CA2191240A1

CA2191240A1 - Dna optical storage

Info

Publication number: CA2191240A1
Application number: CA002191240A
Authority: CA
Inventors: Michael J. Heller; Eugene Tu
Original assignee: Individual
Current assignee: Nanogen Inc
Priority date: 1994-06-10
Filing date: 1995-06-07
Publication date: 1995-12-21
Also published as: US6385080B1; JP4026847B2; EP0764322A4; WO1995034890A1; EP0764322A1; JPH10504925A; US5787032A; US5835404A; US6067246A

Abstract

A DNA optical memory consists of a planar disk (140) rotatable around an axis (142); a plurality of read portals (144) disposed on the planar disk containing chromophoric memory units (CMU) each comprises a donor, an acceptor, and a quencher which permit non-radiative energy transfer; a near-field detector (145) proximate to the read portals; a positioning unit (148); a laser source (150); a dichroic mirror (152); and a read detector (154). To write to the CMU, the quencher is rendered inactive, preferably with ultraviolet light illumination.
To read the CMU, the read portals are illuminated through the near-field detector via the dichroic mirror. The emitted read illumination is passed through the near-field detector and the dichroic mirror to the read detector.

Description

WO 95/34890 P~1/lJ.. ,~. 'S,, 2 ~ 9 ~ 240 DESCRIPTION = =
DNA OPTICAL STORAGE
Field of the Invention This invention relates to information storage devic-5 es. More particularly, it relates to the use of syntheticDNA polymers for information storage in memory, most particularly secondary optical storage mass memory.
Backr~round of the Invention ~Iistorically, data processing engines have been 10 physically and conceptually separated from the memory which stores the data and program ~q. As processor speed has increased over time, there has been a rr/ntinllrus press for larger memories and faster access. Recent advances in processor speed have caused system bottlenecks 15 in access to memory. This restriction is critical because delays in obtaining instructions or data may cause signif-icant processor wait time, resulting in loss of valuable processing time.
Various approaches have been taken to solve these 20 concerns. Generally, the solutions include using various types of memory which have dif f erent attributes . For example, it is common to use a relatively small amount of fast, and typically expensive, memory directly associated with the processor units, typically called cache memory.
25 Additionally, larger capacity, but generally slower, memory such as DRAM or SRAM is associated with the CPU.
This int~rm~l; Ate memory is often large enough for a small number of current applications, but not large enough to ho~ld all system LJL~JyLal.l.. and data. Mass storage memory, 30 which is ordinary very large, but relatively inexpensive, is relatively slow. While advances have been continually made in improving the size and speed of all types of memory, and generally reducing the cost per bit of memory, there remains a substantial need especially to serve yet 35 faster processors.

WO 9s/34890 2 1 9 1 2 4 r~
For the last 20 years most mass ~torage devices have utili7ed a rotating memory medium. Magnetic media have been used for both "floppy" (~lexible) disks or "hard~
disk drives. Information is stored by the presence or 5 absence of magnetization at defined physical locations on the disk. Ordinarily, magnetic media are "read-write~
memories in that the memory may be both written to and read from by the system. Data is written to or read from the disk by heads placed close to the surface of the disk.
A more recent dev~o~ L t in rotating mass storage media are the optical media. Compact disks are read only memory in which the presence. or absence of physical deformations in the disk indicates the data. The informa-tion is read by use of a focused laser beam, in which the 15 change in reflectance properties from the disk indicate the data states. Also in the optical realm are various optical memories which utilize magneto optic properties in the writing and reading of data. These disks are both read only, write once read many ("WORM") drives and 20 multiple read-wrlte memories. Generally, optical media have proved to have a larger storage capacity, but higher costs per bit and limited write ability, as compared with magnetic media.
Several proposals have been made for using polymers 25 for electronic based molecular memories. For example, Hopfield, J.J., Onuchic, J.N. and Beratan, D.~., "A
Molecular Shift Register", Science, 241, p. 817, 1988, discloses a polymer based shift register memory which incorporates charge transfer groups. Other workers have 30 proposed an electronic based DNA memory (see Robinson et al, "The Design of a Biochip: A Self-As~ ;ng Molecular-Scale Memory Device", Protein Enq;n~erinq, 1:295-300 (1987) ) . In this case, DNA is used with electron conduct-ing polymers for~a= molecular memory device. Both concepts 3 5 f or these molecular electronic memories do not provide a viable mechanism for inputting data (write) and for outputting data ~read).

W0 95/34890 E~ 5~
21 9~ 24~
Molecular electronic memories have been particularly disappointing in their practical re6ults. While proposals have been made, and minimal existence proofs performed, generally these systems have not been converted to commercial reality. Further, a specific deficiency of the system described above is that a sequential memory is typically subst~nt;~lly slower than a random access memory f or use in most systems .
The optical memories described above suffer from the particular problem of requiring use of optical systems which are diffraction limited. This imposes size restric-tions upon the minimum size of a data bit, thereby limit-ing memory density. This is an inherent limit in systems which store a single bit of data at a given physical memory location.
Further, in all optical memory systems described above, the information is stored on a bit-by-bit basis, such that only a single bit of data is obtained by access-ing a giving physical location in memory. ~hile word-wide memory access systems do exist, generally they store but a single bit of information at a given location, thereby requiring substantially the same amount of physical memory space whether accessed in a bit manner or word-wide manner .
While systems have generally increased in speed and storage density, and decreased in cost per bit, there remains a clear gap at present between processor speed and system requirements. See generally, "New Memory Architec-tures to soost Performance", Tom R. E~alfhill, Byte, July, 1993, pp 86 and 87. Despite the general desirability of memories which are faster, denser and cheaper per bit, and the specific critical need for mass memory which can meet the demands of modern day processor systems speed, no completely satisfactory solution has been advanced hereto-fore. The fl~n~A~Pnt~l limitations on the currently existing paradigms cannot be overcome by evolutionary W0 9s/34890 2 1 9 1 2 4 0 P~
.

Pnhiqnccr~ntq in those systems. This invention con6titutes a new memory paradigm.
Summarv of the Invention Synthetic DNA polymers are used as an optical storage 5 media for memory.- In the preferred ' - '; --t, a three-dimensional memory is formed having three spatial dimen-aions . Multiple ~= bit information is read as different color wavelengths of light emitted through diffraction limited optical portals on the surface of the media.
Structurally, a planar substrate (x-y dimension) has multiple, physically separate read portals or read loca-tions disposed upon its surface. In the preferred embodi-ment, the substrate is disk shaped and the read portals are arranged in radial tracks or on a decreasing radius spiral around the center of the substrate. The read portal is that area which will be ;ll~lm;n~ted by a read illumination source to provide output from the memory.
The read portal cnnt~;nq within it one or more DNA
chromophoric memory units . In the pref erred erbodiment, each DNA cl~ hnric memory unit is composed of a DNA
template, onto which are attached donor and acceptor units. Functinn~l; 7efl DNA polymers have various arrange-ments of cll~ nric donors, chromophoric acceptors and ~uenchers. The quenchers are associated with the donor and/or the acceptor. The f~lnctinn~l ized DNA polymers cont~;n;ng the donor/acceptor/~lPn~-hpr groups are arranged on the planar surface of the media so as to project into the z-spatial .1; q; nn . The chromophoric memory unit is attached to the substrate.
To write~ to the memory, the response properties of the chromophoric memory unit are changed. In the pre-ferred Pmhntl; -t, a photochemical reaction destroys or inactivates the s~uencher. A write source serves as the illumination source for the photochemical reaction. In the preferred embodiment, the ~uencher may be inactivated by light, most preferably W light, and is formed with WO95/34890 21 ~ ~ 24 0 r~
.

photocleavable linkers, or by derivitization of chromophore molecules with photoactive groups. Thus, the basic memory information is determined by whether the quencher is active or not.
To read from the memory, preferably a single wave-length light i8 used to illuminate the read portal. A
read illumination source illllm;nAt~R the read portal, including the various chromophoric memory units rrnt~inA~
within the portal, providing excitation illumination to the donor units in the chromophoric memory units. If the quencher is not active, the chromophoric memory unit, via the acceptor, radiates to the read detector. However, if the quencher is active, no output occurs. In this way, all chromophoric memory units in a read portal may be simultaneously probed. If multiple chromophoric memory units having various output wavelengths or other detect-able parameters are included within a read portal, a multiple bit or word-wide output may be obtained from a diffraction limited read portal.
In the preferred embodiment, the chromophoric memory unit utiiizes energy transfer between the donor and acceptor, via the Forster energy transfer mc~rh;ln;~
Forster energy transfer is a non-radiative energy transfer -n-h-n; P- which utilizes dipole-dipole coupling. The energy transfer m~rhzln; Rm allows a single wavelength of light to excite all acceptor chromophores.
In one embodiment, multiple write wavelengths are used to selectively activate or deactivate separate wavelength sensitive quenchers. If multiple wavelength sensitive quenchers are utilized, the various chromophoric memory units located within a given read portal may have various chromophoric responses. Multiple write wave-lengths may then be selectively used to activate or inactivate quenchers. Upon illumination from the read 35 illumination source, those chromophoric memory units whose output is not quenched will provide multiple wavelength output to the read detector. However, those chromophoric wt~ 9~34890 r~

memory units whose output is quenched will not provide output .
In another l~mho~;r-nt, the read or optical portal is further spatially subdivided (x-y dimension) into multiple write sublocations. Each write sublocation is written to separately from the other write sublocations in a read portal . In the pref erred embodiment, a given write sublocation contains chromophoric memory units whose primary output wavelength i~ spectrally resolvable as compared to the output from other write sublocations. By writing separately to the individual write sublocations, a single quencher material may be used for multiple read wavelengths .
In another aspect of this invention, the output of the read wavele~gth irom the write sublocation may be varied. In the preferred e~bodiment, small wavelength shift 6ubstrates, various intensity states and/or polar-ization states may be affected by the use of multiple ~uenchers activated by different write wavelengths. By way of example, uf;l;~;n~ a read portal of approximately 1 micron' 16 separate write sublocations may be formed.
Utilizing separate ~ pllnric acceptors for each of the write sublocations results in a 16 bit wide word output from the read portal. IJt;l;z;n~ one of the variations of wavelength shif t substrates, intensity states and/or polarization states can directly produce a 64 bit wide word from a single sub-micron sized or diffraction limited read portal.
Accordingly, it is an object of this invention to 3 0 provide an improYed mass storage system .
It is yet a further object of this invention to provide a mass storage system with word-wide data output from a single potentially diffraction limited read loca-tion .
It is yet a further object of this invention to increase the planar surface storage density and capacity of memory.

W095/3489~1 219~240 ~-"''~-; ' It is an object of this invention to provide a memory having an increased data transf er rate .
It is yet a further object of this invention to provide a nanoscale storage location for memory applica-tions.
It is a object of this invention to utilize functionalized synthetic DNA polymers for non-biological applications .
It is yet a further object of this invention to provide a write once read many (WORM) disk drive.
It is yet a further object of this invention ~ to utilize synthetic DNA polymers as a memory material.
It is yet a further object of this invention to utilize synthetic DNA polymers as a nanofabrication material.
Brief Descri~tion of the Drawinqs Figs. la and lb show a perspective view of a schamatic the DNA optical storage system.
Fig. 2 shows a perspective, stylized view of the 2 0 optical memory .
Fig. 3 shows a schematic version of a nonhybridized donor and acceptor adjacent a DNA ba~kh~n~
Fig. 4 shows a schematic version of hybridized DNA
with basic Forster energy transfer.
Fig. 5 shows the basic photo-write operation.
Fig. 6 shows the hybridized DNA with energy transfer quenched .
Fig. 7 shows a schematic overview of the operation, in Fig. 7a showing an off state, in Fig. 7b the photowrite - 3 0 process, and in Fig . 7c the read step .
Fig. 8a-c show the write mechanism in schematic detail .
Fig. 9 shows the read mechanism in schematic detail.
Fig. lOa and lOb show the organization on unique and repetitive sequences.

wo g5,34890 2 1 9 1 2 4 0 Pl:l/ll.. r'l~l 93~
~ig. 11 showe multi~le write æublocations within a read portal.
Fig. 12 shows various write sublocations having 6econdary variations.
Fig. 13a and 13b show an organized DNA photonics structure.
Fig. 14 showæ a perspective view of the read detector system .
Fig. 15 shows a perspective view of the write device.
Fig. 16 shows multi-wavelength spectra for variou6 acceptor units.
Fig. 17 shows an Pnh~nrPrl DNA polymer map.
Fig. 18 shows the DNA attachment chelrLiætry cycle.
Detailed De6cri~tion of the Drawinqs Fig. 1 shows a perspective view of a portion of the optical memory in accordance with this invention. A
substrate 10 ;nr~ flP~ at least a first planar face 12 on which multiple read portals 14 may be located. An arbi-trary x-y-z coordinate system is shown, where the x-y plane is parallel to the planar face 12 of the substrate 10, and the z-axis is perpendicular to the planar face 12.
The sub6trate is preferably in the form of a round platter or platten. In the preferred embodiment, the substrate 10 is adapted to be~ rotated about a central axis of rotation 18. The read portals 14 are those physically defined locations i~l which various chromophoric memory units 16 are located. The read portal 14 may be formed in any geometric shape desired, such as a circle, oval, square or rectangle. Generally, the shape of the read portal 14 is based upon ease o~ manufacture and the ability to write to and read from a given read portal 14. A~ desired, the read portal 14 may be formed directly on the substrate 12, or alternatively, may be formed in a well or lowered region beneath the planar surface 12 or on a locally W095/34890 2~q~240 r~ c;.j~
raised surface. In the preferred Gmhr~ Gnt / each read portal 14 would be on the order of 1 micron wide.
The read portals 14 contain multiple chromophoric memory units 16. Each chromophoric memory unit contains 5 at least a donor, an acceptor, and, at some time during its existence, an associated quencher. The linear syn-thetic DNA polymers which compose the chromophoric memory unit are preferably arranged in the z-dimension, relative to the planar (x-y) surface.
The chromophoric memory unit 16 is taken to be the basic memory element of the system. A given read portal 14 may contain multiple identical chromophoric memory units 16, the structure of Fig. 1 showing a single chromophoric memory unit for simplicity. The chromophoric memory unit 16 operates as a memory, that is, to indicate the state of information, based upon the presence or absence of effective qllGn~-h;n~. When a auencher is active in conjunction with a donor and/or acceptor of a given chromophoric memory unit 16, such unit would not emit radiation from the acceptor under illumination of the donor. If no effective q~ nrhin~ occurs, the acceptor will reradiate energy received by the donor and trans-ferred to it through a non-radiative transfer process.
Thus, the absence of a quencher may be considered to be a "1" and the presence of a ~uencher ~nnR;~1Pred to be a data bit ~ 0 ~ . Of course, the convention of " 1 " and " 0 " may be reversed. While a digital scenario is presented, the chromophoric memory units could also be designed to emit in an "analog" fashion, such as intensity or flux levels.
The operation of the memory system in a simple embodiment is shown in Fig. la and lb. This illustrates a memory in which each read portal 14 5r)nt~1nR two dis-tinct chromophoric memory units 16. These two units are distinct in that they have a detectable dif f erence in their output, such as spectrally resolvable wavelengths, intensity differences or polarization states. In the preferred embodiment, each chromophoric memory unit will Wo 9~/34890 2 1 9 1 2 4 3 r~ ."
.

provide a spectrally resolvable different wavelength as an output. Further, each chromophoric memory unit 16 is either quenched ~designated ~rQ~ ) or not quenched (desig-nated "NQ"). This qn~n~-h;n~ state is set during the write 5 operation, which is illustrated in connection with Figures 5, 7, 8 and 15.
In the read operation, as the substrate 10 rotates around its axis of revolution 18, a f irst read portal 14 would be illllm;n~ted by light 20 from a read ;llllm;n~tion 10 source . The read ; 11 llm; n~tion or beam can be applied through the detector device via a dichroic mirror or from an illllm;n~;nn source below the planar surface of the media. In both cases, the read beam impinges the media from the z-direction. In the drawing of Fig. la, the 15 right hand complete optical portal 14 is illuminated by light 20, and provides output at Al to a detector 22.
Since chromophoric memory unit 16 (labelled CMUl) is not quenched, the read illl-m;n~t;nn 20 causes PmiR~;nn to the detector 22 at wavelength Al. However, since the 20 chromophoric memory unit 16 (labelled CMU2) is quenched, the read ;111 n~tion 20 does not result in output at A2.
Fig. lb shows the system of Fig. la when the substrate 10 has rotated such that the next read portal 14 is illumi-nated by the read ; 1 1 ~lm; n~tion 20 . Since C~ , hnric 25 memory unit 16 labelled CMUl is quenched, no output occurs at Al. However, since chromophoric memory unit 16 (la-belled CMU2) is not quenched, read illumination 20 causes output at wavelength A2 to detector 22.
~l~r~n~l;n~ the examples of Flgs. la and lb, if the 3C chromophoric memory units 16 had units CMUl and C~IU2 which were quenched, there would be no output at either Al or ;~2.
Conversely, if both chromophoric memory units 16 labelled CMUl and CMU2 were not quenched, there would be output from the optical portal 14 upon read illumination 20 at 35 both wavelength )~1 and A2-In its simplest Pmho~;mPnt~ each read portal 14 couldcontain but a single type of chromophoric memory unit.

w095/34890 2 ~ 9 ~ 24~ ~"~ S
.

Information would be stored based upon the q~ nl-h;n~ or absence of quenching in the chromophoric memory unit 16.
Each read portal 14 would hold a single bit of informa-tion. In the more preferred embodiment, the read portal 5 14 cflnt~ multiple chromophoric memory units 16 which provide resolvable output information. In this way, read illumination 20 on a single read portal 14 can produce a multibit word read. An effective 3-dimensional physical memory is thus formed, two dimensions being formed by the 10 planar (x-y) dimensions of the read portal 14 and one dimension (z) being formed by arrangement of the chromophores in the DNA polymers, where information is output as multiple wavelengths. Parallel data access results in an effectively 4-dimensional memory.
One advantage of such structure is the increase in density of the memory. If the dimension of the optical read illumination 20 is constrained to be a certain size, such as a minimum size imposed by diffraction limits, the ability to provide resolvable data in the wavelength 20 variable greatly increases the physical storage capacity of the memory. The type of memory described in connection with Fig. 1 is generally of the type which is write once, read many or "WORM" drives.
Fig. 2 shows a perspective, stylized view of the 25 optical memory. The substrate 10 has multiple optical portals 14 disposed upon its surface 12. The optical memory would include many other such optical portals 14, but the number is reduced here for simplicity. The condition of the portals 14 in Fig. 2 is schematic in that 3 0 each portal 14 is shown outputting read illumination .
This ordinarily would occur only from a single optica portal 14 at a given time under action of the read illumi-nation. The right most read portal 14 shows five separate output radiations 24. The r~sm:l;n;"~ optical portal 14 35 viewed from right to left respectively show output of 3, 5, 2, 1 and 2 wavelengths 24. The output wavelengths 24 are intended to indicate output f rom chromophoric memory WO gS/34890 I~ 933 21 91 240 ~

units which do not have their outputs quenched at these various output wavelengths 24. Additionally, Fig. 2 shows output wavelength 24 at varying heights intended to indicate intensity. The intensity of the output wave-length 24 is correlated with the amount of chromophoric memory units at a given wavelength which are not quenched.
Fig. 3 6hows a ~ tic view of self-organized building blocks. Here, a chromophore donor 30 and accep-tor 32 have not hybridized with the template sequence 34.
Thus, even when subject to read illumination 20, no energy transfer occurs between the donor 30 and acceptor 32. The base sequences shown are illustrative only of the concept, and are not actual intended sequences.
Fig. 4 shows a hybridized structure in which the donor 4 0 and acceptor 42 are hybridized with the template 44. In this aLLall;. t, energy transfer can occur between the dono:~ 40 and acceptor 42. When read illumina-tion 20 irradiates the donor 40, energy transfer may occur to the acceptor 42 which results in radiation of energy shown as i~1 Energy transfer refers to the photonic process in which energy from the donor molecule 40 is transferred to the acceptor molecule 42 nonradiatively via dipole-dipole coupling. The acceptor 42 reemits light at a longer wavelength than the read ill~m;n~t;~7n wavelength 20. Such dipole-dipole energy transfer is referred to as Forster energy transfer. This process is highly ~ rPn~pnt on the distance between molecular centers, the rhPn~ t~n having a 1/r6 distance dependency where r equals half the distance between molecular centers.
3 0 Fig . 5 shows a schematic version of the basic photo-write process. :A series of donors 50 are associated with acceptors 52 such as acceptor A1 and A2. The acceptors 52 and donors 50 may be hybridized with a template (not shown) . Quenchers 54 are disposed in effective proximity to acceptors 32. The quencher 54 labelled Q1 is shown to be inhibited by the action of the write wavelength 40, as indicated by the "x". The quencher 54 labelled Q2 is Wo 95/3~890 2 ~ 9 ~ 2 4 ~ 5''~
.

shown subject to a destructive photo-write action from the write wavelength 40 as indicated by its disa5sociation from its attachment. Fig. 6 shows a donor 60 and acceptor 62 hybridized with a DNA hi~~khnn~ or template 64.
5 A quencher 66 is still shown as present. Accordingly, the excitation radiation 20 Ao will be received by the donor 60, and passed to the acceptor 62, but energy will not be radiated by the acceptor 62 because of the presence of the quencher 6 6 .
Fig. 7 shows a schematic version of the overall operation of the memory. In Fig. 7a, multiple chromophoric memory units are shown in the "off " stage, prior to any writing to the memory. Pairs of quenchers and acceptors 70 are located in effective energy transfer 15 relationship with the donors 72. As shown in Fig. 7b, during the photo-write operation, the write wavelength effective for various quencher groups acts upon the quenchers responsive thereto. For example, the quencher 74 labelled Q1 is inhibited by the write wavelength 76 20 labeled ~l. The quencher 74 labeled Q3 is destructively written to by write energy 76 at wavelength A3. As shown in Fig. 7(c), during the read operation, read ill-~min~tinl, 20 at wavelengths Al provides energy to the donors 72.
Since acceptors 78 labeled A1 and A3 are not subject to 25 the influence of quenchers 74 labeled Q1 and Q3, radiative emission of read energy 80 may occur at both A1 and A3.
Conversely, since quencher 74 labeled Q2 inhibits acceptor 78 labeled A2, no read energy occurs at wavelength Az.
Fig. 8 shows various forms of write mechanism.
3 0 Selective quenching is re(auired to control the energy transfer process. Generally, three types of quenchers are preferred. The first group (~ig. 7a) involves W sensi-tive quencher molecules 82 that are proximal to the fluorescent acceptor 84, and which prevent light emission.
35 Upon exposure to W radiation 86, the quencher 82 is inactivated (shown by an X in Fig. 7a) leaving the accep-tor 84 free to reemit . The second m,o~h~ni ~-m (Fig. 7b) ,,, , _ ., . . _ .. . .. ... . . .

Wo 95l34890 2 1 9 ~ 2 4 G r~ t .)3 .

involves quencher molecules 86 which are organized proxi-mal to the acceptor 84 by photocleavable linker6. Upon W
irradiation, thelink i5 broken, allowing the quencher 86 to dissociate. The third -h~nl cm (Fig 7c) involves the 5 derivitization af the acceptor 84 with photoactive groups 88. The quencher 88 makes the acceptor 84 nonfluorescent or "caged". Irradiation with W light uncages the accep-tor 84 and permits energy transfer and subsequent light emissions .
Fig. 9 show6 an end on view of three chromophoric memory units 90 attached to substrate 92. Each chromophoric memory unit 90 includes a template 92 to which the donors 94 and acceptors 96 may be attached. The chromophoric memory units 90 terminate in an attachment 15 mechanism 98 which serves to anchor them to the substrate 10. Short illustrative sequences are shown for various donors 94 and acceptors 96 attached to complementary backbone sequences 92.
Fig. 10 shows the orr~n;7~t;nn of DN~ polymers on 20 unique and repetitive att~l t sequences. Substrates 10 have attArl -hcn; oml~ 100 to connect to backbones 102. The use of repetitive sequences allows more chromophoric units to be arranged in the z-dimension. The additional units increase or amplify the read signal.
25 Additionally, if more "unique-repetitive" chromophoric units are added,~ then more information can be stored in the z-dimension. A synthetic DNA polymer =rnnt~;n;nr 1000 nucleotides, could contain as many as 50 repetitive or unique-repetitive chromophoric unit sequences, and would 30 extend approxima~ely 340 nanometers (nm) in the z-dimen-sion .
In one aspect of this invention, the read portal may be subdivided into various write subsections to increase the width of the data word read f rom the read portal .
35 Fig. 11 shows a perspective view of a read portal 110 having 16 write=subsections 112 located within the read portal 110. The write subsections 112 are defined to be wo gSI34890 r~ c/~
21 9~24rJ

those physical areas to which unique writing can occur.
Utilizing current illumination techniques, an individual write sublocation 112 may be sized approximately (~
micron) 2. For a 1 micron2 read portal 110, 16 individual - 5 write subsections 112 can be included therein. While the write subsections 112 are shown as square in Fig. 11, they may be of any shaped desired, other preferable shapes including substantially circular or oval. Such a struc-ture provides both spatial and spectrally resolvable aspects. If each write sublocation 112 t~nnt:~;nR acceptors which radiate at wavelengths which are spectrally resolv-able from those wavelengths of the other write sublocations 112, the structure of Fig. 11 would result in the output of a 16-bit wide word for a single read illumi-nation of the read portal 110. The various output wavelenghts are shown in Fig. 11 as Al, A2, A3, A~, and cnnt;nllPd on shown as A8, Al2 and Al6. In this f~mho~ t, a single write wavelength may be utilized provide that it may be focused then to a sin51e write sublocation 112.
The dimensions for the preferred embodiment are shown on the f igures .
Fig. 12 illustrates another aspect of this invention in which a read portal 120 cr~nt~;nC multiple spatially resolved write sublocations 122 wherein within a given write sublocation 122 one or more ~ tect~hle parameters are involved. Each write sublocation 122 preferably includes acceptors which have read wavelengths which are spectrally resolvable against all of the other read wavelengths from other write sublocations 122. The individual write sublocations 122 have labelled therei~
Al", Alb, AlC, Ald, where the numerical subscript indicate8 the read detection wavelength and the alphabetical subscript indicates the state of the variation. One such variation is to vary the intensity f or each color . The four states may be set at various intensity levels, for example, where T~ = 0~, Ib = 3396, I~ = 67~c and Id = 10096.
These percentages are not required, and may be set as W095/34890 21 91 24 ~ r~
.

desired to optimize detection accuracy and ef f iciency . A
different variation within a given write sublocation 122 involves spectral shifts of each color. Por example, the ' a~ state could be no radiation from the write 5 sublocation, the ~b~ state the unmodified read wavelength, the ' c' state with the read wavelength increased by some amount, such as 5 nanometer6 and the 'd' state with a read detection wavelength decreased by some amount, such as 5 nanometers. The number of variation states available is lO equal to the number of write wavelengths available. With sufficient write wavelengths, a given read portal 120 could output 6g bits per square micron. Yet another variation involves the output polarization of the read wavelength .
Fig. 13 shows an organized DNA photonic structure for a complete read portal 130 and a write sublocation 132.
In the read portal 130, paired quencher and acceptor units 132 are shown having n resolvable output characteristics, such as n spectrally resolvable wavelengths. The write 20 sublocation 132 shows multiple pairs of quenchers and acceptors 132 in which the acceptors will all emit at a given wavelength, but the quenchers are subject to various resolvable write characteristics.
Fig. 14 shows a perspective view of an optical memory 25 in accordance with the invention. A planar optical disk 14 0 is rotatable around an axis of rotation 142 . A
plurality of read portals 144 are disposed upon the surface of the optical disk 140. The optical portals 144 substantially cover the surface of the optical disk 140.
30 In the preferred embodiments, the read portals 144 may be arranged in substantially circular tracks or in a spiral configuration as utilized for conventional optical disks or compact discs. The ~t~ct~ 146 is positioned proxi-mally to the read portal 144 subject to reading. In the 35 preferred ~mho~;m~nt, the detector 146 is a near field f iber optic . A positioning unit 148 serves to vary the spacing between the detector 146 and the surface of the ~VO9~/34890 2 1 9 t 2;~ O P ~
.

optical disk 140. A source of read illumination 150, preferably a laser, is directed through optics to excite the chromophoric memory units within the read portal 144.
In one Pmho~;- t, a dichroic mirror 152 may be utilized 5 to direct the output of the laser through the detector 146. Emitted read illumination from the read portal 144 may be passed via the detector 146 through the optics, such as bandpass f ilters, including the dichroic mirror 132 to a read detector 154. In the preferred embodiment, 10 the read detector 154 may be a single or array of ava-lanche photodiodes for parallel access. The detector 154 then provides a signal on cable 156 to output electronics 158. In an alternate ~mhorl;m~nt, the optical disk may be illuminated from below the disk, with the detector remain-15 ing in the same position above the disk.
Fig. 15 shows a schematic view of the write device.The optical disk media 140 i8 adapted to rotate around its axis of rotation 142. The optical disk media 140 ,-~n~A;nR
various CI1L~ ,~h~ric memory units in which the ~auencher is 20 active in its initial state. During the course of the writing, the quencher may be inactivated. Multiple sources of ill-lm; nA~ n 160 are arranged to provide write illumination through alignment optics 162, preferably alignment optics, to a z positioner 164 and near field 25 fiberoptic 166. In this way, any of the various sources of write ill~m;nAti~n 160 may be directed to the chromophoric memory units disposed on the optical media 140. A write beam controller 168 is connected to the sources of illumination 160 to selectively activate the 30 sources. As the optical disk media 140 rotates around its axis of rotation, the illumination from the sources 160 as controlled by the controller 168 ; l l llm; nAte various read portals or subportal size write locations. In this way, writing occurs as described previously (e.g., Fig. 5, Fig.
35 7b) .
The detailed structure, se~uence and chemistry of the memory will be described below. The discussion is gener-W095/34890 2 ~ 9 ' 2~ u Y~ C~ 33 ally divided to :focus on DNA Design, Synthesis, Deriva-tion, Attachment and Organization, Activation, Hybridiza-tion, ChLL. ~hnric Re6ponse and Write-Details.
DES IGN
The sequences of nucleotides in the bac~cbone 92 (Fig.
9) and complementary donor 94 and acceptor 96 sequences are designed preferably to self-organize by hybridization into discrete chromophoric units. The conventional nucleotide units of adenine (A), thymine (T), guanine (G) and cytosine (C) are arranged in various sequences. The conventional pairing is used, with adenine pairing with thymine and guanine pairing with cytosine. The conven-tional double helix structure is preferably utilized, wherein the standard radius is approximately 1. 0 nm and spacing between~base pairs is apprnl~;r-t-~ly 0.34 nm in a linear direction along the chain. Such DNA is desirable f or use in the instant invention in part because of the precise geometric and distance reguirements of Forster energy transfer photonics processes. Further, these sequences are designed for hybridization efficiency and specificity such that they can self-organize reproducibly into predicted arrangements of chromophore units. Addi-tionally, the structures are preferably optimized for energy transfer efficiency. Finally, it is a desired aspect of the nucleotide sequences that they are attach-able to the solid support, preferably the substrate 10.
These DNA sequences range from approximately 20 to 1000 nucleotides in length (i.e., base units adenine, cytosine, thymine, and guanine) . The shorter DNA polymer sequences are generally referred to as Oligonucleotides or oligomers, and a DNA polymer 20 nucleotides in length would be designated a 20-mer. The actual molecular shape and size of a 20-mer would approximate a linear rod structure about 6 . 8 nanometers tnm) long and 1 nm in diameter (2 nm for double-stranded DNA). Each additional base unit would add 0 . 34 nm to the linear dimension . A

wo9S/34890 2tq~2~ r~ '0l$5~

1000-mer would have a length of approximately 340 nm.
Thus, we will be working with systems that are in the nanometer regime, ref lecting a high degree of control and specificity. And, 20-mers to 1000-mers are easily synthe-sized with available automated instruments and other DNA
technologies .
Sequences are preferably designed for the highe8t hybridization efficiency and specificity 80 that they will self-organize reproducibly into the planned molecular connections and arrangements. This precision is important because electronic transfer and photonic transfer ~Forster) processes are highly dependent on ~~~;ntislnln~
control over distances between the photonic transfer groups or the charge transfer groups. Previous work in 1~ solution phase has shown DNA polymers can achieve this end. It is these mechanism and their associated geometric requirements that make synthetic DNA the optimal material for impl~m~nting a man-made system.
Consistent with the above stated design criteria for DNA structures useful with this invention, various useful and robust sets of building blocks have been formed for these photonic systems. The ~ollowing DNA sequences have been designed for covalent attE~ ' t to metallized or silicon dioxide ~eatures on silicon surfaces.
Multiple DNA polymer attA~ t sequences have been synthesized with 3 ' terminal ribonucleosides . These were designed for covalent attZ~` t to solid supports and the organization of chromophore labelled polymer sequences.
Twelve (12) amine or aldehyde funct;~n~ ed sequences were synthesized for reaction with chromophore groups.
From those 12 DNA sequences, 26 DNA-chromophore deriva-tives were made consisting of 8 distinct colors, quencher and 1 W sensitive caged chromophore. Table l shows the current DNA-chromophore conjugates currently available.

WO 9S/34890 ~ 5~
2fl ~1240 TABLE 1: DNA-Ch.u.,.ùpi-o.~ Conjugates Ch,u",u~,l,v,c Ex/Em(nm) DNA-Chromophore Conjugate Fluorescein: 494/519 DO-1F, DO-2F, DO-3F, DOA, DOB, DOC, DOD, DOE, ET-10-F, ET~ F, T2-Rhodamine T: 544l570 T2-RT
5 Rhodamine X: 570l596 T2-RX
Bodipy 1: 558l568 ET-14 Bodipy 2: 530l550 T2 Lucifer Yellow: 428l533 ET-10-LY, ET-1 1-LY
Texas Red: 589l615 ET-10-TR, ET-11-TR, ET-12R-TR, ET-14-TR, ET-21A-TR, T2-TR
10 Napthofluorescein: 600l672 T2-NF
Caged Carboxy- 494l519' ET-13-CF
f luorescein Malachite Green: 6271none ET-11-MG
'Fluorescent when uncaged by exposure to UV light < 365 nm.
Fig. 16 shows a graph of the inten8ity as a function of wavele~gth for the 8ix polymer ser~uences.
The spectra for the six curves are listed below in Table 2.
Peak DNA-CI ,u" .,~ Excitation rnm) Emission (nm) 1 T2 - Fluorescein 494 519 2T2 - Bodipy 2 530 550 3T2 - Rhodamine T 544 570 4T2 - Rhodamine X 570 596 5T2 - Texas Red 589 615 6 T2 - CN Fluorescein 600 672 Fig. 17 shows an .on71~nr-~-1 DNA polymer map. this map indicates the sequences of all the various DNA chromophore units relative to the attachment sequences The * por~i-W0 95/34890 2 1 9 1 2 4 0 r~ 5 .

tions indicate the nucleotide sequence which is similar to the sequences at the center of the diagram.
In addition to the sequences presented in Figure 14, additional sequences have been designed which allow 5 repetitive chromophoric DNA units to be construced. These include the att~ - t sequences ATT-1-6; the template sequences TEM-1-6; and the cl~ h~ric sequences PET-1-C.
The attachment sequences (ATT) are li8ted below (5' and 3' refer to directionality of the DNA sequence):
ATT-1 5'-GGCTAGCCGAT~G(ilC~ 'AGGTCAAGTCAAT-rA-3' ATT - 2 5 ' - CGCACTA~ iAGTGTTCAGAGGCTATCAG- 3 ' ATT-3 5 ' -r~r7~r7~rTcATGAGcAGGGGcTAGccGATcGGG-rA-3 ~
ATT-4 5 ' -GACTTGACCTr~r~rrrr~TCGGCTAGCCCCTGCT-3 ' ATT - 5 5 ' -ATGTCTGACTGCAGCTCGr ~ rr.~r.~r7~ rTCATGAGC - rA- 3 ' ATT-~ 5'-GCTAGCCCCTGCTCATGA~l~ L~ ~CGAGCTGC-3' The following specific DNA se~auences have been designed to form templates, or to be useful as repeating structures for spanning di8tances greater than substan-tially 100 n~n~ . -t~r8. The template sequences (TEM) are listed below:
TEM- 1 5 ' -ATTGACTTGACCTr-Ar~r~rrrr~TCGGCTAGCC-- CcAAGcTTGcATGccTGcAGGTcGAcTcTAGAG --GA~ e~iG~lACCGAGCTCGAATTC-3 ' TEM - 2 5 ' - GA~TTCGAGCTCGGT - GAATTCGAGCTCGGTACC --AAGCTTGGCCCAAGCTTGGCTGCAGGT-3 ' TEM- 3 5 ' -ACCTGCAGCCAAGCTTGG- CATGATTACGAATTC-- rrr.Gr.r7~TcCGTCGACCTGCAGCCAAGCTTGGC--AcTAGccTcTGAAcAcTrl~rr~Arr~TA-3 ~
TEM-4 5'-TATGCTTCCGGCTCGTA'l-iLl~l~l~,~AATTGTGAGCGGATA-3' - TEM - 5 5 ' - GTCATAG~: L~ l l l C8~ i L~ l ~AAATTGTTATCCGCTCACAAT - 3 ' TEM- 6 5 ' -ACGTTGT~ rr~rr-r,CCAGTGCCAAGCTTGGCTGCAGAG- 3 Specific DNA sequences have been designed for functinr~ tion with various photonic transfer ~chromophore or fluorophore) groups and electronic trans-fer (charge transfer) groups. The photonic/electronic transfer sequences (PET) are listed below:
_ _ . _ . .... ... . .. .. .. . . . . .. . . . _ _ . _ . _ . .. . . _ _ Wo 95l34890 r~ Sg~

PET -1 5 ' - CCGGGGATCCTCTAGAGTCGA- 3 ' PET - 2 5 ' - CCTGC~GGCATGCAAGCTTGG- 3 ' PET-3 5 ' -GCCAAGCTTGCaTGCCTGCAGGTCGACTCT-3 ' PET-4 5'-AGAGGA`l'~ ,LACCGAGCTCGAATTC-3' 5 PET-5 5'-AGTGCCAAGCTTGGCTGCAGGTCG-3' PET-6 5~-AcGGATcrcr~ TTcGTAATcATG-3 :i Y ~l L 'l ~ S
The synthesis of short DNA polymer sequences of from approximately lO to approximately lO0 monomers is a 10 straight forward task for those of ordinary skill in the art. Automated DNA polymer synthesizers, 6uch as tho3e from Applied Biosy3tem3 (Foster City, California) automat-ically 3ynthe3ize u3ing conventional pho3phoramidite chemi3try. In operation, the nucleo3ide at the 3~-15 terminus i3 attached to a controlled pore gla33 support by means of a linker arm. The 5 ' -terminus is blocked with a th~ytrityl ~DMT) group. First, the support bound nucleo3ide i9 deprotected to provide a free 5 ' -hydroxyl group for the att~ of the next nucleotïde. The 20 second nucleotide i8 deblocked and activated at the 3 ' -hydroxyl with tetrazole to form a highly reactive interme-diate . The 5 '--terminus is blocked with DMT to prevent self polymerization. Next, a capping step renders any chains which do not undergo addition inert to further 25 additions . The ; nt.ornllrleotide linkage is then oxidized from the phosphite to the more stable phosphate. After oxidation, the DMT is removed from the growing DNA chain and the cycle is repeated until chain elongation is complete. Finally, the fully assembled oligonucleotide is 30 cleaved from the CPG support, deprotected and purified by polyacrylamide gel electrophoresis (PAGE) or high pressure liquid chromotography (HP~C) to remove failure sequences.
The att~h~^nt sequences contain 3'-terminal ribonu-cleoside and are synthesized by initiating synthesis from 35 a ribonucleoside-CPG support. Certain homopolymer attach-ment sequences are synthesized by enzymatic reaction, and WO 95/34890 r~ Jb _~
21 ~124~

may be purchased f rom commerical sources such as Sigma Chemicals (St. Louis, MO). Other sequences may contain amine functionalities and serve as substrates for the attachment of C~ h~re molecules, including the donor, acceptor and/or quencher molecules. These polymers have a 5'-term.inal amine and ;nt~rn~l primary amine groups.
The 5~-terminal amine functionalities are allt~ tically incorporated by means of the ABI amino link to reagent.
Internal 1 ~h,~1 l; ng of the oligonucleotide is done by several methods. In the case of fluorescein the chromoph-ore is automatically incorporated into the polymer at any position through use of a fluorescein phosphormidite. For labelling with other chromophores, an amine terminated linker arm nucleoside phosphormidite is automatically incorporated into the polymer at any thymine base posi-t ion .
DERIVITIZATION
Derivit; 7~ti~n is performed in the preferred embodi-ment as f ollows:
The amine functionalized synthetic DNA polymers are labelled with chromophore groups and are used in the energy transfer, qn~nrh;n~ and a write m~h~n;F~ Many chromophore groups are commerically available in reactive forms which allow straight forward coupling chemistry to amine groups. The different chromophores are generally available in at least one of the reactive forms listed below:
1. Isothiocyanates (R-N=C=S) which form thioureas (R=NH- [C=S] -NH-R' ) upon reaction with amines.
Fluorescein, tetramethylrht~m; n~ and rhodamine - X DNA conjugates are formed by this chemistry.
2. S-]cc;n;m;dyl esters (R-CO2-X) which form carboxamides R- [C=O] -NH-R' ) upon reaction with amines . Bodipy dyes, napthof luorescein and caged carboxyfluorescein conjugates are formed by this chemistry.
_ .. _ . . _ . ... ... ... . . . ..... .. . .. _ _ _ _ _ Wo 9s/34890 P~ ~5~
2~91240 3. Sulfonyl chlorides ~R-SO2Cl) which form stable sulfonamides (R- [S02] -NX-R' ) upon reaction with amines. Texas Red conjugates are formed by this chemi stry .
5 The typical labeling conditions are as follows:
1. Dissolve the amine rnnt~;n;ng oligo in 0.25M
sodium bicarbonate, pX 9.0-9.1 to a final con-centration of 1 O .D . /units (~5 mM for a 20 mer) .
Substitute 60dium bicarbonate, pH 8 . 3 (uncor-rected for r~rtirnA with s~rr;n;m;dyl esters.
2. Dissolve the amine reactive r rhrre deriva-tive in anhydrous dimethylformamide (DMF) to a final concentration of -lOOmM.
3. Combine 10 ul of DNA and 20 ul chromophore, chr, , hnre/DNA and incubate at room temperature f or 1-2 hours .

4. Add 5 ul rnnr~ntrated ammonia to r~uench unreacted material.

5. ~?urify the material by pa5sing through a G-25 Sephadex column (0.9 x 10 cm) equilibrated in 5 mM sodium acetate, pH 7 . 0 6. Collect fractions and measure ~h5nrb~n~e on spectrophometer from 230-650 nm. DNA absorbs at 260 nm and the C~lr, ~h~re absorbs at its excitation maximum.

7. Pool conjugate fractions. Reaction usually go to ~ 5C96 completion.

8. Analyze 0.1 O.D. product by 20~ polyacrylamide gel el~ctrophoresis.

9. I.yophilize sample to dryness and re-suspend at 1 O . D . /ul in 5mM sodium acetate .
lO. Load sample onto a preparative 20~ PAGE and let xylene cyanol tracking dye run ~lO cm into the gel .
ll. By W backshadowing, cut out gel slice ~nntA~ nr both W absorbing and fluorescent material .

Wogs/34890 2 1 9 ~ 24 0 12. Crush the gel slice rnnt~;n;nr~ product with a mortar and pestle and elute product overnight in lXSSC buffer (0.15M sodium chloride, 0.015M
sodium citrate, pH 7 . 0 ~ .
13. Load the elute onto a pre-equilibrated C1B Sep Pak (Millipore, Milford, MA) reverse phase column to remove rnnt~m; nAting polyacrylamide .
14. Wash the column with 20 mls water.
15. Elute the product with 2 mls of 505O acetoni-trile.
16. Analyze the elute spectrophometrically and then lyophilize to dryness.
17 . Resuspend f inal product to 1 O . D . /ul in 5 mM
sodium acetate, pH 7 . 0 . Typical yields of pure final product are approximately 505O of the starting amount.
ATT ~ T _ 0~ ~ ~ NT 7 ~ TION
Fig. 18 shows the steps associated with the preferred att~rl t chemistry for ~ff;~inr the cl~ hnriC memory units 16 to the substrate 10. (See Fig. 1). The surface of the substrate 90 is amine functinn~l; 7ed with APS .
These then react with aldahyde terminated DNA to form a covalent bond .
The chromophoric memory units are ~tt~rht~t~ to the substrate, either directly or through an intermediary. In the preferred process, a two step process is utilized.
First, the solid surface is activated with primary amine groups. Second, the DNA att~t' - t ser~uence is converted to an intermediate f orm which reacts with amine groups .
- 30 The attachment chemistry is stable and robust and is successful on a variety of substrates, including glass, silicon and metal oxides. The support bound DNA retains all of its hybridization properties relative to hybridiza-tion ef f iciency and nonspecif ic background . A sur~ace loading factor of approximately 105 - 106 DNA att~rhm~nt ser~uences per micron is obtained.

wogs/34890 2 ~ 9 ~ 24~ r~ s ~

Substrate surfaces are amine functi~-nAl ize~ by 3-aminopropyltriethoxysilane (APS , Aldrich Chemical Co ., Milwaukee, WI) which reacts readily with the oxide and/or hydroxyl groups on metal and silicon surfaces and provides 5 a primary amine functionality. Next, the attAr~ t se~uence is converted to a reactive dialdehyde form by the periodate oxidation methods. The amine and aldehyde groups react readily to form a stable imine or Schiff's base. The APS reaction is performed by treating the 10 desired surface for 30 minutes with a 10% (v/v) solution of APS in toulene at 50C. The surface is then washed 3 times in toulene, 3 time6 in alcohol and then air dried for 60 minutes at~ 50~C. The resultant surface i5 amine functionalized and is extremely reactive to aldehyde 15 groups present on the periodate oxidized at se~uences .
ACTIVATION
DNA activation is A _ , l; qh~d in the preferred embodiment by the following process. The 3~-terminal 20r;hr~n--rl~otide terminus of the atta~l sequences is converted to a terminal dialdehyde by the periodate oxidized method. The periodate oxidation reaction is per~ormed as 1 0 . ~/ul . 1 volume of O . lM sodium acetate, pH
5.2 and 1 volume of 0.45M sodium periodate (made fresh in 25 water) is added. ` The reaction is stirred and incubated at room temperature for at least 2 hours protected from light. The reaction mix is then loaded onto a Sephadex G-10 column (pasteur pipette, 0.6 X 5.5 cm) which is equili-brated in O.lM sodium phosphate, pH 7.4. Fractions (200 30 ul) are rA~ t~od and 2 ul ali~rtuots are spoted onto silica T~C plates. The W absorbing fractions are combined and contain the activated DNA polymer.
The solid support materials is rinsed with O . lM
sodium phosphate, pH 7.4. Aspirate and add buffer suffi-35 cient to cover the chips, add the periodate oxidizedattachment sequences, at minimum 1 0 . D . per cm2 of surf ace Wo 95/34890 r~l~u~
2f 91~40 area. Mix well and react 1-2 hours at room temperature.
The carbonyl compounds form covalent adducts with amines by dehydration to imines or Schif f ' 8 bases . The DNA
substrate are then washed twice with sodium phosphate buffer, twice with lXSSC, 0.1~ SDS (WB=0.15M sodium chloride, 0.015M sodium citrate, pEI 7.0 and 0.19~ (w/v) sodium dodecyl sulfate) and twice with lXSSC (0.15M sodium chloride, 0.015M sodium citrate, pH 7.0). The derivatized materials are used immediately or stored dry.
~IYBRIDIZATION
The preferred hybridization process is accomplished utilizing any techniques satisfactory to meet the func-tional criteria of the invention. In the preferred lornho~ / the following hybri~l7A~ion technique is used.
The DNA support substrates are hybridized for 5 minutes with 100-200 nM complementary polymer sequences ~r~nt~;n;n~
a fluorescent group at 37-50C in 5XSSC, 0.1~ SDS (HB) .
The hybridization temperature is estimated by the DNA
sequence composition and by using the formula, Tc = (2 X
A/T) + (4 X G/C). For example, the hybridization tempera-ture for ET-lOAI~ would be (2 X 8) + (4 X 10) = 56C. The actual hybridization temperature is 10C lower (45C) to maximize the extent of hybridization. The support sub-strates are washed 3 times in prewarmed WB at temperature, 1 minute each. Finally the support substrates are rinsed in lXSSC at RT and dried by canned air (i.e., Dust-Off).
The support substrates are mounted on a glass slide and observed by epifluorescence with a ~Jenna Epifluorescent microscope fitted with a Hamamatsu intensified CCD (ICCD) - 3 0 camera imaging system .
A loading factor of approximately 105-106 at~A~ l -n~
sequences/um2 is generally adequate. The loading factor is variable because the APS chemistry modif ies the oxides or hydroxyl groups whose concentration is dependent upon 3 5 process ing f actors .

-WO 95/34890 PCT/US95/~6999 21 91240 ~

rTT~ ~OrA~)RIC ~ ~UN:ilS
Chromophoric groups which emit fluore9cence in the generally 500-800 nanometer range and are reactive with DNA and the amine lAh~1l;n~ chemistry are listed below:
Fluorescent Donor/Acceptor Derivatives:
Texas Red (Em = 610 nm) Rh~ ~lAmlnf~ (Em = 580 nm) Bodipy Dyes (Em = 503, 51~, 550, 568, 570, 588, 594 nm) Lucifer Yellow (Em = 528 nm) Fluorescein (Em = 520 nm) Cascade Blue (Em = 425 nm) Non-Fluore~cent Donor/Quencher Derivatives:
Dimethyl Am; nf~phQnylazophenyl (DABITC) Reactive Red Malachite Green The various wavelengths output f rom a read portal must be spectrally resolvable. Ut; 1; 7; n~ current detec-tion techniques, peak separations of irom approximately 10 20 to 20 nanometers between each color are resolvable.
Various photoactive groups with selective W absorp-tion characteristics useful for the write -hAn; Qm include:
p-Methoxybenzyl Ethers ~280 nm p-Nitrobenzyl Ether8 -280 nm p-methoxyphenacyl Esters ~300 nm o-Nitrobenzyl Ethers -320 nm Pyrenymethyl Esters -340 nm bis-2-~itrobenzyl Acetals -350 nm 3 0 WRITE DETAILS - - The caging group approach has been prepared as follo~ws. A cage fluorescein (fluorescein-bis-dimethoxynitrobenzyl ether) is commerically available as a succinimidyl ester derivative. An ET-13-caged fluores-cein (ET-13-CF) coniugate is made. The compound is 35 intrinsically nonfluorescent until exposed to W radiation at less than 365 nanometers. Upon irrzfl;At;~n, the W095l34890 2~ ~ ~40 l'~,IIL_ ~ ~5~
compound becomes intensely fluorescent at t~e characteris-tic fluorscene excitation and emission maxima, 490 and 520 nanometers, respectively. See Fig. 15.
Although the invention has been described with 5 respect to specific preferred embodiments, many variations and modifications may become apparent to those skilled in the art. It is therefore the intention that the appended claims be interpreted as broadly as possible in view of the prior art to include all such variations and modifica-l o t ions .

' ! ,". ', j , ., ~, ~, _.

Claims

We claim:

1. An optical memory comprising:
a plurality of read portals disposed on a substrate, chromophoric memory units disposed within the read portals, each chromophoric memory unit adapted to receive photonic energy and to re-emit energy based upon the action or non-action of a quencher.

2. The optical memory of Claim 1 where the substrate is a round platter.

3. The optical memory of Claim 2 where the portals are disposed upon the platter in radial tracks.

4. The optical memory of Claim 2 where the portals are located on a radial spiral.

5. The optical memory of Claim 1 wherein the read portals include multiple write sublocations.

6. The optical memory of Claim 5 wherein each of the multiple write sublocations has resolvable read parameters.

7. The optical memory of Claim 6 wherein the re-solvable read parameter is wavelength.

8. The optical memory of Claim 6 wherein the resolvable read parameter is intensity.

9. The optical memory of Claim 6 wherein the resolvable read parameter is polarization.

10. The optical memory of Claim 1 wherein the support has a substantially planar surface upon which the read portals are disposed.

11. The optical memory of Claim 10 wherein the read portal are planar to the support surface.

12. The optical memory of Claim 10 wherein the read portals are located below the support surface.

13. The optical memory of Claim 10 wherein the read portals are disposed in wells below the support surface.

14. The optical memory of Claim 10 wherein the read portals are raised above the support surface.

15. The optical memory of Claim 10 wherein the read portal is substantially circular.

16. The optical memory of Claim 10 wherein the read portal is substantially square.

17. The optical memory of Claim 1 where the chromophoric memory unit includes:
a DNA template, a donor group, an acceptor group, and a quencher group.

18. A memory unit for use in an optical memory comprising:
a support substrate, an attachment mechanism attached to the substrate, and a chromophoric memory unit coupled to the attachment mechanism, the chromophoric memory unit comprising, a DNA template, and functionalized DNA including a donor group, an acceptor group and a quencher group.

19. A memory cell of Claim 18 wherein the support is substrate.

20. The memory cell of Claim 19 wherein the sub-strate is chosen from the following group: silicon, silicon dioxide and metal.

21. The memory cell of Claim 18 wherein the attach-ment mechanism is chosen from the following group:
covalent bonding, ionic bonding.

22. The optical memory of Claim 18 wherein the donor group is fluorescein.

23. The optical memory of Claim 18 wherein the acceptor group is selected from the following group:
Fluorescenin, Bodipy 2, Rhodemine T, Rhodamine X, Texas Red, CN Fluorescein.

24. The optical memory of Claim 18 wherein the quencher is selected from the following group:
Malachite Green, DABITC, Reactive Red.

25. The optical memory of Claim 18 wherein the donor group and acceptor group are in proximal relation to permit non-radiative energy transfer.

26. The optical memory of Claim 25 wherein the non-radiative energy transfer uses dipole-dipole coupling.

27. The optical memory of Claim 18 wherein the non-radiative energy transfer is Forster transfer.

28. A DNA optical memory cell comprising:
a support mechanism, an attachment mechanism coupled to the support mecha-nism, and DNA structure adapted to receive photonic energy and to reemit energy based upon the effective presence of a quencher, the attachment mechanism serving to each the support to the DNA structure.

29. The optical memory cell of Claim 28 wherein the support comprises a substrate.

30. The optical memory cell of Claim 28 wherein the DNA structure comprises a choromophoric memory unit.

31. The optical memory of Claim 30 wherein the choromophoric memory unit includes:
DNA template, and functionalized DNA groups attached to the template including: a donor group, an acceptor group, and a quencher.

32. An optical memory player for reading from a memory array, the memory array including multiple read portals which contain chromophoric memory units adapted to provide a multibit output comprising:
an illumination source operatively positioned to eliminate a read portal on the memory array, a motion device adapted to receive the memory con-taining the portals and to cause relative motion of the read portals and the illumination source, and a detector for resolving a multibit output from the read portal.

33. The optical memory player of Claim 32 where the motion device imports rotational motion to the memory..

34. The optical memory player of Claim 32 wherein the detector spectrally resolves the wavelengths emitted from the read portal.

35. The optical memory player of Claim 32 wherein the detector resolves polarization states from the read portal.

36. The optical memory player of Claim 32 wherein the detector resolves wavelength and polarization from the read portal.

37. A method for storing data comprising the steps of:
forming a chromophoric memory unit by hybridizing a DNA template with at least one donor group, one acceptor group and a quencher group, writing to the chromophoric memory unit to place it in one of two states, a first state being the effective quenched state and a second state being an inactivated quench state, and reading from the memory by illuminating the memory unit with optical radiation and detecting the presence or absence of reemitted radiation.

38. The method for storing data of Claim 37 wherein the quenching step is performed by inactivating the quencher via UV light.

39. The method of Claim 37 wherein the quenching is performed by the breakage of photo cleavable linkers.

40. The method of Claim 37 wherein the quenching is performed by derivitization of chromophore molecules with the photoactive groups.