CA2106315C - Gene construct for production of transgenic fish - Google Patents

Abstract

An "all fish" chimeric gene construct suitable for gene transfer for commercially important fish comprises the antifreeze gene (AFP) promoter fused to the desired gene sequence which is incorporated into fish embryos. The desired gene sequence is expressed in the transfected fish to provide a transgenic fish having the characteristics of the gene sequence,

Description

I
GENE CONSTRUCT FOR PRODUCTION
OF TRANSGENIC FISH
FIELD OF THE INVENTION
This invention relates to transgenic fish and an "all fish" promoter sequence useful in developing transgenic fish.
BACKGROUND OF THE INVENTION
Throughout the :specification, several articles are referred to in ordex- to provide complementary information regarding the invention. The complete citations for those references arEe provided below:
Agellon, L.B., Emery, C.J., Jones, J.M., Davies, S.L., Dingle, ~~.D. and Chen, T.T. (1988) Promotion of rapid growth of rainbow trout (Salmo gairdneri) by a recombinant fish growth hormone. Can. J. Fish.
Aquatic Sci. 45:146-151.
Cantilo, E. and Regalado, T. G. (1942) Investigacione:~ realizadas con el extracto anterohysofisax-io en el desarrollo del Salvelinus Fontinalis. Rear. Med. Vet. (Buenos Aires) 24:323-338.
Chen, T. T., L__n, C. M., Zhu, Z., Gonzalez Villasenor, L. I., Dunham, R. A., and Powers, D. A.
(1990) Gene transfer, expression and inheritance of rainbow trout tend human growth hormone genes in carp and loach. pp :_27-139 In Transgenic Models in Medicine and Agriculture, Wibey-Liss, mc, N.Y..

21~~~1~

Chen, S. and Evens, G. A. (1990) A simple screening method for transgenic mice using the polymerase chain reaction. Biotechnioues, 3:32-33.
Chong, S. S. C., and Vielkind J. R. (?989) Expression and fate of CAT reporter gene microinjected into fertilized medaka (Cryazias latipes) eggs in the form of plasmid DNA, recombinant phage particles and i:.s DNa. '~::ecr.
Appl. Genet. 78 : 369-380.
Connelly, S. and Manley, J. L. ( 1900"; __ °unc-;.ior.al mRNA polyadenylation signal i~ required for transcription termination by RNA pol_".,erase II.
Gen. Dev. 2:440-452.
Davies, L. G., Dibuer, M. D, and Battey, J. F.
(1986) Basic Methods in Molecular Biology. Elsevier Science~Publ~shing Co.
Davies, P. L., Flatchar, G. L, and Hew, C. L.
(1989) Fish antifreeze protein genes and their use in transgenic studies. in: Oxford Surveys on Eukaryotic Genes, 6: 85-110. Edited by Norman Maclean, Published by Oxford University Press.
Davies, P. L. and Hew, C. L. (1990) Biochemistry o!
fish antiiraeze proteins. The FASEe Journal, 4 : 2460-2468 .
~0 D~ Simona, V, and Cortese, R. (1988) Tha transcriptional regulation o! liver-specific gene expression. p. 51-90. Zn: Oxtord surveys on aukarytotic genes. N. Maclean (Ed.) oxford 3s tiniVSrsity Press, NY.

Du, S. J., Gong, Z.,, Fletcher, G. L., Shears, M. A., King, M. J., Idler, D. R. and Hew, C. L. (1992) Growth enhancement in tran:~genic Atlantic salmon by the use of an "all fish" chimeo~:ic growth hormone gene construct.
Bi o/Technol ogy, 10 : .L 7 6-181 .
Fletcher, G. L. and Davies, P. L. (1991) Transgenic fish for aquaculture. p. 331-370. In: Genetic Engineering, Princip:Les and methods. J. K. Setlow (Ed.) Plenum Press, NY.
Fletcher, G, L., Shears, M A., King, M. J., Davies, P. L.
and Hew, C. L. (1988) Evidence for antifreeze protein gene transfer in At=Lantic salmon (Salmo Salary. Can. J.
Fisheries and Aquatic Sciences, 45:352-357.
Fletcher, G. L., Id__er, D. R., Vaisius, A. and Hew, C. L.
(1989) Hormonal regulation of antifreeze protein expression in winter_ flounder. Fish Physiology and Biochemistry, 7:387--393.
Friedenreich, H. and Schartl, M. (1990) Transient expression directed by homologous and heterologous promoter and enhancer sequences in fish cells. Nucleic Acids Research, 18::3299-3305.

Gill, J. A., Sumpter, J. P., Donaldson, E. M., Souza, L., Berg, T., wypycrl, J. and Langley, K. (1985) Recombinant chicken and bovine growth hormones accelerate growth in aquacultured juven:il.e Pacific salmon, (Oncorhynchus kisutch). Bio/Technology, 3:643-646.
Gong, Z. Y., Vielkind, J., Hew, C. L., (1991) Functional analysis and temporal expression of fish antifreeze gene promoters in Japanew~e medaka embryos. Mol. Marine Biol.
Biotech. 1:64-72 Guyomard, R., Chourrout, D., Leroux, C., Houdebine, L. M.
and Pourrain, F. (1.989) Integration and germ line transmission of foreign genes microinjected into fertilized trout eggs. Biochimie, 71:857-863.
Hanley, T., and Merl.ie, J. P. (1991) Transgene detection in unpurified mouse tail DNA by polymerase chain reaction. BioTechn.iques. 10:56-56.
Hew, C. L., Slaughter, D., Joshi, S. B., and Fletcher, G.
L. (1984) Antifreeze polypeptides from the Newfoundland ocean pout, Macrozoarces americanus:
Presence of multiple and compositionally diverse components. J. Com~~arative Physiology B, 155:81-88.

5 Hew, C. L., Wang, N. C., Joshi, S., Fletcher, G.L., Scott, G. K., Hayes,, P. H., Buettner, B. and Davies, P. L. (1988) Multiple genes provide the basis for antifreeze protein <~iversity and dosage in the Ocean Pout (Macrozoares arnericanus) . J. Biol . Ch em. , 263:12049-12055 Hew, C. L., Trinh, K. Y., Du, S. J., and Song, S.
D. (1989) Molecular cloning and expression of salmon pituitary hormones. Fish Physiology and Biochemistry, 7:375--:380.
Hew. C. L. (1989) Transgenic fish: present status and future directions. Fish Physiol. Bioch. 7:409-413.
Hoar, W. S. (1988) ~Che physiology of smolting salmonids.
in Fish Physiology, ~JOl. 11:275-343. edited by Hoar, W.
S. and Randall, D. J. Academic Press.
Kawauchi, H Moriyama, S., Yasuda, A., Yamaguchi, K.
Shirahata, K. , Kubot:a, J. and Hirano, T. (1986) Isolation and characterization of Chum salmon growth hormone. Archives c~.f Biochemistry and Biophysics, 244:542-552.
Li, X., Trinh, K., Hew, C. L., Buettner, B., Baenziger, J. and Davies, P. L. (1985) Structure of an antifreeze polypeptide and its precursor from the ocean pout, Macrozoarces americanus. J. Biol. Chem.
260:12904-12909.
Liu, Z., Moav, B., Faras, A. J., Guise, K. S., Kapuscinski, A. R. and Hackett, P. B. (1990b) Develapment of expression vectol-s for transgenic fish.
Bio/Technology 8:1268-1272.
Luckow, B., and Schutz, G. (1987) CAT construction with multiple unique restriction sites for the functional analysis of eucaryot:_ic promoters and regulatory elements.
Nucleic Acids Res., 15:5490.
Maclean, N., Penman,, D. and Zhu, Z. (1987) Introduction of novel genes into fish. Bio/Technology 5:257-261.
Maclean, N. and Penman, D. (1990) The application of gene manipulation to aquaculture. Aquaculture 85:1-20.
Palmiter, R. D., Brinster, R. L., Hammer, R. E., Trumbauer, M. E., Rasenfeld, M. G., Birnberg, N. C. and Evans, R. M. (1982) Dramatic growth of mice that develop from eggs microinje<~ted with 7 92/16618 ~~ ~ J .. ~J ~ PCT/CA92/00109 metallothionein-growth hormone fusion genes. Nature, 300:611-615.
Proudfoot, N. J. (1989) How RNA polymerase II
terminates transcription in higher eukaryotes.
TIES. 14:105-1 10.
Rokkones, E., Alestrom, P., Skjervold, H. and Gautvik, K. M. (1989) Microinjection and expression l0 of a mouse metallothionein human growth hormone Fusion gene in fertilized salmonid eggs. J. Comp.
Physiol. B., 158:751-758.
Schorpo, M., Kugler, W., Wagner, U. and Ryffel, G.
U. 1988. Hepatocyte-specific promoter element HPI
of the xenopus albumin gene interacts with transcriptional factors of mammalian hepatocytes.
J. Mol. B3ol. 202:307-320.
Sekine, S., Irlizukami, T., Nishi, T., Kuwana, Y., Saito, A., Sato, lrl., Itoh, S., aad Kawauchi, H.
(1985) Cloning and expression o! cDNA !or salmon growth hormone in E. cola. Proc. Patl. Acad. Sci.
U. S. A., 82:4306-4310.
Shears, M. A., Fletcher, G. L. Haw, C. L. Gauthiar, S. and Davias, P. L. (1991) Trans!er, axprassion, and stable inheritance o! antilreaze protein genes in Atlantic salmon (Salmo salary. Mol. Marine 8101. 8lotech. 1:s8-63.
Tuckmann, H. (1936) Action de l~hypophyss sur la morphoganasa et la di!lerentiation saxusella de Girardinus Guppii. C.R. Soc. B~oI. 122:162-164 3s Vialkind, J., Haas-Andela, H., Vielkind, U. and Andars, F. (1982) Tha induction o! a spaci!ic ~~~~:~1~

pigment cell type by total genomic DNA injected into the neural crest region of fish embryos of genus (Xiphophorus). Mol. Gen. Genet. 185 : 379-389.
Vize, P. D., Michalska, A. E., Ashman, R., LLoyd, B., Stone, B. A., Quinn, P., Wells, J. R. E. and Seamark, R. F. (1988) Introduction of a porcine growth hormone fusion gene into transgenic pigs promotes growth. J. Cell Science, 90 : 295-300.
Yanisch-Perron, C., Vieira, J. and Messing, J.
(1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUCl9 vectors. Gene 33:103-119.
Zafarullah, M., Bonham, K. and Gedamu, L. (1988) Structure of the rainbow trout metallothionein B
gene and characterization of its metal-responsive region. Mol. Cell 8iol., 8:4469-4476.
Zhang, P., Hayat, M., Joyce, C., Gonzalez-villasenor, L. I., Lin, C. M., Durham, R. and Chan, T. T. and Powers, D. A. (1990) Gane transfer, expression and inheritance of pRSV-rainbow trout GHcDNA in the common carp, Cyprinus carpio (Linnaeus). Molecular Reproduction and Development, 25:3-13.
Zhou, J. A., McIndoa, A., Davies, H., Sun, X. Y, and Crawford, L. (1991) The induction of cytotoxic T-lymphocyte precursor cells by recombinant vaccinia virus expressing human papillomavirua type 16 Ll.
V~.rology 181:203-210.
' 3S Zhu, Z., Liu., G., He, L. and Chen, S. (1985) Novel . gene transfer into fertilized eggs o! goldfish (Carassius auratus L. 1758). Z. Angew. Ichthyol., 1:31-34.
Zhu, Z. , Xu, K.. , Li, G. , Xie, Y. and He, L. (1986) Biological effects of human growth hormone gene microinjected ~_nto the fertilized eggs of loath (Misgurnus anguillicaudatus). Kexue Tongbao, 31: 988-990.
A variety of attempts and successes have been made in developing transc~enic fish and other animals. Growth hormone has been of particular interest in past investigations. Growth hormone is a single chain polypeptide hormone that plays a principal role in the regulation of somat~_c growth and development in animals.
Many approaches have been made to increase fish growth by growth hormone. These include the feeding of pituitary extracts (Tuckmann :.936), injection or implantation of purified recombinant=-derived growth hormone (Gill et al.
1985, Sekine et al. 1985, Kawauchi et al. 1986, Agellon et al 1988). All these results clearly showed that growth hormone alone is effective in stimulating fish growth. However, a7_=L these studies have limited application in aquaculture, and one major drawback is that the phenotype c:an not be inherited.
Gene transfer technique has become a new and powerful approach to manipulate the genetic and phenotypic characteristic of both animals and plants.
Various reports have been made in the production of transgenic fish. Tree first transgenic study on fish was reported by Vielkind et al. (1982). These investigators injected swordtail tumour genes into the Platyfish, and found that the injected swordtail Tu genes could induce T-melanophore induct=ion in Tu-free Platyfish. In 1985 and 1986, Zhu et al.. reported the production of transgenic fish by growth hormone gene transfer. Using a mouse metallothioneun promoter ligated to a human GH

21;3~~1.~

structural gene, they successfully produced transgenic loach, goldfish and silver carp. On the average, the transgenic fish was 1 to 3 times larger than control.
Since then, several reports using similar gene constructs 5 have been published (Rokkones et al. 1989, Guyomard et al. 1989, Chen et al. 1990). Further work has also been reported in Maclean et al 1987; Hew 1989; Maclean and Penman 1990 and Fletcher and Davies 1991. The earlier GH
gene transfer studies on fish were made by using 10 mammalian metallothionein promoters or viral promoters and hunan or rat GH genes. (Zhu et al. 1980, Rokkones et al. 1989, Guyomard et al. 1989 and Chen et al. 1990).
Them are two problems associated with using those heterologous gene constructs. First, the transgenic fish 1~ produced using mammalian GH genes may not be suitable or acceptable for human consumption. Secondly, it has been reported by Friedenreich and Schartl (1990) that the mammalian GH gene could not be spliced sufficiently in fish cell line in vitro, and they could not detect the expression o! the GH gene in fish cells. This may explain why Rokkones et al. (1989) and Guyomard et al (1989) could not observe faster growth in their transgenic fish by using mammalian metallothionein-mammalian GH fusions or viral promoter-mammalian GH
genes. Zhang et al. (1990) and Chen et al. (1990) used the rainbow trout GH gene for gene transfer in Carp and Loach, using the rstrovirus promoter. However, the tranegenic lash in those investigations were only 20%
larger than the controls, and the trout GH gene used licked the signal sequence needed !or the proper secretion and action o! GH.
Most, i! not all o! these studies were carried out by using either mammalian GH or mammalian gene and viral promoters. To be acceptable in aquaculture, the promoter(e) and genes) used in transgenie fish should be derived preferably !rom !ish protein genes to avoid the possibility o! any potential health hazards. Furthermore ~'~ ~ i'~
»~
~ 92/16618 PCT/CA92/00109 the production of a strain of faster growing fish in an economically important species such as salmonids with an "all fish" gene construct will be beneficial to fish farming.
Recently, an "all fish" expression vector using the carp bets-actin promoter has been published (Liu et al., 1990b). One problem of great concern with this vector is that the vector uses the polyadenylation signal from the chinoo:c sal.~"on GH cDNA (Hew et al., 1989) as the transcription termination signal. However, transcription termination requires both a functional polyadenylation signal ant a GT-rich downstream element (Connelly and i'lanely, 1988; Proudfoot, 1989). Therefore, the polyadenvlation signal of the GH cDNA is most likely insufficient to function as a transcription termination signal. Secondly, the beta-actin promoter is expressed in most if not all tissues or laks tissue-specificity.
~BY OF THE INVENTION
According to an aspect of the invention, a promoter sequence for use in constructing a chimeric gene construct for incorporation in fish genome to produce a transgenic fish comprises a DNA sequence having characteristics functionally corresponding to the antifreeze protein 2.1 kb promoter derived from Ocean pout as a Bam H1 - BglII fragment of OP-AFP gene sequence of following Figure lA.
According to another aspect of the invention, a promoter sequence wherein the DNA sequence comprises a sequence of following Table V from 5' end a base pair position 1 to base pair position 2115.
According to a further aspect of the invention, a transcriptional terminal sequence for use in constructing a chimeric gene construct for incorporation in fish ganome to produce transgenic fish. The terminal sequence comprises a DNA sequence having characteristic functionally corresponding to the Hpa-Z - Aat II fragment of OPS gene sequence of following Figure 18.

n 21~ ~.~1~

According to another aspect of the invention, a promoter/transcriptional terminal sequence for use in constructing a chimeric gene construct for incorporation in a fish genome. The combined sequence includes a 5~
untranslated sequence between said promoter and terminal sequences. The combined sequence has a sequence of following Table V with unique restriction sites of BglII
at base pair position 2116 and of HpaI at base pair position 2188.
According to another aspect of the invention, the promoter/terminai sequence is adapted to express a chimeric gene sequence inserted at the BglII site or the Hpal site and encoding fish hormone, fish growth hormone, antifreeze protein or disease-resistance proteins.
According to another aspect of the invention, a gene expression vehicle has a restriction map of following Figure 11. The gene has a sequence inserted at the BglII
site or at the HpaI site.
According to another aspect of the invention, a promoter sequence has a DNA sequence !or promoting expression of chimeric gene sequences in fish. The promoter sequence is derived lrom antifreeze protein (AFP) or antifreeze glycoprotein (AFGP) of fish genome.
The promoter sequence functions when provided in an expression vehicle the same as the promoter sequence of following Table V from the 5~ and of the BglII site.
According to another aspect of the invention, a promoter sequence further comprises a DNA responsive element to render the promoter sequence responsive to the ~l~ment ~n vtvo.
According to another aspect of the invention, a promoter sequence wherein the promoter DNA sequence is modified in portions thereof to alter its promoter activity.
According to another aspect of the invention, a host transformed with the chimeric gene construct comprising the subject promoter.

p CA 02106315 2003-10-22 12a According to another aspect of the invention, an expression cassette for promoting fish growth comprises a fish growth hormone gene operably linked to a type ITI
antifreeze protein (AFP) promoter and to a transcription termination signal.
According to another aspect of the invention, an assay for determining the presence of an expression cassette comprising a fish growth hormone gene operably linked to a type III AFP promoter and to a transcription termination signal, wherein the promoter comprises the sequence of Table V from 5' end at base position 1 to base position 2115, comprises the steps of:
(i) amplifying by a DNA sequence amplification technique a portion of expression cassette having a DNA
sequence which is a portion of the promoter sequence of Table V; and (ii) detecting the presence of the amplified DNA.
According to a further aspect of the invention, a transgenic fish characterized by having incorporated in its genome a chimeric gene construct comprises:
(i) the promoter sequence; and (ii) a gene sequence which, when expressed, exhibits a desired character for said transgenic fish.
According to a further aspect of the invention, a process for producing a transgenic fish comprises introducing a chimeric gene construct into fertilized fish embryos. The construct comprises the promoter sequence.
According to a further aspect of the invention, a process for producing a transgenic fish comprises the steps of r (i) preparing an expression cassette comprising a fish growth hormone gene.operably linked to a type III antifreeze protein (AFP) promoter and to a transcription termination signal;
(ii) introducing the expression cassette into a fertilized fish embryo; and (iii)allowing the embryo to develop into a transgenic fish.
According to another aspect of the invsntion, an assay !or determining a transgenic fish comprises:
i) amplifying by PCR techniques a portion of fish genome having a DNA sequence which is a portion o! the promoter sequance; and ii) detecting presence of the amplified portion to indicate a transgenic fish.
According to an aspect of the invention, the successful production of transganic Atlantic salmon is produced by using a fish gene promoter derived from ocean pout antifreeze gene (OP-AFP), (New et al. 1988) and the GH cONA gene from Chinook salmon (Hew st al. 1989).
According to another aspect of the invention, an gall fish" promoter for use in constructing a chimaric gent construct is provided. The promoter comprises an antifreeze gene (AFP), promoter having characteristics functionally corresponding to the AFP promoter derived from ocean pout and 3' sequence containing the normal RNA
transeriptional termination signal. Tha promoter is ,::aractarized by a ~ :b oam HI - 8glII lragmant of OP-AFP
of the following Figures la and ib and Table I. The 7'saquenca is characterized by the 1 kb HpaI ~ Hind III
fragment in Figure ib. Functional analysis o1 other antifreeze gene promoters, including those isolated from wolttish~(w0), sea raven (SR) and wintsr flounder (wF), shows that they can ba used in a similar fashion (Table II). Here only the ocean pout antifreeze protein promoter is used as an example in producing transgenic fish.
The invention provides specific embodiments, such as the analysis of transient expression of the OP-AFP gene promoter activities in a salmonid cell line and the Japanese medaka embryos, the construction of AFP-GH
fusion gene, and its gene transfer by microinjection, screening of transgenic salmon by polymerise chain reaction (PCR), and size and growth rate measurements.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. (A). Construction of pOP-CAT for transient CAT assay in salmonid cell lines and Japanese medaka embryos. T'he plasmid is named as pOPSH. (B).
Construction of al.l fish chimeric gene (pOP-GHe) for gene transfer;
Figure 2. Strategy of PCR analysis. Three sets of primers were used to detect the presence of transgene.
The distance between primers are 813 by for primer A and 8, 335 by for primers A and D, 119 by for primers C and D
(sequencing studies gave more refined data for the distance between primers; i.e., 855 by for primer A and B; 333 by for primers A and D; 199 by for primers C and D) ;
Figure 3. Analysis of the OP-AFP promoter activity in rainbow trout hepatoma cells by CAT assay. The ocean pout-GT plasmid is pOPSB;
Figure 4. Time course analysis of GT expression in embryos injected with OP-CAT (pOP5B). A pool of live embryos were used for CAT assay of i~day, 2 day, 4 day, 6 day, 8 day and 11 day embryos. Individual larva was used for the CAT assay of hatched medaka (one day after hatching). Embryos injected with pHLCAT3 was used as negative control;
Figure 5. Screening of transgenic salmon by PCR
using primers A/H. (Ar. Analysis of PCR amplified products by agarose gel electrophoresis. (H). Southern blot analysis of the PCR product by using GH specific probe E;
Figure 6. (A). Confirming the transgenic salmon by PCR using primers C:/D. (B). Study of the integrity of the 5 transgene by PCR using primers A/B;
Figure 7. The: size distribution of transgenic salmon and nontrans~genic salmon;
Figure 8. Tra,nsgenic salmon vs nontransgenic salmon;
10 Figure 9. Analysis of the opAFP gene promoter activity by CAT assay in two salmonid cell lines, wr.ich include the rainbow trout hepatoma cell line RTH-149 and the Chinook salmon embryonic cell line CHSE-214. The acetylated and non-acetylated chloramphenicols, as 15 indicated by AC and C on the right, were separated by thin layer chromatography, followed by autoradiogaphy;
Figure 10. CA.T expression in different stages of embryos injected with opAFP-CAT. Individual embryo was used for each CAT assay. The acetylated and non-acetylated chloramphenicols are indicated by AC and C on the right. The time points analyzed were day 1, day 2, day 6, day, 9 and day 11;
Figure 11 is a diagram of opAFP-V. o ocean pout AFP gene promoter and gene 3'-flanking sequences; r~
ocean pout AFP gene 5'-untranslated sequence; ~ , ocean pout AFP gene 3'-untranslated sequence; , pUC plasmid DNA sequence and ~ , Ampicillin resistance gene. The TATA box, the poly(A) signal (AATAAA) and the predicted transcription termination signal (TTTTTCT) are indicated. Restriction sites are:
A, AatII; Ba, BamHI; Bg, BglII; E, EcoRI; H, HindIII; Hp, Hpal; K, Kpnl; Sac, Sacl; Sal, Sall and Sm, Smal;
Figura 12. Transgenic salmon (~34, 33 g) and nontransgenic siblings (average weight 5-7 g); and Figure 13. Size-frequency distribution of salmon.
(A) Fish (200) were weighed in October 1990 and 50 were t~~ged and blood sampled for DNA analysis (solid bars).

1 fi The presence of individual transgenic fish is identified by T. (T) indicates a transgenic fish that was found to be possible by Scale DNA analysis only. (B.) All fish (484) in the aquari.u.m were weighed in January 1991 and blood sampled for DNA analysis. T indicates the presence of a transgenic salmon. (T) indicates a transgenic fish that was found to be positive by scale DNA analysis only.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention provides the successful production of transgenic fish with dramatic expression of the desired genetic trait. According to one embodiment of the invention, a chimeric gene, pOP-GHe was constructed by usin~~ antifreeze promoter linked to the Chinook salmon GH c:DNA clone. This gene construct pOP-GHe was microinjected into fertilized, nonactivated Atlantic salmon eggs via the micropyles. Transgenic Atlantic salmon carrying the transgene were generated with an incorporation frequency of at least 2%. The presence of transgene was detected by polymerase chain reaction using specific oligonucleotide primers. These transgenic fish showed dramatic increase in their weight and growth rate. At eight months old, the average increase of the transgenic fish was 4-fold and the largest transgenic :Fish was eight times bigger than the non-transgenic cont:=ols. These studies demonstrated that the AFP promoter wa:~ effective in producing large transgenic salmon and would be applicable to many different species of fish. Use of fish growth hormone with promoter of this invention will result in transgenic fish up to eight tunes larger than controls. This is the largest increase that has been reported to date for a transgenic fish. Cornparing with the 2-fold increase in transgenic mouse (Palmiter et al. 1982) and transgenic pig (Vine et al. 1988), these studies indicate that growth of transgenic salmon is more pronounced.
The data later presented in this specification demonstrate further the successful production of transgenic salmon by using a DNA construct derived from fish genes. In one aspect of our development of the invention, ocean pout antifreeze gene promoter and transcription termination signal were ligated with 10 Chinook salmon GH gene, both of which are derived from fish genes, therE~fore avoiding the problems associated with the use of raammaiian or viral genes for gene transfer in commercially important fish.
The following abbreviations are used:
opAFP Ocean pout antifreeze proteins.
opAFP-CAT A chimeric plasmid consisting of the ocean pout antifreeze protein promoter linked to the bacterialchloramphenicolacetyl transferase. (originally this product 20 was referred to as "pOP-CAT. During further development, we chose to identify it: as "opAFP-CAT" ) .
opAFP-GHc An "all fish" chimeric gene consisting of the ocean pout antifreeze protein promoter and 3' non-translated sequences linked to the fish growth hormone cDNA gc!:~e.
(C>riginally this product was referred to as "pOP-GHe. During further development, we chose to identify it as "opAFP-GHc").
30 opAFP-V An "all fish" gene cassette based on the use of the ocean pout antifreeze promoters and 3'non-translated saquencas.
The 2kb BamFiI - BglII fragment of OP-AFP
characteristic o!: the promoter was shown by sequencing 35 studies to have a length of 2.1 kb. The 3' sequence HpaI
- HindIII fragment was shown to have a length o! 1.1 kb.

The ocean pout AFP is a member of the type III AFP
(Davies and Hew 1990). It has approximately 150 gene copies (Hew et al. 1988, Davies et al. 1989). The protein and genomic structure of this AFP have been well characterized by us (Hew et al. 1984, 1988, Li et al.
1985). More recently, its promoter sequences have been investigated in both the salmonid cell lines and the Japanese medaka embryos (Gong et al. 1991. See Table II). The ocean pout AFP gene is expressed predominantly in liver cells (Gong et al. 1991).
Unlike the type l, alanine-rich AFP from the winter flounder which is synthesized only in the winter, the ocean pout AFP is present all year around, albeit at a higher concentration during the winter months (Fletcher et al. 1989). The following data demonstrate that the OP-AFP promoter is a very effective promoter for inducing CAT and GH gene or other desired compatible gene expression in fish, such as Atlantic salmon. Although there is no antifreeze (AFP) gene in salmonids or medaka genomes, it is likely in view of successful implementation of the invention that the transcriptional factors controlling the OP-AFP gene expression do exist in salmon and in all other fish. This is consistent with our earlier investigation in producing the transgenic Atlantic salmon using the type I antifreeze protein gene from the winter flounder (Fletcher et al. 1988). In that investigation, a DNA coding for the genomic sequence of the AFP gene and its 5' and 3' flanking sequences were used. Transgenic flounder animals and F1 generations producing circulating AFP in the serum were achieved (Shears at al. 1991). Our studies of the ocean pout promoter in the salmonid cell lines, the Japanese rnedaka embryos and the positive results from the transgenic Atlantic salmon indicate that the promoter is useful in a variety of fish species. The present AFP gene construct ~ 92/16618 PCT/CA92/00109 can be further developed into a gene cassette where many other fish genes of interest can be inserted.
The ocean pout AF? gene promoter is attractive in several respects. First of all, it is expressed predominantly in the liver, a tissue that has large synthetic and secretory capabilities. The expression of a transgene in liver is one of the most common approaches in gene transfer studies. Secondly, the AFP gene is present only in a s,~,all nu;,iber of fish species. Its expression will not be affec;.ed by the host genome, because there are no homologous endogenous genes.
Moreover, the absence o. the A:? gene in most fish genomes makes the detection of this AFP derived gene construct simple without any background contributed from the host DNA. This was clearly illustrated in our studies of transgenic Atlantic salmon (Du et al., 1992).
Finally, it has been shown that there are several positive and negative cis-acting elements in the opAFP
gene promoter (Gong et al. 1991). This provides an ZO opportunity to modily this vector in order to mast the different requirements of transgene expression.
We have also determined that adequate expression of the selected gene can be achieved by placing the 1.2 kb of opAFP gene 3' sequence in our vector opAFP-V. DNA
sequencing analysis shows that it contains a typical polyadenylation signal AATAAA. Moreover, a 7 by sequence moti! (TTTTTCT) was found 26 by downstream of the poly(A) signal. This 7 by moti! is a suitable transcription termination signal (TTTTTNT) as in virus (Zhou st al., 1991). Ths 1.2 kb sequence can therefore function as a 9enaral transcription termination signal in gene expression.
Tha development of the opAFP gene cassette; i.e.
opAFP-V, has greatly simplified the insertion of other genes for gene transfer. Transgenie salmon and other species o! trangsnic fish can bs produced with other ~~~=X15 pituitary hormones and many other proteins and polypeptides using this expression vector.
EXPERIMENTAL ?ROCEDURES - FIRST Sx'RIES OF EMBODIMENTS OF
THE INVENTION

A-1 Atlantic salmon eggs collection Mature Atlantic salmon (Salmo salary were captured 2-3 weeks prior to spawning from the exploits and Colinet rive. syste~s, Newfoundland, and transported live to the 10 ocean Sciences Centre, Memorial University of Newfoundland. The fish were maintained at seasonally ambian:. ~ho~opariod in 2 x 2 x 0.5 m aquaria supplied with freshwater and air.
eggs and sperms were stripped from salmon which had 15 been anaesthetized in a dilute solution of t-amyl alcohol. Eggs were kept in 4°C, and were fertilized up to 2h prior to microinjection and rinsed with several changes of ice-cold salmon Ringer solution. Activation occurred when the eggs were placed in fresh water after 20 microinjection (Flatcher et al. 1988).
71-Z lledalu egg collection Japanese medaka (Oryzias latipes) ware maintained at Dr. J. vielkind's laboratory, cancer research centre, Vancouver. The reproductive activities of the adults were induced with artificial photoperiod of 10 hours - darkness to 14 hours light. Fertilized eggs attached to lemslss were collected i-2 h after the onset of light and maintained in Ringer solution (0.751 NaCl, 0.021 KC1, 0.021 CaCil:, pH 7.3) at 12°C prior to injection. Injected medaka embryos were reared in medium containing o.i~
NaCl, 0.0032 KCl, 0.0041 CaCl::.2H=0, 0.0168 MgS0,.7Hi0, 0.0001 methylane blue and transferred to aquarium water immediately after hatching (Chong and Vielkind 1989>.
3s A-3 Plasmid construction a. Ocean pout antifreeze promoter-CAT fusion gene (pOP-CAT) .
The 2 kb Ban H1.-~Bgl II fragment containing the OP AFP promoter was subcloned into plasmid pBLCAT3 (Luckow and Schutz 1.987) at Bam HI, Bgl II sites to form OP-CAT fusion gene :Fig. 1A). Supercoil plasmids for transfection were pz-epared by ethidium bromide CsCl gradient centrifugation. The 2 kb Bam Hi - Bgl II
fragment is isolated from the gene sequence of the ocean pout AFP gene as de:~cribed in Hew et al (1988). The restriction map of plasmid op5 is shown in Table 1. The construction and promoter activities of other antifreeze promoters from othe~_ fish are also included in Table II.
b. Ocean pout antifreeze promoter-salmon growth hormone fusion gene . (pOP-GHe).
The 217 by Hinc~ III-Sau 3A fragment from plasmid OP5 containing the OP-Al~P promoter (Hew et al. 1988) of Table I, was subcloned info plasmid pBLCAT3 in pUC 18 (Luckow and Schutz 1987) at Hind III, Barn HI sites as illustrated in Fig. 1B. The plasmid was digested with BgIII, and then lig~~ted with a 73 by BgIII-Pst I
synthetic linker which contains the 5'-untranslated sequence of Chinook salmon GH gene. The GH gene has been characterized in Hew et al (1989) and is specifical=Ly outlined in the salmon growth hormone sequences of Table III. The ligated D:L~A was digested with Pst I and EcoRI, and the larger fragment containing the OP-AFP promoter, Chinook salmon GH 5'-untranslated sequences and pUC 18 sequence was purified by gel elution. This larger fragment was then ligated with a 709 by Pst I-EcoRI
fragment containing Chinook salmon GH coding sequence and part of 5' and 3'--untranslated region (Hew et al. 1989).
The resultant plasmid was cut with Hind III and cloned into a plasmid whi.cli contained the 2kb Bam H1-Hind III
flanking sequence from the ocean pout antifreeze gene promoter (Hew et al. 1988). This plasmid was then digested with Stu I and Aat II, and the larger fragment which contained the OP-AFP promoter and GH
coding region and part oL the GH 3~-untranslated sequence, was then ligated to a 1 kb Hpa I-Aat II
fragment fron OP5 plasmid which included the OP- AFP gene polyadenylation and the transcription termination signals (Heca e= al. .938). Subsequent DNA sequence determination showed that the 1 kb HpaI-AatII fragment is 1.6 kb in size. T. ~~r.tains the 1.1 kb :?paI-HindIII fragment during c=_ 0.'-5 piasmid and 0.5 kb HindIII-AaI fragment fro: c::e pi.,':: plasmid. The final construct was designated as pOP-G::a ;_-'_, 13) .
A-d T=aTsi~nt C?.T assay in salmon call lines RTH-149, a rainbow trout hepatoma cell line was kindly provided by Dr. L. Gedamu. The cells were maintained at i8°C in minimus essential medium supplemented with 25 mM HEPES buffer (Gibco). The fish calls were transfectad with DNA by calcium phosphate co-precipitation with glycerol shock and CAT assay were carried out essentially according to Davies et al.
(1986) and modified for fish cells by Zafarullah et al.
(1988).
A-5 Transient CAT assay in Japanese Madaka.
The Supercoiled pOP-CAT plasmid DNA (approximately 500 pl, lOs copies) was microinjectad into the cytoplasm of the fertilized medaka eggs prior to or immediately alter elsavaga. Phenol red was added to the DNA to a final concentration of 0.251 to aid in visualization of injection. CAT assays ware performed according to Chong arid Vielkind (1989). For 5 day embryos, batches of five embryos ware used for CAT assay. For hatched fish, individual fry was used for CAT assay.

A-6 Gene transfer i.n Atlantic salmon by microinjection.
The 4 kb insert in pOP-GHe was excised by EcoRI
digestion and dissolved in saline buffer at a concentration of 3 yg/ml. Approximately (2-3 nl, 106 copy) of the DNA in:~ert was injected through the micropyle into a fertilized, nonactivated salmon egg cytoplasm (Fletcher et al. 1988). Approximately 50G eggs were injected. The survival rate was 80 % as compared to the noninjected control.
A-7 Synthesis of oligonucleotide primers for PCR
For PCR analys:~s, four primers were synthesized by the Biotech Service Centre, Hospital for Sick Children, Toronto, Canada. A:~ shown in Figure 2, primer A, located at position +27 to -X47 relative to the TATA box, is from the sense strand of the OP-AFP gene promoter; Primer B, located at position +861 to +881 relative to the TATA
box, is from the an1=isense strand of the OP-AFP gene 3, flanking region. Primer C, located at position +161 to +181, is from the sense strand of GH coding sequence;
While primer D, loc~~ted at position +339 to +359, is from the antisense strand of GH gene.
Primer A + 27 5' -G'TCAGAAGTCTCAGCTACAGC- 3' + 47 sense strand Primer B + 861 5' -.ATCTCAACAGTCTCCACAGGT- 3'+ 881 antisense strand Primer C + 161 5' -TCTGCTGATGCCAGTCTTACT- 3' + 181 sense strand Primer D +. 339 5' -ACAGAAGTCCAGCAGGAATAT- 3' + 359 antisense strand W0 92/16618 PCT/CA92/00109 ~-~

A-8 DNA isolation from blood cells for PCR
Thirty microliters of blood was collected from one year old His::. One r,.icroliter of the blood was lysed in 50 ul of 10 mM NaOH, boiled in water bath for 3 min, then centrifuged for 3 min. Two microliters of the supernatant were used =or PCR directly.
A-9 ?C~ 3mD11=lC3LlOn PCR '~idS Carrled Out i., 7~ l:l r2aCtlOn SOlutlOn containing 50 ~;li4 RC1, 10 :~:4 Tr is, 2. 5 m2'i i~IgCl: , 1 uM of each pri;:==, Lour deo;~yrbonuclaotide Lriphosphate at 200 uM each, and 2.> >_.nits o. T=a DNA poly.~"erase (Promega), 100 ;sl of mineral oil '~ras added to prevent condensation.
Amplification was started by denaturating the DNA at 92°C
for 3 min, followed by 30 PCR cycles. Each cycle included 1 min at 92°C (denaturation), 1 min at 60°C
(annealing), and 2 min at 72°C (extension). After the final cycle, the reaction was held for another 10 min at 72°C in order to complete all the reaction. PCR was carried out by using the PTC-100 Programmable Thermal Controller (MJ Research, Inc. Ocala, FL).
11-10 llaalysis of the PClt product by agarose gel electrophoresis and southern blot Twenty microliters of the amplified product was subjected to electrophoresis on a 0.8~ agarose gel, and the DNA products were visualized by ethidium bromide staining. The DNA was transferred to a Nylon membrane (Am~rsham) !or Southern analysis. A 17 by GFI specific oligonuclaotids probe E, 5~ -GAAAATGTTCAATGACT- 3~, rrom s~qu~ne~ o! Chinook salmon GH cDNA a~nsa strand (+277 to.
+294) (Fig. 2) was end labelled with p'= by T4 kinase and used as probe !or Southern blot.
3S EZpEitIlIE~IT7IIr PROTOCOL - SECOND BERIEB OF EM80DIl~lENTB OF
T8E I:IVEIiTION

B-1. Alternative embodiment for construction of ocean Pout antifreeze promoter-CAT fusion gene (OpAFP-CAT) The 2.1 kb BamH:1-Bglll fragment containing the OpAFP
gene promoter was ex:cised from plasmid OpAFP-GHc2, it was 5 then cloned into pla_smid pBLCAT3 (Luckow and Schutz, 1987) at the Bam HI and BglII sites to form the opAFP-CAT
fusion gene.
B-2 Alternative cor~struction of an "all fish" expression 10 cassette OpAFP--V.
Plasmid opAFP-C~Hc2, derived from OpAFP-GHc by replacing the 73 by GH gene 5'-untranslated sequence with a 72 by OpAFP gene >'-untranslated sequence, was digested with Pst 1, then blunted with T4 DNA polymerase and 15 dephosphorylated wit=h calf intestinal alkaline phosphatase. It wa;~ then ligated to a phosphorylated 8 by HpaI linker (5' (:GTTAACG 3'). The resulting plasmid which contains the 2.1 kb OpAFP gene promoter, the 63 by opAFP gene 5'-untranslated sequence and the plasmid pUC
20 was digested with HpaI and SalI, and then ligated to the 1.2 kb HpaI-SalI fragment from OP-5 (Hew et al., 1988) which contains the c~pAFP gene 3'- sequence. The final construct was designated as vector opAFP-V. The DNA
sequence starting Ba and extending to the second HindIII
25 site H, in Fig. 11, contains 3350 bp, as in Table V.
B-3 Transient CAT assay in salmon cell, lines RTH- 149, a rainbow trout: hepatoma cell line and CHSE-214, a chinook salmon embryonic cell line, were kindly provided by Dr. L. Gedamu. University of Calgary, Canada. The cells were maintained at 18 oC in minimum essential medium supplemented with 25 mM HEPES buffer (Gibco). The fish cells were transfected with DNA by calcium phosphate co-precipitation with glycerol shock.
CAT assay were carried out essentially according to Davies et al. (1986) as modified for fish cells by Zafarullah et ai. (1988).
H-4 Transient CAT assays in Japanese m~daka Japanese medaka (Oryzias latipes) were maintained at Dr. J. Vielkind's laboratory, Cancer Research Centre, Vancouver. The reproductive activities of the adults were induced by artificial photoperiod according to the method reported by Chong and Vielkind (1989). Fertilized eggs attached to females were collected 1-2 h after the onset of light and maintained in Ringer solution (0.75 NaCl, 0.02 KC1, 0.02 CaCl~, pH 7.3) at 12°C prior to injection. Injected medaka embryos were reared in medium containing 0.1~ NaCl, 0.003 KC1, 0.004 CaClz.2H~0, 0.016; MgS0,.7Hi0, 0.0001 methylene blue and transferred ~o aquarium water immediately .:fter hatching.
Supercoiled opAFP-CAT plasmid DNA (approximately 500 pl, lOb copies) was microinjected into the cytoplasm of fertilized medaka eggs at the 1 or 2 cell stages. Phenol red was added t.o the DNA to a final concentration of 0.25 to aid visualization during injection. CAT assay were performed according to Chong and Vielkind (1989).
Individual embryos were used for each CAT assay.
H-s D1d71 s~quancing The didaoxy chain terminator sequencing method was used to sequence opAFP-V. A series of clones containing DNA fragments of different lengths were generated by EXO-3 nuclease deletion (Promega Erase-a-Base deletion kit). Double str~nnded DNA purified from these clones were used as templates for DNA sequencing (Phamacia sequencing kit).

_ ~, a_c~r3~.5 TEST RESULTS OF THE ABOVE PROCEDURES - ACCORDING TO THE
FIRST SERIES OF EMBODIMENTS
1. ocean pout AFP promoter can function in salmonid cells in vitro.
To test the effectiveness of the OP-AFP promoter, the OP-CAT construct was transfected into RTH 149 cell line for CAT assay. As showed in Figure 3, CAT activity was clearly detected. The level of CAT activity resulted from OP-CAT was comparable to that from pBLCAT2, which has the thymidine kinase promoter from Herpes simplex virus; however, when these cells transfected :with pBLCAT3, a promoterless CAT construct, little or na CAT
activity was detected. Similar results were obtained with Chinook salmon embryonic cells (CHSE-124) and Chum salmon heart cells (CHH-1). These results suggest that OP-AFP promoter can be used to target the GH gene expression in salmonids. Although the salmonids including the rainbow trout lack the AFP gene, these calls contain all the transcription lectors required !or the expression of the AFP gene.
Z. ocean pout 71F>' promoter can !unction in Japaaase riadal~a in vivo.
To further investigate the suitability of the OP-AFP
promoter in gene transfer, the OP-CAT construct was microinjected into medaka eggs. CAT activity was determined from embryos at different times during dwelopment. As showed in Figure 4, the CAT activity was lust detected at d8 hours attar the injection, the activity reached the maximum at 6-7 days, than the CAT
activity began to decline. However the CAT activity was still detectable even in the hatched fish (11-12 days).
In contrast, the CAT activity was not detected in the uninfected embryo or embryo injected with pBLCAT3. This result confirms that the OP-AFP promoter is active in a variety of fish species.

3. The PCR-based .ocreening strategy.
To screen for the presence of transgenic salmon, three different set:> of primers were used, Primers A/D, primers C/D and printers A/B (Fig. 2). The basis for' using primer A/B is that the sequences of primer A and Primer B are specific for OP-AFP gene, which are absent in Atlantic salmon, therefore DNA from the nontransgenic salmon can not be amplified when using primers A/B for PCR. Only the DNA from the transgenic fish can be amplified by using primer A/B, and will generate a 855 by DNA fragment by PCR.
The basis of u~>ing primers A/D is similar as using primer A/B. Although primer D is derived from Chinook salmon GM cDNA, and might hybridize with the endogenous Atlantic salmon GH gene, primer A is specific for the OP-AFP gene. Hence the DNA from nontransgenic fish can not be amplified by using primers A/D, only the DNA from transgenic fish can be amplified and generate a 333 by DNA fragment.
The basis for Using primers C/D is different from that of other two sets. The sequences for both primer C
and D are from the c:hinook salmon GH cDNA, which could hybridize with the Atlantic salmon GH gene, and therefore DNA from Atlantic s~ilmon can be amplified by using primer C/D. However there is an intron (intron 2) between primer C and primer D, the distance between primer C and primer D is 344 bp. Primers C/D will generate a 344 by fragment in all the DNA samples. The transgene pOP-GHe was constructed using Chinook salmon GH cDNA which lacks the intron and the distance between primer C and primer D
is 199 bp. Primers C/D will generate two fragments in transgenic salmon, a 344 by from the endogenous GH gene and a 199 by from tree GH cDNA insert.

~~I il~;?i.7 J 92/16618 ~ ~ ~ ~ PCT/CA92/00109 4. The identification of transgenic salmon by PCR.
Preliminary analysis of the DNA extracted from 100 one month old salmon embryos revealed that two of them (2%) contained the injected sequence (pOP-GHe).
Eight months after hatching, the salmon were large enough to tag for identification. At this time, 50 of the approximately 500 salmon in one aquarium were weighed and blood sampled for PCR analyses. These 50 included the 14 largest salmon in the aquaria (>8 gm body weight) and 36 additional fish with body weights ranging from 5 t0 14 gm.
The PCR analysis was carried out without the analyst knowing the size of any of the fish. In other words, the analysis was carried out "blind" in order to be certain to eliminate any bias by the analyst.
Eight month old Atlantic salmon developed from the eggs injected in November 1989 with pOP-GHe were bled in October 1990. The DNA from the nucleated blood cells were used directly for PCR analysis using primer A/D to determine the presence of the pOP-GHa transgene. Out o!
50 lish analyzed, eight were shown to ba positive. As showed in Fig. 5A, a 333 by fragment was generated from salmon #14, #20, #28, #31, #34, #42, #li, #25 and the positive control (pOP-GHe), in contrast this 333 by fragment was absent in the noninjected salmon. The size of the amplified fragment (333 bp) corresponded with the size predicted from the transgene sequence.
To conlirm that the amplified 333 by DNA fragment was derived lrom the transgana pOP-GHa, the DNA was translarrad to a nylon membrane for Southern blot hybridized with a GH specific probe E (Fig. 2) which was from the sequence between the primer A and primer D, and the result showed that all the 333 by hybridized with the probe E (Fig. 5B). This confirmed that the 333 by DNA
3s lragmant was in tact derived lrom the transgane pOP-GHa.
To iurthar eoalirm that the presence of transgans pOP-GHa in the positives, the DNA ware amplified by using 2~.~~'.31~
WO 92/16618 PCZ'/CA92/00109 primers C/D. As discussed in the screening strategy, the expected 344 by DNA fragment derived from the endogenous Atlantic salmon GH gene were pound in all the salmon analyzed. An additional smaller DNA fragment (199 bp) 5 were found from fish T14, X20, ;~28, .=31, m34 and #42, X11 and #25 (Fig. 6A). This 119 by fragment was derived from the Chinook salmon GH transge.~.e. Thasa positives mere the same ones as obtained by using primers A/D, thus confirming that fish ~1~, X20, :'23, ;=,1, ;=34, =42, X11 10 and X25 were transgenic salnons.
5. Ths GH coding regions cf v5a vi3a3g~a~a ~=: i3~:act is the traasgsnic salmoa.
To determine the int'grity o_ th=_ GH codincr seauence 15 of the transgene, primers A/5 sera us=d for PCR'anal~sis.
Primers A and primer B were derived from the sequences of the OP-AFP gene 5' and 3', which were located outside of the 5' and 3' of the GH coding sequence in the transgene (Fig.2), therefore, if the GH coding in the transgene was 2o intact in the transgenic fish, a 855 by DNA fragment should be generated when using primers A/B to amplify the DNA from the tranagenic fish. As showed in Figure 68, a 855 by fragment was found in all the eight positives, indicating that the GH transgene was intact in the 25 transgenic salmon.
6. Ths growth psrfozmsncs of the tranagsnic lish.
a. weight of the transgenic lish PCR analysis showed that eight fish were tranagenic.
30 Two fish (111, X25) died in July 1990. Therefore, only the six remaining transgenic fish were analyzed.
O! the six salmon found to be transgenic for the growth hormone gene construct, five of them were amongst the six largest fish in the aquarium. The chances of the observation occurring by coincidence era exceedingly low.
The average weight of the six transgenic fish was 29.2 t 0.3 gm. Ths average weight of all 459 fish in the ~~~r~15 aquarium was 5.06 ~ 1.0 gm. Thus on average the transgenic fish were four times larger than the non-transgenic controls and approximately six times the average size of the salmon in the aquarium. The largest transgenic fish in the aquarium was eight times larger than the non-transgenic controls.
b. The growth rate of the transgenic fish In order to estimate growth rates, the fifty fish that had been blood sampled and tagged were reweighed l00 days later. The mean growth rates of the six transgenic salmon during this period was 0.766 ~ 0.18% per day, while the 24 non-transgenic fish grew at 0.224 ~ 0.03%
per day. This difference is statistically significant.
c. Weights of the transgenic fish The body weights of the two transgenic salmon that had died in July 1990, numbers 11 and 25, were 8.07 g and 12.1 g respectively. These salmon were considerably _ 5 larger than all other salmon in the aquarium at that time. The mean body weight of 10 fish selected at random from the approximately 500 lish in the aquarium was 1.4 ~
0.17 g.
The size frequency distribution of all 200 salmon 10 that were weighed in October 1990, including the fifty that were bled and tagged is presented in Figure 13A. Of the seven transgenic salmon found amongst the fifty fish sampled, six were the biggest fish in the aquarium, . (Figure lIA). The mean body weight of the 200 fish was 5.91 ~ 0.43 g. The body weights of the three largest transganic salmon were greater than two standard deviations larger than this mean. The mean body weight o! the saves transganies was 27.3 ~ 7.8 g, while the lorty-throe non-transganie siblings weighed 7.4 ; 0.26 g.
Thus on average the transgenics were 3.7 times larger than their non-transgenic siblings. The largest transgenic salmon (f28, 65.8 g) was 8.9 times the mean weight of the controls. The three largest transgenic salmon had lost all evidence of parr markings and had fl ;' -7 ~~~~~'SiJ
VfO 92/16618 PCT/CA92/00109 taken on the silvery appearance of smolts (Figure 12).
Growth hormone has been implicated in this process.
The size frequency distribution of all 494 fish present in January 1991, and the weights of the individual transgenics are presented in Figure 12B. The largest transgenic salmon sampled in October 1990 (~28) died following blood sampling, and is not present in the Figure.
The average body weight oell (484) salmon is the aquarium was 6.36 ~ 0.26 g. The average body weight of the non-transgenic salmon (476 Dish) was 5.94 = 0.14 g, while the mean weight of the _ransgenics -..ras 37.0 x-10.2 g; approxi~aately six times larger than the non-transgenics. Five of the eight transgenics in this croup has body weights exceeding two standard deviations of the mean value for the aquarium. The body weights of two of the 476 non-transgenic salmon also exceeded two standard deviations of the aquarium mean. The largest transgenic salmon in January 1991 (f~31, 76.7 g) was approximately 13 times the average weight of the controls.
The growth rates of the transgenic salmon (6) and their non-tranagenic siblings (43) from October 1990 to January 1991 are presented in Table VI. It is evident that on average the transgenic salmon were significantly larger and grew significantly Easter in weight and length, than non-transgenic fish reared in the same . aquarium. In addition, the condition !actors of the transgenics were slightly, but significantly lower than those of the controls. Increases in weight of the transgsnic fish ranged from 0.48 to 1.6~ per day, only two o! the 43 non-transgenic controls had growth rates exceeding those of the slowest growing transgenic.
Smolting is a very complicated transformation process involving many morpholo5ical and physiological )5 chsages (see review by Hoar 1988). One of the aorphological changes is the silvering of smolt. In our studies, the transgenie salmon silvers earlier than the ~1 ~~;'? i_5 tJ 92/16618 PCT/CA92/00109 control, suggesting that transgenic salmon smolts earlier (Fig.8). It has been reported that the fish size and growth rate appear to be the significant factors in controlling the salmon smolting (see review by Hoar S 1988), this is supported by our observation that the transgenic salmon smolt earlier than their control.
Therefore, the transgenic salmon appears to be a good model for the study of salmon smolting.
TEST RESULTS OF THE ABOVE PROCEDURES ACCORDING TO THE
SECOND SERIES OF EMBODIMENTS
1. The ocean pout AFP promoter can function in salmoaid tolls in vitro.
CAT assays were used to test the effectiveness of the opAFP promoter. The opAFP-CAT construct was transfected into two salmonid cell lines, RTH 149, a rainbow trout hepatoma cell line and CHSE-214, a Chinook salmon embryonic cell line. As shown in Figure 9, CAT
activity was~clearly detected in both of them. The level 0! CAT activity resulting from opAFP-CAT was comparable to that from pBLCAT2, which has the thymidine kinase promoter from Herpes simplex virus. When these cells were transtected with pBLCAT3, a promoterlass CAT
construct, little or no CAT activity was detected. These results suggested that although the salmonid cells lack the AFP gene, these cells contain the transcription factors required for the basal expression of the AFP
gene, indicating its usefulness in transgenic studies.
=. The ooeaa pout 1~1'p gene promotes oaa luaotioa is Japanese aeaska eabryos is vivo.
To lurther investigate the suitability of using the opAFP gene promoter in gene transfer, the opAFP-CAT
construct was microinjected into medaka embryos at 1 or 2 3S cell stages. CAT activity was determined from individual embryo at different times during embryonic development.
As shown in Figure 10, CAT activity was tirat detected 2 2~~h3~~
WO 92/16618 PCf/CA92/00109 days after injection, the activity reached a maximum at 6-8 days, then CAT activity began to decline. However CAT activity was still detectable even in the hatched fish (11 days). In contrast, little or no CAT activity 5 was detected in non-injected e..~.,bryos or embryos injected with pBLCAT3 (data not shown). These results further demonstrated that the opAFP gene promoter was active in vivo in a different species o~ fish lacking the AFP
genes.
3. Design and construction oz a universal gene transfer cassette, opAFP-v.
The above results from the CAT assay in salmonid cell lines and medaka embryos suggest that th.=_ ooaFn promoter is active in fish whic'~ do .~.o~ no.~,.~~.a»~_t ar-.ress AFP. This is further supported by our recent GH gene transfer studies in Atlantic salmon. When the opAFP gene promoter was ligated with the salmon GH cDNA and the fusion gene microinjected into Atlantic salmon, the transganic salmon showed a dramatic enhancement in growth rates (Du et al. 1992). Overall, these experiments indicate that the opAFP promoter is active in a variety of fish species.
To facilitate the use of the opAFP gene promoter as a useful vehicle for gene transfer studies, and to simplify the construction of other fusion genes using this promoter, an expression vector , opAFP-V, was cloned in pUC using the opAFP gene promoter, the 5'-untranslated sequence and the opAFP gene 3' sequence. The 2.1 kb 70 ~somotsr is required !or active transcription and the 1.2 kb 3'-sequence is preferred for polyadenylation and transcription termination. As shown in Figure 11, the 2.1 kb opAFP gene promoter was linked with the 63 by opAFP gene 5'untranslated sequence by a unique BgIII
sits, and the 5'-untranslated sequence was linked with its 3' sequence by a unique Hpal site. where and how to insert a gene into this vector depends on the nature of 2,~ t~r~~5 the gene to be inserted, i. e., a cDNA or a genomic DNA, with or without its own 5'untranslated sequence.
To insert a cDNA sequence which contains a short or no 5'-untranslated region into opAFP-V, the insertion 5 should be at the HpaI site, which is right after the opAFP gene 5'untranslated sequence. The Hpal site is the only HpaI site in the vector, thus it can be cleaved by single HpaI digestion and cDNA clones of interest without the 5'-untranslated sequence can be directly cloned into 10 this unique Hpal site. The 5'-untranslated region from opAFP gene may serve as a leader sequence for ribosomal scanning for translation initiation.
To insert a cDNA sequence with a relatively long 5'-untranslated region, the insertion could be targeted 15 to the unique BglII site which is before the opAFP gene 5'-untranslated sequence. To avoid having the extra opAFP gene 5'-untranslated sequence, the opAFP gene 5°-untranslated sequence can be removed by BglII/HpaI
digestion. The insertion could also be at the Hpal site 20 and generate a mRNA with a long fusion 5°-untranslated sequence.
Since genomic genes contain their own 3° sequences which function as a transcriptional terminator, the 3°
opAFP gene sequence is not required for the cloning of 25 genomic genes. The opAFP gene 3' sequence can be removed from the vector by BglII/SaII or Hpal/SaII digestion - depending on the length of the 5°-untranslated sequence in the inserted genomie gene.
As shown in Figure il, several additional unique ~0 restriction sites era present at the 5°- and 3°- ands in the vsetar, such as EcoRI, Ppnl, Smal and BamHI sites at the 5°-end, and the Pstl, SaII, BamHI, Smal and EcoRI at the 3°-and. Thasa enable the excision of the intact fusion gene from the vector.
as 2I~~3~~

4. The complete DNA sequence of OpAFP-0.
To assist the analysis of the integration and expression of the transgene with this vector, the complete DNA sequence of opAFP-V was determined. The full length of the opAFP-V is 6027 bp, with 2677 by derived from pUC sequence (Yanisch-Perron et al., 1985) and 3350 by derived from opAFP DNA sequence. The complete opAFP DNA sequence is shown in Table V. The opAFP gene promoter spans 2.1 kb, it has a '~C~T" box and a "TATA" box located at position 2006 and 2049 respectively. Following the promoter sequence is the opAFP gene 5'-untranslated sequence, which is lin:;ad to the promoter by a synthetic BgIII linker (at position 2116). The exact size of the 5'-untranslated sequence is not known because the ocean pout has 150 copies of the AFP gene (Hew et al., 1988) which have very similar but not identical gene structures, therefore it is difficult to determine the CAP site for this particular AFP gene.
In eukaryotic genes a CAP site is usually located 25-30 by downstream lrom the "TATA" box. Tharetore, the 5~-untranslated sequence of opAFP gene is about 90 bp.
The 5~-untranslated sequence present in opAFP-V is 63 by long, which is located between the BgIII and the Hpal sites. The opAFP gene 3' sequence is linked with the promoter and the 5~-untranslated sequence by a unique HpaI site (at position 2188). The 3' sequence spans 1.2 . kb, which contains an 80-90 by 3'-untranslated sequence, and a 1.1 kb 3~flanking sequence. A poly(A) signal "AATAAA" and a potential transcription termination signal CT" era located at position 2253 and 2285 respectively.
The DNA sequence of the opAFP gene was analyzed for the presence of any liver-specific sequences. Two 17 by fragments with 708 identity to the liver-specific promoter element HPI o! the Xenopus albumin gene (Schorpp et al., 1988), were demonstrated at position 1004 to 1020 and 1944 to 1960 (Table V). These two fragments were located at approximately -1 kb and -100 by up stream of ~~n~~~.~

the CAP site respectively. The Xenopus albumin HP1 sequence is suggested as the binding site for a liver-specific transcription factor LF-B1 (De Simone and Cortese, 1988). However, the function of these two presumptive liver-specific sequences remains to be investigated.
Recently, PCR has become a useful tool to analyze the DNA where the source of DNA is limited. PCR has been used in screening for transgenic mouse (Chen and Evens 1990), the blood cell were lysed by SDS and DNA was used directly for PCR. Recently, Henley and Merile (1991) reported the transgene detection in mouse by PCR using unpurified tail DNA. Our data revealed that 1 ~cl of blood is sufficient for screening of transgenic fish directly by PCR. This protocol has been adopted for the routine analysis in the laboratory for the detection of several thousand samples.
It is appreciated that there are other promoter systems which, in accordance with this invention, work agually in a transgenic gene construct. These include promoter sequences isolated from wolffish, winter flounder, sea raven, and other AFP or AFGP-containing ffishes.
It is appreciated from the above discussion of various embodiments of the invention as they relate to the promoter, optional 5' untranslatad sequence as a gene precursor and the 3' terminal sequence that there are, of course, many functional equivalents to the stated sequences, not only with respect to the particular sequence of Table V, but as well as demonstrated by the promoter sequences as isolated from other species than the ocean pout, namely the wol!lish as described with respect to Table IV. The promoter sequence, according to ' this invention, is applicable to a variety of gene products since they are derived from fish genes and are therefore compatible with a variety of types of lisp.
Hancs the promoter sequence is referred to as "all-fish"

21t~~315 gene construct. In view of the advantage of the promoter sequence being liver specific or liver-predominant for expression, which is a tissue well suited for the synthesis and secretion of transgene products, there is a diversity of AFP/AFGP promoters useful in making the "all fish" gene conduct (Gong et al, 1992).
In view of the AFP promoter sequence being absent in most fish species, detection of transgenic species is readily provided by PCR or other forms of gene sequence amplification techniques, such as ligase chain reaction.
Furthermore, since most fishes do not contain these AFP
genes, it is easier to modify the transgene using the ?F;
promoter without affecting the performance of endogenous genes. Also the AFP gene sequence including both the 5' and 3' ends contains functional DNA sequences important for normal DNA transcription and termination and tissue specific expression. These DNA sequences can further be modified to improve its experience level at will and responsive to many external signals such as hormones, growth !actors, etc.
Although preferred embodiments of the invention are described herein in detail, it will be understood by those skilled in the art that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims.

. J 92/16618 ~ ~ ~ a ~ ~~ ~ PCT/CA92/00109 ~ ~c, ~o N ~ !
a ~ x m Y i ri ~, m ii . .
m it N
a$ $~ 0 0 0 0 .. e, a p!

W o vi o n ~ - N
W ~ ~ M ~ ~ O N H
W
.' i7 a h (,~, ~ O O m m O O N Q N
0 ~ (a ~ N H h N O N H
W
t-1 jl<~« 1< VIV V
V V V V V V
w ~ J
.o '' _ ,.
a x a ~ o _z H. ~ a ° _ z a o° ' ~, m N ~ ° -wx H

N
H wW ~ ~
" ~ ~ °° a d _ ~, ~ J , _ H
a n w . J ~ ° , T
o _ o ,~ _ . ,.
a o 3 0 0°
H
a o °
~d ~ ° m x w x a.

v~ ~' o Q

v E"' ~ tl7 U7 !l7 M

M M m d' Is .7 N M O

,~
_i.

a a v a ~_ - m +

+
a ,o N

C i 4.
V lf7 Q

C Li v~

U L

"' N

H
H

H

+ N

N

- N L

H
O

O
M

N

Q

.1., ~ n o 0 0 0, o r ~ _ v H ~ o - m ca o~ c o r: ~ ,ri o ~o ~~ ~~ t~~ f. t~. ,.
a a a a a w <
c - ~n '" ac ~ ~o c o U
H -D
i W + Q w.
U.
1 m a_ a - N

w Q
O
O
M
N

a ~J 92/16618 ~ t n ~ ~ ~. ~ PGT/CA92/00109 TABLE III
SALMON GH
TP.AAMTGGGACMGTGi'TTCjGCTGATGCCAGT CT'fACTGGTCAGTTGTTf G
MecGlyGlnValPheLeuLeutletProValLeuLeuValSerCysPhe ~': GA.~CMGGGGCACCCATAGAAMCCMCGGCTCTTCMCATCCCGGTC
LeuSerGlnGlyAlaA1 ~ leGlvAsnGlnArgLeuPheAsnIleAlaVa1 ,. :GCGTGCMCATCTCCACCTATTGGCTCAGAAMTGTTCMTGACTI2 SerArgValGInHlsLeuHisLeuLeuAleGlnLysMecPheAaaASpPhe CxCC~ ACCCTGT'.CCCTGATGMCGCACACAGCTGMCMCATATTCCTC
xspClyThrLeuLeuProASpGluArgArgGlnLeuASnLysIlePheLeu C:GGACTTCTCTMC.'CTGACTCCATCGTCAGCCCAGTCGACMGCACGAG~
~e::Asp?::eCys:.saSerASpSer:leValSerProYalASpLysBlsGlu ACTC.1G.1:.G.1G:TCA.f'ZC~ C.1'nGCTCv:C:A:AI'Ci'1:CC~ CTCA::
ShrGlaLysSerSerValLeuLysLeulecHisIleSerPheArgLeuIle GMTCCGGGAGTACCCTAGCCAGACCCTGATCATCTCCMCAGCCTMTG
.-~Sez-:yGl~Ty:PrOSe:GI:Th:Le:=1e11eSerASnSerLevtlet CAGAMCGCCMCCAGATCTCTGAGMGWCACCGACCTCAMGTGGGC
'TS1A: aAs:.Al:J~snG'r.I leSerGluLysLeuSerAspLevlysValGly ATCMCCTGCTCATC1C6666'AGCCAGGATGGCCTACTGAGCCTGGATGAC
IleAanl.euLeuIleThrGlySer6laAaDGlyLeuLeuSerLeuAapAep AATGACfCTCAGCAALTCCCCCCCTAC66GMCTACTACCAGMGGTCGCG
AsoAsyEosClaClnL~oPsoFsoTysGlyASnTyrTysClnAaaluCl7 0~0AOCC1AAC~CACCACCAACTACCACTiGiTCCGATCClIGAIGAAG
cbA~DC17~Y~~I~tA~e~Cl~~aA1~C7sThvlr~Lr~
r~.r..,..
A~D~~~f~~~v~~~slWlwaLlaty~~~ASA1~~3~e lodlaAL~y~hsl.ou ACCGCAtCTCCACCf.IZCCCltlCCAGATACACIlACCGGItCGCtCWCl~
CAG~TCGATISlCAA?tcAWTlCZCAC6TMGATCCliItCACtGTAGG
TAATIiSATSSICCAT~ccTAClAGGCLWCIGGAGCG6I1T1'WGGGAT' TTCWZ!!!lTlCYCZCAAATCAATA1CAAC1CIIZGlATAZT6IClCTAT ' CACTCnACCiACCATICATiACiACAT:lATATTA~TlATIAAASC'!' G1?ATllACAIA?ATCCilCATCGC6ClCLTACrlATCCACTACClI'AATA
T'rtA0GC0'ICAAAT00CAICZS~lAGACClCCAAGC!l~IGGATAATATAT
Ti'lA0A9lA1liZCClrtAAGYAltliCATTCClZAATCllAT~Gi~'~GA
.-y. Th~ aoisP~~ oxide ~puenee and deduced amino a.~uense of ehinook ~almav GN. 1 indiaus the ekav~ie gie~ bww~ tYmi~a~1 s~atwso~ and au~un o~otan. The poly-adw~~gioa iprl MTAM i~ nAdwiined.

W092/1~6 8~~~~~

TABLE IV
Hind ttt ";
WO ~~'-'r~GGele~e~eIGTAC.aAGCelel:":':GC.~C~CeI:C.I:':C':G:a....'~CC.~.C?.G:.'.. -2ti4 _______________________ _ ______ _ ___________________T__:.~ _Zq~
< a >< a >< a > Pru n EeaR V ~
C """ '"?v:':G3.1.e1G~ie~G.IGIC"~; -s~..w~~-a:C':?G.1C?G'::' ice' -« j WC .J~fI.J.-~1n'.G.J. t~.-ViG~..
'________'___~___C'a______________________________________... ,~ -:~
Sen I < b ><
~iv p:":~.:,.,~'~islC~,GyCCC~s11Ce41C.i?.G°.V:,a.~'-"-~~-J'~'GeIGVIG'_"G.3.'~'_'~V..AG~TGTR~ -144 ~p3 ____________________________________~r__________________..._..... _iZ
L.nS pZyyrGaG:~?n:~'~:':w'.lCel~1?vCel?.Gi:?.:aC~T?aC°. -14~:
Hind I11 > Mav Itl WO TTGGV.dG~ITGWITGeIGrIGC~IA:'TACeIAi _GACT?~GGrIGGT':':G~1C?vCe~~T -~~
CTrlC? -?
Op3 ...........__..___......_________~_________~ =====_== -9a OPS ?l:luGIATA?A.wITTT-C---G_____-G_a___________ -84 tla~ 111 pp ~~ .WiCGGSaT:.:G~.a~TT.11G'TCCTCCCAC1T.1C'~~"..~:. .AGAT' -Z?
O?3 _____--____________~»_--__--~_- __ ____________________ 2y 3 ____~_________________________ Hla 111 ~ 1 « >
wo G<.aGccrGTCCTCTCaca~G~rcTC~GCia~c..~rrrcAC::cme2cccci 131 0113 _______________T__~_~_~_______________=________G;<--____A_ ~37 oas _________~____~__~~__________________ N.1 ' wo ~,na~.......~~n~,.n~cscTC~ccc.~caGCC~TJ ~ao oas _____________........~_~_____________~__~______- 'ao oas __________ __~,n~,.r~=_----_________ - ~ea SUBSTITUTE SHEET

7 92116618 ~ j n ~ ~ 1_ ~j PCT/CA92/00109 TABLE V
The complete ocean pout DNA nucleotide sequence in opAFP-V. The "CART" and "TATA" sequences are boxed; the poly(A) signal (AATAAA) and the predicted transcription -5 termination signal (TTTTTCT) are underlined by double lines; the two presumptive liver-specific sequences are underlined by single line; and the unique BgIII and Hpal sites for gene insertion are indicated.

~l!~~' 1a PCT/CA92/00109 ' f TAHLE V (contined) .0 __0 30 40 50 60 5' G~ATCC~~~AGAATGAGCTGGAACATGTTGCGGGGAGAGGGAAGTCTGGGTCAGCCTGCT
%0 80 90 100 110 1~0 TGGCCTGCTGCCACCGTGACCCGACCTCAGATAAGCGGAGGAAAATGGATGGATGGATTG
is0 140 150 160 170 180 AATCACAGAATGTTTCTGAAGACAGATATCACCTTCOCTTCAAAGAGGTOCGCACCTGGG

CAGGCACCCACACAGCCACACAAATGGCATATGAATCAACCAAGAAGACGGTTGGAACTG

ACTTAOAOACAGAOCTCTOAGCAGCTATOAOATTOTAOTTTOOCCAOGATGCGCTTAAOA
370 ~ S80 390 400 410 42C ~
CCTTTGTGATGAAAAGTTATCAAATTCGTGAOTTTTCATGGAAGAACCTTGACGTGGCGT
SUBSTITUTE SHEET

'O 92/16618 ~'. '~ ~' ? ~ :) PCT/CA92/00109 4?
TP.HL~ '. (conti:~ued1 ado a4o a50 4b0 a70 480 GGTuGCU:.:,TT~TG,_,GTCnTT=GGC.~TGGt,:,A,aGGAAGTCG'TA T.~ACTCCC:,GGTaC:,TT
~?O 500 510 520 530 540 ATCTT:.TCTACACAAAATGTCTAATGC:,TGATACTACTTAAAGCCTGaGCATATTTCAAG
s9i; 55in 57i~ 5gi~ 590 b00 GCCAGCACTTTTCAATAACTCATAGGCCACCTGCTGGCAAAAGGAAATGCCACATTTTAT
617 6~0 b~~0 640 6~0 bb«
ACTTTTATTTCCTCCTAGACPGTTGAC=T=ATC'aGT'TCA.'i~""T'TGGT.~,:,G3AT.~,GCCT' 670 680 b90 700 710 7.0 AAGACAATGAAGATGCTTCATC.'aGGAATATTGTGAGTTGTCGTTGAACGTTGTTGCCGTG

OCAACGCATCATTCOCCATOAApAA0AA0CTGATOGTTCA8T00CTTO00ATGCTCAAAA
790 800 8i0 820 830 840 CTTATTATAAATTOTCTCCATAGCGCCCCCTACAATATTTCAAAAGAGCAGCCCCAGTGC
!10 !ZO 9~0 !40 ~~0 !~O
TAC3TACATBTATpAApCTTABTAGCCA0AT8TACCATATA0A0ACTTACAAAAAGGTAT
!70 110 9!0 1000 1010 1020 SUBSTITUTE SHEET

2~~~c;~l~

Th3LE V (continued) 1~?9!a 11!uJ 1110 11.0 11.10 1146 T:.:.TC'.ATTTCAAATTTTGTCAGTACaATCTCAGTACTACAGTACCAAATCTACAGTTCT
11°'? 1150 1170 1186 119! l~Oi~
uCAT~'.~GTAGCTGCTCAGAGGT~TGTV,TCTAAGTCCCTGTCTTTTATACACTGTGACAA
.=1C~ 1~='> 1«C> 1=4ii 1=50 1.60 ACA.;CTGTCACACATGGTATAGTGAAGGTTTTGACCAGTTCCAACCGTCTTGTTGGTTGA
:.70 180 1290 1300 1310 1520 TTC:.T.:TG:CAT'CGTGTGGCTGTGTGGGTGCCTACCCAGATGCGCACCTCTTTGAAGCG

AATGTGATATCTGTCTTCATAAACATTCTGTTATTAGCAAGTTCATATGAGAATGAAGGC
1390 1400 1410 1~ZO 1430 1440 TOTATOCAAACAfiOTOCACA0TCT0TTTCTAAOCATCAT00fWAAOTACAAOCAATTTOC
140 1460 14T0 1490 1~90 100 ACAAATCATTCTGTATTTTTCCAATAGCTAACAATOTCACCGGBACATTGTGGTATTGGA
1010 1520 1530 1940 1»0 1060 TAOAAOAOACCAOCTOATCTAOACAGTTOATATCATOATCAACAOCCCCAAACAACAAGT
170 10~0 1090 1600 1610 1620 0T0CAT0COC0A0oAATa11TT0OCAtfAT0TAT0A0AACTAAACCACT0ACT0AACTTOCA
1~30 1N0 1650 1660 1670 1650 CTAGApOCATCTATTTTOTCTTTTCTCATATOATOTT00AATGOCACATG00AOTTTTTC

CCCTpTCTCA0GTT0CTTTTTACCCCAAATATTpTATATCTATTAOAACCpT'TOTCACAO
SUgS~ITUTE SHEET

~1~;?
7 92/16618 ~ ~ " w ~- '~ PCT/CA92/00109 TABLE V (continued) 17~i~ 175' 1776 178!: 179ia l9t:ni GGTTCAAATTAACGTTTTAGTTTAGTTTTGATCATGATAT.~.CF~CATT'TATCCuT.~,AAGC
18111 12~U 180 194i~ 18°O 1860 ATGTUCATATACAGTAAGGGCTTGTTATTCGACAGCAAGAAGAAGAGGATATGTGTGCAG
1976 1980 1990 1900 1910 19:0 GCAGTCAGCTAATGCATGGATCACAAG T T A T "GAA T Gi.i,:,GCTTG T uA T .~,G T T
TGGr1CAA

AAACAAGTTAT.aCTT7ACT-ATA:,G'-~.'>'-~.T..~-AAVT""r' :TTGCr'~4TT3uCATAAGGAuG
1990 2000 3010 2020 2030 . 2040 TGTGACACAGTGAGCTACTTTCAG CAA GGAaACGGGATATGCCGGTTAAGTCCTCC

CACATACT A5' A6ATACAflCACAT00ACCTflTCCTATCAAAABTCTCAGCTACAf3C
2110 2120 2130 21~0 2i~0 2160 TTTCaCTTCCiATCCaflATCTTTTCACTTCflATCTCCOATAATTAATTAATTAATTAATTA
BqlII

TTIWTTMTTAABTCTCAOCCACCOTTAACTOAACATflTCAAAACCTOT00A0ACTGTTG
Hpsl ~~' 30 X40 2500 2=60 2270 2:80 AOATTT0AT0TTCTflAAAAflATAAAflCCTATAAA~ TATTACCCAAATTTCCTflCCT
2290 2300 1310 r320 23'.ao 2340 flpTpTTTT TTTBTCTTTBCTACATOACTTTflCTflCTC88ATCGflCTCACTCTOTGTAT
2390 2360 2370 23~0 2390 2400 flapCflTTCACTTTOTAZTCTCCTTCTCACOATAflflTTTATTATTTTTA0AT3TflCAflTT
SUBSTITUTE SHEET

'=':.3LE 'J ( continued) _ _. =4_~:v =4-~:~ =44ii _45p =46~i _ _', ,,'~,~~',:.:, T ;"_,C,:C",.".,,..,_,.~,"" T -,r:T, .:, ,-,-,_,TCTG T
GCATTGAGT T GGTGAG T GC
_ '~7 =48h =49~:~ ._°~iii~ =Olin =1=r~
.:u.:-". _ , ~ ~'TG.:'LTTuAVi.'.=.", T.: T ~:','', 3:,'Ti~,a'yAGGTGAACTGTGTGAA'CTA
~c.411 ~dRia _ . . __ . =SSO =sn~ =seu AAuTGC-CCaTA~.3GATGTT~-~C~TTGAAAAV:~TTCTCATTTTATTAGTGGAAGTGAGT
=590 .500 C61~> .5.0 2SS0 CS40 W=, .,.__.,:,:, T C=.;A..:..;---,.r".,_A"AC:.=::: :uTATG:.TTTAATGCAAAAAAATGA
=S50 ~b60 =S70 680 =690 =700 AGGTATCAAACACGCATTACTACTTTGCAGTTAAATATTTAACATTTATTCCAACACGAA

AiWAAGCAGTAAATAACACTTTGACAAACACGTCAGGACATCTTATTTTTOTCACCCTCA
.'70 ~_780 =790 800 810 ~A20 CAp3CAATTTAGTATAATATATTATATATATATATATATCATATAATAATATTCAGTATA

ATATATATATATATATCATATTATAATATTCAGTATAATATAAAACACAAACACATATAT
Zt90 2100 .910 291'0 2'130 940 vTATAATATAATATAACATTTTTATTTATT3A0AT8CCTCTATOAACCOTBTTATAAOAA
=930 2960 970 .980 2990 3000 BTAAAOATCA0tiA0AA0TAAACATGAAGTGTAATTATOAATACTBATGTTAAATTAAGCT
;.010 3020 ~0~0 :030 3030 :.ObO

SUgS'~TUTE SHEET.

. 7 92/16618 ~ ~ ~ ~ -' ~~ J PCf/CA92/00109 TABLE V(continued) ~i>7i> ~i>gi~ -ii9i~ 'li~i~ ~ i lip GTTAAC-CAGATGAGACTGAGACAACTGTAGAAGACAAGATGTTCACTTTGCTGAATATAG
rl-C~ '_.14C ~ -15~:~ -16~ i 1?io _ 18i ~
CTGGCTTGACAGTTATCTr',TGACTCTATAAATATATATATATTT'TTTTTTTATAAAaTG
C19C> =CUio _C1C~ ~:CC ,.C=C~ _=4i~
AT T T A T T T nT"ACTA T ATr1TCCATTTCTC'.GAC'rlG:~'', G CTTCi~-', ~=, T
C.~~CTr;'aCTCv.CGTA
...~.~G ~ c61~ :..~7C~ 3~8G .'.vC9l~ C ~ OCR
GCTGTCCATGCTGGATCTGTCCCCGTTGTTTTTAAAAAGCTAAATAAGTTATTAACATGA
x310 3320 3350 3340 330 CTGCATCCAGCGAGCCAAACCTGTCTOOTGTACAOCTACCABAOAAGCTT 3' SUBSTITUTE SHEET

' ~

P Iff -,1 +L,.~
fD r' C Ar O '1 O b ..Or _ 1~ 1~
-r O O v ~

cb C 1-~ U
~ U to ~ +~

V ,H ~ 4a p Cl~

~

V (Y N N fff iT ' V

O O

~ 0~ ., ~ ~'t7 H O v N

a m ~ U
O

r o G~

G O N
~

.. ~6 U

a p ~
~

y D . C1, U~

,., " O
' ", ~0 00 ~fi U ~~~ ~ ~p, r ' r E., r~e~ 00 00 ,~
~m Z t7oc a ~~

4 ~

H

1~ U''i O

-rl N''1 4 3.
~C

~,~
W v O ~

V o , ~-~ ~~no o .
,.. N_ Z o~v ~~ p ~~w~

47 C v N~~wo V A ~oo ono oU
-G~x z -.~ o~, ~ ,~
a~ o p o rn a ~ rn , ~, b ~ ~ 0 O
~

O - o o E
o .
a d N ~ ~-p O ~ 0~ v ~
~ 0 N
al m Z .
N

~"~
N~3 C

c a p, N
U b V _ r, .. o S-i N-~

~

t i N' p ~3 Z ~0 a ~o ~ ~ ~ -a ' vo ~ E

p ~ ., O
I C1 m er N ~-, N rl ~ ~ roou ~~

r ~p 0 y _ .I

vac o0 0 ?.~ td ~ UJ
U

N U!
U .~
-,-I

E, , ... 3 ~

O .-i ~d G N

s s o ~ p On U
~ m v o N N

~ ~ ~
R
~

Wn i o ~ o -vD .~
.~

t!1 O ~ O ~
o ~o r o~ v ., v .c1 U
o~ O b a ~r ~~~v ~v .~N~~63 O .. ..

.~~~vv ~tr~E,~

= a ~ N O ' O ~ ~ o ,~
~zv H

O o ~~ ~o R' ~

v m ~~

a~~o o .~
s~ a~

~NV 3 m 3 27 ~-I N

V U-~-14-i . ~ .~.

.,., -~ O'b O

c a c'~

N N N
r0-r-I

v~ c p 0~ s~
s~ ~
~

a ... r m~~u~r~

c ~ y c~~

r ~ O. O iL ~ ~ N
~ O

H (~ H U ~
O U

Claims (11)

WE CLAIM:

1. ~An expression cassette for promoting fish growth comprising:
a fish growth hormone gene operably linked to a type III antifreeze protein (AFP) promoter and to a transcription termination signal.

2. ~The expression cassette of claim 1, wherein the promoter comprises the sequence of Table V from 5' end at base position 1 to base position 2115.

3. ~The expression cassette of claim 1, wherein the transcription termination sequence comprises the sequence of Table V from basepair 2188 to the 3' end at base pair position 3350.

4. ~The expression cassette of claim 1, wherein the fish growth hormone gene is operably linked to an ocean pout polyadenylation signal.

5. ~The expression cassette of claim 1, wherein the fish growth hormone gene is from a salmonid fish.

6. ~The expression cassette of claim 1, wherein the fish growth hormone gene comprises the sequence of Table III.

7. ~The expression cassette of claim l, wherein expression of the fish growth hormone gene in a fish results in expression of a fish growth hormone protein and in an increase in the growth rate of the fish at least four times that of control fish lacking the expression cassette of claim 1.

8. ~An assay for determining the presence of the expression cassette of claim 2, comprising the steps of:
(i) amplifying by a DNA sequence amplification technique a portion of expression cassette having a DNA
sequence which is a portion of the promoter sequence of Table V; and (ii) detecting the presence of the amplified DNA.

9. ~An assay of claim 8, wherein the amplification technique is PCR using primers selected from sequence fragments of Table V, from the 5' end to the BglII site.

10. ~An assay of claim 9, wherein the primers are selected from the group consisting of:
Primer A +27 5'-GTCAGAAGTCTCAGCTACAGC-3' +47 sense strand;
Primer B +861 5'-ATCTCAACAGTCTCCACAGGT-3' +881 antisense strand;
Primer C +161 5'-TCTGCTGATGCCAGTCTTACT-3' +181 sense strand; and Primer D +339 5'-ACAGAAGTCCAGCAGGAATAT-3' +359 antisense strand.

11. ~A process for producing a transgenic fish, the process comprising the steps of:
(i) preparing an expression cassette as defined in Claim 1, (ii) introducing the expression cassette into a fertilized fish embryo, and (iii) allowing the embryo to develop into a transgenic fish.