CA2190588C - Pteridine nucleotide analogs as fluorescent dna probes - Google Patents

Abstract

The invention provides novel pteridine nucleotide which are highly fluoresce nt under physiological conditions and which may be used in the chemical synthesis of fluorescent oligonucleotides. The invention fur ther provides for fluorescent oligonucleotides comprisin g one or more pteridine nucleotides. In addition the invention provides for pteridine triphosphates which may be used as the constituent monomers in DNA amplification procedures.

Description

PTERIDINE NU(~LEOT'IDE ANALOGS AS FLUORESCENT DNA
PROBES
MACK ROUND OF THE INVENTION
Synthetic oligonucleotides find numerous uses in molecular biology as probes for screening genomic and complementary DNA libraries, as primers for DNA
synthesis, sequencing, and amplification, and in the study of DNA-protein interactions.
In addition, oligonucleotide probes have proven useful for assaying in vitro gene expression using techniques of in situ hybridization.
Recent improvements in DNA sequencing methods, fluorescent labels, and detection systems have dramaticallly increased the use of fluorescently labeled oligonucleotides in all of these applications. Typically oligonucleoddes are labeled with a fluorescent marker, either directly through a covalent linkage (e.g., a carbon linker), or indirectly whereby the oligonucleotide is bound to a molecule such as biotin or dioxigenin, which, is subse:quentl;y coupled to a fluorescently labeled binding moiety (e. g. , streptavidin or a labeled monoclonal antibody).
These fluorescent labeling systems, however, suffer the disadvantage that the fluorescent complexes and their binding moieties are relatively large. The presence of large fluorescent labels and associated linkers may alter the mobility of the oligonucleotide, either through a ;gel as in sequencing, or through various compartments of a cell.
In addition, the presence of these markers alters the interaction of the oligonucle:otide with other molecules either through chemical interactions or through steric hinderance. Thus the presence of these markers makes it difficult to study the interactions of DNA with other molecules such as proteins. The study of protein-DNA
interactions is of profound interest as they involve some of the most fundamental mechanisms in biology. They include, for example, the progression of a DNA
polymerase or reverse tramscriptase along the length of the oligonucleotide, the activation WO 95/31469 'PCT/US95/05264 of gene transcription as in the AP1 or steroid hormone pathway, or the insertion of viral DNA into the host genome as mediated by the HIV IN,enzyme. For these reasons, it is desirable to obtain a fluorescent moiety analogous in structure to a pyrimidine or purine nucleotide and capable of being incorporated into an oligoriucleotide. Such a moiety would preferably render the oligonucleotide molecule fluorescent without significantly altering the size or chemical properties of the oligonucleotide.
Numerous analogs of nucleotides are known. Among them are furanosyl pteridine derivatives. Methods of synthesizing these pteridine derivatives, which are structurally analogous to purine nucleotides, are well known. Indeed, a number of pteridine-derived analogs have been synthesized in the hope of discovering new biologically active compounds. Thus, Pfleiderer (U.S. Patent No. 3, 798,210 and U.S.
Patent No. 3,792,036) disclosed a number of pteridine-glycosides which possessed antibacterial and antiviral properties. Pfleiderer, however, did not investigate the fluorescent properties of these compounds.
Similarly, Schmidt et al., Chem. Ber. 106: 1952-1975 (1973) describe the ribosidation of a series of pteridine derivatives to produce structural analogs of the nucleoside guanosine, while Hams et al., Liebigs. Ann. Chem. 1457-1468 (1981), describe the synthesis of pteridine derivatives structurally analogous to adenosine.
Again, neither reference describes measurements of the fluorescent properties of the nucleosides.
The synthesis of oligonucleotides incorporating lumazine derivatives has been described by Bannwarth et al., Helvetica Chimica Acta. 74: 1991-1999 (1991), Bannwarth et al. , Helvetica Chimica Acta. 74: 2000-2007 ( 1991 ) and Bannwarth et al. , (European Patent Application No. 0439036A2). Bannwarth et al. utilized the lumazine derivative in conjunction with a bathophenanthroline-ruthenium complex as an energy transfer system in which the lumazine derivative acted as an energy donor and the ruthenium complex acted as an energy receptor. Energy transfer occurred when the two compounds were brought into proximity resulting in fluorescence. The system provided a mechanism for studying the interaction of molecules bearing the two groups.
The references, however, did not describe the use of a lumazine derivative alone in an oligonucleotide. In addition, Bannwarth recognized that a major disadvantage of the lumazine derivative was the ". . . relatively low extinction coefficient for the long wave-WO 9.'i131469 PCT/US95/p526.i length absorption of the lumazine chromophore (E=8900 m-' cm'' at 324 nm pH
6.9)."
Bannwarth et al., Helv. Chim. Acta., ?4: 1991-1999 (1991).
The present invention overcomes the limitations of these prior art compounds by providing a number of pteridine nucleotides which are analogous in :5 structure to purine nucleotides, highly fluorescent under normal physiological conditions, and suitable for use in the chemical synthesis of oligonucleotides.
SUMMARY OF THE Il~'VEIVTION
In accordance with the present invention there is provided a compound (pteridine nucleotides) having the formula:

R13 ~ R14 4 5\6 16 2 ~ 7 19 R ~1 8 R
R15 ~ ~ R18 R1~ R20 in which R~' is combined with R~' to form a single oxo oxygen joined by a double bond to ring vertex 4, or with R'3 to form a double bond between ring vertices 3 and 4; R'z, when not combined with R", is either NHZ or NH2 either mono- or disubstituted with a protecting group; R'3 when not combined with R" is a lower alkyl or H;
R'° is either H, lower alkyl or phenyl; R's is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2, or with R'7 to form a double bond between ring vertices 1 and 2, such that ring vertices 2 and 4 collectively bear at most one oxo oxygen; and R'6 when not combined with R'S is a member selected from the group Consisting of H, phenyl, NHz, and NHZ mono- or disubstituted with a protecting group. When R'S
is not combined with R'6, R'g is combined with R'9 to form a single oxo axygen joined by a double bond to ring vertex 7. When R'S is combined with R'6, R'8 is combined with RZo to form a double bond between ring vertices 7 and 8, and R'9 is either H or a lower alkyl. R" when not combined with R'S, and RZ° when not combined with R'8, are compounds of formula:

H H H H

where the symbol Rz~ represents a hydrogen, protecting groups, or a triphosphate; the symbol R2z represents a hydrogen, a hydroxyl, or a hydroxyl substihcted with a protecting group; and R''~ represents H, a phosphoramidite, an H-phosphonate, a methyl phosphonate, a phosphorothioate, a phosphotriester, a hemisuccinate, a hemisuccinate covalently bound to a solid support, a dicyclohexylcarbodiimide, and a dicyclohexylcarbodiimide covalently bound to a solid support. When R' ~ is H
and RZ' is H, Rzl is a triphosphate and when R' ~ is combined with R' ~ to form a double bond between ring vertices 3 and 4 and Rz3 is H, R'~ is a triphospl~ate.
These compounds are highly fluorescent under normal physiological conditions, and suitable for use in the chemical synthesis of oligonucleotides. The invention further provides for oligonucleotides that incorporate these pteridine nucleotides.
In addition, the invention provides for pteridine nucleotide triphosphates that may be utilized in various DNA amplification processes.
When used in. a DNA amplification process, the nucleotide triphosphates are directly incorporated into the amplified DNA sequence rendering it fluorescent. This provides for a rapid assay for the presence or absence of the amplified product.
In accordance with an aspect of the present invention is a oligonucleotide comprising one or more nucleotide monomers which are pteridine dc;rivatives having the forn~ula shown below. with ring vertices 1 through 8 as shown:

4a \h3 4 5\

16 2 ~ 7 R ~ 1 8 R19 R1~ N ~ 18 R

in which:
R" is combined with R''to form a single oxo oxygen joined by a double bond to ring vertex 4, or with R' s to form a double bond between ring vertices 3 and 4;
R'Z when not combined with R ~ ~ is NH-~
R13 when not combined with R~' is Lower alkyl or H;
R'4 is a member selected from tile group consisting of H, lower alkyl and phenyl;
R'' is combined with R~''to form a single oxo oxygen joined by a double bond to ring vertex 2, or with'z'~ to forni a double bond between ring vertices 1 and ?, such that ring vertices '? and 4 collectively bear at most one oxo oxygen;
R'Gwhen not combined with R~' is a member selected from the group consisting of H, phenyl, and 'slH~;
when R'Sis not combined with R'v, R~~ is combined with R~''to fom a single oxo oxygen joined by a double bond to ring vertex 7;
when R'S is combined with R'c'. R~~ is combined with R-° to form a double bond between ring vertices 7 and 1_;, and R''' is a member selected from the group consisting of I-I and lower alkyl; and R" when not combined with R ~ ,, and R'° when not combined with R ~
~, are 0 -~P
_t-~ 0~
0 ~ H H
H ~ H
OH R2z 4b in which R2z is a member selected from the group consisting of H and OH.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS
As used herein, the term ''lower alkyl" refers to a saturated hydrocarbon radical which may be straight-chain or branched-chain (for example, ethyl, isopropyl, t-am;yl, or 2,5-dimethylhexyl). Preferred alkyl groups are those containing one to six carbon atoms. All numerical ranges in this specification and claims are intended to be inclusive of their upper and tower limits.

/ ,:

i /;

i:

f 21905~~ 5 The term "oligonucleodde" refers to a molecule comprised of two or more deoxyribonucleotides, rihonuclec~tides, modified ribonucleotides, modified dexoyribonucleotides, rihonucleo~tide analogs, deoxyribonucleotide analogs, or pteridine derivatives of the present invention. The exact size of an oligonucleotide depends on many factors and the ultimate function or use of the oligonucleotide.
Generally, chemically synthesized oligonucleotides range in length from 2 to 200 bases, although, it is well known that oligonucleotides may be ligated together to provide longer sequences.
As used herein, the terms "oligonucleotide" also encompasses these longer sequences. It is also recognized that double-stranded polynucleotides may be created by hybridization with a complementary sequence ~or enzymatically through primer extension. The term oligonucleotide as used in this application encompasses both single and double-stranded oligonucleotides.
The term "solid support" refers to a solid material which is functionalized to permit the coupling of a monomer used in polynucleotide synthesis. The solid support is typically coupled to a nucleoside monomer through a covalent linkage to the 3'-carbon on the furanose. Solid support nnaterials typically are unreactive during the polynucleotide synthesis and simply provide a substratum to anchor the growing polynucleotide. Solid support materials include, but are not limited to, polacryloylmorpholide, :silica, controlled pore glass (CPG), polystyrene, polystyrene/latex, and c~~rboxyl modified teflon.
The term "cleavage" in reference to solid phase oligonucleotide synthesis refers to the breaking of the bomd which binds an oligonucleotide to a solid support.
Typically, cleavage involves hydrolysis of a succinate ester bond between the 3'-hydroxyl of an attached oligonuclE~tide and the solid support.
The term "deprotection" refers to the removal of protecting groups from the exocyclic amines of 'the heterocyclic bases of an oligonucleotide.
Typically, deprotection consists of lhydrolysis of an amide moiety consisting of an exocyclic amine and an amino protection group, e'. g. benzoyl, p-nitrophenoxycarbonyl, di-n-butylaminomethylidene, and dimethyaminomethylenamino. The term deprotection is also used to refer to the removal of protecting groups from the phosphate diesters (internucleotide phosphates) of tree oligonucleotide. When such protecting groups are methoxy, "deprotection" as used herein may not encompass their removal.
Instead, WO 9S/31a69 PC'TlUS95/0526.1 additional treatment with a standard thiophenol-containing reagent may be desired to produce a "thiolated" oligonucleotide.
The term "pteridine nucleotide" or "pteridine monomer" is used herein to refer to the furanosyl pteridine derivatives of the present invention with a 3'-phosphate group. It is recognized that properly speaking the furanosyl pteridine derivatives are not nucleotides as the pteridine is neither a purine or a pyrimidine. However, because the furanosyl pteridine derivatives are structurally analogous to purine nucleotides, and the furanosyl pteridines of this invention are used in the same manner as nucleotides both will be referred to as nucleotides. As used herein, the pteridine nucleotide or pteridine monomer may be fully protected for use in polynucleotide synthesis or it may be deprotected when used as a triphosphate or when incorporated into an oligonucleotide.
The term "nucleotide monomer" as used herein refers to pteridine nucleotides, the "standard" nucleotides; adenosine, guanosine, cytidine, thymidine, and uracil, or derivatives of these nucleotides. Such derivatives include, but are not limited to, inosine, 5-bromodeoxycytidine, 5-bromo-deoxyuridine, N6-methyl-deoxyadenosine and 5-methyl-deoxycytidine.
As used herein, the term "protecting group" refers to a group which is joined to or substituted for a reactive group (e.g. a hydroxyl or an amine) on a molecule.
The protecting group is chosen to prevent reaction of the particular radical during one or more steps of a chemical reaction. Generally the particular protecting group is chosen so as to permit removal at a later time to restore the reactive group without altering other reactive groups present in the molecule. The choice of a protecting group is a function of the particular radical to be protected and the compounds to which it will be exposed.
The selection of protecting groups is well known to those of skill in the art.
See, for 2:5 example Greene et ar. , Protective Groups in Organic Synthesis, 2nd ed. , John Wiley &
Sons, Inc. Somerset, N.J. (1991).
As used herein, the term "protected amine" refers to an amine which has been reacted with an amino protecting group. An amino protecting group prevents reaction of the amide function during either the synthesis of the derivatized pteridine 317 nucleoside or during the chemical synthesis of DNA or RNA using that nucleotide. The amino protecting group can be removed at a later time to restore the amino group without altering other reactive groups present in the molecule. For example, the exocyclic amine may be reacted with dimethylformamid-diethylacetal to form the -w° WO 95/31469 dimethylaminomethylen,3mino function. Amino protecting groups generally include carbamates, benzyl radi~:als, imidates, and others known to those of skill in the art.
Preferred amino protecting groups include, but are not limited to, p-nitrophenylethoxycarbonyl or dimethyaminomethylenamino.
The term "coupling" is generally used in DNA synthesis to refer to the joining of one nucleotide monomer to another nucleotide monomer or to the 5' terminal of an oligonucleotide. ',Che coupling is generally accomplished by the formation of a phosphodiester linkage from the 3'- phosphate of one nucleotide monomer to the 5'-hydroxyl of a second misnomer or oligonucleotide. Coupling is also used to refer to the joining of an initial nucleoside to a solid support.
The term "capping;" refers to a step in which unreacted S'-hydroxyl groups that fail to condense andl successfully couple with the next derivatized nucleotide are blocked. This insures that subsequent reactions proceed only by propagating chains of the desired sequence. Typically capping involves the acetylation of the 5'-hydroxyl functions. Usually this is accomplished by acetic anhydride catalyzed by 4-dimethylaminopyridine (DMAP). Other reagents, known to those of skill in the art are suitable.
The term "synthesis cycle" refers to the sequence of reactions necessary to couple a nucleotide monomer to the 5' terminal of the oligonucleotide being synthesized.
Typically, a synthesis cycle involves removal of the S'-hydroxyl blocking group on the terminus of the oligonucleodde, reaction with the phosphite derivative of a nucleotide monomer to form a pho;~phodies~ter bond, and then capping of molecules in which coupling was unsuccessful.
The term "normal physiological conditions" is used herein to refer to conditions that are typiG~l inside a living organism or a cell. While it is recognized that some organs provide extreme conditions, the infra-organismal and infra-cellular environment normally v~iries around pH 7 (i. e. from pH 6.5 to pH 7.5), contains water as the predominant solvent, and exists at a temperature above 0°C and below 50°C.
This invention provides a number of pteridine nucleotides which are highly fluorescent under normal physiological conditions and which may be utilized in the chemical synthesis of oligonucleotides to produce fluorescent oligonucleotides. These fluorescent oligonucleotides have: many uses including, for example, probes for screening genomic and complementary DNA libraries, probes for in situ hybridization, primers for DNA synthesis, sequencing, and amplification, and as model substrates to investigate DNA-protein interactions.
In one embodiment, the pteridine nucleotides of this invention are suitable for use in the chemical synthesis of oligonucleotides. In general, this requires blocking S the exocyclic amines on the pteridine, derivatizing the phosphite moiety with a reactive group appropriate to the particular synthetic chemistry contemplated, and blocking the S' hydroxyl with a protecting group that may be removed during synthesis to facilitate the stepwise coupling of derivatized nucleotides to the 5' terminus of the growing oligonucleotide. Where the sugar of the pteridine derivative is a ribose, the reactive 2'-hydroxyl group must also be protected.
In a preferred embodiment, the invention provides for nucleotide monomers of formula I.
R1 l R12 \N3 4 5\

7 is These nucleotide monomers are pteridine derivatives with ring vertices 1 through 8 as 15 shown, where R" is combined with R'2 to form a single oxo oxygen joined by a double bond to ring vertex 4, or with R'3 to form a double bond between ring vertices 3 and 4;
R'2, when not combined with R", is either NHZ or NHZ either mono- or disubstituted with a protecting group; R'3 when not combined with R" is a lower alkyl or H;
R" is either H, lower alkyl or phenyl; R'S is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2, or with R" to form a double bond between ring vertices 1 and 2, such that ring vertices 2 and 4 collectively bear at most one oxo oxygen; and R'6 when not combined with R'S is a member selected from the group consisting of H, phenyl, NH2, and NHZ mono- or disubstituted with a protecting group.
When R'S is not combined with R'6, R'8 is combined with R'9 to form a single oxo p oxygen joined by a double bond to ring vertex 7. When R'S is combined with R'6, R'a is combined with RZ° to form a double bond between ring vertices 7 and 8, and R'9 is either H or a lower alkyl. R" when not combined with R'S, and RZ° when not combined with R'g, are compounds of formula IlL

H H

where the symbol RZ' reF~resents a hydrogen, protecting groups or a triphosphate; the symbol RZZ represents a Hydrogen, a hydroxyl, or a hydroxyl substituted with a protecting group; and R'~ represe:nts a hydrogen, a phosphoramidite, an H-phosphonate, a methyl phosphonate, a ;phosphorothioate, a phosphotriester, a hemisuccinate, a hemisuccinate covalently bound to a solid support, a dicyclohexylcarbodiimide, and a dicyclohexylcarbodiimide covalendy bound to a solid support. When R'3 is H and R~ is H, RZ' is a triphosphate and when R" is combined with R'3 to form a double bond between ring vertices 3 and 4 and R~ is H, RZ' is a triphosphate.
In another preferred embodiment R'4 is hydrogen, a methyl or a phenyl, more particularly a hydrogen or a methyl.
In still another preferred embodiment, R'6, when not combined with R'S, is a hydrogen, a phenyl, an amino group, or NHZ disubstituted with a protecting group.
More particularly, R'6 is .a hydrogen and a phenyl.
In yet another preferred embodiment when R'e is combined with RZ°, R'9 is a hydrogen or a methyl.
In still yet .another preferred embodiment, R'4 is a hydrogen, a methyl, or a phenyl, R'6, when not combined with R'S, is a hydrogen, a phenyl or an amino, and, when R'g is combined with RZ°, R'9 is a hydrogen or a methyl.
Among the compounds of the present invention, nine embodiments are particularly preferred. In a first preferred embodiment R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'z is NHZ or NHZ mono- or disubstituted with a protecting group; R'° is a hydrogen; R'S is combined with R" to form a double bond between ring vertices 1 and 2; R'6 is a phenyl; R'g is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and RZ° is formula II. This embodiment is illustrated by formula III. Particularly preferred compounds of this 5 embodiment are illustrated by formula III when R'2 is NH2.

N H
N
I ~N~N 0 In a second preferred embodiment R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'2 is NHZ or NHz mono- or disubstituted with a protecting group; R'4 is a phenyl; R'S is combined with R" to form a double bond 10 between ring vertices 1 and 2; R'6 is a hydrogen; R'g is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7 and RZ° is formula II. This embodiment is illustrated by formula IV. Particularly preferred compounds of this embodiment are illustrated by formula IV when R'2 is NH2.
R12 \
N ~ I /
~N N 0 In a third preferred embodiment R" is combined with R'2 to form a single oxo oxygen joined by a double bond to ring vertex 4; R'3 is CH3; R'° is H; R'S is combined with R" to form a double bond between ring vertices 1 and 2; R'6 is NH2; R'g 20 is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R2° is formula II. This embodiment is illustrated by formula V.
One particularly preferred compound of this embodiment is the nucleoside illustrated by formula V when R~ of formula II is H and more particularly when RZ', RZZ, and R~ of formula II are all H.

H3C~N \ H

In a fourth preferred embodiment R" is combined with R'2 to form a single oxo oxygen joined by a do~,~ble bond to ring vertex 4; R'3 is a hydrogen; R'4 is hydrogen; R's is combined with IZ;" to form a double bond between ring vertices 1 and 2;
R'6 is NHz or NHZ mono-~ or disubstituted with a protecting group; R'g is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R2° is formula II. This embodiment is illustrated by formula VI. Particularly preferred compounds of this embodiment are illustrated by formula VI when R'b is NH2.

N H
i6~

In a fifth preferred embodiment R" is combined with R'2 to form a single oxo oxygen joined by a double bond to ring vertex 4; R'3 is a hydrogen; R'4 is CH3; R's is combined with R" to form a double bond between ring vertices 1 and 2; R'6 is NHZ or NHZ mono- or disubstitutf;d with a~ protecting group; R'e is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and RZ° is formula II. This embodiment is illustrated by formula VII. Particularly preferred compounds of this embodiment are illustrated by formula VII when R'6 is NH2.

HN
,16~
R. N N 0 In a sixth preferred embodiment R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'2 is NHZ or NHZ mono- or disubstituted with a protecting group; R'4 is CH3; R's is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2; R" is formula IIrR'e is combined with RZ°to form a double bond between ring vertices 7 and 8; and R'9 is CH3. This embodiment is illustrated by formula VIII. Particularly preferred compounds of this embodiment are illustrated by formula VIII when R'2 is NH2.

N ~ CH3 In a seventh preferred embodiment R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'z is NHZ or NHZ mono- or disubstituted with a protecting group; R'4 is H; R'S is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2; R" is formula II; R'8 is combined with RZ° to form a double bond between ring vertices 7 and 8; and R'9 is CH3. This embodiment is illustrated by formula IX. Particularly preferred compounds of this embodiment are illustrated by formula IX when R'2 is NH2.

N H

In an eighth preferred embodiment R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'2 is NH2; R'° is CH3; R'S
is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2; R"
is formula II; R'g is combined with R2° to form a double bond between ring vertices 7 and 8; and R'9 is H. This embodiment is illustrated by formula X. Particularly preferred compounds of this embodiment are illustrated by formula X when R'Z is NH2.

N ~ CH3 N N H

R (X) WO 95/31469 PC'TlUS95/0526.i In a ninth preferred embodiment R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'z is NH2 or NHz mono- or disubstituted with a protecting group; R'° is H; R'S is combined with R'6 to form a single oxo oxygen jov~ed by a double bond to ring vertex 2; R" is formula II; R'e is combined with R~° to form a double bond between ring vertices 7 and 8; and R'9 is H. This embodiment is illustrated by formula III. Particularly preferred compounds of this embodiment are illustrated by formula XI when R'z is NHz.
Rlz N H
N N H

(Xn to As explained above, the exocyclic amines of the pteridines must generally be protected during okigonucleotide synthesis. Protecting groups suitable for blocking the exocyclic amines of the pteridines are widely la~own to those of skill in the art. In general, a protecting group will prevent undesired reactions of the exocyclic amines during the synthesis of an oligonuckeotide incorporating the pteridine derivative. It is of course recognized that these groups may also need to be protected during the actual synthesis of the pteridine derivative to prevent undesired reactions. The protecting group should be removable after synthesis of the oligonuckeotide to restore the amine group without altering other reactive groups present in the molecule.
Typically, the amine groups are protected by acylation, usually by carbamates, benzyl radicals, imidates, and others imown to those of skill in the art.
Examples of protecting groups include, but are not limited to, benzoyl, 4-methoxybenzoyl, phenoxyacetyl, diphenylacetyl, isobutyryl, phthaloyl, di-n-butylaminomethykidene, dimethylaminomethylenamino, dimethylaminomethylidene, p-nitrophenylethoxycarbonyk and dimethylformamide-diethylacetal. Particularly preferred are :p-nitrophenylethoxycarbonyl or dimethylaminomethylenamino. For a description of a number of suitable protecting groups see Reese, Tetrahedron, 34: 3143-3179 (1978);
Ohtsuka et al. , Nucleic Acids ReS. , 10: 6553-6570 ( 1982), and Narang, Tetrahedron 39:
3n 3-22; (1983).

WO 95/31469 ~ PCT/US95/05264 Thus, in a preferred embodiment, the invention provides for nucleotide monomers of formula I in which R'2 and R'b are independently NHZ either mono-or disubstituted by a protecting group selected from the group consisting of benzoyl, isobutyryl, phthaloyl, di-n-butylaminomethylidene, dimethylaminomethylidene, p-nitrophenylethoxycarbonyl and dimethylaminomethylenamino. More particularly, R'z is NHZ monosubstituted by a protecting group selected from the group consisting of di-n-butylaminomethylidene, p-nitrophenylethoxycarbonyl, and dimethylaminomethylenamino.
During oligonucleotide synthesis, the 5'-hydroxyl group of the pteridine monomer must be blocked to prevent undesired reactions. However this blocking group must also be removable during synthesis to permit the stepwise coupling of new monomers to the S' terminus of the growing oligonucleotide. Appropriate protecting groups are well known to those of skill in the art and include, but are not limited to, trityl, monomethoxytrityl, dimethoxytrityl, phthaloyl, di-n-butylaminomethylene, and dimethylaminomethylidene. Dimethoxytrityl is generally preferred as a blocking group for the 5'-hydroxyl group.
Thus, in a preferred embodiment, the invention provides for nucleotide monomers of formula I in which RZ° is formula II wherein R2' is H, trityl, monomethoxytrityl, dimethoxytrityl, phthaloyl, di-n-butylaminomethylene, or dimethylaminomethylidene. More specifically, RZ' is either dimethoxytrityl, di-n-butylaminomethylene, or dimethylaminomethylidene.
Where the sugar of the pteridine derivative is a ribofuranose, the 2'-hydroxyl group must also be protected. Preferred 2'-hydroxyl protecting groups include, but are not limited to, trityl, monomethoxytrityl, dimethoxytrityl, tetrahydropyran-1-yl, 4-methoxytetrahydropyran-4-yl, 1-(2-chloro-4-methyl)phenyl-4-methoxypiperidin-4-yl, t-butyldimethylsilyl, p-nitrophenylerhysulfonyl, tetrahydropyranyl, 4-methoxytetrahydropyranyl, 2-nitrobenzyl, 9-phenylxanthen-9-yl and p-nitrophenylethyl.
In a preferred embodiment, the 2'-hydroxyl group will be protected by substitution with a tertbutyldimethylsilyl group.
Thus in another preferred embodiment, the invention provides for nucleotide monomers of formula I, in which RZ° is formula II wherein R22 is either H, OH, or OH substituted with either trityl, monomethoxytrityl, dimethoxytrityl, tetrahydropyran-1-yl, 4-methoxytetrahydropyran-4-yl, 1-(2-chloro-4-methyl)phenyl-4-NCV. Vt)N : L:F'A MUL:\'CHEV U 1 _ '_' ~- '1_-9Ei : 1 ' av : -- . ~- ~ 5 ~'~3 SU4O~ +~H f3J '?:3JJ44E~6 ;, II _4-. . __ . .. ~ ._ . . .. ~ ... . .

methozypiperidin-4-yl, t-~butyldimethylsilyl, p-nitrophenylcthylsulfonyl, tetrahydropyranyl, 4-methoxytetrahydropyranyl, 2-nitrobenryl, 9-phenylxanthen-9-yI and p-nitrophenylcthyl. MorE; particularly, R~ is either H or OH substituted with either dimethoxytrityL, tetrahydr'opyran-1-yl, t-butyldimcthylsilyl, 2-nitrobenzyl, or p-5 nitrophenylcxhyl.
The (B-cyanoethyl)-N,N-diisopmpyl phosphoramidite compounds of the present invention are preferred as oligonucleotide synthesis monomers. These compounds may gentrall3r be utilized in most commercial DNA synthesizers without modification of the synthesis protocol. However, where large scale synthesis is desired, 10 or where it is desirable to incorporate sulfur groups or other modifications in the phosphate linkages, the H(-phosphonate compounds of the present invention may be preferred as synthesis reagents. The synthesis and use of other phosphate derivatives l suitable for oligonucleotide synthesis is well lrnown to those of skill in the art. These include, but are not limit~:d to a methyl phosphonate, a phosphorothioate, and a I5 phosphotriestcr.
Preferred e~rnbodiments of this invention are the compounds where the pteridine nucleotides art derivatized and protected for use as reagents in the synthesis of oligonucleotides. In particular, the reactive exocyclic amines are protected and the 3'-hydroxyl is dcrivatizcd as an H-phosphonate or as a phosphoramidite.
Particularly preferred are compounds illustrated by formulas TII through XI derivatized in this manner.
Thus, a fir:rt preferred embodiment is illustratcrl by formula TII in which R'Z is NHS mono- or disubstituted with a protecting group and R2° is formula II in which R~ is an H-phosphonate or a phosphoramidite. Morc particularly, RZt of formula II is a dimethoxytrityl; RZZ is H and R" is a (13-cyanoethyl)-N,N-diisopropyl phosphoramidite.
Still more particularly, R'z is dimethylaminomethylenamino.
A second p~refen~'ed embodiment is illustrated by formula IV in which R'~
is NHz mono- or disubstituted with a protecting group and Rte' is formula II
in which R~
is an H-phosphonate or a phosphoramidite. More particularly, R2' of formula YT
is a dimcthoxytrityl; Ru is H .and R~ is a (li-cyanoethyl)-N,N-diisopropyl phosphozamidite.
Still morn particularly, R'= is dimcthylaminomethylenamino.
A third preferred embodiment is illustrated by formula V in which R~°
is formula II and R~ is an H-phosphonate or a phosphoramidite. More particularly, R2' of [ Replacement page ]
AMENDED Sf~E~

IZC~. V(W:I~f'A-111:t:VC:lll:~i-():3 . ..t.- .~ ::3(i : 1 i~:ai,3 : --_4I i i?fi ():)()(l-. +4J ~;7 '~:3:)~)44fi6:.lf ,4, _ . . - . . . . . _ ~ . _ . . ~., 21905~g formula II is a dimethoxytrityl; R~ is H and R~ is a !3-cyanoethyl, N-diisopropyl phosphoramidite.
A fourth preferred embodiment is illustrated by formula VI in which R'6 is NH2 mono- or disubstituted with a protecting group and ;R~° is formula II in which R'~ is s an H-phosphonate or a phosphocamidite. More particularly, RZ' of formula II( is a dimethoxytrityl; Rn is l3 and Rw is a B-cyanocthyl, N-diisopropyl phosphoramiditc. Still more particularly, R's i;s dimethylaminomethylenamino.
A fifth p:referted embodiment is illustrated by formula VII in which R'6 is NHz mono- or disubstituted with a protecting group and Rz° is formula IY in which R=3 is l0 an H-phosphonate or a phosphoramidite. More particularly, RZ' of formula II
is a dimethoxytrityl; Rzz is 13 and Rw is a B-cyanoethyl, N-diisopropyl phosphoramidite. Still '-~ more particularly, R'6 is dimethytaminomethylcnamino.
A sixth preferred ernbodimertt is illustrated by formula Vn'I in which R"
is NH2 mono- or disubsxituted with a protecting group and R" is formula II in which Rz3 ~5 is an H-phosphonate or a phosphoramidite. More particularly, Rz' of formula II is a dimethoxytrityl; RzZ is 13 and R'3 is a B-cyanoethyl, N-diisopropyl .phosphoramidite. Still more particularly, R'z i;, NH= mono- or disubstituted with a p-nitrophenylethoxycarbanyl.
A sevcntlo preferred embodiment is illustrated by formula rX in which R'z is NH2 mono- or disubstituted ~rith a protecting group and R" is formula II in which Rz3 2 o is an H-phosphonate or a phosphoramidite. More particularly, Ri' of formula II is a dimethoxytrityl; R~ is 13 and R'~ is a B-cyanoethyl, N-diisopropyl phosphoramidioc. Still more particularly, R'z i:, NH2 mono- or disubstirsted with a p-nitrophenyletltoxyearbonyl.
'. An eighth preferred embodiment is illustrated by formula X in which R'z is NH2 mono- or disubstituted with a protecting group and R" is formula II in which R~
25 is an H-phosphonate or a phosphoramidite. lvXore particularly, R'' of formula II is a dimethoxytrityl; Rzz is l~ and R~'3 is a li-cyanoethyl, N-diisopropyl phosphoramidite. Still more particularly, R'2 is NHz mono- or disubstihaed with a p-nitraphenylethaxycarbonyl.
A ninth F)refenred embodiment is illustrated by formula XI in which R'z is IVHi mono- or disubstitured with a protecting group and R" is formula II in which Rn is 3 o an H-phosphonate or a ;phosphoramidite. More particularly, RZ' of formula II is a dimethoxytrityl; Rn is 1i and Rz3 is a !3-cyanoethyl, N-diisopropyl phosphoramidite. Still more particularly, R'z i:;; NHz mono- or disubstituted with a p-nitrophcnylethoxycarbonyl.
~Replacemept pa<gej Wo 95/31469 PC'T/L'S95/05264 The oligonucleotides of the present invention may be synthesized in solid phase or in solution. Generally, solid phase synthesis is preferred. Detailed descriptions of the procedures for solid phase synthesis of oligonucleotides by phosphite-triester, phosphotriester, and H-phosphonate chemistries are widely available. See, for example, Itakura, U.S. Pat. No. 4,401,796; Caruthers et al., U.S. Pat. Nos. 4,458,066 and 4,500,707; Beaucage et al., Tetrahedron Lett., 22: 1859-1862 (1981); Matteucci et al., J. Amer. Chem. Soc., 103: 3185-3191 (1981); Caruthers et al., Genetic Engineering, 4:
1-:L7 (1982); Jones, chapter 2, Atkinson et al., chapter 3, and Sproat et al., chapter 4, in Gait, ed. Oligonucleotide Syrahesis: A Practical Approach, IRL Press, Washington D.C.
(1984); Froehler et al., Tetrahedron Lett., 27: 469-472 (1986); Froehler et al., Nucleic Acids Res., 14: 5399-5407 (1986); Sinha et al. Tetrahedron Lett., 24: 5843-5846 (1983);
and Sinha et al., Nucl. Acids Res., 12: 4539-4557 (1984).
Generally, the timing of delivery and concentration of reagents utilized in a coupling cycle will not differ from the protocols typical for unmodified commercial phosphoramidites used in commercial DNA synthesizers. In these cases, one may merely add the solution containing the pteridine derivatives of this invention to a receptacle on a port provided for an extra phosphoramidite on a commercial synthesizer (e. g., model 3808, Applied Biosystems, Foster City, California, U.S.A.).
However, where the coupling efficiency of a particular derivatized pteridine compound is substantially lower than the other phosphoramidites, it may be necessary to alter the timing of delivery or the concentration of the reagent in order to optimize the synthesis.
Means of optimizing oligonucleotide synthesis protocols to correct for low coupling efficiencies are well known to those of skill in the art. Generally one merely increases the concentration of the reagent or the amount of the reagent delivered to ~ch:eve a higher coupling efficiency. Methods of determining coupling efficiency are also well known. For example, where the 5'-hydroxyl protecting group is a dimethoxytrityl (DMT), coupling efficiency may be determined by measuring the DMT ration concentration in the acid step (which removes the DMT group). DMT ration concentration is usually determined by spectrophotometrically monitoring the acid wash.
The acid/DMT solution is a bright orange color. Alteratively, since capping prevents further extension of an oligonucleotide where coupling has failed, coupling efficiency may be estimated by comparing the ratio of truncated to full length oligonucleotides utilizing, for example, capillary electrophoresis or HPLC.
Solid phase oligonucleotide synthesis may be performed using a number of solid supports. A suitable support is one which provides a functional group for the attachment of a protected monomer which will become the 3' terminal base in the synthesized oligonucleodde. The support must be inert to the reagents utilized in the particular synthesis chemistry. Suitable supports are well known to those of skill in the art. Solid support materials include, but are not limited to polacryloylmorpholide, silica, controlled pore glass (CPG), polystyrene, polystyrene/latex, and carboxyl modified teflon. Preferred supports are amino-functionalized controlled pore glass and carboxyl-functionalized teflon.
Solid phase oligonucleotide synthesis requires, as a starting point, a fully protected monomer (e. g. , a protected nucleoside) coupled to the solid support. This coupling is typically through the 3'-hydroxyl (oxo when coupled) covalently bound to a linker which is, in turn, covalently bound to the solid support. The first synthesis cycle then couples a nucleotide monomer, via its 3'-phosphate, to the 5'-hydroxyl of the bound nucleoside through a condensation reaction that forms a 3'-5' phosphodiester linkage.
Subsequent synthesis cycles add nucleotide monomers to the 5'-hydroxyl of the last bound nucleotide. In this manner an oligonucleotide is synthesized in a 3' to 5' direction producing a "growing" oligonucleotide with its 3' terminus attached to the solid support.
Numerous means of linking nucleoside monomers to a solid support are known to those of skill in the art, although monomers covalently linked through a succinate or hemisuccinate to controlled pore glass are generally preferred.
Conventional protected nucleosides coupled through a hemisuccinate to controlled pore glass are commercially available from a number of sources (e.g., Glen Research, Sterling, Vermont, U.S.A., Applied Biosystems, Foster City, California, U.S.A., Pharmacia LKB, Piscataway, New Jersey, U.S.A.).
Placement of a pteridine nucleotide at the 3' end of an oligonucleotide requires initiating oligonucleotide synthesis with a fully blocked furanosyl pteridine linked to the solid support. In a preferred embodiment, linkage of the pteridine nucleoside is accomplished by first derivatizing the pteridine nucleotide as a hemisuccinate. The hemisuccinate may then be attached to amino functionalized controlled pore glass in a condensation reaction using mesitylene-2-sulfonyl chloride/1-methyl-1H-imidazole as ~3 condensing agent. Controlled pore glass functionalized with a number of different reactive groups is commercially available (e.g., Sigma Chemical, St.
Louis, Missouri, U.S.A.,). A similar coupling scheme is described by Atkinson et al., chapter 3 in Gait, ed., C)ligonucl'eotide Synthesis: A Practical Approach, IRL
Press, Washington, D.C., (1984). Triisopropylbenzenesulfonyl chloride, imidazolides, triazolides or even the tearazolidfa may also be used as condensing agents.
Dicyclohexylcarbodiimide (DCC) and structural analogs are also suitable linkers. Other linkers and appropriate condensing groups are well known to those of skill in the art.
In prefernrd embodiments, this invention therefore provides for pteridine nucleotides in which the S'-hydroxyl is derivatized as a hemisuccinate which may then be covalently bound to a solid support; more specifically to controlled pore glass.
Particularly preferred am compounds illustrated by formulas III through XI
derivadzed in this manner.
Thus, in a. first preferred embodiment, this invention provides for compounds of formula IQ where R'Z is NHZ mono- or disubstituted with a protecting group and R2° is formulas II in which R'~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; R22 is H; and R~3 is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R" is dimethylaminomethylenamino.
In a second preferred embodiment, this invention provides for compounds of formula IV where R" is NHZ mono- or disubstituted with a protecting group and R2°
is formula II in which R~ is a hE:misuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, R2' of formula II is a dimethoxytrityl; R'~
is H; and R~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R'2 is dimethylaminomethylenamino.
In a third preferreti embodiment, this invention provides for compounds of formula V where R2° is formula :Q in which R~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; R'~ is H; and Rz3 is a hemisuccinate covalently bound to controlled pore glass.
In a fourth preferr~°d embodiment, this invention provides for compounds of formula VI where R'6 is NHZ mono- or disubstituted with a protecting group and Rzo is formula II in which R'~ is a he:misuccinate, or a hemisuccinate cova~lently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; RZZ
is H; and R~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R'6 is dimethylaminomethylenamino.
In a fifth preferred embodiment, this invention provides for compounds of 5 formula VII where R'6 is NHZ mono- or disubstituted with a protecting group and RZ° is formula II in which R~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, R2' of formula II is a dimethoxytrityl; RZZ
is H; and R~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R'6 is dimethylaminomethylenamino.
10 In a sixth preferred embodiment, this invention provides for compounds of formula VIII where R'Z is NHZ mono- or disubstituted with a protecting group and R" is formula II in which R~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; RZZ
is H; and R~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly 15 R'2 is p-nitrophenylethoxycarbonyl.
In a seventh preferred embodiment, this invention provides for compounds of formula IX where R'Z is NHZ mono- or disubstituted with a protecting group and R"
is formula II in which R~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; R~
is H; and 20 R~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R'2 is p-nitrophenylethoxycarbonyl.
In an eighth preferred embodiment, this invention provides for compounds of formula X where R'2 is NH2 mono- or disubstituted with a protecting group and R" is formula II in which R~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; R~
is H; and R'~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R'2 is p-nitrophenylethoxycarbonyl.
In a ninth preferred embodiment, this invention provides for compounds of formula XI where R'2 is NHz mono- or disubstituted with a protecting group and R" is formula II in which R'~ is a hemisuccinate, or a hemisuccinate covalently bound to a solid support. More particularly, RZ' of formula II is a dimethoxytrityl; R22 is H; and R~ is a hemisuccinate covalently bound to controlled pore glass. Still more particularly R'2 is p-nitrophenylethoxycarbonyl.

WO 95/31469 PCT/US95/0526.t In embodiments where the exocyclic amines are protected by the p-nitrophenylethoxycarbonyl group, the deprotection reagents may also cleave the ester function of the succinyl spacer linking the 3' terminal nucleoside to the solid support. In this case, the coupling scheme described by Stengele et al. , Tetrahedron Lett. , 18: 2549-2552 (1990), is preferred. In this method. solid supports (dihvdroxypropvl-CPG, SOOA and 1400, F luka AG, S~~itzerland, Catalog Nos.: 27754, 27764, 2770) are reacted first with N, N'-carbonvidiimiazole and then with l,Ei-bismethylaminohexane as an aliphatic secondary amine spacer. This compound is then coupled with the appropriately protected 2'-nucleoside-3'-O-succinates and the free hydroxyl groups of the solid support are subsequently with acetic anhydride and 4-dimethylaminopyridine (DMAP). This linker is completely stable under the deprotection conditions used for p-nitrophenylethoxycarbonyl and p-nitrophenylethyl groups, while cleavage from the matrix can be achieved normally under hydrolytic conditions in concentrated ammonia in less than two hours.
Once the full length oligonucleotide is synthesized, the protecting groups are removed (the oligonucleotide is deprotected), and the oligonucleotide is then cleaved from the solid support prior to use. (Where a teflon solid support is used, the oligonucleotide may be left permanently attached to the support to produce an affinity column.) Cleavage and deprotection may occur simultaneously or sequentially in any order. The two procedures may be interspersed so that some protecting groups are removed from the oligonucleotide before it is cleaved off the solid support and other groups are deprotected from the cleaved oligonucleotide in solution. The sequence of events depends on the particular blocking groups present, the particular linkage to a solid support, and the preferences of the individuals performing the synthesis.
Where >5 deprotection precedes cleavage, the protecting groups may be washed away from the oligonucleotide which remains bound on the solid support. Conversely, where deprotection follows cleavage, the removed protecting groups will remain in solution with the oligonucleotide. Often the oligonucleotide will require isolation from these protecting groups prior to use.
:30 In a preferred embodiment, and most commercial DNA synthesis, the protecting group on the 5'-hydroxyl is removed at the last stage of synthesis.
The oligonucleotide is then cleaved off the solid support, and the remaining deprotection occurs in solution. Removal of the 5'-hydroxyl protecting group typically just requires treatment with the same reagent utilized throughout the synthesis to remove the terminal S'-hydroxyl groups prior to coupling the next nucleotide monomer. Where the 5'-hydroxyl protecting group is a dimethoxytrityl group, deprotection may be accomplished by treatment with acetic acid, dichloroacetic acid or trichloroacetic acid.
Typically, both cleavage and deprotection of the exocyclic amines are effected by first exposing the oligonucleotide attached to a solid phase support (via a base-labile bond) to the cleavage reagent for about 1-2 hours, so that the oligonucleotide is released from the solid support, and then heating the cleavage reagent containing the released oligonucleotide for at least 20-60 minutes at about 80-90°C so that the protecting groups attached to the exocyclic amines are removed. The deprotection step may alternatively take place at a lower temperature, but must be carried out for a longer period of time (e.g., the heating can be at 55°C for 5 hours). In general, the preferred cleavage and deprotection reagent is concentrated ammonia.
Where the oligonucleotide is a ribonucleotide and the 2'-hydroxyl group is blocked with a tert-butyldimethylsilyl(TBDMS) moiety, the latter group may be removed using tetrabutylammonium fluoride in tetrahydrofuran at the end of synthesis.
See Wu et al., J. Org. Cytem. 55: 4717-4724 (1990). Phenoxyacetyl protecting groups can be removed with anhydrous ammonia in alcohol (under these conditions the TBDMS
groups are stable and the oligonucleotide is not cleaved). The benzoyl protecting group of cytidine is also removed with anhydrous ammonia in alcohol.
Where the exocyclic amines are protected by the p-nitrophenylethoxy-carbonyl group and the coupling to the solid support is via a 1,6-bis-methylaminohexane condensed with succinate nucleoside, the amino groups are preferably deprotected by treatment with a 1 M DBU (1,8-diaza-bicyclo[5.4.0]-under-7-ene). Cleavage of the oligonucleotide from the solid support is then accomplished by treatment with concentrated ammonia.
If this latter approach to deprotection is used, it is preferred to synthesize the oligonucleotide using pteridine, adenine, thymidine, guanosine, cytidine, uracil, and modified nucleotide monomers protected with p-nitrophenyethyl and p-nitrophenyl-ethoxycarbonyl groups for amide and~amine protection respectively. See Stengele and Pfleiderer, Tetrahedron Lett., 31: 2549-2552 (1990) citing Barone, et al.
Nucleic Acids Res., 12: 4051-4061 (1984). The single deprotection protocol will then deprotect all the constituent nucleotides of the oligonucleotide.

Cleaved and fully deprotected oligonucleotides may be used directly (after lyophilization or evaporation to remove the deprotection reagent) in a number of applications, or they may be purified prior to use. Purification of synthetic oligonucleotides is generally desiired to isolate the full length oligonucleotide from the S protecting groups that were removed in the deprotection step and, more importantly, from the truncated oligonucleotides that were formed when oligonucleotides that failed to couple with the next nucleotide monomer were capped during synthesis.
Oligonucl~°otide purification techniques are well known to those of skill in the art. Methods include, but are not limited to, thin layer chromatography ('TLC) on silica plates, gel electroF~horesis, size fractionation (e. g. , using a Sephadex column), reverse phase high performance liquid chromatography (HPLC) and anion exchange chromatography (e.g., using the mono-Q column, Pharmacia-LKB, Piscataway, New Jersey, U.S.A.). For a discussion of oligonucleotide purification see McLaughlin et al., chapter 5, and Wu et al., chapter 6 in Gait, ed., Oligonucleotide Synthesis: A
Practical Approach, IRL Press, Washington, D.C., (1984).
The oligonucleotid.es of the present invention contain pteridine nucleotides at one or more positions in the syuence, either internal to the sequence or terminal. An oligonucleotide of the present invention may contain a single pteridine derivative at one or more locations or ma~~ contain two or more different pteridine derivatives.
The oligonucleotide may consist entirely of pteridine nucleotides or contain naturally occurring and/or modified nuclet~tides. Modified nucleotides are well known to those of skill in the art and include, but are not limited to, inosine, 5-bromodeoxycyddine, S-bromo-deoxyuridine, N6-methyl-deoxyadenosine and 5-methyl-deoxycytidine.
Phosphoramidite forms of these nucleotides are commercially available from a number of suppliers including, for example, Applied Biosystems, Inc. Foster City, California, U.S.A., Clonetech, Palo Alto, California, U.S.A., and Glen Research, Sterling, Vermont, U.S.A..
In a preferred embodiment, this invention provides for oligonucleotides comprising one or more nucleotide monomers having formula RII.

WO 95/31469 219 0 5 8 ~ r PCTIUS95/05264 11 ~12 ~N 4 5\

(XIn 2 ~ 7 19 R16 ~ 1 8 R
Rlg N N R18 The nucleotide monomers are pteridine derivatives with ring vertices 1 through 8 as shown where R" through R'6, R'g, and R'9 are as described for formula I except that the protecting groups are eliminated. Thus, R'Z, when not combined with R", is NHZ
and R'6, when not combined with R'S, is H, phenyl, or NH2. R", when not combined with R'S, and RZ° when not combined with R'a, are compounds of formula XIII.

-p ~p- 0 _I

OH R2z (X~
where the symbol Rn represents a hydrogen or a hydroxyl.
In a preferred embodiment, the oligonucleoddes of the present invention comprise monomers of formula XII where R'4 is hydrogen, a methyl or a phenyl, more particularly a hydrogen or a methyl.
In another preferred embodiment, the oligonucleotides of the present invention comprise monomers of formula XII where R'6, when not combined with R'S, is a hydrogen, a phenyl, or an amino group, more particularly a hydrogen and a phenyl.
In yet another preferred embodiment, the oligonucleotides of the present invention comprise monomers of formula XII where when R'g is combined with R2°, R'9 is a hydrogen or a methyl.
In a further preferred embodiment, the oligonucleotides of the present invention comprise monomers of formula XII where R'4 is a hydrogen, a methyl, or a phenyl; R'6 is a hydrogen, a phenyl or an amino; and, when R'a is combined with RZ°, R'9 is a hydrogen or a methyl.
Among the compounds of the present invention, oligonucleotides comprising one or more of nine nucleotide monomers are particularly preferred.
The 5 first preferred nucleotide: monomer is illustrated by formula XII where R"
is combined with R'3 to form a double bond between ring vertices 3 and 4; R'2 is an amino group; R'4 is a hydrogen; R'S is combined vvith R" to form a double bond between ring vertices 1 and 2; R'6 is a phenyl, R'g is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and RZ° is formula XIV. This nucleotide monomer is 10 illustrated by formula X:(V where R~ is H or OH and more preferably RZZ is H.
NHz N H
N
.'~N~N 0 I I
_ 0 _I

OH R2z A second preferre~~ nucleotide monomer is illustrated by formula XII
15 where R" is combined v~ith R'3 1:o form a double bond between ring vertices 3 and 4; R'2 is NH2; R'° is a phenyl; R'S is combined with R" to form a double bond between ring vertices 1 and 2; R'6 is a hydrogen, R'8 is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and RZ° is formula XIB. This nucleotide monomer is illustrated( by formula XV where RZZ is H or OH and more 20 preferably R~ is H.

z19u5gg 26 NHz N ~ I /
H~N N 0 -0 _ p-_I 0 A third preferred nucleotide monomer is illustrated by formula XII where R" is combined with R'z to form a single oxo oxygen joined by a double bond to ring vertex 4; R'3 is CH3; R'4 is H; R's is combined with R" to form a double bond between ring vertices 1 and 2; R'6 is NHz; R'8 is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and Rz° is formula XIII. This nucleotide monomer is illustrated by formula XVI where Rzz is H or OH and more preferably Rzz is H.

H3~~N \ H
HzN N N 0 I I
_0 _ P- 0 OH R22 (XVn A fourth preferred nucleotide monomer is illustrated by formula XII where R" is combined with R'z to form a single oxo oxygen joined by a double bond to ring vertex 4; R'3 is H; R'4 is H; R'S is combined with R" to form a double bond between ring vertices 1 and 2; R'6 is NHz; R'g is combined with R'9 to form a single oxo oxygen joined by a double bond to ring vertex 7; and Rz° is formula XIII. This nucleotide monomer is illustrated by formula XVIII where Rzz is H or OH and more preferably Rzz is H.

;~~9Q58'8 2~

N H

I I
0 =P-0 0 A fifth pre;ferred nucleotide monomer is illustrated by formula XII where R" is combined with R'2 to form a single oxo oxygen joined by a double bond to ring vertex 4; R'3 is a hydrogen; R'4 is CH3; R'S is combined with R" to form a double bond between ring vertices 1 a,nd 2; R'6 is NHZ; R'8 is combined with R'9 to form a single oxo oxygen joined by a double bond no ring vertex 7; and RZ° is formula XIB. This nucleotide monomer is illustrated by formula XVBI where R2z is H or OH and more preferably Rz2 is H.

HN ~ ~H3 HzN N N 0 _0._P-0 0 OH R2z A sixth preferred nucleotide monomer is illustrated by formula XII where R" is combined with R'3 to form a double bond between ring vertices 3 and 4;
R'2 is NH2; R'4 is CH3; R's is combined with R'b to form a single oxo oxygen joined by a double bond to ring vertex 2; R" is formula XBI; R'8 is combined with R2° to form a double bond between ring vertices 7 and 8; and R'9 is CH3. This nucleotide monomer is illustrated by formula X~K where R2z is H or OH and more preferably RZZ is H.

21.9088 28 N ~ CH3 0 =P-0 0 A seventh preferred nucleotide monomer is illustrated by formula XII
where R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'2 is NHZ; R'4 is H; R'S is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2; R" is formula XIli; R'e is combined with RZ° to form a double bond between ring vertices 7 and 8, and R'9 is CH3. This nucleotide monomer is illustrated by formula XX where R'~ is H or OH and more preferably R22 is H.

N H

I I
_0 _P- 0 OH R22 ~X~
An eighth preferred nucleotide monomer is illustrated by formula XII
where R" is combined with R'3 to form a double bond between ring vertices 3 and 4; R'2 is NH2; R" is CH3; R'S is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2, R" is formula XIII, R'g is combined with R2° to form a double bond between ring vertices 7 and 8, and R'9 is H. This nucleotide monomer is illustrated by formula XXI where R22 is H or OH and more preferably RZZ is H.

N ~ ~H3 II
-0 = p._ 0 OH R22 (XXn A ninth preferred nucleotide monomer is illustrated by formula XII where R" is combined with R'3 to form a double bond between ring vertices 3 and 4;
R'2 is NHZ; R'4 is H; R'S is combined with R'6 to form a single oxo oxygen joined by a double bond to ring vertex 2; R'' is formula XBI; R'8 is combined with R2° to form a double bond between ring verticca 7 and 8; and R'9 is H. This nucleotide monomer is illustrated by formula XXII where 1122 is H or OH and more preferably R22 is H.

N H

II
_0 _ P~ 0 ~0 OH R2z ~XX~
The selection of particular pteridine nucleotides and their position within the oligonucleotide sequence will depend on the particular application for which the oligonucleotide is intended. One of skill in the art would recognize that the fluorescent signal of the pteridine derivative will be affected by pH and the particular chemistry of the neighboring molecules. In general, neighboring purines will tend to quench the signal more than neighboring pyrimidines. Purines as primary neighbors severely quench the signal, and they have a significant effect even as secondary neighbors.
Tertiary purines are not as powerful quenchers. In addition, proximity to an end of the nucleotide minimizes the quench of ~~the signal. Thus, where a strong signal is desired from the intact oligonucleotide, it is prefewed that the pteridine nucleotides be located at or near a terminus and adjacent to one or more pyrimidines to reduce quenching of the signal.

i : ;. ; pCT/US95105264 Conversely, where it is desired that the oligonucleotide only provide a signal when it is cut (e.g., by an endonuclease), it is preferred to place the pteridine derivative close to quenching groups (purines), but at a location that is expected to separate the pteridine containing strand from quenching bases when the oligonucleotide is cut thereby releasing 5 the fluorescent signal. The latter approach is illustrated in Example 12.
Thus, in one embodiment, the pteridine nucleotides are located at the 3' end, while in another embodiment, the pteridine nucleotides are located at the 5' end of the oligonucleotides of the present invention.
In yet another embodiment, the oligonucleotides of the present invention 10 comprise pteridine nucleotide monomers which are surrounded by 1 to 10 pyrimidine monomers.
The oligonucleotides of the present invention are not limited to short single stranded sequences. One of skill would recognize that while oligonucleotide synthesis typically has an upper limit of approximately 200 bases, a number of oligonucleotides 15 may be ligated together to form longer sequences. In addition, oligonucleotides having complementary sequences may be hybridized together to form double-stranded molecules.
Methods of hybridizing and ligating oligonucleotides to form longer double stranded molecules are well known. See, for example, Sambrook et al., Molecular Cloning - A
Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 20 1985).
The pteridine derivatives of the present invention are structurally analogous to naturally occurring purines. When incorporated into an oligonucleodde, they act as a fluorescent tag, but do not alter the physical and chemical properties of the oligonucleotide as severely as currently available fluorescent tags. In some cases the 25 perturbations are so minimal as to allow the oligonucleotide to act as an enzyme substrate permitting the enzyme catalyzed reaction to occur even when the substitution has been made at a site known to be critical for the enzyme function. Thus the oligonucleotides of this invention are particularly useful in the investigation of DNA-protein interactions.
One such interaction is illustrated by the interaction between DNA and the 30 viral integration (IN) protein. Integrase is a viral integration protein that has been implicated in the incorporation of HIV viral genes into the human genome.
Engleman et al. Cell, 67: 1211-1221 (1991). Thus integrase appears crucial to the HIV
infection of cells and may provide an important target for AIDS antiviral research.

WO 95/31469 2 ~ ~

,~ .

A specific :DNA se<luence (5'-GTG TGG AAA ATC TCT AGC AGT-3', Sequence LD. No: 1) has been used as an effective model for the HIV integrase enzyme.
Id. The enzyme functions in a step-wise manner to achieve preparation and actual insertion of the HIV genome into the genome of the host cell. The first step in the mechanism appears to be cleavage: of a dinucleotide from the 3' end of the sequence leaving a 5' overhang. Because of their structural similarity to guanosine a number of the pteridine nucleotides of the present invention (e.g., compounds illustrated by formula V or formula VI) may be substituted for the guanosine in the dinucle:otide that is cleaved off by integrase. In the intact DN~'A sequence, the neighboring purine will quench the signal of the pteridine nucleotide. Cleavage of the nucleotide from the strand by integrase releases the quenched fluorescent signal and allows real-time monitoring of the reaction by detecting the increase in fluorescence. This provides a simple and rapid assay for the activity of the integr~se enzyme.
Thus, in still another embodiment, the oligonucleotides of the present invention are DNA sequences that model the US end of HIV-1 DNA, act as a substrate for integrase and are selected from the group consisting of:
5'- GTN TI;G AAA ATC TCT AGC AGT -3' (Se.quence LD. No: 2), 5'- GTG T1~TG AAA ATC TCT AGC AGT -3' (Sequence LD. No: 3), 5'- GTG TGN A,AAv ATC TCT AGC AGT -3' (Sequence LD. No: 4), 5'- GTG T(JG AAA. ATC TCT ANC AGT -3' (Sequence LD. No: 5), 5'- GTG TGG AAA. ATC TCT AGC ANT -3' (Sequence LD. No: 6), 5'- GTG T1~1G AAA. ATC TCT ANC AGT -3' (Sequence LD. No: 7), 5'- ACT GI~T AGA, NAT TTT CCA CAC -3' (Sequence LD. No: 8), 5'- ACT GI~T ANA, GAT TTT CCA CAC -3' (Sequence LD. No: 9), 5'- ACT NIT AGA, GAT TTT CCA CAC -3' (Se:quence LD. No: 10), and S'- ACT G(~T NGA, GAT TTT CCA CAC -3' (Sequence LD. No: 11);
where A is an adenosine nucleotide, C is a cytosine nucleotide, G is a guanosine nucleotide, T is a thymidine nucleotide, and N is a pteridine nucleotide of formula XVI, formula XV'll, or formula XV)QI in which RZZ is H or OH and more preferably R2z is H.
Of course, ~:he pteridine nucleotides and pteridine oligonucleotides may be utilized to investigate the interaction of DNA with other molecules in a number of m9a~8g 32 contexts. For example, the pteridine nucleotides of formulas XIX, XX, XXI, and XXII
may achieve an energy transfer with most of the other claimed compounds. These compounds may be used to monitor the insertion of foreign DNA into a host genome where a DNA strand containing the nucleotide would be brought into proximity to another DNA strand containing one of the other claimed compounds. This would create an energy transfer with the resulting emission of a new discreet signal.
One of skill would recognize that the pteridine derivatives of this invention may also be used simply as fluorescent labels to label almost any biological molecule.
The unprotected pteridines alone may be linked by the pteridine 1N or 8N, either directly or through a linker or spacer to a composition it is desired to label.
Alternatively, the pteridine nucleosides may be used as fluorescent labels. They may be linked preferably through the 5'-hydroxyl, the 3'-phosphate, or the 2'-hydroxyl (in the case of a ribofuranose) directly, or through a linker, to the composition it is desired to label. Such labeled compositions may include, but are not limited to, biological molecules such as antibodies, ligands, cell surface receptors, and enzymes.
Methods of detecting fluorescently labeled oligonucleotides in vitro or in vivo are well known to those of skill in the art. These means include, but are not limited to, direct visualization, fluorescence microscopy, fluorometers, photographic detection, detection using image intensifiers, photomultipliers, video cameras, and the like. Of course, the selection of a particular method depends on the particular experiment. For example, where the oligonucleotides are used as an assay for enzyme activity or for energy transfer between a pair of molecules, the reactions may be carried out in solution in a fluorometer. Where the oligonucleotides are used as probes for in situ hybridization, detection may be with an image acquisition system (e.g., using a CCD
video camera on a fluorescence microscope coupled to an image processing system).
The nucleotide triphosphate compounds of the present invention may be utilized as monomers for DNA synthesis in DNA amplification techniques such as polymerase chain reaction (Innis, et al., PCR Protocols. A Guide to Methods and Application. Academic Press, Inc. San Diego, (1990)), ligase chain reaction (LCR) (see Wu et al., Genomics, 4: 560 (1989), Landegren, et al., Science, 241: 1077 (1988) and Barringer, et al. , Gene, 89: 117 ( 1990)), transcription amplification (see Kwoh, et al. , Proc. Natl. Acad. Sci. (U.S.A.), 86: 1173 (1989)) and self sustained sequence replication (see Guatelli, et al., Proc. Natl. Acad. Sci. (U.S.A.), 87: 1874 (1990).
Amplification ~Y WO 95/31469 utilizing the pteridine nu~~leotides of this invention provides a rapid assay for a particular DNA sequence. Where the presf:nce or absence of a particular DNA sequence is diagnostic of a pathological condition (e.g., AIDS), amplification using the pteridine nucleotide triphosphates :provides an extremely sensitive and rapid diagnostic tool.
For examyle, if PCR amplification is used, a pair of PCR primers will be chosen that are complementary to the DNA sequences flanking the DNA sequence of interest. If the proper target sequences are present in the sample, the DNA
sequence between the primers will be amplified. This amplified DNA sequence will contain the pteridine nucleotide triphosphates. The amplified sequence may be separated from the remaining monomers in the mixture by simple size fractionation (e.g., by using an NAP
column, Pharmacia-LKB., Piscataway, New Jersey, U.S.A.) or other techniques well known to those of skill in the art. The presence or absence of the amplified sequence may then be immediately detected by measuring the fluorescence of the remaining mixture.
Alternatively, fluorescence polarization (FP) measurements can be used to detect a positive or negative PCR reaction without the necessity of separating the PCR
products from the primers a.nd nucleotide monomers. The technique uses pteridine nucleotide monomers or ;alternatively relatively short primers, about 25 base pairs each, that incorporate pteridine nucleotide monomers. After the PCR procedure is completed, the resulting mixture is analyzed using FP, by passing a beam of polarized light at an excitatory wavelength through the: mixture. If the target sequence is not present in the starting mixture, the fluorescent primers will remain in solution as relatively small single-stranded fragments, or the fluorescent nucleotide monomers will remain in solution as relatively small molecules. Both the monomers or the short primer fragments will emit a relatively scattered. and non-polarized fluorescent light. By contrast, if the target sequence is present, the F~teridine monomers or the fluorescent primers will be incorporated into larger double-stJranded segments which will move more slowly in response to the excitatory signal and the fluorescent light emitted by the mixture will be more polarized. See EP No.: 38:'.433 which describes this technique in greater detail.
Thus the invention provides for pteridine nucleotide triphosphates of formula I. Particularly preferred are the triphosphate compounds of formulas III
through XI. Thus a first preferred triphosphate is formula III in which R'Z is NHZ and R2° is formula II in which RZ' is ai triphosphate, RZZ is H, and R~ is H.

WO 95131469 pCT/US9SI0526.1 A second preferred triphosphate is formula IV in which R'z is NHZ and RZ° is formula II in which R2' is a triphosphate, R~ is H, and R'~
is H.
A third preferred triphosphate is formula V in which Rz° is formula II in which RZ' is a triphosphate, Ru is H, and R~ is H.
i A fourth preferred triphosphate is formula VI in which R'b is NHz and RZ°
is formula II in which Rz' is a triphosphate, R~ is H, and R'~ is H.
A fifth preferred triphosphate is formula VII in which R'6 is NH2 and Rz°
is formula II in which R2' is a triphosphate, R22 is H, and R~ is H.
A sixth preferred triphosphate is formula VIII in which R'Z is NHz and R"
10~ is formula II in which RZ' is a triphosphate, R~ is H, and R'~ is H.
A seventh preferred triphosphate is formula IX in which R'z is NH2 and R" is formula II in which RZ' is a triphosphate, R22 is H, and R'~ is H.
A eighth preferred triphosphate is formula X in which R'z is NHz and R"
is formula II in which RZ' is a triphosphate, RZZ is H, and R~ is H.
15 An ninth preferred triphosphate is formula XI in which R'2 is NH2 and R"
is formula II in which RZ' is a triphosphate, R~ is H, and R'~ is H.
An additional aspect of the invention relates to kits useful in implementing the above-described assay. These kits take a variety of forms and can comprise one or more containers containing the sequence specific amplification primers and one or more 20 pteridine nucleotide triphosphates. Other optional components of the kit include, for example, a polymerise, means used to separate the monomers from the amplified mixture, and the appropriate buffers for PCR or other amplification reactions.
In addition to the above components, the kit can also contain instructions for carrying out the described method.
25 The claimed pteridine nucleotides can be synthesized by standard methods well known to one of skill in the art. In general, the protected pteridine derivative is reacted with a chlorofuranose having its 3'- and 5'-hydroxyls protected as their 4-chlorobenzoyl or paratoluenesulfonyl esters to produce a pteridine:
nucleoside. See, for example Kiriasis et al. , page 49-53 in Chemistry and Biology of Pteridines, Kisliuk and 30 Brown, eds. Elsevier North Holland, Inc. N.Y. (1979), Schmid et u1., Chem.
Ber. 106:
1952-1975 (1973), Pfleiderer U.S. Patent No. 3,798,210, Pfleiderer, U.S.
Patent No.
3,792.,036, Hams et al., Liebigs Ann. Chem., 1457-1468 (1981), which illustrate the synthesis of various pteridine nucleosides. see also Examples 1 through 4 which describe the synthesis of pteridine nucleosides.
Following coupling, the protecting groups can be removed and the 5'-hvdroxvl converted to its dimethoxvtrityl ether. Subsequent conversion of the 3'-hydroxyl to the H-phosphonate, phosphoramidite, or hemisuccinate provides the desired compounds.
5 Where an exocyclic amine or protected amine is desired in the product, it can be introduced at any of several stages. For example, the starting pteridine may contain an amine substituent which is protected prior to further manipulation (e. g. see compounds of formula )~. Alternatively, an amine may be introduced at a later stage by conversion of an oxo moiety to a thione followed by amination with ammonia (e.g.
10 see Example 8 describing the synthesis of a phosphoramidite of formula V>~.
Yet another method for introducing an amine uses a starting ptcridine bearing a methylthio substituem in the 2 position (e. g. see Example 7 describing the synthesis of a phosphoramidite of formula V). After coupling with the desired chlorofuranose the protecting groups are removed and the methylthio group is displaced with ammonia.
15 The 5'-hydroxyl of the nucleoside is blocked with a protecting group (preferably dimethoxytrityl). Means of coupling protecting groups are well latown to those of skill in the art. In particular, the coupling of a dimethoxytrityl group is illustrated in Examples 6 through 9. Briefly, this is accomplished by reaction of the nucleoside with dimethoxytrityl chloride in dry pyridine. Other protocols are generally 20 known to those of skill in the art. See, for example, Atkinson et al. , chapter 3, in Gait, ed., Oligonueleotide Synthesis: A Practical Approach (IRL Press, Washington, D.C., 1984), The 3'-hydroxyl of the pteridine nucleoside can be converted to its respective hemisuccinate (for coupling to CPG as describe earlier), phosphoramidite, H-25 phosphonate, or triphosphate using methods well known to those of skill in the art. For example, conversion of the nucleoside 3'-hydroxyl to a hemisuccinate may be accomplished by reaction with succinic anhydride. Atkinson et al. , chapter 3, in Gait, ed., Oligonucleotide Synthesis: A Practical Approach (IRL Press, Washington, D.C., 1984) describe the functionalization of control pore glass and the synthesis and coupling 30 of nucleoside-3'-O succinates.
Means of converting a nucleoside to a phosphoramidite are also well known to those of skill in the art. See, for example, Atkinson et al. , chapter 3, in Gait, ed., Dligonucleotide Synthesis: A Practical Approach (IRL Press, Washington, D.C., WO 95/31469 PCT/L'S9510526.i 1984;), who utilize the method of McBride and Caruthers, Tetrahedron Lett., 24: 245 (1983). Another approach is illustrated in Examples 7 and 8 in which the nucleoside is reacted with B-cyanoethoxy-bis-diisopropylphosphane in tetrazole. Subsequent isolation of the phosphoramidite is described in those examples.
Similarly, means of converting a nucleoside to an H-phosphonate are also well known to those of skill in the art. In one approach, phosphorous (III) trichloride derivatives are used to directly phosphitylate the 3'-hydroxyl of the nucleoside. More specifically, phosphorous (III) triimidazolide may be used to phosphitylate the 3'-hydraxyl. This method is described in detail by Garegg et al. Chemica Scripts, 25: 280-282 (1985) and by Tocik et al. Nucleic Acids Res., 18: 193 (1987)"
Similarly, the use of tris-(1,1,1,3,3,3-hexafluoro-2-propyl) phosphite to produce ribonucleoside-H-phosphonates is described by Sakatsume et al. Nrccleic Acids Res., 17: 3689-3697 (1989), which is incorporated herein by reference.
The use of the same reagent to produce deoxynucleoside-H-phosphonates is described by Sakatsume et al. Nucleic Acids Res., 18: 3327-3331 (1990).
Other approaches to the derivatization of the 3'-hydroxyl to produce H-phosphonates may be found in Sekine et al. J. Org. Chem., 47: 571-573 (1982);
Marugg et al. Tetrahedron Lett. , 23: 2661-2664 (1986), and Pon et al. Tetrahedron Lett. , 26:
2525-2528 (1985).
Derivatization of the 3'-hydroxyl as a triphosphate may be accomplished by a number of means known to those of skill in the art. Where the pteridine nucleoside has sufficient structural similarity to native nucleotides to act as an enzymatic substrate, the monophosphate may be synthesized chemically as described below and then enzymatically converted to the diphosphate and then to the triphosphate using the appropriate nucleotide monophosphate and diphosphate kinases respectively.
Alternatively, the nucleoside may be chemically derivatized as the triphosphate. This may be accomplished by reacting the nucleoside with trimethyl phosphate and POC13 and then adding a triethylammonium bicarbonate buffer to form the nucleotide monophosphate which may then be purified chromatographically. The nucleotide monophosphate is then activated using carbonyldiimidazole and coupled with tributylammonium pyrophosphate to form the nucleotide triphosphate. The nucleotide triphosphate may then be precipitated as a sodium salt which is more stable than the _.. ~,O 95/31469 trierthyklammonium salt and can be stored without decomposition. Details of the derivatization of a nucleoside to the nucleotide triphosphate are provided in Example 10.
The syntheses of the pteridine derivatives of the present invention are described in detail in the; examples. In particular, the syntheses of pteridine nucleosides of formulas III, VI, IX, X and :K/ are illustrated in Examples 1 through 5 respectively.
The syntheses of the pte:ridine nucleotide phosphoramidites of formulas IV, V, VILLI and VII are illustrated in Examples Ei, through 9. The conversion of pteridine nucleosides to pteridine nucleotide triphosphates is illustrated in Example 10. The synthesis, cleavage and deprotection of deox:yoligonucleotides incorporating one of the claimed pteridine nucleotides is illustrated in Example 11. Finally, the use of the claimed oligonucleotides in an assay for integrase activity is illustrated in Example 12. The examples are provided to illustrate, bux not to limit the claimed invention.

Synthesis a Nucleoside of Formula III: 4-Amino-2-phenyl-8-(2-deox~(3-D-ribofuranosvl)pteridine-7-one h~.
a) Silver Salt of isonitrosomalononitrile (1) Synthesis of the silver salt of isonitrosomalononitrile used in step (b) was described by Longo, Ga;~z. Chim. Ital., 61: 575 (1931). To 120 mL of a solution of acetic acid and H20 -(1/1) was added 20 g (0.3 mole) of malononitrile (Fluky AG, Switzerland). The mixture was heated and stirred until the malononitrile dissolved. The mixture was then cooled to 0°C .and a solution of 23 g (0.33 mole) sodium nitrite in 100 mL of H20 was slowly added while stirring. The solution was then stirred at room temperature for 12 hours. in the clack. To this orange colored solution was added a solution of 52 g (0.3 mole) of silver nitrate dissolved in 100 mL of HZO. The resulting precipitate was collected,, filtered under low vacuum, washed with ether and then dried in a desiccator over P40,o i:n vacuum to yield 1 as 59.7 g (99% yield, m.p. >
350°C).
b) 2 phenyl-4,6 diamino-5~-nitrosopyrimidine (2) The synthEais of 2-phenyl-4,6-diamino-5-nitrosopyrimidine was described by Taylor et al., J. Am. Chem. ,~,~oc., 81: 2442-2448 (1959). Small portions, 0.11 mole, of finely divided silver salt of isonitrosomalononitrile (1) was added to a stirred solution of 0.1 mole of benzamidine hydrohalide in 100 mL of methanol. Stirring was continued for one hour after addition was complete. By this time, the yellow silver salt had WO 95/31469 219 0 5 8 g PCTIUS95/05264 w. f '°.
disappeared and a heavy precipitate of white silver Halide had separated. The reaction mixture was filtered, and the yellow filtrate was evaporated at room temperature under reduced pressure to dryness. The yield of crude product was almost quantitative.
Recrystallization from ethyl acetate yielded a pure benzamidine salt of isonitrosomalononitrile in the form of light yellow crystals (m.p.
151°C -152°C).
Analysis for C,oH5N50 calculated: C, 55.8; H, 4.2; N, 32.5. Found: C, 55.7; H, 4.0;
N, 32.6.
A mixture of 2 grams of the benzamidine salt of isonitrosomalononitrile in mL of a-picoline was heated was heated to 125 ° to 130 ° C for 0.5 hours. The salt 10 dissolved rapidly and the color of the mixture gradually turned green. The reaction mixture was then cooled and diluted with H20. Filtration after standing yielded 2 as bluish green crystals of 2-phenyl-5,6-diamino-5-nitrosopyrimidine (m.p. 243-244°C).
Analysis for C,oH9N50 calculated: C, 55.8; H, 4.2; N, 32.5. Found: C, 55.9; H, 3.9;
N, 32.6.
c) 4-amino-2 phenyl pteridine-7 one (3) Synthesis of 4-amino-2-phenyl-pteridine-7-one was described by Hams et al., Liebigs. Ann. Chem. 1457-1468 (1981). To 200 mL of methanol was added 2.15 g (10 mmol) of 2-phenyl-4,6-diamino-5-nitrosopyrimidine (2). The mixture was hydrated in an agitator at room temperature using hydrogen via 5 % Pd/C-catalyst until the reaction ceased (approximately 2 hours). The colorless solution was filtered, combined with a solution of 1 g Na in 20 mL of HZO, heated to a boil, and then treated with activated charcoal and filtered while hot. The filtrate was brought to pH 5 with glacial acetic acid and left to stand and cool. The precipitate was recrystallized from dimethylformamide to obtain 3 as 1.0 g of brownish crystals (42% yield, m.p.
330°-332°C).
d) 4 Amino-2 phe~ryl-8-~2-deoxy-3,S-di-O-(4-chlorobenzoyl)-(3-D-ribofuranosylJ-pteridine-7 one (4J
A mixture of 1.0 g (4.2 mmol) of 4-amino-2-phenyl-pteridine-7-one (3) and a few crystals of ammonium sulfate was heated in 100 mL of hexamethyldisilazane (HMDS) under reflux for 4 hours. After cooling the excess HMDS was distilled off in vacuum and the residue dissolved in 100 mL of dry toluene. To the mixture was added 2.17 g (4.6 mmol) of 2-deoxy-3,5-di-O-(4-chlorobenzoyl)-a-D-ribofuranosyl chloride (made as in Example 3, step (a) for the toluyl derivative) and 0.476 g (2.3 mmol) of 2i9a5~s 39 silver perchlorate. The solution was then stirred under anhydrous conditions for 24 hours at room temperature and then diluted with 200 mL of CHZCIz. The resulting AgCI
precipitate was filtered off throul;h silica and then the filtrate was treated with 100 mL of a saturated aqueous solul:ion of sodium bicarbonate followed by 100 mL of a saturated aqueous solution of NaCI. The organic layer was dried over Na2S04, filtered and then the filtrate evaporated.
The residue was diissolved in a little ethyl acetate, put onto a silica-gel column and then eluted with n-hexane / ethyl acetate 5:1. The main fraction was collected, evaporated and the residue recrystallized twice from CHC13 /
methanol to give 4 as 1.43 g (54% yield) of colorless crystals (m.p. 175-178°C).
Analysis calculated for C~3,H~C1z.H5O6 (632.5): C, 58.87; H, 3.67; N, 11.07.
Found: C, 58.62; H, 3.74; N, 11.10.
eJ 4 Amino-2 phenyl-8-(2-deoxy-~B-D-ribofuranosyl)pteridine-7 one (S~
To a solutiion of 1() mg of sodium in 50 mL of anhydrous methanol was added 0.632 g (1 rnmol) of 4-amiino-2-phenyl-8-[2-deoxy-3,5-di-O-(4-chlorophenyl)-(iD-ribofuranosyl]pteridine-7-one (4). The solution was stirred at room temperature for 1 hour. The solution was then neutralized by the addition of AcOH and then evaporated.
The residue was recrystallized from methanol / H20 to give 5 as 0.323 g (91 %
yield) of colorless crystals (m.p. 169-172°C).
Analysis calculated for CI~HI~N504 (355.4): C, 57.46; H, 4.81; N, 19.71.
Found: C, 57.04; H, 4.88; N, 20.01.

Synthesis of a Nucleosid.,e of Formula VI: 2'-Deox~B-D-ribofuranospl-isoxanthopterin (1~.
The synthesis of 2.,4,5-triamino-6-benzyloxy-pyrimidine (9), steps (a) through (d), is described by Pfleiderer et al., ahem. Ber., 94: 12-18 (1961).
a) 6-chloro-2,4-di~amino prrimidine (6J
To 500 m/, of freshly distilled POC13 at a temperature of 80-90°C
is added 100 g of 2,4-diamino-6-oxo-dihydLropyrimidine (Aldrich, Milwaukee, Wisconsin, USA).
The mixture is distilled under reflux until, after approximately 2 hours, the mixture has completely dissolved. Th,e residu,~l POC13 is suctioned off using vacuum and the remaining syrup is dripped slowly onto ice. The highly acidic solution is carefully WO 95/31469 219 0 5 8 8 , pCT/US95/05264 neutralized by cooling it using concentrated sodium aluminate solution, and in the final stage with solid sodium carbonate. When completed the total volume of solution is approximately 1800 mL. Upon cooling a yellowish precipitate is separated out which is suctioned off and dried in a vacuum desiccator. The end product which contains mostly 5 non-organic salts is boiled three times, each time with 1 liter of acetone to which active charcoal is added. The extracts are cooled and the resulting clear precipitate is collected.
Evaporation of the filtrates yields an additional fraction.
b) 2,4-diamino-6-benzyloxy pyrimidine (7) A solution of 3.8 g sodium in 100 mL benzylalcohol is heated in an oil 10 bath with 21.6 g 6-chloro-2,4-diamino-pyrimidine (6) for 3 hours at 160°C. The surplus alcohol is distilled off in vacuum.
a) The oily residue is thoroughly washed in warm water thereby giving rise to a rubbery substance. The warm solution is dissolved in warm 30 % acetic acid, faded with activated charcoal and brought to pH 6 using diluted ammonia. When slowly cooled an 15 oily mass initially separates out, followed by a crystalline substance. The crystals are separated from the congealed oil by means of excitation, decanting and filtration. The oily residue is then heated and cooled several times to become crystalline.
The pooled fractions, once they are dried in a vacuum desiccator, are dissolved in a small quantity of chloroform, then treated with activated charcoal and aluminum oxide (base, cationotropic 20 A1203) and separated out again by intense freezing a temperature of -20°C or lower.
Several repetitions of this process yield chromatographically pure 7.
b) In an alternative purification process the alcohol-free reaction residue is dissolved in benzole, treated with activated charcoal and the filtrate is thoroughly evaporated. The product which separates out when cooled is recrystallized several times 25 from benzole to yield 7.
c) S-nitroso-2, 4-diamino-6-benzyloxy primidine (8) To a solution of 16 g 2,4-diamino-6-benzyloxy-pyrimidine (7) in 250 mL
of warm 30 % acetic acid is added a solution of 7g sodium nitrite in 25 mL
HzO. The sodium nitrite solution is held at 70-80°C and is added dropwise while being stirred 30 continuously. The sodium nitrite solution is added until potassium-iodate starch paper shows a positive reaction. The violet-red precipitate is cooled, suctioned off and then recrystallized from ethanol or acetone to yield 8.

WO 95/31469 , PCT/US95/05264 d) 2,4,5-triamino-~6-benzyloxy pyrimidine (9) Sodium di~;hionite is added in portions to a suspension of 17 g 5-nitroso-2,4-diamino-6-benzyloxy-primidine (8) in 300 mL H20 at 50°C until the red nitroso compound is fully reduced. The free base is separated out by adding aqueous ammonia.
The crude product is cooled, suctioned off and crystallized from water, to which activated charcoal and a trace of sodium dithionite is added yielding 9.
e) 2,4-diamino-6-~5enryloxy-S-ethoxycarbonylmethyleneimino pyrimidine (10) The synthesis of 2,4-diamino-6-benzyloxy-5-ethoxycarbonylmethyleneimino-pyrimidine is described by Pfleiderer & Reisser, Chem.
Ber., 95: 1621-1628 (19fi1). A suspension of 2.3 g of 2,4,5-triamino-6-benzyloxy-pyrimidine (9) in 250 m/, of HZO is agitated in 3 g ethylglyoxylate-hemiethylacetal for three hours at room temperature. The resulting bright yellow precipitate is filtered off under light vacuum, washed, and dried at a temperature of 100°C. The precipitate is recrystallized from ethanol to give 10.
,~ 2-amino-4-berczyvloxypterzdine-7 one (11) The synthesis of 2-amino-4-benzyloxypteridine-7-one is described by Pfleiderer & Reisser, Che~m. Ber., 95: 1621-1628 (1961). To a solution of 1 g 2,4-diamino-6-benzyloxy-5-ethoxycarbonylmethyleneimino-pyrimidine (10) in 190 mL
of ethanol is added 30 mL 1 N NaHC03. The solution is distilled under reflux for 1 hour and then the solution is heat sepa~~ated from the little remaining undissolved material.
The pteridine that precipitates out due to acidification of the filtrate with 20 mL of glacial acetic acid is suctioned off' after cooling and recrystallized from benzylalcohol to give 11.
g) 4-benryloxy-2-(N,N dimethylaminomethylenimino) pteridine-7 one (12) To 100 m/, of anhydrous DMF is added 2.88 g (10.7 mmoles) of 2-amino-4-benzyloxypteridine-7-one (11) and 1.92 mL (11.2 mmoles) of N,N-dimethylforamide-diethylacetal. The mixture is stiwed at room temperature for 4 hours by which time it becomes a clear solution. The DIVIF is distilled off in high vacuum below 50°C. To the residue is then added a solution of 1 mL of methanol and 50 mL of diethylether. After 10 minutes, the precipitate is collfxted. The filtrate is again evaporated to dryness and the resulting residue is stirred in 1l0 mL of diethylether to yield a second precipitate.
The precipitates are poolW and dried under high vacuum to give 12.

fF.
h) 4-benzyloxy-2-(N,N dimethylaminomethyleneimino)-8-(2-deoxy-3,5-di p-toluoyl-/3-D-ribofuranosyl) pteridine-7 one (13) To 3.24 g (10 mmoles) of 4-benzyloxy-2-(N,N-dimethylaminomethyleneimino)-pteridine-7-one (12) is added 100 mL of anhydrous acetonitrile. Then 1.87 mL (12.5 mmoles) of DBU are added and the solution is stirred until it becomes clear after about 10 min. To this solution is gradually added 4.5 g (11 mmoles of 1-chloro-2-deoxy-3,5-di-O-p-toluoyl-a-D-ribofuranose. The stirring is then continued for 30 min. The resulting precipitate is collected to give after drying an a,~-anomeric mixture. The filtrate is evaporated to dryness, the residue dissolved in 100 mL
of CHZCIZ and twice washed with HZO to remove the DBU. The organic layer is dried over Na2S04 and then evaporated. The resulting residue is purified by silica-gel column chromatography in toluene/ethyl acetate 1/3. The main fraction is collected and gives on evaporation an a,~-anomeric mixture. Both crops are pooled and recrystallized from ethyl acetate/methanol 20/ 1 to give 13.
i) 8-(2-Deoxy-3,5-di-O p-toluoyl-~-D-ribofuranosyl)-isoxanthopterin (14) In 100 mL of methanol are dissolved 3.38 g (5 mmoles) of 4-benzyloxy-2-(N, N-dimethylaminomethyleneimino)-8-(2-deoxy-3 , 5-di-p-toluoyl-(i-D-ribofuranosyl)-pteridine-7-one (13). Then 0.2 g of palladium-charcoal (5 % ) is added and the mixture is shaken under hydrogen atmosphere for 1 day. The catalyst is filtered off and the filtrate evaporated to dryness. The residue is recrystallized from methanol to give 14.
j) 8-(2-Deoxy-~ D-ribofuranosyl)-isoxanthopterin (15) To 30 mL of a saturated solution of ammonia in methanol is added 1.0 g (2 mmoles) of 8-(2-deoxy-3,5-di-O-p-toluoyl-/3-D-ribofuranosyl)-isoxanthopterin (14).
The mixture is stirred at room temperature overnight. The solution is then evaporated to dryness and the residue recrystallized from a little HZO by addition of drops of acetic acid. Cooling produces 15.

synthesis of a Nucleoside of Formula IX~ 4-Amino-1-l2-deoxv-Q-D-ribofuranosvll-methjrl-pteridine-2-one (23).
a) 2-deoxy-3,5-di-O p-toluoyl-a-D-ribojuranosyl-chloride (16) The synthesis of 2-deoxy-3,5-di-O-p-toluoyl-a-D-ribofuranosyl chloride, used in step (e) is described by Hoffer, Chem. Ber., 93: 2777-2781 (1960). To 243 mL

of methanol is added 13. ~6 g (0.1 mol) of 2-deoxy-D-ribose (Aldrich, Milwaukee, Wisconsin, USA) and 27 mL of 1. % methanolized HCI. The mixture is allowed to stand sealed for 12-15 minutes to form methylglycoside. Afterwards, 3-5 g silver carbonate is mixed in to immediately bind all hydrogen chloride. The clear filtered solution is boiled down in vacuum to a synsp-like consistency and the remaining methanol is separated off by repeated boiling in vacuum while adding small amounts of dry pyridine.
Finally the mixture is dissolved in 80 mL pyridine and acylated with 34 g (0.22 mole) p-toluylchloride while cooling. The: mixture is then heated for two hours at 40-50°C or is allowed to stand overnight at roorn temperature. Water is added, after which the mixture is partitioned with 200 m:L ether. The ether solution is then washed free of pyridine using H20 followed by dilute sulphuric acid followed by potassium hydrogen carbonate solution. The mixture is then boiled down in vacuum to form a honey-yellow syrup.
From this syrup, it is possible to obtain crystallized 3,5-di-p-toluyl-methyl-2-deoxy-D-ribofuranoside by seeding.
To isolate the chloride, the syrup is dissolved in 20-50 mL glacial acetic acid and the solution is placed in .a beaker together with 80 mL of acetic acid that has been saturated with hydrogen chloride. The solution is held at 10°C and hydrogen chloride is introduced until the mixture hardens after about 10 minutes to a thick crystalline paste. After not more than 30 minutes, the crystalline substance is washed on a filter under low vacuum with absolute ether. This washing step is preferably repeated a second time. The substance is then dried in a vacuum desiccator with soda lime and phosphorous pentaoxide and remaiins stable in this condition for weeks. When desired, 2-deoxy-3,5-di-O-p-toluo~rl-a-D-ribofuranosyl-chloride (16) is recrystallized from toluene or carbon tetrachloride.
b) 2-hydroxy-4,6 diaminopyrimidine sulfate (17) The synthesis of 4,ti-diamino-2-hydroxy-pyrimidine sulfate is described by Bendich et al. J. Amer. C'hem. So~c., 70: 3109-3113 (1948). To 5.40 g of 4,6-diamino-2-thiolpyrimidine (Aldrich (:hemical Co., Milwaukee, Wisconsin, USA) and S.Sg of chloroacetic acid is added 75 mL of boiling H20. The solution is refluxed for 1.25 hours. Without cooling, X1.5 ml o:F 18 N sulfuric acid is added and the refluxing is continued for an additional hour. Norite is added and upon cooling the filtrate yields 17.

WO 95/31469 219 0 5 8 8 PCTlUS95105264 c) 4, 6-diamino-S formylamino-2-hydroxy pyrimidine (18) The synthesis of 4,6-diamino-5-formylamino-2-hydroxy-pyrimidine is described by Pfleiderer, Chem. Ber. 90: 2272-2276 (1957). To 54 mL of formamide is added 9 g of 4,6-diamino-2-hydroxy-pyrimidine sulfate (1'n and 4.5 g of sodium nitrite.
S This solution is heated to 60 °C and 10 mL of formic acid is added drop-wise. This forms a red suspension which is further heated to 110°C. Small quantities of sodium dithionite are added until a yellow coloring is obtained. During this time the temperature must not exceed 130 °C. The mixture is allowed to cool and the precipitate is filtered off under light vacuum. Finally, 18 is recrystallized from a large amount of H20 with animal charcoal.
d) 4,5,6-triamino pyrimidine-2-one hydrochloride (19) The synthesis of 4,5,6-triamino-pyrimidine-2-one hydrochloride is described by Pfleiderer, Chem. Ber. 90: 2272-2276 (1957). To 3 g of 4,6-diamino-5-formylamino-2-hydroxy-pyrimidine (18) is added 50 mL of 10 % to 15 %
methanolic HCI.
The solution is refluxed for 7 hours and then allowed to cool. Once cooled, the mixture is filtered under light vacuum, then washed in alcohol and dried in a drying chamber.
The hydrochloride is then dissolved in H20 at room temperature and neutralized to pH 7 by the addition of 1 N ammonia. The resulting precipitate is collected, washed with ethanol, and dried in a drying chamber to yield 19.
e) 4-amino-7 methyl pteridine-2-one (20) In 50 mL of HZO is dissolved 1.77 g (0.01 mole) of 4,5,6-triamino-pyrimidine-2-one hydrochloride (19). The pH of the solution is adjusted to 5 and then, 4 mL of 40% aqueous methylglyoxal (FLUKA AG, Switzerland) is added and the solution is heated under reflux for 30 minutes. The resulting precipitate is collected and purified by recrystallization from a large amount of H20 to give Z0.
,~ 4-benzoylamino-7 methyl pteridine-2-one (21) In 20 mL of pyridine is dissolved 1.63 g (0.01 mole) of 4-amino-7-methyl-pteridine-2-one (20). Then 3.12 g (0.02 mole) of benzoyl chloride is added dropwise while stirring the mixture. The mixture is heated to 80°C for 30 minutes and then poured on ice. The resulting precipitate is collected, washed with ethanol and ether and then recrystallized from DMF to give 21.

WO 95/31469 2 I 9 0 5 ~~ ~ PCT/US95105264 g) 4-benzoylamin:o-1 (2-deoxy-3,5-di-O p-toluoyl-/3-D-ribofuranosyl)-7 methyl-pteridine-2-one (22) To 60 mL of anhydrous acetonitrile is added 2.83 g (0.01 mole) of 4-benzoylamino-7-methyl-pteridine-~2-one (21). Then 1.5 mL (11 mmole) of 1,8-5 diazabicyclo[5.4.0]-undea;-7-ene (DBU) is added and the mixture is stirred for 15 min at room temperature. After stirring, 4.26 g (11 mmole) of 2-deoxy-3,5-di-O-p-toluoyl-a-D-ribofuranosyl chloride is added to the solution and stirred for 1 hour at room temperature. The solution is then evaporated to dryness, the residue dissolved in CHC13, washed with sodium bicarbonate solution and the organic phase is dried over Na2S0,.
10 After concentration to a small volume the material is purified by silica-gel column chromatography in ethyl acetate l acetone 4/ 1. The main fraction is evaporated and the residue recrystallized from ethanol to give 22.
h) 4-amino-1 (2-d~~oxy-~-D-ribofuranosyl)-7 methyl pteridine-2-one (23) To 50 mL of saturated methanolic ammonia is added 1.65 g (0.005 mole) 15 of 4-benzoylamino-1-(2-deoxy-3,5-di-O-p-toluoyl-J3-D-ribofuranosyl)-7-methyl-pteridine-2-one (22). The mixture: is stirred overnight at room temperature. The mixture is then evaporated to dryness and the residue recrystallized from ethanol/H20 20:1 to give 23.

20 synthesis of a Nucleoside of Fo~nula X : 4-Amino-l-(2-deox,~B-D-ribofuranospD-6-methyl-gteridine-2-one ~2$~.
a) methylglyoxal monoaldoxime (l4) Methylglyoxalmonoaldoxime may be synthesized according to the protocol of G. Charrier Gazz. Chim. Italy 37: 145 (1907). To 30 mL of an acetic acid/HZO
25 solution (1/1) is added 5.8 g (O. 1. mole) of acetone. The solution is then cooled to 0°C.
A solution of 7.6 g (0.l mole) of sodium nitrite in 20 mL of H20 is added dropwise with stirring. The solution is then stirred for another 3 hours at room temperature and then evaporated carefull;r in vacuum. The residue is extracted with benzene to give, on partial evaporation, 24 as colorless crystals. The crystals can be further purified by 30 sublimation in high vacuum.
b) 4 Amino-6-methyl pten~dine-2-one (25) To 50 mL, of H20 is added 1.77 g (0.01 mole) of 4,5,6-triamino-pyrimidine-2-one hydrochloride 1;19) (see Example 3). The pH is adjusted to 5 and 1.74 g (0.02 mole) of methylglyoxalmonoaldoxime (24) is added while stirring the mixture.
The resulting precipitate of the corresponding Schiff s base is collected, then dissolved in 25 mL of 80% sulfuric acid and heated to 100° for 30 min. After cooling the mixture is poured onto ice and then carefully neutralized by NaHC03 which results in the formation of a precipitate. The product is filtered and then recrystallized from a large volume of H20 to give 25.
c) 4-benzoylamino-6-methyl pteridine-2-one (26) The synthesis of 4-benzoylamino-6-methyl-pteridine-2-one is carried out as in Example 3, step (d), substituting 4-amino-6-methyl-pteridine-2-one (25) for 4-amino-7-methyl-pteridine-2-one (20).
d) 4-berrzoylamino-1-( 2-deoxy-3,5-di-O p-toluoyl-~B-D-ribofuranosyl)-6-methylpteridine-2-one (27) The synthesis of 4-benzoylamino-1-(-2-deoxy-3,5-di-O-p-toluoyl-~B-D-ribofuranosyl)-6-methylpteridine-2-one is carried out as in Example 3, step (e), substituting 4-benzoylamino-6-methyl-pteridine-2-one (26) for 4-benzoylamino-7-methyl-pteridine-2-one (21).
e) 4-amino-1-(2-deoxy-~-D-ribofuranosyl)-6-methyl pteridine-2-one (28) The synthesis of 4-Amino-1-(2-deoxy-(i-D-ribofuranosyl)-6-methyl-pteridine-2-one is carried out as in Example 3, step (f), substituting 4-benzoylamino-1-(-2-deoxy-3,5-di-O-p-toluoyl-~-D-ribofuranosyl)-6-methylpteridine-2-one (27) for benzoylamino-1-(-2-deoxy-3,5-di-O-p-toluoyl-~-D-ribofuranosyl)-7-methylpteridine-2-one (22).

Synthesis of a Nucleoside of Formula XI: 4-Amino-l-(2-deoxv-B-D-ribofuranosyl)-pteridine-2-one (32).
a) 4,5,6-triamino-2-hydroxypyrimidine sulfate (29J
Compound 17, 4,6-diamino-2-hydroxy-pyrimidine sulfate, is synthesized as described in Example 3 step (b). The conversion of 17 to 4,5,6-triamino-2-hydroxypyrimidine sulfate (29) is described by Bendich et al., J. Amer. Chem.
Soc., 70:
3109-3113 (1948). To a mixture of 110 mL of glacial acetic acid and 110 mL of Hz0 is added 15.3 g of very finely pulverized 17. The mixture is kept at about 5°C and 11.0 g of sodium nitrite in 25 mL of H20 is added with constant stirring. The carmine red-WO 95/31469 ' ~ ~ ~ PCT/US95/05264 colored precipitate is collected after two hours and washed with three small portions of chilled HZO. The moist F~recipitate is suspended in 4C10 mL of H20 and 45 g of sodium hydrosulfite is added and the mixture is boiled for three minutes during which time the substance is bleached. To this solution 53 mL of 18 N sulfuric acid is carefully added.
The fixture is boiled for a. few minutes and filtered after Norite treatment to yield, on chilling 29 which can be recrystalliized from 2 N sulfuric acid.
b) 4-amino-pteridine-2-one (30J.
The synthesis of 4-~unino-pteridine-2-one is described by Taylor et al. , J.
Amer. Chem. Soc., 71: 2.'i38-2541 (1949). To a solution of 2.0 g (0.0084 mole) of 4,5,6-triamino-2-hydroxyhyrimidine sulfate (29) in 50 mL of HZO adjusted to pH
5 with dilute NaOH is added 3.0 g (0.01:13 mole) of glyoxal bisulfate. The reaction mixture is heated to boiling, the pH adjusted to 9 and the boiling is continued for fifteen minutes.
After neutralization with dilute hydrochloric acid, cooling and filtering, the light tan solid is washed with H20 followed by acetone and dried in vacuo. The solid is dissolved in hot 0.5 N NaOH and then. treated with Norite. The hot filtrate is then acidified with acetic acid. A final recry;stallizadon from 0.5 N acetic acid gives 30.
c) 4-amino-1-(2-deoxy-3,5-~di-O p-toluoyl-~B-D-ribofuranosyl) pteridine-2-one (31) To 20 mL of hexamethyldisilazane (HMDS) is added 2.98 g (0.02 mole) of 4-amino-pteridine-2-one (30). 'The mixture is heated for 24 hours under reflux, with moisture excluded, to obtiun a clei~r solution. The excess HMDS is removed under high vacuum to give 1-trimethy~lsilylam:ino-2-trimethylsilyloxy-pteridine as a viscous oil. The residue is dissolved in 20(1 mL of benzene and then 9.37 g (0.022 mole) of 2-deoxy-3,5-di-O-p-toluoyl-a-D-ribofu:ranosyl chloride, 4 g HgO, and 4 g HgBr2 are added and the mixture is refluxed for 5 hours. After cooling, the precipitate is filtered off, the filtrate evaporated to dryness and the residue dissolved in 100 mL of CHC13. The solution is extracted twice with 100 rnL of 20% KI. The organic layer is then dried over NazS04, again evaporated and the residue dissolved in a little ethyl acetate for silica-gel column chromatography with ethyl acetate / acetone 7:3. The first fraction contains excess sugar, the second fraction the a-ar~omer and last eluting fraction the Q-deoxyriboside.
Evaporation and recrystallization o~f the residue from ethanol gives 31.
d) 4-amino-1-(2-deoxy-~-D~-ribofuranosyl) pteridine-2-one (32) To 0.51 g (1 mmole:) of 4-amino-1-(2-deoxy-3,5-di-O-toluoyl-~B-D-ribofuramosyl)-pteridine-2-one (31) is added 50 mL of 0.0005 N sodium methoxide. The yv . W : I:f'A rItJIW caiE:~_ a 1 _ ~:~5- _4-= 3f~ : 1 ~ 4:) : -- _ 4~ 1 >
;4;3 5u4~3-. . +4J fig ''JJJ44f~~ : rr E~.
... __ _. _. _ ~._ ._ 219~~$8 mixture is stirred at room temperature for 24 h. The mixture is then neutralized with AcOH, evaporated to dryness, and twice coevaporated with HzO. The residue is then recrystallized from 50 cn~L, of ethanol to give 32.
~X
.S~vnthesis of A Phosohorannidi ~of Nucleoside of Formalg IV~ 4-Amln~-6-nhenvl-f5-O~~ethoxwtritvl-2~~deo -8-D-ri~ofurynospl~teri~ne-7-one-3'-O-(B-cvanoethvD-N N-dlisooroovl ~hos~horamidrte (41) The synthesis of 4,6-diamino-5-nitroso-pyrimidine, steps (a) through (c), was descn'bed by Evans et al. J. Chern. Sec., 4106 (1956).
aj 4, 6 diaminopyrimidine-2-sulphinic acid (33) To a solution of SO g of 4,6-diamino-2-mcrcaptopyrimidine (Aldrich, Milwaukee, Wisconsin, USA) in 2N NaOH (220 mL) was added 750 mL of a 3 ~
hydrogen peroxide solution. The solution was maintained at a temperature less than 20°C. Stirring was continued far a further 30 minutes and the clear pale yellow solution was acidified with acetic: acid (cu. SO mL). The precipitate was washed with Hz0 and air dried, to give 33 as .58 g (95 R~ yield) of an off-white amorphous acid (m.p. 168-170°C dccomp.). Far analysis, a sample was dissolved in dilute aqueous ammonia and reprecipitated with acetic acid.
Analysis for C4H5N4,OzS calculated: C, 27.6; H, 3.5; N, 32.2. Found C, 27.8;
H, 3.8;
N, 32.2.
b) 4,6 diomino-pyrimidine hydrochloride (34) To 500 mI. of dry ethanol containing 2.5 N ethanolic hydrogen chloride (150 mL) was added 50 g of 4,6-diaminapyrimidine-2-sulphinic acid (33). The mixture was shaken for 30 minuaes. The mixture was then cooled to 0°C and, after 1 hour, the crystals were rernovcd, washed ~wi.th ether, and dried to give 23 g of pale yellow needles ' ' (m.p. 196-198°C). Concentration of the original filtrate to 250 mL, followed by addition of 750 mL of eaher, gave a further crop of 1S g of almost white needles (m.p.
188°C). Recrystallization from spirit gave 34 as white needles (m.p.
203-204°C).
Analysis for C~H6N,,HC:1 calculated: C, 32.8; H, 4.8; N, 3.82; Cl, 24.2. Found C, 33.3; H, 4.8; N, 38.1; Cl, 24.1.
The sulplW is acid (Sg) was then added portion-wise to hydrochloric acid (15 ml; d 1.18) at room temperature_ The reaction was vigorous and sulphur dioxide [ Replacement PaEe ]
AA~EP!DED SHEET

2~(905,~38 49 was freely evolved. Hydrochloriic acid was removed from the resulting slurry under reduced pressure. The residue was washed with acetone and then ether to give 4.05 g of 7 (m.p. 195°C). Recrys;tallization of a sample from spirit raised the melting point to 201-202 ° C.
c) 4,6-diamino-S-nitrosopyrimidine (35) To 250 m:L of 2 N HCl was added 8.0 g (55 mmoles) of 4,6-diamino-pyrimidine hydrochloridE: (34). 'the 4,6-diamino-pyrimidine hydrochloride was allowed to dissolve. The solution was then cooled to 0°C and a solution of 4.2 g (61 mmoles) of NaN02 dissolved in 15 rnL of H; O was added dropwise within 20 minutes while stirring.
Stirring was continued for another 30 minutes at 0° and then 2 hours at room temperature. The violet solution was neutralized by NaHC03, the precipitate collected, washed with H20 and ethanol and dried to give 35 as 6.3 g (82 % yield) of a blue-violet crystal powder (m.p. > 350°C).
d~ 4-amino-6 phenyl pteri~dine-7 one (36) The synth~ais of 4-amino-6-phenyl-pteridine-7-one was described by Hams et al., Liebigs. Ann. ChE~m. 1457-1468 (1981). To a solution of 0.5 g Na in 50 mL of absolute ethanol was added 1.38 g (10 nmol) of 4,6-diamino-5-nitroso-pyrimidine (35) and 2.0 g of phenyl acetiic acid e~thylester. The materials were allowed to dissolve and the solution was then hinted for 1 hour under reflux. The precipitate which settled out was cooled and collected. The precipitate was then heated in 100 mL H20, filtered off from the insoluble nitros~o compound, and then acidified to pH 2 using dilute hydrochloric acid. Once the gelatinous reaction product precipitated out it was heated until it reached a microcrystalline: state. The gelatinous reaction product was then drawn off and recrystallized from dimet;hylformamide yielding 36 as crystals (m.p. >
320°C).
Analysis for C~2H9N50 calculated: C, 60.24; H, 3.79; N, 29.28. Found C, 60.35;
H, 3.78; N, 29.53.
e) 4-N,N Dimethylaminoxnethyleneimino-6 phenyl pteridine-7 one (37) A mixture of 400 mL of dry DMF, 2.39 g (10 mmol) of 4-amino-6-phenyl-pteridine-7-one (36) and 2.5 mL of N,N-dimethlformamide-diethylacetal was stirred at 60°C for 5 hours. The solution was evaporated in vacuum to dryness and the residue recrystallized from isopre~panol to give 37 as 2.83 g (96% yield) of colorless crystals (m.p. 284-286°C;).

WO 95/31469 ~ PCT/US95105264 Analysis calculated for C,SH,4N60 (294.3): C, 61.2 1; H, 4.79; N, 28.55.
Found: C, 60.88; H, 5.00; N, 28.15.
4-N,N Dimethylaminomethyleneimino-6 phenyl-8-~2-deoxy-3,5-di-O-(4-chlorobenzoyl)-~3-D-ribofuranosylJpteridine-7 one (38J
5 To 60 mL of dry acetonitrile was added 2.94 g (10 mmol) of 4-N,N-dimethylaminomethyleneimino-6-phenyl-pteridine-7-one (37) and 1.49 mL (11 mmol) of 1,8-diazabicyclo[5.4.0]under-7-ene (DBU). The solution was stirred for 15 min until clear. To this solution was added 4.72 g (11 mmol) of 2-deoxy-3,5-di-O-(4-chlorobenzoyl)-a-D-ribofuranosyl chloride (made as in Example 3, step (a) for the toluyl 10 derivative). The solution was then stirred for 2 hours at room temperature during which period a yellowish precipitate formed. The solid precipitate was collected and recrystallized from CHCl3/methanol to provide 38 as 5.3 g (83 % yield) of yellowish crystals (m.p. 171-174°C).
Analysis calculated for C~,HZgC12N6O6. 1/2 HZO (696.6): C, 58.62; H, 4.05; N, 12.06.
15 Found: C, 58.71; H, 4.16; N 11.91.
g) 4 Amino-6 phenyl-8-(2-deoxy-~-D-ribofuranosyl)pteridine-7 one (39) To a solution consisting of 70 mg of KZC03 in 25 mL of anhydrous methanol was added 0.687 g (1 mmol) of 4-N,N-dimethylaminomethylenimino-6-phenyl-8-[2-deoxy3,5-di-O-(4-chlorobenzoyl)-~B-D-ribofuranosyl]pteridine-7-one (38).
Then 0.7 20 mL of concentrated ammonia was added to this suspension. The solution was neutralized by the addition of AcOH after stirring for 2 days at room temperature and the resulting yellow precipitate (0.2 g, 56% yield) collected. The filtrate was evaporated to dryness and the residue recrystallized from methanol to give 39 as another 0.12 g (34 % yield) of yellow crystals (m.p. 163°C decomp.).
25 Analysis calculated for CI~H,.,N504 ~ 1/2 H20 (364.4): C, 56.03; H, 4.97;
N, 19.22.
Found: C, 56.16; H, 4.75; N, 19.14.
h) 4-Amino-6 phenyl-8-(5-O-dimethoxytrityl-2-deoxy-~i-D-ribofuranosyl) pteridine-7 one (40J
To a solution of 0.355 g (lmmol) of 4-amino-6-phenyl-8-(2-deoxy-/3-D-30 ribofuranosyl)-pteridine-7-one (39) in 10 ml of anhydrous pyridine were added some molecular sieves and 0.407 g (1.2 mmol) of dimethoxytrityl chloride. The solution was stirred at room temperature for 12 hours. The molecular sieves were filtered off and the filtrate evaporated. The residue was dissolved in 30 ml of CHZC12 then extracted with a KCW. VUn:,I_:1'A Vll. t:~CIILV . U 1 ~ _ . ~ .'':' 9,-~(i : 1 ~ vu : _ - . 't' I v ~4:.i oU4:3~ +~1 J ti;3 '_':3;3,)~14 Ei5 : b -7 2I9a588 saturated solution of NaHCO,, followed by a saturated solution of NaCl. The organic layer was dried over NaZSOa, then evaporated again and the residue put onto a silica gel column for chromatography with toluene/EtOAc 1:1 as cluent_ The product fraction was evaporated, 'dissolved al;ain in little CHiCIz and then dmp-wise added to n-hexane with stirring to give after drying in a vacuum desiccator 40 as 0.46g (70°b) of a yellowish crystal powder of m.p..114°C (deeomp.).
Analysis calculated for C 3aHsyNs06 (657.7): C, 69.39; H, 5.36; N, 10.64.
Found: C, 68.91; Ji, 5.67; N, 10.44.
i) 4amino-6 ph~~nyi-8-(S-~O-dimerlaaxytriryl-2-deoxy-(i D-ribofuranosyl) preridlne-7 one-3'-O-(j8-cyanoethyl)-N,N diisopropyl phosphorarnidite (4~) To a solution of 0.657 g (a mmol) of 4-amino-6-phenyl-8-(5-O-dimcthoxy-trityl-2-deoxy-~B-D-ribofuranosyl;I-pteridine-7-one (40) in 15 ml of CHZC12 were added 0.452 g (1.5 mmol) of :;~,yanoethoxy-bis-N, N-diisopropylamino-phosphane and 3S mg (0.5 mmol) of tetrazole. The mixture was then stirred under argon atmosphere for I2 hours at room temperature. The reaction solution was diluted with 15 ml of CH~CI~ and then extracted with saturated solutions of NaHC03 and NaCI. The organic phase was dried over NazSO,, filtered and evaporated. The residue was put onto a silica gel column for chromatography with toluene I EtOAc 3:2 containing a small amount of tx-iethylamine. The product fraction was collected, evaporated, the residue dissolved in little toluene and then added dropwise to 100 ml of n-hexane with stirring to give 41 as 0.78 g (91~) of a micrc~erystallule powder (m.p. > 100°C decomp.).
Analysis calculated for (:,.,HjzN~()~,P (858.0): C, 65.80; H, 6.11; N, 11.43.
Found C, 66.13; H, 6.20; N, 11.03.
EXA112PLE y Sy~e~ of a Phospho'd' ~ Formula V: (3-Methvl-$-(2-deoa~-5-O-dimethox;~t~yt-d-D-~b~ofuranosylliSOxaO,thonterin-3'-O-(B-cvanoethyn-N,N-diiso~ropylyhosn_yc- nidite) (5,~
a) 2-fiethylmercapto-4-a»atno-6 oxo Fyrimidine (42) The synthesis of 2-methylmcrcapto-4-amino-6-oxypyrimidine was described by Johns a al., J. Biol. Chern., 14: 38I-387 (1913). To 100 mI. of a IO
percent solution of NaOI~ was added ZS g of pulverized 4-amino-2-mercapto-6-( Replacement Page ]
erg"~r,~t?~ D SHEEN

~~~~~58~i 52 ~ ; '' oxopyrimidine (Aldrich, :Milwaukee, Wisconsin, USA). To this solution was added 25 g of technical dimethylsulplhate in small portions, with thorough shaking after each addition. In some cases iit was found necessary to dilute the solution with Hz0 as the precipitate which resulted became too thick to permit thorough mixing to take place.
After the mixture had stood at room temperature for 15 minutes, it gave an acid reaction and the precipitate was filtered by suction. The mercapto pyrzmidine thus obtained was removed to a flask while still moist, 200 mL of 95 percent alcohol were added and the mixture was heated to the: boiling point of the alcohol. This dissolved most of the precipitate. The flask wa.s then cooled and allowed to stand at room temperature for an hour. On filtering, 20 to 25 grams of pure 42 were obtained. This was 75 to 90% of the calculated weight.
b) 4-amino-1-methyl-2-methylthio-6-oxodihydropyrimidine (43J
The synthesis of 4-;amino-1-methyl-2-methylthio-6-oxodihydropyrimidine was described by Johns e,t al., J. Biol. Chem., 20: 153-160 (1915). To 65 mL
of normal potassium hydroxide solu~~tion was added 10 g of 2-methylmercapto-4-amino-6-oxo-pyrimidine (42). To this solution was gradually added 9 grams of dimethyl sulphate while the solution was agitated by frequent shaking. A white, crystalline precipitate began to appear almost immediately, and this soon became very bulky. As soon as the solution became acid to litmus, the crystals were filtered off by suction. The filtrate was neutralized with NaOH, and evaporated to dryness. The residue was washed with cold water, the solid was filtered off and added to the crystals already obtained.
The combined solids were them triturated with dilute ammonia to dissolve any unaltered 2-methylmercapto-4-amino-6-oxo-pyrimidine, a small quantity of which was found to be present. That part of the residue which was not soluble in ammonia consisted of two compounds which differe,~i widely as to their melting points and solubility in ether. The compound having the lower melting point was very soluble in ether, while the one with the higher melting point vvas almost insoluble in this solvent. Ether, therefore, served as a means of separating these compunds from each other.
The compound soluble in ether was 2-methylmercapto-4-amino-6-methoxypyrimidine. This compound was removed from the solid residue by repeated washings with ether and filtering out of the solid residue. The solid residue was then recrystallized from alcohol to give: 43 as slender prisms (yield = 60%, m.p.
255°C).
Analysis calculated for C~,H90N3S: N, 24.57. Found N, 24.71.

c) 6-amino-3-methyl-2-methylthio-S-nitroso pyrimidine-4-one (44) The synthesis of 6-amino-3-methyl-2-methylthio-5-nitroso-pyrimidine-4-one (= 4-amino-1-methyl-2-methylthio-5-nitroso-6-oxodihydropyrimidine) was described by Schneider et al. Chem. bier., 10i': 3377-3394 (1974). To a suspension of 11 g of 4-amino-1-methyl-2-methy:lthio-6-oxodihydropyrimidine (43) in 1 L of 30% acetic acid was added dropwise a solution of 50 ,g of sodium nitrite in 100 mL of H20. The mixture was stirred for an additional hour at room temperature and then cooled in a refrigerator overnight. The precipitate was collected and washed with HZO and then acetone and dried at 100°C. This yiE:lds 119.5 g (92% yield) of a chromatographically uniform crude product (m.p. 230°C dec:omp.). Recrystallization of 1 g of this material from 240 mL of HZO gave 44 as 0.52 g of blue crystals (m.p. 234°C decomp.).
d) S, 6-Diamino-3~-methyl-:?-methylthio pyrimidine-4-one (45) To 4.0 g (0.02 mole) of 6-amino-3-methyl-2-methylthio-5-nitroso-pyrimidine-4-one (44) w~~s added 40 mL of 20% aqueous ammonium sulfide solution.
The mixture was heated under re,flux for 30 min. After cooling the precipitate was collected, washed with a little ethanol and dried in a desiccator to give 45 as 2.72 g (75% yield) of colorless crystals (m.p. 211-212°C).
e) 1-methyl-2-metnylmercapto-4-amino-froxo-dihydropyrimidine-azomethinecarbonic acid-~S ethylerter (46).
The synthesis of 3-methyl-2-methylthio-pteridine-4,7-dione from 1-methyl-2-methylmercapto-4,5-di~unino-6-oxo-dihydropyrimidine (5,6-diamino-3-methyl-2-methylthio-pyrimidine-4-one), steps c and d, was described by Pfleiderer, Chem. Ber.
91: 1670 (1958). In 200 mL of H20 was dissolved 6 g of 5,6-diamino-3-methyl-2-methylthio-pyrimidine-4-Mme (45). The solution was cooled to room temperature and then combined with 6 g a:thylglyoxylate-hemiethylacetal. The thick precipitate that immediately resulted was drawn off after one hour and recrystallized from ethanol producing 8 g of bright yellow crystals of 46 (m.p. 178°C).
Analysis calculated for C,oH,4N4C)3S~H2O: C, 41.66; H, 5.59; N, 19.44. Found:
C, 42.18; H, 5.57; N, 19.3!.
fj 3-methyl-2-methylthio p~teridine-4, 7 dione (47) To 200 mI, of 0.5 :N NaHC03 was added 8g of 1-methyl-2-methylmercapto-4-amino-6-oxo-dihydropyrimidine-azomethinecarbonic acid-5 ethylester crystals (46). The solution was relluxed 30 minutes. The clear solution was treated with WO 95/31469 ~ ~ ~ PCT/US95/05264 54 ~ ~ ' i animal charcoal and then heat acidified to pH 1. Once cooled the precipitate was collected and recrystallized from HZO yielding 47 as 4.5 g of faint yellow crystals of 3-methyl-2-methylthio-pteridine-4,7-dione (m.p. 292-294 °C).
Analysis calculated for CgHgN,O2S: C, 42.86; H, 3.60; N, 24.99. Found: C, 42.70; H, 3.58; N, 24.43.
g) 3-Methyl-2-methylthio-8-(2-deoxy-3,5-di-O-(4t-chloro-(i-D-ribofuranosylJpteridine-4, 7 dione (48J
Crystals of 3-methyl-2-methylthio-pteridine-4,7-dione (47) were dried in a drying oven at 100°C under high vacuum. Then 5.6 g (25 mmol) of the dried crystals were suspended in 250 mL of anhydrous acetonitrile under argon atmosphere with 12.9 g of 2-deoxy-3,5-di-O-(4-chlorobenzoyl)-D-ribofuranosyl chloride (made as in Example 3, step (a) for the toluyl derivative). Then 3 mL of hexamethyldisilazane and 2 mL of trimethylsilyl chloride were added. The mixture was stirred for 30 minutes and then 7.4 mL of SnCl4 was added dropwise within 2 minutes. After exactly 20 min of reaction the mixture was poured slowly into 1200 mL of a chilled saturated aqueous solution of sodium bicarbonate. The solution was then extracted three times with 200 mL of ethyl acetate each. The pooled organic layers were washed with a saturated solution of NaCl, dried over MgS04, evaporated to dryness and coevaporated three times with CH2Clz.
The resulting residue consisting mainly of an a, B anomeric nucleoside mixture was separated by fractional recrystallization. The first crystallization was done with 200 mL methanol/350 mL ethyl acetate. The resulting precipitate was again recrystallized from 200 mL methanol/280 mL ethyl acetate and then the resulting solid once more recrystallized from 200 mL methanol /500 mL ethyl acetate leading to 4.54 g of colorless crystals consisting of pure a-nucleoside (m.p. 188-191°C, 29% yield). The filtrates were combined, evaporated, and the residue was recrystallized from 100 mL
methanol/130 mL ethyl acetate yielding to 1.8 g of the a,~B-mixture (12%
yield). The filtrate thereof was again evaporated to dryness the residue was recrystallized from 50 mL ethyl acetate / 50 mL ether to yield 48 as 6.79 g (44 % yield) of chromatographically pure crystalline ~-nucleoside (m.p. 130-133°C).
Analysis calculated for C~,HZZC12N40,S: C, 52.52; H, 3.59; N, 9.07. Found: C, 52.45;
H,3.61;N8.90.

''~l~p'~88 ss h) 3-Methyl-8-(,'2-deoxy-~3-D-ribofuranosyl)isoxanthopterin (2-Amino-3-methyl-(2-deoxy-/3-D-ribofuraru~syl)pteridine-4, 7 dione) (49) A solution of 3.3 g (4 mmol) of 3-methyl-2-methylthio-8-[2-deoxy-3,5-di-O-(4-chlorobenzoyl)-~-I~-ribofuranosyl]pteridine-4,7-dione (48) in 100 mL of dry s acetonitrile was treated added to 100 mL of saturated methanic ammonia at room temperature. The mixture was l.et stand for 24 hours. A small amount of insoluble material was filtered off and the filtrate evaporate to dryness. After two coevaporations with methanol the precipitate wars dissolved in 20 mL of warm methanol. Then s0 mL
of ethyl ether was added and the; mixture was chilled in the ice-box for 3 days. The precipitate was collected and dried at 60°C in vacuum yielding 49 as 1.46 g (88% yield) of colorless crystals (m.p. > 25.0°C decomp.).
Analysis calculated for nIZHISNsOs~ 1/2 H20: C, 45.28; H, 5.07; N, 22.00.
Found: C, 4s.ss; H, s.07; N 21.92.
i) 3-Methyl-8-(2-deoxy-S-O-dimethoxytrityl-(3 D-ribofuranosyl)isoxanthopterin (SO) To 3.1 g (10 mmol) of 3-methyl-8-(2-deoxy-/3-D-ribofuranosyl)isoxanthopterin (49) was added 50 mL of dry pyridine. The solution was then coevaporated. The coevaporation was repeated three times with 50 mL of dry pyridine each. The residue was then suspended in 50 mL of dry pyridine. To this solution was added 5.1 g (1s mmol) of dimethoxytrit~~l chloride and the mixture was stirred at room temperature.
After 10 minutes a clear solution was obtained and after 3 hours the reaction was stopped by addition of 10 mL of methannl. The solution was evaporated, the residue dissolved in CHZC12 and then extracted twice with a 5 % aqueous solution of sodium bicarbonate. The organic layer was dried over Mg;S04 and the filtrate evaporated again. The residue was dissolved in a little CHZ~C12/methanol, put onto a silica-gel column (3 x 20 cm, packed with toluene / ethyl acetate) for flash-chromatography. A gradient of solvent mixtures had to be applied to achieve puriification : 500 mL toluene/ethyl acetate 1:1, 2.5 1 of ethyl acetate, 1 1 of ethyl acetate:/methanol 99:1 and 2 1 of ethyl acetate /methanol 98:2.
The substance fraction in ethyl acetate/methanol was evaporated and dried in high vacuum to give 50 as 3.9 g (63 °ro yield)) of a colorless amorphous solid.
Analysis calculated for ~.~.g3H33N5~o7 ~ 1/2 H20: C, 63.86; H, S.s2; N, 11.28.
Found: C, 63.90; H, 5. 82; N, 10. f.6.

ft(:V. ~Uy,~i'A ~1l~fiVC:fIE_:y()1 ~ _. ~.''.- 4~,-'3E' ~ 1v iE> : --.4'1 r 51:3 5(14;3 +4~ F3:3 '.':3~J;YIAEi~:N t3 2190588 5s j) 3-Methyl-8-(2-deoxy-5~-O-dimethnacytriryl-~ D-ribofuranosyl)isoxa~nthopterin-3'-O-(~B-cyQrcoethyl)-N,N-di'isopropyl phosphorarrcidite (51~
A suspen;don of 3.06 g (4.9 mmol) of 3-methyl-8-(2-deoxy-5-O-dimethoxytrityl-~i-D-ribofuranosyl)isoxanthopterin (SO) and 0.18 g (25 mmol) of tetsazole was stirred under argon atmosphere with 2.2 g (7.3 mmol) of ~3-cyanoethoxy-bis-diisopropylphosphane. 'The suspension became clear after 30 min and the reaction was stappcd after 4 hours. '.fhe reaction solution was extracted once with a 5 %
aqueous solution of sodium bicarbonate, then the organic layer was dried over Mg504 and the filtrate evaporated to drlness. purification was done by flash-chromatography on a silica-gel column {3 x Z0 cm) in 200 mL of hexane / ethyl acetate 2:1 followed by 2 1 of hexane I ethyl acetate 1:.1. The product fraction was collected, evaporated to dryness and dried in high vacuum to give SI as 2.38 g (5930 yield)) of a colorless amorphous ~, solid.
Analysis calculated for C,2H~aN'7OaP ~ H20 (820.8): C, 61.45; H, 6.26; N, 11.94.
Found: C, 61.56; H, 6, ~47; N 11.51.
Synthesis of a Phasnha~ramidite of Formula V'.CB: ~6.T-Dimethyl-~4-f2-(4-nitrapl:enx))ethoxyca~rk~onvll am~~l-(2-d~-~O-dimethoxlr-tritvl ~ D-~,~granasvDnteridin~~Z-o '-O-(B-cvanoethyp-N.I1T-dii~,lQro~yl~ho~h~~ramidite a) 4,5-diaminouraril-hydrochloride (52~
The synthesis of 4~,5-diarninouracil-hydrochloride, used in step (b) is described by Shermart & Taylor, Org. Syn. Cell. Vol IV, 247. In a 3 L, three-necked flask equipped with a reflex condenser and an eff cicnt stirrer was placed 1 L
of absolute (99.8%) ethanol. To this was added 39.4 g (1.72 g. atom) of sodium, and, after solution is complete, 91.5 mL (97.2 g., 11.86 mole) of ethyl cyanoacetate and SI.S g (0.86 mole) of urea were added. THe mixture was heated under reflex on a steam bath with vigorous stirring for 4 hours. After about 2 hours, the reaction mixture becomes practically solid, and the stirrer may have; to be stopped. At the tnd of Lhc reaction time, 1 L
of hot (80°C) HBO was added to the reaction mixture, and stitrirlg is resumed.
After complete solution has taken place, the stirred mixture was heated at 80° fox 15 minutes and is then neutralized to litmus with glacial acetic acid. Additional glacial acetic acid (75 mL) was [ Replacelfnent PaEe ]
APv'FP:f)~D SNE

s7 added, followed by cautious addition of a solution of 64.8 g (0.94 mole) of sodium nitrite dissolved in 70 mL of HZO. The rose-red nitroso compound separated almost immediately as an expa~aded precipitate which almost stopped the stirrer.
After a few minutes the nitroso compound was removed by filtration and washed twice with a small s amount of ice water. T'he moist: material was transferred back to the 3 L
flask, and 430 mL of warm H20 (s0°(:) were added.
The slurry was stirred while being heated on a steam bath, and solid sodium hydrosulfite wa:~ added until the red color of the nitroso compound was completely bleached. Then an a~,dditional 30 g of sodium hydrosulfite was added; the light tan suspension was. stirred 'with heating for is minutes more and was allowed to cool. The dense diamin.ouracil bisulfate was filtered from the cooled solution, washed well with H20, and partially dried.
The crude; product was readily purified by conversion to its hydrochloride salt. The bisulfate salt was transferred to a wide-mouthed 1-L flask, and concentrated is hydrochloric acid was added until the consistency of the resulting mixture was such as to permit mechanical stirring (100 to 200 mL of acid). The slurry was heated on a steam bath with stirring for 1 hour. Tape tan diaminouracil hydrochloride was filtered on a sintered glass funnel, washed well with acetone, and vacuum-dried over phosphorus pentoxide to yield 104-124 g of .52 (68-81 ~).
b) 6, 7 dimethyllumazine f53) The synthesis of 6~,7-dimethyllumazine is described by Pfleiderer et al.
Chem. Ber., 106: 3149-:3174 (1973). To a solution consisting of 50 mL HZO, 20 mL
ethanol, and 1 mL conc~;ntrated :HCI was added 20 mL of diacetyl. The solution was heated to a boil and droplets of a solution of 20 g 4,s-diaminouracil-hydrochloride (52) 2s in 4s0 mL of H20 were slowly added. T'he mixture was heated under reflux for 2 hours, refrigerated in an ice bo:K overnight and the resulting precipitate (18.7 g) was collected.
The precipitate was purified by toiling it in s00 mL H20, to which a diluted sodium aluminate solution was added until the precipitate was dissolved. The solution was filtered through activated charcoa after which the filtrate was added dropwise into boiling, diluted acetic acid. After cooling, the mixture was dried at a temperature of 100 °C under reduced pressure to give 53 as 17.0 g (79% yield) of virtually colorless crystals (m.p. > 360°C)., 2190~~~

cJ 6,7dimethyl-1-(2-deoxy-3,5-di-O-toluoyl-(3-D-ribofuranosylJlumazine (54J
The synthesis of 6,7-dimethyl-1-(2-deoxy-3,5-di-O-toluoyl-a-D--ribofuranosyl)lumazine is described by Ritzmann et al. , Liebigs Ann. Chem. , (1977). To 50 mL of hexamethyldisilazane was added 7.68 g of 6,7-dimethyllumazine (53) and a few ammonium sulfate crystals. The solution was heated under reflux for about 24 hours until it became clear. The excess hexamethyldisilazane was then distilled off in vacuum. The residue was dissolved in 220 mL of absolute benzole, 16 g of 3,5-Di-O-p-toluoyl-2-desoxy-d-erythro-pentofuranosylchloride was added and the solution was agitated for a period of one week at room temperature under dry conditions. To this solution was added 5 mL of methanol. The solution was evaporated to dryness, and the residue was recrystallized from 200 mL of methanol. Nearly DC-pure 6,7-Dimethyl-1-(2-deoxy-3-5-di-O-p-toluoyl-B-D-ribofuranosyl)-4-thiolumazine (the B isomer) was precipitated out. Renewed recrystallization of this first fraction from 300 mL
methanol yielded 2.36 g of pure B isomer. The filtrates were purified, evaporated to dryness and then chromatographed over a silica gel column (70 x 5 cm) using chloroform/methanol (30:1). The first main fraction to appear yielded 6.5 g DC-pure 6,7-dimethyl-1-(2-deoxy-3-5-di-O-p-toluoyl-a-D-ribofuranosyl)-4-thiolumazine (the a isomer) after it was evaporated to a colorless amorphous solid. The subsequent mixed fraction was also evaporated to dryness, recrystallized from 100 mL methanol, after which an additional 2.67 g of colorless crystals of the B isomer were precipitated out with a melting point of 154-155°C. The filtrate was again evaporated to dryness, poured on a silica gel column (900g) and developed with chloroform/acetone (9:1). An additional 2.7 g of the a isomer was obtained from the main fraction having the greater RF value and an additional 0.43 g of the B isomer from the fraction with the lesser RF value. The total yield consisted of 54 as 5.46 g (25%) of the B isomer in the form of colorless crystals with a melting point of 154-155°C and 9.2 g (43% yield) of the a isomer as an amorphous solid (m.p. 126-132°C). Note that the assignment of the a- and B-D-anomers was reversed after the Ritzman et al. paper by Cao et al. , Helv. Chim. Acta. , 75: 1267-1273 (1992).
dJ 6,7Dimethyl-1-(2-deoxy-3-5-di-O p-toluoyl-(3-D-ribofuranosylJ-4-thiolumazine (55J.
A mixture of 0.871 g (1.6 mmol) of 6.7-dimethyl-1-(2-deoxy-3,5-di-O-toluoyl-~-D-ribofuranosyl)lumazine (54) and 0.403 g (1 mmol) of Lawesson reagent in 20 mL of toluene was refluxed for 20 hours. The mixture was then evaporated, the residue taken up in 20 mL of CHZCIz and then tseatcd twice with a saturated solution of sodium bic~rrbonata. The aqueous phase was extracted threr times with 10 mL of CHzCI:
each, the united organic extracts dried over Na=SO,, filtered and again evaporated. Re-crystallisation of the residue from 150 rnL of methanol yielded S5 as 0.67 g (75 Ye yield) of orange-colored crystals (m.p. I66-ib$'C).
Analysis calculated for C~H~N,UdS o FixO (578.6): C, 60.20; H, 5.22; 1~, 9.68.
Found: C, 60.43; H, 5.06; N 9.72.
e~ 4-Amino-6,7-dimeehyl-1-(2,deaxy-d-D-ribofLranoryl)preridine-2-one fS6) In as autoclas~e was heated 0.42 g (0.75 rnmol) of 6,7-dimethyl-1-(2-deoxy-3,5-di-O-p-toluoyl-~-D-rlbofuranosyl).4-thiolumazine (5S) in 25 mL of a saturated solution of ammonia in methanol far 16 h to 100°C. After cooling the solution was evaporated and the residue tre2ted with CHUG=. The solid material was collected.
washed with ether and dried in high vacuum to give Sb as 0.207 $ (91 % yield) of a colorless crystal powder (m.p. > 300°C decamp.).
Analysis calculated for C,3H1,Ns0, ~ HzU: C 49.36, H 5.74, 1122.14. Found: C
49.17, H 5.47, N 21.80.
,~ 6, 7 Dimuhyl-4~ 2-~4-nitrnphenyhcti:osycarbonyt~antino-l ~ (2-deoxy.~ D--ribofu~ryl)-pteridine-2-nne (S7~
A mixture of 1.54 g (5 mmol) of 4-amino-6,7-dimethyl-1-(2-daoxy-~-D-riboftrnanosyl)ptrridino-2-0ne (56) and 1.8? g (b mmol) of 1-methyl-3-x'1(4-nitrophcnyl)-ethoxycarbonyI]imidazolium chloride (see Himmelsbach, er al. Ttrnahedrnn 40:

(1984) in 80mL of anhydrous DMF was stirred at room temperature over night. To this solution was slowly added 100 mL of HZO with stirring. The solution was then cooled and the precipitate collected by suction and, after washing with methanol and ether and drying in a desiccates, gave 57 as 2.0 g (80% yield) of crude material.
Recrystallization from methanol yielded 1.5 g (60% yield) of colourless crystals (m.p. 154-155°C).
Analysis calculated for C~HuN,O, a H30: C, 50.96; H, 5.01; N, 16.21, Found: C, 50.51; H, 5.15; N, 15.84.

KC\~ . \ un ; L:f A .,l1l:L:VClll:y U l _ __ ~_~~" _~-:)~ ' I ~ I'u : -_ . 41 ~ 6~l~ii 5u4,), +4~J tiJ '.:J;)~J~1~4E~5.: a_ :~
2~~0~8~
g~ 6,7Dimethy,f-4-f2-(4~~nitrophenyl)ethoxycarborryl~rynir~o-1-(2-deoxy-S-p.
dinsEthoxytrityl-~8-D-ribnfuranosyl~pteridine-2-one (38J
Water was removed from 2.0 g (4 mmol) of 6,7-dimethyl-4-[2-(4-nitraphenyl)ethoxycarbonyl~ami>zo-1-(2deoxy-~3-D-ribofuranosyl)pteridine-2-one (S7) by twicx coevaporating the crystals with 20 mL of anhydrous pyridine. The residue was dissolved in 100 tnL of dry pyridine to which 1.63 g (4.8 mmol) of dimethoxytrityl chloride was added. The mixture was then stirred far 18 hours at room temperature.
The reaction was quenched by tlye addition of IO mL of methanol, then evaporated and finally the residue was ~~issolvcd in CHzCIz. The solution was treated with a saturated IO aqueous solution of sodium bicarbonate. After separation the organic layer was dried over sodium sulfate, filmred, and evaporated again. The residue was dissolved in a little CHClj, put onto a silica-gel column and then eluted with a gradient of toluene/ethyl acetate 4:1 to 1:1. The main fraction was obtained with toluene/ethyl acetate 2:1 and gave on evaporation 58 as 2.84 ,g (88 % yield)) of a colorless amorphous solid.
Analysis calculated for 'C43H4zN6CI0~ C~ 64.33; H, 5.27; N, 10.4?. Found: C, 64.51; H, 5.23; N, 10.24.
3aJ 6,7Dlmethyl-4-(2-I4-nitrophenyl)ethoxycarhonylJamino-1-(2-deozy-5-O-dimethaxy-triryl-~-17-ribwfuranosyl)pteridine-Z-one-3'-p- (S-cyannethyl)-N, N-diisop ropyl phosphoramidite (S9) To 40 mI. of dry CHzCIz and 20 mL of dry a.cetonitrile were added 1.0 g (1.25 mmol) of 6.7-dimethyl-4-[2-(4-nitrophenyl)cthoxycarbonyl]amino-l-(2-deoxy-5-0-dimethoxytrityl-,8-D-ribofuranosyl)pteridine-2-one (58), 44 mg (0.63 mmol) of tetrazole and 0.754 g (2.5 mmol) of ,S-cyanocthoxy-bis-diisopropylanuno-phosphane with stimng.
After 18 hours the solution was diluted with 50 mL of CHTCIz, then extracted with a saturated aqueous solution of sodium bicarbonate, the organic layer was dried over sodium sulfate and finallly evaporated. The residue was dissolved in a little CH=Clz and then purified by column chromatography on a silica-gel with a gradient of tolucneJethyl acetate 4:1 to I.1. The main fraction gave an evaporation and drying in high vacuum 59 as 0.98 g (78% yield) of an amorphous solid.
Analysis calculated for t:~Hs9NgC" (1003.1): C, 62.27; H, 5.93; N, 11.17.
Found: C, 62.00; H, 6.01; N 10.6:1.
[ Replacement Page ]
Rf.1ctvC)~0 ~tiE~ ~.

tCC: \ . \ ( r\_, ta'~1 \1l L::\C:I lL:~ , o J ~ - _ ~ .=.''.- 4~,-:3~ : J :
51 ~ - _ . '1' 15 54~a 5()4x3-. +~ ;3 H9 :.',1;):)44 Ei f : a! I l1 ~vnthesis of a Phosnl~amidite of Formula VTI- amino-frrnethvl..4-,~
nitrophenylethvl-&(S-0-dimethoxyte~tvl-~-deoxv-Q-Dribofuranasy~ nte~~t~p-7-one-3'-O-.(B-cyarroethyD-fJ,N-diis ~rop,~ osphorarnidite (71).
The synthesis of 5,6-diamino-2-methylthio-pyrimidine-4-one (2-methylmereapto-4,5-diamino-6~xypyrimidine), steps (a) through (c) was performed as described by rohns et al., J. B(ol. C~rem. , 14: 3$I-388 (1913).
a~ 2-methylmercapto-4-amino-6-oxo-pyrirnidine (42) The synthesis of 2-methylrnezcapto-4-amino-6-oxypyzimidinc was described by Johns et al:, J. B;iol. ptem., 14: 381-387 (1913) and illustrated in Example 5, step (a) .
b~ 2-methylmercapto-øamino-S-nltroso-Eroxypyrimidine (60~
- To 350 mL of H10 were added 20 g of 2-methylmercapto-4-amino-~-oxypyrimidine (42) and 5.1 g NaOH. A solution of sodium nitrite in 40 mI, of water I5 was added. The mixture was thtn acidified by the gradual addition of 17 g of glacial acetic acid. The precipitate which formed was white, but turned blue in a short time.
The mixture was allowed to remain at room temperature overnight after which the precipitate was filtered; off, washed with cold wafer and used, without drying, for the preparation of 2-methylmercapto-4,5-diamino-6-oxypyrimidine. The yield of the nitroso derivative was almost quantitative. It was but slightly soluble in hot water or alcohol and was not soluble in benzene. It formed a red solution in alkaLies and blue in acids. A
portion was purified for analysis by dissolving it in ammonia and precipitating with acetic acid. The substance did not melt, but began to decompose at about 255°C.
' Analysis caicuiated for C,HOZN,S: N, 30.10. Found N, 30.16.
c~ S,~diarnino-~2-methyllhio-pyrimidine-4-one (61) To a 1 I:. flask was added 50 mL of a 10 percent solution of ammonium sulphide. The solution was heated on a steam bath. The moist 2-methylmercapto-amino-5-nitroso-6-oxy-pyrimidine (b0) obtained in the previous experiment was added gradually. Ammonium sulphide was also added when the solution turned red as this indicated that the nitroso compound was present in excess. When the ammonium sulphide was prtsent v~ excess the solution was yellow. When all of the nitroso compound was reducai the addikion of excess ammonium sulphide should be avoided or the diamino compound obtained. will be highly colored.
[ Replacement Page ]
AMENDED S~1EET

WO 95/31469 ~ ~ PCT/US95/05264 ;, d) 6-Ethoxycarbonylmethyl-2-methylthio pteridine-4, 7 dione (62) A mixturE: of 17.x: g (0.1 mol) of 5,6-diamino-2-methylthio-pyrimidine-4-one (61) and 22.6 g of :.odium ethyl oxalylacetate was heated in 200 mL of glacial acetic acid to 80°C for 30 minutes. After cooling the precipitate was collected, washed with H20 and dried. The cn~de material was then dissolved again by heating in EtOH/HZO
1:1 and 170 mL of saturated NaEIC03 solution was added. The hot solution was treated with charcoal, filtered and the filtrate poured slowly into 200 mL of hot glacial acetic acid with stirring. The yellowish precipitate was filtered off, washed with Hz0 and ethanol and dried at 100°C to give 62 as 18.9 g (64 % ) of glittering crystals of m.p.
213°C. Analysis calculated for C"H,ZN4O4S (296.3): C, 44.59; H, 4.08;
N, 18.91.
Found: C, 44.49; H, 4.1)3; N, 18.88.
e) 6-Methyl-2-methylthio ;pteridine-4, 7 dione (63) A soludor~ of 19. i' g (66.5 mmol) of 6-ethoxycarbonylmethyl-2-methylthio-pteridine-4,7-dione (62) in 120 mL of 2.5 N NaOH was stirred at 80°C
for 30 min. The hot solution was treated with ch~~rcoal, filtered and the filtrate added slowly into 50 mL
of hot glacial acetic acid. The precipitate was collected after cooling, washed with H20 and acetone and dried at 100° to give 63 as 14.3 g (96%) of a yellow crystalline powder (m.p. .275°C decomp.).
Analysis calculated for CgHaN40zS (224.3); C, 42.85; H, 3.60; N, 24.99. Found:
C, 42.79; H, 3.59; N, 25.Q~6.
fj 6 Methyl-2-meilrylthio-!3-(3,5-di-O p-toluoyl-2-deoxy-~-D-ribofuranosylJ-pteridine-4, 7 dione (64) To a suspension o:F 4.0 g (17.83 mmol) of 6-methyl-2-methylithio-peteridine-4,7-dione (64) in 240 mI. of anhydrous acetonitrile was added 8 mL
(53.6 mmol) of DBU. The miixture was stirred for 30 minutes at room temperature. To the resulting clear solution vvere added 4.62 g (11.9 mmol) of 3,5-di-O-p-toluoyl-2-deoxy-a-D-ribofuranosyl chloride (16) and then the mixture was stirred for 6 hours at room temperature with moisture excluded. To this solution was added 2.4 mL glacial acetic acid in 100 mL of dicholoromethane. The solution was stirred for 5 minutes and then evaporated to dryness under reduced pressure to give a syrupy residue which was chromatographed on a silica gel column (16 x 8.5 cm) first with 2.5 L of toluene/ethyl acetate 1:l, then 2.5 L of toluene/ethyl acetate 1:2 and finally 3 L of dichloromethane/methanol 100:3, The product fraction was collected, evaporated and the WO 95/31469 - ~ . ~- PCT/US95/05264 residue recrystallized from toluene to give 64 as 2.12 g (31 %) of colorless crystals (m.p.
196-197°C).
Analysis calculated for (~29HZgN4~O~S (576.6): C, 60.41; H, 4.89; N, 9.72.
Found: C, 60.26; H, 4.96; N, 9.6E~.
g) 6-Methyl-2-me'thylthio-4 p-nitrophenylethoxy-8-(3,5-di-O p-toluoyl-2-deoxy-Eli-D-ribofuranosyl) pteridine-7 one (65) To a solu~:ion of 2.19 g (3.8 mmol) of 6-methyl-2-methylthio-8-(3,5-di-O-p-toluoyl-2-deoxy-B-D-riibofuranosyl)-pteridine-4,7-dione (64), 9.95 g (5.69 mmol) of p-nitro-phenylethanol and 1.52 g (:5.69 mmol) of triphenylphosphane in 75 mL of dioxan was added 1.16 g (5.7 mmol) of ethyl azodicarboxylate. The mixture stirred for 2.5 hours at room temperature. The. solvent was removed under reduced pressure and the residue purified by silica gel column (5.3 x 15 cm) flash chromatography using 300 mL
of toluene, 250 mL toluene/ethyl acetate 8:1 and 650 mL of toluene ethyl acetate 6:1.
The product fraction ways collected, evaporated to dryness and the residue recrystallized from CH2C12/AcoEt to give 65 as 2.31 g (85 % ) of colorless crystals (m.p. 122-125 °C).
Analysis calculated for (~3~H35NSO9S(727.8): C, 61.23; H, 4.86; N, 9.65.
Found: C, 61.18; H, 4.95; N, 9.6 i'.
h) 6-Methyl-2-me~thylsulfa~nyl-4 p-nitrophenylethoxy-8-(3,5-di-O p-toluoyl-2-deoxy-,~i-D-ribofuranosyl) pteridine-7 one (66) To a solu~aon of 2.27 g (3.13 mmol) of 6-methyl-2-methylthio-4-p-nitrophenylethoxy-8-(3, '~-di-O-p-~toluoyl-2-deoxy-B-D-ribofuranosyl)-pteridine-7-one (65) in 100 mL anhydrous C:H2C12 wE:re added with stirring 1.35 g ( > 6.25 mmol) of m-chloro-perbenzoic acid (80-90 % purity). After stirring for 24 hours, the solution was concentrated under redwxd pressure to 10 mL and the precipitate of m-chlorobenzoic acid filtered off, washed with CHZC12 (92 x 5 ml) and then both filtrates evaporated.
The residue was put onto a silic~i gel column (5.3 x 14 cm) and the produce eluted by toluene/AcOEt 5:2. The: product fraction was concentrated to a small volume whereby 66 crystallized out of solution producing 2.4 g (86%) of colorless crystals(m.p. 193°C).
Analysis calculated for (~3~H35NSO11S (757.8): C, 58.65; H, 4.66; N, 9.24.
Found: C, 58.77; H, 4.69; N, 9.3(I.

WO 95/31469 219 0 ~ 8 g PCT/US95/05264 i) 2-Amino-6-methyl-4 p-nitrophenylethoxy-8-(3,5-di-O p-toluoyl-2-deoxy ~f-D-ribofuranosyl) pteridine-7 one (67) While stirring, a solution of 1.89 g (2.5 mmol) of 6-methyl-2-methylsulfonyl-4-p-nitrophenylethoxy-8-(3,5-di-O-p-toluoyl-2-deoxy-B-D-ribofuranosyl)-pteridine-7-one (66) was bubbled with gaseous NH3 for 80 minutes. The solution was then evaporated, twice coevaporated with CHzCl2 and the resulting residue was put onto a silica gel column (5.5 x 8 cm) for chromatography with toluene/AcOEt 5:2.
The product fraction was concentrated to a small volume whereby 67 crystallized out of solution as 1.68 g (97%) of colorless crystals (m.p. 208-209°C).
Analysis calculated for C36H~,N6Og (694.7): C, 62.24; H, 4.93; N, 12.10.
Found: C, 61.98; H, 4.94; N, 12.14.
j) 2 Amino-6-methyl-4 p-nitrophenylethoxy-8-(2-deoxy-/3-D-ribofuranosyl)-pteridine-7 one (68) To a solution of 1.17 g (1.69 mmol) of 2-amino-6-methyl-4-p-nitrophenylethoxy-8-(3,5-di-O-p-toluoyl-2-deoxy-(i-D-ribofuranosyl)-pteridine-7-one(67) in 30 mL of CHZC12 and 60 mL of MeOH was added 0.45 g (3.37 mmol) of sodium thiophenolate. The solution was stirred at room temperature for 16 hours. Then 11 g of flash silica gel was added to the reaction mixture and evaporated under reduced pressure.
The resulting powder was put onto a silica gel column (5.3 x 8.5 cm) previously equilibrated with CHZC12/MeOH mixtures (500 ml of 100:1, 300 ml of 50:1 and 500 ml of 9:1). The product fractions were pooled and evaporated to yield 68 as 0.63 g (81 %) of a microcrystalline powder (m.p. > 220°C decomp.).
Analysis calculated for C2oH22N6O, (458.4): C, 52.40; H, 4.84; N, 18.34.
Found: C, 52.31; H, 4.76; N, 18.22.
k) 2 Amino-6-methyl-8-(2-deoxy-,B D-ribojicranosyl) pteridine-4,7 dione(6-Methyl-8-(2-deoxy-~ D-ribofuranosyl)-iSOxanthopterin (69) To a solution of 0.195 g (0.425 mmol) of 2-amino-6-methyl-4-p-nitrophenyl-ethoxy-8-(2-deoxy-/3-D-ribofuranosyl)-pteridine-7-one (68) in 15 mL of pyridine was added with 1.12 mL (1.14 mmol) of DBU. The solution was stirred for 3 hours at room temperature. The solution was then evaporated under reduced pressure, the residue dissolved in 25 mL of HZO, and washed with CH2Clz (3 x 25 ml). The aqueous phase was neutralized by HCl to pH7 and then concentrated to a small volume kCr . r cry, l:! ~A yLn:vCnl::~ , a l _ _ . ~:-'~.- '~~,-.~~ : 1 : ' 1 . - 4 t G .1~;~ 5U4;)~ +4y9 f3;~ v:39;~14E; , : a 1 1 2195$8 s5 (5 mL). The mixture was placed in the ice-box and 69 precipitated as 0.94 g (71'6) of colorless crystals (m. p . > 300 ° C decomp. ) .
Analysis calculated for C,ZH~sNsOs x 'fiHzO 0318.3): C, 54.28; N, 5.06; N, 22.00.
Found: C, 45.42; H, 4.91; N, 21.86.
S I) 2 Amino-6-methyl-4 p-r~ltropherrylethoxy-8-(5-O-dimethoxytrityl-2-deoxy-a D-ribo, furanosylJ pteridine-7-one .(70) To a solution of 0.57 g (I.22 mmol) of 2-amino-b-methyl-4-p-nitxopheriyl-ethoxy-8-(2~eoxy-~B-Lt-ribofuranosyl)-pteridine-7-one (69) in 15 mL of anhydrous pyridine was added 0..454 g (1..34 mmol) of dimethyloxytrityl chloride. The mixture was stirred for 1.5 hours at room temperature. Then, 5 rnL of I~eOH were added, the solution was stirred for 5 min ;and then diluttd by 100 mL of CHzClz. The resulting solution was washed with 100 mL of saturated NaHC03 solution and twice with Hz0 - (100 mL). The organic layer was dried over Na2SOQ, evaporated and the residue put onto a silica gel column (3 x 15 crn) for chromatography with toluene ! AcOEt 1:1. The product fraction was evaporated to give 70 as 0.5 g (54 ~O ) of a solid foam.
Analysis calculated fo:c Cq~H4pNsOg (760.8): C, 63.14; H, 5.30; N, 11.05.
Found: C, 63 . 06; H, 5. 21; N, 10.91.
m) 2 Amino-methyl-4~p-nitrophenylerho~,y-8-(S-O-dirnethoxytrityl-2-deoxy-~ D-ribofumnosyl) pteridin~e-7-one-3'-O-(~3-cyanoethyl)-N,N diisopropyl phnsphoramidite (71) To a solution of 0.76 g (1 mmol) of 2-amino-6-methyl-p-nitrophenylethoxy-8-(:i-0-dimethoxytrityl-2-deoxy-~B-D-ribofuranosyl)-pteridine-7-one (70) in 15 mL of anhydrous CH2Clz, under argon atmosphere, was added 0.452 g (1.5 mmol) of 2-cyanoethoxy-bis-;N,N-diisopropylamino-phosphane and 35 mg (0.5 mmol) of tetrazole. Tht solution was stirred for 12 hours at room temperature. The mixture was then diluted with 15 mL of CHZCIz and extracted once with 10 mL of a saturated NaHC03 solution and twice with a saturated NaCI solution. The organic layer was dried over NazSO,, evaporated and the residue put onto a silica geZ column for chromatography with toluene / AcOEt 3:2 containing a small amount of triethylamine. The product fraction was collected, evaporated to a yellowish foam which was dissolved in tattlt toluene and added dre~pwise into 10b mI. of n-hexane with stirring to give, after filtration by suction and drying, 71 as 0.865 g (900) of a yellowish powder (m.p. >
150°C
decomp.).
Replacement Page pMEN~ED SHEET

219058~~ 66 Analysis calculated for CsoHs~NeO~oP (960.9): C; 62.'97; H, 5.98; N, 12.32.
Found: C, 62.81; H, 5.88; N, 12.2 0.

General Synthesis of 2'-deoxv-B-D-ribofuranosvl-nteridine-5'-trinhos hates a) triethylammonium pterzdine-2'-deoxyribonucleoside-S'-monophosphate (72) To 15 mI. of trimethyl phosphate is added 6.5 mmoles of the appropriate pteridine-(3-D-2'-deoxyribonucleoside. The mixture is cooled to -6°C
excluding all moisture. The mixture was then stirred and 1.5 mL (16.3 mmole) of POC13 was added dropwise over a period ~~f 5 minutes, after which the mixture is stirred for 2 h at 0°C to obtain a clear solution. To the solution is added 120 mL of 0.5 M
triethylammonium bicarbonate buffer pH 7.5. The solution is stirred for 15 minutes and then evaporated in vacuo. After several coevaporations with methanol, the residue is dissolved in Hz0 and put onto a DEAE-Sephadex column (2.5 x 80 cm; HC03-form). Chromatography is performed using a lineau~ gradient of 0 - 0.3 M triethylammonium bicarbonate buffer pH
7.5 using 8 - 10 Liters of buffer.
The main fraction is eluted at a 0.2 - 0.3 M buffer concentration. This fraction is evaporated in. vacuo apt 30° and then the resulting residue coevaporated several times with methanol. Drying in high vacuum gives solid 72.
b) triethylammonium pteridine-2'-deoxyribonucleoside-S'-triphosphate (73J
The triethylammonium pteridine-2'-deoxyribonucleoside-5'-monophosphate (58) (1 mmole) is coevapoprated three rimes with anhydrous pyridine and then dissolved in 10 mL of anhydrous dimethylformamide (DMF). The solution is stirred overnight after addition of 0.8g (S mmole) of carbonyldimidazole under anhydrous conditions.
Excess carbonyldimidazole is quenched by the adding of 0.33 mL of anhydrous methanol to the solution and stirring for 1 hour. To this solution is added a suspension of 5 mmole of tributylammonium pyrophosphate in 50 mL of anhydrous DMF. The mixture is then stirred continuously for 2:0 hours at room temperature. The resulting precipitate is filtered off, washed v~~ith DMl~ and the filtrate evaporated under high vacuum at 30°C.
The residue is coevapor,~ted several times with methanol and H20, then dissolved in Hz0 and put onto a DEAF-S~~phadex column (2.5 x 80 cm, HC03 form) and eluted with a linear gradient of triethylammonium bicarbonate buffer pH 7.5 using about 10 L. The product is eluted in the 'fractions at a buffer concentration of 0.7M. The fractions are ;~I905gg pooled, evaporated, and then coe:vaporated several times with methanol. The mixture is then dried under high vacuum to give an 73 as an amorphous solid.
c) sodium pteridi~ne-2'-deoxyribonucleoside-S'-triphosphate (74) In 10 mL of anhydrous methanol is dissolved 0.5 mmole of triethylammonium pteridine-2'-dE:oxyribonucleoside-5'-triphosphate (73). The solution is stirred and 1.5 e~;uivalents of a 1 N NaI solution in acetone is slowly added dropwise producing a precipitate of the sodium salt. The suspension is diluted with 100 mL of acetone, stirred for 30 minutes and then the solid is collected by suction through a porcelain funnel. The solid is washed with small portions of acetone and dried under high vacuum to give the 74 which is more stable then the trierthyklammonium salt and can be stored without decomposition.

Synthesis of Oligonucle~o id ontaining Pteridine Derivatives The following oligonucleotides were synthesized on an ABI DNA
synthesizer (model 380B, Applied Biosystems, Foster City, CA):
Oligo 1: 5'- GTN TGG AAA ATC TCT AGC AGT -3' (Sequence LD.
No: 2), Oligo 2: 5'- GTG TNG AAA ATC TCT AGC AGT -3' (Sequence LD.
No:2), Oligo 3: 5'- GTG T13N AAA ATC TCT AGC AGT -3' (Sequence LD.
No: 4), Oligo 4: 5'- GTG T13G AAA ATC TCT ANC AGT -3' (Sequence LD.
No: S), Oligo 5: 5'- GTG TGG AAA ATC TCT AGC ANT -3' (Sequence LD.
No: 6), Oligo 6: 5'- GTG TNG AAA ATC TCT ANC AGT -3' (Sequence LD.
No: 7), Oligo 7: 5'- ACT GCT AGA NAT TTT CCA CAC -3' (Sequence LD.
No:8), Oligo 8: 5'- ACT GCT ANA GAT TTT CCA CAC -3' (Sequence LD.
No: 9), Oligo 9: S'- ACT NCT AGA GAT TTT CCA CAC -3' (Sequence LD.
No: 10) and Oligo 10: 5'- ACT GCT NGA GAT TTT CCA CAC -3' (Sequence LD.
No: 11).
In each oligonucleotide one or more guanosines was replaced by the pteridine deoxyribonucleotide (designated N) of formula XV.
To synthesize the oligonucleotides containing the pteridine nucleotide, the dimethoxytrityl blocked pteridine phosphoramidite was placed in bottle port #
5 on the DNA synthesizer. No changes in synthesis protocol were necessary to achieve incorporation of the pteridine nucleotide.
The oligonucleotides were cleaved from the solid support by treatment with concentrated ammonia, and deprotected by heating the ammonia solution to 55°C
for 8 hours. Samples where then evaporated to dryness in a Speed Vac Concentrator (Savant, Farmingdale, New York, USA). The oligonucleotides were purified by 19:1 20% polyacrylamide gel electrophoresis. Bands were detected by UV shadowing, excised, and eluted into 0.3 M sodium acetate pH 5.2 using a crush and soak method.
Finally, after addition of MgCl2 to achieve a concentration of 0.1 M, samples were precipitated in ethanol.
Fluorescent analysis of the oligonucleotides in TRIS buffer at pH 7.8 revealed the relative quantum yields shown below in Table 1. Fluorescence measurements were made using an excitatory wavelength of 360 nm. Quinine sulfate was used as the standard and measurements were taken on a fluorometer (model 8000, SLM-Aminco, Urbana, Illinois, U.S.A.).

WO 95/31469 219 0 ~ 8 8 PCT/US95/05264 Table 1: Relative quantum yields of oligonucleotides containing pteridine nucleotides substituted for guanosine at various positions.
Relative Sequence Oligonucleotide Quantum EfficiencyID

5'- GTN TGG AAA ATI~ TCT AGC AGT -3' 0.12 - 0.17 2 5'- GTG TNG AAA ATC TCT AGC AGT 0.09 - 0.15 3 -3' 5'- GTG TGN AAA ATC TCT AGC AGT -3' 0.02 - 0.03 4 5'- GTG TGG AAA ATI~ TCT ANC AGT -3' 0.04 - 0.07 5 5'- GTG TGG AAA ATI~ TCT AGC ANT -3' 0.14 6 5'- GTG TNG AAA ATI~ TCT ANC AGT -3' 0.10 7 5'- ACT GCT AGA NA'r TTT C:CA CAC 0.03 - 0.04 8 -3' 5'- ACT GCT ANA GA'r TTT C'.CA CAC 0.02 - 0.03 9 -3' 5'- ACT NCT AGA GA'C TTT C'.CA CAC 0.24 - 0.39 10 -3' 5'- ACT GCT NGA GA'f TTT C:CA CAC -3' 0.23 11 Realtime Detection of In teErasg Activity Utilizing Oligonucleotides Containing Pteridine Derivatives.
The oligonucleotidE: 5'- GTGTGGAAAATCTCTAGCANT -3' (Sequence LD. No: 6) and its complement 5'- ACTGCTAGAGATTTTCCACAC -3' were synthesized according to the method of Example 11. The oligonucleotides were then annealed together by heating there to 85 °C in a 100 mM NaCI solution and allowing the solution to slowly cool to room temperature. This formed the model substrate, a double-stranded DNA molecule:
5'-- GTG 'rGG AAA ATC TCT AGC ANT -3' (Sequence I.D. No: 6) 3'-- CAC ACC TTT TAG AGA TCG TCA -5' (Sequence LD. No: 12) where N represents the pteridine nucleotide.
HIV-1 integrase protein (3.5 pmol per reaction) was produced via an Echerichia coli expression vector, as described by Bushman et al. Science, 249: 1555-1558 (1990). The protein was stored at -70°C in 1 M NaCI/20 mM Hepes, pH 7.6/1 mM EDTA/ 1 mM dithiothreitol/20 % glycerol (wt/vol).
The stock protein (1.44 mg/ml) was first diluted 1:3 in protein storage buffer (1 M NaCI/20 mM Hepes, pH 7.6/1 mM EDTA/1 mM dithiothreitol/20%

219058$ ., (wt/vol) glycerol). Subsequent enzyme dilution was at 1:20 in reaction buffer (25 mM
Mops, pH 7.2/7.5 mM MnCl2/bovine serum albumin at 100 ~cg/ml/10 mM 2-mercaptoethanol). The reaction volume is 60 ~.1. The final reaction mixture contained 50 mM NaCI, 1 mM Hepes, 50 ~cM EDTA and 50 ~cM dithiothreitol, 10 % (wt/vol) glycerol, 7.5 mM MnCl2, 0.1 mg/ml bovine serum albumin, 10 mM 2-mercaptoethanol, and 25 mM MOPS, pH 7.2.
The reaction was initiated by addition of the enzyme and was monitored for 10 to 20 minutes in real time by observing the change in fluorescence intensity using a fluorometer (model 8000, SLM-Aminco, Urbana, Illinois, U.S.A.). The excitation wavelength was 360 nm and the emission wavelength was 460 nm.
The integrase reacted with the model substrate shown above to produce:
5'- GTG TGG AAA ATC TCT AGC A -3' + NT
3'- CAC ACC TTT TAG AGA TCG TCA -5' The fluorescence of the pteridine nucleotide was quenched considerably when it was incorporated into the oligonucleotide (quantum yield of 0.14). The cleavage reaction released this quench resulting in a four-fold increase in the signal (quantum yield of 0.88 for the monomer). Thus the activity of integrase was assayed by measuring the increase in fluorescence.

x,095/31469 X19~5~g - ,,;.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: The United States of America, as represented by The Secretary of the Department of Health and Human Services (B) STREET: 6011 Executive Blvd., Suite 325 (C) CITY: Rockville (D) STATE: :Maryland (E) COUNTRY: U.S.A.
(F) POSTAL CODE (ZIP): 20852 (G) TELEPHONE: (301) 496-7056 (H) TELEFAX: (301) 402-0220 (I) TELEX:
(ii) TITLE OF INVENTION: PTERIDINE NUCLEOTIDE ANALOGS AS
FLUORESCENT DNA PROBES
(iii) NUMBER OF SE~~UENCES: 12 (iv) COMPUTER READABLE FORM:
(A) MEDIUM 'TYPE: Floppy disk (B) COMPUTE:ft: IBM PC compatible (C) OPERATI1NG SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version ,1.25 (v) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/US95/ not yet assigned ( B ) FILING 1DATE:
(C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 08/245,923 ( B ) FILING D~9TE : 18-MAY-1994 (vii) ATTORNEY/AGE1VT INFORMATION:
(A) NAME: M. HENRY HEINES
(B) REGISTRATION NUMBER: 28,219 (C) REFERENCE/DOCICET NUMBER: 15280-183PC
(ix) TELECOMMUNIC~!~TION INFORMATION:
(A) TELEPHO1VE: (415) 543-9600 (B) TELEFAK: (415) 543-5043 ( 2 ) INFORMATION FOR S1EQ ID N~O:1:
( i ) SEQUENCE CHAI~ACTERI,STICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic .acid (C) STRANDE1~NESS: aingle ( D ) TOPOLOG'.i : 1 ine,ar (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTIO1V: SEQ ID NO: l:

WO 95/31469 219 0 ~ 8 8 PCT/US95105264 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(D) OTHER INFORMATION:
N = pteridine nucleotide (xi) SEQUENCE DESCRIPTION: N0:2:
SEQ ID

TCTCTAGCAG
T

(2) INFORMATION
FOR
SEQ
ID
N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(D) OTHER INFORMATION: pteridine nucleotide N =

(xi) SEQUENCE DESCRIPTION: N0:3:
SEQ ID

TCTCTAGCAG
T

(2) INFORMATION
FOR
SEQ
ID
N0:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(D) OTHER INFORMATION: pteridine nucleotide N =

(xi) SEQUENCE DESCRIPTION: N0:4:
SEQ ID

TCTCTAGCAG
T

(2) INFORMATION
FOR
SEQ
ID
N0:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(D) OTHER INFORMATION: pteridine nucleotide N =

(xi) SEQUENCE DESCRIPTION: N0:5:
SEQ ID

TCTCTANCAG
T

WO 95/31469 ' ~ PCT/US95/05264 ( 2 ) INFORMATION FOR :SEQ ID :NO: 6 (1) SEQUENCE CHi~iRACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRAND7:DNESS: single (D) TOPOLOGY: limear (ii) MOLECULE TY7?E: DNA (genomic) (ix) FEATURE:
(D) OTHER :CNFORMA'PION: N = pteridine nucleotide (xi) SEQUENCE DE:aCRIPTION: SEQ ID N0:6:

( 2 ) INFORMATION FOR :iEQ ID 1~T0: 7 ( i ) SEQUENCE CH1,RACTER:CSTICS:
(A) LENGTH:. 21 base pairs (B) TYPE: nucleic acid (C) STRANDF:DNESS: single (D) TOPOLOC:Y: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(D) OTHER 7:NFORMA7CION: N = pteridine nucleotide (xi) SEQUENCE DEaCRIPTION: SEQ ID N0:7:
GTGTNGAAAA TCTCTANCAC~ T 21 (2) INFORMATION FOR S~EQ ID N0:8:
( i ) SEQUENCE CHF~RACTER7:STICS
(A) LENGTH: 21 bas;e pairs (B) TYPE: nucleic acid (C) STRANDE;DNESS: single ( D ) TOPOLOGY : 1 ine:ar (ii) MOLECULE TYF~E: DNA (genomic) (ix) FEATURE:
(D) OTHER INFORMA7'ION: N = pteridine nucleotide (xi) SEQUENCE DESCRIPTIC1N: SEQ ID N0:8:
ACTGCTAGAN ATTTTCCACA. C 21 (2) INFORMATION FOR SEQ ID hf0:9:
(i) SEQUENCE CHARACTERLSTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(D) OTHER INFORMATION: N = pteridine nucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:

WO 95/31469 219 0 ~ 8 8 PCTIUS95/05264 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(D) OTHER INFORMATION: N = pteridine nucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(D) OTHER INFORMATION: N = pteridine nucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

(2) INFORMATION FOR SEQ ID N0:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:12:

Claims (105)

WHAT IS CLAIMED IS:

1. A compound having the formula shown below, with ring vertices 1 through 8 as shown:
in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4, or with R13 to form a double bond between ring vertices 3 and 4;
R12 when not combined with R11 is a member selected from the group consisting of NH2, and NH2 either mono- or disubstituted with a protecting group;
R13 when not combined with R11 is lower alkyl or H;
R14 is a member selected from the group consisting of H, lower alkyl and phenyl;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2, or with R17 to form a double bond between ring vertices 1 and 2, such that ring vertices 2 and 4 collectively bear at most one oxo oxygen;
R16 when not combined with R15 is a member selected from the group consisting of H, phenyl, NH2, and NH2 mono- or disubstituted with a protecting group;
when R15 is not combined with R16, R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7;

when R15 is combined with R16, R18 is combined with R20 to form a double bond between ring vertices 7 and 8, and R19 is a member selected from the group consisting of H and lower alkyl; and R17 when not combined with R15, and R20 when not combined with R18, are in which:
R21 is a member selected from the group consisting of H, a triphosphate, and protecting groups;
R22 is a member selected from the group consisting of H, OH and OH substituted with a protecting group; and R23 is a member selected from the group consisting of H, a phosphoramidite, an H-phosphonate, a methyl phosphonate, a phosphorothioate, a phosphotriester, a hemisuccinate, a hemisuccinate covalently bound to a solid support, a dicyclohexylcarbodiimide, and a dicyclohexylcarbodiimide covalently bound to a solid support;
when R13 is H and R23 is H, R21 is a triphosphate; and when R11 is combined with R13 to form a double bond between ring vertices 3 and 4 and R23 is H, R21 is a triphosphate.

2. A compound in accordance with claim 1 in which R14 is a member selected from the group consisting of H, CH3 and phenyl.

3. A compound in accordance with claim 1 in which R14 is a member selected from the group consisting of H and CH3.

4. A compound in accordance with claim 1 in which R16, when not combined with R15, is a member selected from the group consisting of H, phenyl, NH2, and NH2 disubstituted with a protecting group.

5. A compound in accordance with claim 1 in which R16, when not combined with R15, is a member selected from the group consisting of H and phenyl.

6. A compound in accordance with claim 1 in which, when R18 is combined with R20, R19 is a member selected from the group consisting of H and CH3.

7. A compound in accordance with claim 1 in which R14 is a member selected from the group consisting of H, CH3 and phenyl; R16, when not combined with R15, is a member selected from the group consisting of H, phenyl and NH2; and, when R18 is combined with R20, R19 is a member selected from the group consisting of H and CH3.

8. A compound in accordance with claim 1 in which R12 is NH2 either mono- or disubstituted by a protecting group selected from the group consisting of benzoyl, isobutyryl, phthaloyl, di-n-butylaminomethylidene, dimethylaminomethylidene, and p-nitrophenylethoxycarbonyl.

9. A compound in accordance with claim 1 in which R12 is NH2 monosubstituted by a protecting group selected from the group consisting of di-n-butylaminomethylidene, p-nitrophenylethoxycarbonyl, and dimethylaminomethylidene.

10. A compound in accordance with claim 1 in which R16 is NH2 either mono- or disubstituted by a protecting group selected from the group consisting of benzoyl, isobutyryl, phthaloyl, di-n-butylaminomethylidene, dimethylaminomethylidene, and p-nitrophenylethoxycarbonyl.

11. A compound in accordance with claim 1 in which R16 is NH2 monosubstituted by a protecting group selected from the group consisting of di-n-butylaminomethylidene, p-nitrophenylethoxycarbonyl, and dimethylaminomethylidene.

12. A compound in accordance with claim 1 in which R21 is a member selected from the group consisting of H, trityl, monomethoxytrityl, dimethoxytrityl, phthaloyl, di-n-butylaminomethylene, and dimethylaminomethylidene.

13. A compound in accordance with claim 1 in which R21 is a member selected from the group consisting of dimethoxytrityl, di-n-butylaminomethylene, and dimethylaminomethylidene.

14. A compound in accordance with claim 1 in which R22 is a member selected from the group consisting of H, OH and OH substituted with a member selected from the group consisting of trityl, monomethoxytrityl, dimethoxytrityl, tetrahydropyran-1-y1, 4-methoxytetrahydropyran-4-yl, 1-(2-chloro-4-methyl)phenyl-4-methoxypiperidin-4-yl, t-butyldimethylsilyl, p-nitrophenylethylsulfonyl, tetrahydropyranyl, 4- methoxytetrahydropyranyl, 2-nitrobenzyl, 9-phenylxanthen-9-yl and p-nitrophenylethyl.

15. A compound in accordance with claim 1 in which R22 is a member selected from the group consisting of H and OH substituted with a member selected from the group consisting of dimethoxytrityl, tetrahydropyran-1-yl, t-butyldimethylsilyl, 2-nitrobenzyl, and p-nitrophenylethyl.

16. A compound in accordance with claim 1 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is selected from the group consisting of NH2, and NH2 mono- or disubstituted with a protecting group;;
R14 is H;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is phenyl;

R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

17. A compound in accordance with claim 1 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is selected from the group consisting of NH2, and NH2 mono- or disubstituted with a protecting group;
R14 is phenyl;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is H;
R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

18. A compound in accordance with claim 1 in which:

R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4;
R13 is CH3;
R14 is H;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is NH2;
R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

19. A compound in accordance with claim 1 in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4;
R13 is H;
R14 is H;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is selected from the group consisting of NH2 and NH2 mono- or disubstituted with a protecting group;
R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

20. A compound in accordance with claim 1 in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4;
R13 is H;
R14 is CH3.
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is selected from the group consisting of NH2 and NH2 mono- or disubstituted with a protecting group;
R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

21. A compound in accordance with claim 1 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is selected from the group consisting of NH2 and NH2 mono- or di-substituted with a protecting group;
R14 is CH3;

R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;
R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is CH3.

22. A compound in accordance with claim 1 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is selected from the group consisting of NH2 and NH2 mono- or di-substituted with a protecting group;;
R14 is H;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;
R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is CH3.

23. A compound in accordance with claim 1 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is selected from the group consisting of NH2 and NH2 mono- or di-substituted with a protecting group;
R14 is CH3;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;
R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is H.

24. A compound in accordance with claim 1 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is selected from the group consisting of NH2 and NH2 mono- or di-substituted with a protecting group;
R14 is H;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;
R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is H.

25. A compound in accordance with claim 16 in which R12 is NH2.

26. A compound in accordance with claim 16 in which:
R12 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

27. A compound in accordance with claim 26 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

28. A compound in accordance with claim 27 in which:
R12 is dimethylaminomethylenamino.

29. A compound in accordance with claim 26 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

30. A compound in accordance with claim 29 in which:
R12 is dimethylaminomethylenamino.

31. A compound in accordance with claim 17 in which R12 is NH2.

32. A compound in accordance with claim 17 in which:
R12 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

33. A compound in accordance with claim 32 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

34. A compound in accordance with claim 33 in which R12 is dimethylaminomethylenamino.

35. A compound in accordance with claim 32 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

36. A compound in accordance with claim 35 in which R12 is dimethylaminomethylenamino.

37. A compound in accordance with claim 18 in which R23 is a member selected from the group consisting of H, H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

38. A compound in accordance with claim 37 in which:
R21 is H;
R22 is H; and R23 is H.

39. A compound in accordance with claim 37 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

40. A compound in accordance with claim 37 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

41. A compound in accordance with claim 19 in which R16 is NH2.

42. A compound in accordance with claim 19 in which:
R16 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

43. A compound in accordance with claim 42 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

44. A compound in accordance with claim 43 in which R16 is dimethylaminomethylenamino.

45. A compound in accordance with claim 42 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

46. A compound in accordance with claim 45 in which R16 is dimethylaminomethylenamino.

47. A compound in accordance with claim 20 in which R16 is NH2.

48. A compound in accordance with claim 20 in which:
R16 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

49. A compound in accordance with claim 48 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

50. A compound in accordance with claim 49 in which R1~ is dimethylaminomethylenamino.

51. A compound in accordance with claim 48 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

52. A compound in accordance with claim 51 in which R16 is dimethylaminomethylenamino.

53. A compound in accordance with claim 21 in which R12 is NH2.

54. A compound in accordance with claim 21 in which:
R12 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

55. A compound in accordance with claim 54 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl-N,N-diisopropyl phosphoramidite.

56. A compound in accordance with claim 55 in which R12 is NH2 mono- or disubstituted with a p-nitrophenylethoxycarbonyl.

57. A compound in accordance with claim 54 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

58. A compound in accordance with claim 57 in which R12 is NH2 mono- or disubstituted with a p-nitrophenylethoxycarbonyl.

59. A compound in accordance with claim 22 in which R12 is NH2.

60. A compound in accordance with claim 22 in which:
R12 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

61. A compound in accordance with claim 60 in which:
R23 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

62. A compound in accordance with claim 61 in which R12 is NH2 mono- or disubstituted with a p-nitrophenylethoxycarbonyl.

63. A compound in accordance with claim 60 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

64. A compound in accordance with claim 63 in which R12 is p-nitrophenylethoxycarbonyl.

65. A compound in accordance with claim 23 in which R12 is NH2.

66. A compound in accordance with claim 23 in which:
R12 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

67. A compound in accordance with claim 66 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a (.beta.-cyanoethyl)-N,N-diisopropyl phosphoramidite.

68. A compound in accordance with claim 67 in which R12 is NH2 mono- or disubstituted with a p-nitrophenylethoxycarbonyl.

69. A compound in accordance with claim 66 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

70. A compound in accordance with claim 69 in which R12 is an NH2 mono- or disubstituted with a p-nitrophenylethoxycarbonyl.

71. A compound in accordance with claim 24 in which R12 is NH2.

72. A compound in accordance with claim 24 in which:
R12 is NH2 mono- or di-substituted with a protecting group; and R23 is a member selected from the group consisting of H-phosphonate, phosphoramidite, hemisuccinate, and hemisuccinate covalently bound to a solid support.

73. A compound in accordance with claim 72 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a .beta.-cyanoethyl, N-diisopropyl phosphoramidite.

74. A compound in accordance with claim 73 in which:
R12 is p-nitrophenylethoxycarbonyl.

75. A compound in accordance with claim 72 in which:
R21 is dimethoxytrityl;
R22 is H; and R23 is a hemisuccinate covalently bound to controlled pore glass.

76. A compound in accordance with claim 75 in which:
R12 is p-nitrophenylethoxycarbonyl.

77. A compound in accordance with claim 16 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

78. A compound in accordance with claim 17 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

79. A compound in accordance with claim 18 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

80. A compound in accordance with claim 19 in which:
R21 is a triphosphate;

R22 is H; and R23 is H.

81. A compound in accordance with claim 20 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

82. A compound in accordance with claim 21 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

83. A compound in accordance with claim 22 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

84. A compound in accordance with claim 23 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

85. A compound in accordance with claim 24 in which:
R21 is a triphosphate;
R22 is H; and R23 is H.

86. An oligonucleotide comprising one or more nucleotide monomers which are pteridine derivatives having the formula shown below, with ring vertices 1 through 8 as shown:

in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4, or with R13 to form a double bond between ring vertices 3 and 4;
R12 when not combined with R11 is NH2.
R13 when not combined with R11 is lower alkyl or H;
R14 is a member selected from the group consisting of H, lower alkyl and phenyl;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2, or with R17 to form a double bond between ring vertices 1 and 2, such that ring vertices 2 and 4 collectively bear at most one oxo oxygen;
R16 when not combined with R15 is a member selected from the group consisting of H, phenyl, and NH2;
when R15 is not combined with R16, R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7;
when R15 is combined with R16, R18 is combined with R20 to form a double bond between ring vertices 7 and 8, and R19 is a member selected from the group consisting of H and lower alkyl; and R17 when not combined with R15, and R20 when not combined with R18, are in which R22 is a member selected from the group consisting of H and OH.

87. An oligonucleotide in accordance with claim 86 in which R14 is a member selected from the group consisting of H, CH3 and phenyl.

88. An oligonucleotide in accordance with claim 86 in which R14 is a member selected from the group consisting of H and CH3.

89. An oligonucleotide in accordance with claim 86 in which R16, when not combined with R15, is a member selected from the group consisting of H, phenyl and NH2.

90. An oligonucleotide in accordance with claim 86 in which R16, when not combined with R14, is a member selected from the group consisting of H and phenyl.

91. An oligonucleotide in accordance with claim 86 in which, when R18, is combined with R20, R19 is a member selected from the group consisting of H and CH3.

92. An oligonucleotide in accordance with claim 86 in which R14 is a member selected from the group consisting of H, CH3 and phenyl; R16 is a member selected from the group consisting of H, Phenyl and NH2; and, when R18 is combined with R20, R19 is a member selected from the group consisting of H and CH3.

93. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is NH2;
R14 is H;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is phenyl;
R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

94. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is NH2;
R14 is phenyl;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is H;
R11 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

95. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4;
R13 is CH3;
R14 is H;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is NH2;
R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

96. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4;
R13 is H;
R14 is H.
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is NH2;
R11 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

97. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4;
R13 is H;
R14 is CH3;
R15 is combined with R17 to form a double bond between ring vertices 1 and 2;
R16 is NH2;

R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is

98. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is NH2;
R14 is CH3;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;
R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is CH3.

99. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is NH2;
R14 is H;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;

R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is CH3.

100. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is NH2;
R14 is CH3;
R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;
R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is H.

101. An oligonucleotide in accordance with claim 86 in which:
R11 is combined with R13 to form a double bond between ring vertices 3 and 4;
R12 is NH2;
R14 is H;

R15 is combined with R16 to form a single oxo oxygen joined by a double bond to ring vertex 2;

R17 is R18 is combined with R20 to form a double bond between ring vertices 7 and 8;
and R19 is H.

102. An oligonucleotide in accordance with claim 86 in which said nucleotide monomers are at the 3' end of said oligonucleotide.

103. An oligonucleotide in accordance with claim 86 in which said nucleotide monomers are at the 5' end of said oligonucleotide.

104. An oligonucleotide in accordance with claim 86 in which said nucleotide monomers are surrounded by 1 to 10 pyrimidine monomers.

105. An oligonucleotide in accordance with claim 86 selected from the group consisting of:

5'- GTN TGG AAA ATC TCT AGC AGT -3' (Sequence I.D. No:2), 2), 5'- GTG TNG AAA ATC TCT AGC AGT -3' (Sequence I.D. No:3), 5'- GTG TGN AAA ATC TCT AGC AGT -3' (Sequence I.D. No:4), 5'- GTG TGG AAA ATC TCT ANC AGT -3' (Sequence I.D. No:5), 5'- GTG TGG AAA ATC TCT AGC ANT -3' (Sequence I.D. No:6), -3' 6), 5'- GTG TNG AAA ATC TCT ANC AGT -3' (Sequence I.D. No:7), 5'- ACT GCT AGA NAT TTT CCA CAC -3' (Sequence I.D. No:8), 5'- ACT GCT ANA GAT TTT CCA CAC -3' (Sequence I.D. No:9), 5'- ACT NCT AGA GAT TTT CCA CAC -3' (Sequence I.D. No:10), 5'- ACT GCT NGA GAT TTT CCA CAC -3' (Sequence I.D. No: 11), wherein A is an adenosine nucleotide, C is a cytosine nucleotide, G is a guanosine nucleotide, T is a thymidine nucleotide, and N is a pteridine nucleotide in which R11 is combined with R12 to form a single oxo oxygen joined by a double bond to ring vertex 4; R13 is CH3 or H; R14 is H or a methyl group; R15 is combined with R17 to form a double bond between zing vertices 1 and 2; R16 is NH2; R18 is combined with R19 to form a single oxo oxygen joined by a double bond to ring vertex 7; and R20 is in which R22is H.