CA2383367C - Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2 - Google Patents

Abstract

What is described is a recombinant poxvirus, such as avipox virus, containing foreign DNA from porcine circovirus (2). What are also described are immunological compositions containing the recombinant poxvirus for inducing an immunological response in a host animal to which the immunological composition is administered. Also described are methods of treating or preventing disease caused by porcine circovirus (2) by administering the immunological compositions of the invention to an animal in need of treatment or susceptible to infection by porcine circovirus (2).

Description

Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2.
FIELD OF THE INVENTION
The invention relates to methods and/or compositions for the prevention and/or treatment of PCV-2-caused myocarditis, and/or abortion and/or intrauterine infection, as well as pathologic sequelae including but not limited to post-weaning multisystemic wasting syndrome; and, to methods for preparing such compositions and kits for preparing such compositions or for performing such methods, inter alia.
BACKGROUND OF THE INVENTION
Porcine circovirus-2 (PCV-2) was recently identified as an agent that has been consistently associated with post-weaning multisystemic wasting syndrome (PMWS) in swine populations in several parts of the world (Allan et al. 1998; Ellis et al., 1998). Isolates of PCV-2 obtained from infected pigs in several countries are virtually identical genetically, and are distinctly different from the PCV (CCL33, PCV-1) that was originally identified in the 1970's as a noncytopathic contaminant of porcine kidney (PKJ15) cell line (Meehan et al.
1998; Tischer et al. 1974). Pigs with naturally acquired or experimentally induced PCV-2 infections present with progressive weight loss, tachypnea, dyspnea, and jaundice (Allan et al.
1998; Allan et al. 1999; Ellis et al. 1998; Ellis et al. 1999). Gross pathologic findings that have been directly associated with PCV-2 antigen include, lymphadenopathy, interstitial pneumonia, hepatitis and nephritis (Allan et al. 1998; Allan et al. 1999;
Ellis et al. 1998; Ellis et al. 1999). See also WO-A-99 18214, WO-A-00 01409, WO-A-99 29717 and WO-A-99 29871. PCV-2 has not heretofore been directly linked to abortion or lesions in fetal pigs.
Thus, heretofore, it has not been proposed to address the issue of PCV-2-caused myocarditis, and/or abortion and/or intrauterine infection.
OBJECTS AND SUMMARY OF THE INVENTION
It has surprisingly been found that PCV-2 is a causative agent of myocarditis, abortion and intrauterine infection, as well as post-weaning multisystemic wasting syndrome.
By definition, a PCV-2 immunogen is intended to encompass live attenuated or inactivated PCV-2, or subunit(s) from PCV-2 obtained by in vitro expression or by extraction, or fragment(s) comprising at least one epitope of interest which can be obtained by chemical synthesis or by in vitro recombinant expression, as well as recombinant vector(s) comprising and expressing in vivo sequence(s) or fragment(s) or epitope(s) of PCV-2 genome as herein disclosed or as in documents cited or referenced herein.
A similar definition applies for an immunogen of another porcine pathogen as disclosed herein.
By definition, an immunogenic composition elicits an immunogenic response -local or systemic. A vaccine composition elicits a local or systemic protective response. The term "immunogenic composition" include a "vaccine composition" (as the former term can be protective composition).
Thus, an object of the invention can be to provide methods and/or compositions for the prevention and/or treatment of PCV-2-caused myocarditis, and/or abortion and/or intrauterine infection, as well as post-weaning multisystemic wasting syndrome and/or pathologic sequelae including but not limited to post-weaning multisystemic wasting syndrome; and, methods for formulating such compositions (which compositions can also include a porcine parvovints (PPV) immunogen) and uses of a PCV-2 immunogen for foimulating such compositions.
Another object is also the use of PCV-2 immunogens to prepare compositions for prevention and/or treatment of PCV-2 caused myocarditis, and/or abortion, and/or intrauterine infection.
Another object of the invention is the isolation and characterisation of new strains identified 1103 (1103/1 P.2) and 1121 (1121/1 P.1), and their uses to produce immunogens, as well as antigens and antibodies for diagnostics, in relation with PCV-2-caused myocarditis, and/or abortion and/or intrauterine infection, as well as post-weaning multisystemic wasting syndrome and/or pathologic sequelae associated therewith.
The invention provides also for inoculation of female pigs (e.g., sows, gilts) with a composition comprising a (at least one) PCV-2 immunogen (which composition can also include an immunogen from porcine parvovirus) prior to breeding; and/or prior to serving, and/or during gestation (or pregnancy); and/or prior to the perinatal period or farrowing;
and/or repeatedly over a lifetime, to prevent myocarditis and/or abortion and/or intrauterine infection associated with PCV-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2; or, to elicit an immunogenic or protective response against PCV-2 and thereby prevent post-weaning multisystemic wasting syndrome and/or myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2 and/or other pathologic sequelae associated with PCV-2.
Advantageously, at least one inoculation is done before serving.
It is also advantageously followed by an inoculation to be perfoimed during gestation, e.g., at about mid-gestation (at about 6-8 weeks of gestation) and/or at the end of gestation (at about 11-13 weeks of gestation). Thus, an advantageous regimen is an inoculation before serving and a booster inoculation during gestation. Thereafter, there can be reinoculation before each serving and/or during gestation at about mid-gestation (at about 6-8 weeks of gestation) and/or at the end of gestation (at about 11-13 weeks of gestation). Preferably, reinoculation can be during gestation only.
In another preferred embodiment, piglets, such as piglets from vaccinated females (e.g., inoculated as herein discussed), are inoculated within the first weeks of life, e.g., inoculation at one and/or two and/or three and/or four and/or five weeks of life. More preferably, piglets are first inoculated within the first week of life or within the third week of life (e.g., at the time of weaning). Even more advantageous, such piglets are then boosted two (2) to four (4) weeks later (after being first inoculated). Thus, both offspring, as well as female pig (e.g., sow, gilt) can be administered compositions of the invention and/or can be the subject of performance of methods of the invention.
Thus, the invention comprehends immunogenic or vaccine compositions comprising immunogen(s) from PCV-2 strain(s) 1103 and/or 1121, for preventing or treating myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2.
And, the invention further comprehends uses of a PCV-2 immunogen to formulate an immunogenic or vaccine composition for preventing or treating myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2.
Further still, the invention comprehends an immunogenic or vaccine composition for the prevention and/or treatment of PCV-2-caused myocarditis, and/or abortion and/or intrauterine infection and/or post-weaning multisystemic wasting syndrome comprising a pharmaceutically or veterinarily acceptable carrier and/ or vehicle and/or excipient and/or adjuvant, and a PCV-2 immunogen.
The composition can additionally include at least one immunogen from at least one additional pig pathogen, e.g.: Porcine Reproductive and Respiratory Syndrome (PRRS), Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, E. coli, Bordetella bronchiseptica, Pasteurella multocida, Erysipelothrix rhusiopathiae, Pseudorabies, Hog cholera, Swine Influenza, and Porcine Parvovirus (PPV). Thus, vector-based compositions can include at least one immunogen from at least one additional pig pathogen, such as a vector expressing a sequence from this pathogen, wherein the vector can also be the vector expressing the PCV-2 immunogen. The vector expressing a PCV-2 sequence can comprise a PCV-2 sequence or fragment ; and the invention comprehends such nucleic acid molecules, vectors containing them, compositions comprising such nucleic acid molecules or vector expression products from such nucleic acid molecules, compositions comprising such expression products, probes or primers for such nucleic acid molecules, and methods for making and using any or all of the foregoing.
= The vector can comprise a DNA vector plasmid, a bacteria such as an E.
coli, a virus such as baculovirus, a herpesvirus including pig herpes viruses, including Aujeszky's disease virus, an adenovirus including a porcine adenovirus, a poxvirus, including a vaccinia virus, an avipox virus, a canarypox virus, a racoonpox and a swinepox virus, and the like. The vector-based compositions can comprise a vector that contains and expresses an ORF
selected from the group consisting of ORFs 1 to 13, such as an ORF selected from ORFs 4, 7, 10 and 13;
preferably ORFs 4 and/or 13, of a PCV-2, advantageously of any one of the PCV-2 strains identified herein and in particular of strains 1103 and/or 1121. And, the immunogen in compositions (either PCV-2 and/or from another pig pathogen) can be recombinantly produced.
The word plasmid is intended to include any DNA transcription unit in the form of a polynucleotide sequence comprising the PCV sequence to be expressed.
Advantageously, the plasmid includes elements necessary for its expression; for instance, expression in vivo. The circular plasmid form, supercoiled or otherwise, is advantageous; and, the linear form is also included within the scope of the invention. The plasmid immunogenic or vaccine composition can be administered by way of a gene gun, intradermally via an needleless injector, subcutaneously or intramuscularly, or by mucosal route, or by any other means that allows for expression in vivo, and advantageously an immunogenic or protective response.
It is noted that the expression product generated by vectors or recombinants in this invention optionally can also be isolated and/or purified from infected or transfected cells; for instance, to prepare compositions for administration to pigs; however, in certain instances, it may be advantageous not to isolate and/or purify an expression product from a cell; for instance, when the cell or portions thereof enhance the immunogenic effect of the polypeptide.
And, techniques for protein purification and/or isolation are known and can be used, without undue experimentation, to purify and/or isolate recombinant or vector expression products and/or subunits of PCV-2 and/or other pig pathogens, in the practice of the invention ; such techniques, in general, can include: precipitation by taking advantage of the solubility of the protein of interest at varying salt concentrations, precipitation with organic solvents, polymers and other materials, affinity precipitation and selective denaturation; column chromatography, including high performance liquid chromatography (HPLC), ion-exchange, affinity, immunoaffinity or dye-ligand chromatography; immunoprecipitation, gel filtration, electrophoretic methods, ultrafiltration and isoelectric focusing, and their combinations, inter alia.
The invention further envisages methods for the prevention and/or treatment of porcine circovirus-2 (PCV-2)-caused myocarditis, and/or abortion and/or intrauterine infection and/or post-weaning multisystemic wasting syndrome and/or other pathologic sequelae associated with PCV-2 comprising inducing an immunogenic or protective response against PCV-2 in a pig comprising administering to the pig an aforementioned or herein disclosed composition.
Thus, the invention comprehends a method for the prevention and/or treatment of porcine circovirus-2 (PCV-2)-caused myocarditis, and/or abortion and/or intrauterine infection and/or post-weaning multisystemic wasting syndrome and/or other pathologic sequelae associated with PCV-2 comprising inducing an immunogenic or protective response against PCV-2 in a pig comprising administering to the pig a composition comprising a pharmaceutically or veterinarily acceptable carrier or excipient or vehicle, with preferably an adjuvant, and an active agent comprising a PCV-2 immunogen. The method can be for the prevention of PCV-2-caused mycarditis and/or abortion and/or intrauterine infection comprising administering a composition comprising a pharmaceutically or veterinarily acceptable carrier and a PCV-2 immunogen. The PCV-2 immunogen can be an attenuated live whole PCV-2 or inactivated PCV-2. The method can involve a composition that is a subunit immunogenic, or vaccine composition. The method can involve the composition additionally including at least one immunogen from at least one additional pig pathogen , including a vector expressing such an immunogen or epitope; e.g., the at least one additional pig pathogen can be selected from the group consisting of PRRS, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, E. coli, Pseudorabies, Hog cholera, Bordetella bronchiseptica, Pasteurella multocida, Erysipelothrix rhusiopathiae, Swine Influenza, and PPV
and combinations thereof. The method can involve a vector that is a DNA vector plasmid, a bacteria such as an E. coli, a virus such as baculovirus, a herpesvirus including Aujeszky's disease virus, an adenovirus including a porcine adenovirus, a poxvirus, including a vaccinia virus, an avipox virus, a canarypox virus, and a si.vinepox virus, and the like. The method can involve a vector-based composition additionally including at least one sequence, fragment or epitope from at least one additional pia pathogen, or a vector expressing such a sequence, fragment or epitope, wherein the vector can also be the vector expressing the PCV-2 sequence, fragment or epitope. The method can involve a vectOr that contains and expresses an ORF
selected from the group consisting of ORFs 1 to 13, e.g., an ORF selectred from ORFs 4, 7, 10 and 13; preferably ORFs 4 and/or 13. The method can also involve an immunogen -based composition wherein one or more of the immunogen(s) is recombinantly produced.
In this method, females and/or piglets are preferably inoculated as described above.
In another embodiment, the invention involves a method for preparing any of the aforementioned or herein disclosed compositions comprising admixing the phaimaceutically or veterinarily acceptable carrier and possibly the adjuvant, and the PCV-2 immunogen. The method can further include transfecting or infecting a cell or host with a recombinant vector that contains DNA encoding a PCV-2 immunogen and expresses that immunogen; and optionally purifying and/or isolating the immunogen from the cell. Similarly the method can include isolating and/or purifying a PCV-2 immunogen from PCV-2, or isolating PCV-2 from a sample.
The invention also provides a kit for preparing any of the aforementioned or herein disclosed compositions or for performing any of the aforementioned or herein disclosed methods comprising in a first container the pharmaceutically or veterinarily acceptable carrier or vehicle or excipient and in a second container the active agent comprising the PCV-2 immunogen, wherein the first and second containers are optionally packaged together, and the kit optionally includes instructions for admixture of ingredients of the composition and/or administration of the composition.
In yet another embodiment, the invention provides for administering any of the aforementioned or herein disclosed compositions to male and/or female pigs; to prevent transmission of PCV-2 and prevent or treat or control myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2.
Administration is preferably done as described above.
Accordingly, in one aspect, the invention relates to the use of an immunogenic composition in the manufacture of a medicament for reducing the viral load of porcine circovirus-2 (PCV-2) in the mesenteric nodes of a pig; wherein said immunogenic composition comprises a PCV2 immunogen and at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; wherein said PCV-2 immunogen is an inactivated PCV-2; an attenuated PCV-2; or capable of being expressed from a first vector comprising a DNA fragment containing a first nucleotide sequence encoding ORE
13 of PCV-2.
In another aspect, the invention relates to the use of: a) a first DNA
plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
and b) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; in the manufacture of a medicament for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig.
In another aspect, the invention relates to the use of: a) a first DNA
plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
b) a second DNA plasmid vector comprising a second nucleotide sequence encoding of PCV-2; and c) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; in the manufacture of a medicament for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig.
In another aspect, the invention relates to the use of an immunogenic composition for reducing the viral load of porcine circovirus-2 (PCV-2) in the mesenteric nodes of a pig; wherein said immunogenic composition comprises a PCV2 immunogen and at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; wherein said PCV-2 immunogen is an inactivated PCV-2; an attenuated PCV-2; or capable of being expressed from a first vector comprising a DNA fragment containing a first nucleotide sequence encoding ORE 13 of PCV-2.
In another aspect, the invention relates to the use of: a) a first DNA
plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
and b) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; for reducing the viral load of PCV-2 in the mesenteric nodes of a pig.
In another aspect, the invention relates to the use of: a) a first DNA
plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
b) a second DNA plasmid vector comprising a second nucleotide sequence encoding of PCV-2; and c) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; for reducing the viral load of PCV-2 in the mesenteric nodes of a pig.
7a = CA 02383367 2012-09-26 In another aspect, the invention relates to an immunogenic composition for use in reducing the viral load of porcine circovirus-2 (PCV-2) in the mesenteric nodes of a pig; wherein said immunogenic composition comprises a PCV2 immunogen and at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant; wherein said PCV-2 immunogen is an inactivated PCV-2; an attenuated PCV-2; or capable of being expressed from a first vector comprising a DNA fragment containing a first nucleotide sequence encoding ORF
13 of PCV-2.
In another aspect, the invention relates to an immunogenic composition for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig wherein said immunogenic composition comprises: a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2; and b) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant.
In another aspect, the invention relates to an immunogenic composition for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig wherein said immunogenic composition comprises: a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2; b) a second DNA plasmid vector comprising a second nucleotide sequence encoding ORF4 of PCV-2; and c) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant.
In another aspect, the invention relates to a first plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV-2 for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig.
The term "comprising" in this disclosure can mean "including or can have the meaning commonly given to the term "comprising" in U.S. Patent Law.
7b Other aspects of the invention are described in or are obvious from (and within the ambit of the invention) the following disclosure.
DETAILED DESCRIPTION
Porcine circovirus-2 (PCV-2) is an agent associated with post-weaning multisystemic wasting syndrome (PMWS) in swine populations. As shown in Examples 1 and 2, the potential spectrum of disease associated with PCV-2 is expanded by evidence of vertical transmission and associated reproductive failure.
In particular, Example 1 shows that PCV-2 was isolated from a litter of aborted piglets from a farm experiencing late term abortions and stillbirths.
Severe, diffuse myocarditis was present in one piglet associated with extensive immunohistochemical staining for PCV-2 antigen. Variable amounts of PCV-2 antigen were also present in liver, lung and kidney of multiple fetuses. The presence of other agents that have been associated with fetal lesions and abortion in swine including porcine parvovirus, porcive reproductive respiratory syndrome virus, encephalomyocarditis virus and enterovirus could not be established.
More in particular, Example 2 shows that tissues obtained from 30 high health herds over a four-year period, and tested in routine cases of abortion or reproductive failure, were positive for PCV 2 in two submissions involving several stillborn piglets and non-viable neonates presenting with severe diffuse myocarditis, cardiac hypertrophy and evidence of 7c chronic passive congestion. The two positive submissions were from the same farm, but occurred at two different times. The presence of PCV-2 in the hearts and other tissues of affected piglets was confirmed by immunohistochemistry and virus isolation.
Failure to detect porcine circoviruses in cases of reproductive failure prior to 1999 in areas of endemic infections supports the view that reproductive disease is a new clinical manifestation of PCV-2 infection, and further suggests that sexual, as well as vertical, modes of transmission are responsible for viral dissemination in the pig population.
Accordingly, inoculation of pigs, e.g., female pigs, such as sows or gilts, with a composition including at least one PCV-2 immunogen (e.g. from at least one strain chosen among strains Imp1008, Imp1010, Imp999, Irnp1011-48285, Imp1011-48121, 1103 and 1121) (which composition can also include at least one immunogen from at least one other porcine pathogen such as at least one porcine parvovirus, wherein when a vector is used the vector can co-express both the PCV-2 immunogen(s) and the at least one immunogen of the at least one other porcine pathogen, e.g., PPV immunogen(s), inter alia), in particular in a schedule of immunization as described above, can prevent myocarditis and/or abortion and/or intrauterine infection associated with PCV-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2.
Thus, the invention involves methods and compositions using PCV-2 immunogen for preventing myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2. In particular, immunogen from strain 1103 and/or strain 1121 is useful for methods and compositions using PCV-2 immunogen for preventing myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2.
The invention also involves the use of any known PCV-2 strain or immunogen therefrom to formulate an immunogenic or vaccine composition for preventing or treating myocarditis and/or abortion and/or intrauterine infection associated with PCV-2, as well as post-weaning multisystemic syndrome and other pathologic sequelae associated with PCV-2 (these strains include strains Imp1008, Imp1010, Imp999, Imp1011-48285, Imp1011-48121, 1103 and 1121), in particular when the composition is intended to be administered to piglets such as to piglets from vaccinated females and more particularly to female pigs, in particular to pregnant females or females which will be subjected to serving ; and more particularly according to the inoculation schemes define above.
More particularly, the use is to formulate such compositions intended to prevent or treat myocarditis and/or abortion and/or intrauterine infection associated with PCV-2, in particular when the composition is intended to be administered to piglets such as to piglets from vaccinated females and more particularly to female pigs in particular to pregnant females or females which will be subjected to serving ; and more particularly according to the inoculation schemes defined above.
The at least one immunogen from at least one other porcine pathogen can be as used in known porcine vaccines or immunogenic compositions, or as in WO 98/03658.
Compositions for use in the invention can be prepared in accordance with standard techniques well known to those skilled in the veterinary or pharmaceutical or arts. Such compositions can be administered in dosages and by techniques well known to those skilled in the veterinary arts taking into consideration such factors as the age, sex, weight, condition and particular treatment of the pig, and the route of administration. The compositions can be administered alone, or can be co-administered or sequentially 'administered with other compositions of the invention (e.g., other compositions comprising a PCV-2 immunogen) or with other prophylactic or therapeutic compositions (e.g., other porcine immunogenic or vaccine compositions). Thus, the invention also provides multivalent or "cocktail" or combination compositions and methods employing them. In this regard, reference is made to U.S. Patent No. 5,843,456 directed to rabies compositions and combination compositions and uses thereof.
Compositions of the invention may be used for parenteral or mucosal administration, preferably by intradermal or intramuscular routes. In particular for intradermal route, injection can be done using a needleless injector. When mucosal administration is used, it is possible to use oral, nasal, or ocular routes.
In such compositions the immunogen(s) may be in a mixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose or the like, and/or preferably with an adjuvant. The compositions can also be lyophilized or frozen. The compositions can contain auxiliary substances such as pH buffering agents, adjuvants, preservatives, polymer excipients used for mucosal routes, and the like, depending upon the route of administration and the preparation desired.
Standard texts, such . as "REMLNIGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985, may be consulted to prepare suitable preparations, without undue experimentation. Suitable dosages can also be based upon the text herein and documents cited herein.
Adjuvants are substances that enhance the immune response to immunogens.
Adjuvants, can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, water-in-oil emulsion, oil-in-water emulsion, water-in-oil-in-water emulsion.
The emulsion can be based in particular on light liquid paraffin oil (European Pharmacopea type); isoprenoid oil such as squalane or squalene: oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di(caprylate/caprate), glyceryl tri(caprylate/caprate) or propylene glycol dioleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to fonu the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycerol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L121. See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart-Tull, D.E.S.). John Wiley and Sons, NY, pp51-94 (1995) and Todd et al., Vaccine 15:564-570 (1997).
For example, it is possible to use the SPT emulsion described on page 147 of "Vaccine Design, The Subunit and Adjuvant Approach" edited by M. Powell and M. Newman, Plenum Press, 1995, and the emulsion MF59 described on page 183 of this same book.
For example the adjuvant-containing vaccine is prepared in the following way:
67%
v/v of aqueous phase comprising the immunogen are emulsified in 2,3% w/v of anhydromannitol oleate, 2,6% w/v of oleic acid ethoxylated with 11 EO
(ethylene oxide) and 28,1% v/v of light liquid paraffin oil (European Phaimacopea type) with the aid of an emulsifying turbomixer.

An alternative method for preparing the emulsion consists in emulsifying, by passages through a high-pressure homogenizer, a mixture of 5% w/v squalane, 2.5% w/v Pluronic0 L121, 0.2% w/v of an ester of oleic acid and of anhydrosorbitol ethoxylated with 20 E0, 92.3% v/v of the aqueous phase comprising the immunogen.
It is also possible to formulate with synthetic polymers (e.g.,homo- and copolymers of lactic and glycolic acid, which have been used to produce microspheres that encapsulate immunogens, see Eldridge et al., Mol. Immunol. 28:287-294 (1993), e.g., biodegradable microspheres), with cytokines such as IL-2 and IL-12 (see, e.g., U.S. Patent No. 5,334,379), and GMCSF, advantageously porcine GMCSF (granulocyte macrophage-colony stimulating factor; see, generally, U.S. Patents Nos. 4,999,291 and 5,461,663, see also Clark et al., Science 1987, 230:1229; Grant et al.. Drugs, 1992, 53:516), inter alia.
Certain adjuvants can be expressed in vivo with immunogen(s) and/or epitope(s); e.g., cytokines, GMCSF (see, e.g., Inumani and Takamatsu, Immunol. Cell. Biol., 1995, 73:474-76 concerning a plasmid encoding and expressing porcine GM-CSF).
A further instance of an adjuvant is a compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative.
Advantageous adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols.
These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Patent No. 2,909,462 which describes such acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol0 974P, 934P and 971P. Among the copolymers of maleic anhydride and alkenyl derivative, the copolymers EMAO (Monsanto) which are copolymers of maleic anhydride and ethylene, linear or cross-linked, for example cross-linked with divinyl ether, are preferred. Reference may be made to J. Fields et al., Nature, 186 : 778-780, 4 June 1960.

