituted C1-10-alkyl group; and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
6. Energy-transfer systems according to any of Claims 1-5, characterised in that one or more chromophores of the lumazine type are incorporated at the end of a DNA or RNA sequence or within a DNA or RNA sequence in place of one or more nudeosides in the DNA or RNA sequence, and the DNA or RNA
sequence is bound to a ruthenium complex of the general formula III in which the charge-transfer units L1, L2 and L3 are identical or different and representbipyridyl, bathophenanthroline or benzobathophenanthroline groups, each of which can optionally be substituted.
sequence is bound to a ruthenium complex of the general formula III in which the charge-transfer units L1, L2 and L3 are identical or different and representbipyridyl, bathophenanthroline or benzobathophenanthroline groups, each of which can optionally be substituted.
7. Energy-transfer systems accordirng to Claim 6 with one of the following formulae Ru2+ L1 L2 L3-d(LuGTTGACAAGAATCCTCACAATACC) 3', Ru2+ L1 L2 L3-dtGTLuGACAAGAATCCTCACAATACC) 3', Ru2+ L1 L2 L3-d(GTTGALuAAGAATCCTCACAATACC) 3', Ru2+ L1 L2 L3-d(GTTGACAALuAATCCTCACAATACC) 3' or Ru2+ L1 L2 L3-d(LuLuLuLuLuGTTGACAAGAATCCTCACAATACC) 3' in which the ruthenium complex of the general formula III is linked via a very stable phosphodiester linkage to the DNA or RNA, and the chromo-phores of the lumazine type are 1-(2'-deoxy-.alpha.-D-ribofuranosyl)-6,7-dimethyl-lumazine [Lu].
8. Energy-transfer systems according to any of Claims 1-5, characterised in that the chromophores of the lumazine type and the ruthenium complexes are incorporated in different modified or unmodified DNA or RNA sequences.
9. Use of the energy-transfer systems according to Claims 1-8 for measuring distances within a molecule or between different molecules, in particular for measuring distances within a DNA or RNA sequence or between different DNA or RNA sequences.
10. Use according to Claim 9 in diagnostic assays.
11. DNA or RNA sequences which contain one or more chromophores of the lumazine type.
12. DNA or RNA sequences according to Claim 11, characterised in that the chromophores of the lumazine type are lumazine derivatives of the general formula I
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
13. DNA sequences according to Claim 12 with the following formulae
14. DNA sequences according to Claim 13, characterised in that the chromophores of the lumazine type (Lu) are 1-(2'-deoxy-.alpha.-D-ribofuranosyl)-6,7-dimethyl-lumazine.
15. Lumazine derivatives of the general formula I
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound.
16. Phosphoramidites or H-phosphonates of the lumazine derivatives according to Claim 15, in particular 1-(5'-O-4,4'-dimethoxytrityl-2'-deoxy-.alpha.-D-ribofuranosyl 3'-O-((2-cyanoethyl)-N,N-diisopropyl-phosphoramidite)-6,7-dimethyl-lumazine.
17. Support material modified with lumazine derivatives according to Claim 15, in particular 1-(5'-O-4,4'-dimethoxytrityl-2'-deoxy-.alpha.-D-ribofuranosyl-3'-O-succinyl)-6,7-dimethyl-lumazine.
18. Use of the support material according to Claim 17 in solid-phase synthesis.
19. Process for preparing energy-transfer systems consisting of two organic compounds, one of which is a chromophore of the lumazine type and the other, with which it interacts, is an Ru complex, characterised in that the two chromophores are synthesised independently of one another by described methods and are brought into spatial proximity for the interaction.
20. Process for preparing DNA or RNA sequences which contain one or more chromophores of the lumazine type, characterised in that lumazine derivatives of the general formula I
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, are covalently incorporated, in a form suitable for the coupling, preferably as phosphoramidites, H-phosphonates or activated phosphate functionalities, into the sequences which are to be synthesised during the course of DNA or RNA synthesis.
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, are covalently incorporated, in a form suitable for the coupling, preferably as phosphoramidites, H-phosphonates or activated phosphate functionalities, into the sequences which are to be synthesised during the course of DNA or RNA synthesis.
21. Process for preparing support material linked to lumazine derivatives, characterised in that lumazine derivatives of the general formula I
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, are, after conversion into a form suitable for linkage to the support, preferably as succinyl derivative, coupled to the latterwith the formation of a covalent bond.
in which R1 and R2 each represent an H atom, an optionally substituted C1-10-alkyl group, 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound; R3 represents an H atom or represents an optionally substituted C1-10-alkyl group; and R4 represents an optionally substituted C1-10-alkyl group; 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, or of the general formula II
in which R5 and R6 each represent an optionally substituted C1-10-alkyl group;
and R7 and R8 represent 1'-ribosyl, 1'-(2'-deoxyribosyl) or the radical of an analogous hydroxyl compound, are, after conversion into a form suitable for linkage to the support, preferably as succinyl derivative, coupled to the latterwith the formation of a covalent bond.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CH23590 | 1990-01-25 | ||
| CH235/90 | 1990-01-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2033692A1 true CA2033692A1 (en) | 1991-07-26 |
Family
ID=4182372
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002033692A Abandoned CA2033692A1 (en) | 1990-01-25 | 1991-01-07 | Energy transfer systems |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US5278043A (en) |
| EP (1) | EP0439036A3 (en) |
| JP (1) | JPH05211872A (en) |
| AU (1) | AU640982B2 (en) |
| CA (1) | CA2033692A1 (en) |
| NZ (1) | NZ236822A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5573906A (en) * | 1992-03-23 | 1996-11-12 | Hoffmann-La Roche Inc. | Detection of nucleic acids using a hairpin forming oligonucleotide primer and an energy transfer detection system |
Families Citing this family (70)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2788786B2 (en) * | 1991-11-15 | 1998-08-20 | イゲン，インコーポレーテッド | Rapid assay of amplification products |
| ZA929351B (en) * | 1991-12-11 | 1993-06-04 | Igen Inc | Electrochemiluminescent label for DNA assays. |
| DE69333991T2 (en) * | 1992-11-27 | 2006-12-14 | Canon K.K. | Method and probe for the detection of nucleic acids |
| JP3247001B2 (en) * | 1992-12-21 | 2002-01-15 | キヤノン株式会社 | Method for detecting double-stranded nucleic acid using pyrylium compound, probe containing pyrylium compound and method for detecting target nucleic acid using the same, novel pyrylium compound |
| US5670315A (en) * | 1993-09-13 | 1997-09-23 | Canon Kabushiki Kaisha | Nucleic acid determination employing pyryilium dye |
| US5824473A (en) | 1993-12-10 | 1998-10-20 | California Institute Of Technology | Nucleic acid mediated electron transfer |
| US5952172A (en) * | 1993-12-10 | 1999-09-14 | California Institute Of Technology | Nucleic acid mediated electron transfer |
| US5591578A (en) * | 1993-12-10 | 1997-01-07 | California Institute Of Technology | Nucleic acid mediated electron transfer |
| US6071699A (en) | 1996-06-07 | 2000-06-06 | California Institute Of Technology | Nucleic acid mediated electron transfer |
| JPH07233065A (en) | 1993-12-27 | 1995-09-05 | Canon Inc | Photochemical therapeutic agent containing pyrylium salt or pyrylium analog salt |
| US5654419A (en) * | 1994-02-01 | 1997-08-05 | The Regents Of The University Of California | Fluorescent labels and their use in separations |
| US5871918A (en) * | 1996-06-20 | 1999-02-16 | The University Of North Carolina At Chapel Hill | Electrochemical detection of nucleic acid hybridization |
| US5525711A (en) * | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| EP0684239B1 (en) * | 1994-05-26 | 2003-12-10 | Canon Kabushiki Kaisha | A method for detecting a target substance in a sample, utilizing pyrylium compound |
| US5620850A (en) * | 1994-09-26 | 1997-04-15 | President And Fellows Of Harvard College | Molecular recognition at surfaces derivatized with self-assembled monolayers |
| GB9423459D0 (en) * | 1994-11-21 | 1995-01-11 | Biochemie Gmbh | Silylation process |
| WO1996025518A1 (en) * | 1995-02-17 | 1996-08-22 | The Society For Techno-Innovation Of Agriculture, Foresty And Fisheries | Probe for use in nucleic acid analysis and detecting method |
| US6387625B1 (en) * | 1995-06-27 | 2002-05-14 | The University Of North Carolina At Chapel Hill | Monolayer and electrode for detecting a label-bearing target and method of use thereof |
| US6180346B1 (en) | 1995-06-27 | 2001-01-30 | The Universtiy Of North Carolina At Chapel Hill | Electropolymerizable film, and method of making and use thereof |
| US6361951B1 (en) * | 1995-06-27 | 2002-03-26 | The University Of North Carolina At Chapel Hill | Electrochemical detection of nucleic acid hybridization |
| US6346387B1 (en) * | 1995-06-27 | 2002-02-12 | Xanthon, Inc. | Detection of binding reactions using labels detected by mediated catalytic electrochemistry |
| US6127127A (en) * | 1995-06-27 | 2000-10-03 | The University Of North Carolina At Chapel Hill | Monolayer and electrode for detecting a label-bearing target and method of use thereof |
| US5968745A (en) * | 1995-06-27 | 1999-10-19 | The University Of North Carolina At Chapel Hill | Polymer-electrodes for detecting nucleic acid hybridization and method of use thereof |
| US6132971A (en) * | 1995-06-27 | 2000-10-17 | The University Of North Carolina At Chapel Hill | Microelectronic device |
| US5716784A (en) * | 1996-02-05 | 1998-02-10 | The Perkin-Elmer Corporation | Fluorescence detection assay for homogeneous PCR hybridization systems |
| US6444423B1 (en) | 1996-06-07 | 2002-09-03 | Molecular Dynamics, Inc. | Nucleosides comprising polydentate ligands |
| DE19627290A1 (en) * | 1996-07-06 | 1998-01-08 | Boehringer Mannheim Gmbh | Determination of analytes using two labels |
| ATE230801T1 (en) | 1996-10-03 | 2003-01-15 | Canon Kk | METHOD FOR DETECTING TARGET NUCLEIC ACID, METHOD FOR QUANTIFYING IT AND PYRYLIUM COMPOUNDS FOR CHEMILUMINESCENCE ANALYSIS |
| US7160678B1 (en) | 1996-11-05 | 2007-01-09 | Clinical Micro Sensors, Inc. | Compositions for the electronic detection of analytes utilizing monolayers |
| US7014992B1 (en) * | 1996-11-05 | 2006-03-21 | Clinical Micro Sensors, Inc. | Conductive oligomers attached to electrodes and nucleoside analogs |
| US7393645B2 (en) * | 1996-11-05 | 2008-07-01 | Clinical Micro Sensors, Inc. | Compositions for the electronic detection of analytes utilizing monolayers |
| US6096273A (en) * | 1996-11-05 | 2000-08-01 | Clinical Micro Sensors | Electrodes linked via conductive oligomers to nucleic acids |
| US7381525B1 (en) | 1997-03-07 | 2008-06-03 | Clinical Micro Sensors, Inc. | AC/DC voltage apparatus for detection of nucleic acids |
| US7045285B1 (en) | 1996-11-05 | 2006-05-16 | Clinical Micro Sensors, Inc. | Electronic transfer moieties attached to peptide nucleic acids |
| US6013459A (en) * | 1997-06-12 | 2000-01-11 | Clinical Micro Sensors, Inc. | Detection of analytes using reorganization energy |
| AU1656299A (en) | 1997-12-16 | 1999-07-05 | University Of Saskatchewan | Conductive metal-containing nucleic acids |
| US6686150B1 (en) | 1998-01-27 | 2004-02-03 | Clinical Micro Sensors, Inc. | Amplification of nucleic acids with electronic detection |
| JP2002500897A (en) | 1998-01-27 | 2002-01-15 | クリニカル・マイクロ・センサーズ・インコーポレイテッド | Amplification of electronic nucleic acid detection |
| US6290839B1 (en) | 1998-06-23 | 2001-09-18 | Clinical Micro Sensors, Inc. | Systems for electrophoretic transport and detection of analytes |
| US7087148B1 (en) | 1998-06-23 | 2006-08-08 | Clinical Micro Sensors, Inc. | Binding acceleration techniques for the detection of analytes |
| US6761816B1 (en) | 1998-06-23 | 2004-07-13 | Clinical Micro Systems, Inc. | Printed circuit boards with monolayers and capture ligands |
| US5998146A (en) * | 1998-07-17 | 1999-12-07 | Wallac Oy | Homogeneous luminescence assay method based on energy transfer |
| US6740518B1 (en) | 1998-09-17 | 2004-05-25 | Clinical Micro Sensors, Inc. | Signal detection techniques for the detection of analytes |
| AU1241000A (en) | 1998-10-27 | 2000-05-15 | Clinical Micro Sensors, Inc. | Detection of target analytes using particles and electrodes |
| US7160869B2 (en) * | 1998-12-16 | 2007-01-09 | University Of Saskatchewan | Biologically active metal-containing nucleic acids |
| US6833267B1 (en) * | 1998-12-30 | 2004-12-21 | Clinical Micro Sensors, Inc. | Tissue collection devices containing biosensors |
| US6942771B1 (en) | 1999-04-21 | 2005-09-13 | Clinical Micro Sensors, Inc. | Microfluidic systems in the electrochemical detection of target analytes |
| US20020177135A1 (en) * | 1999-07-27 | 2002-11-28 | Doung Hau H. | Devices and methods for biochip multiplexing |
| US7312087B2 (en) | 2000-01-11 | 2007-12-25 | Clinical Micro Sensors, Inc. | Devices and methods for biochip multiplexing |
| CA2380258C (en) | 1999-07-26 | 2008-07-15 | Clinical Micro Sensors, Inc. | Sequence determination of nucleic acids using electronic detection |
| GB2359625B (en) * | 1999-12-10 | 2004-10-20 | Molecular Light Tech Res Ltd | Monitoring oligonucleotide binding process using chemiluminescence quenching |
| WO2001046209A1 (en) * | 1999-12-20 | 2001-06-28 | Fluorrx, Inc. | Fluorescent probes |
| JP4382265B2 (en) * | 2000-07-12 | 2009-12-09 | 日本電気株式会社 | Method and apparatus for forming silicon oxide film |
| IL155450A0 (en) * | 2000-10-20 | 2003-11-23 | Expression Diagnostics Inc | Leukocyte expression profiling |
| US20020175317A1 (en) * | 2001-05-24 | 2002-11-28 | Lee Jeremy Stuart | Nucleic acid circuit elements and methods |
| US7235358B2 (en) * | 2001-06-08 | 2007-06-26 | Expression Diagnostics, Inc. | Methods and compositions for diagnosing and monitoring transplant rejection |
| US7026121B1 (en) * | 2001-06-08 | 2006-04-11 | Expression Diagnostics, Inc. | Methods and compositions for diagnosing and monitoring transplant rejection |
| US6905827B2 (en) | 2001-06-08 | 2005-06-14 | Expression Diagnostics, Inc. | Methods and compositions for diagnosing or monitoring auto immune and chronic inflammatory diseases |
| US6664111B2 (en) * | 2001-08-22 | 2003-12-16 | 3M Innovative Properties Company | Fluorescence based oxygen sensor systems |
| DE10153829A1 (en) | 2001-11-05 | 2003-05-28 | Bayer Ag | Assay based on doped nanoparticles |
| US20030175947A1 (en) * | 2001-11-05 | 2003-09-18 | Liu Robin Hui | Enhanced mixing in microfluidic devices |
| WO2004094986A2 (en) * | 2003-04-16 | 2004-11-04 | Handylab, Inc. | System and method for electrochemical detection of biological compounds |
| US7892745B2 (en) * | 2003-04-24 | 2011-02-22 | Xdx, Inc. | Methods and compositions for diagnosing and monitoring transplant rejection |
| WO2006029184A2 (en) * | 2004-09-08 | 2006-03-16 | Expression Diagnostics, Inc. | Genes useful for diagnosing and monitoring inflammation related disorders |
| EP1885889A4 (en) * | 2005-05-11 | 2010-01-20 | Expression Diagnostics Inc | Methods of monitoring functional status of transplants using gene panels |
| CA2648580A1 (en) * | 2006-04-07 | 2008-05-02 | Xdx, Inc. | Steroid responsive nucleic acid expression and prediction of disease activity |
| WO2008021431A2 (en) * | 2006-08-14 | 2008-02-21 | Xdx, Inc. | Methods and compositions for diagnosing and monitoring the status of transplant rejection and immune disorders |
| EP2102367A2 (en) * | 2006-11-09 | 2009-09-23 | XDX, Inc. | Methods for diagnosing and monitoring the status of systemic lupus erythematosus |
| US9193746B2 (en) * | 2006-12-07 | 2015-11-24 | Biotium, Inc. | Luminescent metal complexes and associated technology |
| WO2014157377A1 (en) | 2013-03-26 | 2014-10-02 | 株式会社ニッポンジーン | Primer and probe set used in identifying gene polymorphism, and use thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK365785A (en) * | 1984-09-17 | 1986-03-18 | Hoffmann La Roche | metal complex |
| US4699978A (en) * | 1985-01-18 | 1987-10-13 | The Trustees Of Columbia University In The City Of New York | Site-specific chiral ruthenium (II) and cobalt (III) antitumor agents |
| US4980473A (en) * | 1985-01-18 | 1990-12-25 | The Trustees Of Columbia University In The City Of New York | Chemical probes for left-handed DNA and chiral metal complexes as Z-specific anti-tumor agents |
| CA1273552A (en) * | 1985-12-23 | 1990-09-04 | Michael J. Heller | Fluorescent stokes shift probes for polynucleotide hybridization assays |
| US4868103A (en) * | 1986-02-19 | 1989-09-19 | Enzo Biochem, Inc. | Analyte detection by means of energy transfer |
-
1991
- 1991-01-07 CA CA002033692A patent/CA2033692A1/en not_active Abandoned
- 1991-01-12 EP EP19910100343 patent/EP0439036A3/en not_active Withdrawn
- 1991-01-18 NZ NZ236822A patent/NZ236822A/en unknown
- 1991-01-21 AU AU69855/91A patent/AU640982B2/en not_active Ceased
- 1991-01-22 US US07/643,313 patent/US5278043A/en not_active Expired - Fee Related
- 1991-01-25 JP JP917777A patent/JPH05211872A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5573906A (en) * | 1992-03-23 | 1996-11-12 | Hoffmann-La Roche Inc. | Detection of nucleic acids using a hairpin forming oligonucleotide primer and an energy transfer detection system |
Also Published As
| Publication number | Publication date |
|---|---|
| JPH05211872A (en) | 1993-08-24 |
| US5278043A (en) | 1994-01-11 |
| EP0439036A3 (en) | 1992-06-10 |
| EP0439036A2 (en) | 1991-07-31 |
| AU6985591A (en) | 1991-08-01 |
| NZ236822A (en) | 1994-01-26 |
| AU640982B2 (en) | 1993-09-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5278043A (en) | Ruthenium-lumazine energy transfer systems | |
| Agrawal et al. | Efficient methods for attaching non-radioactive labels to the 5′ ends of synthetic oligodeoxyribonucleotides | |
| KR101032008B1 (en) | Polynucleotide labelling reagent | |
| CA2145405C (en) | Nucleotides labelled with an infrared dye and their use in nucleic acid detection | |
| Haralambidis et al. | Preparation of base-modified nucleosides suitable for non-radioactive label attachment and their incorporation into synthetic oligodeoxyribonucleotides | |
| CA1338379C (en) | Derivatives of pyrazolo[3,4-d] pyrimidine | |
| EP0543913B1 (en) | Oligo(alpha-arabinofuranosyl nucleotides) and alpha-arabinofuranosyl precursors thereof | |
| JP2655569B2 (en) | Liquid phase nucleic acid sandwich assays | |
| Smith et al. | The synthesis of oligonucleotides containing an aliphatic amino group at the 5′ terminus: synthesis of fluorescent DNA primers for use in DNA sequence analysis | |
| US5824796A (en) | Cross-linking oligonucleotides | |
| AU757983B2 (en) | Pentopyranosyl nucleoside, and production and use of the same | |
| EP0101985A1 (en) | Oligonucleotide derivatives and production thereof | |
| US5410068A (en) | Succinimidyl trityl compounds and a process for preparing same | |
| JP2835630B2 (en) | Nucleoside derivatives that can be used in the synthesis of targeted oligonucleotides, oligonucleotides derived from these derivatives, and their synthesis | |
| USRE38416E1 (en) | Cross-linking oligonucleotides | |
| AU2006316903B8 (en) | Polynucleotide labelling reagent | |
| Bamwarth et al. | Energy Transfer from a Lumazine (= Pteridine‐2, 4 (1H, 3H)‐dione) Chromophore to Bathophcnanthroline‐ruthenium (II) Complexes during Hybridization Processes of DNA | |
| US6664058B2 (en) | Base analogues | |
| AU758101B2 (en) | Linker nucleoside, and production and use of the same | |
| JPS59148798A (en) | Biotin nucleotide derivative and its preparation | |
| EP0310312A2 (en) | Non-nucleotide reagents for substituting termini of oligonucleotides | |
| Schubert et al. | Fluorescent labelling of sequencing primers for automated oligonucleotide synthesis | |
| Wahl | Synthesis and purification of oligodeoxyribonucleotides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued |