CA2258511A1 - Method for polynucleotide sequencing - Google Patents
Method for polynucleotide sequencing Download PDFInfo
- Publication number
- CA2258511A1 CA2258511A1 CA002258511A CA2258511A CA2258511A1 CA 2258511 A1 CA2258511 A1 CA 2258511A1 CA 002258511 A CA002258511 A CA 002258511A CA 2258511 A CA2258511 A CA 2258511A CA 2258511 A1 CA2258511 A1 CA 2258511A1
- Authority
- CA
- Canada
- Prior art keywords
- primer
- template
- string
- analog
- label
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/14—Heterocyclic carbon compound [i.e., O, S, N, Se, Te, as only ring hetero atom]
- Y10T436/142222—Hetero-O [e.g., ascorbic acid, etc.]
- Y10T436/143333—Saccharide [e.g., DNA, etc.]
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is a method of sequencing polynucleotides by sequential step sequencing. Sequential step sequencing begins with a single-stranded polynucleotide template that is annealed with a primer forming a primer-template complex. In one embodiment of the method, one labeled nucleotide at a time is added to the primer-template complex. Alternatively, this method can be used with a nucleotide or nucleotide analog that does not stop addition after a first nucleotide or nucleotide analog has been added to the primer.
Other embodiments of the invention involve identification of polynucleotides having a contiguous non-redundant string or a superimposed non-redundant string pattern. The detection of a non-redundant contiguous string can be used to identify a particular gene. Alternatively, if the non-redundant contiguous string is not unique to a particular gene, the string can be used to form a DNA library that can then be searched with a second string. Similarly, a superimposed non-redundant string pattern can be used to identify a gene or to search a DNA library. Such strings can be used in annealing reactions and in computer searches of a database having a catalog of sequenced polynucleotides.
Other embodiments of the invention involve identification of polynucleotides having a contiguous non-redundant string or a superimposed non-redundant string pattern. The detection of a non-redundant contiguous string can be used to identify a particular gene. Alternatively, if the non-redundant contiguous string is not unique to a particular gene, the string can be used to form a DNA library that can then be searched with a second string. Similarly, a superimposed non-redundant string pattern can be used to identify a gene or to search a DNA library. Such strings can be used in annealing reactions and in computer searches of a database having a catalog of sequenced polynucleotides.
Description
CA 022~8~11 1998-12-14 METHOD FOR POLYNUCLEOTIDE SEQUENCING
Related Co-Pending U.S. Patent Applications This patent application is being concurrently filed with the following related U.S. patent applications: "Nuclease Protection Assays," R. Kllm~r, inventor, 5 Attorney Docket No. DSRC 12038; "Microfluidic Method for Nucleic Acid Amplification," Z. Loewy and R. Kumar, inventors, Attorney Docket No. DSRC
12050; "Method for Amplifying a Polynucleotide," Z. Loewy, inventor, Attorney Docket No. DSRC 12081; "Automated Nucleic Acid Preparation" D. Southgate and Z. Loewy, inventors, Attorney Docket No. DSRC 12120; and "Padlock Probe 1 0Detection," R. KllmP~r, inventor, Attorney Docket No. 317913/12162. This patent application is related to the following copending U.S. patent applications: Ser.No.60/009517, filed November 3, 1995; Ser. No. 60/00602, filed November 3, 1995; and Ser. No. 60/010513, filed January 24, 1996. All of the foregoing patent applications are hereby incorporated by reference herein in their entirety.
1 5This invention was made with U.S. Government support under Contract No.
70NANB5H1037. The U.S. Government has certain rights in this invention.
In one aspect, the present invention provides a new method for determining the base sequence of RNA or DNA, termed sequential step sequencing. In another aspect, the present invention provides new methods of identifying a 20 polynucleotide or polynucleotides using a contiguous string of non-redundant nucleotides or a superimposed non-redundant string pattern.
Prior art methods of sequencing include the M~m-Gilbert method and the Sanger dideoxy method. In the lVr~m-Gilbert method, a substrate DNA is labeled on one strand with 32p at the ~'-hydroxyl terminus. The labeled DNA is 25 then broken preferentially at one of the four nucleotides using one reaction mixture for each base, the reaction conditions causing an average of one break per DNA molecule. In the reaction mixture for each base, each broken chain yields a radiolabeled fragment extending from the 32p 5'-hydroxyl terminus to one of the positions in the DNA in which that base appears. Thus, every time a base 3 0 appears in a DNA molecule, it generates a fragment of a different size, which are then separated by gel electrophoresis. The autoradiogram of a gel in which all four chemical reactions have been entered into the gel shows a pattern of bands CA 022~8~11 1998-12-14 from which the sequence of the DNA can be read. See, for example, Stryer, Biochemistry (3d ed. 1988) at pages 120-121.
In the Sanger dideoxy method, DNA is sequenced by generating fragments through the controlled interruption of enzymatic replication. First, a primer is5 constructed which is complementary to the DNA sequence. Then, DNA
polymerase is used to copy a sequence of a single-stranded DNA using the primer and four labeled deoxyribonucleoside triphosphates and a 2',3'-dideoxy analog ofeach of the triphosphates. The incorporation of an analog in the new DNA strand being synthesized results in the termination of incorporation of labeled 10 deoxyribonucleoside triphosphates since the dideoxy analogs lack the 3'-hyd~o~yl terminus needed to form the next phosphodiester bond. Thus, the synthesis results in DNA fragments of various lengths in which the dideoxy analog is at the 3' end. The reaction mixture for each base can then be separately electrophoresed on a gel or electrophoresed together if the deoxyribonucleoside triphosphate 15 corresponding to each base has a separate label. See, for example, Stryer, Biochemistry (3d ed. 1988) at pages 121-123.
The sequential step sequencing methods of the invention, unlike the above-described seqllençing methods, involve individual reactions for each type of base in every position in which it appears on the DNA molecule, or for every position in 2 0 which it appears next to a different type of base. The large number of reactions involved would likely have been considered impractical due to being too labor-intensive under the procedures known in the prior art for performing the necessary chemical reactions.
However, the sequential step sequencing methods of the invention can be 2 5 used, for example, in the context of a microfluidics-based device for automatedly moving fluids in and out of a reaction chamber, which has been disclosed in U.S.Patent Serial Number 60/010613, filed January 24, 1996, the contents of which are incorporated herein by reference. This combination of the microfluidics-based system and the methods of the invention makes sequential step sequencing an 3 0 attractive alternative to known conventional methods of nucleotide sequencing.
Furthermore, the present invention provides an advantage in eliminating the need for electrophoresis, which is one of the most time-consuming steps of the CA 022~8~11 1998-12-14 sequencing reactions of the prior art. Additionally, the present invention provides for an increased rate of sequence read-out since nucleotide addition can occur, for example, at 800 nucleotides per minute.
Further, the present invention provides the advantage, for example, of 5 providing a me~h~ni.~m for more accurate determin~tion of sequences, such as the sequence adjacent to the poly-A tail of a polynucleotide.
SUMMARY OF THE INVENTION
In one aspect, the present invention provides a method of sequential step sequencing of a polynucleotide having x number of nucleotides comprising:
(A) providing a single-stranded polynucleotide template and a first complementary primer having n nucleotides, wherein n is an integer greater than three;
(B) causing the template and the primer to anneal, thereby forming a template-primer complex;
(C) adding a template-dependent nucleotide polymerase and at least one nucleoside triphosphate or analog thereof having a label attached thereto, wherein the nucleoside triphosphate or analog thereof includes a base selected from the group consisting of adenine, thymine, cytosine, guanine, and uracil; and (D) determining whether a label is associated with the template-primer~ 0 complex or which label is associated with the template-primer complex.
DETAILED DESCRIPTION
DEFINITIONS
The following terms shall have the me~ning set forth below:
~ sequential step sequencing - sequencing a polynucleotide by individual 25 reactions, each reaction detecting no more than the sequence of one type of nucleotide at a time. The nucleotide detected can occur, for example, once or more than once in adjacent positions, such as G,GG or GGGGG (SEQ ID NO: 1).
~ actual non-redundant contiguous string - a base sequence in which the sequence of each base is actually not repeated in the immediately adjacent base.3 0 For example, TACATGTACTGCT (SEQ ID NO: 2) is an actual non-redundant contiguous string, whereas TAACATGTACTGCTT (SEQ ID NO: 3) is not, CA 022~8~11 1998-12-14 although the underlined sequence within this sequence, ACATGTACTGCT (SEQ
ID NO: 4), is an actual non-redundant contiguous string.
~ superimposed non-redundant string pattern - pattern derived from an actual sequence. In the pattern, the redundancies in the actual sequence are 5 removed, a redundancy being the duplication of a base in the immediately adjacent base. For example, given an actual sequence CATTAAAGGGAAAAGCCCAGTCA (SEQ ID NO: 5), the superimposed non-redundant string pattern of the sequence is CATAGAGCAGTCA (SEQ ID NO: 6).
In one aspect, the present invention relates to methods of sequencing of 10 polynucleotides using sequential step sequencing. The sequential step sequencing methods of the invention, unlike the methods of the prior art, involve individual reactions for each type of base in every position in which it appears on the DNAmolecule, or for every position in which it appears next to a different type of base.
The methods of the invention are preferably used in the context of a microfluidics-15 based device for automatedly moving fluids in and out of a reaction chamber,which has been disclosed in U.S. Patent Serial Number 60/010513, filed January 24, 1996, the contents of which are incorporated herein by reference. The present invention provides an advantage over prior art methods, for example, in elimin~ting the need for electrophoresis, which is one of the most time-consuming 2 0 steps of sequencing reactions. Additionally, the present invention provides for an increased rate of sequence read-out since nucleotide addition can occur, for example, at 800 nucleotides per minute.
The methods of the invention begin with the provision of a single-stranded polynucleotide template that is annealed with a primer, forming a template-2 5 primer complex. In one aspect, the present invention provides for adding onenucleoside triphosphate or analog thereof at a time to the template-primer complex, the nucleoside triphosphate or analog being labelled. If necessary, each of the four nucleoside triphosphates or analogs is added until a label is detected due to the incorporation of a nucleotide into the complex. This method can be 30 used with a nucleoside triphosphate analog that is modified to preclude any subsequent addition of such analog after a first analog has been added to the primer, such as a dideoxynucleoside triphosphate. Alternatively, this method can CA 022~8~11 1998-12-14 be used with a nucleoside triphosphate or analog thereof that does not stop addition after a first nucleotide or nucleotide analog has been added to the primer.
In other aspects of the invention, all four nucleoside triphosphates or analogs 5 are added at once to the complex, each nucleoside triphosphate or analog having a different label. Using the latter method, the sequence at this position is determined by identifying the type of label incorporated into the complex. This method is preferably used only with a nucleoside triphosphate analog that is modified to preclude any subsequent addition of such analog after a first analog10 has been added to the primer.
In one aspect of the invention, when a nucleoside triphosphate or analog is used in the sequential step sequencing methods of the invention, in which the nucleoside triphosphate or analog is not modified to preclude any subsequent addition of such nucleoside triphosphate or analog after a first nucleotide has 15 been added to the primer, the sequence obtained may not match the actual sequence of the polynucleotide. Instead, the sequence obtained may be a superimposed non-redundant string pattern. Specifically, if the polynucleotide sequence has a redundancy such that immediately adjacent bases are the same, the sequence obtained using the latter methods of the invention will only detect2 0 one of the bases. For example, a polynucleotide with a sequence of CATTAAAGGGAAAGCCCAGTCA (SEQ ID NO:5) will be detected as the corresponding superimposed non-redundant string pattern, CATAGAGCAGTCA
(SEQID NO: 6). Thus, in one aspect, the methods of the invention provide for thedetection of a superimposed non-redundant string pattern in a polynucleotide 2 5 template.
In another aspect of the invention, when a nucleoside triphosphate or analog is used in the sequential step sequencing methods of the invention, in which thenucleoside triphosphate or analog is not modified to preclude any subsequent addition of such nucleoside triphosphate or analog after a first nucleotide has 3 0 been added to the primer, the sequence obtained will match the actual sequence of the polynucleotide when the amount of label attached to the nucleotide is CA 022~8~11 1998-12-14 quantified, using for example, autoradiography followed by ~c~nning of the autoradiogram to determine signal strength.
More generally, in one aspect, the present invention provides a method of sequential step seqll~n(ing of a polynucleotide having x number of nucleotides 5 comprising:
(A) providing a single-stranded polynucleotide template and a first complementary primer having n nucleotides, wherein n is an integer greater than three;
(B) causing the template and the primer to anneal, thereby forming a 10 template-primer complex;
(C) adding a template-dependent nucleotide polymerase and at least one nucleoside triphosphate or analog thereof having a label attached thereto, wherein the nucleoside triphosphate or analog thereof includes a base selected from the group consisting of adenine, thymine, cytosine, guanine, and uracil;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
Peferably, the above method also includes removing unincorporated nucleoside triphosphate or analog from the template-primer complex.
In certain embodiments of the above method, step (C) is limited to using one 2 0 nucleoside triphosphate or analog thereof, and if no label is associated with the template-primer complex as determined in step (D), then steps (A) to (D) are repeated using another nucleoside triphosphate or analog thereof having a different base than that used previously in step (C), steps (A) to (D) being repeated until it is determined that a label is associated with the template-primer 2 5 complex.
Preferably, the above methods further comprise step (E), step (E) being, upon having determined which base was added to the first primer by exercise of step (D), a second primer is generated having n+y nucleotides, y being one or the number of identical adjacent nucleotides, wherein the added nucleotide is at its 3' 3 0 end; and steps (A) to (D) are repeated with the proviso that the second primer is substituted for the first primer. Step (E) is preferably repeated until the primer is CA 022~8~ll l998-l2-l4 at least x nucleotides long, such that n=x, n being the number of nucleotides inthe polynucleotide being sequenced.
In certain embodiments, the methods of the invention involve the use of a nucleoside triphosphate analog modified to preclude any subsequent addition of 5 such analog after a first analog has been added to the primer.
When such nucleoside triphosphate analog is used with the methods of the invention, in addition to adding one labeled nucleoside triphosphate analog at atime, the methods also include the addition of more than one labeled nucleoside triphosphate analog at a time. Thus, in certain embodiments, the nucleoside 10 triphosphate analog of step (C) is a combination comprising two, three, or four different nucleoside triphosphate analogs having different bases, wherein the nucleoside triphosphate analogs having different bases are differentially labeled.
Preferably, the differentially labeled nucleoside triphosphate analogs are labeled with fluorescent dyes, such as fluorescein, rhodamine, 7-amino-4-methylcoumarin, dansyl chloride, Cy3, Hoechst 33258, R-phycoerythrin, Quantum RedTM, Texas Red, suitable analogs and derivatives thereof, and the like, which can be obtained commercially, such as from Sigma.
When a combination of two, three or four different nucleoside triphosphate analogs are used, it is preferred to use a combination of all four different 2 0 nucleoside triphosphate analogs are used in concert, the four nucleoside triphosphate analogs having the bases adenine, thymine, cytosine and guanine if the polymerase is DNA-dependent, or the bases adenine, uracil, cytosine and guanine if the polymerase is RNA-dependent.
The above-described sequential step sequencing methods of the invention 2 5 preferably include step (E), step (E) being, upon having determined which base was added to the first primer by exercise of steps (A) to (D), a second primer is generated having n+1 nucleotides, wherein the added nucleotide or nucleotides are at its 3' end; and steps (A) to (D) are repeated with the proviso that the second primer is substituted for the first primer. In certain preferred embodiments, step 3 0 (E) is repeated until n is x nucleotides long, x being the number of nucleotides in the polynucleotide being sequenced, thereby providing for a full sequence.
CA 022~8~11 1998-12-14 The methods of the present invention can be used, for example, to sequence the 3' end of an mRNA or a cDNA nucleotide sequence. Using sequential step DNA seql~e~ing and a poly-T or a poly-U primer, nucleoside triphosphates or analogs thereof having the bases thymine or uracil are added until the primer is5 extended to the beE~inning of the poly-A tail. The sequence from this point is then determined using the methods of sequential step sequencing described above, and can be used to determine the actual sequence, or a superimposed non-redundant string pattern. This aspect of the invention overcomes the problems associated with the prior art sequencing methods, such as the presence of a smear on the 10 sequencing gel since a poly-T or poly-U primer randomly anneals to different parts of the poly-A tail.
Specifically, the above-described methods of se~uential step sequencing can be used to sequence polynucleotides adjacent to a poly-A tail of the template, the methods further comprising the following steps prior to providing the first primer 15 in step (A):
(a) providing a single-stranded polynucleotide template and an initial complementary primer, the template having a poly-A sequence, and the primer being a poly-T or a poly-U primer;
(b) causing the template and the primer to anneal, thereby forming a 2 0 template-primer complex;
(c) adding a template-dependent nucleotide polymerase and an nucleoside triphosphate or analog thereof including a base, the base being thymine or uracil, thereby forming an elongated initial primer.
In certain embodiments, the sequenced polynucleotides near the poly-A tail of 25 the template are contiguous, and optionally, the sequenced nucleotides form a non-redundant contiguous string. In other embodiments, the sequenced polynucleotides near the poly-A tail of the template are non-contiguous and forma superimposed non-redundant string pattern.
In certain embodiments, the first primer used in step (A) is the elongated 30 initial primer, the primer being complementary to the 5' end of the poly-A
sequence in the template polynucleotide. In other embodiments, the elongated initial primer is used to determine at least one nucleotide of the template adjacent CA 022~8~11 1998-12-14 WO 97/47761 PCT/US97tO9664 to the poly-A sequence, and the first primer used in step (A) is complementary to this nucleotide and at least a portion of the poly-A sequence.
Preferably, the primers used in the methods of the invention are about 10 to about 50 nucleotides long, and more preferably, about 15 to about 30 nucleotides5 long.
In preferred embodiments of the sequencing methods of the invention, the label attached to the nucleoside triphosphate or analog is preferably selected from the group consisting of a radioisotope, a fluorescent dye, a signal-generating enzyme, and a first ligand that specifically binds to a second ligand comprising a 1 0 radioisotope, a fluorescent dye or a signal-generating enzyme, and most preferably, the label is a fluorescent dye. Suitable radioisotopes include, but are not limited to, 3H, 14C, and 32p. Suitable fluorescent dyes include, but are notlimited to, fluorescein, rhodamine, 7-amino-4-methylcoumarin, dansyl chloride, Cy3, Hoechst 33258, R-phycoerythrin, Quantum RedTM, Texas Red, suitable 1 5 analogs and derivatives thereof, and the like. Suitable signal-generating enzymes include, but are not limited to, ~lk~line phosphatase, peroxidase, and urease. Any of the aforementioned labels can be obtained commercially, such as from Sigma.
For instance, labeling methods are described in: Sinha and Striepeke, "Oligonucleotides with Reporter Groups Attached to the 5' Terminus" in 2 0 Oligonucleotides and Analogues: A Practical Approach, Eckstein, Ed., IRL, Oxford, 1991, p. 185 et seq.; Sinha and Cook, "The Preparation and Application of Functionalized Synthetic Oligonucleotides: 3. Use of H-Phosphate Derivatives of Protected Amino-Hexanol and Mercapto-Propanol or Mercapto-Hexanol," Nucleic Acids Research, 1988, Vol. 16, p. 2659 et seq.; Ha~ n~, Molecular Probes 2 5 Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes, Inc., Eugene, OR, 1992, p. 20 et seq.; Theisen et al., "Fluorescent Dye Phosphoramidite Labelling of Oligonucleotides," Tetrahedron Letters, 1992, Vol. 33, p. 3036 et seq.;
Rosenthal and Jones, "Genomic Walking and Sequencing by Oligocassette Mediated Polymerase Chain Reaction," Nucleic Acids Research, 1990, Vol. 18, p.
30 3095 et seq.; Smith et al., "The Synthesis of Oligonucleotides cont~inin~ an Aliphatic Amino Group at the 5' Terminus - Synthesis of Fluorescent DNA
. --. . ..
CA 022~8~11 1998-12-14 Primers for Use in DNA-Sequence Analysis," Nucleic Acids Research, 1985, Vol.
13, 2399 et seq.
The detection used in conjunction with the invention will depend on the nature of the label. Where a colorimetric or fluorescent label is used visual inspection or an optical instrument such as the fluorescence microscope from Olympus (Lake Success, NY), the Plate Reader device from BioTek Instruments (Winooski, VT) and the CCD (charge-coupled device) camera from Princeton Instruments (Princeton, NJ). Where radioisotopes are used, detection can comprise such spatially sensitive detection devices as the Phosphor Imager device (Molecular Dynamics, Sunnyvale, CA), or can comprise separately detecting individual solid surfaces in a detection apparatus such as a gamma-counter or a liquid scintillation counter.
Further, the template-primer complex is preferably attached to a solid surface, such as a microparticle, which is preferably par~m~netic. A
microparticle can have any shape, and preferably it is spherical. Preferably, ithas a diameter of less than 1 mm, and more preferably, less than 500 microns. Incertain prefererred embodiments, the microparticles have a diameter from about 0.5 micron to about 25 microns, and more preferably about 1 micron to about 5 microns, and even more preferably, about 2 microns to about 4 microns.
2 0 Microparticles are comprised of any suitable material, the choice of material being guided by its characteristics, which preferably include minim~l non-specific absorptive characteristics, such as that of polystyrene. In other embodiments, the microparticles are comprised of, for example, plastic, glass, cellulose, a cellulose derivative, nylon, polytetrafluoroethylene ("TEFLON"), ceramic and the like. A
2 5 par~m~netic bead can be comprised of, for example, iron dispersed in a poly~ylene matrix. A par~m~gnetic bead can be comprised of, for example, iron dispersed in a polystyrene matrix, and can be obtained with an associated biomolecule, for example, from Dynal (Oslo, Norway), or without an associated biomolecule, for example, from Bang Laboratories (Carmel, Indiana).
3 0 Additionally, in preferred embodiments, the template-dependent nucleotidepolymerase is a DNA polymerase or an RNA polymerase or a fragment thereof having polymerase activity. Most preferably, the DNA polymerase or a fragment CA 022~8~ll l998-l2-l4 thereof having polymerase activity is T7 DNA polymerase, the Klenow fragment of E.coli DNA polymerase I or Taq polymerase and the RNA polymerase or a fragment thereof having polymerase activity is derived from E.coli or S.cerevisiae.
Furthermore, the modified nucleoside triphosphate is preferably a 5 dideoxynucleoside triphosphate. Reaction conditions for the methods of the invention can be found, for example, in EP 0 223 618 and Maniatis et al., Molecular Clon~ng (Cold Spring Harbor 1982) which are hereby incorporated by reference herein in their entirety. Additionally, where methodologies are referred to herein without specific enumeration of well-known methods steps, generally, 10 the following text can be referenced for further details: Ausubel et al., Short Protocols in Molecular Biology; Sambrook et al., DNA Cloning, A Laboratory Manual; and Molecular Biology Protocols, web-site:
listeria.nwfsc.noaa.gov/protocols.html.
In preferred embodiments, the methods of the invention are used in the 15 context of a microfluidics-based device for automatedly moving fluids in and out of a reaction chamber, which has been disclosed in U.S. Patent Serial Number 60/010513, filed January 24, 1996, the contents of which are incorporated hereinby reference. The microfluidics device is designed specifically for moving smallvolumes of fluids through fluid exchange channels that connect various sorts of 2 0 fluid chambers. In particular, such a device comprises a fluid chamber, which is a generic term that describes chambers designed for storage of fluid reagents or reactants, i.e., a supply chamber, for locating reactants undergoing a reaction, i.e., a reaction chamber, for measuring a volume of a fluid, i.e., a metering chamber,and more. More particularly, the device includes a reaction chamber. The 2 5 reaction chamber is comprised of any suitable material, as are all fluid chambers, such as, for example, glass, plastic, ceramic, or combinations thereof, and is connected to at least two fluid exchange channels for p~A.s~g~ng material in andout of the reaction chamber. The reaction chamber preferably rem~in.~ at a constant temperature of within about two degrees centigrade, wherein the 3 0 temperature is between about 20~C and 65~C, and alternatively can have adjustable temperatures as in accordance with the requisites of the reactions totake place therein.
CA 022~8~ll l998-l2-l4 The liquid distribution system can conduct synthesis in a great number of separate reaction wells, such as 10,000 reaction wells. The synthesis in each reaction well can occur on a bead or microparticle or can occur on the surfaces of the wells, where these surfaces have been appropriately treated. The wells are 5 formed on a plate that is separable from the portions of the liquid distribution system used to shuttle reagents to a multitude of reaction wells. Another way offorming an array is to apply the photolithographic synthesis procedures described in a number of patents and patent applications owned by Affymax, Inc. These include Fodor et al., "Very Large Scale Immobilized Polymer Synthesis,"
1 0 WO92/10092; Dovor et al., "Method of Synthesizing Diverse Collections of Oligomers," WO93/06121; Campbell et al., "Methods for Synthesis of Phosphonate Esters," U.S. Pat. 5,359,115; Campbell, "Methods for Synthesis of Phosphonate Esters," U.S. Pat. 5,420,328; Fodor et al., "Very Large Scale Immobilized Polymer Synthesis," U.S. Pat. 5,424,186; and Pirrung et al., "Large 1 5 Scale Photolithographic Solid Phase Synthesis of Polypeptides and Receptor Binding Screening Thereof," U.S. Pat. 5,143,854.
In another aspect, the methods of the invention involve the identification of a polynucleotide or polynucleotides having a contiguous non-redundant string or a superimposed non-redundant string pattern. The detection of the presence of a 2 0 non-redundant contiguous string can be used, for example, to identify a particular gene. Alternatively, for example, if the non-redundant contiguous string is not unique to a particular gene, the string can be used to form a DNA library that can then be searched, for example, with a second string. Similarly, a superimposed non-redundant string pattern can be used, for example, to identify a gene or to 2 5 search a DNA library. Preferably the string is at least about 10 nucleotides long, and more preferably, the string is at least about 12 nucleotides long.
Specifically, one method of identifying a polynucleotide or a group of nucleotides, comprises:
(A) providing a primer complementary to a contiguous string of non-3 0 redundant nucleotides, said primer having a label attached thereto;
(B) providing a single-stranded polynucleotide template;
CA 022~8~ll l998-l2-l4 (C) causing the template and the primer to anneal, thereby forming a template-primer complex;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
Another method of identifying a polynucleotide or a group of polynucleotides comprises:
(A) providing a base sequence of a string, the string being a superimposed non-redundant string pattern or a contiguous non-redundant string; and (B) searching a computer database of polynucleotide base sequences using 10 the base sequence of the string. In embodiments wherein the string is a superimposed non-redundant string pattern, the above method preferably further comprises providing a computer program for searching for the superimposed string pattern in the polynucleotide sequences, the computer program being capable of identifying a superimposed string pattern despite the presence of a 15 redundancy or redundancies within a sequence that includes the string patternlocated in the base sequence of a polynucleotide or polynucleotides in the database.
While this invention has been described with an emphasis upon a preferred embodiment, it will be obvious to those of ordinary skill in the art that variations 2 0 in the preferred composition and method may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein.
Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the following claims.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: ~llm~r, Rajan and Heaney, Paul (ii) TITLE OF INVENTION: METHOD FOR POLYNUCLEOTIDE
SEQUENCING
(iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SARNOFF Corporation (B) STREET: CN 5300 (C) CITY: Princeton (D) STATE: NJ
(E) COUNTRY: USA
(F) ZIP: 08543-5300 2 0 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible Pentium Pro (C) OPERATING ~Y~ a: WINDOWS NT
(D) SOFTWARE: Microsoft WORD 97 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Silverio~ John V.
(B) REGISTRATION NUMBER: 34,014 (C) REFERENCE/DOCKET NUMBER: SAR 12024PCT
(i) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 609-734-2454 (B) TELEFAX: 609-734-2673 (2) INFORMATION FOR SEQ ID NO:1:
1 0 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
2 0 (3) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 base pairs (B) TYPE: nucleic acid 2 5 (C) STRANDEDNESS: double (D) TOPOLOGY: linear 3 0 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Related Co-Pending U.S. Patent Applications This patent application is being concurrently filed with the following related U.S. patent applications: "Nuclease Protection Assays," R. Kllm~r, inventor, 5 Attorney Docket No. DSRC 12038; "Microfluidic Method for Nucleic Acid Amplification," Z. Loewy and R. Kumar, inventors, Attorney Docket No. DSRC
12050; "Method for Amplifying a Polynucleotide," Z. Loewy, inventor, Attorney Docket No. DSRC 12081; "Automated Nucleic Acid Preparation" D. Southgate and Z. Loewy, inventors, Attorney Docket No. DSRC 12120; and "Padlock Probe 1 0Detection," R. KllmP~r, inventor, Attorney Docket No. 317913/12162. This patent application is related to the following copending U.S. patent applications: Ser.No.60/009517, filed November 3, 1995; Ser. No. 60/00602, filed November 3, 1995; and Ser. No. 60/010513, filed January 24, 1996. All of the foregoing patent applications are hereby incorporated by reference herein in their entirety.
1 5This invention was made with U.S. Government support under Contract No.
70NANB5H1037. The U.S. Government has certain rights in this invention.
In one aspect, the present invention provides a new method for determining the base sequence of RNA or DNA, termed sequential step sequencing. In another aspect, the present invention provides new methods of identifying a 20 polynucleotide or polynucleotides using a contiguous string of non-redundant nucleotides or a superimposed non-redundant string pattern.
Prior art methods of sequencing include the M~m-Gilbert method and the Sanger dideoxy method. In the lVr~m-Gilbert method, a substrate DNA is labeled on one strand with 32p at the ~'-hydroxyl terminus. The labeled DNA is 25 then broken preferentially at one of the four nucleotides using one reaction mixture for each base, the reaction conditions causing an average of one break per DNA molecule. In the reaction mixture for each base, each broken chain yields a radiolabeled fragment extending from the 32p 5'-hydroxyl terminus to one of the positions in the DNA in which that base appears. Thus, every time a base 3 0 appears in a DNA molecule, it generates a fragment of a different size, which are then separated by gel electrophoresis. The autoradiogram of a gel in which all four chemical reactions have been entered into the gel shows a pattern of bands CA 022~8~11 1998-12-14 from which the sequence of the DNA can be read. See, for example, Stryer, Biochemistry (3d ed. 1988) at pages 120-121.
In the Sanger dideoxy method, DNA is sequenced by generating fragments through the controlled interruption of enzymatic replication. First, a primer is5 constructed which is complementary to the DNA sequence. Then, DNA
polymerase is used to copy a sequence of a single-stranded DNA using the primer and four labeled deoxyribonucleoside triphosphates and a 2',3'-dideoxy analog ofeach of the triphosphates. The incorporation of an analog in the new DNA strand being synthesized results in the termination of incorporation of labeled 10 deoxyribonucleoside triphosphates since the dideoxy analogs lack the 3'-hyd~o~yl terminus needed to form the next phosphodiester bond. Thus, the synthesis results in DNA fragments of various lengths in which the dideoxy analog is at the 3' end. The reaction mixture for each base can then be separately electrophoresed on a gel or electrophoresed together if the deoxyribonucleoside triphosphate 15 corresponding to each base has a separate label. See, for example, Stryer, Biochemistry (3d ed. 1988) at pages 121-123.
The sequential step sequencing methods of the invention, unlike the above-described seqllençing methods, involve individual reactions for each type of base in every position in which it appears on the DNA molecule, or for every position in 2 0 which it appears next to a different type of base. The large number of reactions involved would likely have been considered impractical due to being too labor-intensive under the procedures known in the prior art for performing the necessary chemical reactions.
However, the sequential step sequencing methods of the invention can be 2 5 used, for example, in the context of a microfluidics-based device for automatedly moving fluids in and out of a reaction chamber, which has been disclosed in U.S.Patent Serial Number 60/010613, filed January 24, 1996, the contents of which are incorporated herein by reference. This combination of the microfluidics-based system and the methods of the invention makes sequential step sequencing an 3 0 attractive alternative to known conventional methods of nucleotide sequencing.
Furthermore, the present invention provides an advantage in eliminating the need for electrophoresis, which is one of the most time-consuming steps of the CA 022~8~11 1998-12-14 sequencing reactions of the prior art. Additionally, the present invention provides for an increased rate of sequence read-out since nucleotide addition can occur, for example, at 800 nucleotides per minute.
Further, the present invention provides the advantage, for example, of 5 providing a me~h~ni.~m for more accurate determin~tion of sequences, such as the sequence adjacent to the poly-A tail of a polynucleotide.
SUMMARY OF THE INVENTION
In one aspect, the present invention provides a method of sequential step sequencing of a polynucleotide having x number of nucleotides comprising:
(A) providing a single-stranded polynucleotide template and a first complementary primer having n nucleotides, wherein n is an integer greater than three;
(B) causing the template and the primer to anneal, thereby forming a template-primer complex;
(C) adding a template-dependent nucleotide polymerase and at least one nucleoside triphosphate or analog thereof having a label attached thereto, wherein the nucleoside triphosphate or analog thereof includes a base selected from the group consisting of adenine, thymine, cytosine, guanine, and uracil; and (D) determining whether a label is associated with the template-primer~ 0 complex or which label is associated with the template-primer complex.
DETAILED DESCRIPTION
DEFINITIONS
The following terms shall have the me~ning set forth below:
~ sequential step sequencing - sequencing a polynucleotide by individual 25 reactions, each reaction detecting no more than the sequence of one type of nucleotide at a time. The nucleotide detected can occur, for example, once or more than once in adjacent positions, such as G,GG or GGGGG (SEQ ID NO: 1).
~ actual non-redundant contiguous string - a base sequence in which the sequence of each base is actually not repeated in the immediately adjacent base.3 0 For example, TACATGTACTGCT (SEQ ID NO: 2) is an actual non-redundant contiguous string, whereas TAACATGTACTGCTT (SEQ ID NO: 3) is not, CA 022~8~11 1998-12-14 although the underlined sequence within this sequence, ACATGTACTGCT (SEQ
ID NO: 4), is an actual non-redundant contiguous string.
~ superimposed non-redundant string pattern - pattern derived from an actual sequence. In the pattern, the redundancies in the actual sequence are 5 removed, a redundancy being the duplication of a base in the immediately adjacent base. For example, given an actual sequence CATTAAAGGGAAAAGCCCAGTCA (SEQ ID NO: 5), the superimposed non-redundant string pattern of the sequence is CATAGAGCAGTCA (SEQ ID NO: 6).
In one aspect, the present invention relates to methods of sequencing of 10 polynucleotides using sequential step sequencing. The sequential step sequencing methods of the invention, unlike the methods of the prior art, involve individual reactions for each type of base in every position in which it appears on the DNAmolecule, or for every position in which it appears next to a different type of base.
The methods of the invention are preferably used in the context of a microfluidics-15 based device for automatedly moving fluids in and out of a reaction chamber,which has been disclosed in U.S. Patent Serial Number 60/010513, filed January 24, 1996, the contents of which are incorporated herein by reference. The present invention provides an advantage over prior art methods, for example, in elimin~ting the need for electrophoresis, which is one of the most time-consuming 2 0 steps of sequencing reactions. Additionally, the present invention provides for an increased rate of sequence read-out since nucleotide addition can occur, for example, at 800 nucleotides per minute.
The methods of the invention begin with the provision of a single-stranded polynucleotide template that is annealed with a primer, forming a template-2 5 primer complex. In one aspect, the present invention provides for adding onenucleoside triphosphate or analog thereof at a time to the template-primer complex, the nucleoside triphosphate or analog being labelled. If necessary, each of the four nucleoside triphosphates or analogs is added until a label is detected due to the incorporation of a nucleotide into the complex. This method can be 30 used with a nucleoside triphosphate analog that is modified to preclude any subsequent addition of such analog after a first analog has been added to the primer, such as a dideoxynucleoside triphosphate. Alternatively, this method can CA 022~8~11 1998-12-14 be used with a nucleoside triphosphate or analog thereof that does not stop addition after a first nucleotide or nucleotide analog has been added to the primer.
In other aspects of the invention, all four nucleoside triphosphates or analogs 5 are added at once to the complex, each nucleoside triphosphate or analog having a different label. Using the latter method, the sequence at this position is determined by identifying the type of label incorporated into the complex. This method is preferably used only with a nucleoside triphosphate analog that is modified to preclude any subsequent addition of such analog after a first analog10 has been added to the primer.
In one aspect of the invention, when a nucleoside triphosphate or analog is used in the sequential step sequencing methods of the invention, in which the nucleoside triphosphate or analog is not modified to preclude any subsequent addition of such nucleoside triphosphate or analog after a first nucleotide has 15 been added to the primer, the sequence obtained may not match the actual sequence of the polynucleotide. Instead, the sequence obtained may be a superimposed non-redundant string pattern. Specifically, if the polynucleotide sequence has a redundancy such that immediately adjacent bases are the same, the sequence obtained using the latter methods of the invention will only detect2 0 one of the bases. For example, a polynucleotide with a sequence of CATTAAAGGGAAAGCCCAGTCA (SEQ ID NO:5) will be detected as the corresponding superimposed non-redundant string pattern, CATAGAGCAGTCA
(SEQID NO: 6). Thus, in one aspect, the methods of the invention provide for thedetection of a superimposed non-redundant string pattern in a polynucleotide 2 5 template.
In another aspect of the invention, when a nucleoside triphosphate or analog is used in the sequential step sequencing methods of the invention, in which thenucleoside triphosphate or analog is not modified to preclude any subsequent addition of such nucleoside triphosphate or analog after a first nucleotide has 3 0 been added to the primer, the sequence obtained will match the actual sequence of the polynucleotide when the amount of label attached to the nucleotide is CA 022~8~11 1998-12-14 quantified, using for example, autoradiography followed by ~c~nning of the autoradiogram to determine signal strength.
More generally, in one aspect, the present invention provides a method of sequential step seqll~n(ing of a polynucleotide having x number of nucleotides 5 comprising:
(A) providing a single-stranded polynucleotide template and a first complementary primer having n nucleotides, wherein n is an integer greater than three;
(B) causing the template and the primer to anneal, thereby forming a 10 template-primer complex;
(C) adding a template-dependent nucleotide polymerase and at least one nucleoside triphosphate or analog thereof having a label attached thereto, wherein the nucleoside triphosphate or analog thereof includes a base selected from the group consisting of adenine, thymine, cytosine, guanine, and uracil;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
Peferably, the above method also includes removing unincorporated nucleoside triphosphate or analog from the template-primer complex.
In certain embodiments of the above method, step (C) is limited to using one 2 0 nucleoside triphosphate or analog thereof, and if no label is associated with the template-primer complex as determined in step (D), then steps (A) to (D) are repeated using another nucleoside triphosphate or analog thereof having a different base than that used previously in step (C), steps (A) to (D) being repeated until it is determined that a label is associated with the template-primer 2 5 complex.
Preferably, the above methods further comprise step (E), step (E) being, upon having determined which base was added to the first primer by exercise of step (D), a second primer is generated having n+y nucleotides, y being one or the number of identical adjacent nucleotides, wherein the added nucleotide is at its 3' 3 0 end; and steps (A) to (D) are repeated with the proviso that the second primer is substituted for the first primer. Step (E) is preferably repeated until the primer is CA 022~8~ll l998-l2-l4 at least x nucleotides long, such that n=x, n being the number of nucleotides inthe polynucleotide being sequenced.
In certain embodiments, the methods of the invention involve the use of a nucleoside triphosphate analog modified to preclude any subsequent addition of 5 such analog after a first analog has been added to the primer.
When such nucleoside triphosphate analog is used with the methods of the invention, in addition to adding one labeled nucleoside triphosphate analog at atime, the methods also include the addition of more than one labeled nucleoside triphosphate analog at a time. Thus, in certain embodiments, the nucleoside 10 triphosphate analog of step (C) is a combination comprising two, three, or four different nucleoside triphosphate analogs having different bases, wherein the nucleoside triphosphate analogs having different bases are differentially labeled.
Preferably, the differentially labeled nucleoside triphosphate analogs are labeled with fluorescent dyes, such as fluorescein, rhodamine, 7-amino-4-methylcoumarin, dansyl chloride, Cy3, Hoechst 33258, R-phycoerythrin, Quantum RedTM, Texas Red, suitable analogs and derivatives thereof, and the like, which can be obtained commercially, such as from Sigma.
When a combination of two, three or four different nucleoside triphosphate analogs are used, it is preferred to use a combination of all four different 2 0 nucleoside triphosphate analogs are used in concert, the four nucleoside triphosphate analogs having the bases adenine, thymine, cytosine and guanine if the polymerase is DNA-dependent, or the bases adenine, uracil, cytosine and guanine if the polymerase is RNA-dependent.
The above-described sequential step sequencing methods of the invention 2 5 preferably include step (E), step (E) being, upon having determined which base was added to the first primer by exercise of steps (A) to (D), a second primer is generated having n+1 nucleotides, wherein the added nucleotide or nucleotides are at its 3' end; and steps (A) to (D) are repeated with the proviso that the second primer is substituted for the first primer. In certain preferred embodiments, step 3 0 (E) is repeated until n is x nucleotides long, x being the number of nucleotides in the polynucleotide being sequenced, thereby providing for a full sequence.
CA 022~8~11 1998-12-14 The methods of the present invention can be used, for example, to sequence the 3' end of an mRNA or a cDNA nucleotide sequence. Using sequential step DNA seql~e~ing and a poly-T or a poly-U primer, nucleoside triphosphates or analogs thereof having the bases thymine or uracil are added until the primer is5 extended to the beE~inning of the poly-A tail. The sequence from this point is then determined using the methods of sequential step sequencing described above, and can be used to determine the actual sequence, or a superimposed non-redundant string pattern. This aspect of the invention overcomes the problems associated with the prior art sequencing methods, such as the presence of a smear on the 10 sequencing gel since a poly-T or poly-U primer randomly anneals to different parts of the poly-A tail.
Specifically, the above-described methods of se~uential step sequencing can be used to sequence polynucleotides adjacent to a poly-A tail of the template, the methods further comprising the following steps prior to providing the first primer 15 in step (A):
(a) providing a single-stranded polynucleotide template and an initial complementary primer, the template having a poly-A sequence, and the primer being a poly-T or a poly-U primer;
(b) causing the template and the primer to anneal, thereby forming a 2 0 template-primer complex;
(c) adding a template-dependent nucleotide polymerase and an nucleoside triphosphate or analog thereof including a base, the base being thymine or uracil, thereby forming an elongated initial primer.
In certain embodiments, the sequenced polynucleotides near the poly-A tail of 25 the template are contiguous, and optionally, the sequenced nucleotides form a non-redundant contiguous string. In other embodiments, the sequenced polynucleotides near the poly-A tail of the template are non-contiguous and forma superimposed non-redundant string pattern.
In certain embodiments, the first primer used in step (A) is the elongated 30 initial primer, the primer being complementary to the 5' end of the poly-A
sequence in the template polynucleotide. In other embodiments, the elongated initial primer is used to determine at least one nucleotide of the template adjacent CA 022~8~11 1998-12-14 WO 97/47761 PCT/US97tO9664 to the poly-A sequence, and the first primer used in step (A) is complementary to this nucleotide and at least a portion of the poly-A sequence.
Preferably, the primers used in the methods of the invention are about 10 to about 50 nucleotides long, and more preferably, about 15 to about 30 nucleotides5 long.
In preferred embodiments of the sequencing methods of the invention, the label attached to the nucleoside triphosphate or analog is preferably selected from the group consisting of a radioisotope, a fluorescent dye, a signal-generating enzyme, and a first ligand that specifically binds to a second ligand comprising a 1 0 radioisotope, a fluorescent dye or a signal-generating enzyme, and most preferably, the label is a fluorescent dye. Suitable radioisotopes include, but are not limited to, 3H, 14C, and 32p. Suitable fluorescent dyes include, but are notlimited to, fluorescein, rhodamine, 7-amino-4-methylcoumarin, dansyl chloride, Cy3, Hoechst 33258, R-phycoerythrin, Quantum RedTM, Texas Red, suitable 1 5 analogs and derivatives thereof, and the like. Suitable signal-generating enzymes include, but are not limited to, ~lk~line phosphatase, peroxidase, and urease. Any of the aforementioned labels can be obtained commercially, such as from Sigma.
For instance, labeling methods are described in: Sinha and Striepeke, "Oligonucleotides with Reporter Groups Attached to the 5' Terminus" in 2 0 Oligonucleotides and Analogues: A Practical Approach, Eckstein, Ed., IRL, Oxford, 1991, p. 185 et seq.; Sinha and Cook, "The Preparation and Application of Functionalized Synthetic Oligonucleotides: 3. Use of H-Phosphate Derivatives of Protected Amino-Hexanol and Mercapto-Propanol or Mercapto-Hexanol," Nucleic Acids Research, 1988, Vol. 16, p. 2659 et seq.; Ha~ n~, Molecular Probes 2 5 Handbook of Fluorescent Probes and Research Chemicals, Molecular Probes, Inc., Eugene, OR, 1992, p. 20 et seq.; Theisen et al., "Fluorescent Dye Phosphoramidite Labelling of Oligonucleotides," Tetrahedron Letters, 1992, Vol. 33, p. 3036 et seq.;
Rosenthal and Jones, "Genomic Walking and Sequencing by Oligocassette Mediated Polymerase Chain Reaction," Nucleic Acids Research, 1990, Vol. 18, p.
30 3095 et seq.; Smith et al., "The Synthesis of Oligonucleotides cont~inin~ an Aliphatic Amino Group at the 5' Terminus - Synthesis of Fluorescent DNA
. --. . ..
CA 022~8~11 1998-12-14 Primers for Use in DNA-Sequence Analysis," Nucleic Acids Research, 1985, Vol.
13, 2399 et seq.
The detection used in conjunction with the invention will depend on the nature of the label. Where a colorimetric or fluorescent label is used visual inspection or an optical instrument such as the fluorescence microscope from Olympus (Lake Success, NY), the Plate Reader device from BioTek Instruments (Winooski, VT) and the CCD (charge-coupled device) camera from Princeton Instruments (Princeton, NJ). Where radioisotopes are used, detection can comprise such spatially sensitive detection devices as the Phosphor Imager device (Molecular Dynamics, Sunnyvale, CA), or can comprise separately detecting individual solid surfaces in a detection apparatus such as a gamma-counter or a liquid scintillation counter.
Further, the template-primer complex is preferably attached to a solid surface, such as a microparticle, which is preferably par~m~netic. A
microparticle can have any shape, and preferably it is spherical. Preferably, ithas a diameter of less than 1 mm, and more preferably, less than 500 microns. Incertain prefererred embodiments, the microparticles have a diameter from about 0.5 micron to about 25 microns, and more preferably about 1 micron to about 5 microns, and even more preferably, about 2 microns to about 4 microns.
2 0 Microparticles are comprised of any suitable material, the choice of material being guided by its characteristics, which preferably include minim~l non-specific absorptive characteristics, such as that of polystyrene. In other embodiments, the microparticles are comprised of, for example, plastic, glass, cellulose, a cellulose derivative, nylon, polytetrafluoroethylene ("TEFLON"), ceramic and the like. A
2 5 par~m~netic bead can be comprised of, for example, iron dispersed in a poly~ylene matrix. A par~m~gnetic bead can be comprised of, for example, iron dispersed in a polystyrene matrix, and can be obtained with an associated biomolecule, for example, from Dynal (Oslo, Norway), or without an associated biomolecule, for example, from Bang Laboratories (Carmel, Indiana).
3 0 Additionally, in preferred embodiments, the template-dependent nucleotidepolymerase is a DNA polymerase or an RNA polymerase or a fragment thereof having polymerase activity. Most preferably, the DNA polymerase or a fragment CA 022~8~ll l998-l2-l4 thereof having polymerase activity is T7 DNA polymerase, the Klenow fragment of E.coli DNA polymerase I or Taq polymerase and the RNA polymerase or a fragment thereof having polymerase activity is derived from E.coli or S.cerevisiae.
Furthermore, the modified nucleoside triphosphate is preferably a 5 dideoxynucleoside triphosphate. Reaction conditions for the methods of the invention can be found, for example, in EP 0 223 618 and Maniatis et al., Molecular Clon~ng (Cold Spring Harbor 1982) which are hereby incorporated by reference herein in their entirety. Additionally, where methodologies are referred to herein without specific enumeration of well-known methods steps, generally, 10 the following text can be referenced for further details: Ausubel et al., Short Protocols in Molecular Biology; Sambrook et al., DNA Cloning, A Laboratory Manual; and Molecular Biology Protocols, web-site:
listeria.nwfsc.noaa.gov/protocols.html.
In preferred embodiments, the methods of the invention are used in the 15 context of a microfluidics-based device for automatedly moving fluids in and out of a reaction chamber, which has been disclosed in U.S. Patent Serial Number 60/010513, filed January 24, 1996, the contents of which are incorporated hereinby reference. The microfluidics device is designed specifically for moving smallvolumes of fluids through fluid exchange channels that connect various sorts of 2 0 fluid chambers. In particular, such a device comprises a fluid chamber, which is a generic term that describes chambers designed for storage of fluid reagents or reactants, i.e., a supply chamber, for locating reactants undergoing a reaction, i.e., a reaction chamber, for measuring a volume of a fluid, i.e., a metering chamber,and more. More particularly, the device includes a reaction chamber. The 2 5 reaction chamber is comprised of any suitable material, as are all fluid chambers, such as, for example, glass, plastic, ceramic, or combinations thereof, and is connected to at least two fluid exchange channels for p~A.s~g~ng material in andout of the reaction chamber. The reaction chamber preferably rem~in.~ at a constant temperature of within about two degrees centigrade, wherein the 3 0 temperature is between about 20~C and 65~C, and alternatively can have adjustable temperatures as in accordance with the requisites of the reactions totake place therein.
CA 022~8~ll l998-l2-l4 The liquid distribution system can conduct synthesis in a great number of separate reaction wells, such as 10,000 reaction wells. The synthesis in each reaction well can occur on a bead or microparticle or can occur on the surfaces of the wells, where these surfaces have been appropriately treated. The wells are 5 formed on a plate that is separable from the portions of the liquid distribution system used to shuttle reagents to a multitude of reaction wells. Another way offorming an array is to apply the photolithographic synthesis procedures described in a number of patents and patent applications owned by Affymax, Inc. These include Fodor et al., "Very Large Scale Immobilized Polymer Synthesis,"
1 0 WO92/10092; Dovor et al., "Method of Synthesizing Diverse Collections of Oligomers," WO93/06121; Campbell et al., "Methods for Synthesis of Phosphonate Esters," U.S. Pat. 5,359,115; Campbell, "Methods for Synthesis of Phosphonate Esters," U.S. Pat. 5,420,328; Fodor et al., "Very Large Scale Immobilized Polymer Synthesis," U.S. Pat. 5,424,186; and Pirrung et al., "Large 1 5 Scale Photolithographic Solid Phase Synthesis of Polypeptides and Receptor Binding Screening Thereof," U.S. Pat. 5,143,854.
In another aspect, the methods of the invention involve the identification of a polynucleotide or polynucleotides having a contiguous non-redundant string or a superimposed non-redundant string pattern. The detection of the presence of a 2 0 non-redundant contiguous string can be used, for example, to identify a particular gene. Alternatively, for example, if the non-redundant contiguous string is not unique to a particular gene, the string can be used to form a DNA library that can then be searched, for example, with a second string. Similarly, a superimposed non-redundant string pattern can be used, for example, to identify a gene or to 2 5 search a DNA library. Preferably the string is at least about 10 nucleotides long, and more preferably, the string is at least about 12 nucleotides long.
Specifically, one method of identifying a polynucleotide or a group of nucleotides, comprises:
(A) providing a primer complementary to a contiguous string of non-3 0 redundant nucleotides, said primer having a label attached thereto;
(B) providing a single-stranded polynucleotide template;
CA 022~8~ll l998-l2-l4 (C) causing the template and the primer to anneal, thereby forming a template-primer complex;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
Another method of identifying a polynucleotide or a group of polynucleotides comprises:
(A) providing a base sequence of a string, the string being a superimposed non-redundant string pattern or a contiguous non-redundant string; and (B) searching a computer database of polynucleotide base sequences using 10 the base sequence of the string. In embodiments wherein the string is a superimposed non-redundant string pattern, the above method preferably further comprises providing a computer program for searching for the superimposed string pattern in the polynucleotide sequences, the computer program being capable of identifying a superimposed string pattern despite the presence of a 15 redundancy or redundancies within a sequence that includes the string patternlocated in the base sequence of a polynucleotide or polynucleotides in the database.
While this invention has been described with an emphasis upon a preferred embodiment, it will be obvious to those of ordinary skill in the art that variations 2 0 in the preferred composition and method may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein.
Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the following claims.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: ~llm~r, Rajan and Heaney, Paul (ii) TITLE OF INVENTION: METHOD FOR POLYNUCLEOTIDE
SEQUENCING
(iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: SARNOFF Corporation (B) STREET: CN 5300 (C) CITY: Princeton (D) STATE: NJ
(E) COUNTRY: USA
(F) ZIP: 08543-5300 2 0 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible Pentium Pro (C) OPERATING ~Y~ a: WINDOWS NT
(D) SOFTWARE: Microsoft WORD 97 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Silverio~ John V.
(B) REGISTRATION NUMBER: 34,014 (C) REFERENCE/DOCKET NUMBER: SAR 12024PCT
(i) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 609-734-2454 (B) TELEFAX: 609-734-2673 (2) INFORMATION FOR SEQ ID NO:1:
1 0 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
2 0 (3) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 base pairs (B) TYPE: nucleic acid 2 5 (C) STRANDEDNESS: double (D) TOPOLOGY: linear 3 0 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
(4) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
(6) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENGTH: 12 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
(6) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
(7) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 base pairs (B) TYPE: nucleic acid 2 0 (C) STRANDEDNESS: double (D) TOPOLOGY: linear 2 5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
(6) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
2 0 (A) LENGTH: 12 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
(6) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
(7) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 base pairs (B) TYPE: nucleic acid 2 0 (C) STRANDEDNESS: double (D) TOPOLOGY: linear 2 5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Claims (13)
1. A method of sequential step sequencing of a polynucleotide having x number of nucleotides comprising:
(A) providing a single-stranded polynucleotide template and a first complementary primer having n nucleotides, wherein n is an integer greater than three;
(B) causing the template and the primer to anneal, thereby forming a template-primer complex;
(C) adding a template-dependent nucleotide polymerase and at least one nucleoside triphosphate or analog thereof having a label attached thereto, wherein the nucleoside triphosphate or analog includes a base selected from the group consisting of adenine, thymine, cytosine, guanine, and uracil;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
(A) providing a single-stranded polynucleotide template and a first complementary primer having n nucleotides, wherein n is an integer greater than three;
(B) causing the template and the primer to anneal, thereby forming a template-primer complex;
(C) adding a template-dependent nucleotide polymerase and at least one nucleoside triphosphate or analog thereof having a label attached thereto, wherein the nucleoside triphosphate or analog includes a base selected from the group consisting of adenine, thymine, cytosine, guanine, and uracil;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
2. The method of claim 1, further comprising removing unincorporated nucleoside triphosphate from the template-primer complex.
3. The method of claim 1, wherein step (C) is limited to using one nucleoside triphosphate or analog thereof, further comprising:
if no label is associated with the template-primer complex as determined in step (D), then steps (A) to (D) are repeated using another nucleoside triphosphate or analog thereof having a different base than that used previously in step (C),steps (A) to (D) being repeated until it is determined that a label is associated with the template-primer complex.
if no label is associated with the template-primer complex as determined in step (D), then steps (A) to (D) are repeated using another nucleoside triphosphate or analog thereof having a different base than that used previously in step (C),steps (A) to (D) being repeated until it is determined that a label is associated with the template-primer complex.
4. The method of claim 1, further comprising (E) upon having determined which base was added to the first primer by exercise of step (E), a second primer is generated having n+y nucleotides, y being one if each nucleotide is added one at a time, or, if each nucleotide is added more than one at a time, y being the number of identical adjacent nucleotides, wherein the added nucleotide or nucleotides are at the primer's 3' end; and steps (A) to (D) are repeated with the proviso that the second primer is substituted for the first primer.
5. The method of claim 1, wherein, in step (C), the nucleoside triphosphate analog has a modification that precludes any subsequent addition of such analog after a first analog has been added to the primer.
6. The method of claim 1, wherein the method is used to sequence polynucleotides adjacent to a poly-A tail of the template, further comprising the following steps prior to providing the first primer in step (A):
(a) providing a single-stranded polynucleotide template and an initial complementary primer, the template having a poly-A sequence, and the primer being a poly-T or a poly-U primer;
(b) causing the template and the primer to anneal, thereby forming a template-primer complex;
(c) adding a template-dependent nucleotide polymerase and an nucleoside triphosphate or analog thereof including a base, the base being thymine or uracil, thereby forming an elongated initial primer.
(a) providing a single-stranded polynucleotide template and an initial complementary primer, the template having a poly-A sequence, and the primer being a poly-T or a poly-U primer;
(b) causing the template and the primer to anneal, thereby forming a template-primer complex;
(c) adding a template-dependent nucleotide polymerase and an nucleoside triphosphate or analog thereof including a base, the base being thymine or uracil, thereby forming an elongated initial primer.
7. The method of claim 1, wherein the label is selected from the group consisting of a radioisotope, a fluorescent dye, a signal-generating enzyme, and a first ligand that specifically binds to a second ligand comprising a radioisotope, a fluorescent dye or a signal-generating enzyme.
8. The method of claim 1, wherein the template-primer complex is attached to a solid surface.
9. The method of claim 8, wherein the solid surface is a microparticle.
10. The method of claim 1, wherein the template-dependent nucleotide polymerase is a DNA polymerase or an RNA polymerase or a fragment thereof having polymerase activity.
11. A method of identifying a polynucleotide or polynucleotides, comprising:
(A) providing a primer complementary to a contiguous string of non-redundant nucleotides, said primer having a label attached thereto;
(B) providing a single-stranded polynucleotide template;
(C) causing the template and the primer to anneal, thereby forming a template-primer complex;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
(A) providing a primer complementary to a contiguous string of non-redundant nucleotides, said primer having a label attached thereto;
(B) providing a single-stranded polynucleotide template;
(C) causing the template and the primer to anneal, thereby forming a template-primer complex;
(D) determining whether a label is associated with the template-primer complex or which label is associated with the template-primer complex.
12. A method of identifying a polynucleotide or polynucleotides, comprising:
(A) providing a base sequence of a string, the string being a superimposed non-redundant string pattern or a contiguous non-redundant string; and (B) searching a computer database of polynucleotide base sequences using the base sequence of the string.
(A) providing a base sequence of a string, the string being a superimposed non-redundant string pattern or a contiguous non-redundant string; and (B) searching a computer database of polynucleotide base sequences using the base sequence of the string.
13. The method of claim 12, wherein the string is a superimposed non-redundant string, further comprising providing a computer program for searching for the superimposed string pattern in the polynucleotide sequences, the computer program being capable of identifying a superimposed string pattern despite the presence of a redundancy or redundancies within a sequence that includes the string pattern located in the polynucleotide or polynucleotides in the database.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US66521096A | 1996-06-14 | 1996-06-14 | |
| US08/665,210 | 1996-06-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2258511A1 true CA2258511A1 (en) | 1997-12-18 |
Family
ID=24669185
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002258511A Abandoned CA2258511A1 (en) | 1996-06-14 | 1997-06-13 | Method for polynucleotide sequencing |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US5908755A (en) |
| EP (1) | EP0912752A1 (en) |
| JP (1) | JP2000512498A (en) |
| AU (1) | AU740238B2 (en) |
| CA (1) | CA2258511A1 (en) |
| IL (1) | IL127560A0 (en) |
| WO (1) | WO1997047761A1 (en) |
Families Citing this family (62)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6235471B1 (en) * | 1997-04-04 | 2001-05-22 | Caliper Technologies Corp. | Closed-loop biochemical analyzers |
| US6391622B1 (en) | 1997-04-04 | 2002-05-21 | Caliper Technologies Corp. | Closed-loop biochemical analyzers |
| US6780591B2 (en) | 1998-05-01 | 2004-08-24 | Arizona Board Of Regents | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
| US7875440B2 (en) | 1998-05-01 | 2011-01-25 | Arizona Board Of Regents | Method of determining the nucleotide sequence of oligonucleotides and DNA molecules |
| GB9828785D0 (en) * | 1998-12-30 | 1999-02-17 | Amersham Pharm Biotech Ab | Sequencing systems |
| AU3567900A (en) * | 1999-03-30 | 2000-10-16 | Solexa Ltd. | Polynucleotide sequencing |
| US6818395B1 (en) * | 1999-06-28 | 2004-11-16 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
| US7332275B2 (en) | 1999-10-13 | 2008-02-19 | Sequenom, Inc. | Methods for detecting methylated nucleotides |
| WO2001032930A1 (en) * | 1999-11-04 | 2001-05-10 | California Institute Of Technology | Methods and apparatuses for analyzing polynucleotide sequences |
| GB0021286D0 (en) * | 2000-08-30 | 2000-10-18 | Gemini Genomics Ab | Identification of drug metabolic capacity |
| US9708358B2 (en) | 2000-10-06 | 2017-07-18 | The Trustees Of Columbia University In The City Of New York | Massive parallel method for decoding DNA and RNA |
| EP3034627B1 (en) | 2000-10-06 | 2019-01-30 | The Trustees of Columbia University in the City of New York | Massive parallel method for decoding dna and rna |
| US6720148B1 (en) * | 2001-02-22 | 2004-04-13 | Caliper Life Sciences, Inc. | Methods and systems for identifying nucleotides by primer extension |
| US7110885B2 (en) | 2001-03-08 | 2006-09-19 | Dnaprint Genomics, Inc. | Efficient methods and apparatus for high-throughput processing of gene sequence data |
| CA2440754A1 (en) * | 2001-03-12 | 2002-09-19 | Stephen Quake | Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension |
| JP3871301B2 (en) * | 2001-05-15 | 2007-01-24 | インターナショナル・ビジネス・マシーンズ・コーポレーション | Database search apparatus and program |
| US20030170678A1 (en) * | 2001-10-25 | 2003-09-11 | Neurogenetics, Inc. | Genetic markers for Alzheimer's disease and methods using the same |
| US20030224380A1 (en) * | 2001-10-25 | 2003-12-04 | The General Hospital Corporation | Genes and polymorphisms on chromosome 10 associated with Alzheimer's disease and other neurodegenerative diseases |
| WO2003054143A2 (en) * | 2001-10-25 | 2003-07-03 | Neurogenetics, Inc. | Genes and polymorphisms on chromosome 10 associated with alzheimer's disease and other neurodegenerative diseases |
| AU2002348099A1 (en) * | 2001-10-26 | 2003-05-06 | Sequenom Inc. | Resin dispensing device |
| US20030220844A1 (en) * | 2002-05-24 | 2003-11-27 | Marnellos Georgios E. | Method and system for purchasing genetic data |
| EP2112229A3 (en) | 2002-11-25 | 2009-12-02 | Sequenom, Inc. | Methods for identifying risk of breast cancer and treatments thereof |
| CA2510166A1 (en) | 2002-12-20 | 2004-09-30 | Caliper Life Sciences, Inc. | Single molecule amplification and detection of dna |
| EP1592810A2 (en) * | 2003-02-12 | 2005-11-09 | Genizon Svenska AB | Methods and means for nucleic acid sequencing |
| US7169560B2 (en) | 2003-11-12 | 2007-01-30 | Helicos Biosciences Corporation | Short cycle methods for sequencing polynucleotides |
| US7981604B2 (en) | 2004-02-19 | 2011-07-19 | California Institute Of Technology | Methods and kits for analyzing polynucleotide sequences |
| US20080199480A1 (en) * | 2004-07-22 | 2008-08-21 | Sequenom, Inc. | Methods for Identifying Risk of Type II Diabetes and Treatments Thereof |
| US7666593B2 (en) | 2005-08-26 | 2010-02-23 | Helicos Biosciences Corporation | Single molecule sequencing of captured nucleic acids |
| US20080309926A1 (en) * | 2006-03-08 | 2008-12-18 | Aaron Weber | Systems and methods for reducing detected intensity non uniformity in a laser beam |
| US7397546B2 (en) | 2006-03-08 | 2008-07-08 | Helicos Biosciences Corporation | Systems and methods for reducing detected intensity non-uniformity in a laser beam |
| EP2602321B1 (en) | 2006-05-31 | 2017-08-23 | Sequenom, Inc. | Methods and compositions for the extraction and amplification of nucleic acid from a sample |
| US8153369B2 (en) | 2006-06-05 | 2012-04-10 | Cancer Care Ontario | Assessment of risk for colorectal cancer |
| US7883869B2 (en) | 2006-12-01 | 2011-02-08 | The Trustees Of Columbia University In The City Of New York | Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators |
| US7902345B2 (en) | 2006-12-05 | 2011-03-08 | Sequenom, Inc. | Detection and quantification of biomolecules using mass spectrometry |
| WO2008098142A2 (en) | 2007-02-08 | 2008-08-14 | Sequenom, Inc. | Nucleic acid-based tests for rhd typing, gender determination and nucleic acid quantification |
| US20110189663A1 (en) | 2007-03-05 | 2011-08-04 | Cancer Care Ontario | Assessment of risk for colorectal cancer |
| AU2008230813B2 (en) | 2007-03-26 | 2014-01-30 | Sequenom, Inc. | Restriction endonuclease enhanced polymorphic sequence detection |
| JP2009011230A (en) * | 2007-07-04 | 2009-01-22 | Hitachi High-Technologies Corp | Method for analyzing base sequence by utilizing restricted extension of nucleotide |
| US9404150B2 (en) | 2007-08-29 | 2016-08-02 | Sequenom, Inc. | Methods and compositions for universal size-specific PCR |
| US9115163B2 (en) | 2007-10-19 | 2015-08-25 | The Trustees Of Columbia University In The City Of New York | DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators |
| EP4310194A2 (en) | 2007-10-19 | 2024-01-24 | The Trustees of Columbia University in the City of New York | Design and synthesis of cleavable fluorescent nucleotides as reversible terminators for dna sequencing by synthesis |
| US8017338B2 (en) | 2007-11-20 | 2011-09-13 | Life Technologies Corporation | Reversible di-nucleotide terminator sequencing |
| WO2009067632A1 (en) * | 2007-11-20 | 2009-05-28 | Applied Biosystems Inc. | Method of sequencing nucleic acids using elaborated nucleotide phosphorothiolate compounds |
| EP2271772B1 (en) | 2008-03-11 | 2014-07-16 | Sequenom, Inc. | Nucleic acid-based tests for prenatal gender determination |
| US8206926B2 (en) | 2008-03-26 | 2012-06-26 | Sequenom, Inc. | Restriction endonuclease enhanced polymorphic sequence detection |
| US8962247B2 (en) * | 2008-09-16 | 2015-02-24 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
| US8476013B2 (en) | 2008-09-16 | 2013-07-02 | Sequenom, Inc. | Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| EP3722810A3 (en) | 2009-02-11 | 2021-01-13 | Caris MPI, Inc. | Molecular profiling of tumors |
| CA2755615A1 (en) * | 2009-03-18 | 2010-09-23 | Sequenom, Inc. | Use of thermostable endonucleases for generating reporter molecules |
| EP2414545B1 (en) | 2009-04-03 | 2017-01-11 | Sequenom, Inc. | Nucleic acid preparation compositions and methods |
| WO2011056688A2 (en) | 2009-10-27 | 2011-05-12 | Caris Life Sciences, Inc. | Molecular profiling for personalized medicine |
| WO2011087760A2 (en) | 2009-12-22 | 2011-07-21 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
| EP3378954B1 (en) | 2011-04-29 | 2021-02-17 | Sequenom, Inc. | Quantification of a minority nucleic acid species |
| EP4155401A1 (en) | 2012-03-02 | 2023-03-29 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
| CA2878979C (en) | 2012-07-13 | 2021-09-14 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| US9896728B2 (en) | 2013-01-29 | 2018-02-20 | Arcticrx Ltd. | Method for determining a therapeutic approach for the treatment of age-related macular degeneration (AMD) |
| WO2014168711A1 (en) | 2013-03-13 | 2014-10-16 | Sequenom, Inc. | Primers for dna methylation analysis |
| WO2014144883A1 (en) | 2013-03-15 | 2014-09-18 | The Trustees Of Columbia University In The City Of New York | Raman cluster tagged molecules for biological imaging |
| EP3117011B1 (en) | 2014-03-13 | 2020-05-06 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| KR20210111254A (en) | 2018-11-30 | 2021-09-10 | 캐리스 엠피아이, 아이엔씨. | Next-generation molecular profiling |
| WO2021112918A1 (en) | 2019-12-02 | 2021-06-10 | Caris Mpi, Inc. | Pan-cancer platinum response predictor |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4863849A (en) * | 1985-07-18 | 1989-09-05 | New York Medical College | Automatable process for sequencing nucleotide |
| CA1340806C (en) * | 1986-07-02 | 1999-11-02 | James Merrill Prober | Method, system and reagents for dna sequencing |
| US5002867A (en) * | 1988-04-25 | 1991-03-26 | Macevicz Stephen C | Nucleic acid sequence determination by multiple mixed oligonucleotide probes |
| US5374524A (en) * | 1988-05-10 | 1994-12-20 | E. I. Du Pont De Nemours And Company | Solution sandwich hybridization, capture and detection of amplified nucleic acids |
| GB8910880D0 (en) * | 1989-05-11 | 1989-06-28 | Amersham Int Plc | Sequencing method |
| US5143854A (en) * | 1989-06-07 | 1992-09-01 | Affymax Technologies N.V. | Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof |
| US5424186A (en) * | 1989-06-07 | 1995-06-13 | Affymax Technologies N.V. | Very large scale immobilized polymer synthesis |
| US5334501A (en) * | 1989-07-11 | 1994-08-02 | Microprobe Corporation | Quantification of bacteria using a nucleic acid hybridization assay |
| US5695926A (en) * | 1990-06-11 | 1997-12-09 | Bio Merieux | Sandwich hybridization assays using very short capture probes noncovalently bound to a hydrophobic support |
| AU8951191A (en) * | 1990-10-29 | 1992-05-26 | Dekalb Plant Genetics | Isolation of biological materials using magnetic particles |
| EP0562025B1 (en) * | 1990-12-06 | 2001-02-07 | Affymetrix, Inc. (a Delaware Corporation) | Compounds and their use in a binary synthesis strategy |
| AU669489B2 (en) * | 1991-09-18 | 1996-06-13 | Affymax Technologies N.V. | Method of synthesizing diverse collections of oligomers |
| US5359115A (en) * | 1992-03-26 | 1994-10-25 | Affymax Technologies, N.V. | Methods for the synthesis of phosphonate esters |
| US5403708A (en) * | 1992-07-06 | 1995-04-04 | Brennan; Thomas M. | Methods and compositions for determining the sequence of nucleic acids |
| US5420328A (en) * | 1992-09-11 | 1995-05-30 | Affymax Technologies, N.V. | Methods for the synthesis of phosphonate esters |
-
1997
- 1997-06-13 JP JP10501677A patent/JP2000512498A/en active Pending
- 1997-06-13 WO PCT/US1997/009664 patent/WO1997047761A1/en not_active Application Discontinuation
- 1997-06-13 EP EP97936015A patent/EP0912752A1/en not_active Withdrawn
- 1997-06-13 IL IL12756097A patent/IL127560A0/en unknown
- 1997-06-13 AU AU38784/97A patent/AU740238B2/en not_active Ceased
- 1997-06-13 CA CA002258511A patent/CA2258511A1/en not_active Abandoned
- 1997-10-15 US US08/950,709 patent/US5908755A/en not_active Expired - Lifetime
Also Published As
| Publication number | Publication date |
|---|---|
| AU3878497A (en) | 1998-01-07 |
| WO1997047761A1 (en) | 1997-12-18 |
| EP0912752A1 (en) | 1999-05-06 |
| JP2000512498A (en) | 2000-09-26 |
| US5908755A (en) | 1999-06-01 |
| IL127560A0 (en) | 1999-10-28 |
| AU740238B2 (en) | 2001-11-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU740238B2 (en) | Method for polynucleotide sequencing | |
| US9404155B2 (en) | Alternative nucleic acid sequencing methods | |
| EP0972081B1 (en) | Method of nucleic acid amplification | |
| AU632996B2 (en) | Mutation detection by competitive oligonucleotide priming | |
| US5914229A (en) | Method for amplifying a polynucleotide | |
| US6258539B1 (en) | Restriction enzyme mediated adapter | |
| US6280954B1 (en) | Arrayed primer extension technique for nucleic acid analysis | |
| US7192707B2 (en) | Methods for analyzing polynucleotide targets using tethered oligonucleotide probes | |
| JP2002504812A (en) | Nucleic acid array | |
| KR20020008195A (en) | Microarray-based analysis of polynucleotide sequence variations | |
| IE62098B1 (en) | Process for amplifying nucleic acid sequences | |
| US5858731A (en) | Oligonucleotide libraries useful for producing primers | |
| US6692915B1 (en) | Sequencing a polynucleotide on a generic chip | |
| WO2002081743A3 (en) | Polynucleotide analysis using combinatorial pcr | |
| US6015675A (en) | Mutation detection by competitive oligonucleotide priming | |
| WO1998055657A1 (en) | Methods and reagents for indexing and encoding nucleic acids | |
| KR20060131972A (en) | Dna array and method of detecting single nucleotide polymorphism | |
| CA2473308C (en) | Assay and kit for analyzing gene expression | |
| WO2000065098A2 (en) | Nucleotide extension on a microarray of gel-immobilized primers | |
| RU2716589C1 (en) | Method of determining polymorphic markers in cyp2c19 and cyp2d6 genes for determining individual sensitivity to antidepressants | |
| US20040038258A1 (en) | Methods for detecting DNA polymorphisms | |
| US20040224324A1 (en) | Happiar mapping | |
| US20030044827A1 (en) | Method for immobilizing DNA | |
| ZIEGLE | STEPHEN RE BATES, DAVID A. KNORR, JENNIFER W. WELLER, JANET S. ZIEGLE | |
| WO2002097109A2 (en) | Compositions and methods for extension of nucleic acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued | ||
| FZDE | Discontinued |
Effective date: 20030613 |