CA2071446C - Synthetic catalytic oligonucleotide structures - Google Patents

Synthetic catalytic oligonucleotide structures

Info

Publication number
CA2071446C
CA2071446C CA002071446A CA2071446A CA2071446C CA 2071446 C CA2071446 C CA 2071446C CA 002071446 A CA002071446 A CA 002071446A CA 2071446 A CA2071446 A CA 2071446A CA 2071446 C CA2071446 C CA 2071446C
Authority
CA
Canada
Prior art keywords
formula
oligonucleotide structure
nucleotides
residues
nucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA002071446A
Other languages
French (fr)
Other versions
CA2071446A1 (en
Inventor
Brian Sproat
Angus Lamond
Giovanni Paolella
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Europaisches Laboratorium fuer Molekularbiologie EMBL
Original Assignee
Europaisches Laboratorium fuer Molekularbiologie EMBL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Europaisches Laboratorium fuer Molekularbiologie EMBL filed Critical Europaisches Laboratorium fuer Molekularbiologie EMBL
Publication of CA2071446A1 publication Critical patent/CA2071446A1/en
Application granted granted Critical
Publication of CA2071446C publication Critical patent/CA2071446C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/121—Hammerhead
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base

Abstract

A b s t r a c t A synthetic catalytic oligonucleotide structure and nucleotides having the general structural formula (I) contains:

Description

The present invention concerns synthetic catalytic oligonucleotide structures which are suitable for cleaving a nucleic acid target sequence and contain modified nucleotides. In addition the invention concerns a process for cleaving a nucleic acid target sequence, using synthetic catalytic modified oligonucleotide structures.
After the discovery of RNA-mediated catalysis various attempts were made to inactivate specific RNA molecules in vitro and in vivo. The discovery that hammerhead ribozymes can be used for the development of a multi-purpose enzyme which is at least in vitro capable of recognizing and cleaving a given specific RNA (Haseloff and Gerlach; Nature (1988), 334, pp. 585-591, has proven to be of particular interest. Many interesting possibilities of using such ribozymes are based on their capability to efficiently recognize and cleave a specific RNA within a given mixture. The possibilities of using RNA enzymes range from the development of RNA restriction enzymes to the specific inactivation of genes in the cell. A particular interest in the biomedical field arises from the fact that many diseases, including many types of tumours, correlate with the expression of specific genes. The inactivation of such genes by cleaving the respective mRNA would be a possible way of controlling and finally or healing such diseases.

- la -Furthermore there is a great need for the development of antivirally active pharmaceutical agents whereby RNA
enzymes could possibly be such an agent since the viral expression can be selectively blocked by cleaving the viral RNA molecules.
Previous attempts to express ribozymes in the cell by transfecting the cell with the corresponding gene have proven to be not very effective since a very high expression is necessary to inactivate the specific RNA.
The direct administration of RNA molecules is probably also impossible because of the sensitivity of RNA to degradation by RNAases and their interactions with proteins.
Therefore there was a great need to develop RNA enzymes which overcome at least some of the disadvantages of the state of the art.
The object which is the basis of the invention is achieved by using a new type of nucleic acid instead of a RNA molecule which is based on artificial nucleotides with a 2'-alkoxy substituent. Such malecules are considerably more stable than native RNA molecules since they are cleaved neither by RNAases nor by DNAases and also interact less with RNA-or DNA-binding proteins (Iribarren et al., Proc. Nat. Aced. Sci. USA 87 (1990), 7747-7751). Such molecules promise to be more effective in the cellular environment than corresponding native RNA molecules. However, these modified nucleic acids are not normally effective as catalyzers, nevertheless it surprisingly turned out that their activity can be preserved when a very small number of hydroxyl residues are incorporated at specific positions on the molecule.
In this process their characteristic properties, in particular stability and reduced interaction with proteins, are also surprisingly preserved.
The present invention therefore concerns a synthetic catalytic oligonucleotide structure which is suitable for cleaving a nucleic acid target sequence and contains nucleotides having the general structural formula (I):
.- ._ ~ ~~ B
OR (I) X
P
w in which B represents a nucleoside base which is in particular selected from the group comprising adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil-1-yl (U), uracil-5-yl (4~), hypoxanthin-9-yl (I), thymin-1-yl (T) and 2-aminoadenin-9-yl, V in each nucleotide is independently an O or a CH2 group, X and W can in each nucleotide be the same or different and are independently of each other O, S, NH2, alkyl or alkoxy groups with 1 to 10, preferably with 1 to 4 carbon atoms, R is hydrogen or a straight-chained or branched alkyl, alkenyl or alkinyl group with 1 to 10 carbon atoms which is substituted, if desired, with halogen, cyano, isocyano, nitro, amino, carboxyl, hydroxyl or/and mercapto groups, which is characterized in that in at least one of the nucleotides the residue R in formula (I) is different from hydrogen.
B can represent any purine or pyrimidine nucleoside base. Examples of suitable purine nucleoside bases are for example adenin-9-yl, guanin-9-yl, hypoxanthin-9-yl and 2-aminoadenin-9-yl. Examples of pyrimidine nucleoside bases are for instance cytosin-1-yl, uracil-1-yl, uracil-5-yl and thymin-1-yl.
In each nucleotide V is independently an O or a CH2 group, preferably an 0 group. X and W can be the same or different in one nucleotide and independently of each other denote O, S, NH2 alkyl or alkoxy groups with 1 to 10, preferably with 1 to 4 carbon atoms. It is particularly preferred that X and W are each O groups (whereby in this case one 0 atom would be bound via a double bond to a phosphorus and the other would be bound via a single bond and would have a negative charge).
R is hydrogen or a straight-chained or branched alkyl, alkenyl or alkinyl group with 1 to 10 carbon atoms which is substituted, if desired, with halogen (fluorine, chlorine, bromine, iodine), cyano, isocyano, vitro, amino, carboxyl, hydroxyl or/and mercapto groups. The residues R that are different from hydrogen preferably contain 1 to 6 carbon atoms. Examples of preferred residues R are methyl, ethyl, propyl, allyl, dimethylallyl, butyl or cyanomethyl residues. R is particularly preferably an alkenyl residue with 1 to 4 carbon atoms, e.g. an allyl residue.
A catalytic oligonucleotide structure according to the present invention is characterized in that the residue R
in formula (I) is different from hydrogen in at least one of the nucleotides. In this connection it is preferred that the oligonucleotide structure contains as few nucleotides as possible in which R denotes hydrogen.

Such oligonucleotides are very resistant to nucleases and exhibit less interactions with nucleic acid binding proteins. On the other hand the residue R should not be different from hydrogen in all nucleotides since otherwise the oligonucleotide will no longer be catalytically active. In particular individual nucleotides are present within the catalytically active centre of the oligonucleotide according to the present invention in which the residue R represents a hydrogen atom.
The catalytically active centre of the oligonucleotide structure according to the present invention preferably has a hammerhead or a hairpin structure.
Catalytic hairpin structures are for example described in the publications of Tritz and Hampel (Biochemistry 28 (1989), 4929) and Hampel et al., Nucleic Acids Res. 18 (1990), 299-309:. Such a hairpin structure contains 4 helices, two of which are formed between the substrate and the catalytic RNA. The following gives an example of a catalytic centre in the form of a RNA hairpin structure which is derived from the tobacco~ringspot virus:
cleavage site substrate RNA
3' U AUA AC A 5' GUC
, A

~
~

U
_ UU CUGGU CUGUUU-3' GUG GU UGAC

*** ** ** ***** ******
*

~CAC ~ GACCA-ACUG GACAAA_5' j A

G \ / \
\
\ /

A A A AGA
A

catalytic RNA

:~:~~ 1 ~ ~' The active centre of a catalytic RNA can also have a so-called hammerhead structure (Hotchins et al., Nucleic Acids Res. 14 (1986), 3627; Kiese and Symons in: Viroids and viroid-like pathogens, J.S. Semancik, publisher (CRC
Press, Bocaraton, Florida (1987), p. 1-47)). The catalytic centre of the hammerhead structure contains 3 stems and can be formed from adjacent sequence regions of the RNA or can even be formed from regions which are separated from one another by many nucleotides.
The present invention therefore concerns a hammerhead oligonucleotide structure having the general structural formula (II) 3I(N)xNoNt Ntc (N)y5~
NZ Nt 3 N3 Nt2 (II) N~ ~ Nt t NS * N6 Na Nt o \N/

N. N..
5' 3' in which N in each case represents a nucleotide according to the general structural formula (I), x and y can be the same or different and x > 1 and y >
2, N5 and N6 are in each case nucleotides which are complementary to one another and * represents a base pairing, N' and N " either represent two nucleotide sequences which contain nucleotides which are at least partially complementary to one another so as to enable a stable base pairing between the two nucleotide sequences or N' and N " together represent a single nucleotide sequence whereby at least part of the sequence can form a double-stranded stem by base pairing between complementary nucleotides, and in which, if desired, one or several additional nucleotides N can be inserted after N~ and/or N9;
which is characterized in that the residue R in formula (I) is different from hydrogen in at least one of the nucleotides N2, N3, N5, N6, N~, Ng, N10, N12~ N13 and N14 in formula (II).
The region N1 to N1~ contains the catalytic centre of the oligonucleotide structure (II). The nucleotides denoted (N)x and (N)y are located outside the active centre and contain regions which are responsible for hybridization to a specific nucleic acid target sequence. The length of these regions is such that x must be > 1 and y must be > 2. x and y are preferably < 20, larger values for x or/and y do not have any particular advantages but make the synthesis of the oligonucleotide more difficult. The oligonucleotide structure II can either be a continuous molecule or can be composed of two different molecules i.e. N' and N "
either together represent a single nucleotide sequence or represent two different nucleotide sequences. It is important for the structure according to the present invention th«t the nucleotide sequences N° and N "
contain regions which are at least partially complementary to one another that enable a stable base pairing between both nucleotide sequences. In this connection the term stable base pairing is understood to mean that the oligonucleotide structure is present as a double-stranded strand under physiological conditions at -room temperature and preferably at temperatures up to 40°C.
A feature of the oligonucleotide structure according to the present invention is that the residue R in formula (I) is different from hydrogen in at least one and preferably in several of the nucleotides N2, N3, N5, N&, N~, N9, N10, N12~ N13 and N14. In contrast the residues R in formula (I) in the nucleotides N1, N4, N8 and N11 are preferably hydrogen. In addition it is preferred that the nucleoside base at N1 is adenin-1-yl or 2-aminoadenin-9-yl and is guanin-1-yl (or hypoxanthin-9-yl) in each of the nucleotides N4, N$ and N11.
A particularly preferred subject matter of the present invention is an oligonucleotide structure having the general structural formula (III):
3~(N)xNoNt Nt4 (N)y5' Nz Nt3 N3 Nt z Nc / N~ w Nt t NS * N6 N8 Nt o ( I I I ) N * N ~ /
i i N9 N * N
(N)m * (N)n N N
\ M ~
in which N, x and y are defined as in claim 3, M represents a chemical bond or denotes a nucleotide sequence (N)a in which a > 1, m and n are the same or different and in which, if desired, one or several ~v.~ ~~;

additional nucleotides can be inserted after N~
or/and N9.
The residues R in formula (III) are preferably hydrogen in the nucleotides N1, N4, N8, N1~, N11 and N12. The residues R in formula (III) are preferably different from hydrogen in all nucleotides apart from N1, N4, N8, N10, N11 and N12.
A preferred concrete example of an oligonucleotide according to the present invention with a hammerhead structure as the catalytic centre has a structure according to formula (II) or (III) and is characterized in that the residues V, W and X in formula (I) are O
groups and the residues B and R in formula (I) or (III) have the following meanings for the nucleotides N1 to N14' N1: B = A and R = H, N2: B = A and R = allyl, N3: B = A and R = allyl, N4: B = G and R = H, N5: B = C and R = allyl, N6: B = G and R = allyl, N~: B = A and R = allyl, N8: B = G and R = H, N9: B = U and R = allyl, Nlp: B = A and R = H, N11: B = G and R = H, N12: B = U and R = H, N13: B = C and R = allyl, N14: B = U and R = allyl.
A further preferred concrete example of an oligonucleotide with a hammerhead structure as the catalytic centre is characterized in that the residues 1 ~ ~d.
V, W and X in formula (I) are O groups except that the linkage between N11 and N12 is a phosphorothioate group (X = O and W = S) and that the residues B and R in formula (I) or (III) have the above-mentioned meanings for the nucleotides N1 to N14.
A further example of an oligonucleotide is characterized in that the residues V, W and X in formula (I) are O
groups and that the residues B in formula (I) or (III) have the above-mentioned meanings for the nucleotides N1 to N14 and that R = H for N1, N4, Ng, N1~, N11 and N12, R = 3,3-dimethylallyl for N9 and R = allyl for Nl, N3, N5, N6, N~, N13 and N14. A further oligonucleotide differs from the latter structure only in that R = 3,3-dimethylallyl for N3 and R = allyl for N9.
In yet another structure R = H for N1, N4, N8, Nlp, N11 and N12, R = cyanomethyl for N2, N3, N~, N9 and N13 and R = a11y1 for N5, N6 and N1~ whereby the residues B have the above-mentioned concrete meanings.
In addition it may also be preferred that in the oligonucleotide structures according to the present invention one or several of the residues R are butyl in order to improve the uptake of the catalytic structures by the cell. A concrete example of this is an oligonucleotide in which R = H for N1, N4, N8, N1~, N11 and N12, R = butyl for N5 and N6 and R = allyl for N2, N3, N?, N9, N13 and N14 whereby, if desired, R may also be butyl in one, several or all of the residues N that are present in formula (III) in a base-paired form (labelled by an *).

- lz -In order to additionally stabilize the oligonucleotide structures according to the present invention 3'-deoxyribonucleotides or/and 3'-O-alkylribonucleotides can be located at their free 3'-end or at their free 3'-ends. In this manner the oligonucleotide according to the present invention is protected from 3'-exonuclease degradation.
In addition the oJ.igonucleotides according to the present invention can also contain nucleotides to stabilize their spatial configuration whose nucleoside bases are modified by a cross-linking agent. An example of such a cross-linking agent is psoralen or a psoralen derivative. In this way double-stranded oligonucleotide structures can be modified by covalent cross-linking.
The production of nucleotides which are modified by a cross-linking agent is disclosed in detail in DE-A 39 28 900.
Furthermore the oligonucleotide structure according to the present invention can be linked to a prosthetic group in order to improve its uptake into the cell or/and the specific cellular localization of the oligonucleotide structure. Examples of such prosthetic groups are polyamino acids (e. g. polylysine), lipids, hormones or peptides. The linking of these prosthetic groups is usually carried out via the free 5'-ends or 3'-ends of the oligonucleotide structure according to the present invention whereby this linking is either direct or via a linker. Examples of linkers are far instance di-esters with amino or phosphate groups or with mercaptoalkoxy groups present at the terminal 5'-phosphate.

Z2 - ~~~x The synthesis of the oligonucleotide structures according to the present invention is carried out in a known manner from monomer units. Such monomer units usually have the general formula (V) D_ V ~~
(V) -- G
in which V, B and R are defined as in formula (I) and D
and E denote reactive groups capable of forming 3'- to 5'-internucleotide bonds. Such groups are known to one skilled in the art and are described for example in B.
Sproat et al., Nucleic Acids Res. 18 (1990), 41-49 as well as in summary form in E.L. Winnacker, "Gene and Klone", VCH-Verlagsgesellschaft mbH, Weinheim (Germany) (1985), in particular pages 44-49 and in Froehler and Matteucci, Tetrahedron Let. (1986), p. 469-472. Using the reactive mononucleotides having formula (V) it is possible to produce the oligonucleotide structures according to the present invention in a known manner especially on a solid phase.
The present invention additionally concerns a process for cleaving a nucleic acid target sequence using a synthetic catalytic oligonucleotide structure according to the present invention. This nucleic acid target sequence can in this case either be a part of the synthetic catalytic oligonucleotide structure itself or this nucleic acid target sequence can be a molecule which is different from the synthetic catalytic oligonucleotide structure.

If an oligonucleotide according to the present invention with a hammerhead structure having the general formula (II) is used to cleave a nucleic acid target sequence then usually an intermediate stage forms having the following structures S' (h)~Y-U-Z (K)b 3, (IV) ' (N)xNoN~ P7ic (N)y N~3 N3 \ Nt z / N~~ \N1 t NS * Zee Na Nt o y N9 (II) N. N"
5' 3' in which the symbols N, N', N " , ~, y and * are defined as in claim 3, and K, Y, U and Z represent nucleotides of the nucleic acid target sequence in which U is uridine, Z is a non-modified ribonucleotide selected from the group comprising adenosine, cytidine or uridine, K and Y are any nucleotides, a > 1 and b > 3 , and the cleavage of the nucleic acid target sequence takes place on the 3'-side of the nucleotide sequence YUZ and whereby, if desired, there is a chemical bond between the 5'-end of the nucleic acid target sequence (IV) and the 3'-end of the oligonucleotide (II) at (N)X
or between the 3'-end of the nucleic acid target sequence (IV) and the 5'-end of the oligonucleotide (II) at (N) y.

The nucleotide Y in the nucleic acid target sequence preferably represents a guanosine residue and Z
preferably denotes adenosine or cytidine. The nucleic acid target sequence can be any oligo- or polynucleotide provided that Z is a non-modified ribonucleotide. The remainder of the target sequence can for example be DNA, 2'-O-alkyl-RNA or a mixed structure. The nucleic acid target sequence is, however, preferably a RNA. The cleavage specificity of the oligonucleotide according to the present invention for a certain nucleic acid target sequence can be achieved by changing the sequence of the hybridization arms of the catalytic components (N~(N)X
or (N)YN14) in such a way that they are complementary to the sequences which flank the cleavage site of the desired target sequence.
The process according to the present invention can be carried out within a living cell as well as in vitro.
The cleavage is preferably carried out in the presence of a divalent cation, especially Mg2+ and at a pH value of about 7 to 9, particularly preferably of about 8.
The present invention in addition concerns the use of an oligonucleotide structure according to the present invention for the catalytic cleavage of a nucleic acid target sequence whereby the nucleic acid target sequence is either a part of the catalytic oligonucleotide structure or represents a molecule which is different from it.
In addition the invention concerns a pharmaceutial agent which contains an oligonucleotide structure according to the present invention as the active substance, if desired, together with the usual pharmaceutical carrier agents, auxiliary agents, filling agents or/and dilution 2~~.

agents. The invention also concerns a process for the production of a pharmaceutical agent for antiviral therapy in humans, animals and plants whereby an oligonucleotide structure according to the present invention is used as the active substance. An example of such an antiviral therapy would be the fight against AIDS with the oligonucleotides according to the present invention (see e.g. Sarver et al., Science 247 (1990), 1222-1225).
The present invention additionally concerns a diagnostic reagent which contains an oligonucleotide structure according to the present invention as a constituent as well as a process for the production of such a diagnostic reagent. This diagnostic reagent according to the present invention can for example be used for a genetic screening procedure.
It is intended to further elucidate the invention by the following examples and the sequence protocols SEQ ID N0.1 and SEQ ID N0.2.
SEQ ID N0.1: shows the nucleotide sequence of a substrate RNA and SEQ ID N0.2: shows the nucleotide sequence of a catalytically active ribozyme RNA
Example 1 Oligonucleotide synthesis, deblocking and purification The synthesis of 2'-O-methylribonucleoside-3°-0-phosphoramidite building blocks was carried out according to Sproat et al. (Nucleic Acids Res. 18 (1990), 41-49). 2'-O-allylribonucleoside-3°-0-phosphoramidite building blocks wee synthesized according to Sproat et al. (Nucleic Acids Res. 19 (1991), 733-738).
2'O-[1-(2-fluorophenyl)-4-methoxypiperidin-4-yl]ribo-nucleoside-3'-0-phosphoramidite building blocks were synthesized according to Beijer et al. (Nucleic Acids Res. 18 (1990) , 5143-5151) .
The oligonucleotides were assembled according to the (3-cyanoethylphosphoramadite process on controlled pore glass using a modified DNA synthesis cycle on an Applied Biosystems synthesizing apparatus. Instead of tetrazole, 5-(4-nitrophenyl)-1H-tetrazole was used as the activator for the condensation step whereby the reaction period for the condensation was increased to 12 minutes (cf. Nucleic Acids Res. 18 (1990) , 41-49 and 5141-5151) .

- 16a -The deblocking and purification was carried out by firstly treating a carrier, to which a completely blocked oligonucleotide was bound with a solution of 25% aqueous ammonia in a sealed sterile vessel for 10 hours at 60°C.
The cooled solution was then evaporated to dryness in a vacuum in a sterile vessel. The oligonucleotide crude product which still contains a 5'-terminal 5'-O-dimethoxytrityl protecting group and several 2'-O-Fpmp-protecting groups was then purified by reverse phase HPLC
on a ~-Bondapak (Trade-mark) C18 column using an acetonitrile gradient in aqueous 0.1 mol/1 triethyl-ammonium acetate pH 7.0 as an eluting agent. The product peak was collected and the solvent was removed in a vacuum. The residue was resuspended in 1 ml 10% glycerol in water and the solution was centrifuged for 10 minutes.
The supernatant was applied to a G15 Sephadex (Trade-mark) column (30 ml) which was eluted with sterile _ 17 _ distilled water. The void volume of the column (about 9 ml) was discarded and a 3 ml fraction was collected which contained the partially blocked oligonucleotide.
Then sterile aqueous hydrochloric acid (270 ~.1, 0.1 mol/1) was added by which means the pH was kept in a range from 2 to 2.5. The solution was kept at 20 to 25°C
for 20 hours in order to remove the acid-labile DMTr and Fpmp protecting groups. The solution was subsequently centrifuged for 10 minutes at 2000 rpm. The supernatant was neutralized by addition of 2 mol/1 Tris-acetate (75 ~,1, pH 7.9). The pure completely deblocked oligonucleotide was isolated from the aqueous solution using repeated extractions with 1-butanol as described by Cathala and Brunel (Nucleic Acids Res. 18 (1990), 201). The oligonucleotide pellet was dried and dissolved in 100 ~.1 Tris buffer (10 mmol/1, pH 7.5, 1 mmol/1 EDTA).
Exam~rle 2 Production and labelling of substrate RNA
Chemically synthesized substrate oligonucleotides were labelled either with ~-32P-ATP and kinase or with RNA
ligase and 32P-pCp according to the standard procedures proposed by the manufacturers for the respective enzymes.
As an alternative to this, RNA was also synthesized by transcription with SP6-RNA polymerase after linearizing the respective templates with suitable restriction enzymes. The RNA molecules were labelled by incorporating a-3~P-UTP in the transcript. The conditions for the transcription were as follows:
40 mmol/1 Tris, pH 7.5 6 mmol/1 MgCl2 2 mmol/1 spermidine mmol/1 dithiothreitol 500 mmol/1 nucleoside triphosphates (A, C, G) 100 ~,mol/1 UTP
10 ~.Ci a-32P-UTP
10 U/~.l SP6-polymerase U/~.1 RNAse inhibitor (human placenta) After a two hour incubation at 37°C the DNA used as a template was digested with RNAse-free DNAse. RNA was separated by gel electrophoresis on 6 % polyacrylamide gels (acrylamide:bis-acrylamide 1:30) in the presence of 7 mol/1 urea. RNA bands were eluted by diffusion and RNA
was isolated by ethanol precipitation. The determination of activity was carried out in a 10 ~.1 reaction mixture which contained substrate RNA (10 nM to 1 ~,M), 50 mM
Tris pH 7.5, 20 mM MgCl2, 0.01 to 10 pMol ribozyme. This mixture was incubated for 60 minutes at 50°C. The cleavage products were separated on a 7 % polyacrylamide gel in the presence of 7 M urea.
Example 3 Determination of the activity of different modified catalytic oligonucleotides A 17 nucleotide long chemically synthesized oligoribonucleotide based on the EDB exon of human fibronectin mRNA was used as the target sequence. The sequence (SEQ ID NO.1) was as follows:
5'- r[UACACAGUCACAGGGCU]
The ribozyme used to cleave this sequence had the nucleotide sequence (SEQ ID No.2) shown in the following:
5'- r[GCCCUGUCUGAUGAGUCCGUGAGGACGAAACUGUGU]
This sequence is denoted E0. The underlined regions mark the nucleotides N14 to N6 or N5 to NO according to formula (III). In addition the following analogues of EO
(with an identical base composition) were synthesized:
E1: R = H for Nl, N4, N8, N10, N11 and N12; R = allyl for all the other N's.
E2: R = H for Nl, N4, N8, N10 and N11; R = allyl for all the other N's.
E3: R = H for Nl, N4, N8, N10, N11 and N12; the connection between N11 and N12 is a phosphorothioate group (i.e. X
- O and W = S according to formula (I)); R = allyl for all the other N's.
E4: R = H for Nl, N4, N8, N10, N11 and N12; R = 3,3-dimethylallyl for N9 and R = allyl for all the other N's.

E5: R = H for N1, N4, N8, N10, N11 and N12; R = 3,3-dimethylallyl for N3 and R = al.lyl for all the other N's.
E6: R = H for N1, N4, N8, N10, N11 and N12; R = butyl for N5 and N6 as well as for all the other 6 N's (UCC
and GGA), that form a base-paired region. R = allyl for all the other N's.
E7: R = H for N1, N4, N8, N10, N11 and N12; R =
cyanomethyl for N2, N3, N~, N~ and N13; R = allyl for all the remaining N's.
The test to determine the cleavage activity was carried out in a reaction volume of 10 ~C1 which contained the substrate RNA (10 nmol/1 to 1 ,umol/1), 50 mmol/1 Tris pH 7.5, 20 mmol/1 MgCl2 and 0.01 to 10 pmol ribozyme.
The reaction mixture was incubated for ~0 minutes at 50°C. The cleavage products were separated by polyacrylamide gel electrophoresis in the presence of 7 mol/1 urea.
The reaction kinetics were determined by measuring the amount of 32P-radioactively labelled substrate for a cleavage duration of 1.5, 10 and 15 minutes at 50°C. The substrate concentrations were as follows: 25, 50, 100, 250 nmol/l; the ribozyme concentration was between 4 nmol/1 and 20 nmol/1. The samples were preheated and the reaction was started by addition of ribozyme. After the predetermined reaction period the reaction was stopped by addition of 2 volumes 20 mmol/1 EDTA. The products were separated by polyacrylamide-urea gel electrophoresis and quantitatively analyzed with a Molecular Dynamics phosphorus imager.

~-~v.4y~

In the following Table 1 the relative activity and RNase sensitivity of the above-listed catalytic oligonucl2otides E0, E1, E2, E3, E4, E5, E6 and E7 are stated.
Table 1 Catalytic structure Relative activity RNase A
sensitivity E1 0.2 0.01 E2 < 0.05 stable E3 0.1 0.001 E4 ca. 0.2 0.01 E5 ca. 0.2 0.01 E6 ca. 0.2 0.01 E7 ca. 0.2 0.01 SEQ ID NO.1:
Nucleic acid (RNA):
single-stranded linear length: 17 U.ACACAGUCA CAGGGCU 17 SEQ ID N0.2:
Nucleic acid (RNA):
single-stranded linear length: 36

Claims (43)

1. A synthetic oligonucleotide structure which contains nucleotides having the general structural formula (I) in which:
B represents a nucleoside base which is selected from the group consisting of adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G) , uracil-1-yl (U) , uracil-5-yl (yr) , hypoxanthin-9-yl (I), thymin-1-yl (T) and 2-aminoadenin-9-Yl;

V in each nucleotide is independently an O or a CH2 group;
X and W in each nucleotide are the same or different and are independently selected from O, S, NH2, alkyl of 1 to 10 carbon atoms or alkoxy of 1 to 10 carbon atoms, R is hydrogen or a straight-chained or branched alkyl, alkenyl or alkinyl group with 1 to 10 carbon atoms, unsubstituted or substituted with at least one of halogen, cyano, isocyano, nitro, amino, carboxyl, hydroxyl and mercapto, wherein in at least one of the nucleotides the residue R in formula (I) is a said unsubstituted or substituted alkyl, alkenyl or alkinyl, for use in catalytic cleaving of a nucleic acid target sequence.
2. An oligonucleotide structure as claimed in claim 1, having a catalytically active centre with a hammerhead or hairpin structure.
3. An oligonucleotide structure as claimed in claim 1 or 2, wherein X and W in each nucleotide are independently selected from O, S, NH2, alkyl of 1 to 4 carbon atoms and alkoxy of 1 to 4 carbon atoms.
4. An oligonucleotide structure with a catalytically active centre containing nucleotides having the general structural formula (I) in which:

B represents a nucleoside base which is selected from the group consisting of adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil-1-yl (U) , uracil-5-yl (~), hypoxanthin-9-yl (I), thymin-1-yl (T) and 2-aminoadenin-9-yl;

V in each nucleotide is independently an O or a CH2 group;
X and W in each nucleotide are the same or different and are independently selected from O, S, NH2, alkyl of 1 to 10 carbon atoms or alkoxy of 1 to 10 carbon atoms;
R is hydrogen or a straight-chained or branched alkyl, alkenyl or alkinyl group with 1 to 10 carbon atoms, unsubstituted or substituted with at least one of halogen, cyano, isocyano, nitro, amino, carboxyl, hydroxyl and mercapto, wherein in at least one of the nucleotides the residue R in formula (I) is a said unsubstituted or substituted alkyl, alkenyl or alkinyl, and having the general structural formula (II):
in which N in each case represents a nucleotide according to the general structural formula (I), x and y can be the same or different and x ~ 1 and y ~ 2, N5 and N6 are in each case nucleotides which are complementary to one another and * represents a base pairing, and N' and N" represent two nucleotide sequences which contain nucleotides which are at least partially complementary to one another so as to enable a stable base pairing between the two nucleotide sequences or N, and N" together represent a single nucleotide sequence whereby at least part of the sequence can form a double-stranded stem by base pairing between complementary nucleotides, one or several additional nucleotides N being non-inserted or inserted after at least one of N7 and N9;
wherein in at least one of the nucleotides N2, N3, N5, N6, N7, N9, N10, N12, N13 and N14 in formula (II) , the residue R in formula (I) is a said unsubstituted or substituted alkyl, alkenyl or alkinyl.
5. An oligonucleotide structure as claimed in claim 4, wherein the residues R in formula (I) are hydrogen in the nucleotides N1, N4, N8 and N11.
6. An oligonucleotide structure as claimed in claim 4 or 5, wherein the residues B in formula (I) are in each case A or 2-aminoadenin-9-yl, G, G or G in the nucleotides N1, N4, N8 and N11.
7. An oligonucleotide structure as claimed in claim 4, 5 or 6, wherein the residues V, W and X in formula (I) are O groups.
8. An oligonucleotide structure as claimed in claim 4, 5, 6 or 7, wherein the residues R in formula (I) which are alkyl, alkenyl or alkinyl contain 1 to 6 carbon atoms.
9. An oligonucleotide structure as claimed in claim 8, wherein the residues R in formula (I) which are alkyl, alkenyl or alkinyl are selected from the group consisting of methyl, ethyl, propyl, allyl, dimethylallyl, butyl or cyanomethyl residues.
10. An oligonucleotide structure as claimed in claim 4, having the general structural formula (III):
in which N, x and y are defined as in claim 4, M
represents a chemical bond or denotes a nucleotide sequence (N)a, whereby a ~ 1, m and n are the same or different and, one or several additional nucleotides are non-inserted or inserted after at least one of N7, and N9.
11. An oligonucleotide structure as claimed in claim 10, wherein the residues R in formula (I) are hydrogen in the nucleotides N1, N4, N8, N10, N11 and N12.
12. An oligonucleotide structure as claimed in claim 10 or 11, wherein the residues R in formula (I) are independently selected from said alkyl, alkenyl or alkinyl in all nucleotides other than N1, N4, N8, N10, N11 and N12.
13. An oligonucleotide structure as claimed in claim 10, 11 or 12, wherein the residues V, W and X in formula (I) are O groups and the residues B and R in formula (I) or (III) have the following meanings for the nucleotides N1 to N14:
N1: B = A and R = H , N2: B = A and R = allyl, N3: B = A and R = allyl, N4: B = G and R = H, N5: B = C and R = allyl, N6: B = G and R = allyl, N7: B = A and R - allyl, N8: B = G and R = H , N9: B = U and R = allyl, N10: B = A and R = H, N11: B = G and R = H, N12: B = U and R = H, N13: B = C and R = allyl, N14: B = U and R = allyl.
14. An oligonucleotide structure as claimed in claim 4, 5, 6, 10, 11 or 12, wherein the residues V, W
and X in formula (I) are O groups with the exception that the linkage between N11 and N12 is a phosphorothioate group such that X = O and W = S, and the residues B and R in formula (I) or (III) have the meanings set forth in claim 13, for the nucleotides N1 to N14.
15. An oligonucleotide structure as claimed in claim 4, 5, 6, 8, 9, 10, 11 or 12, wherein the residues V, W and X in formula (I) are O groups and the residues B
in formula (I) or (III) have the meanings set forth in claim 13, for the nucleotides N1 to N14 and R = H for N1, N4, N8, N10, N11 and N12, R = 3, 3-dimethylallyl for N9 and R = allyl for N2, N3, N5, N6, N7, N13 and N14.
16. An oligonucleotide structure as claimed in claim 4, 5, 6, 8, 9, 10, 11 or 12, wherein the residues V, W and X in formula (I) are O groups and the residues B
in formula (I) or (III) have the meanings set forth in claim 13, for the nucleotides N1 to N14 and R = H for N1, N4, N8, N10, N11 and N12, R = 33,3-dimethylallyl forN3 and R = allyl for N2, N5, N6, N7, N9, N13 and N14.
17. An oligonucleotide structure as claimed in claim 4, 5, 6, 8, 9, 10, 11 or 12, wherein the residues V, W and X in formula (I) are O groups and the residues B
in formula (I) or (III) have the meanings set forth in claim 13, for the nucleotides N1 to N14 and R = H for N1, N4, N8, N10, N11 and N12, R = cyanomethyl for N2, N3, N7, N9 and N13 and R = allyl for N5, N6 and N14.
18. An oligonucleotide structure as claimed in claim 4, 5, 6, 8, 9, 10, 11 or 13, wherein the residues V, M and X in formula (I) are O groups and the residues B
in formula (I) or (III) have the meanings set forth in claim 13, for the nucleotides N1 to N14 and R = H for N1, N4, N8, N10, N11 and N12, R = butyl for N5 and N6 and R =
allyl for N2, N3, N7, N9, N13 and N14.
19. An oligonucleotide structure as claimed in claim 10, 11 or 12, wherein the residues V, W and X in formula (I) are O groups and the residues B in formula (I) or (III) have the meanings set forth in claim 13, for the nucleotides N1 to N14 and R = H for N1, N4, N8, N10, N11 and N12, R = butyl for N5 and N6 and R = allyl for N2, N3, N7, N9, N13 and N14 and R = butyl in one or several of the residues N that are present in a base-paired form in formula (III).
20. An oligonucleotide structure as claimed in any one of claims 4 to 19, wherein at least one nucleotide selected from 3'-deoxyribonucleotides and 3'-O-alkylribonucleotides is present in the free 3'-ends of the oligonucleotide structure.
21. An oligonucleotide structure as claimed in any one of claims 4 to 20, additionally containing for spatial configuration stabilization, nucleotides having nucleoside bases modified by a cross-linking agent.
22. An oligonucleotide structure as claimed in claim 21, wherein the cross-linking agent is psoralen or a psoralen derivative.
23. An oligonucleotide structure as claimed in any one of claims 4 to 22, linked to a prosthetic group selected from polyamino acids, lipids, hormones or peptides.
24. An oligonucleotide structure of any one of claims 4 to 23, for use in catalytic cleaving of a nucleic acid target sequence.
25. Use of an oligonucleotide structure linked to a prosthetic group as defined in claim 23, to improve uptake into a cell.
26. Use of an oligonucleotide structure linked to a prosthetic group as defined in claim 23, to improve specific cellular localization of the oligonucleotide structure.
27. In a process for cleaving a nucleic acid target sequence with a nucleotide, the improvement wherein said nucleotide is an oligonucleotide structure as defined in any one of claims 4 to 23.
28. A process as claimed in claim 27, wherein the nucleic acid target sequence forms part of said oligonucleotide structure.
29. A process as claimed in claim 27, wherein the nucleic acid target sequence is a molecule which is different from said oligonucleotide structure.
30. A process as claimed in claims 27, 28 or 29, wherein a nucleic acid target sequence having the general formula (IV) is cleaved with an oligonucleotide structure having the general formula (II) whereby an intermediate stage is formed in which the symbols N, N',N", x, y and * are as defined in claim 4, and K, Y, U and Z represent nucleotides of the nucleic acid target sequence in which:
U is uridine, Z is a non-modified ribonucleotide selected from the group comprising adenosine, cytidine or uridine, K and Y are any nucleotides, a ~ 1 and b ~ 3, and the cleavage of the nucleic acid target sequence takes place on the 3'- side of the nucleotide sequence YUZ.
31. A process according to claim 30, wherein thee is a chemical bond between the 5'-end of the nucleic acid target sequence (IV) and the 3'-end of the oligonucleotide (II) at (N)x or between the 3'-end of the nucleic acid target sequence (IV) and the 5'-end of the oligonucleotide (II) at (N)y.
32. A process as claimed in claim 30 or 31, wherein Y is guanosine.
33. A process as claimed in claim 30, 31 or 32, wherein Z is adenosine or cytidine.
34. A process as claimed in any one of claims 27 to 33, wherein the nucleic acid target sequence is a ribonucleic acid.
35. A process as claimed in any one of claims 27 to 34, wherein the cleavage is carried out in the presence of a divalent cation, in particular Mg2+.
36. A process as claimed in any one of claims 27 to 35, wherein the cleavage is carried out at a pH value of about 7 to 9.
37. A synthetic oligonucleotide structure which contains nucleotides having the general structural formula (I) in which:
B represents a nucleoside base which is selected from the group consisting of adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl (G), uracil-1-yl (U), uracil-5-yl (~), hypoxanthin-9-yl (I), thymin-1-yl (T) and 2-aminoadenin-9-yl;

V in each nucleotide is independently an O or a CH2 group;
X and W in each nucleotide are the same or different and are independently selected from O, S, NH2 or alkoxy of 1 to 10 carbon atoms, R is hydrogen or a straight-chained or branched alkyl, alkenyl or alkinyl group with 1 to 10 carbon atoms, unsubstituted or substituted with at least one of halogen, cyano, isocyano, nitro, amino, carboxyl, hydroxyl and mercapto, wherein in at least one of the nucleotides the residue R
in formula (I) is a said unsubstituted or substituted alkyl, alkenyl or alkinyl, for use in catalytic cleaving of an nucleic acid target sequence.
38. Use of an oligonucleotide structure as claimed in claim 37, for the catalytic cleavage of a nucleic acid target sequence.
39. A pharmaceutical agent comprising an oligonucleotide structure as claimed in any one of claims 4 to 23 or 37 as the active substance, together with a pharmaceutically acceptable carrier.
40. Use of an oligonucleotide structure of any one of claims 4 to 23 or 37, in the production of a pharmaceutical agent for antiviral therapy in humans, animals and plants.
41. Use of an oligonucleotide structure as claimed in any one of claims 4 to 23 or 37, as an antiviral agent.
42. Use of any oligonucleotide structure of any one of claims 4 to 23 or 37, as a diagnostic reagent for genetic screening.
43. Use of an oligonucleotide structure of any one of claims 4 to 23 or 37, in the manufacture of a diagnostic reagent for genetic screening.
CA002071446A 1991-06-20 1992-06-17 Synthetic catalytic oligonucleotide structures Expired - Fee Related CA2071446C (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DEP4120406.9 1991-06-20
DE4120406 1991-06-20
DEP4216134.7 1992-05-15
DE4216134A DE4216134A1 (en) 1991-06-20 1992-05-15 SYNTHETIC CATALYTIC OLIGONUCLEOTIDE STRUCTURES

Publications (2)

Publication Number Publication Date
CA2071446A1 CA2071446A1 (en) 1992-12-21
CA2071446C true CA2071446C (en) 1999-09-14

Family

ID=25904724

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002071446A Expired - Fee Related CA2071446C (en) 1991-06-20 1992-06-17 Synthetic catalytic oligonucleotide structures

Country Status (10)

Country Link
US (1) US5334711A (en)
EP (3) EP1061085A3 (en)
JP (3) JP3512818B2 (en)
AT (2) ATE172468T1 (en)
AU (1) AU658634B2 (en)
CA (1) CA2071446C (en)
DE (3) DE4216134A1 (en)
DK (2) DK0519463T3 (en)
ES (2) ES2124712T3 (en)
PT (1) PT845476E (en)

Families Citing this family (386)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5914396A (en) * 1990-01-11 1999-06-22 Isis Pharmaceuticals, Inc. 2'-O-modified nucleosides and phosphoramidites
US7101993B1 (en) 1990-01-11 2006-09-05 Isis Pharmaceuticals, Inc. Oligonucleotides containing 2′-O-modified purines
DE69123979T2 (en) 1990-10-12 1997-04-30 Max Planck Gesellschaft MODIFIED RIBOZYMS
US6041910A (en) * 1997-09-22 2000-03-28 Jervis B. Webb Company Baggage pusher device and system
US5646267A (en) * 1991-08-05 1997-07-08 Polish Academy Of Sciences Method of making oligonucleotides and oligonucleotide analogs using phospholanes and enantiomerically resolved phospholane analogues
US5359052A (en) * 1991-08-05 1994-10-25 Polish Academy Of Sciences Chalcophospholanes useful in the synthesis of oligonucleoside phosphorothioates, phosphorodithioates and related selenates
US7119184B2 (en) * 1991-08-12 2006-10-10 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US6369209B1 (en) * 1999-05-03 2002-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides having A-DNA form and B-DNA form conformational geometry
US5652094A (en) 1992-01-31 1997-07-29 University Of Montreal Nucleozymes
US6204027B1 (en) * 1992-02-26 2001-03-20 University Of Massachusetts Worcester Ribozymes having 2′-O substituted nucleotides in the flanking sequences
US20040054156A1 (en) * 1992-05-14 2004-03-18 Kenneth Draper Method and reagent for inhibiting hepatitis B viral replication
US20030125270A1 (en) * 2000-12-18 2003-07-03 Lawrence Blatt Enzymatic nucleic acid treatment of diseases or conditions related to hepatitis C virus infection
US20040127446A1 (en) * 1992-05-14 2004-07-01 Lawrence Blatt Oligonucleotide mediated inhibition of hepatitis B virus and hepatitis C virus replication
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US5646042A (en) * 1992-08-26 1997-07-08 Ribozyme Pharmaceuticals, Inc. C-myb targeted ribozymes
US5891684A (en) * 1992-10-15 1999-04-06 Ribozyme Pharmaceuticals, Inc. Base-modified enzymatic nucleic acid
US5616488A (en) * 1992-12-07 1997-04-01 Ribozyme Pharmaceuticals, Inc. IL-5 targeted ribozymes
US5612215A (en) * 1992-12-07 1997-03-18 Ribozyme Pharmaceuticals, Inc. Stromelysin targeted ribozymes
US5811300A (en) * 1992-12-07 1998-09-22 Ribozyme Pharmaceuticals, Inc. TNF-α ribozymes
US5837542A (en) * 1992-12-07 1998-11-17 Ribozyme Pharmaceuticals, Inc. Intercellular adhesion molecule-1 (ICAM-1) ribozymes
US5567604A (en) * 1993-04-23 1996-10-22 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich oligonucleotides
US6323185B1 (en) * 1993-04-23 2001-11-27 The United States Of America As Represented By The Department Of Health And Human Services Anti-viral guanosine-rich oligonucleotides and method of treating HIV
US6288042B1 (en) 1993-04-23 2001-09-11 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich tetrad forming oligonucleotides
FR2705099B1 (en) * 1993-05-12 1995-08-04 Centre Nat Rech Scient Phosphorothioate triester oligonucleotides and process for their preparation.
US5955591A (en) * 1993-05-12 1999-09-21 Imbach; Jean-Louis Phosphotriester oligonucleotides, amidites and method of preparation
US5817635A (en) * 1993-08-09 1998-10-06 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Modified ribozymes
PT748382E (en) * 1993-09-02 2003-03-31 Ribozyme Pharm Inc NUCLEIC ENZYMAL ACIDS CONTAINING NON-NUCLEOTIDES
CA2174339A1 (en) * 1993-10-27 1995-05-04 Lech W. Dudycz 2'-amido and 2'-peptido modified oligonucleotides
WO1995013378A1 (en) 1993-11-08 1995-05-18 Ribozyme Pharmaceuticals, Inc. Base-modified enzymatic nucleic acid
US5631359A (en) * 1994-10-11 1997-05-20 Ribozyme Pharmaceuticals, Inc. Hairpin ribozymes
US5639647A (en) 1994-03-29 1997-06-17 Ribozyme Pharmaceuticals, Inc. 2'-deoxy-2'alkylnucleotide containing nucleic acid
US5869248A (en) * 1994-03-07 1999-02-09 Yale University Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences
US5627053A (en) * 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US6639061B1 (en) * 1999-07-07 2003-10-28 Isis Pharmaceuticals, Inc. C3′-methylene hydrogen phosphonate oligomers and related compounds
US6103890A (en) * 1994-05-18 2000-08-15 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids that cleave C-fos
US5998193A (en) * 1994-06-24 1999-12-07 Gene Shears Pty., Ltd. Ribozymes with optimized hybridizing arms, stems, and loops, tRNA embedded ribozymes and compositions thereof
US5599706A (en) * 1994-09-23 1997-02-04 Stinchcomb; Dan T. Ribozymes targeted to apo(a) mRNA
US5716824A (en) 1995-04-20 1998-02-10 Ribozyme Pharmaceuticals, Inc. 2'-O-alkylthioalkyl and 2-C-alkylthioalkyl-containing enzymatic nucleic acids (ribozymes)
US5672501A (en) * 1994-12-23 1997-09-30 Ribozyme Pharmaceuticals, Inc. Base-modified enzymatic nucleic acid
WO1996018736A2 (en) * 1994-12-13 1996-06-20 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of arthritic conditions, induction of graft tolerance and reversal of immune responses
US5705388A (en) * 1994-12-23 1998-01-06 Ribozyme Pharmaceuticals, Inc. CETP Ribozymes
US5663064A (en) * 1995-01-13 1997-09-02 University Of Vermont Ribozymes with RNA protein binding site
US5683873A (en) * 1995-01-13 1997-11-04 Innovir Laboratories, Inc. EGS-mediated inactivation of target RNA
US6057153A (en) * 1995-01-13 2000-05-02 Yale University Stabilized external guide sequences
US5910408A (en) * 1995-06-07 1999-06-08 The General Hospital Corporation Catalytic DNA having ligase activity
US5877021A (en) * 1995-07-07 1999-03-02 Ribozyme Pharmaceuticals, Inc. B7-1 targeted ribozymes
AU725936B2 (en) * 1995-07-19 2000-10-26 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich oligonucleotides
US20040220128A1 (en) * 1995-10-26 2004-11-04 Sirna Therapeutics, Inc. Nucleic acid based modulation of female reproductive diseases and conditions
US20040142895A1 (en) * 1995-10-26 2004-07-22 Sirna Therapeutics, Inc. Nucleic acid-based modulation of gene expression in the vascular endothelial growth factor pathway
US6346398B1 (en) 1995-10-26 2002-02-12 Ribozyme Pharmaceuticals, Inc. Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor
US20040102389A1 (en) * 1995-10-26 2004-05-27 Ribozyme Pharmaceuticals, Inc. Nucleic acid-mediated treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
US7034009B2 (en) * 1995-10-26 2006-04-25 Sirna Therapeutics, Inc. Enzymatic nucleic acid-mediated treatment of ocular diseases or conditions related to levels of vascular endothelial growth factor receptor (VEGF-R)
US5998203A (en) 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
JP4293636B2 (en) 1996-02-14 2009-07-08 アイシス・ファーマシューティカルス・インコーポレーテッド Oligonucleotide with sugar-modified gap
US6238917B1 (en) * 1996-04-02 2001-05-29 Commonwealth Scientific Industrial Research Organizaion Asymmetric hammerhead ribozymes
US6610478B1 (en) 1996-08-16 2003-08-26 Yale University Phenotypic conversion of cells mediated by external guide sequences
US5807743A (en) * 1996-12-03 1998-09-15 Ribozyme Pharmaceuticals, Inc. Interleukin-2 receptor gamma-chain ribozymes
AU5794598A (en) * 1996-12-13 1998-07-03 Patricia Tekamp-Olson Method for expression of heterologous proteins in yeast
US6248878B1 (en) 1996-12-24 2001-06-19 Ribozyme Pharmaceuticals, Inc. Nucleoside analogs
US20030186909A1 (en) * 1997-01-27 2003-10-02 Ribozyme Pharmaceuticals, Inc. Nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
US6057156A (en) * 1997-01-31 2000-05-02 Robozyme Pharmaceuticals, Inc. Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
CA2279488A1 (en) * 1997-02-04 1998-08-06 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich tetrad forming oligonucleotides
US6159951A (en) * 1997-02-13 2000-12-12 Ribozyme Pharmaceuticals Inc. 2'-O-amino-containing nucleoside analogs and polynucleotides
US6251666B1 (en) 1997-03-31 2001-06-26 Ribozyme Pharmaceuticals, Inc. Nucleic acid catalysts comprising L-nucleotide analogs
US6548657B1 (en) 1997-06-09 2003-04-15 Ribozyme Pharmaceuticals, Inc. Method for screening nucleic acid catalysts
US6280936B1 (en) 1997-06-09 2001-08-28 Ribozyme Pharmaceuticals, Inc. Method for screening nucleic acid catalysts
US6300483B1 (en) * 1997-06-19 2001-10-09 Ribozyme Pharmaceuticals, Inc. Compositions inducing cleavage of RNA motifs
US6183959B1 (en) 1997-07-03 2001-02-06 Ribozyme Pharmaceuticals, Inc. Method for target site selection and discovery
US6316612B1 (en) 1997-08-22 2001-11-13 Ribozyme Pharmaceuticals, Inc. Xylofuranosly-containing nucleoside phosphoramidites and polynucleotides
JP2001518292A (en) * 1997-09-22 2001-10-16 マックス−プランク−ゲゼルシャフト・ツア・フェルデルング・デア・ヴィッセンシャフテン・エー・ファオ Nucleic acid catalyst having endonuclease activity
US6656731B1 (en) 1997-09-22 2003-12-02 Max Planck Gesellschaft Zur Forderung Der Wissenschaften E.V. Nucleic acid catalysts with endonuclease activity
US6054576A (en) * 1997-10-02 2000-04-25 Ribozyme Pharmaceuticals, Inc. Deprotection of RNA
US6482932B1 (en) 1997-11-05 2002-11-19 Ribozyme Pharmaceuticals, Incorporated Nucleoside triphosphates and their incorporation into oligonucleotides
US6617438B1 (en) 1997-11-05 2003-09-09 Sirna Therapeutics, Inc. Oligoribonucleotides with enzymatic activity
US6013447A (en) * 1997-11-21 2000-01-11 Innovir Laboratories, Inc. Random intracellular method for obtaining optimally active nucleic acid molecules
US20020147143A1 (en) 1998-03-18 2002-10-10 Corixa Corporation Compositions and methods for the therapy and diagnosis of lung cancer
US6248525B1 (en) 1998-03-30 2001-06-19 Yale University Method for identifying essential or functional genes
WO1999054459A2 (en) 1998-04-20 1999-10-28 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
US6995259B1 (en) * 1998-10-23 2006-02-07 Sirna Therapeutics, Inc. Method for the chemical synthesis of oligonucleotides
CA2368194A1 (en) * 1999-04-30 2000-11-09 University Of Florida Adeno-associated virus-delivered ribozyme compositions and methods of use
AR025996A1 (en) 1999-10-07 2002-12-26 Valigen Us Inc NON-TRANSGENIC PLANTS RESISTANT TO HERBICIDES.
US6831171B2 (en) * 2000-02-08 2004-12-14 Yale University Nucleic acid catalysts with endonuclease activity
US20050233329A1 (en) * 2002-02-20 2005-10-20 Sirna Therapeutics, Inc. Inhibition of gene expression using duplex forming oligonucleotides
US8273866B2 (en) * 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
CA2398282A1 (en) * 2000-02-11 2001-08-16 Ribozyme Pharmaceuticals, Inc. Method and reagent for the modulation and diagnosis of cd20 and nogo gene expression
US20080039414A1 (en) * 2002-02-20 2008-02-14 Sima Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US8202979B2 (en) * 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US7491805B2 (en) * 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2005041859A2 (en) 2003-04-30 2005-05-12 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery.
US7833992B2 (en) * 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US20050032733A1 (en) * 2001-05-18 2005-02-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
US20040002068A1 (en) 2000-03-01 2004-01-01 Corixa Corporation Compositions and methods for the detection, diagnosis and therapy of hematological malignancies
US20050239061A1 (en) * 2000-03-01 2005-10-27 Marshall William S Identification and use of effectors and allosteric molecules for the alteration of gene expression
US20040023292A1 (en) * 2001-10-19 2004-02-05 Mcswiggen James Method and reagent for the detection of proteins and peptides
US20040009510A1 (en) * 2000-03-06 2004-01-15 Scott Seiwert Allosteric nucleic acid sensor molecules
US20030065155A1 (en) * 2000-03-06 2003-04-03 Nassim Usman Nucleic acid sensor molecules
US20020102694A1 (en) * 2000-03-31 2002-08-01 Ronald Breaker Nucleozymes with endonuclease activity
DE60134158D1 (en) 2000-06-28 2008-07-03 Corixa Corp COMPOSITIONS AND METHODS FOR THERAPY AND DIAGNOSIS OF LUNG CANCER
WO2002002792A1 (en) 2000-06-30 2002-01-10 Molecular Staging, Inc. Signal amplification with lollipop probes
US8568766B2 (en) 2000-08-24 2013-10-29 Gattadahalli M. Anantharamaiah Peptides and peptide mimetics to treat pathologies associated with eye disease
US20050209179A1 (en) * 2000-08-30 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
US20080032942A1 (en) * 2000-08-30 2008-02-07 Mcswiggen James RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
US20030190635A1 (en) * 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
AU9684601A (en) 2000-10-12 2002-04-22 Univ Rochester Compositions that inhibit proliferation of cancer cells
WO2002061133A2 (en) * 2000-11-09 2002-08-08 Yale University Nucleic acid detection using structured probes
EP1383782A1 (en) * 2001-03-26 2004-01-28 Sirna Therpeutics, Inc. Oligonucleotide mediated inhibition of hepatitis b virus and hepatitis c virus replication
EP1386004A4 (en) * 2001-04-05 2005-02-16 Ribozyme Pharm Inc Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies
JP2005504513A (en) 2001-05-09 2005-02-17 コリクサ コーポレイション Compositions and methods for treatment and diagnosis of prostate cancer
US20050196765A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint Kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US20050209180A1 (en) * 2001-05-18 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
US20050164966A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of type 1 insulin-like growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050233344A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA)
US20050182006A1 (en) * 2001-05-18 2005-08-18 Sirna Therapeutics, Inc RNA interference mediated inhibition of protein kinase C alpha (PKC-alpha) gene expression using short interfering nucleic acid (siNA)
US20050227935A1 (en) * 2001-05-18 2005-10-13 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TNF and TNF receptor gene expression using short interfering nucleic acid (siNA)
US20050182007A1 (en) * 2001-05-18 2005-08-18 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
US20080188430A1 (en) * 2001-05-18 2008-08-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
US20050176665A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hairless (HR) gene expression using short interfering nucleic acid (siNA)
US20050176666A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GPRA and AAA1 gene expression using short interfering nucleic acid (siNA)
US20050153914A1 (en) * 2001-05-18 2005-07-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MDR P-glycoprotein gene expression using short interfering nucleic acid (siNA)
US20050124568A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of acetyl-CoA-carboxylase gene expression using short interfering nucleic acid (siNA)
US20070042983A1 (en) * 2001-05-18 2007-02-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050136436A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of G72 and D-amino acid oxidase (DAAO) gene expression using short interfering nucleic acid (siNA)
US20040006035A1 (en) * 2001-05-29 2004-01-08 Dennis Macejak Nucleic acid mediated disruption of HIV fusogenic peptide interactions
US20050124566A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)
US20050288242A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of RAS gene expression using short interfering nucleic acid (siNA)
US20050191638A1 (en) * 2002-02-20 2005-09-01 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20050222066A1 (en) * 2001-05-18 2005-10-06 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US7517864B2 (en) * 2001-05-18 2009-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050196767A1 (en) * 2001-05-18 2005-09-08 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acis (siNA)
US20060241075A1 (en) * 2001-05-18 2006-10-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of desmoglein gene expression using short interfering nucleic acid (siNA)
US20040219671A1 (en) * 2002-02-20 2004-11-04 Sirna Therapeutics, Inc. RNA interference mediated treatment of parkinson disease using short interfering nucleic acid (siNA)
US20070270579A1 (en) * 2001-05-18 2007-11-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050256068A1 (en) * 2001-05-18 2005-11-17 Sirna Therapeutics, Inc. RNA interference mediated inhibition of stearoyl-CoA desaturase (SCD) gene expression using short interfering nucleic acid (siNA)
US20040019001A1 (en) * 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
US20050203040A1 (en) * 2001-05-18 2005-09-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US20030124513A1 (en) * 2001-05-29 2003-07-03 Mcswiggen James Enzymatic nucleic acid treatment of diseases or conditions related to levels of HIV
US20050153915A1 (en) * 2001-05-18 2005-07-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of early growth response gene expression using short interfering nucleic acid (siNA)
US20050124567A1 (en) * 2001-05-18 2005-06-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TRPM7 gene expression using short interfering nucleic acid (siNA)
US20050119212A1 (en) * 2001-05-18 2005-06-02 Sirna Therapeutics, Inc. RNA interference mediated inhibition of FAS and FASL gene expression using short interfering nucleic acid (siNA)
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20060019913A1 (en) * 2001-05-18 2006-01-26 Sirna Therapeutics, Inc. RNA interference mediated inhibtion of protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA)
US20050159376A1 (en) * 2002-02-20 2005-07-21 Slrna Therapeutics, Inc. RNA interference mediated inhibition 5-alpha reductase and androgen receptor gene expression using short interfering nucleic acid (siNA)
US20060142226A1 (en) * 2001-05-18 2006-06-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cholesteryl ester transfer protein (CETP) gene expression using short interfering nucleic acid (siNA)
US20050143333A1 (en) * 2001-05-18 2005-06-30 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (SINA)
EP3231445A1 (en) 2001-05-18 2017-10-18 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20050282188A1 (en) * 2001-05-18 2005-12-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20030170891A1 (en) * 2001-06-06 2003-09-11 Mcswiggen James A. RNA interference mediated inhibition of epidermal growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050159380A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of angiopoietin gene expression using short interfering nucleic acid (siNA)
US20050176664A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cholinergic muscarinic receptor (CHRM3) gene expression using short interfering nucleic acid (siNA)
US20060142225A1 (en) * 2001-05-18 2006-06-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin dependent kinase-2 (CDK2) gene expression using short interfering nucleic acid (siNA)
US20050164968A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of ADAM33 gene expression using short interfering nucleic acid (siNA)
US20050137155A1 (en) * 2001-05-18 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated treatment of Parkinson disease using short interfering nucleic acid (siNA)
US7109165B2 (en) * 2001-05-18 2006-09-19 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20050080031A1 (en) * 2001-05-18 2005-04-14 Sirna Therapeutics, Inc. Nucleic acid treatment of diseases or conditions related to levels of Ras, HER2 and HIV
US20050079610A1 (en) * 2001-05-18 2005-04-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US20050159379A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc RNA interference mediated inhibition of gastric inhibitory polypeptide (GIP) and gastric inhibitory polypeptide receptor (GIPR) gene expression using short interfering nucleic acid (siNA)
US20060211642A1 (en) * 2001-05-18 2006-09-21 Sirna Therapeutics, Inc. RNA inteference mediated inhibition of hepatitis C virus (HVC) gene expression using short interfering nucleic acid (siNA)
US20050054596A1 (en) * 2001-11-30 2005-03-10 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050287128A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TGF-beta and TGF-beta receptor gene expression using short interfering nucleic acid (siNA)
US20050187174A1 (en) * 2001-05-18 2005-08-25 Sirna Therapeutics, Inc. RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20050164224A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US20050014172A1 (en) * 2002-02-20 2005-01-20 Ivan Richards RNA interference mediated inhibition of muscarinic cholinergic receptor gene expression using short interfering nucleic acid (siNA)
US20050164967A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US20030175950A1 (en) * 2001-05-29 2003-09-18 Mcswiggen James A. RNA interference mediated inhibition of HIV gene expression using short interfering RNA
US20050148530A1 (en) * 2002-02-20 2005-07-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050182009A1 (en) * 2001-05-18 2005-08-18 Sirna Therapeutics, Inc. RNA interference mediated inhibition of NF-Kappa B / REL-A gene expression using short interfering nucleic acid (siNA)
US20050054598A1 (en) * 2002-02-20 2005-03-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition hairless (HR) gene expression using short interfering nucleic acid (siNA)
US20050267058A1 (en) * 2001-05-18 2005-12-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sINA)
US20040198682A1 (en) * 2001-11-30 2004-10-07 Mcswiggen James RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (siNA)
US20050233997A1 (en) * 2001-05-18 2005-10-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA)
US20080161256A1 (en) * 2001-05-18 2008-07-03 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US20050119211A1 (en) * 2001-05-18 2005-06-02 Sirna Therapeutics, Inc. RNA mediated inhibition connexin gene expression using short interfering nucleic acid (siNA)
US20040209831A1 (en) * 2002-02-20 2004-10-21 Mcswiggen James RNA interference mediated inhibition of hepatitis C virus (HCV) gene expression using short interfering nucleic acid (siNA)
US20050130181A1 (en) * 2001-05-18 2005-06-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of wingless gene expression using short interfering nucleic acid (siNA)
US20030140362A1 (en) * 2001-06-08 2003-07-24 Dennis Macejak In vivo models for screening inhibitors of hepatitis B virus
US7205399B1 (en) 2001-07-06 2007-04-17 Sirna Therapeutics, Inc. Methods and reagents for oligonucleotide synthesis
US20030148928A1 (en) * 2001-07-20 2003-08-07 Leonid Beigelman Enzymatic nucleic acid peptide conjugates
WO2003013226A2 (en) * 2001-08-09 2003-02-20 Cibus Genetics Non-transgenic herbicide resistant plants
US20050075304A1 (en) * 2001-11-30 2005-04-07 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20040138163A1 (en) * 2002-05-29 2004-07-15 Mcswiggen James RNA interference mediated inhibition of vascular edothelial growth factor and vascular edothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20070203333A1 (en) * 2001-11-30 2007-08-30 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20030219775A1 (en) * 2001-12-14 2003-11-27 Ward David C. Nucleic acid diagnostic reagents and methods for detecting nucleic acids, polynucleotides and oligonucleotides
EP2224012B1 (en) 2001-12-17 2013-01-30 Corixa Corporation Compositions and methods for the therapy and diagnosis of inflammatory bowel disease
ATE469167T1 (en) 2002-02-06 2010-06-15 Vicor Technologies Inc ANTI-INFARCH MOLECULES
US20050096284A1 (en) * 2002-02-20 2005-05-05 Sirna Therapeutics, Inc. RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20050137153A1 (en) * 2002-02-20 2005-06-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of alpha-1 antitrypsin (AAT) gene expression using short interfering nucleic acid (siNA)
WO2003106476A1 (en) * 2002-02-20 2003-12-24 Sirna Therapeutics, Inc Nucleic acid mediated inhibition of enterococcus infection and cytolysin toxin activity
US20050222064A1 (en) * 2002-02-20 2005-10-06 Sirna Therapeutics, Inc. Polycationic compositions for cellular delivery of polynucleotides
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
AU2003207708A1 (en) 2002-02-20 2003-09-09 Sirna Therapeutics, Inc. Rna interference mediated inhibition of map kinase genes
EP1534729A2 (en) * 2002-02-26 2005-06-01 University of Utah Research Foundation Variants of nedd4l associated with hypertension and viral budding
US20030195164A1 (en) * 2002-04-16 2003-10-16 Veli-Matti Kahari Novel ribozyme and its use
US20040018520A1 (en) * 2002-04-22 2004-01-29 James Thompson Trans-splicing enzymatic nucleic acid mediated biopharmaceutical and protein
US20030224435A1 (en) * 2002-05-16 2003-12-04 Scott Seiwert Detection of abused substances and their metabolites using nucleic acid sensor molecules
US7655790B2 (en) 2002-07-12 2010-02-02 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
US6989442B2 (en) * 2002-07-12 2006-01-24 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
CA2495478A1 (en) 2002-08-05 2004-02-12 University Of Rochester Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof
US7923547B2 (en) 2002-09-05 2011-04-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
EP1581648A2 (en) * 2002-09-09 2005-10-05 Nura, Inc. G protein coupled receptors and uses thereof
US20080260744A1 (en) * 2002-09-09 2008-10-23 Omeros Corporation G protein coupled receptors and uses thereof
AU2003288906C1 (en) * 2002-09-20 2010-12-09 Yale University Riboswitches, methods for their use, and compositions for use with riboswitches.
US9233120B2 (en) 2002-11-15 2016-01-12 Jyant Technologies Anti-CCL25 and anti-CCR9 antibodies for the prevention and treatment of cancer and cancer cell migration
US8512701B2 (en) 2002-11-15 2013-08-20 Morehouse School Of Medicine Anti-CXCL13 and anti-CXCR5 antibodies for the prevention and treatment of cancer and cancer cell migration
US8658377B2 (en) 2002-11-15 2014-02-25 Morehouse School Of Medicine Detecting cancer with anti-CCL25 and anti-CCR9 antibodies
US9487823B2 (en) 2002-12-20 2016-11-08 Qiagen Gmbh Nucleic acid amplification
US20040231231A1 (en) * 2002-12-20 2004-11-25 Cataldo Dominic A. Use of colloidal clays for sustained release of active ingredients
US20030232400A1 (en) * 2002-12-20 2003-12-18 Susan Radka Methods of screening subjects for expression of soluble receptors of vascular endothelial growth factor (VEGF) for use in managing treatment and determining prognostic outcome
US8043834B2 (en) 2003-03-31 2011-10-25 Qiagen Gmbh Universal reagents for rolling circle amplification and methods of use
WO2004093788A2 (en) * 2003-04-17 2004-11-04 The Trustees Of Columbia University In The City Ofnew York Desmoglein 4 is a novel gene involved in hair growth
US20050287668A1 (en) * 2003-11-04 2005-12-29 Cell Therapeutics, Inc. (Cti) RNA interference compositions and screening methods for the identification of novel genes and biological pathways
WO2005078848A2 (en) * 2004-02-11 2005-08-25 University Of Tennessee Research Foundation Inhibition of tumor growth and invasion by anti-matrix metalloproteinase dnazymes
ES2423060T3 (en) 2004-03-12 2013-09-17 Alnylam Pharmaceuticals, Inc. IRNA agents that target VEGF
MXPA06012076A (en) * 2004-04-20 2007-01-25 Nastech Pharm Co Methods and compositions for enhancing delivery of double-stranded rna or a double-stranded hybrid nucleic acid to regulate gene expression in mammalian cells.
WO2005105157A2 (en) 2004-04-23 2005-11-10 The Trustees Of Columbia University In The City Ofnew York INHIBITION OF HAIRLESS PROTEIN mRNA
US20060040882A1 (en) * 2004-05-04 2006-02-23 Lishan Chen Compostions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
AU2005272920B2 (en) 2004-08-10 2011-05-12 Institute For Multiple Myeloma And Bone Cancer Research Methods of regulating differentiation and treating of multiple myeloma
US8129124B2 (en) 2005-02-02 2012-03-06 The Uab Research Foundation Agents and methods related to reducing resistance to apoptosis-inducing death receptor agonists
JP4528154B2 (en) * 2005-02-25 2010-08-18 株式会社クボタ Seedling planting mechanism for rice transplanters
EA037929B1 (en) 2005-03-23 2021-06-08 Генмаб А/С Antibodies against human cd38 and use thereof
US7476733B2 (en) 2005-03-25 2009-01-13 The United States Of America As Represented By The Department Of Health And Human Services Development of a real-time PCR assay for detection of pneumococcal DNA and diagnosis of pneumococccal disease
DK1866414T3 (en) 2005-03-31 2012-04-23 Calando Pharmaceuticals Inc Inhibitors of ribonucleotide reductase subunit 2 and uses thereof.
US8309303B2 (en) 2005-04-01 2012-11-13 Qiagen Gmbh Reverse transcription and amplification of RNA with simultaneous degradation of DNA
US20060234973A1 (en) * 2005-04-14 2006-10-19 Kevin Fitzgerald Transcription factor RNA interference reagents and methods of use thereof
US20100129288A1 (en) * 2005-06-28 2010-05-27 Elior Peles Gliomedin, Fragments Thereof and Methods of Using Same
EP1896586A2 (en) 2005-06-28 2008-03-12 Medtronic, Inc. Methods and sequences to preferentially suppress expression of mutated huntingtin
US20090176725A1 (en) * 2005-08-17 2009-07-09 Sirna Therapeutics Inc. Chemically modified short interfering nucleic acid molecules that mediate rna interference
EP1762627A1 (en) 2005-09-09 2007-03-14 Qiagen GmbH Method for the activation of a nucleic acid for performing a polymerase reaction
AU2006302245A1 (en) * 2005-10-06 2007-04-19 Emthrax, Llc Methods and compositions relating to anthrax spore glycoproteins as vaccines
US8080534B2 (en) 2005-10-14 2011-12-20 Phigenix, Inc Targeting PAX2 for the treatment of breast cancer
WO2007047512A2 (en) 2005-10-14 2007-04-26 Musc Foundation For Research Development Inhibition of pax2 by defb1 induction as a therapy for cancer
US8313901B2 (en) * 2005-12-21 2012-11-20 Yale University Methods and compositions related to the modulation of riboswitches
FI20055712A0 (en) * 2005-12-29 2005-12-29 Wallac Oy Moacrocyclic oligonucleotide labeling reagents and conjugates derived therefrom
SI2465341T1 (en) * 2006-01-12 2015-04-30 Cibus Europe B.V. EPSPS Mutants
ES2550099T3 (en) 2006-01-27 2015-11-04 Biogen Ma Inc. Nogo receptor antagonists
NZ587704A (en) * 2006-03-31 2012-04-27 Alnylam Pharmaceuticals Inc Use of dsRNA for inhibiting expression of Eg5 gene
WO2007117657A2 (en) 2006-04-07 2007-10-18 The Research Foundation Of State University Of New York Transcobalamin receptor polypeptides, nucleic acids, and modulators thereof, and related methods of use in modulating cell growth and treating cancer and cobalamin deficiency
WO2007128874A1 (en) * 2006-05-05 2007-11-15 Wallac Oy Biomolecule labeling reactants based on azacycloalkanes and conjugates derived thereof
US8598333B2 (en) * 2006-05-26 2013-12-03 Alnylam Pharmaceuticals, Inc. SiRNA silencing of genes expressed in cancer
CA2982638A1 (en) * 2006-06-28 2008-01-03 Nucelis Inc. Fatty acid blends and uses therefor
EP2061799A4 (en) * 2006-09-11 2010-12-22 Univ Yale Methods and compositions for the use of lysine riboswitches
AU2007297535C1 (en) 2006-09-21 2017-11-23 University Of Florida Research Foundation, Inc. Compositions and methods related to protein displacement therapy for myotonic distrophy
US9074205B2 (en) * 2006-10-18 2015-07-07 Marina Biotech, Inc. Nicked or gapped nucleic acid molecules and uses thereof
WO2008052774A2 (en) 2006-10-31 2008-05-08 Noxxon Pharma Ag Methods for detection of a single- or double-stranded nucleic acid molecule
WO2008136852A2 (en) 2006-11-01 2008-11-13 University Of Rochester Methods and compositions related to the structure and function of apobec3g
CA2672297A1 (en) 2006-12-11 2008-06-19 University Of Utah Research Foundation Compositions and methods for treating pathologic angiogenesis and vascular permeability
WO2008109357A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting apob gene expression and uses thereof
JP2010519905A (en) * 2007-03-02 2010-06-10 エムディーアールエヌエー，インコーポレイテッド NUCLEIC ACID COMPOUND FOR SUPPRESSING EXPRESSION OF AKT GENE AND USE THEREOF
WO2008109361A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc, Nucleic acid compounds for inhibiting erbb family gene expression and uses thereof
US20100055784A1 (en) * 2007-03-02 2010-03-04 Mdrna, Inc. Nucleic acid compounds for inhibiting wnt gene expression and uses thereof
WO2008109362A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting vegf gene expression and uses thereof
US20100105134A1 (en) * 2007-03-02 2010-04-29 Mdrna, Inc. Nucleic acid compounds for inhibiting gene expression and uses thereof
JP2010519910A (en) * 2007-03-02 2010-06-10 エムディーアールエヌエー，インコーポレイテッド Nucleic acid compound for suppressing expression of BCL2 gene and use thereof
JP2010519908A (en) * 2007-03-02 2010-06-10 エムディーアールエヌエー，インコーポレイテッド Nucleic acid compound and use thereof for suppressing expression of HIF1A gene
WO2008109377A1 (en) * 2007-03-02 2008-09-12 Mdrna, Inc. Nucleic acid compounds for inhibiting vegf family gene expression and uses thereof
US20100055782A1 (en) * 2007-03-02 2010-03-04 Mdrna, Inc. Nucleic acid compounds for inhibiting myc gene expression and uses thereof
EP2191001B1 (en) 2007-04-09 2016-06-08 University of Florida Research Foundation, Inc. Raav vector compositions having tyrosine-modified capsid proteins and methods for use
MX2009011218A (en) * 2007-04-17 2010-02-11 Baxter Int Nucleic acid microparticles for pulmonary delivery.
ES2531520T3 (en) 2007-05-04 2015-03-16 Marina Biotech, Inc. Lipoamino acids and their uses
US20100150924A1 (en) * 2007-05-22 2010-06-17 Elior Peles Regulation of myelination by nectin-like (necl) molecules
EP2426219A1 (en) * 2007-05-29 2012-03-07 Yale University Riboswitches and methods and compositions for use of and with riboswitches
WO2008150884A1 (en) * 2007-05-29 2008-12-11 Yale University Methods and compositions related to riboswitches that control alternative splicing and rna processing
EP2195331B1 (en) 2007-08-28 2013-11-20 Uab Research Foundation Synthetic apolipoprotein e mimicking polypeptides and methods of use
US8557767B2 (en) 2007-08-28 2013-10-15 Uab Research Foundation Synthetic apolipoprotein E mimicking polypeptides and methods of use
WO2009033027A2 (en) * 2007-09-05 2009-03-12 Medtronic, Inc. Suppression of scn9a gene expression and/or function for the treatment of pain
AU2008308530A1 (en) 2007-10-05 2009-04-09 Cibus Europe B.V. Mutated acetohydroxyacid synthase genes in Brassica
US8501912B2 (en) * 2007-12-03 2013-08-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Filipil compositions and methods for treating cancer
AU2008333811B2 (en) 2007-12-04 2014-05-01 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
CA2710767C (en) * 2007-12-27 2016-09-27 Cibus Llc Alkylester fatty acid blends and uses therefor
EP3100718B1 (en) 2008-01-02 2019-11-27 Arbutus Biopharma Corporation Improved compositions and methods for the delivery of nucleic acids
EP2262489A2 (en) * 2008-02-28 2010-12-22 Deutsches Krebsforschungszentrum, Stiftung des öffentlichen Rechts Hollow nanoparticles and uses thereof
EP2712926A2 (en) * 2008-03-05 2014-04-02 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of Eg5 and VEGF genes
US20090233993A1 (en) * 2008-03-06 2009-09-17 Burnham Institute For Medical Research Compositions and methods for inhibiting gsk3 activity and uses thereof
JP2011516065A (en) 2008-04-04 2011-05-26 カランド ファーマシューティカルズ， インコーポレイテッド Compositions and uses of EPAS1 inhibitors
NZ588583A (en) 2008-04-15 2012-08-31 Protiva Biotherapeutics Inc Novel lipid formulations for nucleic acid delivery
US20110262395A1 (en) 2008-05-08 2011-10-27 University Of Utah Research Foundation Sensory receptors for chronic fatigue and pain and uses thereof
WO2009143490A1 (en) 2008-05-23 2009-11-26 Cibus International, L.P. Production of squalene using yeast
WO2009155100A1 (en) 2008-05-30 2009-12-23 Yale University Targeted oligonucleotide compositions for modifying gene expression
US20100015708A1 (en) * 2008-06-18 2010-01-21 Mdrna, Inc. Ribonucleic acids with non-standard bases and uses thereof
WO2010011347A2 (en) 2008-07-25 2010-01-28 The Regents Of The University Of Colorado Clip inhibitors and methods of modulating immune function
WO2010039801A2 (en) 2008-10-02 2010-04-08 The J. David Gladstone Institutes Methods of treating hepatitis c virus infection
ES2475065T3 (en) 2008-10-09 2014-07-10 Tekmira Pharmaceuticals Corporation Enhanced amino acids and methods for nucleic acid administration
KR20110071017A (en) 2008-10-16 2011-06-27 마리나 바이오테크, 인크. Processes and compositions for liposomal and efficient delivery of gene silencing therapeutics
ES2631507T3 (en) 2008-10-29 2017-08-31 China Synthetic Rubber Corporation Procedures and agents for the diagnosis and treatment of hepatocellular carcinoma
KR20220150995A (en) 2008-11-10 2022-11-11 알닐람 파마슈티칼스 인코포레이티드 Novel lipids and compositions for the delivery of therapeutics
US20120070443A1 (en) 2008-12-02 2012-03-22 University Of Utah Research Foundation Pde1 as a target therapeutic in heart disease
EP3243504A1 (en) 2009-01-29 2017-11-15 Arbutus Biopharma Corporation Improved lipid formulation
WO2010096813A1 (en) 2009-02-23 2010-08-26 New York Blood Center Krüppel-like factors and fat regulation
US20120149756A1 (en) 2009-04-10 2012-06-14 Associatin Institut de Myologie Tricyclo-dna antisense oligonucleotides, compositions, and methods for the treatment of disease
EP2419143B8 (en) 2009-04-13 2018-06-27 INSERM - Institut National de la Santé et de la Recherche Médicale Hpv particles and uses thereof
CA3042927C (en) 2009-05-05 2022-05-17 Arbutus Biopharma Corporation Lipid compositions for the delivery of therapeutic agents
US20100285112A1 (en) 2009-05-05 2010-11-11 Tatiana Novobrantseva Methods of delivering oligonucleotides to immune cells
KR102205886B1 (en) 2009-06-10 2021-01-21 알닐람 파마슈티칼스 인코포레이티드 Improved lipid formulation
WO2011000107A1 (en) 2009-07-01 2011-01-06 Protiva Biotherapeutics, Inc. Novel lipid formulations for delivery of therapeutic agents to solid tumors
US20110060000A1 (en) 2009-09-10 2011-03-10 Maurizio Grimaldi Acridine analogs in the treatment of gliomas
WO2011039646A2 (en) 2009-09-30 2011-04-07 Inserm (Institut National De La Sante Et De La Recherche Medicale) Papilloma virus -like particles for targeted gene delivery
US8450090B2 (en) 2009-10-06 2013-05-28 The Regents Of The University Of Colorado, A Body Corporate Compositions and methods for promoting fatty acid production in plants
EP3219815B1 (en) * 2009-11-23 2019-10-02 Cibus Europe B.V. Methods and compositions for producing squalene using yeast
WO2011071860A2 (en) 2009-12-07 2011-06-16 Alnylam Pharmaceuticals, Inc. Compositions for nucleic acid delivery
WO2011075656A1 (en) 2009-12-18 2011-06-23 The University Of British Columbia Methods and compositions for delivery of nucleic acids
MX2012009318A (en) 2010-02-10 2012-09-07 Novartis Ag Methods and compounds for muscle growth.
CA2785529C (en) * 2010-02-11 2019-01-08 Nanostring Technologies, Inc. Compositions and methods for the detection of small rnas
US20110207789A1 (en) 2010-02-19 2011-08-25 Ye Fang Methods related to casein kinase ii (ck2) inhibitors and the use of purinosome-disrupting ck2 inhibitors for anti-cancer therapy agents
WO2011119842A1 (en) 2010-03-25 2011-09-29 The J. David Gladstone Institutes Compositions and methods for treating neurological disorders
WO2011120023A1 (en) 2010-03-26 2011-09-29 Marina Biotech, Inc. Nucleic acid compounds for inhibiting survivin gene expression uses thereof
WO2011133584A2 (en) 2010-04-19 2011-10-27 Marina Biotech, Inc. Nucleic acid compounds for inhibiting hras gene expression and uses thereof
PT2561067T (en) 2010-04-23 2019-02-04 Univ Florida Raav-guanylate cyclase compositions and methods for treating leber's congenital amaurosis-1 (lca1)
EP2563922A1 (en) 2010-04-26 2013-03-06 Marina Biotech, Inc. Nucleic acid compounds with conformationally restricted monomers and uses thereof
WO2011139843A2 (en) 2010-04-28 2011-11-10 Marina Biotech, Inc. Multi-sirna compositions for reducing gene expression
WO2012006506A1 (en) 2010-07-09 2012-01-12 Massachusetts Institute Of Technology Metabolic gene, enzyme, and flux targets for cancer therapy
WO2012016184A2 (en) 2010-07-30 2012-02-02 Alnylam Pharmaceuticals, Inc. Methods and compositions for delivery of active agents
WO2012016188A2 (en) 2010-07-30 2012-02-02 Alnylam Pharmaceuticals, Inc. Methods and compositions for delivery of active agents
UA112969C2 (en) 2010-08-03 2016-11-25 Сібас Юс Ллс PLANT RESISTANT TO ONE OR MORE PPH-INHIBITING HERBICIDES CONTAINING PROTOPORPHYRINOGEN IX OXIDASE (PPX) MUTANT GENE
US20120122223A1 (en) 2010-08-03 2012-05-17 Cibus Us Llc Mutated protoporphyrinogen ix oxidase (ppx) genes
KR20130137160A (en) 2010-08-24 2013-12-16 머크 샤프 앤드 돔 코포레이션 Single-stranded rnai agents containing an internal, non-nucleic acid spacer
WO2012044992A2 (en) 2010-09-30 2012-04-05 Agency For Science, Technology And Research (A*Star) Methods and reagents for detection and treatment of esophageal metaplasia
EP3327125B1 (en) 2010-10-29 2020-08-05 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acids (sina)
AU2012207606B2 (en) 2011-01-11 2017-02-23 Alnylam Pharmaceuticals, Inc. Pegylated lipids and their use for drug delivery
CN104136451A (en) 2011-09-07 2014-11-05 玛瑞纳生物技术有限公司 Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
JP6250543B2 (en) 2011-09-27 2017-12-20 アルニラム・ファーマシューティカルズ・インコーポレーテッド Dialiphatic substituted PEGylated lipids
KR20140082796A (en) 2011-10-14 2014-07-02 제넨테크, 인크. ANTI-HtrA1 ANTIBODIES AND METHODS OF USE
JP2015502365A (en) 2011-12-12 2015-01-22 オンコイミューニン，インコーポレイティド In vivo delivery of oligonucleotides
EP2797948B1 (en) 2011-12-27 2019-02-20 The J. David Gladstone Institutes Compositions for use in regulating glucose metabolism
US9700639B2 (en) 2012-02-07 2017-07-11 Aura Biosciences, Inc. Virion-derived nanospheres for selective delivery of therapeutic and diagnostic agents to cancer cells
RU2020111326A (en) 2012-02-24 2020-04-29 Протива Байотерапьютикс Инк. TRIALKYL CATIONIC LIPIDS AND METHODS OF USE THEREOF
KR101520383B1 (en) 2012-08-02 2015-05-15 에이비온 주식회사 Composition for Treating HPV-related Cancers
WO2014153178A2 (en) 2013-03-14 2014-09-25 Cibus Us Llc Mutated allene oxide synthase 2 (aos2) genes
US9957515B2 (en) 2013-03-15 2018-05-01 Cibus Us Llc Methods and compositions for targeted gene modification
US11434494B2 (en) 2013-03-15 2022-09-06 Cibus Us Llc Targeted gene modification using oligonucleotide-mediated gene repair
EP2966980A4 (en) 2013-03-15 2016-12-28 Cibus Us Llc Methods and compositions for increasing efficiency of increased efficiency of targeted gene modification using oligonucleotide-mediated gene repair
CN105283561A (en) 2013-04-04 2016-01-27 佐治亚州立大学研究基金会公司 RNA microchip detection using nanoparticle-assisted signal amplification
WO2015006740A2 (en) 2013-07-11 2015-01-15 Alnylam Pharmaceuticals, Inc. Oligonucleotide-ligand conjugates and process for their preparation
US9163284B2 (en) 2013-08-09 2015-10-20 President And Fellows Of Harvard College Methods for identifying a target site of a Cas9 nuclease
ES2917573T3 (en) 2013-09-18 2022-07-08 Aura Biosciences Inc Production method of photosensitive molecules
WO2015074010A2 (en) 2013-11-18 2015-05-21 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for cardiac regeneration
EP3116305B1 (en) 2014-03-14 2023-12-06 Cibus US LLC Methods and compositions for increasing efficiency of targeted gene modification using oligonucleotide-mediated gene repair
AU2015298571B2 (en) 2014-07-30 2020-09-03 President And Fellows Of Harvard College Cas9 proteins including ligand-dependent inteins
BR112017001860A2 (en) 2014-07-31 2018-02-27 Uab Research Foundation synthetic peptide, pharmaceutical composition, methods, dosage regimen, and monoclonal antibody
WO2016061131A1 (en) 2014-10-14 2016-04-21 The J. David Gladstone Institutes Compositions and methods for reactivating latent immunodeficiency virus
US10723794B2 (en) 2015-03-18 2020-07-28 University Of South Carolina Anti-CcL8 antibodies and uses thereof
EP3331536A4 (en) 2015-08-03 2019-03-27 The Regents of The University of California Compositions and methods for modulating abhd2 activity
EP3368656A4 (en) 2015-10-30 2019-07-17 The United States of America, as represented by the secretary, Department of Health and Human Services Targeted cancer therapy
KR102162324B1 (en) 2015-10-30 2020-10-07 제넨테크, 인크. Anti-HtrA1 antibodies and methods of use thereof
JP2019506170A (en) 2016-02-09 2019-03-07 キブス ユーエス エルエルシー Methods and compositions for increasing the efficiency of targeted gene modification using oligonucleotide mediated gene repair
MA45349A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc EGFR NUCLEIC ACIDS AND THEIR USES
MA45469A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc BETA-CATENIN NUCLEIC ACIDS AND THEIR USES
MA45471A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc PHOSPHATIDYLINOSITOL-3-KINASE NUCLEIC ACIDS AND THEIR USES
MA45468A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc MYC NUCLEIC ACIDS AND USES
MA45470A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc KRAS NUCLEIC ACIDS AND THEIR USES
US10905710B2 (en) 2016-05-24 2021-02-02 Emory University Particles with RNA cleaving nucleobase polymers and uses for managing inflammatory disorders
WO2018026943A1 (en) 2016-08-03 2018-02-08 H. Lee Moffitt Cancer Center And Research Institute, Inc. Tlr9 targeted therapeutics
CN109804066A (en) 2016-08-09 2019-05-24 哈佛大学的校长及成员们 Programmable CAS9- recombination enzyme fusion proteins and application thereof
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
CA3049424A1 (en) 2017-01-06 2018-07-12 Avidity Biosciences Llc Nucleic acid-polypeptide compositions and methods of inducing exon skipping
WO2018165504A1 (en) 2017-03-09 2018-09-13 President And Fellows Of Harvard College Suppression of pain by gene editing
GB201711809D0 (en) 2017-07-21 2017-09-06 Governors Of The Univ Of Alberta Antisense oligonucleotide
JP2020534795A (en) 2017-07-28 2020-12-03 プレジデント アンド フェローズ オブ ハーバード カレッジ Methods and Compositions for Evolving Base Editing Factors Using Phage-Supported Continuous Evolution (PACE)
EP3676376A2 (en) 2017-08-30 2020-07-08 President and Fellows of Harvard College High efficiency base editors comprising gam
WO2019079347A1 (en) 2017-10-16 2019-04-25 The Broad Institute, Inc. Uses of adenosine base editors
WO2019113393A1 (en) 2017-12-06 2019-06-13 Avidity Biosciences Llc Compositions and methods of treating muscle atrophy and myotonic dystrophy
WO2019140009A1 (en) 2018-01-09 2019-07-18 Cibus Us Llc Shatterproof genes and mutations
MX2021007368A (en) 2018-12-21 2021-07-15 Avidity Biosciences Inc Anti-transferrin receptor antibodies and uses thereof.
WO2020191249A1 (en) 2019-03-19 2020-09-24 The Broad Institute, Inc. Methods and compositions for editing nucleotide sequences
KR20220053599A (en) 2019-08-14 2022-04-29 아퀴타스 테라퓨틱스 인크. Improved Lipid Nanoparticles for Delivery of Nucleic Acids
AU2021237465A1 (en) 2020-03-19 2022-10-13 Avidity Biosciences, Inc. Compositions and methods of treating Facioscapulohumeral muscular dystrophy
KR20220161378A (en) 2020-03-27 2022-12-06 어비디티 바이오사이언시스 인크. Compositions and methods for the treatment of muscular dystrophy
MX2022014008A (en) 2020-05-08 2023-02-09 Broad Inst Inc Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence.
WO2022097157A2 (en) 2020-11-09 2022-05-12 1E Therapeutics, Ltd. Catalytic sequence based methods of treating or preventing bacterial infections
JP2024500804A (en) 2020-12-18 2024-01-10 イェダ リサーチ アンド ディベロップメント カンパニー リミテッド Compositions and methods for their identification for use in the treatment of CHD2 haploinsufficiency
WO2022144883A2 (en) 2020-12-28 2022-07-07 1E Therapeutics, Ltd. P21 mrna targeting dnazymes
IL304047A (en) 2020-12-28 2023-08-01 1E Therapeutics Ltd P21 mrna target areas for silencing
IL307298A (en) 2021-03-31 2023-11-01 Entrada Therapeutics Inc Cyclic cell penetrating peptides
CA3218805A1 (en) 2021-05-10 2022-11-17 Ziqing QIAN Compositions and methods for intracellular therapeutics
WO2022240760A2 (en) 2021-05-10 2022-11-17 Entrada Therapeutics, Inc. COMPOSITIONS AND METHODS FOR MODULATING mRNA SPLICING
WO2022240721A1 (en) 2021-05-10 2022-11-17 Entrada Therapeutics, Inc. Compositions and methods for modulating interferon regulatory factor-5 (irf-5) activity
KR20240038967A (en) 2021-06-23 2024-03-26 엔트라다 테라퓨틱스, 인크. Antisense compounds and methods for targeting CUG repeats
WO2023014938A1 (en) 2021-08-05 2023-02-09 Sanegene Bio Usa Inc. 1'-alkyl modified ribose derivatives and methods of use
AU2022345098A1 (en) 2021-09-16 2024-04-04 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
CA3233113A1 (en) 2021-09-22 2023-03-30 Sanegene Bio Usa Inc. 2'-alkyl or 3'-alkyl modified ribose derivatives for use in the in-vivo delivery of oligonucleotides
US20230227480A1 (en) 2021-10-05 2023-07-20 Sanegene Bio Usa Inc. Polyhydroxylated cyclopentane derivatives and methods of use
WO2023144792A1 (en) 2022-01-31 2023-08-03 Genevant Sciences Gmbh Poly(alkyloxazoline)-lipid conjugates and lipid particles containing same
WO2023144798A1 (en) 2022-01-31 2023-08-03 Genevant Sciences Gmbh Ionizable cationic lipids for lipid nanoparticles
US20230346819A1 (en) 2022-02-22 2023-11-02 Sanegene Bio Usa Inc. 5'-modified carbocyclic ribonucleotide derivatives and methods of use
WO2024015796A1 (en) 2022-07-11 2024-01-18 Sanegene Bio Usa Inc. Optimized 2'- modified ribose derivatives and methods of use

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
CA1340323C (en) * 1988-09-20 1999-01-19 Arnold E. Hampel Rna catalyst for cleaving specific rna sequences
DE3928900A1 (en) 1989-08-31 1991-03-07 Europ Lab Molekularbiolog New psoralen-modified nucleotide derivatives - used as anti-sense nucleotide(s) in the treatment of viral infections, e.g. AIDS
US5215899A (en) * 1989-11-09 1993-06-01 Miles Inc. Nucleic acid amplification employing ligatable hairpin probe and transcription
NO904633L (en) * 1989-11-09 1991-05-10 Molecular Diagnostics Inc AMPLIFICATION OF NUCLEIC ACIDS BY TRANSCRIPABLE HAIRNEL PROBE.

Also Published As

Publication number Publication date
EP0519463B1 (en) 1998-10-21
EP0519463A1 (en) 1992-12-23
JP3512818B2 (en) 2004-03-31
DE59209895D1 (en) 2001-04-19
EP0845476B1 (en) 2001-03-14
AU658634B2 (en) 1995-04-27
DK0519463T3 (en) 1999-06-28
ES2155959T3 (en) 2001-06-01
DE4216134A1 (en) 1992-12-24
JPH06128284A (en) 1994-05-10
JP2004123754A (en) 2004-04-22
JP2001069972A (en) 2001-03-21
PT845476E (en) 2001-07-31
EP1061085A3 (en) 2003-08-13
EP1061085A2 (en) 2000-12-20
ATE172468T1 (en) 1998-11-15
JP4027305B2 (en) 2007-12-26
AU1824992A (en) 1992-12-24
DE59209531D1 (en) 1998-11-26
EP0845476A3 (en) 1998-06-10
DK0845476T3 (en) 2001-06-25
ATE199725T1 (en) 2001-03-15
US5334711A (en) 1994-08-02
EP0845476A2 (en) 1998-06-03
CA2071446A1 (en) 1992-12-21
ES2124712T3 (en) 1999-02-16

Similar Documents

Publication Publication Date Title
CA2071446C (en) Synthetic catalytic oligonucleotide structures
US6239272B1 (en) 2&#39;-O-alkylthioalkyl and 2&#39;-c-alkylthioalkyl-containing nucleic acids
US6365374B1 (en) 2′-deoxy-2′-alkylnucleotide containing nucleic acid
US5627053A (en) 2&#39;deoxy-2&#39;-alkylnucleotide containing nucleic acid
EP0866865B1 (en) Chimeric oligomers having an rna-cleavage activity
US5783425A (en) Amino and peptido modified enzymatic nucleic acid
US6831171B2 (en) Nucleic acid catalysts with endonuclease activity
JP2002510207A (en) Hammerhead ribozymes with extended cleavage rules
AU665113B2 (en) Oligoribonucleotide and ribozyme analogs with terminal 3&#39;-3&#39; and/or 5&#39;-5&#39; linkages
Zon Oligonucleoside phosphorothioates
AU687479B2 (en) Base-modified enzymatic nucleic acid
JP3855117B2 (en) Combined antisense library
AU781297B2 (en) Chimeric DNA/RNA ribozymes containing propanediol
Cramer et al. Nucleotides LXIV [1]: Synthesis, hybridization and enzymatic degradation studies of 2′-O-methyl-oligoribonucleotides and 2′-O-methyl/deoxy gapmers
AU730347B2 (en) Base-modified enzymatic nucleic acid
JPH08205869A (en) Miniribozyme, stabilized miniribozyme, method for cutting target rna using the same and agent

Legal Events

Date Code Title Description
EEER Examination request
MKLA Lapsed