CA2301334A1 - Insect sequences for improving the efficiency of secretion of non-secreted proteins in eukaryotic cells - Google Patents
Insect sequences for improving the efficiency of secretion of non-secreted proteins in eukaryotic cells Download PDFInfo
- Publication number
- CA2301334A1 CA2301334A1 CA002301334A CA2301334A CA2301334A1 CA 2301334 A1 CA2301334 A1 CA 2301334A1 CA 002301334 A CA002301334 A CA 002301334A CA 2301334 A CA2301334 A CA 2301334A CA 2301334 A1 CA2301334 A1 CA 2301334A1
- Authority
- CA
- Canada
- Prior art keywords
- gene
- promoter
- secretion
- protein
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/50—Fusion polypeptide containing protease site
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/61—Fusion polypeptide containing an enzyme fusion for detection (lacZ, luciferase)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
Abstract
An expression cassette useful for the secretion of a heterologous protein from eukaryotic cells comprising a DNA sequence encoding a promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which is linked in frame to a heterologous gene is disclosed. Also disclosed is a method of secreting heterologous proteins in eukaryotic cells.
Description
INSECT SEQUENCES FOR IMPROVING THE EFFICIENCY OF SECRETION
OF NON-SECRETED PROTEINS IN EUKARYOTIC CELLS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application Serial No.
60/056, 871 filed August 21, 1997, which is incorporated herein by reference in its entirety .
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates to the engineering of heterologous gene constructs by recombinant DNA techniques for the more efficient processing and secretion of heterologous genes in eukaryotic cells. Particularly the present invention relates to functionally linking the heterologous gene in frame to the 3' end of the juvenile hormone esterase gene.
DESCRIPTION OF THE RELATED ART
Recombinant polypeptides for medical, research and veterinary applications are produced using a wide variety of genetically engineered organisms that include transgenic animals (eg. cows, goats) transgenic plants (eg. canola) recombinant viruses (eg. baculoviruses) and transformed prokaryotic cells (eg. bacteria) and eukaryotic cells (eg. yeast and animal cells) in culture.
Since most of the proteins are glycoproteins requiring advanced post-translational modification expression systems using yeast and bacteria are unsuitable.
For this reason, other protein expression systems were developed using higher eukaryotes, including virus-based expression systems such as baculovirus and adenovirus and expression from transformed mammalian cells (CHO, BHK Ns0 etc.
and production in the milk of transgenic farm animals). However, even these most advanced vehicles for protein production are inadequate due to difficulties in recovery and purification of the recombinant proteins.
Viral expression systems can produce impressive levels of recombinant proteins in both insect (Maiorella et al. 1988) and mouse cell lines (Garnier et al., 1994) but suffer from serious biological and engineering disadvantages. First, because host cells are killed at the end of each infection cycle, protein expression is only temporary. This also means that protein expression is not suited to the state of the art perfusion bioreactors. Second, the biological authenticity of the expressed protein is not guaranteed because the cell machinery necessary for post-translational modifications is inactivated in the late stages of infection. Unsuitable N-linked glycosylation patterns are widely reported for proteins produced following infection with recombinant viruses, which alters the normal glycosylation characteristics of the cell hosts (Jarvis and Summers, 1989). It is known however that the lepidopteran insect cell hosts are capable of the complex oligosaccharide processing required for in vivo human use of proteins (Davis and Wood 1995) Thirdly, although native genes containing all or part of their introns are generally expressed at a higher level than the corresponding cDNAs (Brinster et al. 1988) virus infected insect cells cannot efficiently excise introns from expressed genomic DNA, thus limiting foreign protein expression from cDNAs only (O'Reilly et al., 1991). Fourth, purification of recombinant proteins from virus infected systems is problematic. Because proteins cannot be secreted efficiently in viral systems due to the inactivation of the secretory pathway upon infection (Jarvis and Summers 1989) they must be recovered from cell lysates after cell lysis. The presence of proteases in such cellular lysates also cause degradation of the over-expressed product.
A major problem in biotechnology exists in the production and recovery of recombinant non-secretion competent polypeptides, such as intracellular proteins or protein subunits, from genetically engineered organisms. Often these intracellular proteins or protein subunits can be expressed at only moderate levels inside a cell and their purification must first include steps to lyse the cells, followed by complex procedures to isolate the desired polypeptides from many other intracellular proteins.
All secreted proteins possess a consensus signal peptide of IO to 50 amino acids at their N-terminus that directs the protein to the secretory pathway of eukaryotic cells or to the cytoplasmic membrane of prokaryotic cells. Using genetic engineering techniques, some research groups have therefore tried to secrete intracellular proteins by fusing the gene sequences of consensus signal peptides in-frame to the 5' end of the gene encoding the non-secretion polypeptide. When these heterologous genes were expressed, however, the mere presence of a consensus signal peptide was found to be insufficient for the efficient secretion of non-secretion competent polypeptides across a given biological membrane, a problem which is often encountered in the field of biotechnology. For example, Martens et al. (1995), attached the signal sequence of the juvenile hormone esterase gene to the 5' end of the CryIA(b) insecticidal crystal protein gene to induce secretion but found that secretion into the medium from the insect cells was poor.
A method to efficiently secrete non-secretion competent polypeptides, such as cytoplasmic proteins, nuclear factors and protein subunits would be desirable.
This would allow the recombinant protein to be expressed at a higher level. Second because the recombinant protein would be secreted into the extracellular environment, purification of the peptide or protein would not be complicated by the presence of other intracellular proteins and would not involve harming the producing cells.
Advantages of the present invention will become apparent from the following description of the invention with reference to the attached drawings.
SUMMARY OF THE INVENTION
The present invention is directed to an expression cassette useful for the secretion of a heterologous protein from eukaryotic cells comprising a DNA
sequence encoding a promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein.
In a second aspect, the present invention is also directed to a vector useful for the secretion of a heterologous protein from eukaryotic cells comprising an expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA
OF NON-SECRETED PROTEINS IN EUKARYOTIC CELLS
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority to U.S. Provisional Application Serial No.
60/056, 871 filed August 21, 1997, which is incorporated herein by reference in its entirety .
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates to the engineering of heterologous gene constructs by recombinant DNA techniques for the more efficient processing and secretion of heterologous genes in eukaryotic cells. Particularly the present invention relates to functionally linking the heterologous gene in frame to the 3' end of the juvenile hormone esterase gene.
DESCRIPTION OF THE RELATED ART
Recombinant polypeptides for medical, research and veterinary applications are produced using a wide variety of genetically engineered organisms that include transgenic animals (eg. cows, goats) transgenic plants (eg. canola) recombinant viruses (eg. baculoviruses) and transformed prokaryotic cells (eg. bacteria) and eukaryotic cells (eg. yeast and animal cells) in culture.
Since most of the proteins are glycoproteins requiring advanced post-translational modification expression systems using yeast and bacteria are unsuitable.
For this reason, other protein expression systems were developed using higher eukaryotes, including virus-based expression systems such as baculovirus and adenovirus and expression from transformed mammalian cells (CHO, BHK Ns0 etc.
and production in the milk of transgenic farm animals). However, even these most advanced vehicles for protein production are inadequate due to difficulties in recovery and purification of the recombinant proteins.
Viral expression systems can produce impressive levels of recombinant proteins in both insect (Maiorella et al. 1988) and mouse cell lines (Garnier et al., 1994) but suffer from serious biological and engineering disadvantages. First, because host cells are killed at the end of each infection cycle, protein expression is only temporary. This also means that protein expression is not suited to the state of the art perfusion bioreactors. Second, the biological authenticity of the expressed protein is not guaranteed because the cell machinery necessary for post-translational modifications is inactivated in the late stages of infection. Unsuitable N-linked glycosylation patterns are widely reported for proteins produced following infection with recombinant viruses, which alters the normal glycosylation characteristics of the cell hosts (Jarvis and Summers, 1989). It is known however that the lepidopteran insect cell hosts are capable of the complex oligosaccharide processing required for in vivo human use of proteins (Davis and Wood 1995) Thirdly, although native genes containing all or part of their introns are generally expressed at a higher level than the corresponding cDNAs (Brinster et al. 1988) virus infected insect cells cannot efficiently excise introns from expressed genomic DNA, thus limiting foreign protein expression from cDNAs only (O'Reilly et al., 1991). Fourth, purification of recombinant proteins from virus infected systems is problematic. Because proteins cannot be secreted efficiently in viral systems due to the inactivation of the secretory pathway upon infection (Jarvis and Summers 1989) they must be recovered from cell lysates after cell lysis. The presence of proteases in such cellular lysates also cause degradation of the over-expressed product.
A major problem in biotechnology exists in the production and recovery of recombinant non-secretion competent polypeptides, such as intracellular proteins or protein subunits, from genetically engineered organisms. Often these intracellular proteins or protein subunits can be expressed at only moderate levels inside a cell and their purification must first include steps to lyse the cells, followed by complex procedures to isolate the desired polypeptides from many other intracellular proteins.
All secreted proteins possess a consensus signal peptide of IO to 50 amino acids at their N-terminus that directs the protein to the secretory pathway of eukaryotic cells or to the cytoplasmic membrane of prokaryotic cells. Using genetic engineering techniques, some research groups have therefore tried to secrete intracellular proteins by fusing the gene sequences of consensus signal peptides in-frame to the 5' end of the gene encoding the non-secretion polypeptide. When these heterologous genes were expressed, however, the mere presence of a consensus signal peptide was found to be insufficient for the efficient secretion of non-secretion competent polypeptides across a given biological membrane, a problem which is often encountered in the field of biotechnology. For example, Martens et al. (1995), attached the signal sequence of the juvenile hormone esterase gene to the 5' end of the CryIA(b) insecticidal crystal protein gene to induce secretion but found that secretion into the medium from the insect cells was poor.
A method to efficiently secrete non-secretion competent polypeptides, such as cytoplasmic proteins, nuclear factors and protein subunits would be desirable.
This would allow the recombinant protein to be expressed at a higher level. Second because the recombinant protein would be secreted into the extracellular environment, purification of the peptide or protein would not be complicated by the presence of other intracellular proteins and would not involve harming the producing cells.
Advantages of the present invention will become apparent from the following description of the invention with reference to the attached drawings.
SUMMARY OF THE INVENTION
The present invention is directed to an expression cassette useful for the secretion of a heterologous protein from eukaryotic cells comprising a DNA
sequence encoding a promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein.
In a second aspect, the present invention is also directed to a vector useful for the secretion of a heterologous protein from eukaryotic cells comprising an expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA
WO 99/10489 PCT/C.a98/00796 sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein.
in another aspect, the present invention is directed to a method of secreting a heterologous protein, comprising introducing into a cell an expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA
sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein under conditions wherein the heterologous protein is expressed and secreted from the cell.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is the generic design of the DNA molecule for the secretion of either an intracellular protein or protein subunit.
Figure 2A is the design of the DNA module used to secrete the bacterial cytoplasmic protein CAT.
Figure 2B is a western blot which shows the secretion of the JHE-CAT fusion protein using the secretion module described in Figure 2A.
Figure 2C shows the liberation of the CAT protein from the fusion protein when incubated with enteropeptidase.
Figure 3A shows the design of the DNA molecule used to secrete the insect nuclear protein BmCFl.
Figure 3B is a western blot which shows the secretion of the JHE-BmCFI
fusion protein using the secretion module described in Figure 3A.
Figure 4 shows the DNA sequence of the juvenile hormone esterase (JHE) gene from Heliothis virescens, Genbank Accession No. 104955 (Hanzlik et al., 1989).
The first translation start codon, methionine, and the translation stop codon are indicated in bold.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention relates to an expression cassette useful for the secretion of a heterologous gene from eukaryotic cells comprising a DNA sequence encoding a .WO 99/10489 PCT/CA98/00796 promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which in turn is functionally linked in frame at its 3' end to a heterologous gene.
The present invention is also directed to a method of secreting a heterologous protein from eukaryotic cells, comprising transforming a cell with a expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA
sequence coding for the juvenile hormone esterase gene which in turn is functionally linked in frame at its 3' end to a heterologous gene coding for the heterologous protein under conditions wherein the heterologous protein is expressed and secreted as a JHE-fusion protein from the cell.
However, prior to discussing this invention in further detail, the following terms will first be defined.
Definitions The term "baculovirus" is used herein as an alternative to the term "nuclear polyhedrosis virus" or "NPV". It encompasses viruses classified under subgroup A of the family of Baculoviridae. Preferably, it includes the viruses specific for the following insects: Bombyx sp., Autographica sp., Spodoptera sp. and other lepidoptera.
The term "expression cassette" means a fragment of nucleic acid comprising a promoter sequence and a DNA sequence coding for the juvenile hormone esterase gene which in turn is functionally linked in frame at its 3' end to a gene coding for the heterologous protein, with or without a sequence containing mRNA
polyadenylation signals. The expression cassette is capable of directing the expression and secretion of a heterologous protein as a JHE-fusion protein when the expression cassette containing the heterologous protein is introduced into a eukaryotic cell.
The term "vector" means nucleic acid which comprises: (1) the expression cassette, and (2) DNA sequences allowing replication and selection in bacteria, for example E. coli. The vector may be a plasmid, another virus or simply a linear DNA
fragment. It is contemplated that the vector may be a baculovirus artificial chromosome (BVAC) as set forth in U.S. Patent Application Serial No. -, -S-entitled BACULOVIRUS ARTIFICIAL CHROMOSOMES AND METHODS OF
USE, Attorney Docket No. 028722-171, and filed concurrently herewith, which claims priority to U.S. Provisional Patent Application Serial No.60/056,807, filed August 21, 1997, both of which are incorporated by reference herein in their entirety.
The term "baculovirus chromosome" refers to the genome of the baculovirus, which genome is circular. In a preferred embodiment, the baculovirus artificial chromosome is derived from the B. mori nuclear polyhedrosis virus. In another embodiment, the chromosome is derived from the A. californica nuclear polyhedrosis virus or any other nuclear polyhedrosis virus that contains a lef 8 gene or lef 8-like gene.
Detectable markers are genes which allow detection of cells that have been transfected or infected with the gene. Detectable markers include reporter genes and selection genes. Reporter gene are genes which confer a characteristic onto the cell which is detectable. Suitable reporter genes include the gene encoding for green fluorescent protein, the ~3-galactosidase gene and the chloramphenicol acetyl transferase gene. Selection genes are wild-type alleles of genes that encode for enzymes which allow the cell to grow on certain media, such as media containing antibiotics.
These genes include, for example, the prokaryotic hygromycin resistance and neomycin resistance genes.
The term "juvenile hormone esterase gene" or "JHE gene" means that portion of the juvenile hormone esterase gene, in addition to its signal sequence, which directs the secretion of non-secretion competent heterologous protein when it is functionally linked in frame at its 3' end with the heterologous gene. The juvenile hormone esterase gene does not include its stop codon. The term "JHE gene" means a DNA sequence of at least about 100 bp, more preferably at least about S00 by and most preferably an entire gene substantially identical to the DNA sequence as set forth in Figure 4. The juvenile hormone esterase gene is derived from Heliothis virescens.
The terms "producing heterologous protein" or "expressing heterologous protein" means that the structural gene encoding the heteroIogous protein is transcribed into mRNA and that the mRNA is further translated into protein. In a preferred embodiment the heterologous protein will be properly processed by the eukaryotic cell, although such processing may be in a tissue specific manner.
The term "secreting" or "secretion" is the active export of a protein from a cell into the extracellular environment. Generally secretion occurs through a secretory pathway in the cell, for example, in eukaryotic cells, this involves the endoplasmic reticulum and golgi apparatus.
The term "structural gene" refers to those DNA sequences which, when functionally attached to a cellular or viral promoter and linked in frame with the JHE
gene, will be transcribed and produce a JHE-heterologous fusion protein which is secreted from the cells.
The term "heterologous structural gene" or "heterologous gene" is a structural gene which will be transcribed and will produce a heterologous protein when functionally attached to any promoter capable of functioning in the host cell or to an enhancer and promoter where the structural gene is introduced into eukaryotic cells either by infection or transfection of cells. While the chloramphenicol acetyl transferase ("CAT") gene was used to characterize the secretion of a heterologous protein under the control of the promoter and the JHE gene in the examples provided herein, it will be recognized that any heterologous structural gene meeting the above criteria may be used in the invention.
The term "heterologous protein" refers to a protein encoded by a heterologous structural gene. Examples of heterologous proteins are chloramphenicol acetyl transferase, human alpha interferon (IFN-a), insulin-like growth factor-II
(IGF-II), human interleukin 3, mouse interleukin 3, human and mouse interleukin 4, human T-lymphotropic virus (HTLV-1) p40x, HTLV-1 env, human immunodeficiency virus (HIV-1) gag, pol, sor, gp4l, and gp120, adenovirus Ela, Japanese encephalitis virus env (N), bovine papilloma virus 1 (BPV 1 ) E2, HPV6b E2, BPV 1 E6, and human apolipoproteins A and E; (3-galactosidase, hepatitis B surface antigen, HIV-1 env, HIV-1 gag, HTLV-1 p40x, human IFN-(3, human interleukin 2, c-myc, D. melanogaster Kruppel gene product, bluetongue virus VP2 and VP3, human parainfluenza virus hemagglutinin (HA), influenza polymerases PA, PB 1, and PB2, influenza virus HA, ~WO 99/10489 PCT/CA98/00796 lymphocytic choriomeningitis virus (LCMV) GPC and N proteins, Neurospora crassa activator protein, polyomavirus T antigen, simian virus 40 (SV40) small t antigen, SV40 large T antigen, Punta Toro phlebovirus N and Ns proteins, simian rotavirus VP6, CD4 (T4), human erythropoietin, Hantaan virus structural protein, human epidermal growth factor (EGF) receptor, human insulin receptor, human B
lymphotrophic virus 130-kd protein, hepatitis A virus VPl, human tyrosine hydroxylase, human glucocerebrosidase, p53 protein, topoisomerases, ecdysone receptor, DNA polymerise subunits, RNA polymerise I, II and III subunits, cytoplasmic and nuclear factors.
The term "non-secretion competent heterologous proteins" means proteins which are not naturally secreted from the cell into the extracellular environment.
Examples of non-secretion competent heterologous proteins are chloramphenicol acetyl transferase, human immunodeficiency virus (HIV-1) gag, pol, sor, ~3-galactosidase, c-myc, influenza polymerises PA, PB1, and PB2, Neurospora crassa activator protein, p53 protein, topoisomerases, ecdysone receptor, DNA polymerise subunits, RNA
polymerise I, II and III subunits, cytoplasmic and nuclear factors and non-secretion competent subunits of secreted proteins.
The term "promoter" means a DNA sequence which initiates and directs the transcription of a heterologous gene into an RNA transcript in cells. The promoter may be a baculovirus promoter derived from any of over S00 baculoviruses generally infecting insects, such as for example the orders Lepidoptera, Diptera, Orthoptera, Coleoptera and Hymenoptera, including for example but not limited to the viral DNAs of Autographa californica MNPV, Bombyx mori NPV, Tricoplusia ni MNPV, Rachiplusia ou MNPV, or Galleria mellonella MNPV wherein said baculovirus promoter is a baculovirus immediate-early gene IE1 or IEN promoter; a delayed-early gene promoter region such as the 39K gene promoter or a baculovirus late gene promoter, such as the polyhedrin gene promoter. The promoter may also be a insect cellular promoter, such as the actin gene promoter, the ribosomal gene promoter, the histone gene promoter, or the tubulin gene promoter. The promoter may also be a _g_ mammalian promoter such as the cytomegalovirus immediate early promoter, the large T antigen promoter or the Rous Sarcoma virus (RSV) LTR promoter.
The term "enhancer" means a cis-acting nucleic acid sequence which enhances the transcription of the structural gene and functions in an orientation and position-independent manner. The enhancer can function in any location, either upstream or downstream relative to the promoter. The enhancer may be any DNA sequence which is capable of increasing the level of transcription from the promoter when the enhancer is functionally linked to the promoter, for example the RSV LTR enhancer, baculovirus HRI, HR2 or HR3 enhancers or the CMV immediate early gene product enhancer. In a preferred embodiment, the enhancer is the 1.2 kb BmNPV enhancer fragment set forth in U.S. Patent Application No. 08/608,617 which is incorporated by reference herein.
It is also contemplated that the expression of the heterologous gene may be enhanced by the expression of other factors, for example the IE-1 protein of nuclear IS polyhedrosis viruses or the herpes simplex virus VP16 transcriptional activator.
The term "functionally linked" or "functionally attached" when describing the relationship between two DNA regions simply means that they are functionally related to each other and they are located on the same nucleic acid fragment. A
promoter is functionally attached to a structural gene if it controls the transcription of the gene and it is located on the same nucleic acid fragment as the gene. An enhancer is functionally linked to a structural gene if it enhances the transcription of that gene and it is functionally located on the same nucleic acid fragment as the gene.
The term "linked in frame" means that one gene is linked at its 3' end to the S' end of a second gene such that after transcription and translation of the genes a single fusion protein comprising the two proteins encoded by the genes is produced.
The two genes may be linked by a spacer nucleic acid sequence.
The term "introduction" refers to either infection or transfection of insect cells.
The term "infection" refers to the invasion by pathogenic viral agents of cells where conditions are favorable for their replication. Such invasion can occur by placing the viral particles directly on the insect cell culture or by injection of the insect larvae with the recombinant virus or by oral ingestion of the viral particles by the insect. The amount of recombinant virus injected into the larvae will be from 10'- to 105 pfu of non-occluded virus/larvae. Alternatively, larvae can be infected by the oral route using occlusion bodies carrying recombinant viruses. In general, the amount of occlusion bodies fed to the larvae is that amount which for wild-type viruses corresponds to the LDSO for that species of baculovirus and insect host. The LDSo varies with each species of baculovirus and the age of the larvae. One skilled in the art can readily determine the amount of occlusion bodies to be administered:
Typically, the amount will vary from 10-106 occlusion bodies/insect.
The term "transfection" refers to a technique for introducing purified nucleic acid into cells by any number of methods known to those skilled in the art.
These include but are not limited to, electroporation, calcium phosphate precipitation, lipofection, DEAE dextran, liposomes, receptor-mediated endocytosis, and particle delivery. The chromosomes or DNA can also be used to microinject eggs, embryos or ex vivo or in vitro cells. Cells can be transfected with the chromosomes or with the DNA described herein using an appropriate introduction technique known to those in the art, for example, liposomes. In a preferred embodiment, the DNA is introduced into the insect cells by mixing the DNA solution with LipofectinT"' (GIBCO BRL
Canada, Burlington, Ontario) and adding the mixture to the cells.
The cell or host cell may be prokaryotic or eukaryotic. If the cell is eukaryotic, it is preferably an insect cell or a mammalian cell.
The term "insect cells" means insect cells from the insect species which are subject to baculovirus infection. For example, without limitation: Autographa californica; Bombyx mori; Spodoptera frugiperda; Choristoneura fumiferana;
Heliothis virescens; Heliothis zea; Helicoverpa zea; Helicoverpa virescens; Orgyia pseudotsugata; Lymantria dispar; Plutella xylostella; Malacostoma disstria;
Trichoplusia ni; Pieris rapae; Mamestra confrgurata; Mamestra brassica;
Hyalophora cecropia.
The term "mammalian cells" includes, for example, COS cells, CHO cells, BHK cells and HeLa cells.
Methodolog;~
Signal peptide sequences are often not sufficient for the efficient secretion of certain peptides or proteins such a nuclear factors from eukaryotic cells.
Such peptides or proteins are termed non-secretion competent proteins.
It has now been found that the fusion of the JHE gene to the 5' end of the non-secretion competent protein will allow efficient secretion of the fusion protein from the cell into the extracellular environment. In order to achieve continuous high level secretion of heterologous proteins in cells, the cells are transformed with an expression cassette comprising a promoter functionally linked to the JHE gene which in turn is linked in frame to the gene coding for the heterologous protein. The linkage of the JHE gene to the heterologous gene is preferably in frame to ensure that both the JHE
gene and the heterologous gene are transcribed and translated as a single fusion protein.
To achieve continuous secretion of heterologous proteins, in one embodiment, normal insect tissue culture cells can be transformed with a vector containing such an expression cassette comprising a promoter and the JHE gene functionally linked in frame to the desired heterologous gene. It is contemplated that the vector may also contain an extra gene expressing a selective marker (e.g. antibiotic resistance gene under the control of a promoter that functions constitutively in insect cells).
Application of a relevant selection should lead to integration of one or more multiple copies of the plasmid into the chromosomes of the cells, thus generating an insect cell line capable of continuous secretion of the heterologous protein.
It is contemplated that the expression cassette may also include an enhancer sequence which would increase the level of transcription from the promoter.
The level of transcription from the cellular promoter functionally linked to an enhancer as compared to the level of transcription from the cellular promoter alone is preferably at least about 10 fold and more preferably at least about 100 fold.
The insect cells may further express other transcription factors which enhance transcription such as the IE-1 protein. In one embodiment the insect cells can be transformed with a vector containing the IE-1 gene and a suitable resistance/selectable marker gene. Application of a relevant selection should lead to integration of one or more multiple copies of the vector into the chromosomes of the cells, thus generating an insect cell line capable of continuous high level expression of the IE-1 gene product.
Thus the cell line will contain the IE-1 gene in the absence of added baculovirus. Such a cell line can be subsequently transformed with additional vectors containing either the expression cassette containing an insect cellular promoter functionally linked to the JHE
gene and a heterologous gene. The second vector may also comprise an additional gene conferring resistance to a second selection agent. In another embodiment, the gene for the IE-1 protein may be inserted into the vector comprising the expression cassette such that the vector contains both the JHE-heterologous genes and the IE-1 gene. In both cases, synthesis of the foreign protein will be continuous, because integrated expression cassettes cannot be lost through replication and the insect cells never die because they are not infected by any viruses. The level of production of heterologous proteins in cells expressing the IE-1 gene as compared to cells without the IE-1 gene is preferably at least about 10 fold greater and more preferably at least about 100 fold greater.
The vector may be a baculovirus artificial chromosome as set forth in U.S.
Patent Application No. Serial No. 60/056,807, entitled BACULOVIRUS ARTIFICIAL
CHROMOSOMES AND METHODS OF USE, Attorney Docket No. 028722-153, filed August 21, 1997 and incorporated by reference in its entirety. Such baculovirus artificial chromosomes would not integrate into the cellular chromosomes but rather replicate autonomously without killing the cells.
It is appreciated that the expression cassette of the present invention could be used to express and secrete any heterologous protein. However, the expression cassette is particularly useful in the expression and secretion of heterologous proteins previously thought to not be secretion competent.
Eukaryotic cells, other than insect cells could be transfected with the expression cassette of the present invention, resulting in the expression and secretion of the heterologous protein from the eukaryotic cell. In particular it is contemplated that mammalian tissue culture cells could be used for the expression and secretion of heterologous proteins. If mammalian cells were used, the promoter sequence and enhancer sequence would preferably be those promoters and enhancers appropriate for expression of the heterologous gene in the mammalian cells.
The heterologous protein is secreted from the cell into the extracellular environment as a fusion protein, wherein the heterologous protein may be fused in frame directly, or via a linking peptide, to the 3' end of the JHE gene. The heterologous fusion protein may then be treated to remove the JHE protein sequences at the 5' end resulting in an active heterologous protein. In order to facilitate the removal of the JHE protein sequences, it is contemplated that the heterologous gene may be linked to the JHE gene in frame via a linking sequence which encodes an amino acid sequence or linking peptide which can be easily cleaved_ An example of a suitable cleavage site is the nucleic acid sequence coding for the amino acid sequence DDDDK, which is a cleavage site recognized by the protease porcine intestine enteropeptidase.
The linking sequence may also contain a DNA sequence encoding a spacer peptide for better access to the cleavage site. The linking sequence may also contain a sequence for efficient purification of the fusion peptide from the extracellular environment. An example of such a sequence is a nucleic acid sequence coding for six histidine residues, which residues will bind to a Ni(II)-NTA chromatography matrix for affinity purification.
yti This technique would be useful for the extracellular production of non-secretion competent polypeptides from a genetically engineered organism for medical, research or veterinary application. For polyclonal or monoclonal antibody generation, this secretion technique would be coupled with a DNA vaccine vector to induce a humoral immune response against non-secretion competent polypeptides. For non-secretion competent polypeptides derived from pathogenic organisms, this secretion technique would be coupled with a DNA vaccine vector to induce an immune response for human and animal vaccines.
As can be appreciated from the disclosure above, the present invention has a wide variety of applications. Accordingly, the following examples are offered by way of illustration and not by way of limitation.
EXAMPLES
In the examples below, the following abbreviations have the following meanings. If not defined below, then the abbreviations have their art recognized meanings.
ORF - open reading frame kb - kilobase mg - milligram mL - milliliter Chemicals used in the following examples were obtained from the following companies:
Amersham Canada Ltd., Oakville, Ontario, Canada J.T. Baker, Phillipsburg, New Jersey BioRad Laboratories Ltd. Canada, Mississauga, Ontario, Canada Boehringer Mannheim, Laval, Quebec, Canada 5 Prime-3 Prime, Inc., Boulder, Colorado GIBCO BRL Canada, Burlington, Ontario, Canada Hyclone Laboratories, Inc. , Logan, Utah ICN Biopharmaceuticals Canada Ltd., Montreal Quebec, Canada JRH Biosciences, Inc., Lenexa, Kansas Life Technologies, Burlington, Ontario, Canada New England Biolabs, Inc. , Mississauga, Ontario, Canada Pharmacia LKB, Baie d' Urfe', Quebec, Canada Promega Corporation, Madison, Wisconsin Sigma, St. Louis, Missouri Stratagene, La Jolla, California United States Biochemicals, Cleveland, Ohio All enzymes used for the construction and characterization of the recombinant plasmids and baculoviruses were obtained from Pharmacia, LKB; New England Biolabs, Inc.; GIBCO BRL Canada; Boehringer Mannheim; and used according to those suppliers recommendations.
The cloning procedures set forth in the examples are standard methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1989) which is incorporated herein by reference. This reference includes procedures for the following standard methods: cloning procedures with E. coli plasmids, transformation of E. coli cells; plasmid DNA purification, agarose gel electrophoresis, restriction endonuclease digestion, ligation of DNA fragments and other DNA-modifying enzyme reactions.
Example 1 Secretion of chloramphenicol acetyl transferase I,CAT) The DNA module for the secretion of chloramphenicol acetyl transferase (CAT) is shown in Figure 2A. At the 5' end, it contains the complete cDNA coding for the insect secreted protein juvenile hormone esterase (JHE) (Hanzlik et al.) which can be secreted from animal cell hosts. The spacer region contains DNA coding for six histidine residues that are attracted to Ni(II)-NTA chromatography matrices for affinity purification (Knoll 1993). The spacer region also contains a nucleic acid sequence coding for the amino acid sequence DDDDK, which is a cleavage site recognized by the protease porcine intestine enteropeptidase (Kell 1971). The spacer region is bound on each side by a proline residue which encourages the spacer peptide to form its own domain for better access to both the chromatographic purification matrix and the enteropeptidase. The module also contains the DNA sequence coding for CAT.
The vectors for Example 1 were constructed as follows. The expression plasmid pIE1/153A contains the Bombyx mori cytoplasmic actin cassette (Johnson et al., 1992; U.S. Patent Application No. 08/608,617), Bombyx mori Nuclear Polyhedrosis Virus (BmNPV) HR3 enhancer element and the BmNPV iel gene and was constructed as follows. A 1.2 kb SspI fragment corresponding to the BmNPV
genomic region from S 1.8 to 52.7 map units containing the BmNPV HR3 element was cloned into the SmaI site of pBluescript-SK+ (Stratagene) to yield plasmid p153. The plasmid pIEl/153 was made by inserting a 3.8 kb CIaI fragment containing the iel gene into the CIaI site of plasmid p153, removing unwanted restriction sites in the polylinker of this plasmid by double digestion with SacII and BamHI, blunt ending with T4 DNA
polymerase and self ligating the resultant plasmid. A 2.2 kb SacI fragment containing the actin cassette from the plasmid pBmA (Johnson et al., 1992) was ligated into the unique SacI site of plasmid pIEI/153 to yield the expression plasmid pIEI/153A.
The vector, pBmA is a pBluescript (Stratagene) derivative of clone pA3-5500 which contains the A3 cytoplasmic actin gene of Bombyx mori (Mounier and Prudhomme, 1986). Plasmid pBmA was constructed to contain 1.5 kb of the A3 gene 5' flanking sequences and part of its first exon to position +67 (relative to transcription initiation), a polylinker region derived from plasmid pBluescript (Stratagene) for insertion of foreign gene sequences, and an additional 1.05 kb of the A3 gene .
sequences encompassing part of the third exon of the gene from position +836 and adjacent 3' flanking sequences which contain signals required for RNA
transcript polyadenylation. See U.S. Patent Application Serial No.08/608,617 which is incorporated by reference herein in its entirety.
This expression vector was constructed by (1) subcloning into plasmid Bluescript-SK+ (Stratagene) a 1.5 kb Kpnl/AccI fragment of clone pA3-5500 containing the 5' flanking, 5' untranslated and coding sequences of the A3 gene up to position + 67 to generate plasmid pBmAp; (2) mutagenizing the ATG translation initiation codon present at position +36 to +38 of the actin coding sequence in plasmid pBmAp into AGG, AAG or ACG by the method of Kunkel (1985) to generate plasmids pBmAp.AGG, pBmAp.AAG and pBmAp.ACG; (3) subcloning into plasmid pSP72 (Promega Corporation) a 1.05 kb XhoI/SaII fragment of clone pA3-5500, containing part of the third exon of the actin gene from position +836 and adjacent 3' flanking S sequences which include signals required for RNA transcript polyadenylation, to generate plasmid pBmAt; (4) converting the unique XhoI site of plasmid pBmAt into a NotI site by digestion of this plasmid with XhoI (GIBCO BRL), and end-filling with Klenow DNA polymerise (Boehringer Mannheim), ligation of NotI tinkers (DNA
Synthesis Laboratory.
A 0.8 kb BamHI fragment, containing the CAT open reading frame was isolated from pBmA.CAT (Johnson et al., 1992; U.S. Patent No. 08/608,617) and cloned into the unique BamHI site in plEl l153A to generate plEl l153A. CAT.
A 1.8 kb EcoRI fragment containing the JHE(kk) open reading frame was first isolated from pAcIIW21-KK (Bonning and Hammock, 1996), NotI linkers were ligated to its ends, and it was inserted into the unique NotI site of plEl l153A to generate the plasmid plEll153A.JHE.
The plasmid plEll153A.JHE.HisEP.CAT was generated in several steps.
(i) First 2 oligonucleotides were synthesized (5' to 3') coding for region II
in Figure 2A:
I. S'- AAAGGATCCAATGCCACATCATCATCAT
CATCATGGCGGCGGC -3' II. 5'- AAAACCATGGCCTGGGTCCTTGTCGTCGTC
GTCGCCGCCGCC- 3' These oligonucleotides were annealed together, end-filled by mutually primed synthesis with Klenow enzyme, double digested with BamHI and NcoI, and ligated into pBluescript-SK+ (Stratagene) to yield pHisEP(Ncol).
(ii) Next two mutagenic primers (5' to 3') were synthesized in order to generate region III in Figure 2A:
I. 5'- GGGCTACCATGGAGAAAAAAATCACTGG -3' II. 5'- GGGTGCTCTAGAATTTCTGCCATTCATCC -3' PCR amplification using Pfu polymerise from plEll153A. CAT plasmid DNA
yielded a 0.8 kb product containing the CAT open reading frame that was double digested with NcoI and XbaI and ligated in-frame into the unique NcoI/XbaI
sites of pHisEP(Ncol) to yield pHisEP. CAT.
(iii) The following two mutagenic primers (5' to 3') were synthesized to obtain region I in Figure 2a:
I. 5'- AAAAGGATCCATGACTTCACACGTACTCGC -3' II. 5'- AAAAGGATCCTTCAAGCGGGCTTCTACTG -3' PCR amplification using Pfu polymerise from plEll153A.JHE(kk) plasmid DNA yielded a 1.6 kb product containing the JHE open reading frame (with no stop codon) that was partially digested with BamHI and ligated in-frame into the unique BamHI site of pHisEP. CAT to yield pJHE. HisEP. CAT.
(iv) A partial BamHI digestion and complete NotI digestion of pJHE. HisEP. CAT released a 2.5 kb fragment containing the complete secretion module (regions I, II, and III in Figure 2A) that was ligated into the unique BamHI/NotI sites of the expression plasmid plEl l153A to yield plEl l153A. JHE. HisEP. CAT.
Control DNA for the experimental demonstration of the secretion of CAT was the expression plsmid plEll153A ("mock DNA"); the expression plasmid with the complete CAT gene plEll153A.CAT ("CAT"), the expression plasmid with spacer plus the CAT gene ("spacer + CAT") and the expression plasmid with the JHE gene plEll153A.JHE ("JHE") in Figure 2B.
The various expression plasmids were transfected into Bombyx mori insect host cells in in vitro cultures. (Lu et al. 1996) Bm5 cells were maintained in IPL-41 (Gibco) + 10% fetal bovine serum. For transfection, cells were seeded into 35mm diameter dishes at a density of 106 cells/well, allowed to adhere, and transfected with 0.5 mL of basal media containing 3 micrograms plasmid DNA and 15 microgram Lipofectin (Gibco) for 5 hours according to manufacturers instructions. Cells and supernatant were harvested for analysis 2 days following transfection.
The extracellularly expressed CAT was detected by western blotting (Sambrook 1989) the culture supernatants, using an antibody recognizing CAT. Aliquots of cells or cell culture supernatants were resolved by electrophoresis in a SDS-containing 8 %
polyacrylamide gel (SDS-PAGE) and electroblotted onto Hybond-ECL membrane (Amersham). After transfer, the membrane was blocked for 1 hour at room temperature in 50 ml PBS-0.1 % Tween-20 (PBST) containing 10% (w/v) skim milk S powder (PBSTM). The filter was incubated for 1 hour at room temperature in S
mL
PBSTM containing rabbit polyclonal anti-CAT antibody (5 Prime-3 Prime, Inc., 1:1000 dilution), washed twice for 15 minutes with PBST, and incubated 1 hour with SmL
PBSTM containing horseradish peroxidase conjugated goat anti-rabbit IgG (Life Technologies; 1:1000 dilution). After washing twice with PBST, the filter was incubated with ECL chemiluminescent substrate (Amersham) according to the suppliers' instructions and exposed to X-ray film.
Figure 2B shows that no CAT was detected in either the supernatant of cells transfected with mock plasmid DNA or cells transfected with a plasmid expressing CAT or cells transfected with a plasmid expressing the spacer plus the CAT
gene, or cells transfected with a plasmid expressing JHE. CAT was detected in the supernatant of cells transfected with plasmid plEl l153A.JHE. HisEP. CAT ("secretion module").
Therefore, the naturally secreted protein JHE can be employed to drag a non-secretion competent polypeptide, such as CAT, into an extracellular environment.
E~~nple 2 Liberation of the CAT nentide from the fusion rn otein To demonstrate that the CAT protein could be liberated from the expressed fusion protein culture, supernatant from the culture described in Example 1 was dialyzed against enteropeptidase buffer, and incubated with porcine intestine enteropeptidase [ICN Biopharmaceuticals Canada Ltd.] for 36 hours at 37°C (Kell 1971). Figure 2C is a western blot of an enteropeptidase digested sample, using the anti-CAT antibody (S Prime-3 Prime, Inc. 1:1000 dilution) which shows that some CAT was successfully liberated from the fusion protein.
The intracellular protein Bombyx mori chorion factor 1 (BmCFl) is naturally found in the nucleus of some Bombyx mori insect cells. The module for secretion of BmCFI is shown in Figure 3A.
A 3.8 kb NotI fragment of pBmCFI (Tzertziniz et al, 1994) containing the BmCFl open reading frame was ligated into the unique NotI site of plEll153A to form plEl l153A.BmCFl.
The plasmid plEll153A.JHE.HisEP.BmCFI was generated in several stages.
(i) First 2 oligonucleotides were synthesized (5' to 3') coding for region II
in Figure 3A:
I. S'- AAAGGATCCA ATG CCA CAT CAT CAT CAT CAT CAT GGC GGC
GGC -3' II. 5'- AAAAGC ATG CCC TGG GTC CTT GTC GTC GTC GTC GCC GCC
GCC -3' These oligonucleotides were annealed together, endfilled by mutually primed synthesis with Klenow enzyme, double digested with BamHI and SphI and Iigated into pBluescript-SK+ (Stratagene) to yield pHisEP (Sphl).
(ii) The following 2 oligonucleotides were synthesized (5' to 3') to obtain region III in Figure 3A:
I. 5'- TGTGGGCATGCAGAGCGTGGCGAAG -3' II. 5'- CGACATTCAAATCTAGAATAAGTCCCCCTAC -3' PCR amplification using Pfu polymerase from pBmCFI plasmid DNA yielded a 1.5 kb product containing the BmCFI open reading frame that was completely digested with XbaI and partially digested with SphI and ligated in-frame into the unique SphI/XbaI sites of pHisEP (Sphl) to yield pHisEP.BmCFl.
(iii) The PCR product containing the JHE ORF (with no stop codon), described in Eample 1, was ligated in-frame into the unique BamHI site of pHisEP.BmCFI to yield pJHE.HisEP.BmCFl.
(iv) A partial BamHI digestion and complete NotI digestion of pJHE. HisEP. BmCFl released a 2.6 kb fragment containing the complete secretion module (regions I, II and III in Figure 3A) that was ligated into the unique BamHI/NotI
sites of plEll153A to yield plElll53A.JHE.HisEP.BmCFl.
Control DNA for the experimental demonstration of the secretion of BmCFI
was the expression plasmid plEll153A ("mock DNA"); the expression plasmid with the complete BmCFl gene, plEll153A.BmCFl ("BmCFI "), and the expression plasmid with the complete JHE gene, plEll153A.JHE ("JHE") in Figure 3B.
Each plasmid was transfected into Bombyx mori insect host cells in in vitro cultures as set forth in Example 1. Intracellular and extracellular expressed BmCFl was detected by western blotting using mouse monoclonal anti-BmCFl (provided by Dr. F.C. Kafatos, Harvard University, Boston, Massachusetts; 1:100 dilution) and horse-radish peroxidase conjugate goat anti-mouse antibody [Life Technologies;
1:1000 dilution) by the methods set forth in Example 1.
The western blot, shown in Figure 3B reveals that the normally intracellular protein BmCFI was only detected in the supernatant of cells transfected with the pIEI/153A.JHE.HisEP.BmCFl, ("secretion module") described in Figure 3A.
While the present invention has been described with reference to what are considered to be the preferred examples, it is to be understood that the invention is not limited to the disclosed examples. To the contrary, the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.
REFERENCES
All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
U.S. Patent Application No. 08/608,617 Bonning and Hammock, (1996) Ann. Rev. Entomol. 41:191-210 Brinster et al., (1988) Proc. Natl. Acad. Sci. U.S.A. 85:836-840 Davis and Wood (1995) "Intrinsic glycosyiation potentials of insect cell cultures and insect larvae" in vitro Cell. Dev. Biol.
Garnier et al., (1994) Cryotech 15(1-3):145-155 Hanzlik et al., (1989) J. Biol. Chem.264:12419-12425 Huybrechts et al. (1992) "Nucleotide sequence of a transactivating Bombyx mori nuclear polyhedrosis virus immediate early gene" Biochim. Bioph. Acta.
1129:328-330 Jarvis and Summers, (1989) "Glycosylation and secretion of human tissue plasminogen activator in recombinant baculovirus-infected cells. " Mol Cell Biology 9:214-223 Johnson et al. , ( 1992) "A cellular promoter-based expression cassette for generating recombinant baculoviruses directing rapid expression of passenger genes in infected insects" Virology 190:815-823 Kell ( 1971 ) in The Enzymes, Academic Press, 3:249-275 Kroll et al., (1993) DNA and Cell Bio. 12:441-453 Kunkel (1985) Proc. Nat. Acad. Sci U.S.A. 82:488-492 Lu et al. , ( 1996)"trans-activation of a cell housekeeping gene promoter by the IE1 gene product of baculoviruses" Virology 218:103-113 Maiorella et al. (1988) "Large scale insect culture media for recombinant protein production" BiolTechnology 6:1406-1410 Martens et al., (1995) "Characterization of baculovirus insecticides expressing tailored Bacillus thuringiensis CrylA(b) crystal proteins" J. of Invertebrate Pathology 66:249-157 Mounier and Prudhomme, (1986) Biochimie 68:1053-1061 O'Reilly et al., (1992) Baculovirus Expression Vectors. W.H. Freeman and Co.
Sambrook et al., (1989) In Molecular Cloning, A laboratory Manual Cold Spring Harbor Press.
Tzertziniz et al, (1994) J. Mol. Biol. 238:479-486
in another aspect, the present invention is directed to a method of secreting a heterologous protein, comprising introducing into a cell an expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA
sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein under conditions wherein the heterologous protein is expressed and secreted from the cell.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is the generic design of the DNA molecule for the secretion of either an intracellular protein or protein subunit.
Figure 2A is the design of the DNA module used to secrete the bacterial cytoplasmic protein CAT.
Figure 2B is a western blot which shows the secretion of the JHE-CAT fusion protein using the secretion module described in Figure 2A.
Figure 2C shows the liberation of the CAT protein from the fusion protein when incubated with enteropeptidase.
Figure 3A shows the design of the DNA molecule used to secrete the insect nuclear protein BmCFl.
Figure 3B is a western blot which shows the secretion of the JHE-BmCFI
fusion protein using the secretion module described in Figure 3A.
Figure 4 shows the DNA sequence of the juvenile hormone esterase (JHE) gene from Heliothis virescens, Genbank Accession No. 104955 (Hanzlik et al., 1989).
The first translation start codon, methionine, and the translation stop codon are indicated in bold.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention relates to an expression cassette useful for the secretion of a heterologous gene from eukaryotic cells comprising a DNA sequence encoding a .WO 99/10489 PCT/CA98/00796 promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which in turn is functionally linked in frame at its 3' end to a heterologous gene.
The present invention is also directed to a method of secreting a heterologous protein from eukaryotic cells, comprising transforming a cell with a expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA
sequence coding for the juvenile hormone esterase gene which in turn is functionally linked in frame at its 3' end to a heterologous gene coding for the heterologous protein under conditions wherein the heterologous protein is expressed and secreted as a JHE-fusion protein from the cell.
However, prior to discussing this invention in further detail, the following terms will first be defined.
Definitions The term "baculovirus" is used herein as an alternative to the term "nuclear polyhedrosis virus" or "NPV". It encompasses viruses classified under subgroup A of the family of Baculoviridae. Preferably, it includes the viruses specific for the following insects: Bombyx sp., Autographica sp., Spodoptera sp. and other lepidoptera.
The term "expression cassette" means a fragment of nucleic acid comprising a promoter sequence and a DNA sequence coding for the juvenile hormone esterase gene which in turn is functionally linked in frame at its 3' end to a gene coding for the heterologous protein, with or without a sequence containing mRNA
polyadenylation signals. The expression cassette is capable of directing the expression and secretion of a heterologous protein as a JHE-fusion protein when the expression cassette containing the heterologous protein is introduced into a eukaryotic cell.
The term "vector" means nucleic acid which comprises: (1) the expression cassette, and (2) DNA sequences allowing replication and selection in bacteria, for example E. coli. The vector may be a plasmid, another virus or simply a linear DNA
fragment. It is contemplated that the vector may be a baculovirus artificial chromosome (BVAC) as set forth in U.S. Patent Application Serial No. -, -S-entitled BACULOVIRUS ARTIFICIAL CHROMOSOMES AND METHODS OF
USE, Attorney Docket No. 028722-171, and filed concurrently herewith, which claims priority to U.S. Provisional Patent Application Serial No.60/056,807, filed August 21, 1997, both of which are incorporated by reference herein in their entirety.
The term "baculovirus chromosome" refers to the genome of the baculovirus, which genome is circular. In a preferred embodiment, the baculovirus artificial chromosome is derived from the B. mori nuclear polyhedrosis virus. In another embodiment, the chromosome is derived from the A. californica nuclear polyhedrosis virus or any other nuclear polyhedrosis virus that contains a lef 8 gene or lef 8-like gene.
Detectable markers are genes which allow detection of cells that have been transfected or infected with the gene. Detectable markers include reporter genes and selection genes. Reporter gene are genes which confer a characteristic onto the cell which is detectable. Suitable reporter genes include the gene encoding for green fluorescent protein, the ~3-galactosidase gene and the chloramphenicol acetyl transferase gene. Selection genes are wild-type alleles of genes that encode for enzymes which allow the cell to grow on certain media, such as media containing antibiotics.
These genes include, for example, the prokaryotic hygromycin resistance and neomycin resistance genes.
The term "juvenile hormone esterase gene" or "JHE gene" means that portion of the juvenile hormone esterase gene, in addition to its signal sequence, which directs the secretion of non-secretion competent heterologous protein when it is functionally linked in frame at its 3' end with the heterologous gene. The juvenile hormone esterase gene does not include its stop codon. The term "JHE gene" means a DNA sequence of at least about 100 bp, more preferably at least about S00 by and most preferably an entire gene substantially identical to the DNA sequence as set forth in Figure 4. The juvenile hormone esterase gene is derived from Heliothis virescens.
The terms "producing heterologous protein" or "expressing heterologous protein" means that the structural gene encoding the heteroIogous protein is transcribed into mRNA and that the mRNA is further translated into protein. In a preferred embodiment the heterologous protein will be properly processed by the eukaryotic cell, although such processing may be in a tissue specific manner.
The term "secreting" or "secretion" is the active export of a protein from a cell into the extracellular environment. Generally secretion occurs through a secretory pathway in the cell, for example, in eukaryotic cells, this involves the endoplasmic reticulum and golgi apparatus.
The term "structural gene" refers to those DNA sequences which, when functionally attached to a cellular or viral promoter and linked in frame with the JHE
gene, will be transcribed and produce a JHE-heterologous fusion protein which is secreted from the cells.
The term "heterologous structural gene" or "heterologous gene" is a structural gene which will be transcribed and will produce a heterologous protein when functionally attached to any promoter capable of functioning in the host cell or to an enhancer and promoter where the structural gene is introduced into eukaryotic cells either by infection or transfection of cells. While the chloramphenicol acetyl transferase ("CAT") gene was used to characterize the secretion of a heterologous protein under the control of the promoter and the JHE gene in the examples provided herein, it will be recognized that any heterologous structural gene meeting the above criteria may be used in the invention.
The term "heterologous protein" refers to a protein encoded by a heterologous structural gene. Examples of heterologous proteins are chloramphenicol acetyl transferase, human alpha interferon (IFN-a), insulin-like growth factor-II
(IGF-II), human interleukin 3, mouse interleukin 3, human and mouse interleukin 4, human T-lymphotropic virus (HTLV-1) p40x, HTLV-1 env, human immunodeficiency virus (HIV-1) gag, pol, sor, gp4l, and gp120, adenovirus Ela, Japanese encephalitis virus env (N), bovine papilloma virus 1 (BPV 1 ) E2, HPV6b E2, BPV 1 E6, and human apolipoproteins A and E; (3-galactosidase, hepatitis B surface antigen, HIV-1 env, HIV-1 gag, HTLV-1 p40x, human IFN-(3, human interleukin 2, c-myc, D. melanogaster Kruppel gene product, bluetongue virus VP2 and VP3, human parainfluenza virus hemagglutinin (HA), influenza polymerases PA, PB 1, and PB2, influenza virus HA, ~WO 99/10489 PCT/CA98/00796 lymphocytic choriomeningitis virus (LCMV) GPC and N proteins, Neurospora crassa activator protein, polyomavirus T antigen, simian virus 40 (SV40) small t antigen, SV40 large T antigen, Punta Toro phlebovirus N and Ns proteins, simian rotavirus VP6, CD4 (T4), human erythropoietin, Hantaan virus structural protein, human epidermal growth factor (EGF) receptor, human insulin receptor, human B
lymphotrophic virus 130-kd protein, hepatitis A virus VPl, human tyrosine hydroxylase, human glucocerebrosidase, p53 protein, topoisomerases, ecdysone receptor, DNA polymerise subunits, RNA polymerise I, II and III subunits, cytoplasmic and nuclear factors.
The term "non-secretion competent heterologous proteins" means proteins which are not naturally secreted from the cell into the extracellular environment.
Examples of non-secretion competent heterologous proteins are chloramphenicol acetyl transferase, human immunodeficiency virus (HIV-1) gag, pol, sor, ~3-galactosidase, c-myc, influenza polymerises PA, PB1, and PB2, Neurospora crassa activator protein, p53 protein, topoisomerases, ecdysone receptor, DNA polymerise subunits, RNA
polymerise I, II and III subunits, cytoplasmic and nuclear factors and non-secretion competent subunits of secreted proteins.
The term "promoter" means a DNA sequence which initiates and directs the transcription of a heterologous gene into an RNA transcript in cells. The promoter may be a baculovirus promoter derived from any of over S00 baculoviruses generally infecting insects, such as for example the orders Lepidoptera, Diptera, Orthoptera, Coleoptera and Hymenoptera, including for example but not limited to the viral DNAs of Autographa californica MNPV, Bombyx mori NPV, Tricoplusia ni MNPV, Rachiplusia ou MNPV, or Galleria mellonella MNPV wherein said baculovirus promoter is a baculovirus immediate-early gene IE1 or IEN promoter; a delayed-early gene promoter region such as the 39K gene promoter or a baculovirus late gene promoter, such as the polyhedrin gene promoter. The promoter may also be a insect cellular promoter, such as the actin gene promoter, the ribosomal gene promoter, the histone gene promoter, or the tubulin gene promoter. The promoter may also be a _g_ mammalian promoter such as the cytomegalovirus immediate early promoter, the large T antigen promoter or the Rous Sarcoma virus (RSV) LTR promoter.
The term "enhancer" means a cis-acting nucleic acid sequence which enhances the transcription of the structural gene and functions in an orientation and position-independent manner. The enhancer can function in any location, either upstream or downstream relative to the promoter. The enhancer may be any DNA sequence which is capable of increasing the level of transcription from the promoter when the enhancer is functionally linked to the promoter, for example the RSV LTR enhancer, baculovirus HRI, HR2 or HR3 enhancers or the CMV immediate early gene product enhancer. In a preferred embodiment, the enhancer is the 1.2 kb BmNPV enhancer fragment set forth in U.S. Patent Application No. 08/608,617 which is incorporated by reference herein.
It is also contemplated that the expression of the heterologous gene may be enhanced by the expression of other factors, for example the IE-1 protein of nuclear IS polyhedrosis viruses or the herpes simplex virus VP16 transcriptional activator.
The term "functionally linked" or "functionally attached" when describing the relationship between two DNA regions simply means that they are functionally related to each other and they are located on the same nucleic acid fragment. A
promoter is functionally attached to a structural gene if it controls the transcription of the gene and it is located on the same nucleic acid fragment as the gene. An enhancer is functionally linked to a structural gene if it enhances the transcription of that gene and it is functionally located on the same nucleic acid fragment as the gene.
The term "linked in frame" means that one gene is linked at its 3' end to the S' end of a second gene such that after transcription and translation of the genes a single fusion protein comprising the two proteins encoded by the genes is produced.
The two genes may be linked by a spacer nucleic acid sequence.
The term "introduction" refers to either infection or transfection of insect cells.
The term "infection" refers to the invasion by pathogenic viral agents of cells where conditions are favorable for their replication. Such invasion can occur by placing the viral particles directly on the insect cell culture or by injection of the insect larvae with the recombinant virus or by oral ingestion of the viral particles by the insect. The amount of recombinant virus injected into the larvae will be from 10'- to 105 pfu of non-occluded virus/larvae. Alternatively, larvae can be infected by the oral route using occlusion bodies carrying recombinant viruses. In general, the amount of occlusion bodies fed to the larvae is that amount which for wild-type viruses corresponds to the LDSO for that species of baculovirus and insect host. The LDSo varies with each species of baculovirus and the age of the larvae. One skilled in the art can readily determine the amount of occlusion bodies to be administered:
Typically, the amount will vary from 10-106 occlusion bodies/insect.
The term "transfection" refers to a technique for introducing purified nucleic acid into cells by any number of methods known to those skilled in the art.
These include but are not limited to, electroporation, calcium phosphate precipitation, lipofection, DEAE dextran, liposomes, receptor-mediated endocytosis, and particle delivery. The chromosomes or DNA can also be used to microinject eggs, embryos or ex vivo or in vitro cells. Cells can be transfected with the chromosomes or with the DNA described herein using an appropriate introduction technique known to those in the art, for example, liposomes. In a preferred embodiment, the DNA is introduced into the insect cells by mixing the DNA solution with LipofectinT"' (GIBCO BRL
Canada, Burlington, Ontario) and adding the mixture to the cells.
The cell or host cell may be prokaryotic or eukaryotic. If the cell is eukaryotic, it is preferably an insect cell or a mammalian cell.
The term "insect cells" means insect cells from the insect species which are subject to baculovirus infection. For example, without limitation: Autographa californica; Bombyx mori; Spodoptera frugiperda; Choristoneura fumiferana;
Heliothis virescens; Heliothis zea; Helicoverpa zea; Helicoverpa virescens; Orgyia pseudotsugata; Lymantria dispar; Plutella xylostella; Malacostoma disstria;
Trichoplusia ni; Pieris rapae; Mamestra confrgurata; Mamestra brassica;
Hyalophora cecropia.
The term "mammalian cells" includes, for example, COS cells, CHO cells, BHK cells and HeLa cells.
Methodolog;~
Signal peptide sequences are often not sufficient for the efficient secretion of certain peptides or proteins such a nuclear factors from eukaryotic cells.
Such peptides or proteins are termed non-secretion competent proteins.
It has now been found that the fusion of the JHE gene to the 5' end of the non-secretion competent protein will allow efficient secretion of the fusion protein from the cell into the extracellular environment. In order to achieve continuous high level secretion of heterologous proteins in cells, the cells are transformed with an expression cassette comprising a promoter functionally linked to the JHE gene which in turn is linked in frame to the gene coding for the heterologous protein. The linkage of the JHE gene to the heterologous gene is preferably in frame to ensure that both the JHE
gene and the heterologous gene are transcribed and translated as a single fusion protein.
To achieve continuous secretion of heterologous proteins, in one embodiment, normal insect tissue culture cells can be transformed with a vector containing such an expression cassette comprising a promoter and the JHE gene functionally linked in frame to the desired heterologous gene. It is contemplated that the vector may also contain an extra gene expressing a selective marker (e.g. antibiotic resistance gene under the control of a promoter that functions constitutively in insect cells).
Application of a relevant selection should lead to integration of one or more multiple copies of the plasmid into the chromosomes of the cells, thus generating an insect cell line capable of continuous secretion of the heterologous protein.
It is contemplated that the expression cassette may also include an enhancer sequence which would increase the level of transcription from the promoter.
The level of transcription from the cellular promoter functionally linked to an enhancer as compared to the level of transcription from the cellular promoter alone is preferably at least about 10 fold and more preferably at least about 100 fold.
The insect cells may further express other transcription factors which enhance transcription such as the IE-1 protein. In one embodiment the insect cells can be transformed with a vector containing the IE-1 gene and a suitable resistance/selectable marker gene. Application of a relevant selection should lead to integration of one or more multiple copies of the vector into the chromosomes of the cells, thus generating an insect cell line capable of continuous high level expression of the IE-1 gene product.
Thus the cell line will contain the IE-1 gene in the absence of added baculovirus. Such a cell line can be subsequently transformed with additional vectors containing either the expression cassette containing an insect cellular promoter functionally linked to the JHE
gene and a heterologous gene. The second vector may also comprise an additional gene conferring resistance to a second selection agent. In another embodiment, the gene for the IE-1 protein may be inserted into the vector comprising the expression cassette such that the vector contains both the JHE-heterologous genes and the IE-1 gene. In both cases, synthesis of the foreign protein will be continuous, because integrated expression cassettes cannot be lost through replication and the insect cells never die because they are not infected by any viruses. The level of production of heterologous proteins in cells expressing the IE-1 gene as compared to cells without the IE-1 gene is preferably at least about 10 fold greater and more preferably at least about 100 fold greater.
The vector may be a baculovirus artificial chromosome as set forth in U.S.
Patent Application No. Serial No. 60/056,807, entitled BACULOVIRUS ARTIFICIAL
CHROMOSOMES AND METHODS OF USE, Attorney Docket No. 028722-153, filed August 21, 1997 and incorporated by reference in its entirety. Such baculovirus artificial chromosomes would not integrate into the cellular chromosomes but rather replicate autonomously without killing the cells.
It is appreciated that the expression cassette of the present invention could be used to express and secrete any heterologous protein. However, the expression cassette is particularly useful in the expression and secretion of heterologous proteins previously thought to not be secretion competent.
Eukaryotic cells, other than insect cells could be transfected with the expression cassette of the present invention, resulting in the expression and secretion of the heterologous protein from the eukaryotic cell. In particular it is contemplated that mammalian tissue culture cells could be used for the expression and secretion of heterologous proteins. If mammalian cells were used, the promoter sequence and enhancer sequence would preferably be those promoters and enhancers appropriate for expression of the heterologous gene in the mammalian cells.
The heterologous protein is secreted from the cell into the extracellular environment as a fusion protein, wherein the heterologous protein may be fused in frame directly, or via a linking peptide, to the 3' end of the JHE gene. The heterologous fusion protein may then be treated to remove the JHE protein sequences at the 5' end resulting in an active heterologous protein. In order to facilitate the removal of the JHE protein sequences, it is contemplated that the heterologous gene may be linked to the JHE gene in frame via a linking sequence which encodes an amino acid sequence or linking peptide which can be easily cleaved_ An example of a suitable cleavage site is the nucleic acid sequence coding for the amino acid sequence DDDDK, which is a cleavage site recognized by the protease porcine intestine enteropeptidase.
The linking sequence may also contain a DNA sequence encoding a spacer peptide for better access to the cleavage site. The linking sequence may also contain a sequence for efficient purification of the fusion peptide from the extracellular environment. An example of such a sequence is a nucleic acid sequence coding for six histidine residues, which residues will bind to a Ni(II)-NTA chromatography matrix for affinity purification.
yti This technique would be useful for the extracellular production of non-secretion competent polypeptides from a genetically engineered organism for medical, research or veterinary application. For polyclonal or monoclonal antibody generation, this secretion technique would be coupled with a DNA vaccine vector to induce a humoral immune response against non-secretion competent polypeptides. For non-secretion competent polypeptides derived from pathogenic organisms, this secretion technique would be coupled with a DNA vaccine vector to induce an immune response for human and animal vaccines.
As can be appreciated from the disclosure above, the present invention has a wide variety of applications. Accordingly, the following examples are offered by way of illustration and not by way of limitation.
EXAMPLES
In the examples below, the following abbreviations have the following meanings. If not defined below, then the abbreviations have their art recognized meanings.
ORF - open reading frame kb - kilobase mg - milligram mL - milliliter Chemicals used in the following examples were obtained from the following companies:
Amersham Canada Ltd., Oakville, Ontario, Canada J.T. Baker, Phillipsburg, New Jersey BioRad Laboratories Ltd. Canada, Mississauga, Ontario, Canada Boehringer Mannheim, Laval, Quebec, Canada 5 Prime-3 Prime, Inc., Boulder, Colorado GIBCO BRL Canada, Burlington, Ontario, Canada Hyclone Laboratories, Inc. , Logan, Utah ICN Biopharmaceuticals Canada Ltd., Montreal Quebec, Canada JRH Biosciences, Inc., Lenexa, Kansas Life Technologies, Burlington, Ontario, Canada New England Biolabs, Inc. , Mississauga, Ontario, Canada Pharmacia LKB, Baie d' Urfe', Quebec, Canada Promega Corporation, Madison, Wisconsin Sigma, St. Louis, Missouri Stratagene, La Jolla, California United States Biochemicals, Cleveland, Ohio All enzymes used for the construction and characterization of the recombinant plasmids and baculoviruses were obtained from Pharmacia, LKB; New England Biolabs, Inc.; GIBCO BRL Canada; Boehringer Mannheim; and used according to those suppliers recommendations.
The cloning procedures set forth in the examples are standard methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory (1989) which is incorporated herein by reference. This reference includes procedures for the following standard methods: cloning procedures with E. coli plasmids, transformation of E. coli cells; plasmid DNA purification, agarose gel electrophoresis, restriction endonuclease digestion, ligation of DNA fragments and other DNA-modifying enzyme reactions.
Example 1 Secretion of chloramphenicol acetyl transferase I,CAT) The DNA module for the secretion of chloramphenicol acetyl transferase (CAT) is shown in Figure 2A. At the 5' end, it contains the complete cDNA coding for the insect secreted protein juvenile hormone esterase (JHE) (Hanzlik et al.) which can be secreted from animal cell hosts. The spacer region contains DNA coding for six histidine residues that are attracted to Ni(II)-NTA chromatography matrices for affinity purification (Knoll 1993). The spacer region also contains a nucleic acid sequence coding for the amino acid sequence DDDDK, which is a cleavage site recognized by the protease porcine intestine enteropeptidase (Kell 1971). The spacer region is bound on each side by a proline residue which encourages the spacer peptide to form its own domain for better access to both the chromatographic purification matrix and the enteropeptidase. The module also contains the DNA sequence coding for CAT.
The vectors for Example 1 were constructed as follows. The expression plasmid pIE1/153A contains the Bombyx mori cytoplasmic actin cassette (Johnson et al., 1992; U.S. Patent Application No. 08/608,617), Bombyx mori Nuclear Polyhedrosis Virus (BmNPV) HR3 enhancer element and the BmNPV iel gene and was constructed as follows. A 1.2 kb SspI fragment corresponding to the BmNPV
genomic region from S 1.8 to 52.7 map units containing the BmNPV HR3 element was cloned into the SmaI site of pBluescript-SK+ (Stratagene) to yield plasmid p153. The plasmid pIEl/153 was made by inserting a 3.8 kb CIaI fragment containing the iel gene into the CIaI site of plasmid p153, removing unwanted restriction sites in the polylinker of this plasmid by double digestion with SacII and BamHI, blunt ending with T4 DNA
polymerase and self ligating the resultant plasmid. A 2.2 kb SacI fragment containing the actin cassette from the plasmid pBmA (Johnson et al., 1992) was ligated into the unique SacI site of plasmid pIEI/153 to yield the expression plasmid pIEI/153A.
The vector, pBmA is a pBluescript (Stratagene) derivative of clone pA3-5500 which contains the A3 cytoplasmic actin gene of Bombyx mori (Mounier and Prudhomme, 1986). Plasmid pBmA was constructed to contain 1.5 kb of the A3 gene 5' flanking sequences and part of its first exon to position +67 (relative to transcription initiation), a polylinker region derived from plasmid pBluescript (Stratagene) for insertion of foreign gene sequences, and an additional 1.05 kb of the A3 gene .
sequences encompassing part of the third exon of the gene from position +836 and adjacent 3' flanking sequences which contain signals required for RNA
transcript polyadenylation. See U.S. Patent Application Serial No.08/608,617 which is incorporated by reference herein in its entirety.
This expression vector was constructed by (1) subcloning into plasmid Bluescript-SK+ (Stratagene) a 1.5 kb Kpnl/AccI fragment of clone pA3-5500 containing the 5' flanking, 5' untranslated and coding sequences of the A3 gene up to position + 67 to generate plasmid pBmAp; (2) mutagenizing the ATG translation initiation codon present at position +36 to +38 of the actin coding sequence in plasmid pBmAp into AGG, AAG or ACG by the method of Kunkel (1985) to generate plasmids pBmAp.AGG, pBmAp.AAG and pBmAp.ACG; (3) subcloning into plasmid pSP72 (Promega Corporation) a 1.05 kb XhoI/SaII fragment of clone pA3-5500, containing part of the third exon of the actin gene from position +836 and adjacent 3' flanking S sequences which include signals required for RNA transcript polyadenylation, to generate plasmid pBmAt; (4) converting the unique XhoI site of plasmid pBmAt into a NotI site by digestion of this plasmid with XhoI (GIBCO BRL), and end-filling with Klenow DNA polymerise (Boehringer Mannheim), ligation of NotI tinkers (DNA
Synthesis Laboratory.
A 0.8 kb BamHI fragment, containing the CAT open reading frame was isolated from pBmA.CAT (Johnson et al., 1992; U.S. Patent No. 08/608,617) and cloned into the unique BamHI site in plEl l153A to generate plEl l153A. CAT.
A 1.8 kb EcoRI fragment containing the JHE(kk) open reading frame was first isolated from pAcIIW21-KK (Bonning and Hammock, 1996), NotI linkers were ligated to its ends, and it was inserted into the unique NotI site of plEl l153A to generate the plasmid plEll153A.JHE.
The plasmid plEll153A.JHE.HisEP.CAT was generated in several steps.
(i) First 2 oligonucleotides were synthesized (5' to 3') coding for region II
in Figure 2A:
I. S'- AAAGGATCCAATGCCACATCATCATCAT
CATCATGGCGGCGGC -3' II. 5'- AAAACCATGGCCTGGGTCCTTGTCGTCGTC
GTCGCCGCCGCC- 3' These oligonucleotides were annealed together, end-filled by mutually primed synthesis with Klenow enzyme, double digested with BamHI and NcoI, and ligated into pBluescript-SK+ (Stratagene) to yield pHisEP(Ncol).
(ii) Next two mutagenic primers (5' to 3') were synthesized in order to generate region III in Figure 2A:
I. 5'- GGGCTACCATGGAGAAAAAAATCACTGG -3' II. 5'- GGGTGCTCTAGAATTTCTGCCATTCATCC -3' PCR amplification using Pfu polymerise from plEll153A. CAT plasmid DNA
yielded a 0.8 kb product containing the CAT open reading frame that was double digested with NcoI and XbaI and ligated in-frame into the unique NcoI/XbaI
sites of pHisEP(Ncol) to yield pHisEP. CAT.
(iii) The following two mutagenic primers (5' to 3') were synthesized to obtain region I in Figure 2a:
I. 5'- AAAAGGATCCATGACTTCACACGTACTCGC -3' II. 5'- AAAAGGATCCTTCAAGCGGGCTTCTACTG -3' PCR amplification using Pfu polymerise from plEll153A.JHE(kk) plasmid DNA yielded a 1.6 kb product containing the JHE open reading frame (with no stop codon) that was partially digested with BamHI and ligated in-frame into the unique BamHI site of pHisEP. CAT to yield pJHE. HisEP. CAT.
(iv) A partial BamHI digestion and complete NotI digestion of pJHE. HisEP. CAT released a 2.5 kb fragment containing the complete secretion module (regions I, II, and III in Figure 2A) that was ligated into the unique BamHI/NotI sites of the expression plasmid plEl l153A to yield plEl l153A. JHE. HisEP. CAT.
Control DNA for the experimental demonstration of the secretion of CAT was the expression plsmid plEll153A ("mock DNA"); the expression plasmid with the complete CAT gene plEll153A.CAT ("CAT"), the expression plasmid with spacer plus the CAT gene ("spacer + CAT") and the expression plasmid with the JHE gene plEll153A.JHE ("JHE") in Figure 2B.
The various expression plasmids were transfected into Bombyx mori insect host cells in in vitro cultures. (Lu et al. 1996) Bm5 cells were maintained in IPL-41 (Gibco) + 10% fetal bovine serum. For transfection, cells were seeded into 35mm diameter dishes at a density of 106 cells/well, allowed to adhere, and transfected with 0.5 mL of basal media containing 3 micrograms plasmid DNA and 15 microgram Lipofectin (Gibco) for 5 hours according to manufacturers instructions. Cells and supernatant were harvested for analysis 2 days following transfection.
The extracellularly expressed CAT was detected by western blotting (Sambrook 1989) the culture supernatants, using an antibody recognizing CAT. Aliquots of cells or cell culture supernatants were resolved by electrophoresis in a SDS-containing 8 %
polyacrylamide gel (SDS-PAGE) and electroblotted onto Hybond-ECL membrane (Amersham). After transfer, the membrane was blocked for 1 hour at room temperature in 50 ml PBS-0.1 % Tween-20 (PBST) containing 10% (w/v) skim milk S powder (PBSTM). The filter was incubated for 1 hour at room temperature in S
mL
PBSTM containing rabbit polyclonal anti-CAT antibody (5 Prime-3 Prime, Inc., 1:1000 dilution), washed twice for 15 minutes with PBST, and incubated 1 hour with SmL
PBSTM containing horseradish peroxidase conjugated goat anti-rabbit IgG (Life Technologies; 1:1000 dilution). After washing twice with PBST, the filter was incubated with ECL chemiluminescent substrate (Amersham) according to the suppliers' instructions and exposed to X-ray film.
Figure 2B shows that no CAT was detected in either the supernatant of cells transfected with mock plasmid DNA or cells transfected with a plasmid expressing CAT or cells transfected with a plasmid expressing the spacer plus the CAT
gene, or cells transfected with a plasmid expressing JHE. CAT was detected in the supernatant of cells transfected with plasmid plEl l153A.JHE. HisEP. CAT ("secretion module").
Therefore, the naturally secreted protein JHE can be employed to drag a non-secretion competent polypeptide, such as CAT, into an extracellular environment.
E~~nple 2 Liberation of the CAT nentide from the fusion rn otein To demonstrate that the CAT protein could be liberated from the expressed fusion protein culture, supernatant from the culture described in Example 1 was dialyzed against enteropeptidase buffer, and incubated with porcine intestine enteropeptidase [ICN Biopharmaceuticals Canada Ltd.] for 36 hours at 37°C (Kell 1971). Figure 2C is a western blot of an enteropeptidase digested sample, using the anti-CAT antibody (S Prime-3 Prime, Inc. 1:1000 dilution) which shows that some CAT was successfully liberated from the fusion protein.
The intracellular protein Bombyx mori chorion factor 1 (BmCFl) is naturally found in the nucleus of some Bombyx mori insect cells. The module for secretion of BmCFI is shown in Figure 3A.
A 3.8 kb NotI fragment of pBmCFI (Tzertziniz et al, 1994) containing the BmCFl open reading frame was ligated into the unique NotI site of plEll153A to form plEl l153A.BmCFl.
The plasmid plEll153A.JHE.HisEP.BmCFI was generated in several stages.
(i) First 2 oligonucleotides were synthesized (5' to 3') coding for region II
in Figure 3A:
I. S'- AAAGGATCCA ATG CCA CAT CAT CAT CAT CAT CAT GGC GGC
GGC -3' II. 5'- AAAAGC ATG CCC TGG GTC CTT GTC GTC GTC GTC GCC GCC
GCC -3' These oligonucleotides were annealed together, endfilled by mutually primed synthesis with Klenow enzyme, double digested with BamHI and SphI and Iigated into pBluescript-SK+ (Stratagene) to yield pHisEP (Sphl).
(ii) The following 2 oligonucleotides were synthesized (5' to 3') to obtain region III in Figure 3A:
I. 5'- TGTGGGCATGCAGAGCGTGGCGAAG -3' II. 5'- CGACATTCAAATCTAGAATAAGTCCCCCTAC -3' PCR amplification using Pfu polymerase from pBmCFI plasmid DNA yielded a 1.5 kb product containing the BmCFI open reading frame that was completely digested with XbaI and partially digested with SphI and ligated in-frame into the unique SphI/XbaI sites of pHisEP (Sphl) to yield pHisEP.BmCFl.
(iii) The PCR product containing the JHE ORF (with no stop codon), described in Eample 1, was ligated in-frame into the unique BamHI site of pHisEP.BmCFI to yield pJHE.HisEP.BmCFl.
(iv) A partial BamHI digestion and complete NotI digestion of pJHE. HisEP. BmCFl released a 2.6 kb fragment containing the complete secretion module (regions I, II and III in Figure 3A) that was ligated into the unique BamHI/NotI
sites of plEll153A to yield plElll53A.JHE.HisEP.BmCFl.
Control DNA for the experimental demonstration of the secretion of BmCFI
was the expression plasmid plEll153A ("mock DNA"); the expression plasmid with the complete BmCFl gene, plEll153A.BmCFl ("BmCFI "), and the expression plasmid with the complete JHE gene, plEll153A.JHE ("JHE") in Figure 3B.
Each plasmid was transfected into Bombyx mori insect host cells in in vitro cultures as set forth in Example 1. Intracellular and extracellular expressed BmCFl was detected by western blotting using mouse monoclonal anti-BmCFl (provided by Dr. F.C. Kafatos, Harvard University, Boston, Massachusetts; 1:100 dilution) and horse-radish peroxidase conjugate goat anti-mouse antibody [Life Technologies;
1:1000 dilution) by the methods set forth in Example 1.
The western blot, shown in Figure 3B reveals that the normally intracellular protein BmCFI was only detected in the supernatant of cells transfected with the pIEI/153A.JHE.HisEP.BmCFl, ("secretion module") described in Figure 3A.
While the present invention has been described with reference to what are considered to be the preferred examples, it is to be understood that the invention is not limited to the disclosed examples. To the contrary, the invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.
REFERENCES
All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
U.S. Patent Application No. 08/608,617 Bonning and Hammock, (1996) Ann. Rev. Entomol. 41:191-210 Brinster et al., (1988) Proc. Natl. Acad. Sci. U.S.A. 85:836-840 Davis and Wood (1995) "Intrinsic glycosyiation potentials of insect cell cultures and insect larvae" in vitro Cell. Dev. Biol.
Garnier et al., (1994) Cryotech 15(1-3):145-155 Hanzlik et al., (1989) J. Biol. Chem.264:12419-12425 Huybrechts et al. (1992) "Nucleotide sequence of a transactivating Bombyx mori nuclear polyhedrosis virus immediate early gene" Biochim. Bioph. Acta.
1129:328-330 Jarvis and Summers, (1989) "Glycosylation and secretion of human tissue plasminogen activator in recombinant baculovirus-infected cells. " Mol Cell Biology 9:214-223 Johnson et al. , ( 1992) "A cellular promoter-based expression cassette for generating recombinant baculoviruses directing rapid expression of passenger genes in infected insects" Virology 190:815-823 Kell ( 1971 ) in The Enzymes, Academic Press, 3:249-275 Kroll et al., (1993) DNA and Cell Bio. 12:441-453 Kunkel (1985) Proc. Nat. Acad. Sci U.S.A. 82:488-492 Lu et al. , ( 1996)"trans-activation of a cell housekeeping gene promoter by the IE1 gene product of baculoviruses" Virology 218:103-113 Maiorella et al. (1988) "Large scale insect culture media for recombinant protein production" BiolTechnology 6:1406-1410 Martens et al., (1995) "Characterization of baculovirus insecticides expressing tailored Bacillus thuringiensis CrylA(b) crystal proteins" J. of Invertebrate Pathology 66:249-157 Mounier and Prudhomme, (1986) Biochimie 68:1053-1061 O'Reilly et al., (1992) Baculovirus Expression Vectors. W.H. Freeman and Co.
Sambrook et al., (1989) In Molecular Cloning, A laboratory Manual Cold Spring Harbor Press.
Tzertziniz et al, (1994) J. Mol. Biol. 238:479-486
Claims (17)
1. An expression cassette useful for the secretion of a heterologous protein from eukaryotic cells comprising a DNA sequence encoding a promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein.
2. The expression cassette of Claim 1 wherein the promoter is selected from the group consisting of a viral promoter, an insect cellular promoter or a mammalian promoter.
3. The expression cassette of Claim 1 further comprising a DNA sequence encoding an enhancer functionally linked to the promoter.
4. The expression cassette of Claim 2, wherein the enhancer is a viral enhancer.
5. The expression cassette of Claim 1 wherein the juvenile hormone esterase gene is linked in frame to the gene encoding the heterologous protein by a linking sequence.
6. A vector useful for the secretion of a heterologous protein from eukaryotic cells comprising an expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein.
7. The vector of Claim 6 wherein the promoter is selected from the group consisting of a viral promoter, an insect cellular promoter or a mammalian promoter.
8. The vector of Claim 6 further comprising a DNA sequence encoding an enhancer functionally linked to the promoter.
9. The vector of Claim 6, wherein the enhancer is a viral enhancer.
10. The vector of Claim 6, further comprising a selectable marker gene.
11. A cell transformed with the expression cassette of Claim 1.
12. The cell of Claim 11 wherein the cell is a eukaryotic cell.
13. A method of secreting a heterologous protein, comprising introducing into a cell an expression cassette comprising a DNA sequence encoding a promoter functionally linked to a DNA sequence coding for the juvenile hormone esterase gene which is linked in frame to a gene coding for the heterologous protein under conditions wherein the heterologous protein is expressed and secreted from the cell.
14. The method of Claim 13 wherein the promoter is selected from the group consisting of a viral promoter, an insect cellular promoter or a mammalian promoter.
15. The method of Claim 13 wherein the expression cassette further comprises a DNA sequence encoding an enhancer functionally linked to the promoter.
16. The method of Claim 15, wherein the enhancer is a viral enhancer.
17. The method of Claim 13 wherein the juvenile hormone esterase gene is linked in frame to the gene encoding the heterologous protein by a linking sequence.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US5687197P | 1997-08-21 | 1997-08-21 | |
| US60/056,871 | 1997-08-21 | ||
| PCT/CA1998/000796 WO1999010489A1 (en) | 1997-08-21 | 1998-08-21 | Insect sequences for improving the efficiency of secretion of non-secreted proteins in eukaryotic cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2301334A1 true CA2301334A1 (en) | 1999-03-04 |
Family
ID=22007076
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002301334A Abandoned CA2301334A1 (en) | 1997-08-21 | 1998-08-21 | Insect sequences for improving the efficiency of secretion of non-secreted proteins in eukaryotic cells |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US6037150A (en) |
| AU (1) | AU8848998A (en) |
| CA (1) | CA2301334A1 (en) |
| WO (1) | WO1999010489A1 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000050616A2 (en) * | 1999-02-24 | 2000-08-31 | University Technologies International Inc. | Sequences for improving the efficiency of secretion of non-secreted proteins from mammalian and insect cells |
| US20030064950A1 (en) * | 2001-02-23 | 2003-04-03 | Ntambi James M. | Methods for reducing body fat and increasing lean body mass by reducing stearoyl-CoA desaturase 1 activity |
| FR2848570B1 (en) | 2002-12-12 | 2005-04-01 | Bayer Cropscience Sa | EXPRESSION CASSETTE ENCODING A 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) AND HERBICIDE TOLERANT PLANTS CONTAINING THE SAME |
| JP4994241B2 (en) * | 2004-11-22 | 2012-08-08 | ニューヨーク・ユニバーシティ | Genetically engineered clostridial genes, proteins encoded by engineered genes, and uses thereof |
| US9315549B2 (en) | 2013-01-28 | 2016-04-19 | New York University | Treatment methods using atoxic neurotoxin derivatives |
| JP7017932B2 (en) | 2014-12-09 | 2022-02-09 | ニューヨーク・ユニバーシティ | Clostridium neurotoxin fusion proteins, propeptide fusions, their expression and usage |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5576195A (en) * | 1985-11-01 | 1996-11-19 | Xoma Corporation | Vectors with pectate lyase signal sequence |
| EP0832981A1 (en) * | 1987-02-17 | 1998-04-01 | Pharming B.V. | DNA sequences to target proteins to the mammary gland for efficient secretion |
| US5643776A (en) * | 1988-11-01 | 1997-07-01 | The Regents Of The University Of California | Insect diagnostic and control compositions |
| EP0455757B1 (en) * | 1989-08-04 | 1999-03-31 | GRANDICS, Peter | An integrated cell culture-protein purification system for the automated production and purification of cell culture products |
| US5155037A (en) * | 1989-08-04 | 1992-10-13 | The Texas A&M University System | Insect signal sequences useful to improve the efficiency of processing and secretion of foreign genes in insect systems |
| US5516657A (en) * | 1992-05-11 | 1996-05-14 | Cambridge Biotech Corporation | Baculovirus vectors for expression of secretory and membrane-bound proteins |
| US5547871A (en) * | 1993-01-25 | 1996-08-20 | American Cyanamid Company | Heterologous signal sequences for secretion of insect controlling proteins |
| WO1995017515A1 (en) * | 1993-12-23 | 1995-06-29 | University Technologies International Inc. | Methods of expressing proteins in insect cells and methods of killing insects |
| US5541087A (en) * | 1994-09-14 | 1996-07-30 | Fuji Immunopharmaceuticals Corporation | Expression and export technology of proteins as immunofusins |
-
1998
- 1998-08-20 US US09/136,421 patent/US6037150A/en not_active Expired - Lifetime
- 1998-08-21 WO PCT/CA1998/000796 patent/WO1999010489A1/en active Application Filing
- 1998-08-21 CA CA002301334A patent/CA2301334A1/en not_active Abandoned
- 1998-08-21 AU AU88489/98A patent/AU8848998A/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| US6037150A (en) | 2000-03-14 |
| AU8848998A (en) | 1999-03-16 |
| WO1999010489A1 (en) | 1999-03-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20030027257A1 (en) | Sequences for improving the efficiency of secretion of non-secreted protein from mammalian and insect cells | |
| US6090584A (en) | Baculovirus artificial chromosomes and methods of use | |
| US5244805A (en) | Baculovirus expression vectors | |
| Jarvis et al. | Use of early baculovirus promoters for continuous expression and efficient processing of foreign gene products in stably transformed lepidopteran cells | |
| AU631223B2 (en) | Improved baculovirus expression vectors | |
| Miller | Baculoviruses as gene expression vectors | |
| Tessier et al. | Enhanced secretion from insect cells of a foreign protein fused to the honeybee melittin signal peptide | |
| McCarroll et al. | Stable insect cell cultures for recombinant protein production | |
| US5516657A (en) | Baculovirus vectors for expression of secretory and membrane-bound proteins | |
| US5143905A (en) | Method and means for extending the host range of insecticidal proteins | |
| US6221632B1 (en) | Methods of expressing proteins in insect cells and methods of killing insects | |
| EP0155476A1 (en) | Production of polypeptides in insect cells | |
| AU736334B2 (en) | Insect expression vectors | |
| WO2003074714A1 (en) | Baculovirus expression system | |
| Shen et al. | Virus-free transient protein production in Sf9 cells | |
| CN102628062B (en) | Expression method of animal alpha interferon and gamma interferon | |
| US7135337B2 (en) | Insect expression vectors | |
| US6037150A (en) | Insect sequences for improving the efficiency of secretion of non-secreted proteins in eukaryotic cells | |
| EP1157120B1 (en) | Sequences for improving the efficiency of secretion of non-secreted proteins from mammalian and insect cells | |
| Taylor et al. | Carbohydrate-recognition domains as tools for rapid purification of recombinant eukaryotic proteins | |
| Van Oers et al. | Expression of the Autographa californica nuclear polyhedrosis virus p10 gene: effect of polyhedrin gene expression | |
| Atkinson et al. | Baculoviruses as vectors for foreign gene expression in insect cells | |
| KR19990076627A (en) | Preparation of Recombinant Baculovirus | |
| US20230063208A1 (en) | Baculovirus expression system | |
| AU4553393A (en) | Recombinant baculoviruses containing insect cellular promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |