CA2208794A1 - Nucleic acid sequence detection employing amplification probes - Google Patents

Abstract

Methods and compositions are provided for detecting nucleic acid sequences. In particular, pairs of probes are employed, where the pair defines a substantially contiguous sequence on a target nucleic acid. Each of the pairs has a side chain which forms a stem of the two side chains which non-covalently binds and is capable of forming a cross-link upon activation, when the probes and sample nucleic acid are base paired. Cross-linking of the stems when unbound to complementary DNA is inhibited. Each of the nucleic acids is initially present as single stranded nucleic acid to allow for base pairing, so that the probes bind to homologous target nucleic acid. The assay mixture is activated to provide cross-linking, the double stranded nucleic acid melted, and the process of base pairing, activation and melting repeated, a sufficient number of cycles, to provide a detectable amount of cross-linked probes. To inhibit background cross-linking, the side chains may provide for duplex formation, where a portion of the side chain binds to a different portion of the side chain or the portion of the probe homologous to the target. Also provided are kits comprising reagents, as well as automatic devices, for carrying out the subject method.

Description

W 096~0289 PCTrUS95/16916 NUCLEIC ACID SEQUENCE DETECTION EMPLOYING
AMPLI~ICATION PROBES

CROSS-RF,FF,RF,~CF, TO RF,T,~TF,n APPT,TCATIONS
This applicaLlion is a continuation-in-part of 08/487,034, filed June 7, 1995, which is a contim~tion-in-part of application Serial No. 08/364,339 filed December 27, 1994, the ~iicçlvs~lre of which is herein incorporated by reference.
s INTRODUCTION
Techni~l Field The field of this invention is nucleic acid sequence detection.
R~cl~rollnd The amount of information concerning the genomes of a large variety of species is increasing expon~onti~lly. The av~ bility of known sequences creates an enormous market for the detection of particular sequences present as DNA or RNA,whereby one can detect the presence of genes, their tr~nCçription or mutations, such as lesions, substitulions, deletions, translocations, and the like. By knowing 15 sequences of interest, one can detect a wide variety of pathogens, particularly unicellular microorg~ni.cmc and viral strains, and genetic ~lic~ces including the presence of genes i~ a,Lhlg antibiotic resict~nce to the unicellular microorg~nicmc, as illustrative of only a few of the available possibilities. In addition, there are needs within the extensive areas of genetic connceling, forensic mPtlicine~ research, 20 and the like, for nucleic acid sequence detection technf~logy.
In many in~t~nces, the target nucleic acid sequence is only a very small proportion of total nucleic acid in the sample. Furthermore, there may be many W O9~n~q CA 02208794 1997-06-26 P~lr~g311016 situations where the target nucleic acid of il~tel~e~l and other sequences present have substantial homology. It is therefore i~ o.L~nt to develop methods for the dete~tic-n of the target nucleic acid sequence that are both sensitive and accurate.
Several enzymatic ~mplific~tion methods have been developed, such as the 5 polymerase chain reaction (PCR), the ligase chain reaction (LCR), NASBA, and self-sust~in~1 sequence replication (SSR). The first and most notable method that has received extensive use is PCR. Starting with specific primers, nucleoside triphosphate monomers, the target strand of DNA and a polymerase enzyme, one can greatly amplify the target DNA sequence of interest. This technology is 10 extremely powerful and has been applied to a myriad of resealcll applications, but it has a number of drawbacks which limit its use in a variety of areas. General availability is limited by the restrictive nature of licenses by the owners of the patent rights. In addition, the method requires an enzyme. While the availability of thermally stable enzymes has greatly enhanced the applicability of PCR, there is15 nevertheless the inconvenience that denaturation of the enzyme occurs during thermocycling. Also, the sample may include inhibitors of the enzyme requiring isolation of the nucleic acid sample free of inhibiting components. In addition, the methodology is sensitive to amplifying stray sequences, which then overwhelm thetarget sequence of interest, obscuring its presence. There is also the fact that the 20 reagents are expensive and the amplified DNA usually requires verification. These commP-n~ apply equally to the other enzymatic amplified techniques noted above, such as LCR, NASBA, and SSR.
There is, therefore, substantial interest in identifying alternative techniques which allow for the detection of specific DNA sequences and avoid the deficiPn~ip~
25 of the other systems. Also of interest is the development of devices for autom~ti~lly carrying out these ~ltPrn~tive nucleotide sequence detection techniques, where these automatic devices will reduce the opportunity of error introduction and provide for con~i~tPncy of assay conditions.

30 Relevant T .iter~t--re Barany, Proc. Natl. Acad. Sci. USA (1991) 88: 189-193; ~-tPlli et al., Proc. Natl. Acad. Sci. USA (1990) 87: 1874-1878. Segev Diagnostics, Inc. WO

WO 96no289 CA 02208794 1997-06-26 ~~ '753ll69l6 90/01069. Tm~lonP Systems, Inc. WO 94/29485. U.S. Patent Nos. 5,185,243, 4,683,202 and 4,683,195.

SUMMARY OF T~F. TNVFNTION
Methods and compositions are provided for d~P-t~Pctin~ nucleic acid sequences by using a pair of probes, in each of which at a dirrerellt end there is a portion of the chain which serves as one half of a stem, which portion will be referred to as a side chain. The side chains comprise a cross linking system, which has a photoactivatable entity, normally coupled to a passive reactive entity. Upon ori~nt~tion of the side ehains in spacial proximity as a result of binding of the probes to a contiguous homologous target sequence and activation of the cross linking system associated with the side chains, the probes are joined together by a covalent linkage. The method employs adding the probes to the target nucleic acid under conditions of base pairing, activating the cross-linking system, so that primarily only those side chains in spacial proximity form a covalent bond, m~oltin~ double-sfr~nde~l nucleic acid and ~P~Iin~ the cycle. Where only one set of probes is used, the eYp~nciQn is linear; where complemPnt~ry sets of probes are used, in the re-~nnP~ling process the probes in ~tlditinn to binding to target nucleic acid, will also bind to cross-linked probes. In this manner, one may obtain a linear or geometric increase in the number of cross-linked probes as the cycle of steps is repe~tec~, wherein the process is initi~tP~ by the presence of target DNA.
In a preferred embo-limPnt, the probes have non-cross-linking duplex forming side chains, where at least one side chain is in the form of a duplex prior to hybridi7~tiQn with the ;arget DNA. The side chains are chara;L~ ed that at leastone of the side chains has a photoactivatable group and the other of the side chains has a recipient group which reacts with the photoactivatable group to form a covalent bond.
The methods comprise combining the probes whose sequences are homologous to adjacent sequences in the target DNA under conditions, which may be succe~ive or simultaneous, which result in melting of the side chain clupleYes and hybridization of the probes to the target DNA. After s--ffici~nt time for hybridi7~tion between ~he probes and the target DNA to occur, the hybridi7~tion W096~0289 CA 02208794 1997-06-26 PCTfUS95/16916 m~ m isirr~ tecl to photoactivate the photoactivatable groups, which will react with the reripien~ group to cross-link the probes bound to target DNA or ~im~-ri7~d probes.

RRTFF nF~scRTpTIoN OF T~TF nRAWI~C'S
Figure 1 is a block diagram of a first embodiment of a control circuit of an auloll-a~ic device according to the subject invention;
Figure 2 is a block diagram for a second embodiment of control circuit of an allLolllatic device according to the subject invention;
Figure 3 shows an automatic device according to the subject invention; and Figures 4 to 6 are diagrammatic views of protective embo~liment~ of this invention.

nF~cRTpTIoN OF THF. SPFCIFIC FMT~onTMF~Ts Methods and compositions are provided for clete~ting a nucleic acid sequence employing at least one set compri~ing a pair of first and second probes. The pair of probes defines a target sequence, where upon base pairing of the probes to the target sequence, the probes are brought into close spacial proximity. _ach of the probes has a portion of the probe, which acts as a side chain which does not bind to the target sequence. The side chains act as one-half of a stem and non-covalently interact through hydrogen bonding, salt bridges, and/or Van der Waal forces. When the stem is formed, the side chains comprise a covalent bond cross-linking system, which upon activation results in a covalent bond between the side chains, thus permanently linking the probes under the conditions of the process.
The method is performed by combining the target nucleic acid with the pair of probes or sets of probe pairs in an appr~.iate medium for base pairing to produce an assay medium. The nucleic acid may be DNA or RNA, single or double stranded, or other molecule which comprises pyrimidines and/or purines or their analogs capable of base pairing. After sllffiçient time for the probes to bind to the target nucleic acid or in subsequent steps to bind as well to cross-linked probes, the cross-linking system is activated resulting in covalent bonding between the two probes. One then melts double stranded nucleic acid to release the probes from the wo s6no289 CA 02208794 1997-06-26 PCTrUSss/16916 homologous sequence ~d repeats the process over again, whereby the number of cross-linked probes in ~he presence of target sequence is increased linearly or geomPtric~lly. Where only one set of probes is used, linear amplific~tic-n of cross-linked probes is obtained, which may be satisfactory in many in~t~nCçs.
~ 5 In describing the subject invention, the probes will be considered first. ~ach of the probes will have a sequence of at least about lO, more usually at least about 15, preferably at least about 18 and usually not more than about l kb, more usually not more than about 0.5 kb, preferably in the range of about 18 to 200 nt, and frequently not more than 60 nucleotides, where the sequence is homologous to thetarget sequence. For the most part, the total number of nucleotides which are homologous to the target sequence for the two probes will be at least about 15 nt, more usually at least about 25 nt, and not more than about 1.2 kb, usually not more than about 0.5 kb, preferably not more than about 300 nt. The base pairing domains present on the target nucleic acid will normally not be separated by more than lO nt, more usually not more than about 6 nt, and preferably not more than about 2 nt and may be contiguous.
Desirably, particularly where the side chain is involved with duplex formation ("~ pleYecl side chain"), the probe with the side chain having the photoactivatable group will desirably have a fewer number of comr)lemPnt~T~
nucleotides to the target as compared to the probe having the recipient group. In this way, where only one probe has hybridized to the target, it will more likely be the probe with the recipient group, which will not react with the target upon photoactivation .
Each of the probes has a side chain, 3' on the first probe and 5' on the second probe in the 5 '-3 ' direction, which will provide for non-covalent association to form a stem. Non-covalent association can be obtained by hydrogen bonding, salt bridges, Van der Waal forces, and the like, particularly hydrogen bonding. For the most part, the groups involved for association will have oxygen and niL.ogen bonded hydrogen, e.g. purines and pyrimidines. Upon activation, covalent cross-linking between members of the stem occurs. The reaction rate occurnng as a result of the spacial proximity of the side chains due to the base pairing of the probes to a homologous sequence ~ivill usually be at least about lO fold, preferably at least about W 096~0289 CA 02208794 1997-06-26 r~l/u~5/16gl6 100 fold, greater than the reaction that occurs between the probes unbound to the homolc gous sequence.
The side chains will be selP~t~d so as to have a weak association or affinity.
By weak is int~nde~l that in the absence of the target in the sollltion, the equilibrium 5 between lln~oci~t~d probes in solution and ~Ccoci~tecl probes, due to the affinity between the side chains and target homologous nucleic acid sequences will be less than about 10-l, usually less than about 10-3 M-'. The affinity may be as a result of hydrogen bonding, salt formation, or other low energy event.
To obtain stem formation, conveniently, one may use paired nucleotides, at 10 least 2, generally at least 3, and usually not more than about 20, more usually not more than about 16 base pairs, preferably not more than about 8 base pairs, morepreferably not more than about 6 base pairs, usually in the range of 2 to 6 basepairs, more usually in the range of 4 to 6 base pairs. ~ltern~tively, one may use amino acids which provide for hydrogen bonding and/or salt bridges. Other 15 hydrogen bridges may involve ~ mines and diol acidic groups, particularly ortho-phPnol~tec. However, for the most part, con~idering convenience, ease of synthesis, control of affinity, and substantial absence of inlelrerence, nucleotides, nucleotide analogues or derivatives will be employed, for example, where the sugars or phosphates may be substituted, base amino and oxo groups motlified, and the like.
20 Usually, the pairs will be A and T, where the nucleotides may be the same on one side chain or different, that is all Ts on one chain and all As on the other chain, or a mixture of As and Ts on the two side chains. However, one may also use G and C, by themselves or in combination with A and T. Instead of the normal 4 or 5 natural bases (including uracil), one may use other bases or other moieties providing for 25 hydrogen bonding and spacial orientation, such as S-methylcytosine, 5-fluorouracil, 2'-deoxy-5-(trifluoromethyl)uridine, inosine, l-methylinosine, 3-nitropyrrole, and the like. The particular choice of nucleotide or substitute moiety will depend on the desired affinity, ease of synthesis, interaction with the covalent cross-linking, oL~o~lu-lity to serve as a reactant for cross-linking, and the like. Generally, the side 30 chains, eY~ lin, groups bound to the chain will be at least about 20 atoms in the chain, more usually at least about 30 atoms in the chain, generally fewer than 100 atoms, more usually fewer than about 60 atoms. The atoms will be carbon, oxygen, W O 96r20289 CA 02208794 1997-06-26 PCTrUS9S/16916 Jgell, sulfur, phosphorus, and the like. The cross-linking moieties may be part of the side chain or appended to the side chain, depending upon the nature of the moiety.
The base pairing sequences of the two probes will be sele~t~ so as to S provide a low affinity between the two probes. Therefore, the target sequences will be sPl~ct~d so that there will not be a signific~nt number of nucleotides dçfinin a sequence of homology, particularly complementarity, between the two probes. The greater the comp]çm~-nt~rity between the two probes, the more stringent the conditions will be required during the period of activation of the cross-linking10 system. Therefore, one has substantial discretion in the selection of the probes in relation to the conditions employed for base pairing of the homologous sequences.
The orientation of the stems may be varied, so that the stems may be in the same or opposite orientation to the target complenlent~ry sequence. Thus, one ofthe stems may be in a parallel orientation to provide for Hoogsten base pairing, or 15 both may have anti-parallel nrient~tinn, so as to have 3'-3' coupling of one stem to the target compl~mP-nt~ ry sequence and analogously 5'-5' coupling of the other stem to the target complem~tlt~ry sequence.
For geometric expansion, the target complement~ry portion of the probes need not, and preferably will not, have target complem~nt~t~ regions of the same20 length. Therefore, when the two complementary probes of the two sets are hybridized, a portion of the target complem~nt~ry regions will be exposed generally of from 1 to 10, usually of from about 2 to 6, nucleotides. The exposed portion will be of the 5' probe in one combination of probes and the 3' portion in the other combination. When the four probes are hybridized, all of the complementary 25 regions will be hybridized, where a S' probe in one combination will extend over the 3' probe of the other combination.
In one embodiment, one of the side ch uns will provide for a bulge adjacent to the homologous sequence. The bulge will be between the last nucleotide base pairing with the target sequence and directly linked to said side chain and the first 30 group providing for non-covalent ~ccoçi~tion between the side chains to form the stem, e.g. base pairing of nucleotides on respective side chains. Using nucleotides as exemplary, there will usually be 1 to 3 unpaired nucleotides, before base pairing WO 96no289 CA 02208794 1997-06-26 ~llu~9~ll69l6 occurs between the two side chains. Other groups may be used which provide ~,u~imately the same degree of flexibility. There will usually be only one bulge, but in some situations, one may have a bulge in each side chain.
Both of the members involved in the cross-linking will normally be provided S by an intermeAi~tP, at least one of which is not a nucleotide or modified nucleotide, although in some situations one of the members may be a nucleotide or modified nucleotide. By employing a difunctional molecule for insertion into the chain of the side chain, where the difunctional molecule carries the cross-linking agent, themembers of the side chains participating in the cross-linking may be conveniently 10 positioned for reaction. Various polyfunctional moleclllPs may be used to provide stable partiCir~tinn of the cross-linking moiety in the side chain. Desirably, agents will be used which can react with a phosphorus moiety, particularly a phosphoramidite, or can form a phosphoramidite, where the linking atom may be oxygen, carbon, sulfur, or the like. Core molecules for linking a cross-linking 15 moiety to the side chain, where the core molecule participates in the backbone of the side chain, include glycerol, dithiothreitol, 1 ,3,5-trihydroxycyclohPY~nP, deoxyribose, 2-hydroxymethylacrylic acid, or the like. Since the phosphorus group can be modified to react with a wide variety of function~litiçs, there is no cignific~nt restriction on how the core molecule is fitted into the backbone of the side chain.
20 Phosphorus derivatives include, phosphor~mi~ites, phosphate esters, phosphines, phosphoh~litles, etc.
In order to reduce the amount of cross-linking of probes in the absence of being bound to the target molecule, protective systems are provided. The pl~ltecLi~e system may employ duplex formation, where the duplex may be solely associated 25 with a side chain, ~oci~t~d with a sequence of the probe homologous to the target, or a side chain associated with an additional molecule. The duplex may form a hairpin (which includes a stem and loop), where a hairpin has at least three llnm~tshed contiguous nucleotides. Usually not more than about 8, more usually not more than about 5, of the nucleotides are llnm~tched. By hairpin is intendecl that the 30 turn to form the duplex has at least three nucleotides which are lmm~tçhPd By stem and loop is inttonded that there is more than three llnm~tchçd nucleotides at the turn to form the loop. By a bulge is intended that there are llnm~tched nucleotides along W O 96no289 CA 02208794 1997-06-26 PCT/IUS95/16916 the stem, which results in a bulge. Usually, if there is only one duplex forming side chain, it will be the side chain with the recipient or passive reactive group.
The first protective system has the terminal sequence of one side chain complem~-nt~ry in the reverse order, so that the hybriAi7ing sequences are both in the 5' - 3' direction as shown in Fig. 4. The hybr~ 7ing sequence of one side chain 11 has a cross-linking group 13 which comI rises a member of the cross-linking system. In con~id~rin~ how the two probes, the 3' probe l5 and the 5' probe 17 will exist in so1utiQn if the side chains hybridize, as shown in the Figure 4A, one should picture the stems forming dsDNA, where the 5' probe 17 has the member of the cross-linking system Y l9 in the hybridizing portion of the side chain, while the 3' probe l~ has the member of the cross-linking system X 13 distal to the hybricli7ing portion. The vertical lines 21 indicate base pairing. The 3' probe 15 is shown as extended so as to hybAdize to the sequence of the 5' probe complementary to the target, allowing lFor triplex formation 23 when the probes are bound to the target 25. The portion of the stem complemçnt~ry to the target hybri-li7ing portion will usually not exceed five nucleotides, usually not eYcee~ling three nucleotides. In Fig, 4B, the two probes are bound to the target 25. The 3' probe stem ll is hybridized to the S' probe stem 27, while the 3' probe is hybridized to the target, pulling the linking group around and the cross-linking member of the 3' probe 13into juxtaposition to the 5' probe cross-linking member 19.
By removing a member of the cross-linking system out of the hybri~li7ing region of the stem, even when the stems are hybrirli7ed, the probability of obsaining cross-linking without being bound to target is subst~nSi~lly ~limini~h~i. Furthermore, by having unreactive groups opposite the photoactivatable group in the hairpin, upon 2~ photoactivation, there will be no reaction. For example, by using an unreactive group, such as an unsubstituted sugar, dihydrothymidine, pseudouTidine, and the like, as the unit across from the photoactivatable group, the photoactivated group will not have a partner with which to react and will return to the ground state from the photoactivated state' to be available for a future reaction with a recipient group.
The linking chain which joins the stem forming sequence to the target homologous sequence of the probe may comprise any linking system which does not i1~telrel-e with the purposes of the probe and is convenient from a synthetic W 096~0289 CA 02208794 1997-06-26 PCTrUS95/16916 standpoint. Desirably, the linking chain is hydrophilic and may be a polyether, polyester, polypeptide, polyamine, etc. Thus the linking chain may comprise alkyleneoxy, wherein alkylene will generally be of from 1 to 3 carbon atoms and the total number of alkylene groups may be from 1 to 6, usually 2 to 4, peptide, where 5 the total number of arnino acids will be in the range of 1 to 6, usually 2 to 4, where the amino groups will usually be small, e.g. G and A, or hydrophilic, e.g. S, T, N, Q, D, E, K and R, sugars, where the total number of sacc-h~ritlic groups will generally be in the range of 1 to 6, usually 2 to 4, or combinations thereof, including 1 or more nucleosides which are not involved in hybritli7ing.
Instead of having a hairpin or stem and loop, one may have a bulge which preferably includes the photoactivatable group in an unreactive environmPnt The bulge may be as a result of a hairpin or the addition of an ~drlition~l sequencepartially homologous to the side chain. For e~mrle, the sequence c~ ing the bulge would lack the passive reactive moiety, as well as the bases complementary to the bases adjacent to the photoactivatable group. The bulge causing sequence would have bases complem~-nt~ry to bases of the side chain distal to the photoactivatable group. In the case of a bulge, the side chain will usually have at least 6, moreusually at least 7 bases, where at least two, preferably at least three and not more than about 5 bases, will not be m~t~hed by the bulge forming sequence. The basesin the bulge may or may not be m~t~hed to provide a ~i~çrh~in hairpin, the basesusually being other than thymidine. So long as the bulge forming sequence is bound to the side chain, the photoactivatable group will be hindered from reacting with the reciprocal side chain.
Alternatively, one or both of the stems may be extended by an oligonucleotide of from about 2, usually at least 3 to 10, usually not more than about 8 nucleotides, whose sequence is complementary to a portion of the target complemçnt~ry portion of the probe sequence. The duplexing portion would be displaced from the junction of the target complemçnt~ry sequence to the side chain sequence. This is shown in Fig. 5. Again the vertical lines intlit~te base pairing.
As shown in the figure, the hybridization forms a stem and loop which inc1tldes the cross-linking member X 41, particularly the photoactivatable group, so as to create steric hindrance around the portion of the side chain hybritli7in~ with the W O 96no289 CA 02208794 1997-06-26 P~-llu~t5sll69l6 other side chain. Where both the probes have duplPYin~ at their te~mini, the hybri~1i7ing belw~n the two stems will be subst~nti~lly ~iimini~hPA. However, when the probe binds to the target or a complement~ry probe, the side chain portion hybridized to the target homologous sequence of the probe will be displaced by the 5 target or probe, rPlP~cing the side chain to hybridize to the other side chain to form the stem. The portion of the probe to which the side chain sequence binds will be SPlP~tP~1 to bring the side chain around in a stem and loop, the region beginning not more than about 30, usually not more than about 20 nucleotides, from the last nucleotide hybri~li7in~ to the target, and beginning at least about 2, usually at least 10 about 4 nucleotides, from the last nucleotide of the side chain hybri~li7in~ to the complemPns~ry side chain.
In situations where one has two sets of probes, one may provide for a fifth probe or a side chain extension, (hereafter referred to as the "double side chain duplexing sequence") which serves to hybridize to the side chains on complem~nt~ry 15 probes. This is exemplified in Fig. 6. For the geometric eYp~n~ion, the complemtqnt~ry probes as pairs 67 and 69 and 71 and 73, respectively, may be totally or partially overlapping. The double side chain duplexing sequence 61 would hybridize to the two side chains 63 and 65 and the available portions of the target complemPnt~ry sequence 69. The photoreactive or passive groups X, 75 and 77, 20 are ~hiekled, while the passive or photoreactive groups(in relation to the nature of X) 79 and 81, need not be shiel~ecl. The double side chain duplexing sequence may include bases which hybridize with portions of the probe complementary to the target sequence. The portions will usually not exceed five nucleotides, more usually not exceed four nucleoti,des, where the double side chain duplexing sequence will 25 displace a portion of the sequence homologous to the target. Usually, the double side chain duplexing sequence would have at least about 6 members, more usually at least about 7 members and may have up to 30 members or more, where there will becomplem~nt~rity between at least 4 members and the side chains, usually at least 5 members and the side chains, preferably there being at least complement~rity 30 between the double side chain duplexing sequence and at least 6 nucleotides of the side chains.

W 096~0289 CA 02208794 1997-06-26 ~lr~ 5ll69l6 There are extensive methodologies for providing cross-linking upon spacial pl~ y between the side chains of the two probes, to form a covalent bond between one member of the stem and the other member of the stem. Conditions for activation may include photonic, thermal and chemi~l, although photonic is the 5 primary method, but may be used in combination with the other methods of activation. Therefore, photonic activation will be primarily discussed as the method of choice, but for completenPss, ~ltPrn~tive methods will be briefly mentioned. In ~lAition to the techniques used to reduce hybridization between the side chains when not bound to the target or complemPnt~ry probe, contlitionc may also be employed10 to provide for a substantial difference in the reaction rate when bound to a template sequence as compared to free in solution. This can be achieved in a wide variety of ways. One can provide concentrations where events in solution are unlikely and activation of the cross-linking group will be sl-fficiently short lived, so that the activated group is not likely to encounter another probe in solution. This can be 15 tested using control solutions having known concentrations of probes and determining the formation of cross-linked probes in the presence and absence of temrl~tP-. One may use quenchers that act to deactivate cross-linking groups on probes that are free in solution, where the quencher may accept energy, provide a ligand to replace a lost ligand, react with the cross-linking group to inhibit cross-20 linking with another probe, and the like. By adjusting the amount of quencher in themPAillm, one can optimize the desired reaction as compared to the background reaction. One may use senciti7~rs, where reaction only occurs upon activation of the cross-linking moiety by transfer of energy from the sPnciti7Pr to the cross-linking moiety. The ~i~nific~nt point is that the sen~iti7er~ which will be bound to the probe 25 carrying the passive reactive moiety, is directly irradiated and the energy will be dic~ip~t~Pd in solution in the absence of the photoactivatable cross-linking moiety accepting the energy. Acceptance of the energy has a much greater probability when the side chains are involved in stem formation. Se.nciti7~ors which may be employed include biphenyl, fluorenone, biacetyl, acetonaphthone, anthraquinone, bibenzoyl, 30 and benzophenone, or other sensitizers, which because of their triplet energies, find particular application with the coumarin functionality. These sPn~it-7~Prs may be . .

WO 96no289 CA 02208794 1997-06-26 ~ 5ll69l6 joined to the side chain in the same ma~ e as the photoactivatable moiety, as aniate site, usually within one or two bases from the passive reactive moiety.
One can also provide for a substantial difference (between probes bound to a tPmpl~te sequence and probes free in solution) in the reaction rate of the members of S the cross-linking system by s~~ t;n~ the cross-linking member or activatable member from the sequence providing for non-covalent association in one of the two side chains of the prob~s. In this manner, when the probes are free in sollltiorl~
although the side chain sequences may be non-covalently ~sori~ted, upon activation cross-linking will not occur because the requisite proximity of the cross-linking 10 members of the two side chains will not be present. In contrast, when the probes are bound to a temrl~te sequence, e.g. the target sequence, the sequences of the side chains will be non-covalently associated and the members of the cross-linking system will also be in the requisite spacial proximity for activation. The cross-linking member will be separated from the sequence in the side chain responsible for non-15 covalent association with the side chain of the second probe by a snfficiPnt (1i~t~nceso that when the two probes are hybridized to the template sequence, non-covalent association between the side chain sequences may still occur while the activatable members of each side chain will be in sufficient proximity for activation. Usingprobes with nucleic acid side chains as eYempl~ry, the sep~tion tlict~nee between 20 the sequences responsible for non-covalent association and the cross-linking member of the side chain in the first probe may range from S to 50 nt, usually from 6 to 40 nt and more usually from 6 to 30 nt.
In one aspect, one can employ photochemi~try where a single reactive species on one chain reacts with a group present on the second chain. A large number of 25 functionalities are photochemic~lly active and can form a covalent bond with almost any organic moiety. These groups include carbenes, nitrenes, ketenes, free r~rlic~
etc. One can provide for a donor molecule in the bulk solution, so that probes which are not bound to a temrl~te will react with the termin~ing molPcnle to avoid cross-linking between probes. Carbenes can be obtained from dia_o compounds, 30 such as ~ 7Onium salts9 sulfonylhydra_one salts, or ~ 7ir~nes. KPtPnPs are available from dia_oketones or quinone ~ 7i~les. Nitrenes are available from aryl a_ides, acyl a_ides, and a_ido compounds. For further information concP-rning W 0 96~0289 CA 02208794 1997-06-26 PCTAUS95/16916 photolytic genpr~tion of an unshared pair of electrons, see A. Schonberg, P,~ dLi~e Organic Photochemictry, Springer-Verlag, NY 1968. Tllllst~tive col,lpounds and t~ in~ting mol~cllles include olefins or compounds with a labileproton, e.g. alcohols, ~min.os, etc.
For specificity, one may use a molecule which upon photoactivation forms a covalent bond with a sperific other molecule or small group of mnl~ s via cyclo~ ition or photosubstitution reaction. There are a ~ignific~nt number of compounds which will react with nucleic acid bases to form covalent bonds.
Thymidine will react with thymidine to form a covalent link. Preferably, other compounds will be used which react with nucleic acid bases. These compounds willinclude functional moieties, such as coumarin, as present in substituted co"."~ c, furocoumarin, isocoumarin, bis-coumarin, psoralen, etc., quinones, pyrones, a,~-mc~tllr~tec~ acids, acid derivatives, e.g. esters, ketones, and nitriles; azido, etc.
Instead of having a reaction with a nucleotide, one can provide for two different reactants, where reaction is unlikely when the two rç~ct~nsc are not in proximity upon activation. Reactions of this nature include the Diels-Alder reaction, particularly a photoactivated Diels-Alder cyclization reaction, where a diene, and a dienophile e.g., olefin or acetylene, are employed. Reactive dienes may be employed, such as 1 ,4-diphenylbut~iene, 1 ,4-dimethylcyclt hey~lient~, cyclop~nt~ ne, l,l-dimethylcyclopent~ ne, but~tlit?ne, furan, etc. Dienophiles include m~leimide, indene, phenanthrene, acrylamide, styrene, quinone, etc. One may provide for stqnciti7ed activation to provide for the cycli7~tion, using such photoactivators as benzophenones with cyclopent~lienç, which may react with another cyclopent~-lito-ne molecule, or a different dienophile. .Alle, ~ rely, one may employ addition of ketones to olefins, as in the case of benzophenone and isobutylene or 2-cyclohexenone.
Another class of photoactive reactants are organomçt~llic compounds based on any of the d- or f-block transition metals. Photoexcitation induces the loss of a ligand from the metal to provide a vacant site available for substitution. Pl~cenntont of the organometallic compound on one side chain and a suitable ligand, on the other chain provides a system which relies on the proximity of the two chains for the cross-linking to occur. Suitable ligands may be the nucleotide itself or other W 096no289 CA 02208794 1997-06-26 PCTrUS9S/16916 moiPtiP~, such as ~mine,s, phosphines, i~onitrilt~s~ alcohols, acids, carbon mnno~id~, nitrile, etc. For further information regarding the photosubstihltinn of organomP-t~llic colllpounds, see "OrganomPt~llic Photochemi~trv," G.L. Geoffrey,M.S. Wrighton, Ac~dernic Press, San Francisco, CA, 1979.
~ 5 By using organometallic compounds having stable coordinaLion comrleY~s, where the ligands can be replaced with other ligands upon photo- or th~rm~l activation, one can provide for stable cross-linking. FY~mpl~s of organom~t~lliccompounds which may serve as cross-linking agents include four coordinate Group ~III metals, particularly noble metals, cyclopent~lienyl metal comI)leY~s, having at least one other ligand, and the like.
One may also employ active monomers which can tlimPri7P with a second monomer, such as styrene, acrylonitrile, vinyl acetate, acenaphthylene, ~nthr~cenç, etc. By activating one of the monomers photolytically, the activated monomer canreact with the other monomer on the other side chain. Particularly, by using twodirr~le~-t monomers, where the second monomer provides for a more st~ble active species than the first monomer, one may include a q~lPn~h~r in the reaction m~Aium so as to quench the active intermediate. In some instances, the interm~Ai~te will self-quench by elimin~tion or other suitable reaction. One may also provide for photolytically activated homolytic or heterolytic cleavage, such as active h~ es, e.g. benzyl halides, particularly bromo and iodo, where upon cleavage, the active molecule would act with a reçipient molecule, such as an olefin which would provide for addition of the carbon and halogen across the double bond.
Other reactions which might be employed include photonucleophilic aromatic substitl-ti~n.
Thermal activation may also be employed, but is less desirable in many cases since until the ~I"~ ture is lowered, the reactive species is m~int~in~A. Therefore, this will usually require lower concentrations of at least one of the probes, the ability to rapidly change the temperature of the system, and the selection of re~ct~nt~ which provide for a high energy barrier for reaction in the absence of spacial proximity.
Reactions which may be employed include ones described above for photolytic activation, such as metal coordination complex cross-linking, and the like.

WO 96/20289 CA o 2 2 o 8 7 9 4 19 9 7 - o 6 - 2 6 PCI~/US9~/16916 ~l1uctr~tive of such cross-linking is the use of pl~tinllm tetr~ nt~te complPYPs, e.g.
~mmoni~ compleYPs.
Also, chPmic~l reactions can be employed where one provides for cycling of the active moiety in the absence of reaction with the recipient re~rt~nt Thus, one S can provide for a redox couple, such as ferrous and ferric ions, where the active species free in sclutinll would normally be inactivated prior to enco~ g the re~ipi~nt compound. For ~Y~mple, one could have a hydroperoxide as the reactant species and an active olefin as the recipient. Upon reduction of the hydlu~u~ide, a free radical can be obtained which can react with the electron donor compound, 10 which can then be further reduced to a stable compound.
Any of the various groups indicated may be modified by repl~cem~o.nt of a hydrogen with a functionality or convenient linking group for ~tt~chm~nt to the backbone of the side chain. These functionalities will, for the most part, be oxy, oxo, amino, thio, and silyl.
lS The probe homologous sequence which binds to the template will usually be naturally occurring nucleotides, but in some inct~nce.s the phQSph~t~-sugar chain may be modified, by using unnatural sugars, by substih-ting oxygens of the phosphatewith sulphur, carbon, nitrogen, or the like, by mo~1ific~tit~n of the bases, or absence of a base, or other mo~ific~tion which can provide for synthetic advantages, stability 20 under the conditions of the assay, reci.ct~nce to enzymatic degradation, etc. The homologous sequence will usually have fewer than 10 number % of the nucleotides dirre~nt from the target sequence, and usually the lesser of 10 number % and 10 nucleotides, more usually S nucleotides. The relationship of the pairs of probes will usually come within the same limitations, but will more usually be complementary, 25 that is, have perfect nucleotide pairing. Differences between sequences may include insertions, deletions, and substitutions, i.e. transitions and transversions. If one wishes one may have more than one set of a pair of probes speçific for a target sequence, and may simultaneously have 2 or more sets of probes, usually not morethan 10 different sets, more usually not more than about 5 different sets, directed to 30 different target sequences. A probe set is one pair for linear expansion and two pairs of probes, for geometric expansion, where for geometric expansion, the probes have homologous binding sequences, so as to bind to target sequence and to each other.

W 0 96~0Z89 CA 02208794 1997-06-26 ~l/u~5ll69l6 Where one has a plurality of probe sets, each of the probe sets will ~en~-.~lly be distingui~h~hle in some assay, for example, by size difference, by label difference, by sequence, etc.
In some in.ct~nces it may be desirable to provide three different probes, 5 where ~ree probes define three contiguous sequences and two stems, the middle probe having two side chains, so as to interact w~th each of the other side chains of the other two probes. This can be particularly useful with regions of polymorphism, where the central probe is directed to a conserved region, and one or both of the other probes are directed to polymorphic regions or vice versa. One may then use a 10 plurality of probes, one for each of the polymorphic regions, where cross-linking will result for any of the polymorphic sequences being present.
The probes may be ~lcpalcd by any convenient synthetic scheme. In one scheme, the side chains may be plc~alcd first, followed by being linked to the sequence homologous to the target sequence. The synthesis of the side chains will 15 depend, of course, on the nature of the pairing groups. For oligonucleotides,convention~l manual or automated techniques may be employed. One or more of the monomers may comprise a cross-linking group. By employing a linker in the backbone which employs a deoxyribosylphosphate group or can substitute for the deoxyribosylphosphate group, the cross-linking cont~ining group may be readily 20 inserted into the backbone during the synthesis. The side chains may have terminal functionalities that allow for direct linkage of the sequence homologous to the target sequence, e.g. a nucleotide 5'-triphosphate or nucleotide having a free 3'-hydroxyl.
The homologous sequence may be joined by lig~tic~n, by using the side chains in conjunction with a primer for PCR, or other linking means. The side chains may be 25 used to ~l",illate a chain being produced on a bead or may be the initi~ting group bound to the bead by a cleavable linker. Thus side chains can be provided as reagents for use in automated synthesis, where the side chains will provide the initi~tin,, or termin~ting reagent. Various attachment groups may be provided for the side chain, where the side chain is to be ~tt~hed to a bead. Functionalities on 30 the bead can be hydroxy, carboxy, iminohalide, amino thio, active halogen or pseudohalogen, carbonyl, silyl, etc. For ease of removal from the bead, various linkers may be employed which will include groups, such as benzhydryl ethers, WO 96no289 CA 02208794 1997-06-26 ~1/U~,95/16916 ~et~l~, in~ din~ sulfur analogs thereof, o-nitrobenzyl ether, 7-nitroindanyl, cyclic anhydrides, polypeptides having a sequence recognized by a peptidase, silanyl, ~-(electron withdrawing group) substituted esters, or the like. The particular linking group which is selecte~ will depend upon the nature of cross-linking group and the 5 manner in which it is bonded to the side chain backbone.
Of particular interest are compositions which provide the hyhri~li7ing side chains and can be joined to sequences homologous to target sequences, to provideprobes. Comhin~tionc of stem forming oligonucleotides are used. Depending on which technique is used to ~1imini~h probe cross-linking background, the 10 compo~itic)n~ providing for a cross-linking member will have the following formula:
(1) N - X~, - Z - Xb- Zc - (X,)c (2) N -A - Z - B - X" or (3) N-XI -Z-X2b-A-X3 wherein:
lS N is a moiety capable of ligation to a nucleotide, which may comprise anhydroxyl group, a phosphate group, a triphosphate group, or the like, incl~rlingnllclP~si~es, nucleotides, phosphor~mi~lites~ phosphate esters, sugars, hydroxyalkyl or -aryl groups, and the like;
X is a nucleotide, naturally occurring or synthetic, capable of hydrogen 20 bonding to another nucleotide, preferably at least one X will be ~ nosine, and when other than duplex formation of the stem is present in the probe, usually at least about 50% of the stem base pairing X's will be adenosine; when Z reacts with thymidine, generally of the total nucleotides in the stems, at least about 30%, more usually at least about 50% will be thymidine and adenosine, where the hybritli7ing nucleotides 25 have each stem in the same direction, e.g. S' - 3' or 3' -S or opposite direction, e.g.
S' - 3' pairing with 3' - 5'; the combination of (1) and (1) and (1) and (3) will have the stem oligonucleotides in the opposite direction, while the combination of (1) and (2) will have the stem oligonucleotides in the same direction;
Z is a cross-linking group having, usually as a side chain, a moiety capable 30 of cross-linking with another moiety, conveniently with a nucleotide, or a member of complement~ry specific reactive pair, more particularly as a result of photoactivation (see groups described above); or a sen~iti7~r (see groups described above), at least one Z in a comhin~tit n of stems will be a cross-linking moiety; Z
will usually be of at least about 8 atoms other than hydrogen, more usually at least about 10 atoms other than hydrogen, and not more than about ~0 atoms, more usually not more than about 36 atoms other than hydrogen, where Z may be - 5 :lliph~ti(:, alicyclic, aromatic, heterocyclic, or combinations thereof, where cyclic having from about 1 to 3 rings, which may be fused or non-fused, composed of carbon, oxygen, nitrogen, sulfur and phosphorus, compri~ing functional groups, such as oxy, oxo, amino, thio, cyano, nitro, halo, etc., usually having at least one heteroatom, more usually at least about 3 heleroalollls, and not more than about 10 he~oa~ol,ls;
Xl and x2 are a nucleotide or oligonucleotide of the stems which hybridize with each other and will generally be at least 2 nucleotides, having a total number of nucleotides in the range of about 2 to 20, usually 2 to 18, more usually about 3 to 16, and preferably not more than about 8 hybri~li7ing base pairs, more usually not more than about 6 hybri~i7ing base pairs, usually in the range of about 2 to 6, more usually in the range of 3 to 6, hybridizing base pairs;
X3is a sequence of at least 2, usually at least 3, nucleotides which is compleme-nt~ry to and hybridizes with a sequence of the probe which binds to thetarget sequence, so as to form a hairpin comprising at least 3 members, usually at least about 4 members and not more than about 12 members, usually not more than about 8 members which are not involved in base pairing, and which hairpin incllldes Z, where Z will be a cross-linking member which does not react with the base of a nucleoside;
A and B are linking groups, which will usually be other than nucleotides, where A and B are of s~ ficiPnt length to permit the two stems to hybridize witheach stem in the same direction, e.g. 5' - 3' or 3' -5', so that the number of atoms in A and B will be determined by the length of the complemPnt~ry stem, the nature and flexibility of A and B, and the like; usually A and B will have a total of at least about 10 atoms in the chain, more usually at least about 12 atoms in the chain and not more than about 60 atoms in the chain, where the side groups will be SP-lPctP~
for synthetic conveniP~nce, solubility, inertness, absence of intelr~reilce in the assay and the like; A and B may be aliphatic, alicyclic, aromatic, h~Lero~;yclic or wO96nO289 CA 02208794 1997-06-26 PCTrUS95/16916 comhin~tion.c thereof, and may be monomeric or oligomeric, such as polyethers, e.g. polyalkyleneoxy, oligopeptides, e.g. polyglycyl, polyurethanes, polymethylene, e.g. polyethylene, polyacrylate, polyvinylether, etc.,; usually A and B will be at least about 6 carbon atoms, more usually at least about 8 carbon atoms and not more S than 100 carbon atoms, more usually not more than about 60 carbon atoms and preferably not more than 36 carbon atoms, usually having at least 1 h~Lel~oalùl,,s, more usually at least 2 he~eroatol,-s and not more than about 36 heteroatoms, usually not more than about 20 heteroatoms, where the heteroatoms may be oxygen, niL.ugell, sulfur, phosphorus, halogen, and the like; and a, b and c are integers of a total in the range of 2 to 20, where a is at least one, b may be 0 or greater, usually at least 1, c usually being 0 or 1, and the total number of nucleotides for base pairing are at least 2, usually at least 3 and not more than about 20, usually not more than about 16, preferably not more than about 8,generally being in the range of 4 to 6 base pairs.
1~ The side chain compositions described above are used in combination forlinking two adjacent sequences homologous to the target sequence. Either of the side chain compositions can be selected for linking to the 3' or 5' ~lllinus of the homologous sequence. The second side chain will usually have nucleotides compl~ment~ry to the nucleotides of the first chain to provide hydrogen bonding. In the ~implest second chain, it may be a poly-T, where the cross-linking group reacts with thymitlint~, and the nucleotides in the first chain are adenosine. Where the first chain has other than adenosine bases, the second chain will usually have the complemPnt~ry bases. The first and second side chains can be provided as reagents for linking to the homologous sequences, as termini of primers for PCR to provide the probes directly, or the like.
In addition, one or both of the side chain compositions may terminate with a label (including ligand) which allows for detection, such as a directly det~ct~ble label, e.g. radiolabel or fluorescer; chemilllminescer, biotin, antigen, photocatalyst, redox catalyst, or the like, for detection of the cross-linked probes.
In carrying out the assay, the sample may be subjected to prior tr~-~tm~nt The sample may be a cellular lysate, isolated episomal element, e.g. YAC, pl~mid, etc., virus, purified chromosomal fragments, cDNA generated by reverse W O 96~0289 CA 02208794 1997-06-26 PCT~US95/16916 ~nc~rirtase, mRNA, etc. Depending upon the source, the nucleic acid may be freed of cellular debris, proteins, DNA, if RNA is of interest, RNA, if DNA is of in~e~e~, size s~ te~l, gel electrophoresed, restriction enzyme digested, sheared, fr~gmPnted by ~lk~lin~o hydrolysis, or the like.
For linear e~tp~rl~iQn, only one pair of probes is required. After each m~.ltingstep, linked probes will be obtained in l~r~o~ 1 ion to the amount of target DNApresent. For geometric expansion, two pairs of probes will be used. Where the target sequence is a single strand, the initial pair would be homologous to the target and the pair having the analogous sequence to the target added concG~ y or after the first cycle of cross-linking. Where the sample is double s~nde~i, then both pairs of probes, a pair for each strand, are added initially.
The probes and rPmpl~t~ will be brought together in an a~r~liate m~Aillm and under conditions which provide for the desired stringency to provide an assay mPAillm Therefore, usually buffered solutions will be employed, employing salts,such as citrate, sodium chlori~i~, tris, EDTA, EGTA, m~gnesi~lm çhlnride, etc.
See, for eY~mple, Molecular Cloning: A Laboratory Manual, eds. Sambrook et al., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1988, for a list of various buffers and con~itions, which is not an eYh~lstive list. Solvents may bewater, form~mif~e, DMF, DMSO, HMP, alkanols, and the like, individually or in combination, usually aqueous solvents. Temperatures may range from ambient to elevated ~e-,~peldl-lres, usually not eYcee~iing about 100~C, more usually not exçee~ling about 90~C. Usually, the lel"pt:ldt~lre for photochemical and chemi~
cross-linking will be in the range of about 20 to 60~C. For th~rm~l cross-linking, the temperature will usually be in the range of about 70 to 120~C.
The ratio of probe to target nucleic acid in the assay m~ m may be varied widely, depending upon the nature of the cross-linking agent, the length of the homology between the probe and the target, the differences in the nucleotides between the target and the probe, the proportion of the target nucleic acid to total nucleic acid, the desired amount of ~mplific~tion, or the like. The probes will usually be about at least equimolar to the target and usually in substantial excess.
Generally, the probes will be in at least 10 fold excess, and may be in 106 foldexcess, usually not more than about lOl2 fold excess, more usually not more than W O 96no289 CA 02208794 1997-06-26 P~~ 9~ll69l6 about 109 fold excess in relation to the target during the first stage. The initial ratio of probes to target nucleic acid may be m~int~ined during succe~ive cycles or may be allowed to tlimini~h by the amount of reaction of the reactive species. The ratio of one probe to the other may also be varied widely, depending upon the nature of the probes, the differences in length of the homologous sequences, the binding affinity of the homologous sequences to the target sequence, the role of the probe in the cross-linking system, and the like. Conveniently, the probes may be eq--imol~r, but may vary in the range of 1:1-20 more frequently, 1:1-10, where, when there is only one reactive or activated species, the passive side chain will usually be in excess to subst~nti~lly ensure that the passive probe is bound to the template whenever the photoreactive probe is present on the template.
Where the sample is double stranded, it will usually be denatured, where denaturation can be achieved chemically or thermally. Chemic~l denaturation may employ sodium hydroxide in an a~r~liate buffered me~ m, e.g., tris-EDTA
(TE). Triplex formation may be employed. However, where triplex formation requires complexing the probes with RecA, there will generally be no advantage to such a protocol, since it requires the continuous presence of natural or active RecA
which will be subject to denaturation.
During the course of the reaction, depending upon how the assay is carried out, there may be significant evaporation. Therefore, it will normally be desirable to put a coating over the assay medium which inhibits evaporation. Various heavyoils may find use, such as mineral oil, silicone oil, vegetable oil, or the like.
Desirably, the oil should be free of any cont~min~nt~ which might inl~lrel~ with the assay. Alternatively, one may use sealed systems, where evaporation is inhihit~d.
The amount of target nucleic acid in the assay me~ m will generally range from about 0.1 yuctomol to about 100 pmol, more usually 1 yuctomol to 10 pmol.
The concentration of sample nucleic acid will vary widely depending on the nature of the sample. Concentrations of sample nucleic acid may vary from about 0.01 fMto 1,uM. In fact, the subject method has the capability to detect a single molecule in the absence of ~ nifi~nt interference. The amount of the probes may be varied and their concentration varied even more widely, in that there will usually be at least about an equimolar amount of the probes and as in~ir~ted previously, large excesses W 096~0289 CA 02208794 1997-06-26 ~~ g~/16916 of one or the other or both of the probes may be present. Where the target is single st-~nde~, one may initially use subst~nti~lly less of the probe in relation to the target since there is no co~ liLion between the probes and an homologous sequence for the target. Where the target is double stranded, initially, one will normally use more of the probes so as to çnh~nee the competitive advantage of the probes for the comrlemPnt~ry sequences as against the target sequences of the ~mrle Where ch~m;c~l denaturation has occurred, normally the m~lillm will be n~utr~li7~1 to allow for hybridi7~tic)n. Various media can be employed for neut~li7~tion, partieularly using mild acids and buffers, such as acetic acid, citrate, etc., conveniently in the presence of a small amount of an innocuous protein, e.g.
serum albumin, ,B-g]obulin, etc., generally added to provide a concentration in the range of about 0.5 to 2.5 % . The particular neutralization buffer employed is selected to provide the desired stringency for the base pairing during the subsequent incubation. Conveniently the stringency will employ about l-lOx SSC or its equivalent. The base pairing may occur at elevated temperature, generally r~nf~in~
from about 20 to 65~C, more usually from about 25 to 60~C. The incubation time may be varied widely, depending upon the nature of the sample in the probes, generally being at least about 5 minut~s and not more than 6 hours, more usually at least about 10 minutles and not more than 2 hours.
After sufficiPnt time for the base pairing to occur, the reactant may be activated to provide cross-linking. The activation may involve light, heat, che-mic~l reagent, or the like, and will occur through ~ch~tion of an activator, e.g. a means for introducing a chçmir~l agent into the medium, a means for mod~ tin~ the tell~e.dture of the me-lillm, a means for irr~ ting the medium and the like. Where the activatable group is a photoactivatable group, the activator will be an irr~ tion means where the particular wavelength which is employed may vary from about 250 to 650 nm, more usually from about 300 to 450 nm. The intensity will depend uponthe particular reaction and may vary in the range of about 0.5 W to 250 W.
In order to obtain amplific~tion, it will now be necç~ry to melt probes bound to the templ~t~. Melting can be achieved most conveniently by heat, generally heating to at least about 60~C and not more than about 100~C, generally in the range of about 65~C to 95 ~C for a short period of time, frequently less than wo s6no28s CA 02208794 1997-06-26 PCT~USg5/16916 about 5 min~-tP~, usually less than about 2 minUtP-S, and normally for at least about 0.1 minutP, more usually for at least about 0.5 minute. While ch~omi~l mPlting may be employed, it is ineffici~nt and will only be used in special circumct~n~ es, e.g. thenn~l activation. After the melting, the medium will usually be cooled by at 5 least about 20~C, usually 30~C or more. During the incubation and photoactivation, the Ir".p~,.tllre will be dropped to below 65~C, usually below about 55~C and may be as low as 15~C, usually be at least about 40~C.
Activation may then be initi~tPrl immediately, or after a short incub~tion period, usually less than 1 hour, more usually less than 0.5 hour. With 10 photoactivation, usually e~rtP-nde~l periods of time will be involved with the activation, where incubation is also concurrent. The photoactivation time will usually be at least about 1 minute and not more than about 2 hours, more usually at least about 5 minutes and not more than about 1 hour. This process may be repeated if desired, so that the melting-~nnP~ling and photoactivation may occur with from 1 15 to 40 cycles, more usually from 1 to 30 cycles, preferably from 1 to 25 cycles.
During the cycles, the amount of probe may be repleni~he~ or Pnh~nced as one proceeds. The enh~ncemPnt will usually not exceed about five fold, more usually not exceed about two fold.
As the reaction proceeds, in the case of linear expansion, at each stage there 20 will be hybridization with the target and additional linked probes formed in relation to the amount of target DNA. For geometric expansion, if the original target wassingle stranded, in the first cross-linking step, there will be the target nucleic acid as a tP-mpl~te and the cross-linked nucleic acid, which can now serve as a template for the probes having the same sequence as the target nucleic acid. In the next stage, 25 one will now produce templates of probes having the same sequence as the target and the homologous sequence as the target. Thereafter, for each subsequent cycle, one will form cross-linked probes on the target sequence fPmr~l~tP~ as well as on the two different cross-linked probe templates. The situation is analogous with double stranded nucleic acid, except that in the first step one needs to provide probes for 30 both target tPmpl~tPS and there is an initial geometrical expansion as to both of these probe sequences.

W 0 96~0289 CA 02208794 1997-06-26 ~ 5/16916 The res~lltin~ compositi~ n~ will ComI~ri~p cross-linked probes. Such compo~itio~t~ may be used as probes to identify homologous sequences, to isolatetarget sequences having homologous sequences, and the like. The co~ osiLions find particular use in identifying the presence of the target sequence in the sample.At the end of the iterations or cycles of steps, the presence and amount of cross-linked probes may be determined in a variety of ways. Conveniently, gel electrophoresis may be employed and the amount of cross-linked probes detel.,~i.led by the presence of a radioactive label on one of the probes using ~utor~-liogl~hy;
by st~inin~ the nucleic acid and rlPtPCting the amount of dye which binds to thecross-linked probesg by employing an antibody specific for the ~limeri7Pd probe,particularly the cross-linked area, so that an immlmo~ y may be employed; or thel~ke.
If desired, for qu~ntit~ti()n7 an internal control may be provided, where a known amount of a known sequence is introduced, with a known amount of probes, equivalent to the probes for the target sequence of interest. By carrying out the assay, one would obtain linked probes from the control and linked probes related to any target sequence present in the sample. By taking aliquots of the assay rnedil~nn during the assay and after each or dirr~i~nt numbers of cycles, one can determine the effl~iency of the assay conditions, as well as ratios of cross-linked control probes to cross-linked sample probes. If one has an ç~stim~tP of the amount of sample DNA
which should be present, one can terminate the assay once the amount of cross-linked control probe in~ tPs that there should be sllfficient cross-linked sample probe to be detectable. By having a fluorescent molecule on one side chain and aq~lPrl~-hP~ molecule on the other side chain, one can monitor the degree of cross-linking in relation to the change in fluorescPnce of the assay me lillm.
Instead of separating the probes from the assay mP~lium, detection techniques can be employed which allow for detection during the course of the assay. For eY~mple, each of the probes may be labeled with different fluorophores, where the energy of the emitted light of one of the fluorophores is in the absorption band of the other fluorophore. In this way, there is only energy transfer when the two fluorophores are in close proximity. See, for example, U.S.Patent Nos. 4,174,384, 4,199,599 and 4,261,968. By exciting a first fluorophore at a wavelength which W 096~0289 CA 02208794 1997-06-26 PCT~US95116916 does not excite the second fluorophore, where the first fluorophore emits at a wavelength absorbed by the second fluorophore, one can obtain a large Stokes shift.
One reads the fluorescence of the second fluorophore, which is related to the number of first and second fluorophores which are in propinquity. During the course of the S assay, at the end of each cycle, one can determine the fluorçsc~n~e of the m~ m at the e-mission wavelength of the second fluorophore as a measure of the amount ofcross-linking and inflic~tive of the presence of the target sequence and its amount.
To provide a more qll~ntit~tive measurement, one can use controls having a knownamount of target sequence and co",pa~e the fluorescent signals observed with the10 sample and control.
By virtue of the fact that one is linking two probes, one can use different labels on the different probes to allow for detection of cross-linking. Since the two labels will not be held together except when the two probes are cross-linked, one can use the existence of the two labels in a single molecule to measure the cross-linking.
15 For eY~mI)le~ by having one label which is a member of a specific binding pair, e.g.
antibody and ligand, such as digoxigenin and anti-digoxigenin, biotin and streptavidin, sugars and lectins, etc., and having the other label providing a tect~hle signal either directly or indirectly, one has the opportunity to s~aldte the cross-linked probes on a solid support, e.g. container surface or bead, e.g. m~nt~tic 20 bead, where the detect~hle label becomes bound to the solid support only when part of the cross-linked probes. For direct detection, one may have fluorophores, chPmill-minescçrs, radiolabels, and the like. ~or indirect detection, one will usually have a ligand which binds to a reciprocal member, which in turn is labeled with a detec~hle label. The detectable label may be any of the above labels, as well as an 25 enzyme, where by adding substrate, one can determine the presence of cross-linked probe.
Where one has ternary probes, particularly with a polymorphic target, a central probe to a conserved region and outer probes for the polymorphic regions, one can use differentially detect~ble labels on the outer probes and a ligand on the 30 central probe for s~L)alahon. In this way, one can readily determine which polymorphism(s) are present. The separation of the cross-linked probes provides the advantage of isolation of the cross-linked probe from the uncross-linked probe W 096no289 CA 02208794 1997-06-26 ~-l/US9~/16916 carrying the label, allows for washing of the bound probe, and ~ uvdl of non-sperifi~lly bound label. Thus, background due to uncross-linked label can be ~imini~he,d .
A diverse rcmge of target sequences can be del~ ed in acco~allce with the - 5 subject protocols. The subject methodology may be used for the d~Pt~Pctic n of b~Ctp-ri~l and viral dice~ces~ plasmid encoded antibiotic rçcict~nce l-l~h~i~, genetic ~ice~ceS and genetic testing, veterinary infections for commercial livestock and pets, fish stocks in fish farming, sexing of ~nim~l~, analysis of water systems for cont~min~tion by or~nicmC or waste m~tPri~lc, and the like.
Among b~rlPri~l and viral ~lice~ces are: Chlamydia trachomatis, Neisseria gonorrhoe~, Mycobacterium tuberculosis, T-T~Pmeophilus ducreyi (chancre, chancroid), Treponema p~llidillm (syphilis), Helicobacter pylori, Mycoplasma, Pneumocystic carinii, Borrelia burgdorferi (Lyme disease), Salmonella, T~gionPll~
T istPri~ monocytogenes, HIV I and II, HTLV-II, Hepatitis A, B, C, and D, Cytomegalovirus, human Papillomavirus, Respiratory syncytial virus, Epstein-Barrvirus, Dengue (RNA virus), Eastern and Western Encephalitis virus (RNA viruses),Ebola virus, and Lassa virus.
Chlamyida trachomatis is the cause of the most prevalent sexually tr~ncmitt~A
disease in the U.S.~ leasing to 4 million cases annually. Nucleic acid targets useful for cletecting all 15 serovars of C. trachomatis include: 16S ribosomal RNA geneand the rRNA itself, and the major outer membrane protein (MOMP) gene. C.
trachomatis also contains a highly conserved 7.5 kb cryptic plasmid. Allserovarscontain this pl~cmid and there are typically 7-10 copies of the pl~cmid per elemPnt~ry body.
N~iCSPri~ gonorrhoeae, the cause of gonorrhoe~e, has species specific sequences useful for its detection, which include: 16S ribosomal RNA gene and the rRNA itself; a 4.2 :kb cryptic plasmid that is present in 96% of al clinical isolates with applu~imately 30 copies present in each bacterium; and the cppB gene, typically present on the plasmid, is present in all strains, in~ ling those lac;king the pl~mi~l .
Mycobacterium tuberculosis, the cause of tuberculosis, has species specific nucleic acid sequences useful for detection, which include: 16S ribosomal RNA

wO96nO289 CA 02208794 1997-06-26 ~-1rU~5S/16916 gene and the rRNA itself; and an insertion sequence, IS6110, sperific for the M.tuberculosis complex, which comprises M. tuberculosis, M. ~m~mlm and M.
microti. The copy number of the insertion sequence varies from 1-5 copies in M.
bovis to 10-20 copies in M. tuberculosis.
s~lmQnpll~ has species specific genes which include: an insertion sequence IS200; invAgene, himA gene; and the Salmonella origin of replication, o~. The inYA gene has been identifi~d in 99.4% of about 500 strains of Salmonella tested.
This gene codes for proteins eSsenti~l for invasion by the S~lmonPll~ organism into epithelial cells. In ~rlt1ition, 142 strains from 21 genera of b~tPri~ different from Salmonella were al found to lack the invA gene. Simil~rly, the insertion sequence IS200 has been identified in almost all Salmonella strains. One additional advantage in ~eLing the IS200 sequence is the presence of multiple gene copies in most strains of Salmonella.
Hepatitis B virus is a DNA virus with an unusual genomic org~ni7~tion.
Virions are likely to be detected in the blood. There is a high degree of conservation in many regions of the genome. The genome is small, 3.2 kb, and, with overlapping reading frames, there is strong selection l~lcs~ule against sequence variation. Candidate probes from the overlap between the polymerase and S antigen coding regions include~ l-l-lCTTGTTGAACAAAAATCCT(SEQ ~
20 NO:01)and TTTCTAGGGGGAACACCCGTGTGTCT(SEQID NO:02), where the probe would include at least about 12 nt coming within the in~ic~t~1 sequences.
Hepatitis delta is a single-stranded RNA genome that is encapsulated in Hepatitis B virus coat proteins. Delta infection requires simultaneous or pre-existing HBV infection and generally aggravates the clinical condition. Virions cont~ining 25 either the delta or HBV genome may be detected in blood ~mples. The delta genome encodes one known protein, the delta antigen, that is believed to be required for replic~ting the viral RNA genome (cellular con~tituents are also required).
Sequences of interest as probes come within the sequence:
CTGGGAAACATCAAAGGAATTCTCGGAAAGAAAGCCAGCAGTCTCCTCTT
30 TACAGAAAAG(SEQIDNO:03).
Cytomegalovirus has a large linear double-stranded DNA genome. The virus is found in blood and to a limited extent infects lymphocytes and is also found in w o~n~q CA 02208794 1997-06-26 PCTrUS9~116916 urine. There are repeated regions in the genome allowing for detecti~ n of such repe~t~l regions. Where only limited viral fr~n~criI)tion has occurred, the TmmPAi~te Early Region would be the target, while for productive infectic)n, probes to the viral glycop1utein genes would be employed.
Human papillomavirus is a circular double-st~n~ DNA and probes may be targeted to any region of the genome. Of particular interest are probes to the E6tE7 coding region, where one may ~1iccrimin~te between genotypes, e.g. HPV 16 and 18, of interest in North ~mPriC~, while other genotypes, such as 31, 33, 35, Sl, and 53 may be rli~gno5tic for cervical cancer in other parts of the world.
F.I~stein-Barr virus, the causative agent of mononucleosis and lymphocytic cancers, may be assayed in the sputum.
For acute viral infections, such as Ebola and Lassa, a rapid test not dependent on antibody formation could be of advantage in treating the patient. CSF
fluids may be monitnred for bacterial and viral infections, reclllting in menin~itic and encephalitis. Transplant p~tientc may be monitored for CMV, herpes, BK and JC viruses.
In the case of plasmid-encoded antibiotic recict~nce genes, there is great concern whether a pathogenic organism is resistant to one or more antibiotics.
Vancomycin is an e~ctremely important drug for tr~tm~nt of strains of Staphylococcus and Streptococcus that are resistant to other antibiotics. Some strains of enterococcus are re~ist~nt to vancomycin. Probing for vanco~1lycin recict~nce may serve to reduce the tr~ncmiCcion of vancomycin recict~nce. Probesfor ~letecting vanconnycin recict~nce include CATAGGGGATACCAGACAATTCAAAC(SEQIDNO:04);
ACCTGA~CGTG-CGC~GTTCACAAAG~SEQID~OQ5};
ACGATGCCGCCATCCTCCTGCAAAA(SEQIDNO:06; and (SEQIDNO:07).
Other targets of interest are the TEM-1 gene (,B-lactamase) found in Enterob~teri~re~; TEM-l gene in penicillin~ce producing N. gonorrhoeae (PPNG) pl~cmi~; genes conferring aminoglycoside antibiotic recict~nce; genes conferring30 erythromycin resistance; and genes conferring rif~mpin recict~nce, especially associated with M. tuberculosis.
.

WO 96/20289 CA 02208794 1997 - O6 - 26 PCI~/IJS95116916 Also of interest is amniocentesiC or other procedure for ;~Q1~t;ng fetal DNA, where the interest may be in the sex of the fetus, gross chromosomal aberrations, e.g Down's syndrome, where one would qu~ntit~te the level of chromosome 21.
The sequences specific for the various pathogens, genes or the like will 5 provide for ~rerificity as to a particular genus, species, strain, or a particular gene, structural or non-structural. Usually, at least lS, more usually at least 18 nt probes will be employed which are homologous to the target of interest. These homologous sequences are joined to an a~-ul,-iate side chain to provide the probe. There will be at least one set of probes, usually at least two sets of probes, where the two sets 10 are homologous to complementary strands of the target sequence. Combinations of sets of probes for the pathogens may be provided as kits, where more than one portion of the target host genome may be targeted for binding by the probes. Probes will be selpctp~ to provide for minimum false positives, screening the probes with s~mples from a plurality of individuals from whom one would obtain physiologicallS samples, e.g. blood, serum, urine, spinal fluid, saliva, sweat, hair, or other source of DNA or RNA to be cletected.
The ~mples will be processed in accordance with conventional ways. Where cells are involved, the cells may be lysed chPmic~lly or mech~nic~lly and the nucleic acid i.~ol~t~rl. Where RNA is the target, inhibitors of RNAses will be employed and 20 the RNA will usually be reverse transcribed to provide the target sequence as DNA.
Processing may involve fragmentation of the nucleic acid by mPch~nil~l means, restriction enzymes, etc. Separations may be involved, where the nucleic acid may be s~.,.led by size, e.g. electrophoresis, chromatography, sP~imPnt~tion, etc.
Usually, the nucleic acid will be freed of other components of the lysate, such as 25 membranes, proteins, sugars, etc., frequently being denatured in the process. The particular manner of isolating the target nucleic acid is not critical and will be chosen in accordance with the nature of the sample, the nature of the target, and the like.
For carrying out the methodology, various heating and cooling systems may 30 be employed, such as a thermal cycler, regulated temperature baths, and the like.
The l~t;lili\~e nature of some of the steps of the methodology, e.g. melting and ~nn~ling of nucleotide sequences and activation of the activatable groups of the W 096120289 CA 02208794 1997-06-26 P~llu~,~5116916 probes, provides for the O~ lLul~ / of employing automatic devices for ~lr~ g the subject assays. Of interest are automatic devices which automate the (1) preincubation, (2) hybrici;7~tion~ (3) photoirradiation, (4) denaLuldLion and (5) post-pr~cescing steps of the subject methotlolngy, and which are capable of cycling 5 between steps 2-4. Automatic devices which may be employed will generally comprise a means for controlling the base pairing or hybric~i7~ti~n con-litit-n~ of the assay mylillm, e.g. for mocl~ ting the temperature of the mP~i~lm; and a means for actuating, in a manner responsive to the conditions of the assay m~Aillm, an activator of the activatable groups of the probes.
The means fi~r controlling the base pairing conditions of the assay mPrlillm may be any means capable of modulating the conditions of the m~lillm, preferablyreversibly, from a first state in which base pairing of complementary nucleotidesequences occurs, i.e. medium conditions conducive to ~nne~ling or hybn~1i7~tion of compl~ment~ry nucleotide sequences, to a second state in which base-paired or hybridized nucleotide sequences dissociate or melt. As described above, the conclitions of the assay mç~ m may be modulated through both thermal and chemical means, bul: thermal means are ~le~,~d. Thus, the means may be one which is capable of reversibly modulating these conditions of the assay me~illm.Where melting and ~nnç~ling of complem~nt~ry nucleotide strands during an assay is accomplich~d through changes in the thermal conditions of the mPAillm, the means for modulating the base pairing conditions will be one which is capable ofch~nging the temperature of the medium from a first temperature in a range at which base pairing occurs l:o a second tel~lpelature in a range at which ~nnP~lP~ nucleotide sequences dissociate. The thermal modulation means should be able to nl~int~in the assay metlillm at a subst~nti~lly constant temperature, i.e. within a 1 to 2 ~C
variation, within the ranges of the first and second temperatures. Furthermore, the thermal modulation means will preferably provide for an adjustable rate of transition between the first and second tell~l)elatures. Suitable means for thermal modulation of the assay medium include thermal cyclers, and the like.
Also present in the subject devices will be a means for ~rtll~ting an activator of the activatable groups of the probes. This actuating means is responsive to assay mPrlium conditions, so that the activator of the cross-linking system, e.g. the source W 0 96~0289 CA 02208794 1997-06-26 P~1/U~55/16916 of irr~ ti~ n in photoactivatable systems, is operative during con(1itionc of base pairing and inoperative during conditions of nucleotide dissociation or mt~l~in~.
Conveniently, this activation means may be a circuit that is configured to be responsive to the assay m~Aillm conditions and controls the operation of the 5 activator.
Control circuits which may be employed in the subject devices are circuits configured to actuate an activator, e.g. an irradiation means, at a predetermined assay mPAillm condition or set of assay me~ m conditions. Suitable control circuits will include a means for transducing the conditions of the assay m~ m into an 10 electrical signal and a means for triggering the activator in response to thetr~ncduced electrical signal. Illustrative control circuits which may be employed in the subject devices are provided in Figures 1 and 2.
Figure 1 provides a block diagram of a control circuit where an irradiation source, the activator, is activated when the temperature of the assay meAi-lm is15 below a predetermined tel~lpcldture or set temperature, e.g. below the temperature at which base pairing of comp1ement~ry nucleotide sequences occurs. C~ircuit 10 comprises a thermistor 12 whose resistance varies in response to changes in the temperature of the assay metlillm with which it is in contact. Circuit 10 also comprices a potentiometer or variable resistor 14, an operational or dirrelc;,.Lial 20 ~mplifier 16 and a transistor 18 which collectively operate to a¢tivate irr~ ti~n source 20 via switch or relay 22 when the temperature of the m~Ail~m is below the set teml)~ldl~lre. Circuit 10 also comprises LED 24 which signals that switch 26 is closed, thereby closing the circuit loop.
During operation, the set temperature of the assay meAium below which the 25 circuit will actuate the irradiation source is controlled by adjusting potentiometer 14.
When the temperature measured by thermistor 12 is above the set tell,peld~ule~ the recict~nce of the thermistor decreases so that the output of operational amplifier 16 is incllfficient to activate the transistor 18. Since the transistor 18 is inactive, current does not flow through relay 28 and light circuit 22 remains in the open position, 30 whereby the irradiation source remains inactive. When the temperature sensed by thermistor drops below the set temperature, the recict~nce of the thermistor increases to a point at which the output of operational amplifier 16 is sllfficient to activate Wo 96/20289 CA 02208794 1997-06-26 pcTAuss~ll69l6 ~n~ictor 18. Since the tr~ncictor 18 is now activated, current flows through relay 28 and light circuit 22 closes (not shown), whereby the irradiation source is turned on.
Instead of having a circuit which is responsive to a single assay medium cnn~lition, e.g. a single te1,1pel~ture, circuits responsive to a set of assay me~ m S con~litic-nC, such as two L~ pel~tures, may be succes~fully employed. Figure 2provides a block di.lgram of a second control circuit wherein the irradiation source is only activated when the temperature of the assay medium is within a narrow, predetermined temperature range, e.g. between 40 and 43 ~C. In other words, the irr~ tinn source is activated when the temperature of the assay me lillm is: (a)10 below a first predetermined or set temperature and (b) above a second pre~letP-rminP~l or set temperature. In Figure 2, circuit 40 comprises a first loop 42 which is analogous to circuit lO in Figure 1 and a second loop 44 which is parallel with first loop 42, where second loop 44 comprises a second operational amplifier 46 and transistor 48. As in the circuit depicted in Figure l, the output of operational15 ~mplifiPr 58 is only snfficiP-nt to activate transistor 60 and thereby close light circuit 62 via activation of switch 66 when the temperature of the assay mP~linm sensed by thermistor 50 is below a first set temperature Tl. The first set te~ erature Tl is determined by potentiometer 64. The output of operational amplifier 46 is s~-fflçiçnt to activate transisto:r 48 only when the te,-,pe,dture of the assay me~linm, as sensed 20 by thermistor 50, e:cceeds a set te~p~lature T2, a fixed tellll)~ldture below Tl. T2 is determined by resistors 52, 54 and 56, where the choice of re~i~t~nce values may be readily determined by calculation depending on the desired set temperature T2.
Since both tr~nCictQrs 60 and 48 must be activated for current to flow through relay 66, light circuit 62 will only be closed, thereby activating irradiation source 20, 25 when the temperature of the assay medium as determined by thermistor 50 is between Tl and T2.
Automatic devices according to the subject invention will also comprise an assay cont~inmçnt means for holding the assay medium during the assay. The assaycont~inmPnt means may be any means capable of holding a fixed volume of assay 30 medium, where the cont~inment means will allow for modulation of the base pairing con(1itionc of the medium and activation of the activatable groups by the activator of the device. For e~mple, where a thermal modulation means is employed, the W 096~0289 CA 02208794 1997-06-26 ~llu~95ll69l6 cont~inmP-nt means should allow for accurate tel~pe.~lul~ control of the mPlillm in the cnnt~inmp-nt means, e.g. an eppendorf tube in a therrnal cycler. Where activation is accompli~hP~ by irr~ tion, the cont~inmPnt means should allow for irr~ tion of the sample, where the shape of the Cont~inm~nt means may provide for 5 subst~nti~lly uniform irradiation of the sample, e.g. a Cnnt~iner which holds the assay me~ m in thin, film like layer. The cont~inmPnt means may be any convenient shape, such as a vial, tube, slide, cl ~nnel, chamber, cylinder and the like.
Automatic devices according to the subject invention comprising means for 10 modulating the base pairing conditions of the assay medium and means for act~ting an activator in a manner responsive to the assay conditions may conveniently be housed in a housing, where the housing comprises means for controlling and/or adjusting the various elements of the device, such as on-off switches, toggle switches, dials and the like.
An automatic device for pelro~ ing the subject assay which incorporates a control circuit as described above is shown in Figure 3. In Figure 3, device 70 comprises thermocycler 72 and control box 80. Positioned over the sample holder (not shown) of the thermal cycler 72 is light bank 76 with which the assay meAillm in the sample holder shown in Figure 3B is in light receiving relationship. Control 20 box 80 is in electrical communication with thermocycler 72 via leads 78.
Control box 80 comprises dial 82 that adjusts the set temperature of the control circuit at which the light bank is activated by adjusting the potentiometer of the circuit. The toggle main switch 89 turns the control box on, as inrlir~tP~ by red LED 88, while push button switch 88 closes and activates the control circuit loop of 25 the subject device, as indicated by illumination of green LED 86.
In Figure 3B, assay medium unit 90, which is placed within the thermocycler 72 and is in light receiving relationship with light bank 76, comprises a tube holder 92 and an eppendorf tube or microtiter plate well 94 comprising the assay me lillm.
Immersed in the assay medium is thermistor 98 which is in electrical comm--nic~tinn 30 with the control circuit of the device via leads 96.
Kits are provided having at least two pairs of probes, or ternary combinations of probes, where each pair may be in the same vessel. At least one pair will define W O 96nOZ89 CA 02208794 l997-06-26 p~lru~5ll69l6 a subst~nti~lly contiguous sequence of a target nucleic acid and the other pair will be h~m~1Ogous, usually complem~-nt~y, to the sequence of the first pair. Each probehas a side chain which forms a stem with the side chain of the other pair, so as to be capable of cross-linking as described previously. If desired, one or both of the~ 5 probes may be labeled to allow for easy detection of cross-linked probes. One may use r~-lio~ctive labels, fluorescent labels, specific binding pair member labels, and the like. The kits may have oligonucleotides which include sequences for hybricli7ing to a target nucleic acid or provide only the side chains for linking to such target homologous sequences. For the side chain sequences, these will have at 10 least two nucleotides in addition to the cross-linking entity and usually not more than about 1~0, more usually not more than about 100, usually not more than about 60,depending upon whether a protective group is present. If the ~ ~Live group is not present, the side chain by itself will usually not exceed 20 nucleotides, more usually not exceed about 1:2 nucleotides. The terminal nucleotide may be function~ ed 15 a~-o~)liately for linking to the target homologous sequence.
The following examples are offered by way of illustration and not by way of limit~tion .
F.XPFRTMF~TAT

20 A. Preparation of the Photocrocclinker Reagent 1-O-(4,4'-Dimethoxy~
3- 0-(7-coumarinyl)-2-O-(~-cyanoethyl-N,N-diisopropyl phosphor~mi-lite) ly~ ol.

The title compound, pl~al~d in four steps starting from 7-hydroxycoumarin, 25 is useful for incoll.ur~ting the photocrosslinker into any position in the sequence of an oligonucleotide via automated synthesis.

Synthesis of 7-glycidyl coum~rin: To 270 mL acetone in a reaction flask equippedwith a reflux conden~çr was added 7-hydroxycoumarin (16.2 g), epibromohydrin 30 (15.8 g) and potassium carbonate (13.8 g) and the mixture was refluxed for 18 h.
After cooling the reaction mixture, 100 mL 5% sodium hydroxide (aqueous) was added and the solution was extracted three times with 80 mL methylene chloride.
The extracts were combined and the solvent removed by rotary evaporation to givethe crude product as a yellow solid (1.5 g). The product was purified by W OS'~n?~9 CA 02208794 1997-06-26 ~~ 7~ll69l6 7~tion from hPy~nP ~cetone (3:2) at 4~C to afford a white powder (290 mg): mp 110-112~C; TLC (8% v/v ethyl acetate/chlolo~o~ ) Rf = 0.6.

Synth~is of 1-0-(7-coum~riny]) ~Iycerol: 7-Glycidyl coumarin (2.0 g) was 5 dissolved in 80 mL acetone and 50 mL 1.8 M sulfuric acid, and the solution wasrefluxed for 20 ...il~utes. The solution was cooled to room te~ Lulc~, neutralized with 1.6 M ~mmonillm hydroxide, and extracted three times with 50 mL ethyl acetate. The combined extracts were evaporated to yield the product as a white solid (1.40 g): mp 118-120~C.
Synthesis of 1-0-(4.4'-nimethoxytrityl)-3-0-(7-coum~rinyl) glycerol: The starting m~ten~ 0-(7-coumarinyl) glycerol (1.37 g) was dried by coevaporation with 11 mL pyridine, repeated three times. To the dried m~tPri~l was added 45 mL
pyridine, 0.33 mL triethylamine, 4-dimethylaminopyridine (44 mg) and 15 ~limPthoxytrityl chloride (1.78 g). The solution was stirred at room temperature for 3 h, 66 mL water was added, and the solution was extracted three times with 35 mL
methylene chloride. The organic extract was dried with sodium sulfate and the solvent was removed to give the crude product. Pllrifi~tion by silica gel columnchromatography using h~ ne acetone:triethylamine (70:28:2) yielded the product as 20 a white solid (2.6 g): TLC (same solvent) Rf = 0.43.

Synthesis of l-o-(4~4l-nimethoxytrityl)-3-o-(7-coum~rinyl)-2-o-(B-cy~noeth~
N,N-dii~opropyl phosphor~rnidite) glycero]: The starting m~ten~l 1-0-(4,4'-Dim~thc-xytrityl)-3-0-(7-coumarinyl) glycerol was dried by coevaporation with 1225 mLpyridine:chlolufu~ (3:1), repeated twice. The resulting viscous liquid was dissolved in 10 mL pyridine:chloroform (1:1) and added under argon with rapid stirring to a flask con~i,it-i,-g 10 mL methylene chloride, 3 mL N,N-diisopropylethylamine, and ,B-cyanoethyl-N,N-diisopropyl chlorophosphoramidite (1.8 g). The solution was stirred for 90 minutes The solution was diluted with 60 30 mL ethyl acetate and 3 mL triethylamine, then washed twice with 50 mL saturated aqueous sodium chloride. The organic phase was dried with sodium sulfate and thesolvent was removed to give the crude product. Pllrific~tion by silica gel column chromatography using hexane:acetone:triethylamine (70:28:2) yielded the product as a viscous, clear oil (2.6 g): TLC (hexane:acetone, 4:1) Rf = 0.20.

Oligonucleotide synthesis: For use in automated oligonucleotide synthesis, the photocros~linking reagent was dissûlved in dry acetonitrile at a concentr~tion of 0.5 g/mL. The bottle of the solution was affixed to an extra port on the synthPsi7t-r and 40 incorporated via the preprogrammed protocol. After automated synthesis, the oligonucleotide was cleaved from the solid support and deprotected with 3 mL 30%

W 0 96~0289 CA 02208794 1997-06-26 ~l/U~95/16916 ammonium hy-llu~ide for 2 h at room temperature. The ammonium hy~ Lide was removed in vacuo, and the oligonucleotide was purified to homogeneity by d~..~ polyacrylamide gel electrophoresis. Stock solutions in ~ tilled, de-ionized water were ~ d and stored until use at -20~C.

- Sequences of nucleic acids employed in Fx~rnples 1 & 2 Nax 228 (SEQ ID NO:08) 5 'Al~GTCTl 1 ~CGCACAGACGATCTA1~3 ' 10 Nax 229 (SEQ ID NO:09) 3 'TITCGTITGTCTGCTAGATAAA5 ' Nax 230 (SEQ ID NO: 10) 3'TAAAACAGAAACGCGCGAXA5' Nax 231(SEQ ID NO:11) 5 'A 11 l l GTCl~[TGCGCGGC1~3 ' Nax 232(SEQ ID NO:12) 20 3 'AXACG 1 1 1 GTCTGCTAGATAAA5 ' Nax 233 (SEQ ID NO: 13) 3 'TAAAACAGAAACGCGCG11~5 ' X = ethoxycoumarin 1. The ability t:o obtain cross-linkin~ with a photoactivatable probe was inv~cti~pte~l ~ample, ,~l c.. ~l.. -.. l, pm/
Nax ~1* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 1 32p228 ~S 2 2 2 2 2 2 2 2 32P-229 ~ 2 2 2 2 3ZP-233 ~ 4 4 4 4 - 35 228 ~ 2 2 2 2 229 ~ 2 2 230 ~ 2 2 2 W 096~0289 CA 02208794 1997-06-26 ~-l/u~9Sll69l6 232 ~ 2 2 2 2 233 n 2 2 5 *pmol/,ul Total volume = 32.5fL1 Protocol Add 18.5,41 of 50:150 0.75M NaOH: 1 x TE to 14,u1 of sample.
Incubate at room temperature for 10 minutes.
Add 17.5~L1 neutralization buffer: 3.5~L1 of 3.5 % BSA; 1 .5,ul of 1 .SM HOAc;
11.3~1 of 20 x SSC and 0.4~L1 of water.
Incubate at 40~C for 15 minutes.
Irradiate at 30~C for 1 hour (Str~link~r; thin pyrex filter) PAGE 15% (with 7M urea) The results of the PAGE showed that samples 3, 8 and 10 showed good cross-linking, but the band for sample 16 was light as colllpal~d to the other bands.

2. The effect of thermal cycling on cross-linkin~ was inv~sti~te-l Sample, ~l c~ , Nax pml ,ul* 1 2 3 4 5 6 7 8 3~P-229 32p 233 n WOg~n~g CA 02208794 1997-06-26 PCTrUS95/16916 228 0.02 230 0.5 2 2 2 2 232 ~ 2 2 2 2 s *pmol/,ul Protocol Add 18.5,u1 of 50:150 0.75M NaOH: 1 x TE to 14~1 of sample.
Incubate at room temperature for 10 minutes.
Add 17.5~1 neutralization buffer: 3.5~1 of 3.5 % BSA; 1 .5~l of l.SM HOAc;
11.3~1 of 20 x SSC and 0.4~1 of water.
Incubate at 40~C for 15 minutes.
Irradiate at 40~C for 25 minutes (Str~t~link~r; thin pyrex filter) Remove ~mples~ 3,4,7,8, as before; heat to 88~C for 1 minute.
Cycle:
TTT~ te at 30~C for 25 minutes.
Remove c~mples, heat to 88~C for 1 minute.
Repeat cycle 3 times ending with irradiation PAGE 17% (with 7M urea) Based on the PAGE results, samples 1, 3, 5, and 7 showed that with or without thermocycling, in the absence of the target strand, the two probes do not cignific~ntly cross-link. Cross-linking was more efficient with probes 229 and 230.
25 The extent of cross-linking was quantified for samples 2 and 4, where cross-linking was 2.3% and 7.8% respectively.

Sequences of Nucleic acids use in F.xamples 3-6:
Nax 238(SEQID NO:14) S'TT~ATAAAAAGCTCGTAATATGCAAGAGCATTGTAAGCAGAAGACTTA3' W 096120289 CA 02208794 l997-06-26 PCT/US95/16916 NaX 271 (SEQ ID NO:15) 5'TTTATA~AA~GCTCGTAATATG~:1111111113' Na~C 270 (SEQ ID NO:16) 3 ~ 111111111 CTCGTAACATTCGTCTTCTGAAT5 ' Na~C 272 (SEQ ID NO:18) 3~AA~TATTTTTCGAGCATTATACGAXA5 10 NaX 273 (SEQ ID NO: 19) 3 'AAATATTTTTCGAGCATTATACGAAAXA5 ' NaX 274 (SEQ ID NO:20) 3 'A ~ ~TATTTTTCGAGCATTATACGAAXAAAA5 ' NaX 275 (SEQ ID NO:21) 3 'A ~ ~TATTTTTCGAGCATTATACGAAAAAXA5 NaX 239 (SEQ ID NO:22) 20 3'AA~TATTTTTCGAGCATTATACGTTCTCGTAACATTCGTCTTCTGAAT5' NaX 278 (SEQ ID NO:23) 3lTAAATATTTTTcGAGcATTATAcGTTcAAGTAAcATTcGTcTTcTGAATs/
25 NaX 277 (SEQ ID NO:24) 3 ~AAATATTTTTCGAGCATTATACGTT~: 1111111115 NaX 276 (SEQ ID NO:25) 5 ~ 111111111 CATTGTAAGCAGAAGACTTA3 /
NaX 279 (SEQ ID NO:26) 5 'TTTATA A~ ~AGCTCGTAATATGCAAGAAXAAAA3 ' NaX 280 (SEQ ID NO:27) 35 5 'TTTATAAAAAGCTCGTAATATGCAAGAXAAAAA3 ' 3. The effect of having the reactive group at the 5' terminus was invPctig~te~l.
SamP1e, ,ul ~ NaX Pml ~1* 1 2 3 4 5 6 7 8 9 10 11 12 32P-270 0.5 2 2 2 2 2 2 W 096/20289 CA 02208794 1997-06-26 ~~ 5sll69l6 238 ~

272 ~ 1 1 1 273 ~ 1 1 1 274 ~ 1 1 1 275 ~ 1 1 1 H~O 11 11 9 1111 9 1111 9 11 11 9 *pmol/~l Protocol Add 18.5~1 of 50:150 0.75M NaOH: 1 x TE to 14~1 of sample into 96 well CoStar.
Incubate at room temperature for 10 minutes.
Add 17.5~1 neutralization buffer: 3.5~1 of 3.5 % BSA; 1.5~1 of l.SM HOAc;
11.3~1Of20xSSCand0.4,ulofwater.
Add 75~1 mineral oil to inhibit evaporation.
Incubate at 40~C for 20 minut~s Irradiate at 40~C for 20 minutes (UV-A lamp, UV-32 Hoya filter) PAGE 20% with 7M llrea.

The percent cross-linking with the reactive entity at the 5' terminus was: 1, 80%; 3, 69%; 4, 57%; 6, 69%; 7, 68%; 9, 80%; 10, 38%; and 12, 67%. There was no ci, nific~nt cross-linking observed where there was no t~ te.
4. The effect of having the reactive group at the 3' terminus was inVpctig;qte~
Sample, ~1 W0 96~0289 CA 02208794 1997-06-26 P~-llu~,S/16gl6 C~ ,N~ pn~
~1* 1 2 3 4 5 6 7 8 32P-276 0.5 2 2 2 2 2 2 32p_277 n 2 2 279 n 280 n 10 *pmol/,ul Protocol The protocol was the same as the previous example, except that the PAGE
was 18%.
lS The percent cross-linking with the reactive entity at the 3' terminus was: 1, 86%; 3, 73%; 4, 83%; 5, 79%; 7, 42%; and 8, 77%. There was no .~i~nific~nt cross-linking observed where there was no template.

5. Ille time dependency of cross-linking effi~ ienCy was determined.

C""'1~ ,Nax pn~
~1~ 1 2 3 4 5 6 7 8 32P-270 0.5 2 2 2 2 32P-276 " 2 2 2 2 W 096~0289 CA 02208794 1997-06-26 ~/U~3116gl6 274 ~ 1 1 1 1 278 n 279 n *pmol/~l Protocol The above protocol was followed to the incubation at 40~C for 15 ",i~ es, 10 where irradiation was then carried out for 20 minutes, with samples 1 and 2 being removed after 5 minutes, 3 and 4 after the next 5 minutes, and so on, followed by PAGE 20% with 7M urea.
The percent cross-linking observed was: sample 1, 65%; 2, 72%; 3, 76%; 4, 80%; 5, 80%; 6, 83%; 7, 82%; and 8, 84%. The odd-numbered c~mples had the 15 reactive group on the 5' terminus, while the even numbered samples had the reactive group on the 3' terminus. The results indicate that after 10 ."ilu~es there does not seem to be any change in the degree of cross-linking and that there is no cignific~nt difference in result, whether the reactive group is on the 5' or 3' tt~llllillUS.

20 6. The effect of variation in concentration of the probes was illv~ te~l Samples, ~1 C~ .. l, Nax pm/
~1* 1 2 3 4 5 6 7 8 32P-276 0.5 2 2 2 278** 1 2 2 2 1 5 2.5 279 0.5 2 2 2 2 2 2 2 2 H20 10 8 8 9 10 6 8.5 10 W 096~0289 CA 02208794 1997-06-26 P~ 5/16916 *pmol/~l ** 278 was 5 pmol/~l for sample 1, 0.5pmol/,ul for ~mples 2 - 5, and 0.02 pmol/~l for samples 6 to 8.
P~ . tocol The sarnple was plepa~cd as previously described, followed by in~lb~tiQn at 40~C for 10 minut~s. Samples 1 and 2 were removed from the plate and put in Robbins SciPntific PCR tubes (clear) and capped. The PCR tubes were laid across 10 the top of a 96-well plate and irradiated 20 minutes (UV-A, UV-32). The samples were analyzed with PAGE 20 % with 7M urea.
The degree of cross-linking observed in the samples was as follows: sample 1, 83%; 2, 81%; 3, 79%, 4, 82%; 5, 78%; 6, 17%; 7, 8.2~; and 3.9%. At 0. lpmol of the probe, the degree of cross-linking has ~ignifi~ntly ~1imini~h~1, but 15 even at 0.05 pmol, cross-linking is still discernible. The effect results from a combination of a lower concentration of the probe and lower mole ratio of the probe to template.

7. Use of Cross-linked Probes as a Template was Inv~ te~, Cross-linked products were prepared on a preparative scale and isolated and purified using PAGE. The five cross-linked products were 345-346, 386-346, 387-346, 388-346, and 389-346.

25 Nucleic Acid Sequences used in F.x~mple 7.
NAX 342 (SEQ ID NO:27 ) 5'-GATATCGGATTTACCAAATACGGCGGGCCCGCCGTTAGCTAACGCTAATCGATT

NAX 345 (SEQ ID NO: 28 ) 30 5 '-AAAAAXAGCCGTTAGCTAACGCTAATCGATT

NAX 346 (SEQ ID NO: 29) 5'-GATATCGGATTTACCAAATACGGCGGGCC~lllllll 35 NAX 347 (SEQ ID NO: 30) W O 96~0289 CA 02208794 1997-06-26 PCTrUS9~116916 5'-~A~AA~GCCGTATTTGGTAAATCCGATATC
NAX 348 (SEQ ID NO: 31) S'-AATCGATTAGCGTTAGCTAACGGCGGGCC~'l''l''l''l''l''ll' NAX 386 (SEQ Il::~ NO: 32 ) 5'-AAA~GCCGT'rAGCT~CGCT~TCGATT
NAX 387 (SEQ ID NO: 33) 5'-AAXAAAGCCGTTAGCTAACGCTAATCGATT
NAX 388 (SEQ ID NO: 34) S'-AXAAAAGCCGTTAGCTAACGCTAATCGATT
15 NAX 389 (SEQ ID NO: 35 ) S'-XAAAAAGCCGT5rAGCTAACGCTAATCGATT

Componentpmol/m Sample [mL]
, NAX L

32P-348 0.5 345-346 2.5 2 386-346 " 2 387-346 " 2 388-346 " 2 389-346 " 2 Protocol The samples were prepared as previously described, except only 70 mL of minPr~l oil was employed. The samples were incubated at 40~C for 20 minutes.
The ~mple~ were then irradiated at 40~C for 20 minutes, followed by analysis by 35 PAGE, 17% polyaclylamide and 7 M urea.

W 096~0289 CA 02208794 1997-06-26 ~-1/U~5/16916 The percent cross-linking as a result of the cross-linked probes acting as a temrl~t~ in co.~p~ on with a single-stranded template is as follows: sample l, 73%; 2, 75%; 3, 71 ~o; 4, 69%; 5, 66%; and 6, 67%. The results demon~tr~tP that the cross-linked probes can serve as a template for cross-linking a hybridized probe S pair as effectively as a single-stranded target can serve as a temr)1~t~. -8. Linear amplification is demonstrated in the following two ~Y~mrlifi-~tion~ .
Example A.
Samples, ~1 C.. ~ J,Nax pn~A 1 2 3 4 5 6 7 8 32P-276 0.5 278 .005 1 1 1 1 1 1 1 #

15279 0.5 2 2 2 2 2 2 2 2 C(-n~ mc No. ~1 " 1 5 5 O O S S S

Heattr~t-ment - A + A + ~ + +
* pmol/~; # add 0.2~ of 0.5pmol/A after 10 irradiations A heat cycle set forth below; + isothermal Protocol The samples were prepared as previously described, with the probes at 100-fold excess over the target sequence.

W 0 96~0289 CA 02208794 1997-06-26 ~ sll69l6 The reagents were combined in 0.2 ml PCR tubes from MJ Research and covered with 60 ,~l min~r~l oil.
All inrub~ti~nc were done on a PTC-100 thermal controller from MT
Research.
The assay lll~ Ul'e was inc~lb~t~d at 40~C for 15 minutes.
Trr~ tion was for 15 minuttos (Autoprobe, 40~C, UV-A, W-32).
S~mp1es 2, 4, and 6 were treated in PTC-100 (Program name PCA 8640, 4 minlltes at 86~C; 11 minutes at 40~C) Samples 3, 5, 7, 8 were left at room temperature.
The irr~ tion was repeated, with samples 2, 3 being removed after 5 irr~ tionc, cycling continued, but with the following sched~le: irradiation time: 5 minutes; heating time: 2 minutes at 86~C; incubation time: 5 minutes at 40~C.
Some cloudiness was observed in samples 4 and 6 after the 6th cycle. The heating telllpeldLule was reduced to 82~C for the 7th heating cycle.
PAGE 17% 7M urea.
The following table intlic~t~c the results.

Sa~nple% cross- Total # Unreact-edCross-linked Cycles linked Counts 1.2 1175411607 147 2 6.6 7027 6563 464 5 20 3 2.8 8272 8037 235 "

4 8.0 7094 6528 566 10 2.9 7953 7722 231 6 9.4 7280 6595 685 15 7 4.0 7020 6734 286 "

25 8 23 7000 5418 1582 "

Example B.

'' WO 96no289 CA 02208794 1997-06-26 PCTrUS95/16916 Samples, ~1 C.. ~ , Na~ pm/A* 1 2 3 4 s 6 7 8 '2P-276 o.s 2 2 2 2 2 2 2 278 .02 .8 .8 .8 .8 .8 .8 .8 .8 279 o.s 2.5 2.5 2.5 2.5 2.5 2.5 2.5 2.5 Crm~ )nc No. i.. ~l~ 5 1 2 lo lo lo lo lo lo Heat ~ + + +

* pmol/A; A heat cycle set forth below; + isothermal Protocol The above procedure was repeated with some modifi~tion~. The probe was 15 in 50-fold excess to the target. 75~1 of mineral oil was used. The reactions were run in a polycarbonate plate. Incubation and heating were on a MJ Research PI C-100 instrument. Irradiation was in a Str~t~linker with the heating provided by a mineral oil bath set at 40~C.
Sample 1 was removed after one cycle of irradiation and heating; sample 2 20 was removed after one cycle of irradiation, heating and an additional ~ tion.
Samples 3, 4 and 5 received 10 cycles of irradiation of 10 minlltes each, with 9 intervening thermal denaturation cycles in accordance with the following sch~ le:
84~C for 3 minutes; 40~C for 7 minutes. Samples 6, 7 and 8 received 10 cycles of irradiation with 9 intervening cycles of rem~ining in the mineral bath inside the 25 Str~t~link~r. The following table indicates the results.

Sample % Cross- Total # Unreacte~l Cross-linked Cycles linked Counts W 0 96/20289 CA 02208794 1997-06-26 P~-1/U~5/16916 1 1.6 11641 11458 183 2 2.2 16744 16381 363 10 3 11.7 11190 9883 1307 4 9.5 15468 13993 1475 8.0 17118 15759 13~9 6 2.0 15260 14954 306 ~*

7 2.2 14000 13687 313 ~*

8 1.8 1792~ 17595 330 ~*

10 * No denaturation Sample 3 showed apl)roximately 12% cross-linking, while sample 6 showed only about 2~ cross-linking, inrlic~ting an approximately 6-fold linear ~mplific~tic n.

15 9. Linear ~mplifir~tion using non-isotopic detection, multiple probe sets, and ~l-ton~ted cycling Nucleic Acid Sequences NAX 595 (SEQ ID NO: 41 ) S'-'1"1"1"1"1"1'CCAAGGAGGTAAACGCTCCTCTGB
NAX 596 (SEQID NO: 42 ) 5'-FATTGGTTGATCGCCCAGACAATGCAXA
25 NAX 601 (SEQID NO: 43 ) S'-'1"1"1"1"1"1"1'CCCTTTATACGCTCAAGCAATAB
- NAX 602 (SEQ ID NO: 44 ) 5'-FTCTTTGCTATA&CACTATCAAGCCAXA
NAX 607 (SEQ ID NO: 45 ) S'-'1"1"1"1"1"1'GTCTCGAACATCTGAAAGCATGGB

~ W096~0289 CA 02208794 1997-06-26 PCTrUS95/16916 ~, N ~ 608 (SEQID NO:46) 5'-FCTGCGTCTTGCTCTATTTGACCGCAXA
NAX 613 (SEQrD NO:47) 5'~ lllGAGCGGCTCTGTCATTTGCCCAs NAX 614 (SEQrD NO:48) 5'-FTGTCCAAGGATTATTTGCTGGTCCAXA
10 X--ethoxycoumarin F--fluorescein B = biotin Component, pmol/mSample [mL]

595 l 0.375 0.375 596 " 0.125 0.125 601 " 0.375 0.375 0.375 0.375 602 " 0.25 0.25 0.125 0.125 607 " 0.375 0.375 608 " 0.125 0.125 613 ., 0 375 0 375 0 3 614 " 0.25 0.25 0.125 0.125 H2O 12.75 12.75 12 12 lysis buffer* 18.5 16.5 18.5 16.5 target DNA** 10-5 2 2 * Lysis buffer = 1:3 0.75M NaOH: lX TE(pH 7.5).
30 ** The target DNAis the Chlamydia cryptic pl~mid cloned into pRlll~seriI)t, pretreated by boiling for 30 minutes in lysis buffer.

W O 96~0289 CA 02208794 l997-06-26 PCTNS9',/16916 Add 17.5 mL of n~ut~li7~tic-n buffer (1.7~ mL of 3.5% BSA, 1.~ mL of 1.5 M HOAc, 11.3 mL of 20X SSC, and 2.15 mL of water) to each ~mplç, loaded in a 96-well polycarbonate plate. Add 50 mL minerAl oil to prevent evapor~tion The plate was put onto a progr~mm~hle thermal controller beneath a bank of 5 UV-A larnps. The thermal controller was ~lcgl~"""ed to bring the s~mrlçs through the following l~ .c; profile: (1) 60~C for 10 minutes; (2) 85~C for 90 se~ontl~; (3) 58~C for S ...il-~ltt~s; (4) 55~ for 5 minutes; (repeat steps 2,3,4 five times); (5) hold at 20~C. The operation of the bank of lamps was controlled via a control circuit that responds to the temperature sensed by a thermistor. The 10 thermistor was embedded in one of the wells in the 96-well plate. The controlcircuit activated the light bank if the temperature sensed by the thermistor waswithin a narrow range (appro~imately +3~C) about a desired lel.lpeldture, in this case 55~C.
Following the cycling procedure the mineral oil was sepal~ted from the 15 aqueous s~mr)le, and hereafter the aqueous sample was treated to: incubation with streptavidin-coated m~gntotic particles, five repetitions of removal of the ~u~ AI~ t liquid and addition of buffered wash solution, incubation with an anti-fluorescein/~lk~line phosphatase conjugate, five repetitions of removal of the ~u~ "~ti~-t liquid and addition of buffered wash solution, and incubAtion with 20 Attophos at 37~C. The fluorescent signal generated in each sample was measured (relative fluorescenre units): Sample 1, 39; 2, 142; 3, 58; 4, 250. The results demonstrate that a mul~it~lde of probe sets can be combined to achieve a higher signal and that the amplification process can be carried out by automated methods.

25 10. Nucleic acid sequence detection of Chlamydia trachomatis in rlini.~l s~mpl~c using an ~mplifirg~tion probe set Component,pmol/m Sample [mL]
NAX L

601 1 1.2 1.2 1.2 1.2 602 " 0.8 0.8 0.8 0.8 ~ W 0 96~0289 CA 02208794 1997-06-26 ~-1/U~5/16916 lysis buffer 37 37 clinical 37 37 sample*

*clinical samples were obtained by endocervical swab. The swabs were boiled in atube with 400 mL of lysis buffer for 30 minutes. For each sample, 37 mL of lysate was removed for testing.

S~mples 1 and 2 are from two different patients, and samples 3 and 4 are negative controls for the experimP-nt Add 35 mL of neutralization buffer (1.75 mL of 3.5 % BSA, 1.5 mL of 1.5 M HOAc, 11.3 mL of 20X SSC, and 2.15 mL of water) to each sample, loaded in a 96-well polycarbonate plate. Add 50 mL mineral oil to prevent evaporation.
The previous protocol was followed for amplifi~tion and detection, except that the time at 58~C was 9 minutes and the time at 55~C was 6 minutes in each thP~m~l cycle. The fluorescent signal generated in each sample was measured (relative fluorescence units): Sample 1, 768; 2, 43; 3, 44; 4, 53. Sample 1 was nPA as positive for the presence of C. trachomatis and sample 2 was ~igned as 20 negative. These results were confirmed by PCR and culture. The results demonstrate the effectiveness of the amplification procedure for the detection of nucleic acid sequences in clinical specimens.

11. Geometric amplification is demonstrated in the following 25 exempli~ tions.

Nucleic Acid Sequences NAX 441 (SEQ ID NO:36) 5 -GATTTAAA~AccAAGGTcGATGTGATAGGG cTcGTATGTGGAATG~cGAAcTcATcGGcGAT
NAX 443 (SEQ ID NO:37) ~-GGGCGAGAXATATCACATCGACCTTGGl'~ AAATC

_ W 0 96~0289 CA 02208794 1997-06-26 ~llu~7~/l69l6 N ~ 444(SEQrD NO:38) 5'-GATTTAAAAACCAAGGTCGATGTGATAGGGCTCGAXAAAAA
NAX 445 (SEQ ID NO:39) 5'-TCGCCGATGAGl'TCGACATTCCACATACGAGCCCTTTCTCG
NAX 446 (SEQ ID NO:40) 5'-llllllllATGTGGAATGTCGAACTCATCGGCGA
S~mrl~

C.. ~ ,N~ p~l 1 2 3 4 5 6 7 8 32p443 1 1 1 1 1 1 1 1 1 ~5 .362.8 2.8 2.82.8 2.8 2.8 2.8 2.8 ~6 1 15 441 lO~oJ~
HzO 9.2 9.2 9.29.2 9.2 9.2 9.2 9.2 C~nnriitirmc No.~ ' 1 3 5 7 1 3 5 7 H~t A heat cycle set forth below The following control s~mrlec were also run:
Samples, ~1 C.. ~ .. l,N~ p~l9 10 11 12 32p~43 1 1 1 1 1 445 .36 2.8 2.82.8 2.8 =
W O96no289 CA 02208794 1997-06-26 PCTnDS95/16916 441 lOfino~

E~O 9.2 7.210.28.2 Cnn~liti~nc 5 No. ' ~ 7 7 7 7 Heat tl~ + +

\ heat rycle set forth below + = isothermal Protocol Add 18.5 ~1 of 1:3 075 M NaOH:lxTE to sample in a microtitre plate.
Add 17.5~11 neutralization buffer (3.5~1 of 3.5% BSA; 1.5~1 of 1.5M HOAc;
11.3~1 of 20 x SSC and 0.4~1 of water) to each well.
Layer 50 ~1 mineral oil on top of each well to inhibit evaporation.
Incubate 20 minutes at 40 ~C.
Irradiate at 40~C for 20 minutes. (UV-A light source) Denature for 2 minutes at 90~C.
Analysis by 10 % PAGE with 7M urea.
Bands were excised and the amount of 32p in each band was quantified by s~intill~tion counting.

Results The results are sl-mm~rized in the following table.

Sample Total Counts Counts in Counts in 5~ Cc,.. ~ ion to Starting Material Product Product 1 5218 5201 17 0.3 2 5437 5382 55 1.0 W O 96~Z89 CA 02208794 1997-06-26 PCTrUS95116916 3 5083 5019 64 1.3 4 5156 5081 75 1.6 4846 4827 19 0.4 6 4777 4708 69 1.4 7 4859 4706 153 3.1 8 4830 4471 359 7.4 9 5629 5616 13 0.2 :5486 5429 57 1.0 11 .~548 5543 5 (1 0 12 '~536 5517 19 0.3 The results demonstrate that by employing two complem~nt~ry sets of probes, a geometric ~mplific~tion of the signal intlic~tive of the presence of the target nucleic acid may be obtained.

12. The Use of a Fith Probe as a Protective System is Demo~L"tted Nucleic Acid Sequences:
NAX442(SEQID NO:49) 5'-ATCGCCGATGAGTTCGACATTCCACATACGAGCCCTATCACATCGACCTT
G~l~ l-lAAATC

NAX562 (SEQ ID NO:50) 5'-AAAGGGCTCGAAAAA
Component, pmol/~l Sample [~l]
NAX

W 096~0289 CA 02208794 1997-06-26 ~llu~sll69l6 32P~46 0.52t 1.9 1.9 1.9 1.9 H70 9.1 8.1 8.1 7.1 10 tprepared from 1.0 ,ul of 0.1 pmol/,ul 32P-446 and 0.9~1 of 1.0 pmol/,ul 446 Protocol:
Add 18.5 ~Ll of 1:3 0.75M NaOH: lX TE (pH7.5) to each sample, loaded in a 96-well microtitre plate.
15 Add 17.5 ~1 of neurtalization buffer (1.75 ~Ll of 3.5% BSA, 1.5~1 of 1.5 M
HOAc, 11.3 ~l of 20X SSC, and 2.15 ,ul of water) to each sample. Add 50 ,ul mineral oil to prevent evaporation.
Incubate at 55 ~C for 15 minutes.
Perform 30 cycles of: incubated at 46 ~C for 1 minute; irr~ te with UV-A light at 20 43 ~C for 7 minutes: and denature at 90 ~C for 1 minute.
The c~mples analyzed by ~len~t~ring PAGE (13% with 7M urea).

The degree of product formed (NAX 446 cro~clink~d to NAX 444) as observed by gel electrophoresis and quantification by sçintill~tion counting was: 1, 8.0%; 2, 25 2.7%; 3,1.3%; 4,23%. The results demonstrate that the fifth probe (NAX 562 suppresses the occurrence of a target independent reaction, and does not prevent the target specific amplification from occurring.

13. Chemical Amplification Using a Coordination Complex as the 30 Crnc~link~r W 096~0289 CA 02208794 1997-06-26 P~-llU~g5/16916 Another class of cro~.~linkin~ agents that are useful for covalently cro~clinkin~ two probes compn~es metal coordination complexes. Activation of themetal complex may be either photonic or thermal. The activated complex may then react by substit~ltinn~ addition, or cyclization with an apl)ropliate reactant ~:itllZ~t~i on S the opposite strand in the stem, and the two probes are covalently cros~link~d as a result of the new coordination complex produced.
For ~Y~m~ , pl~tinllm(II) complexes are useful for forming comI-lPYes with amine ligands as well as nucleic acid bases, especially guanine and ~dPnin~. These complexes undergo thermal substitution reactions, and square planar Pt(II) 10 compleYçs are known to photodissociate upon UV irradiation and subsequently add a ligand.

Photocrosslinking A cros~link~r probe is ~repaled with a platinum complex adduct at a specific 15 site in the stem region, and a recipient probe is prepared with an a~r~.iate ligand to react with the photoactivated complex, for ex~mI)le, an alkylamine, spatially~itn~ted for optimal contact with the platinum complex.

Fx~mple. Probes with the following sequences are 20 NAXP 019 (SEQ I]D NO: 51 ) 5'-TCTTTATTTAGATATAGAArrl'~'l'l-l'l'l'l'AGAGAGl-l-lAGAAGAAT
NAXP 020 (SEQ ID. 52) S'-ATTCTTCTAAACTCTCTAAAAAACA~G'G'A~
NAXP021 (SEQ ID. 53 ) 5'-TT*CCT*TGGAAATTCTATATCTAAATAAAGA
NAXP022 (SEQ ID. 54) 5'-ATTCTTCTAAACTCTCTAAAAAACAAG'AA
NAXP023 (SEQ ID.55 ) - 5'-TT*CT*TGGAAATTCTATATCTAAATAAAGA
35 T* = amine ligand-cont~ining base: 2'-deoxy-5-(b-aminoethoxymethyl)uridine G'= site of Pt adduct UndPrlined bases comprise the stem-forming portion of the oligonucleotide WO s6no2ss CA 02208794 1997-06-26 pcTrus9sll6sl6 NAXP 019 is homologous to the - strand of the Chlamydia cryptic pl~mi~i, complçmPnt~ry to the + strand, postion 3878-3900.
p~ tion of recipient probes (NAXP 021, NAXP 023). The amine ligand-cont~ining base is prepared according to Baker et.al., J. Med. Chem. (1966), 9, 66, 5 from 2'-deoxyuridine and N-trifluoroacetyl-2-aminoethanol. The fully protected N-trifluoroacetyl-5'-O-dimethoxytrityl-3'-O-phosphoramidite is ~r~d by standard techniques. The oligonucleotide is then ~l~al~d by standard automated synthesis techniques. Deprotection of the ~minoethyl ether occurs during de~,oleolion of the oligonucleotide by tr~tmPnt with 40% aqueous ammonia. The oligonucleotide is 10 icol~t~A by denat~nng polyacrylamide gel electrophoresis. The band cont~inin~ the product is excised, extracted into water, and purified and des~ltecl by passage through a Sephadex G25 column. The oligonucleotide is recon~tituted in a known volume of ~lictill~d water and the concentration determined by the absorbance at 260 nm.
Preparation of cro~ClinkPr probes (NAXP 020, NAXP 022). In NAXP 020, G'G' represents the bident~tP- adduct cis-[Pt(NH3)2{d(GpG)-N7(G2,),-N7(G28)}], and in NAXP 022, G' represents the monodentate adduct [Pt(NH3)3{d(G)-N7(G27)}].
NAXP020 is prepared by the reaction of the oligonucleotide (purified as stated above) with the diaqua compound cis-[Pt(NH3)2(H2O)2]2+ at 37~C for 18 hours, and20 NAXP 022 is prepared by the reaction of the oligonucleotide (purified as stated above) with the monoaqua compound tPt(NH3)3(H2O)]2~ at 37~C for 18 hours.
Each of the products is obtained by anion exchange HPLC and cles~lted by dialysis.

The ability to form crocclinkc with a Pt adduct between probes in a templated r~eti--n Component pmol/m Sample [mL]
, NAXP L

32p ol9 0.2 32P-o20 0.2 32p_o2l 0.2 W 0 96~0289 CA 02208794 1997-06-26 ~ u~95ll69l6 Protocol:
Add 18.5 mL of 1:3 0.75M NaOH: lX TE (pH 7.5) to each sample, loaded in a 96-well microtitre plate.
Add 17.5 mL of neutralization buffer (1.75 mL of 3.5 % BSA, 1.5 mL of 10 1.5 M HOAc, 11.3 mL of 20X SSC, and 2.15 mL of water) to each sample. Add 60 mL mineral oil to prevent evaporation.
Incubate at 40~C for 15 minutes.
Irradiate at 40~C for 20 minutes using UV-A lamps (sharp cut-off filter at 300 nm) Analyze by den~t~lnng PAGE (15 % with 7 M urea) The effect of thermal cyclin~ on the amount of crl c~link~-l product formed Componentpmol/m Sample [mL]
, NAXP ]_ 32p_o2l 0.2 019 0.01 H~O 11 ll 10 10 11 11 10 10 No. cycles 1 2 1 2 5 5 5 5 thermal + D + D + D + D
treat.

30 +--isothermal, no denaturation WO 96no289 CA 02208794 1997-06-26 ~llu~y5ll69l6 D = s~mI)les denatured each cycle r~l~OI
The sample L,r~.i.tion is the same as above. After an initial incubation for 5 10 minutes at 40~C the $~mpl~s were treated as intlic~ted in the table.
Cycle:
Trr~ tP, at 40~C for 10 I,lir u~es Heat to 85~C for 2 minutes Incubate at 40~C for 10 minutes Repeat the cycle procedure the in-lic~t~d number of times, ending with the irradiation step at that cycle number.
Analyze by denaturing PAGE (15 %, with 7 M urea) The analogous set of experiments are performed using the monodentate adduct as the crosclinking probe, NAXP 022, the recipient probe NAXP 023, and 15 the synthetic target NAXP 019.
Therm~l crosslinkin~ reaction A cro~linker probe is prepared with a platinum complex adduct at a specific site in the stem region, and a recipient probe is prepared with an a~lu~Liate ligand to react with the complex, for eY~mple, a sulfur-containing ligand, spatially citn~t~
20 for optimal contact with the platinum complex.
rnple. Probes with the following sequences are p~ d:
NAXP 024 (SEQ ID. 56 ) 5'-ATTCTTCTAAACTCTCTAAAAAACAAM~
25 NAXP 025 (SEQ ID. 57) S'-TTT.TTGGAAATTCTATATCTAAATAAAGA
M = a Pt or Pd square planar complex, (L3)MX, where L3 is a trid~nt~te ligand with linking arm joined to the oligo backbone and X is a ligand chosen from OH2, Cl~, Br~, I-, N3-, SCN-, NO2-, NH3, pyridine, and the like. L3 may be a 30 terpyridinyl or diethylenetri~mine derivative.
L = 4-thiouridine, 2'-deoxy-4-thiouridine, 4-thiothymi-line, (the 2,4-dithio analogues of these), non-nucleosidic group cont~inin~ a mercapto group.

W 0 96~0289 CA 02208794 1997-06-26 P~ g5/16916 Tnr~ excess X in the solutionto ~ SS subs~tion re~c~on~atthe me~
complex when it is not hybridized in the stem. The rate of the substil~ltion reaction can be varied by the choice of the metal, (Pd faster than Pt), or the choice of the fourth ligand X (reactivity follows in the order listed above, fastest to slowest).
S Except for the ~ tion step, the procedure will be sub~t~nti~lly the same as for the photoactivation.
13. ~h~mir~l Am~ r~tinn USing an Or~nomPt~ C~ Py as the Crncclinlr~r Another class of cro~linking agents that are useful for covalently cro~clinking two probes comprices organometallic complexes. Activation of the metal complex may be photonic, and the activated complex may then react by substitution with an a~,L)r~l;ate reactant ~itll~ted on the opposite strand in the stem, and the two probes are covalently cros~1inkP-d as a result of the new bond formed.

For e~r~mI)le, cyclopent~-liçnyl m~n~nPse(I) complexes, CpMnL~, where L
is a neutral two electron donor ligand such as CO, are useful for their rich photochçmic~l reactivity. These complexes, in contrast, are inert to thermal substitution reaction conditions and thus provide a system that selectively responds to photonic activation. Photoirradiation using 300-350 nm light induces the loss of a CO ligand. The interm~li~t~, CpMnL2, can recombine with the extruded ligand or react with another suitable ligand, L', such as a phosphine, phosphite, amine, ether, olefin, etc. The photoreactivity of the newly formed compound depends on the identity of the new ligand. When L' is a phosphine or phosphite any subsequent reactions proceed with loss of another CO ligand; the phosphine or phosphite remains bound to the metal. In contrast, for most other ligands L' it is this ligand that is photosubstituted upon further reaction.

F~ple. Probes with the following sequences are p NAXM Ol1 (SEQ ]D NO: 58 ) S'_GATACGACGCCGCAAAAGCTCTTCATM~G
NAXM 012 (SEQ ID NO:59 ) S'-CTT.~TCCAAGCC'GAGTCTACAGTTATAGG

W 096~0289 CA 02208794 1997-06-26 r~-1lU595/16916 NAXM 013 (SEQ ID NO:60) 5'-CCTATAACTGTAGACTCGGCTTGGGAAGAGCTTTTGCGGCGTCGTATC

M = cyclope-nt~ nylm~ng~nese(I) tricarbonyl 5 L = trialkylphosphite Un~Prlin~d bases comprise the stem-forming portion of the oligonucleotide Prep~r~tion of NAXM 011. T.ithillm cyclopPnt~ .nitle is con~ sed with 2,2-dimethyl-1,3-dioxolane-4-methyl mesylate. The trimethyltin adduct of the cyclopçnt~ nto derivative is reacted with Mn(CO)5Br to yield 2,2-dimethyl-1,3-10 dioxolane-4-methylcyclopentadienylm~ng~nese tricarbonyl. The ketal is hydrolyzed to produce l-(cyclopent~tlienylm~n~nese tricarbonyl)-2,3-propanediol. The diol is converted to the 3-O-dimethoxytrityl-2-O-phosphoramidite derivative and the title modified oligonucleotide is ple~aled by automated DNA synthesis techniques.
Plep~alion of NAXM 012 The di-t-butylsilylene of 1,1,1-tris(hydroxymethyl)ethane is l,i~a.ed and the third hydroxyl group is protected as the p-nitrobenzyl ether. The silylene is selectively hydroyzed using tributylammonium fluoride to produce 2-methyl-2-(methylp-nitrobenzyl ether)-1,3-propanediol. The diol is converted to the l-O-dimethoxytrityl-3-O-phosphoramidite derivative and the title sequence is p~ ed by 20 auLol-lated DNA synthesis techniques. The oligo is cleaved from the solid support without removing the protectin~ groups from the exocyclic amines or the phosphate groups. The solution is irradiated with 320 nm light to remove thep-nitrobenzyl ether protecting group. The oligo is lyophilized, dissolved in anhydrous acetonitrile and reacted with diethyl chlorophosphite. The oligonucleotide is then fully 25 deprotecLed by treatment with 40% aqueous ammonia, isolated by reverse phase HPLC and purifiled by passage through a Sephadex G25 column.

The ability to form cro~links via a templated photosubstitution re~c~;Qn.
Componentpmol/m Sample [mL]
, NAXM L

32P-Ol 1 0.~ 1 1 1 W O 96~0289 CA 02208794 1997-06-26 PCTAUS95/16916 32p ol2 0.2 32p_ol3 0.2 011 ~ 1 1 1 1 013 ]

Protocol-Add 1 mL of 50 mM 2-aminoethanol to each sample, loaded in a 96-well microtitre plate.
10 Add 18.5 mL, of 1:3 0.75M NaOH: lX TE (pH 7.5) to each sample Add 17.5 mL of neutralization buffer (1.75 mL of 3.5% BSA, 1.5 mL of 1.5 M HOAc, 11.3 mL of 20X SSC, and 2.15 mL of water) to each sample. Add 60 mL mineral oil to prevent evaporation.
Incubate at 40~C for 15 minutes.
15 Trr~ te at 40~C for 20 minlltes using UV-A lamps (shaIp cut-off filter at 300 nm) Analyze by ~e-n~tllnng PAGE (15 % with 7 M urea) The effect of thermal cycling on the amount of crncclinketl product formed Componentpmol/m Sample ~mL]
20 , NAXM L

32p_ol2 0.2 013 0.01 No. cycles 1 2 1 2 5 5 5 5 ~ th.o-rm~l + D + D + D + D
treat.
30 + = isothermal, no denaturation W 096~0289 CA 02208794 1997-06-26 ~-lJU~/16916 D = .c~mple.s denatured each cycle Protocol:
The sample pl~dtion is the same as above. After an initial incub~tion for 10 minutes at 40~C the samples were treated as intlic~t~ in the table.
Cycle:
Trr~ ,t~ at 40~C for l0 minutes Heat to 85~C for 2 minutes Incubate at 40~C for l0 minutes Repeat the cycle procedure the intlic~t~d number of times, ending with the 10 irr~ tif~n step at that cycle number.
Analyze by d~n~tl-ring PAGE (15 %, with 7 M urea) It is evident from the above results that the subject methodology provides a convenient and efficient way to identify the presence of specific nucleic acid sequences. Amplification is achieved in the absence of enzyme, using sht~mi~1 reactions to cross-link two probes tethered together by means of a template. Once the two probes have been cross-linked, they in turn may serve as a temp1~se for homologous sequences. In this way, a geometric expansion of cross-linked probes may be obtained in relation to a target sequence. Use of the subject ~u~o~ ic devices for p~lrolllling the subject assays provides for minimi7~tion of error introduction and improved con~ist~ncy in assay conditions.
All publications and patent applications mentioned in this specification are herein incol~,ated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incol~oldted by reference.
The invention now being fully described, it will be a~alellt to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

W 0 96~0289 CA 02208794 1997-06-26 ~ 7SIl6916 SEQUENCE LISTING

~1 ) G~N~RAT- INFORMATION:
(i) APPLICANT: NAXCOR, Inc.
(ii) TITLE OF INv~NllON: NUCLEIC ACID SEQUENCE DETECTION
EMPLOYING AMPLIFICATION PROBES
(iii) NUMBER OF SEQUENCES: 60 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: FLEHR, ~O~R~C~, TEST, ALBRITTON & HERBERT
(B) STREET: FOUR EMBARCADERO CENTER, SUITE 3400 (C) CITY: SAN FRANCISCO
(D) STATE: CA
( E) COUNTRY: US
(F) ZIP: 94111 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) CO~PUTER: IBM PC compatible (c) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/U595/
(B) FII.ING DATE:
(C~ CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
( A) NAME: ROWLAND, BERTRAM I
(B) REGISTRATION NUMBER: 20015 (C) REFERENCE/DOCKET NUM8ER: FP60396-2/BIR
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 415-781-1989 (B) TELEFAX: 415-398-3249 (2) INFORMATION F3R SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sinqle (D) TOPOLOGY: linear .

(ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

W O 96~0289 CA 02208794 1997-06-26 PCTrUS9~/16916 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
G111~1 1'G TTGAACAAAA ATCCT 25 5 ( 2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 baSe PairS
(B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: Sing1e (D) TOPOLOGY: 1inear (ii) MOLECULE TYPE: Other nUC1eiC aCid (A) DESCRIPTION: /deSC = "PrObe"

(X ) SEQUENCE DESCRIPTION: SEQ ID NO:2:

(2) INFORMATION FOR SEQ ID NO:3:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 60 baSe PairS
(B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: Sing1e (D) TOPOLOGY: 1inear (ii) MOLECULE TYPE: Other nUC1eiC aCid (A) DESCRIPTION: /deSC = "PrObe"

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
CTGGGAAACA TCA~AGGAAT TCTCGGAAAG AAAGCCAGCA GL~1C~L1 T~CAr7~AA~G 60 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 baSe PairS
(B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: Sing1e (D) TOPOLOGY: 1inear (ii) MOLECULE TYPE: Other nUC1eiC aCid (A) DESCRIPTION: /deSC = "PrObe"

(Xi) S~YU~:N~ DESCRIPTION: SEQ ID NO:4:
CATA&GGGAT ACCAGA~AAT TCA~AC 26 W O 96~0289 CA 02208794 1997-06-26 ~-1n~S/16916 (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LE,NGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TO:POLOGY: linear (ii) ~OLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENC13 DESCRIPTION: SEQ ID NO:6:
35 ACGATGCCGC CA~C~lC~lG CAAAA 25 (2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYE'E: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
~.~c~r.~cr~ TCGCAGTATT GAAAAC 26 55 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs W 096no289 CA 02208794 1997-06-26 ~ u~5ll69l6 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( ii ) MOT T~CUT ~ TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
A~ ~1L TGCGCACAGA CGATCTATTT 30 15 ( 2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (c~ STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"
2~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CG ~ CT TT 22 (2) INFORMATION FOR SEQ ID NO:lO:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

( ix) FEATURE:
(A) NAME/REY: misc_feature (B) LOCATION: l..20 (D) OTHER INFORMATION: /label= N
/note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:lO:

(2) INFORMATION FOR SEQ ID NO:ll:
--(i) SEQUENCE CHARACTERISTICS:

W O 96~0289 CA 02208794 l997-06-26 PCTrUS95/16916 (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULR TYPE: other nucleic acid (A) DE.SCRIPTION: /desc = "probe~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
A~ TGCGCGGCTT T 21 (2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs ( B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = ~'probe~

(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 21 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
PA~TA~-~TCG ~ GCA NA 22 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (c) STRANDEDNESS: single (D) TOPOLOGY: linear tii) ~OLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

~ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
TTTGCGCGCA AAGA~PA~T 20 (2) INFORMATION FOR SEQ ID NO:14:
~(i) SEQUENCE CHARACTERISTICS:

W 0 96~0289 CA 02208794 l997-06-26 ~ u~5ll69l6 (A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
TTT~T~ GCTCGTAATA TGCAAGAGCA TTGTAAGCAG AAGACTTA 48 (2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
TTT~T~ GCTCGTAATA TG~Ll~Ll~l TT 32 (2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRPND~nNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
50 TAAGL~L~L GCTTACAATG ~L~Lll '-L-Ll TT 32 (2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~ (D) TOPOLOGY: linear W O Sf~ 9 CA 02208794 1997-06-26 PCTrUS95116916 ( ii ) MOT.~UT.~ TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/REY: misc feature (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

15 ( 2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (c) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/ ~ Y: misc_feature (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "N = ethoxycoumarin~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
35 ANAAA~CATA TTACGAC,CTT TTTATAAA 28 (2) INFORMATION FOR SEQ ID NO:l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGT~: 30 base pairs (B) TYPE:: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/REY: misc feature (B) LOCATION: 5 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l9:
~ NP~GCA TATTACGAGC TTTTTATAAP 30 W 096no289 CA 02208794 1997-06-26 ~ /U~5/16916 (2) IN~ORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature (8) LOCATION: 2 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
ANAAAA~r.CA TATTACGAGC TTTTTATAAA 30 ~2) INFORMATION FOR SEQ ID NO:2l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
TAAGTCTTCT GCT$ACAATG CTCTTGCATA TTACGAGCTT TTTATAAA 48 (2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 49 base pairs ( B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
TAA61~11~1 GCTTACAATG AACTTGCATA TTACGAGCTT TTTATAAAT 49 W O 96~0289 CA 02208794 1997-06-26 ~ 5/16916 (2) INFOR~ATION FOR SEQ ID NO:2~:
(i) SEQUENCE CHARACTERISTICS:
(A) LEMGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single ~D) TOPOLOGY: linear (ii) MOLECULE' TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LEN~TH: 29 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single ( D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
1111111 l LC ATTGTAAGCA GAAGACTTA 29 (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 29 (D) OTHER INFORMATION: /note= "N=ethokyco~."arin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
TTTATA~A~A GCTCGTAATA TGCAAGAANA AAA 33 W 0 96~0289 CA 02208794 1997-06-26 r~llu~95ll69l6 (2) INFORMATION FOR SEQ ID NO:26:
'Q~N~ CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 28 (D) OTHER INFORMATION: /note= ''N=eth~yc~ arin~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
TTT~T~A~ GCTCGTAATA TGCAAGANAA AAA 33 (2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 54 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs ( B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/REY: misc feature ( B) LOCATION: 6 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

WO 96~0289 CA 0 2 2 0 8 7 9 4 19 9 7 - O 6 - 2 6 PCTnUS95/16gl6 (xi) ~yu~:~ DESCRIPTION: SEQ ID NO:28:
~AAA~NAr-cc GTTAGCTAAC GCTAATCGAT T 31 (2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(x-) SEQUENCE DESCRIPTION: SEQ ID NO:29:
GATATCGGAT TTACCAAATA CGGCGGGCCC 1 '''Ll 11' '' 37 (2) INFORMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

( ix ) FEATURE:
(A) NAME/KEY: misc feature (B) LOCATION: 6 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
AAAAAN~r.cc GTAl~LGt~lA AATcc~-ATA~ C 31 45 (2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (c) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe~

W 096~0289 CA 02208794 l997-06-26 PCTrUS95/16916 (Xi) ~:Q~N~ DESCRIPTION: SEQ ID NO:31:
AATCGATTAG CGTTAGCTAA CGGCGGGCCC llllll L 37 5 ( 2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) sT~ANnT~nNEss: single (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 4 tD) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID No:32:
25 AA~NA~GCCG TTAGCTAACG CTAATCGATT 30 ~2) INFORMATION FOR SEQ ID No:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pair~
(B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/REY: misc_feature (B) LOCATION: 3 (D) OTHER INFORMATION: /note- "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
AA~GCCG TTAGCTAACG CTAATCGATT 30 (2) INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sin~le (D) TOPOLOGY: linear ( ii ) M~T~T~cuT~T~' TYPE: other nucleic acid ~ (A) DESCRIPTION: /desc = "probe"

W 096no289 CA 02208794 1997-06-26 ~ 5~/16916 (ix) FEATURE':
(A) NAME/KEY: misc_feature (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) ~h~u~N~: DESCRIPTION: SEQ ID NO:34:

(2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs ~B) TYPE: nucleic acid (C) ST.RANDEDNESS: single (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: other nucleic acid (A) DE';CRIPTION: /desc = "probe"

(ix) FEATURE
(A) NA~E/KEY: misc feature (B) LOCATION: 1 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE: DESCRIPTION: SEQ ID No:35:

(2) INFORMATION P'OR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 62 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

(2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENC;TH: 37 base pairs (B) TYPE: nucleic acid W 096no289 CA 02208794 1997-06-26 PCTrUS95/16916 (C) STR~N~nNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NA~E/KEY: misc feature (B) LOCATION: 9 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
GGGC~ N~ TATCACATCG ACCTTGGTTT TTAAATC 37 (2) INFORMATION FOR SEQ ID NO:38:
( i ) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

( ix) FEATURE:
(A) NA~E/~EY: misc feature (B) LOCATION: 36 (D) OTHER INFOR~ATION: /note= "N-ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
GATTTA~AAA CCAAGGTCGA TGTGATAGGG CTCGANAAAA A 4l 40 (2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (8) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
TCGCCGATGA GTTCGACATT C~T~CGA GCC~llL~lC G 41 (2) INFORMATION FOR SEQ ID NO:40:

W O 96no289 CA 02208794 l997-06-26 ~l/V~5/16916 (i) ~yu~;~ CHARACTERISTICS:
~A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ( ii ) M~T ~CT~ TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4û:
5 1L-llLll lAT GTGGAATGTC GAACTCATCG GCGA 34 (2) INFORMATION FOR SEQ ID No:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature (8) LOCATION: 30 (D) OTHER INFORMATION: /note= "N=biotin"

(xi) ~Q~ ; DESCRIPTION: SEQ ID No:41:
.~LllCCAA GGAGGTAAAC G~lC~l~GN 30 (2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOP~OLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc feature (B) LOCATION: 1 (D) OTHER INFORMATION: /note= "N=fluorescein"
55 ' (ix) FEATURE:
(A) NAME/KEY: misc_feature ~- (B) LOCATION: 27 W O 96~0289 CA 02208794 1997-06-26 ~-llu~9sll69l6 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:

(2) INFORMATION FOR SEQ ID NO:43:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

( ix) FEATURE:
(A) NAME/REY: misc feature (B) LOCATION: 30 (D) OTHER INFORMATION: /note= "N=biotin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:
~ L~ CCC TTTATACGCT CAAGCAATAN 30 30 ( 2) INFORMATION FOR SEQ ID NO:44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (c) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/REY: misc_feature (B) LOCATION: l (D) OTHER INFORMATION: /note= "n=fluorescein"
(ix) FEATURE:
(A) NAME/REY: misc feature (B) LOCATION: 27 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:
55 Nl~ l lGCTA TAGCACTATC AAGCCANA 28 (2) INFORMATION FOR SEQ ID NO:45:

W O 96~0289 CA 02208794 1997-06-26 PCTAUS9~/16916 (i) ~hg~ CE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MO~-~CUr~ TYPE: other nucleic acid (A) DESCRIPTION: /desc = ~probe~

(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 30 (D) OTHER INFORMATION: /note= "N=biotin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:

(2) INFORMATION FOR SEQ ID NO:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs ( B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/~EY: misc feature ( B) LOCATION: l (D) OTHER INFORMATION: /note= "N=fluorescein~
(ix) FEATURE:
(A) NAME/REY: misc feature (B) LOCATION: 27 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:
NCTGCGTCTT GCTCTAl'TTG ACCGCANA 28 (2) INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs ~ (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe~

W 096no289 CA 02208794 1997-06-26 ~llu~gsll69l6 ~ix) FEATURE:
(A) NAME/REY: misc_feature (B) LOCATION: 30 (D) OTHER INFORMATION: /note- "n=biotin"
s (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:
GAG CGG~~ C ATTTGCCCAN 30 (2) INFORMATION FOR SEQ ID NO:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: single (D) TOPOLOGY: linear (i~) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature ( 8) LOCATION: 1 (D) OTHER INFORMATION: /note= "N=fluorescein~' (ix) FEATURE:
(A) NAME/KEY: misc_feature ( B) LOCATION: 27 (D) OTHER INFORMATION: /note= "N=ethoxycoumarin"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:

(2) INFORMATION FOR SEQ ID NO:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 62 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOG~: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:
ATCGCCGATG AGTTCGACAT TCCACATACG AGCCCTATCA CATCGACCTT G~LL1 L LAAA 60 (2) INFORMATION FOR SEQ ID NO:50:

W 096~0289 CA 02208794 l997-06-26 PCTrUS95/169l6 (i) ~u~ ~ CHARACTERISTICS:
(A) LENGTH: 15 base pairs ~B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = ~probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:
15 AAAGGGCTCG AA~ A 15 (2) INFORMATION FOR SEQ ID NO:51:
(i) SEQUENCE CHARACTERISTICS:
( A) LENGTH: 46 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = '~probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:
TCTTTATTTA ~TATAG~T ~L~ lA GAGAGTTTAG AAGAAT 46 3~
(2) INFORMATION FOR SEQ ID NO:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:
All~ll~lAA A~ AAA AAACAAGGAA 30 (2) INFORMATION FOR SEQ ID NO:53:
- 55 ( i ) SEQUENCE CHARACTERISTICS:
(A) LENGT~: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single wo s6no2ss CA 02208794 1997-06-26 pcTnus9sll6sl6 ~D) TOPOLOGY: linear (ii) ~OLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc feature (8) LOCATION: 2 (D) OTHER INFORMATION: /note=
~N=2'-deoxy-5-(b-aminoethoxymethyl)uridine"
(ix) FEATURE:
(A) NAME/XEY: misc feature (B) LOCATION: 5 (D) OTHER INFORMATION: /note=
~N=2'-deoxy-5(b-aminoethoxymethyl)uridine"

(Xl) SEQUENCE DESCRIPTION: SEQ ID NO:53:

(2) INFORMATION FOR SEQ ID NO:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:
40 A~ l~lAA A~l~l~lAAA A~C~G~ 29 (2) INFORMATION FOR SEQ ID NO:55:
(i) SEQUENCE CHARACTERISTICS:
4~ (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear ~0 (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = ~probe~

(ix) FEATURE:
(A) NAMEtKEY: misc_feature (B) LOCATION: 2 (D) OTHER INFORMATION: /note=
"N=2'-deoxy-5-(b-aminoethoxymethyl)uridine"

W 0 96~0289 CA 02208794 1997-06-26 ~lr~7S/16916 (ix) FEATURE:
(A) NAME/XEY: misc_feature (B) LOrATION: 4 (D) OTHER INFORMATION: /note=
5 ~N=2'-deoxy-5-(b-aminoethoxymethyl)uridine"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:

(2) INFORMATION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sinqle (D) TOPOLOGY: linear ( ii ) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NA~.EJKEY: misc_feature (8) LOCATION: 27 (D) OTHER INFORMATION: /note= "N=Pt or Pd square planar complex"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:
A~ ~LAA A~ AAA A~A~N~ 29 (2) INFORMATION FOR SEQ ID NO:57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STR~NDEDNESS: sin~le (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/ ~ Y: misc_feature (B) LOCATION: 3 (D) OTHER INFORMATION: /note= "N=4-thiouridine"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:
~ 55 TTNTTGGAAA TTCTATATCT AAATAAAGA 29 (2) INFORMATION FC)R SEQ ID NO:58:

w o 96no289 CA 02208794 1997-06-26 ~-1n~SS/16916 (i) SEQUENCE CBARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
(A) NAME/KEY: misc_feature (B) LOCATION: 27 (D) OTHER INFORMATION: /note=
15 ''N=cyclopentadienylmanganese(I)tricarbonyl~

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:
20 r.~T~C~.~CGC CGCA~AAGCT CTTCATNAG 29 (2) INFORMATION FOR SEQ ID NO:59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(ix) FEATURE:
( A) NAME/KEY: misc_feature (B) LOCATION: 3 (D) OTHER INFORMATION: /note= "N=trialkylphosphate"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:

(2) INFORMATION FOR SEQ ID NO:60:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: /desc = "probe"

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:

WO 96no289 CA 02208794 1997-06-26 ~-1/U~g5/16916

Claims (46)

WHAT IS CLAIMED IS:

1. A method for detecting a target nucleic acid sequence in a sample, said method employing at least one pair of probes characterized by having sequences homologous to adjacent portions of said target nucleic acid sequence and having side chains which non-covalently bind to form a stem upon base pairing of said probes to said target nucleic acid sequence, at least one of said side chains having an activatable group, which upon activation during stem formation forms a covalent cross-link with the other side chain member of said stem, said method comprising:
combining said sample with said at least one pair of probes under conditions of base pairing between said probes and said target nucleic acid to produce an assay medium, whereby probes binding to said target nucleic acid form said stem;
activating said activatable group, whereby a covalent cross-link occurs between said side chain members of said stem; and detecting the presence of cross-linked pairs of probes as indicative of the presence of said target sequence in said sample.

2. A method according to Claim 1, wherein said activating is photoactivating.

3. A method according to Claim 1, wherein said target nucleic acid is double stranded and two different pairs of probes are used, where each pair is homologous to one of the strands of said target nucleic acid.

4. A method for detecting a target nucleic acid sequence in a sample, said method employing at least one pair of probes characterized by having sequences homologous to adjacent portions of said target nucleic acid sequence and having side chains which non-covalently bind to form a stem upon base pairing of said probes to said target nucleic acid sequence, at least one of said side chains having a photoactivatable group, which upon activation during stem formation forms a covalent cross-link with the other side chain member of said stem, each of said side chains having at least two nucleotides capable of base pairing with the other side chain to form said stem, said method comprising:
combining said sample with said at least one pair of probes under conditions of base pairing between said probes and said target nucleic acid, wherein when said target nucleic acid is single stranded, at least a first pair of probes is added which is homologous to said single stranded nucleic acid, and if said target nucleic acid is double stranded, at least one of first and second pairs of probes are added, which pairs are homologous to one or the other strands of said double stranded target nucleic acid, whereby probes binding to said target nucleic acid form said stem;photoactivating said photoactivatable group, whereby a covalent cross-link is formed between said side chain members of said stem;
melting double stranded nucleic acid;
repeating the following cycle at least once:
incubating for sufficient time for base pairing between homologous sequences to occur, with the proviso that when only said first pair of probes was added, another pair of probes is added having a sequence analogous to said target nucleic acid;
photoactivating said photoactivatable group, whereby a covalent cross-link is formed between said side chain members of said stem; and melting double stranded DNA, which ends a cycle; and detecting the presence of cross-linked pairs of probes as indicative of the presence of said target sequence in said sample.

5. A method according to Claim 4, wherein said target sequence has a gap of fewer than 2 nucleotides between the sequences homologous to said pair ofprobes and each of said side chains of said stem comprise at least three nucleotides or hybridizing analogs thereof which form base pairs.

6. A method according to Claim 5, wherein said side chains have from 3 to 8 nucleotides or hybridizing analogs thereof which base pair to form said stem.

7. A method according to Claim 4, wherein said photoactivatable group reacts with a nucleotide or analog thereof to form a covalent bond cross-link.

8. A method according to Claim 7, wherein said photoactivatable group is a moiety comprising a coumarin or furocoumarin.

9. A method according to Claim 4, wherein on one of said side chains said at least two nucleotides capable of base pairing with the other side chain to form said stem are separated from said photoactivatable group.

10. A method according to Claim 4, wherein each of said side chains comprises different fluorophores, wherein the energy of emitted light of a first of said fluorophores is in the absorption band of a second of said fluorophores, wherein said detecting the presence of cross-linked probes comprises:
exciting said first fluorophore; and reading the fluorescence of said second fluorophore.

11. A method according to Claim 4, wherein each of probes comprises a label, wherein one of said labels is a member of a specific binding pair and the other of said labels provides for a detectable signal, wherein said detecting the presence of cross-linked probes comprises:
separating said cross-linked probes from said sample on a solid support; and detecting the presence of said signal on said solid support.

12. A method according to Claim 4, wherein at least three cycles are repeated.

13. A method for detecting a sequence of target dsDNA in a sample, said method employing first and second pairs of probes characterized by having sequences homologous to adjacent portions of first and second strands of said target dsDNA and having side chains which non-covalently bind to form a stem upon base pairing of said probes to said target first and second strands, respectively, at least one of said side chains in each pair having a photoactivatable group, which uponactivation during stem formation forms a covalent cross-link with the other sidechain member of said stem, each of said side chains having at least two nucleotides capable of base pairing with the other side chain to form said stem, said methodcomprising:
combining said sample with said first and second pairs of probes under conditions of base pairing between said probes and said target nucleic acid, which first and second pairs of probes are homologous to one or the other strands of said target dsDNA, whereby probes binding to said target nucleic acid form said stem;photoactivating said photoactivatable group, whereby a covalent cross-link is formed between said side chain members of said stem;
melting double stranded nucleic acid;
repeating the following cycle at least once:
incubating for sufficient time for base pairing between homologous sequences to occur;
photoactivating said photoactivatable group, whereby a covalent cross-link occurs between said side chain members of said stem; and melting double stranded DNA, which ends a cycle; and detecting the presence of cross-linked pairs of probes as indicative of the presence of said target dsDNA in said sample.

14. A method according to Claim 13, wherein one of said side chains has a bulge in the side chain between the nucleotide base pairing with said target sequence and directly linked to said side chain and the first nucleotide base pairing with a nucleotide of the other side chain member of said stem.

15. A method according to Claim 13, wherein said side chains have from 3 to 8 nucleotides which base pair to form said stem.

16. A method according to Claim 13, wherein said photoactivatable group reacts with a nucleotide or analog thereof to form a covalent bond cross-link.

17. A method according to Claim 13, wherein said photoactivatable group is a moiety comprising a coumarin or furocoumarin.

18. A method according to Claim 13, wherein at least three cycles are repeated.

19. A method according to Claim 13, wherein each of said side chains comprises different fluorophores, wherein the energy of emitted light of a first of said fluorophores is in the absorption band of a second of said fluorophores, wherein said detecting the presence of cross-linked probes comprises:
exciting said first fluorophore; and reading the fluorescence of said second fluorophore.

20. A method according to Claim 13, wherein each of said probes comprises a label, wherein one of said labels is a member of a specific binding pair and the other of said labels provides for a detectable signal, wherein said detecting the presence of cross-linked probes comprises:
separating said cross-linked probes from said sample on a solid support; and detecting the presence of said signal on said solid support.

21. A method for detecting a target nucleic acid sequence in a sample, said method employing at least one pair of probes characterized by having sequences homologous to adjacent portions of said target nucleic acid sequence and having side chains which non-covalently bind to form a stem upon base pairing of said probes to said target nucleic acid sequence, at least one of said side chains having an activatable group, which upon activation during stem formation forms a covalent cross-link with the other side chain member of said stem, and at least one of said stems forming a hairpin or stem and loop by one portion of said side chain binding to a different portion of said chain or to the sequence of said probe homologous to said target, said method comprising:
combining said sample with said pair of probes under conditions of melting of said hairpin or stem and loop and of base pairing between said probes and said target nucleic acid to produce an assay medium, whereby probes binding to said target nucleic acid form said stem;
activating said activatable group, whereby a covalent cross-link occurs between said side chain members of said stem; and detecting the presence of cross-linked pairs of probes as indicative of the presence of said target sequence in said sample.

22. A method according to Claim 21, wherein said hairpin comprises a bulge, said bulge comprising said photoactivatable group.

23. A method according to Claim 21, wherein one of said side chains comprises a terminal sequence complementary to the sequence homologous to said target sequence joined to said stem forming sequence by a linking group other than an oligonucleotide.

24. A kit comprising at least one pair of probes, said probes being characterized by having sequences homologous to adjacent portions of a target nucleic acid sequence and having side chains which non-covalently bind to form astem upon base pairing of said probes to said target nucleic acid sequence, at least one of said side chains having an activatable group, which upon activation during stem formation forms a covalent cross-link with the other side chain member of said stem.

25. A kit according to Claim 24, comprising at least two pairs of probes, where said target nucleic acid sequence is single or double stranded nucleic acid and the sequences of said probes homologous to one strand of said nucleic acid of one pair of probes are homologous to the sequences of the other pair of probes.

26. A kit according to Claim 25, wherein each of the members of said stem have at least two nucleotides which base pair to form said stem and one member of each of said pairs of probes has a bulge in the side chain between thenucleotide base pairing with said target sequence and directly linked to said side chain and the first nucleotide base pairing with a nucleotide of the other side chain member of said stem.

27. A kit according to Claim 24, wherein at least one of said side chains which comprises an activatable group forms a hairpin or stem and loop by one portion of said side chain binding to a different portion of said side chain or to the sequence of said probe homologous to said target.

28. A kit comprising at least one pair of probes, said probes being characterized by having sequences homologous to adjacent portions of a target nucleic acid sequence and having side chains which non-covalently bind to form astem upon base pairing of said probes to said target nucleic acid sequence, each of the members of said stem have at least two nucleotides which base pair to form said stem, at least one of said side chains having a photoactivatable group, which upon activation during stem formation forms a covalent cross-link with the other sidechain member of said stem.

29. A kit according to Claim 28, wherein said photoactivatable group is coumarin or psoralen.

30. A nucleic acid compound comprising a nucleic acid sequence of at least 12 nucleotides defining a sequence of interest covalently linked at one end to a side chain characterized by having at least two nucleotides and not more than 8 nucleotides, and having a photoactivatable group other than a nucleotide.

31. A nucleic acid compound according to Claim 30, wherein said photoactivatable group is a moiety comprising a coumarin or furocoumarin covalently bonded to a linking group in the backbone of said nucleic acid compound and comprising other than a nucleoside.

32. An oligonucleotide comprising from 2 to 60 nucleotides and a deoxyribosyl backbone having intervening in said backbone from 1 to 2 linkers comprising other than nucleosides and pendent from said linkers, a photoactivatable group other than a nucleotide, capable of forming a covalent bond with a nucleotide.

33. An oligonucleotide according to Claim 32, wherein said oligonucleotide comprises member of a specific binding pair.

34. An oligonucleotide according to Claim 32, wherein said oligonucleotide comprises a directly detectable label.

35. An oligonucleotide according to Claim 34, wherein said directly detectable label is a fluorophore.

36. An oligonucleotide according to Claim 32, wherein said photoactivatable group comprises coumarin.

37. An oligonucleotide compound comprising a first oligonucleotide unit comprising at least 14 nucleotides and a deoxyribosyl backbone having intervening in said backbone proximal to a first terminus of said first oligonucleotide unit from 1 to 2 linkers comprising other than nucleosides and pendent from said linkers, a photoactivatable group, other than a nucleotide, capable of forming a covalent bond with a nucleotide, said first terminus defining a side chain, and linked through said photoactivatable group a second oligonucleotide unit comprising at least 14 nucleotides and comprising a side chain having nucleotides complementary to and capable of base pairing with nucleotides in said first side chain at a second terminus opposite to said first terminus defining a complementary side chain, said first and second side chains forming a stem.

38. An automatic device for detecting a target nucleic acid sequence in a sample by a method employing at least one pair of probes characterized by havingsequences homologous to adjacent portions of said target nucleic acid sequence and having side chains which non-covalently bind to form a stem upon base pairing ofsaid probes to said target nucleic acid sequence, at least one of said side chains having an activatable group, which upon activation during stem formation forms acovalent cross-link with the other side chain member of said stem, where in saidmethod said sample and said probes are combined in an assay medium under base-pairing conditions, said activatable groups are activated resulting in cross-linked pairs of probes and said cross-linked pairs of probes are detected as indicative of the presence of said target sequence in said sample, said device comprising:
a means for modulating the base pairing conditions of said assay medium;
and a control circuit responsive to the base pairing conditions of said medium and configured to actuate an activator for said activatable group at a predetermined assay medium condition.

39. The device according to Claim 38 wherein the base pairing conditions of said assay medium is the temperature of said medium.

40. The device according to Claim 38, wherein said activatable group is a photoactivatable group and said activator is an irradiation source.

41. An automatic device for detecting a target nucleic acid sequence in a sample by a method employing at least one pair of probes characterized by havingsequences homologous to adjacent portions of said target nucleic acid sequence and having side chains which non-covalently bind to form a stem upon base pairing ofsaid probes to said target nucleic acid sequence, at least one of said side chains having an activatable group, which upon activation during stem formation forms acovalent cross-link with the other side chain member of said stem, where in saidmethod said sample and said probes are combined in an assay medium under base-pairing conditions, said activatable groups are activated resulting in cross-linked pairs of probes and said cross-linked pairs of probes are detected as indicative of the presence of said target sequence in said sample, said device comprising:
a thermal cycler for modulating the temperature of said assay medium;

a control circuit responsive to the temperature of said assay medium and configured to actuate an irradiation source for activating said activatable group when said temperature is below a first predetermined temperature; and as assay containment means for holding said assay medium.

42. The device according to Claim 41, wherein said control circuit comprises a thermistor for transducing the temperature of said assay medium into an electrical signa.

43. The device according to Claim 42, wherein said control circuit is configured so that said irradiation source is inactivated at a second predetermined temperature, wherein said second predetermined temperature is a temperature below said first predetermined temperature.

44. A method for detecting a target nucleic acid sequence in a sample, said method employing at least one pair of probes characterized by having sequences homologous to adjacent portions of said target nucleic acid sequence and having side chains which non-covalently bind to form a stem upon base pairing of said probes to said target nucleic acid sequence, at least one of said side chains having an activatable group, which upon activation during stem formation forms a covalent cross-link with the other side chain member of said stem, wherein at least one of said side chains has a linker comprising other than a nucleic acid and pending from said linker is said activatable group, said method comprising:
combining said sample with said at least one pair of probes under conditions of base pairing between said probes and said target nucleic acid to produce an assay medium, whereby probes binding to said target nucleic acid form said stem;
activating said activatable group, whereby a covalent cross-link occurs between said side chain members of said stem; and detecting the presence of cross-linked pairs of probes as indicative of the presence of said target sequence in said sample.

45. A method according to claim 44, wherein said activating is photoactivating.

46. A method according to claim 44, wherein said target nucleic acid is double stranded and two different pairs of probes are used, where each pair is homologous to one of the strands of said target nucleic acid.