From the point of view of their structure, the polymers of acrylic or methacrylic acid and the copolymers EMAC) are preferably formed of basic units of the following formula:

_______________________________ (CH2) _____ C(C ¨
H2)y =
COOH COOH
in which:
R1 and R7, which are identical or different, represent H or CH3, x = 0 or 1, preferably x = 1; and y= 1 or 2, with x + y = 2.
For the copolymers EMA , x = 0 and y = 2. For the carbomers, x = y =1.
The dissolution of these polymers in water leads to an acid solution that will be neutralized, preferably to physiological pH, in order to give the adjuvant solution into which the immunogenic, immunological or vaccine composition itself will be incorporated. The carboxyl groups of the polymer are then partly in C00- form.

Preferably, a solution of adjuvant according to the invention, especially of carbomer, is prepared in distilled water, preferably in the presence of sodium chloride, the solution obtained being at acidic pH. This stock solution is diluted by adding it to the desired quantity (for obtaining the desired final concentration), or a substantial part thereof, of water charged with NaCl, preferably physiological saline (NaCL 9 g/l) all at once in several portions with concomitant or subsequent neutralization (pH 7.3 to 7.4), preferably with NaOH. This solution at physiological pH will be used as it is for mixing with the vaccine, which may be especially stored in freeze-dried, liquid or frozen form.
The polymer concentration in the final vaccine composition can be 0.01% to 2%
w/v, e.g., 0.06 to 1% w/v, such as 0.1 to 0.6% w/v.
From this disclosure and the knowledge in the art, the skilled artisan can select a suitable adjuvant, if desired, and the amount thereof to employ in an immunological, immunogenic or vaccine composition according to the invention, without undue experimentation.
The immunogenic or vaccine compositions according to the invention may be associated to at least one live attenuated, inactivated, or sub-unit vaccine, or recombinant vaccine (e.g. poxvirus as vector or DNA plasmid) expressing at least one immunogen or epitope of interest from at least one another pig pathogen.
Compositions in forms for various administration routes are envisioned by the invention. And again, the effective dosage and route of administration are deteimined by known factors, such as age, sex, weight and other screening procedures which are known and do not require undue experimentation. Dosages of each active agent can be as in herein cited documents and/or can range from one or a few to a few hundred or thousand micrograms, e.g., 1 mg to 1 mg, for a subunit immunogenic, or vaccine composition; and, 104 to 1010 TO:Dso advantageously 106 to 108 TCID50 for an inactivated (titre before inactivation) immunogenic, or vaccine composition. For a live attenuated immunogenic or vaccine composition, the dose can be between 101 and 108 TCID50 advantageously 103 and 106 TCID50.
Recombinants or vectors can be administered in a suitable amount to obtain in vivo expression corresponding to the dosages described herein and/or in herein cited documents.
For instance, suitable ranges for viral suspensions can be determined empiracally. The viral vector or recombinant in the invention can be administered to a pig or infected or transfected into cells in an amount of about at least 103 pfu; more preferably about 104 pfu to about 1010 pfu, e.g., about 105 pfu to about 109 pfu, for instance about 106 pfu to about 108 pfu, per dose, e.g. of about 2 ml. And, if more than one gene product is expressed by more than one recombinant, each recombinant can be administered in these amounts; or, each recombinant can be administered such that there is, in combination, a sum of recombinants comprising these amounts.
In plasmid compositions employed in the invention, dosages can be as described in documents cited herein or as described herein. For instance, suitable quantities of each plasmid DNA in plasmid compositions can be 1 1..tg to 2 mg, preferably 50 jig to lmg.
Documents cited herein regarding DNA plasmid vectors may be consulted by the skilled artisan to ascertain other suitable dosages for DNA plasmid vector compositions of the invention, without undue experimentation.
However, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable immunologenic response, can be determined by methods such as by antibody titrations of sera, e.g., by ELISA and/or = seroneutralization assay analysis and/or by vaccination challenge evaluation in pig. Such determinations do not require undue experimentation from the knowledge of the skilled artisan, this disclosure and the documents cited herein. And, the time for sequential administrations can be likewise ascertained with methods ascertainable from this disclosure.
and the knowledge in the art, without undue experimentation.
The PCV-2 immunogen can be obtained from PCV-2 or can be obtained from in vitro recombinant expression of PCV-2 gene(s) or portions or epitopes thereof.
Methods for making and/or using vectors (or recombinants) for expression can be by or analogous to the methods disclosed in: U.S. Patent Nos. 4,603,112, 4,769,330, 5,174,993, 5,505,941,-5,338,683, 5,494,807, 4,722,848, 5,942,235, 5,364,773, 5,762,938, 5,770,212, 5,942,235, 5,756,103, 5,766,599, 6,004,777, 5,990,091, 6,033,904, 5,869,312, 5,382,425, PCT
publications WO 94/16716, WO 96/39491, WO 95/30018, Paoletti, "Applications of pox virus vectors to vaccination: An update," PNAS USA 93:11349-11353, October 1996, Moss, "Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety,"
PNAS USA 93:11341-11348, October 1996, Smith et al., U.S. Patent No. 4,745,051 (recombinant baculovirus), Richardson, C.D. (Editor), Methods in Molecular Biology 39, "Baculovirus Expression Protocols" (1995 Humana Press Inc.), Smith et al., "Production of Huma Beta Interferon in Insect Cells Infected with a Baculovirus Expression Vector,"
Molecular and Cellular Biology, Dec., 1983, Vol. 3, No. 12, p. 2156-2165;
Pennock et al., "Strong and Regulated Expression of Escherichia coli B-Galactosidase in Infect Cells with a Baculovirus vector," Molecular and Cellular Biology Mar. 1984, Vol. 4, No. 3, p. 399-406;
EPA 0 370 573, U.S. application Serial No. 920,197, filed October 16, 1986, EP
Patent publication No. 265785, U.S. Patent No. 4,769,331 (recombinant herpesvirus), Roizman, "The function of herpes simplex virus genes: A primer for genetic engineering of novel vectors,"
PNAS USA 93:11307-11312, October 1996, Andreansky et al., "The application of genetically engineered herpes simplex viruses to the treatment of experimental brain tumors,"
PNAS USA 93:11313-11318. October 1996, Robertson et al. "Epstein-Barr virus vectors for gene delivery to B lymphocytes," PNAS USA 93:11334-11340, October 1996, Frolov et al., "Alphavirus-based expression vectors: Strategies and applications," PNAS USA
93:11371-11377, October 1996, Kitson et al., J. Virol. 65, 3068-3075, 1991; U.S. Patent Nos. 5,591,439, 5,552,143, WO 98/00166, allowed U.S. applications Serial Nos. 08/675,556, and 08/675,566 both filed July 3, 1996 (recombinant adenovirus), Grunhaus et al., 1992, "Adenovirus as cloning vectors," Seminars in Virology (Vol. 3) p. 237-52, 1993, Ballay et al.
EMBO Journal, vol. 4, p. 3861-65, Graham, Tibtech 8, 85-87, April, 1990, Prevec et al., J.
Gen Virol. 70, 429-434, PCT W091/11525, Feigner et al. (1994), J. Biol. Chem. 269, 2550-2561, Science, 259:1745-49, 1993 and McClements et al., "Immunization with DNA vaccines encoding glycoprotein D or glycoprotein B, alone or in combination, induces protective immunity in animal models of herpes simplex virus-2 disease," PNAS USA 93:11414-11420, October 1996. and U.S. Patents Nos 5,591,639, 5,589,466, and 5,580,859, as well as WO-A-90 11092, WO-A-93 19183, WO-A-94 21797, WO-A-95 11307, WO-A-95 20660, Tang et al., Nature _ 356, 152-154, 1992, and Furth et al. Analytical Biochemistry, 205, 365-368, 1992. relating to DNA expression vectors, inter alia. See also WO 98/33510; RI et al., Diabetologia, 41:736-739, 1998 (lentiviral expression system); Sanford et al., U.S. Patent No.
4,945,050; Fischbach et al. (Intracel), WO 90/01543; Robinson et al., seminars in IMMUNOLOGY, vol.
9, pp.271-283 (1997) (DNA vector systems); Szoka et al., U.S. Patent No. 4,394,448 (method of inserting DNA into living cells); McCormick et al., U.S. Patent No. 5,677,178 (use of cytopathic viruses); and U.S. Patent No. 5,928,913 (vectors for gene delivery), as well as other documents cited herein. A viral vector, for instance, selected from pig herpes viruses, such as Aujeszky's disease virus, porcine adenovirus, poxviruses, especially vaccinia virus, avipox virus, canarypox virus, and swinepox virus, as well as DNA vectors (DNA
plasmids) are advantageously employed in the practice of the invention .
The expression product from the PCV-2 gene(s) or portions thereof can be useful for generating antibodies such as monoclonal or polyclonal antibodies that are useful for diagnostic purposes. Similarly, expression product(s) from the PCV-2 gene(s) or portions thereof can be useful in diagnostic applications.
Further, one skilled in the art can determine an epitope of interest in a PCV-immunoaen, or in an immunogen of another porcine pathogen, without undue experimentation, from the disclosure herein and the knowledge in the art; see, e.g., WO
98/40500, regarding general information for determining an epitope of interest or an epitopic region of a protein, inter alia.
According to the invention, advantageous immunogenic or vaccine compositions are:
An immunogenic or vaccine composition, collected from a cell culture in vitro which has been infected with a purified preparation of PCV-2, such as a purified preparation of porcine circovirus selected from the group consisting of the preparations deposited at the ECACC
(European Collection of Cell Cultures, Centre for Applied Microbiology &
Research, Salisbury, Wiltshire SP4 OJG, UK), under the following references: accession No. V97100219 (strain Imp.1008) , No. V97100218 (strain Imp.1010) and accession No.
V97100217 (strain Imp.999) deposited October 2, 1997, accession No. V98011608(strain Imp.1011-48285) and No. V98011609 (strain Imp.1011-48121) deposited January 16, 1998, accession No.
00012710 (strain 1103) and No. 00012709 (strain 1121) deposited February 2, 2000, or an immunogenic or vaccine composition comprised of porcine circovirus produced on, and isolated from cell culture in vitro, these cells having been infected with a porcine circovirus capable of being isolated from a physiological sample or from a tissue sample, especially lesions, from a pig having the PMWS syndrome, e.g., such a composition wherein the porcine circovirus is produced on, and isolated from a pig kidney cell line, for instance, produced on, and isolated from PKJ15 cells free from contamination with PCV-1; or such a composition comprising or prepared from a culture extract or supernatant, collected from a cell culture in vitro which have been infected with a such a circovirus. Thus, porcine circovirus can be an immunogen. For instance, the vaccine or immunogenic composition can comprise the attenuated live whole immunogen (e.g., virus), advantageously, in a veterinarily or pharmaceutically acceptable vehicle or diluent and optionally a veterinarily or pharmaceutically acceptable adjuvant, as well as, optionally, a freeze-drying stabilizer. The immunogen (e.g., virus) can be inactivated and the vaccine or immunogenic composition can additionally and/or optionally comprise, a veterinarily or pharmaceutically acceptable vehicle or diluent and optionally a veterinarily or pharmaceutically acceptable adjuvant. The vaccine or immunogenic composition can comprise PCV-2 immunogens and/or immunogens of several porcine circoviruses (including PCV-2 or several strains of PCV-2, and including PCV-1), as well as optionally additional immunogens from another pig pathogen;
e.g, PRRS, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, E. coli, Pseudorabies, Hog cholera, Bordetella bronchiseptica, Pasteurella multocida, Erysipelothrix rhusiopathiae, Swine Influenza, PPV (see also WO-A-00 01409).
For the production of circovirus antigenic preparations, the circoviruses may be obtained after passage on cells, in particular cell lines, e.g. PKJ15 cells.
The culture . supernatants or extracts, optionally purified by standard techniques, may be used.
In the context of attenuated PCV, the attenuation may be carried out according to the customary methods, e.g. by passage on cells, preferably by passage on pig cells, especially cell lines, such as PK/15 cells (for example from 20 to 150, especially of the order of 40 to100, passages).
In the context of inactivated vaccine, the PCV, with the fractions which may be present, is inactivated according to techniques known to persons skilled in the art. The inactivation will be preferably carried out by the chemical route, e.g. by exposing the antigen to a chemical agent such as formaldehyde (formalin), paraformaldehyde, 13-propiolactone or ethyleneimine or its derivatives, and/or by physical treatment. The preferred method of inactivation will be herein the exposure to a chemical agent and in particular to ethyleneimine or to f3-propiolactone.
The immunogen in the vaccine or immunogenic composition can be expressed from a DNA fragment containing a PCV-2 nucleotide sequence or fragment thereof (advantageously encoding at least one epitope), e.g. selected from the group consisting of the sequences designated by the references SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, SEQ ID
No: 4, as well as SEQ ID No: 6 and SEQ ID No: 7, (Figures 1-4 and 6-7). The immunogen in the vaccine or immunogenic composition can be expressed from a DNA fragment containing an ORF selected from the group consisting of ORFs 1 to 13, such as ORFs 4, 7, 10 and 13, preferably ORFs 4 and/or 13, of a PCV-2 strain, in particular of one of the above identified strains (as designated in WO-A-99 18214 - see also table 1 hereinafter). Thus, the immunogen or a portion thereof, such as an epitope of interest can be obtained by in vitro expression thereof from a recombinant or a vector. The immunogen may be further purified and/or concentrated by the conventional methods.
The immunogen in the vaccine or immunogenic composition can be expressed in vivo by an expression vector comprising a DNA fragment containing a PCV-2 nucleotide sequence or fragment thereof (advantageously encoding at least one epitope), e.g.
selected from the group consisting of the sequences designated by the references SEQ ID No: 1, SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 6, as well as SEQ ID No: 6 and SEQ ID
No: 7, (Figures 1-4 and 6-7). Similarly, the immunogen in the vaccine, immunogenic or immunological composition can be expressed in vivo by an expression vector comprising a DNA fragment containing an ORF selected from the group consisting of ORFs 1 to 13, such as ORFs 4, 7, 10 and 13, preferably ORFs 4 and/or 13, of a PCV-2 strain, in particular of one of the above identified strains. That is, the vaccine or immunogenic composition can comprise and expression vector that expresses the immunogen or a portion thereof, e.g., an epitope of interest, in vivo.
The expression vector can be any suitable vector such as a vector selected from DNA
plasmids, bacteria such as E. coli, viruses such as baculovirus, herpesvirus such as Aujeszky's disease virus, adenovirus including porcine adenovirus, poxviruses, especially vaccinia virus, avipox virus, canarypox virus, and swinepox virus, inter alia (the one skilled in the art can also refer to the U.S. applications of Audonnet et al. and Bublot et al., Serial Nos. 60/138,352 and 60/138,478, respectively, both filed June 10, 1999, in particular to the detailed description and more particularly to the examples ("DNA VACCINE-PCV", and "PORCINE
CIRCO VIRUS RECOMBLNANT PDX VIRUS VACCINE", respectively, attached as appendices).
Accordingly, the invention also comprehends nucleic acid molecules and vectors containing them, as well as expression products therefrom, compositions comprising such nucleic acid molecules and/or vectors and/or expression products, as well as methods for making and using any or all of these embodiments. The invention especially encompasses herein ORFs and/or fragments encoding an immunogen or epitope, as well as nucleic acid molecules of strains 1103 and/or 1121, in particular their ORFs 1 to 13, such as ORFs 4,7, 10 and 13, preferably ORFs 4 and/or 13, and fragments thereof, as well as vectors comprising these nucleic acid molecules, compositions comprising these nucleic molecules, vectors, or expression products therefrom, compositions comprising such expression products, primers or probes for such nucleic acid molecules, and uses or methods involving these embodiments, e.g., for detecting, diagnosing, assaying for PCV-2, for inducing an immunogenic or protective response, and the like.
As earlier mentioned, embodiments of the invention can include antibodies.
Such antibodies can be polyclonal or monoclonal antibodies; for instance, prepared from the aforementioned circovirus, or from a polypeptide encoded by a DNA fragment having a PCV-2 sequence, e.g. selected from the group consisting of SEQ ID NOS. 1, 2, 3, 4, 6 and 7, (Figures 1-4 and 6-7) or from a polypeptide from expression by a vector comprising a PCV-2 sequence, e.g. selected from the group consisting of SEQ ID NOS. 1, 2, 3, 4, 6 and 7 ; or from a polypeptide from expression by a vector comprising DNA including an ORF
selected from the group consisting of ORFs 1 to 13. The skilled artisan may use techniques known in the art to elicit antibodies and to generate monoclonal or polyclonal antibodies.
Antibodies and antigens can be used in diagnostics.
The invention also comprehends probes or primers from PCV-2 strains 1103 and/or 1121 which can be useful, for instance, in detecting PCV-2 DNA, in particular with respect to myocarditis and/or abortion and/or intrauterine infection, as well as for amplifying PCV-2 DNA, e.g., for preparing an expression vector. A probe or primer can be any stretch of at least 8, preferably at least 10, more preferably at least 12, 13, 14, or 15, such as at least 20, e.g., at least 23 or 25, for instance at least 27 or 30 nucleotides in PCV-2 genome or a PCV-2 gene which are unique to PCV-2, and possibly to these strains, or which are in PCV-2 and are least conserved among the PCV or circovinis family. As to PCR or hybridization primers or probes and optimal lengths therefor, reference is also made to Kajimura et al., GATA
7(4):71-79 (1990). Hybridization is advantageously under conditions of high stringency, as the temi "high stringency" would be understood by those with skill in the art (see, for example, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Hames and Higgins, eds., 1985, Nucleic Acid Hybridization, IRL Press, . Oxford, U.K.).
Hybridization will be understood to be accomplished using well-established techniques, including but not limited to Southern blot hybridization, Northern blot hybridization, in situ hybridization and, advantageously, Southern hybridization to PCR-amplified DNA fragments.
Like probes or primers, peptides which are not full-length PCV-2 proteins are part of invention and can be any stretch of at least 8, preferably at least 10, more preferably at least 12, 13, 14, or 15, such as at least 20, e.g., at least 23 or 25, for instance at least 27 or 30 amino acids in PCV-2 which are unique to PCV-2, and possibly to these strains, or which are in PCV-2 and are least conserved among the PCV and/or circovirus family.
Alternatively or additionally, the amino acids of the invention which are not full length PCV-2 proteins can be an epitopic region of a PCV-2 protein.
PCV-2 sequences are disclosed in Meehan et al., 1998 (Strain Imp.1010 ; ORF1 nucleotides 398-1342; ORF2 nucleotides 1381-314; and correspond respectively to ORF4 and ORF13 in the invention terminology (see table 1), in U.S. application Serial No. 09/161,092 of September 1998 and to COL4 and COL13 in WO-A-9918214). Several PCV-2 strains and their sequences are disclosed herein and called Imp1008, Imp999, Imp1011-48285, Imp1011-48121, 1103 and 1121. Other strains are disclosed in A.L. Hamel et al.
J. Virol. June 20 1998, vol 72, 6: 5262-5267 (GenBank AF027217) and in I. Morozov et al.
J. Clinical Microb.
Sept. 1998 vol. 36, 9: 2535-2541, as well as GenBank AF086834, AF086835 and AF086836.
These sequences, or ORFs therefrom, or regions thereof encoding an antigen or immunogen or epitope of interest can also be used in the practice of this invention.
The invention also encompasses the equivalent sequences to those used or mentioned 25 herein and in documents cited herein; for instance, sequences that are capable of hybridizing to the nucleotide sequence under high stringency conditions (see, e.g., Sambrook et al. (1989).
Among the equivalent sequences, there may also be mentioned the gene fragments conserving the immunogenicity of the complete sequence, e.g., an epitope of interest.
The homology between the whole genome of PCV types 1 and 2 is about 75%. But within type 2, homology is generally above 95%. Thus, in the practice of the invention, use of any PCV-2 strain is encompassed by equivalence. A criteria can be that the strain is of type 2, e.g. that homology at the nucleotide level of the whole genome is equal or greater than 85%, advantageously 90% or greater, more advantageously 95% or greater, preferably 97, 98 or 99% or greater, with the strains disclosed herein, e.g. strain Imp1010.
Limits of the ORFs of strain Imp1010 are given in the following table 1:
Start End Strand Size of the ORF Protein size Name (nucleotides (nt)) (amino acids (aa)) ORF1 103 210 Sense 108 nt 35 aa ORF2 1180 1317 Sense 138 nt 45 aa ORF3 1363 1524 Sense 162 nt 53 aa ORF4 398 1342 Sense 945 nt 314 aa ORF5 900 1079 Sense 180 nt 59 aa ORF6 1254 1334 Sense 81 nt 26 aa ORF7 1018 704 Antisense 315 nt 104 aa ORF8 439 311 Antisense 129 nt 42 aa ORF9 190 101 Antisense 90 nt 29 aa ORF10 912 733 Antisense 180 nt 59 aa ORF11 645 565 Antisense 81 nt 26 aa ORF12 1100 1035 Antisense 66 nt 21 aa 0RF13 314 1381 Antisense 702 nt 213 aa The ORFs are defined with respect to strain Imp1010. The invention also encompasses _ the use of the corresponding ORFs in any other PCV-2 strain, and any of the PCV-2 strains as defined herein or in documents cited herein. Thus, from the genomic nucleotide sequence, it is routine art to detemine the ORFs using a standard software, such as MacVector . Also, alignment of genomes with that of strain 1010 and comparison with strain 1010 ORFs allows the one skilled in the art to readily determine the ORFs on the genome for another strain (e.g.
those disclosed in WO-A-99 18214, say Imp1008, Imp1011-48121, Imp1011-48285, Imp999, as well as the new strains 1103 and 1121). Using software or making alignment is not undue experimentation and directly provides access to these ORFs.

For example, referring to figures 6 and 7, the corresponding ORFs of strains 1103 and 1121 are as given in the following table 2 Start End Strand Size of the ORF Protein size Name (nucleotides (nt)) (amino acids (aa)) ORF1 1524 1631 Sense 108 nt 35 aa ORF2 833 970 Sense 138 nt 45 aa ORF3 1016 1177 Sense 162 nt 53 aa ORF4 51 995 Sense 945 nt 314 aa ORF5 553 732 Sense 180 nt 59 aa ORF6 907 987 Sense 81 nt 26 aa ORF7 671 357 Antisense 315 nt 104 aa ORF8 92 1732 Antisense 129 nt 42 aa ORF9 1611 1522 Antisense 90 nt 29 aa ORF10 565 386 Antisense 180 nt 59 aa ORF11 298 218 Antisense 81 nt 26 aa ORF12 753 688 Antisense 66 nt 21 aa ORF13 1735 1037 Antisense 702 nt 213 aa Also equivalent and useful in the practice of the invention are the nucleotide sequences which change neither the functionality nor the strain specificity (say of strain type 2) of the gene considered or those of the polypeptides encoded by this gene. The sequences differing through the degeneracy of the code are, of course, be included in the practice of the invention.
For ORF4, homology between PCV-1 and PCV-2 is about 86%, and for ORF13, the homology between PCV-1 and PCV-2 is about 66%. Thus, also equivalent sequences useful in the practice of the present invention, for ORF4, are those sequences having an homology equal or greater than 88%, advantageously 90% or greater, preferably 92% or 95% or greater homology with ORF4 of strain Imp1010, and for ORF13, those sequences having an homology equal or greater than 80%, advantageously 85% or greater, preferably 90% or 95%
or greater than ORF13 of strain Imp1010 (Using the terminology of table 1).
For homology regarding the other ORFs, one can determine those sequences which come from a PCV strain having an ORF4 and/or an ORF13 which have an homology as defined above with the corresponding ORF of strain 1010. For ORF7, sequences useful in the practice of the invention include those sequences having an homology that is advantageously equal to or greater than 80%, more advantageously 85% or greater, preferably 90% or 95% or greater with ORF7 of strain Imp1010. For ORF10, sequences useful in the practice of the invention include those sequences having an homology that is advantageously equal to or greater than 86%, more advantageously 90% or greater, preferably 95% or greater with ORF10 of strain Imp1010 (Using the terminology of table 1).
Also, equivalent sequences useful in the practice of this present invention, for ORF4 are those sequences having an homology equal or greater than 88%.
advantageously 90% or greater, preferably 92% or 95% or greater with ORF4 of strain Imp1010, and for ORF13, are those sequences haying an homology equal or greater than 80%, advantageously 85% or greater, preferably 90% or 95% or greater with ORF13 of strain Imp1010.
ORF4 and ORF13 has the potential to encode proteins with predicted molecular weights of 37.7 kD and 27.8 kD respectively. ORF7 and ORF10 (correspond to ORF3 and ORF4 in Meehan et al. 1998) has the potential to encode proteins with predicted molecular weights of 11.9 and 6.5 kD respectively. Sequences of these ORFs are also available in Genbank AF 055392. They can also be incorporated in plasmids and be used in accordance with the invention alone or in combination, e.g. with ORF4 and/or ORF13.
The other ORFs 1-3 and 5, 6, 8-9, 11-12 disclosed in the above table (COLs 1-3 and 5, 6, 8-9, 11-12 in WO-A-9918214), or region(s) thereof encoding an antigen or epitope of interest, may be used in the practice of this invention, e.g., alone or in combination or otherwise with each other or with the ORFs 4 and/or 13 or region(s) thereof encoding antigen(s) or epitope(s). Similarly, for homology, one can determine that there are equivalent sequences which come from a PCV strain having an ORF13 and/or an ORF4 which have an homology as defined above with the corresponding ORF of strain 1010 as defined herein or in Meehan et al., 1998. For ORF7, an equivalent sequence has homology thereto that is advantageously, for instance, equal or greater than 80%, for example 85% or greater, preferably 90% or 95% or greater with ORF7 of strain Imp1010. And, for ORF10, advantageously an equivalent sequence has homology that is equal or greater than 86%, advantageously 90% or greater, preferably than 95% or greater with ORF10 of strain Imp1010.
Nucleotide sequence homology can be determined using the "Align" program of Myers and Miller, ("Optimal Alignments in Linear Space", CABIOS 4, 11-17, 1988, and available at NCBI. Alternatively or additionally, the tem' "homology" or "identity", for instance, with respect to a nucleotide or amino acid sequence, can indicate a quantitative measure of homology between two sequences. The percent sequence homology can be calculated as (Nõf - Ndif)*100/Nõf , wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein N õf is the number of residues in one of the sequences. Hence, the DNA sequence AGTCAGTC will have a sequence similarity of 75%
with the sequence AATCAATC (Nõ = 8; Ndif2).
Alternatively or additionally, "homology" or "identity" with respect to sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman, 1983 PNAS USA 80:726, for instance, using a window size of nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., Intelligenetics TM
Suite, Intelligenetics Inc. CA).. When RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA
sequence is considered equal to uracil (13) in the RNA sequence.
RNA sequences within the scope of the invention can be derived from DNA
sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
Additionally or alternatively, amino acid sequence similarity or identity or homology can be determined using the BlastP program (Altschul et al., Nucl. Acids Res.
25, 3389-3402) and available at NCBI. The following references provide algorithms for comparing the relative identity or homology of amino acid residues of two proteins, and additionally or alternatively with respect to the foregoing, the teachings in these references can be used for determining percent homology or identity: Needleman SB and Wunsch CD, "A
general method applicable to the search for similarities in the amino acid sequences of two proteins,"
J. Mol. Biol. 48:444-453 (1970); Smith TF and Waterman MS, "Comparison of Bio-sequences," Advances in Applied Mathematics 2:482-489 (1981); Smith TF, Waterman MS
and Sadler JR, "Statistical characterization of nucleic acid sequence functional domains,"
Nucleic Acids Res., 11:2205-2220 (1983); Feng DF and Dolittle RF, "Progressive sequence alignment as a prerequisite to correct phylogenetic trees," J. of Molec.
Evol., 25:351-360 (1987); Higgins DG and Sharp PM, "Fast and sensitive multiple sequence alignment on a microcomputer," CABIOS, 5: 151-153 (1989); Thompson JD, Higgins DG and Gibson TJ, "ClusterW: improving the sensitivity of progressive multiple sequence alignment through sequence weighing, positions-specific gap penalties and weight matrix choice, Nucleic Acid Res., 22:4673-480 (1994); and, Devereux J, Haeberlie P and Smithies 0, "A
comprehensive set of sequence analysis program for the VAX," Nucl. Acids Res., 12: 387-395 (1984).
The invention further comprehends uses of a PCV-2 immunogen, either alone or in further combination with an immunogen of another porcine pathogen to generate'compositions according to the invention, e.g., admixing the ingredients; and, the invention also therefore comprehends kits wherein components are individually contained and optionally the containers are packaged together for admixture and/or administration, wherein the kit can also optionally include instructions for admixture and/or administration.
While the invention has been discussed in telins of administering to female pigs immunogenic or vaccine compositions comprising a PCV-2 immunogen, the invention can also comprehend administering such compositions to sow or gilt and/or to boar as described herein; Thus, both mother and offspring (e.g., sow, gilt) and boar can be administered_ compositions of the invention and/or can be the subject of performance of methods of the invention. Accordingly, populations of pigs can be administered compositions of the inventions and/or can be the subject of performance of methods of the invention.
According to the present invention, immunogenic and vaccine compositions may comprise immunogens from more than one PCV-2 strain. For example, it is possible to combine immunogens from strains 1121 and 1103, from one or both of these strains with at least one other strain disclosed herein, or any other combination.

The present invention provides for methods allowing the one skilled in the art to evaluate the efficacy of vaccines against PCV-2. A first method is an ELISA
method or with seroneutralization. A second. method is a vaccination followed by challenge with a virulent PCV-2 strain, e.g. one of the strains disclosed herein. In other words, the invention allows one to check for PCV immunogens, including PCV-1 immunogens, able to elicit an immunogenic or protective response against PCV-2. Such PCV immunogens are then useful to prevent or treat pigs against in particular myocarditis and/or abortion and/or intrauterine associated with PCV-2, as well as against PMWS and/or other pathologic sequelae associated therewith.
Thus one aspect of the invention is to provide immunogenic or vaccinal compositions comprising a PCV immunogen and able to elicit an immunogenic or protective response against PCV-2. The invention relates also to methods of immunization or vaccination using such an immunogen, as well as to the use of such an immunogen to produce such an immunogenic or vaccinal composition.
The invention shall be further described by way of the following Example And Results, provided for illustration and not to be considered a limitation of the invention.
Figure 1 depicts SEQ ID No. 1, the PCV DNA sequence of the genome of the Imp.
1011-48121 strain.
Figure 2 depicts SEQ ID No. 2, the DNA sequence of the genome of the Imp. 1011-48285 strain.
Figure 3 depicts SEQ ID No. 3, the DNA sequence of the genome of the Imp. 999 strain.
Figure 4 depicts SEQ Ill No. 4, the DNA sequence of the genome of the Imp.

strain.
Figure 5 depicts SEQ ID No. 5, the DNA sequence of the genome of the PK/15 strain.
Figure 6 depicts SEQ ID No. 6, the DNA sequence of the genome of the 1103 strain, isolated in Alberta, Canada. k means g (G) or t (T), y means c (C) or t (T).
These variations of sequence were observed in the viral population.
Figure 7 depicts SEQ ID No. 7, the DNA sequence of the genome of the 1121 strain, isolated in Saskatoon. Canada.

EXAMPLE AND RESULTS
EXAMPLE/RESULT 1: MYOCARDITIS, ABORTION AND INTRAUTERINE

Late term abortions and farrowings with both stillborn and mummified piglets occurred in a new 450-female pia swine facility as it was brought into production.
Pseudopregnancy was also observed in several gilts. Gilts received two doses of an inactivated vaccine containing parvovirus and leptospiral immunogens prior to breeding.
A litter received for postmortem examination consisted of nine fetuses that appeared to have died at various stages of gestation. There were 2 mummified, 2 macerated, 3 autolysed and 2 fresh, stillborn piglets. Lesions were observed on gross pathological examination in one partially autolysed fetus only. In this fetus both ventricles of the heart were dilated, the liver was enlarged and firm and there was both hydrothorax and ascites.
Histopathologically, there were extensive areas of myocardial degeneration or necrosis with edema and mild fibrosis, and a diffuse moderate -infiltration of lymphocytes and macrophages. There was marked generalized hepatic congestion and hepatocellular loss. The spleen and kidneys were also congested. Significant histological lesions were not detected in the other fetuses.
Immunohistochemical staining for PCV-2 was performed as previously described using a rabbit polyclonal antiserum and a monoclonal antibody that were raised against PCV-2. on sections of formalin-fixed, routinely processed and embedded tissue (Ellis et al., 1998;
Ellis et al., 1999). In the fetus with dilated cardiomyopathy there was extensive staining for PCV-2 antigen throughout the affected myocardium. Staining was most extensive in areas of necrosis and appeared to involve primarily myocytes. Both cytoplasmic and nuclear staining was present. In multiple fetuses there was extensive staining in the liver. In some sections it _ appeared to involve primarily sinusoidal endothelium and Kupfer cells, while in other fetuses, including the one with myocarditis, there was also nuclear and cytoplasmic staining of -hepatocytes. Positively stained cells were scattered throughout the lung, and multifocally in the kidney. Polymerase chain reaction for PCV-2 was performed as previously described using frozen tissue (Ellis et al., 1999). PCR product of the expected size for PCV-2 was amplified from fetal tissue. PCV-2 was isolated from the fetus with myocarditis and a pool of tissues from other fetuses in the litter by inoculating tissue homogenates onto PCV-free PK-15 cells.

Fetal tissues were also examined for other viral pathogens that have been associated with fetal injury and abortions in swine, including, porcine parvovirus (PPV), porcine reproductive and respiratory syndrome virus (PRRSV), encephalomyocarditis (EMCV), and enteroviruses. PPV antigen was not detected by fluorescent antibody testing (FAT) on frozen sections of lung, liver, and spleen from the mummified or stillborn fetuses.
Homogenates of liver, lung, and spleen from the aborted fetuses were also inoculated into cultures of PCV-free PK-15 cells, primary porcine fallopian tube cells and Vero cells. Cytopathic viruses were not detected after three passages. Tissues were negative for PPV using PCR. PRRSV
antigen was not detected by immunohistochemical staining.
Thus, there were fetal lesions and abortion directly associated with PCV-2.
These results also show vertical transmission of the virus.
In a previous study, PCV-1 was isolated from 2 of 160 pig fetuses examined, implying that this group of viruses can be vertically transmitted; however, PCV-1 antigen could not be associated with any lesions in the tissue (Allan et al., 1995). The exclusion of other agents that have been associated with fetal lesions and abortion in swine, including, PPV (Bolt et al., 1997; Molitor et al., 1991), PRRSV (Lager et al., 1996), EMCV (Kim et al., 1989), and.
enterovinis (Molitor et al., 1991) indicate that PCV-2 can cause significant fetal pathology and subsequent abortion.
However, PCV-1 immunogens (still according to the general definition given at the beginning) may elicit an immunogenic or protective response against myocarditis and/or abortion and/or intrauterine infection as well as post-weaning multisystemic wasting syndrome and ergo PCV-1 immunogens can also be used in the practice of this invention (e.g., in the methods, compositions, uses, etc.) - either alone or in conjunction with PCV-2 immunogens (the vector can contain and express DNA encoding for both a PCV-1 immunogen and/or epitope and a PCV-2 immunogen and/or epitope) and/or alone or in conjunction an immunogen and/or epitope of other porcine pathogen ( if a vector is used, the vector can contain and express DNA encoding for both a PCV-1 immunogen and/or epitope and an immunogen and/or epitope of another porcine pathogen, or for a PCV-1 immunogen and/or epitope and a PCV-2 immunogen and/or epitope and an immunogen and/or epitope of another porcine pathogen). Thus, one skilled in the art may alternatively or additionally use a PCV-1 immunogen, and/or epitope and/or vector encoding such an immunogen and/or epitope in the practice of this invention without any undue experimentation; for instance, to so do, one need only read the text herein prior to this Example and at the conclusion of (after) this Example, and substitute --PCV-1-- for "PCV-2" with any modification minor based on teachings herein.
The wasting syndrome associated with PCV-2 infection most often occurs in 5-12 week old pigs (Allan et al., 1998; Ellis et al., 1998). Experimental infection of neonatal swine indicates a relatively long prodromal period between infection and the development of clinical signs associated with PCV-2 (Allan et al. 1999; Ellis et al. 1999). The findings herein show that the virus is transmitted vertically or in the perinatal period. Not only may interuterine vertical transmission of PCV-2 result in abortion, but it is possible that subletha1ly in utero-infected piglets may be the animals that subsequently develop PIVIWS.
Furthermore, these results show that inoculation of female pigs with a composition comprising an PCV-2 immunogen (which composition can also include an immunogen from another porcine pathogen, e.g., porcine parvovirus), prior to breeding or serving, or prior to the perinatal period and/or during gestation can prevent myocarditis and/or abortion and/or intrauterine infection associated with porcine circovirus-2, as well as post-weaning multisystemic wasting syndrome and other pathologic sequelae associated with PCV-2, by eliciting an immunological response or antibodies against PCV-2.
Of course, compositions, methods, and other aspects of the invention can be used or practiced in animals other than pigs, e.g., sheep, bison, cattle, wild boar;
for instance, if PCV-2 infects such other animals.
EXAMPLE/RESULT 2: MYOCARDITIS, ABORTION AND INTRAUTERINE

The presence of PCV-2 in neonatal piglets suggests that vertical transmission may be an important means of viral transmission. This mode of transmission may be related not only to reproductive failure, but also to the development of multisystemic disease later in life. It is of interest to determine whether previously undetected PCV-2 (and PCV-1) has been vertically transmitted in pork producing areas where PMWS, and by extension PCV-2 infection, has been endemic for at least several years.
Thirty eight submissions involving reproductive failure received in the diagnostic laboratory at the Western College of Veterinary Medicine (WCVM), University of Saskatchewan, Saskatoon, Canada, over a four-year period from a total of 30 high health herds in Canada were evaluated. Five of the fauns from which the samples were obtained had diagnosed cases of PMWS. Twenty-seven of the thirty-eight submissions (71%) were classified as abortions; five of these (13%) also involved at least one mummified fetus. Of the remaining 10 cases: 5 involved stillborn piglets along, with nonviable piglets (13%); 2 with stillborn and one or more mummified feti (5%); 2 with only stillborn piglets (5%); and one with only mummified feti (2.5%). Routine diagnostics for pathogens other than circovinis revealed 4 cases (11%) in which the etiology was determined to be porcine parvovirus and 2 cases (5%) in which the etiology was determined to be of bacterial origin.
Gross necropsies were performed and tissues were collected and fixed in buffered formalin (fixation time 24-72 hrs) and, in most cases, fresh tissues were also submitted for routine microbiological evaluation. None of these cases had been previously tested for PCV-2.
The PCR technique used for the detection of PCV-1 and PCV-2 was perfoimed as previously described (Tischer et al. 1974). PCV-1 was not detected by PCR in any submissions comprising reproductive failure from the four-year period. PCV-2 was detected by PCR in two different submissions that originated from the same multi-site pork production unit on two separate occasions in the spring of the last year in the four-year period. The first of these submissions comprised a litter of piglets with gross evidence of myocarditis, cardiac hypertrophy, and chronic passive congestion.
Immunohistochemical identification of PCV-2 in tissues was performed as previously described (Tischer et al. 1974). Immunohistochemical staining (IHC) for PCV-2 was positive in hearts from all six of the piglets that were submitted. while 4 of 6 were positive by PCV-2 PCR (see following Table).
Table: Detection of PCV-2 in the formalin fixed hearts of porcine with myocarditis by PCR, IHC and viral isolation in cell culture.
PCV-2 postive tissues PCR IHC Virus Isolation Fixed 5/6 6/6 N/A
Frozen 4/4 N/A 2/4 The second submission from the same farm consisted of a litter of four piglets in which 2 were stillborn and 2 others died shortly after birth. All four piglets also had gross evidence of a severe, difuse myocarditis, cardiac hypertrophy, and chronic passive congestion. Only fresh frozen heart, and pooled lung/spleen tissues were submitted for analysis. PCV-2 PCR
was positive in the hearts of 2 of 4 piglets and in the pooled lung and splenic tissues of 4 of 4 piglets. Isolation of PCV-2 from affected hearts and/or pooled lung and splenic tissue was positive in 2 of the 4 cases that were PCV-2 positive by PCR. Based on serology and/or PCR, other agents associated with reproductive failure in swine, including porcine reproductive and respiratory syndrome virus and porcine parvovirus were apparently circulating in the breeding herd. However, these agents could not be shown to be associated with the severe cardiac (or other) lesions in the affected piglets; but, they may contribute to PMWS.
PCV-2 was not detected by PCR or IHC in any representative cases of reproductive failure submitted during the first three years of the four-year period (it was detected in cases of reproductive failure submitted during the last year of the four-year period).
In order to rule out damage to DNA due to founalin fixation as a possible adverse factor limiting the ability to detect PCV-2 by PCR, PCR was performed on tissues collected from four weanling piglets with PMWS, PCV-2 DNA was amplified in all fixed tissues tested, including;
lung, liver, kidney and bronchial lymph node, from all four individuals. Moreover, the sensitivity of the PCR PCV-2 was independent of the length of time that each tissue was fixed in foimalin.
These results confirm and extend the previous observation (West et al. 1999) that PCV-2 can be vertically transmitted and can be present in large amounts within lesions from piglets infected in utero. Vertical transmission of PCV-2 virus and resultant fetal damage, such as myocarditis, is an additional disease manifestation of PCV-2.
Furthermore, the failure to detect PCV-2 in cases of reproductive failure prior to the last year of the four-year period_ from an endemic area of PCV-2 infection may indicate that vertical transmission was not the primary mechanism responsible for the initial dissemination of viral infection. Sexual, as well as vertical, modes of transmission can be attributed to the spread of PCV-2 infection in pigs.
EXAMPLE/RESULT 3: CULTURE AND ISOLATION OF THE
PORCINE CIRCO VIRUS STRAINS

Viruses 1103 and 1021 were isolated respectively in Alberta, respectively Saskatoon, Canada, from abortive cases according to the method described in J. Ellis et al. Can. J. Vet.
1998, vol 39, 44-51.
Viral culture is carried out on PK/15 cell cultures, known to be uncontaminated with the porcine circovirus (PCV), pestiviruses, porcine adenoviruses and porcine parvovimses (Allan G. et al Pathogenesis of porcine circovirus experimental infections of colostrum-deprived piglets and examination of pig foetal material. Vet. Microbiol. 1995, 44, 49-64).
Monolayers of PK/15 cells are dissociated by trypsinization (with a trypsin-versene mixture) from confluent cultures, and taken up in MEM-SA medium containing 15%
foetal calf serum not contaminated by pestivirus (= MEM-G medium) in a final concentration of about 400,000 cells per ml. 10 ml aliquot fractions of this cell suspension are then mixed with 2 ml aliquot fractions of the inocula described above, and the final mixtures is aliquoted in 6 ml volumes in two Falcon flasks of 25 cm2. These cultures are then incubated at +37 C for 18 hours under an atmosphere containing 10% CO2.
After incubation, the culture medium of the semi-confluent monolayers were treated with 300 mM D-glucosamine (Cat # 048175, Sigma-Aldrich'Company Limited, Poole, UK) (Tischr I. et al., Arch. Virol., 1987 96 39-57), then incubation was continued for an additional period of 48-72 hours at +37 C. Following this last incubation, one of the two Falcons of each inoculum was subjected to 3 successive freeze/thaw cycles. The PK/15 cells- of the remaining Falcon were treated with a trypsin-versene solution, resuspended in 20 ml of MEM-G
medium, and then inoculated into 75 cm2 Falcons at a concentration of 400,000 cells/ml. The freshly inoculated flasks were then "superinfected" by addition of 5 ml of the corresponding lysate obtained after the freeze/thaw cycles.
EXAMPLE/RESULT 4: TECHNIQUE FOR THE DETECTION OF
PCV BY IMMUNOFLUORESCENCE
The initial screening of all the cell culture preparations fixed with acetone was carried out by an indirect immunofluorescence technique (IIF) using a 1/100 dilution of a pool of adult pig sera. This pool of sera comprises sera from 25 adult sows from Northern Ireland and is known to contain antibodies against a wide variety of porcine viruses, including PCV:
porcine parvovirus, porcine adenovirus, and PRRS virus. The 111-i technique was carried out by bringing the serum (diluted in PBS) into contact with the cell cultures for one hour at +37 C, followed by two washes in PBS. The cell cultures were then stained with a 1/80 dilution in PBS of a rabbit anti-pig immunoglobulin antibody conjugated with fluorescein isothiocyanate for one hour, and then washed with PBS and mounted in glycerol buffer prior to the microscopic observation under ultraviolet light.
EXAMPLE/RESULT 5: PRODUCTION OF PCV ANTIGENS
BY IN VITRO CULTURE
The culture of the noncontaminated PK/15 cells and the viral multiplication were carried out according to the same methods as in Example 1. The infected cells are harvested after trypsinization after 4 days of incubation at 37 C and enumerated. The next passage is inoculated with 400,000 infected cells per ml.
The various PCV-2 strains disclosed herein, e.g. strains 1103 and 1121 are so cultivated.
EXAMPLE/RESULT 6: TITRATION OF PCV-2 Titration is carried out in 96-well microplates. A suspension of PK/15 cells (150 000 cells per ml) is first introduced (100 1 per well). Then dilutions of the viral culture are done and 100 1 thereof are introduced in the wells. Incubation is done at 37 C
with CO2. After 24h, there is carried out a treatment with glucosamine half an hour at 37 C
(for the conditions see example 3). The culture medium is then removed and fresh medium is introduced.
Incubation is conducted 72h at 37 C. Revelation of the foci is done using an anti-PCV-2 monoclonal antibody and a FITC labelled mouse conjugate.
This method can be used to titration for preparing inactivated as well as live attenuated PCV-2.
EXAMPLE/RESULT 7: INACTIVATION OF THE VIRAL ANTIGENS
At the end of the viral culture, the infected cells are harvested and lysed using ultrasound (Branson Sonifier) or with the aid of a rotor-stator type colloid mill (UltraTurrax, IKA). The suspension is then centrifuged at 3700 g for 30 minutes. The viral suspension is inactivated with 0.1% ethyleneimine for 18 hours at +37 C or with 0.5% beta-propiolactone for 24 hours at +28 C. If the virus titre before inactivation is inadequate, the viral suspension is concentrated by ultrafiltration using a membrane with a 300 kDa cut-off (Millipore PTMK300). The inactivated viral suspension is stored at +5 C.
EXAMPLE/RESULT 8: PREPARATION OF THE VACCINE IN THE FORM
OF AN EMULSION BASED ON MINERAL OIL.

The vaccine is prepared according to the following formula:
- suspension of inactivated porcine circovirus: 250 ml - Montanideg ISA 70 (SEPPIC):
750 ml The aqueous phase and the oily phase are sterilized separately by filtration.
The emulsion is prepared by mixing and homogenizing the ingredients with the aid of a SiIverson turbine emulsifier.
One vaccine dose contains about 107'5 TCID50. The volume of one vaccine dose is 0.5 ml for administration by the intradermal route, and 2 ml for administration by the intramuscular route.
This vaccine is used in a vaccination programme against the multisystemic wasting syndrome in combination with the Parvovax vaccine.
EXAMPLE/RESULT 9: PREPARATION OF THE VACCINE IN THE FORM
OF A METABOLIZABLE OIL-BASED EMULSION
The vaccine is prepared according to the following formula:
- suspension of inactivated porcine circovirus 200 ml - Dehymuls HRE 7 (Henkel):
60 ml - Radia 7204 (Oleofina):
740 ml The aqueous phase and the oily phase are sterilized separately by filtration.
The emulsion is prepared by mixing and homogenizing the ingredients with the aid of a SiIverson turbine emulsifier.
One vaccine dose contains about 107-5 TC1D50. The volume of one vaccine dose is 2 ml for administration by the intramuscular route.
This vaccine is used in a vaccination programme against the multisystemic wasting syndrome in combination with the Parvovax vaccine.
EXAMPLE/RESULT 10: VACCINATION OF PIGLETS
WITH DNA (PLASMID) VECTOR
Groups of 3 or 4 piglets, caesarian-derived day 0 are placed into isolators.
The piglets are vaccinated day 2 either with (A) a plasmid comprising ORF 13 or with (B) a mixture of this plasmid and another plasmid comprising ORF 4, and with a physiological solution for the control group. Each plasmid is diluted in sterile physiological solution (NaC1 0,9%) at 250 mg/ 1 final concentration. A 2 ml volume is injected by intramuscular route in two points of 1 ml (1 point each side of the neck). A second injection of vaccine or placebo is administered day 14. Vaccination with DNA is well tolerated by piglets and no evidence for adverse reaction to vaccination is noted. The piglets are challenged day 21 by oronasal administration of PCV-2 viral suspension, 1 ml in each nostril. After challenge piglets are weighed once a week. Rectal temperatures are recorded on days 17, 21, 22, 24, 27, 29, 31, 34, 37, 41, 44. Day 44 fecal swabs are collected from each piglet for PCV-2 shedding. The virus is detected and quantified by quantitative PCR. Day 45 necropsies are performed and tissue samples are collected for virus isolation.
= Clinical symptoms :
There is no significant difference for the mean body weight gains or the mean body temperatures between groups.
= Necropsy lesions :
The only gross finding noted in pigs at termination is bronchial lymphadenopathy. The lesions are scored according the following criteria.
0 = no visible enlargement of lymph nodes 1 = mild lymph nodes enlargement, restricted to bronchial lymph nodes.
2 = moderate lymph nodes enlargement, restricted to bronchial lymph nodes 3 = severe lymph nodes enlargement, extended to bronchial submandibullar prescapsular and inguinal lymph nodes.
std is an abbreviation for standard deviation Groups Lymphadenopathy scores mean std (A) 1.2 1.3 4 (B) 2.0 1.7 3 controls 3.0 0.0 3 N = number of piglets in each group A reduction of the lymph node lesions is observed in 3 out 4 piglets immunized with (A) and 1 out 3 piglets immunized with (B) mixture. This difference is not significant (p>0.05) due to the high value of the standard deviations (std).
= Virus load in lymph nodes tissues:
Quantitative virus re-isolation is performed on tissue homogenates prepared from bronchial and mesenteric lymph nodes.
The data presented correspond to the virus titers in tissue homogenates after transformation in log I0=
PCV-2 titers Groups Bronchial LN Mesenteric LN
mean std mean std (A) 0.9 0.8 0.9 0.8 4 (B) 0.7 0.6 0.2 0.2 3 Controls 2.0 1.1 1.8 1.1 Bronchial lymph nodes seem to contain the most infectious virus. A reduction of the viral load is observed in bronchial and mesenteric lymph nodes from piglets immunized with either (A) or (B) mixture. This reduction is significant (p 0.05 for the plasmids mixture.
= Viral excretion:
Post challenge fecal swabs are assessed for schedding PCV-2 by PCR based on amplification of PCV-2 ORF 13. Each assay is performed in triplicate on 2 ml of sample.
Unvaccinated controls are negative for PCV-2 prior challenge and positive after challenge confirming the validity of the PCR assay.
Value are expressed as log to (number of molecules of PCV-2 DNA in 2 I
sample).

Logi number of PCV-2 DNA molecules Groups mean std (A) 3.3 0.3 4 (A) 2.9 0.7 3 Controls 3.6 0.6 4 The differences between groups are not significant (p > 0.05).
EXAMPLE/RESULT 11: VACCINATION OF PIGLETS WITH
CANARYPDX LIVE VECTOR AND RESULTS
Groups of 3 or 4 piglets, caesarian-derived day 0 are placed into isolators.
Day 2 the piglets are vaccinated with 108 pfu of (C) a canarypox comprising ORF 13, or (D) of a canarypox comprising ORF 13 and ORF 4, or parental canarypox, in 1 ml of PBS, by intramuscular route on the side of the neck. A second injection of vaccine or placebo is administered at day 14. Vaccination with canarypox is well tolerated by piglets and no evidence for adverse reaction to vaccination is noted The piglets are challenged day 21 by oronasal administration of a PCV-2 viral suspension, 1 ml in each nostril. Day 45 necropsies are performed and samples of tissues are collected for virus isolation.
Necropsy results :
= PMWS is characterized generally by lymphadenopathy and more rarely by hepatitis or = nephritis. So the gross findings in lymph nodes are scored for each piglet in the following manner: 0 = no visible enlargement of lymph nodes; 1 = mild lymph nodes enlargement, restricted to bronchial lymph nodes ; 2 = moderate lymph nodes enlargement, restricted to bronchial lymph nodes ; 3 = severe lymph nodes enlargement, extended to bronchial, submandibullar prescapular and inguinal lymph nodes.

Groups Scores (C) 0.5 0.0 0.0 1.0 mean 0.38 standard deviation 0.48 (D) 0.0 0.5 0.5 1.0 mean 0.5 standard deviation 0.41 Controls 2.0 2.5 2.5 2.5 mean 2.38 standard deviation 0.25 Bronchial lymphadenopathy for PCV-2 is a prominent gross finding. A
significant reduction__ of the lymph nodes lesion in relation to control group is observed after immunization with (C) and (D) (p 0.05).
Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the appended claims is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.

References 1. Allan GM, McNeilly F, Cassady JP, et al.: 1995, Pathogenesis of porcine circovirus;
experimental infections of colostrum deprived piglets and examination of pig foetal material.
Vet Microbiol 44:49-641.
2. Allan GM, McNeilly F, Kennedy S, et al.: 1998, Isolation of porcine circovirus-like viruses from piglets with a wasting disease in the United States of America and Europe. J Vet Diag Invest 10:3-10.
3. Allan GM, Kennedy S, McNeilly F, et al.: 1999, Experimental reproduction of wasting disease and death by co-infection of pigs with porcine circovirus and porcine parvovirus, J
Comp Path 121:1-11 (July 1999).
4. Bolt DM, Hani H, Muller E, and Waldvogel AS: 1997, Nonsuppurative myocarditis in piglets associated with porcine parvovirus infection. J Comp Path 117:107-118.
5. Ellis, JA, Hassard L, Clark EG, et al.: 1998, Isolation of circovirus from lesions of piglets with postweaning multisystemic wasting syndrome. Can Vet J 39:44-51 6. Ellis JA, Krakowka S, Lairmore M, et al.: 1999, Reproduction of lesions of postweaning multisystemic wasting syndrome in gnotobiotic piglets. J Vet Diag Invest 11:3-14.
7, Kim HS, Jo HS and Bergeland ME: 1989, Serologic, virologic, and histopathologic observations of encephalomyocarditis virus infection in mummified and stillborn pigs- J Vet Diag Invest 1:101-104.
8. Lager KM and Halbur PG: 1996, Gross and microscopic lesions in porcine fetuses infected with porcine reproductive and respiratory syndrome virus. J Vet Diag Invest 8:275-282.
9. Meehan BM, McNeilly F. Todd D, et al.: 1998, Characterization of novel circovirus DNA's associated wasting disease syndromes in pigs. J Gen Virol 79:2171-2179.

10. Mengeling WL 1992, Porcine parvovirus. In: Diseases of swine, ed. Leman AD, 7th ed-, _ pp.299-31 1. Iowa State University Press, Ames, IA.

11. Molitor TW, Orveerakul K, Zhang ZZ, et al.: 1991, Polymerase chain reaction (PRC) amplification for detection of porcine parvovirus. J Virol Meth 32:201-211 12. Pensaert M and DeMeurichy W: 1973, A porcine enterovirus causing fetal death and mummification. Experimental infection of pregnant female pigs. Zentralbl Veterinaermed Beih 11:2025.

13. Tischer 1, Rasch R and Tochterrnann G: 1974, Characterization of papovavirus- and picomavirus-like particles -in permanent piglet kidney cell lines. Zentralbl-Bakertiol-Org-A
226:153-167.

14. West KR, Bystrom, JM, Wojnarowicz C, et al.: 1999, Myocarditis and abortion associated with intrauterine infection of sows with porcine circovirus-2. J Vet Diag Invest 1.

RfPEATDIX
. RELATRD APPLICATIONS:
Reference is wade to UR Application Serial 09/082,5SR
filed on 21 May 1998 and to Us Application Serial 09/161,092 filed on 25 September 1998 in the foru of a cuuLinnation-in-part of Serial 09/082,554.
(Reference is made VO U.S. applicatiou Serial No. 09/161,092, filnd 09/25/98 as a CIP of u.S.
application Serial No. 09/082,558, riled 05/71/98, Claming priority from Freauch Application Nes.97/12302, lg 98/00873, 90/03707, filed 10/03/97, 1/22/90. 3/20/98. .
The present invention relates to plasmid constructs encoding and expressing porcine circoviruS
(PCV for Porcine CircoVirus) immunogens responsible for =
the PMWS syndrome (Porcine Mnitisystemic Wasting Syndrome or Post-Weaning Multisystemic Wasting Syndrome). to methods of vaccination and to DNA
vaccines, as Well as to methods of producing and of formulating these vacrines.
PCv was originally detacted as a ndncytopathogenic contaminant in pig kidney nell lines PR/15. This virus was classified among the Circovdae with the chicken anaemia virus (CNV for Chicken Anaemia Virus) and tho PBPDV virus (Pscittacine Beak and .
Father Diseaeo Virus). These are 'small nonenveloped viruscs (from 15 to 24 nm) whose common characteristic iS to contain a gcnome in the form of a circular .
single-stranded DNA of 1.76 to 2.31 kilobases (kb). It = was first thought that this genome encoded a polyDepEide of about 30 kna (Todd ec al., Arch. Virol., 1991, 117. 129-135). Recent work has however shown a = =
41 =

more comr x transcription (Meehan B.M. a/., J. Gen.
Virol., 1997, 78: 221-227). Moreover, no significant homologies in nucleotide sequence or in common antigenic determinants are known between the three species of circoviruses known.
The PCV derived from PK/15 cells is considered not to be pathogenic. Its sequence is known from B.M. Meehan et al., J. Gen. Virol. 1997 (78) 221-227.
It is only very recently that some authors have thought that strains of PCV could be pathogenic and associated with the PMWS syndrome (G.P.S. Nayar et al., Can. Vet.
J., 1997, 38: 385-387 and Clark E.G., Proc. Am. Assoc.
Swine Prac. 1997: 499-501). Nayar et a/. have detected PCV DNA in pigs having the PMWS syndrome using PCR
techniques.
Monoclonal and polyclonal antibodies directed against circoviruses found in pigs having the symptoms of the PMWS syndrome have been able to demonstrate differences between these circoviruses and the porcine circoviruses isolated from culture of PK-15 cells (Allan G.M. et al. Vet Microbiol., 1999, 66: 115-123).
The PMWS syndrome detected in Canada, the United States and France is clinically characterized by a gradual loss of weight and by manifestations such as tachypnea, dyspnea and jaundice. From the pathological point of view, it is manifested by lymphocytic or granulomatous infiltrations, lymphadenopathies and, more rarely, by hepatitis and lymphocytic or granulomatous nephritis (Clark E. G., Proc. Am. Assoc.
Swine Prac. 1997: 499-501; La Semaine Veterinaire No.
26, supplement to La Semaine Veterinaire 1996 (834); La Semaine Veterinaire 1997 (857): 54; G.P.S. Nayer et a/., Can. Vet. J., 1997, 38: 385-387).
These circoviruses obtained from North America and from Europe are very closely related, with a degree of identity of more than 96% of their nucleotide sequence, whereas the degree of identity is less than 80% when the nucleotide sequences of these circoviruses are compared with those of porcine circoviruses isolated Irom PK-15 cells. According_Ly, two viral subgroups have been proposed, PCV-2 for the circoviruses associated with the PMWS syndrome and PCV-1 for the circoviruses isolated from the PK-15 cells (Meehan B.M. et a/., J. Gen. Virol., 1998, 79:
2171-2179; WO-A-9918214).
The Applicant has found that plasmid constructs encoding and expressing PCV-2 immunogens can be used to immunize pigs against the PMWS syndrome.
PCV-2 immunogens can be used in combination with PCV-1 immunogens to also immunize these animals against PCV-2.
According to a less preferred mode, the PCV-1 immunogens may be used alone.
The subject of the present invention is plasmid constructs encoding and expressing a PCV-1 or PCV-2 immunogen, in particular the open reading frames (ORFs) 1 and 2 of PCV-1, and the ORFs 1 and 2 of PVC-2.
It goes without saying that the invention automatically covers the plasmids encoding and expressing equivalent nucleotide sequences, that is to say the sequences which change neither the functionality or the strain specificity of the gene considered or those of the polypeptides encoded by this gene. The sequences differing through the degeneracy of the code will, of course, be included.
The PCV-2 sequences used in the examples are derived from Meehan et al. supra (ORF1 nucleotides 398-1342; ORF2 nucleotides 1381-314; and correspond respectively to ORF4 and ORF13 in US 09/161,092 of 25 September 1998 and to COL4 and C0L13 in WO-A-9918214). Other PCV-2 sequences have also been published in WO-A-9918214 and called Imp1008, Imp999, Imp1011-48285 and Imp1011-48121, as well as in A.L. Hamel et a/. J. Virol. June 1998, vol 72, 6:
5262-5267 (GenBank AF027217) and in I. Morozov et al.
J. Clinical Microb. Sept. 1998 vol. 36, 9: 2535-2541, as well as GenBank AF086834, AF086835 and AF086836, and give access to equivalent ORF sequences.

.
=

The_ invention also covers t6, equivalent sequences in the sense that they are capable of hybridizing to the nucleotide sequence of the gene considered under high stringency conditions. Among these equivalent sequences, there may be mentioned the gene fragments conserving the immunogenicity of the complete sequence.
The other ORFc 1-3 and 5-12 disclosed in US 09/161,092 of 25 September 1998 ICOLs 1-1 and 5-13 in WO-A-9918214), in particular the OFF s 7 and 10, may be used under the conditions described here, in combination or otherwise with each other or with the OR.Fs 1 and 2 as defined here_ The word plasmid is here intended to cover any DNA transcrition Will. in the form of a polynnelectide sequence comprising the PCV sequence to be expressed and the elements necessary. for its expression in vivo.
'r1it circular nlasmia form. supercniled or otherwise, is preferred. The linear form in also included within the 2-0 scope of the invention.
The subject of the present invention is more _ particularly the plasmids called pJP109 (containing thp 0RF2 gene of PCV-2, 1icrure1.1), p3P111 (containing the URF1 gene at Figure2.2), nJP120 (containing the ORF2 gene of PCV-1, Pigurea.õ3) end pJP121 (containing the ORF1 gene of PCV-1, Figure1.4).
Each plasmid comprises a promoter capa1r1Le of ensuring, in the host cells, the expression of the inserted gcne under its control. It is in general a strong eukaryotic promoter and in particular cymomegalovirup early promoter CMV-I, of humAn or =urine origin, or optionally of other nrigin such as rat or guinea pig. More generally, -the promote' is either of viral origin or of cellular origin. As a viral promoter other than CMV-IE, there may be mentioned the SV4.0 Nlrus early or late'pramocer or the Rou Sarcoma virus 1,-.1.1( promocer. It may also be a ' promoter from the Virus from which the gene is derived, for example the promoter specific lo the gene. As =
44 .
- -cellular -omoter, there may be mention the promoter of a cytoskeleton gene, such as for example the desmin promoter, or alternatively the actin promoter. When several genes are present in the same plasmid, they may be provided in the same transcription unit or in two different units.
The plasmids may also comprise other transcription regulating elements such as, for example, stabilizing sequences of the intron type, preferably intron II of the rabbit P-globin gene (van Ooyen et a/.
Science, 1979, 206: 337-344), signal sequence of the protein encoded by the tissue plasminogen activator gene (tPA; Montgomery et a/. Cell. Mol. Biol. 1997, 43:
285-292), and the polyadenylation signal (polyA), in particular of the bovine growth hormone (bGH) gene (US-A-5,122,458) or of the rabbit P-globin gene.
The subject of the present invention is also immunogenic preparations and DNA vaccines comprising at least one plasmid according to the invention, encoding and expressing one of the PCV-1 or PCV-2 immunogens, preferably one of the abovementioned ORFs, in addition a veterinarily acceptable vehicle or diluent, with optionally, in addition, a veterinarily acceptable adjuvant.
The subject of the present invention is more particularly immunogenic preparations and vaccines containing at least one plasmid encoding and expressing one of the PCV-1 or PCV-2 immunogens, compositions formulated with an adjuvant, in particular a cationic lipid containing a quaternary ammonium salt, e.g.
preferably DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanammonium; WO-A-9634109), and preferably coupled with a neutral lipid, e.g.
preferably DOPE (dioleoylphosphatidylethanolamine), to form DMRIE-DOPE. Preferably, the plasmid mixture with this adjuvant is made immediately before use and preferably, before its administration to the animal, the mixture thus produced is allowed to form a complex, . 7 fo-r ex.a. 1.e over a perinii rangins from 10 to 6U minutes, in particular of the order of 30 minutes.
When DOPE is pzusent, the DMIE:DOPE molar ratio preferably ranges from 955 to 5:95, more = 5 partirularly 1:1.
The plasmid:DMRLE or DIE-DOPE adjuvant weight ratio may range. in particular from 50:1 Lo 1:10, in particular from 10:1 to 1:5, preferably from 11 to 1:2.
According to another advantageous mode ot the invention, it is poasible to use, an adjuvant, . an adjuvant compound selected from the polymers of acrylic or methacrylic acid and the couolymers of maleic anhydride and of alkenyl derivative. ThA polymero of acrylic.: or metridorYilc acid crozzlinked in particular with polyalkenyl ethers of sugars or of polyalcohols are preferred. These compounds are known by the term earl:tomer (PharMeur0372. vnl. 2, No. 2, June 1996).
Persons skilled in the art can also rater to US-A.2.909,4G2 describing such acrylic polymers crosslinked wlth a polyhydroxylated compound -having at least 3 hydroxyl groups, preferably not more than 9, the hydrogen co ot at 1Past -three hydroxyls being rePlaced with unsaturated aliphatic radicals having at least 2. carbon atoms. The Preferred radicals arc those containing 2 Co 4 carbon atoma, e.g. vinyls, allVls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other subscituents.
such az methyl. The products sold under the name carbopole (GP Goodrich, Ohio, USA) are particularly appropriate. They are crorislinked with an allvl saccharose or with allylpentaervthrit01. Among them, there may be mentioned Carbono100 97.1P, 934P and 971P.
. . Among the CabolyMerE of maleic anhydride and of an alkenyl derivative, the EMAs8 (Monsanto) are palcfu.c..t.d which are copoiymers of maleic. anhydride and ethylene, linear or crosalinkod, for example crosslinked with divinyl eLher. Reference may be made = 46 = =

to J. Fie1as et a/. Nature, 186 : 778-7F 4 June 1960 From the point of view of Lheir stucture, Ui oolymers of acrylic or metbacrylic anid and the EMPisIN preferably consist of basic units of the following formula:

--C ---(a -12) y COCH
in which - Ri and Rz, which are identical or different, represent H or CH3 - 0 or 1. preferably x = 1 y 1 or 2, with x + y = 2 For the EMS . x = 0 and y = 2. For the carbomers, y = 1.=
The dissolution of these polymers in water leads to an acidic solution which will be neutralized, preferably to physiological pN, to give the adjuvant InLu which the "actual vaccine will he incorporated. The carboxyl groups of the polymer are then partly in t00' form.
For this type of adjuvant, it is preZerable to prepare a solution of the adjuvant, in particular of carbomer, in distilled water, preferably in the piesence of sodium chloride, the solution obtained 2b being at acidic pH. This stock sn]ution is diluted by adding it to the required quantity (in order to obtain the desired final Concentration), or a substantial part thereof, of water loaded with NaC1, preferably physiological saline (NaC1 9 g/1), in one or more portions with concomitant or subgequent neutralization (pH 7.3 to 74),. preferably with NaOH. This solution at physiological pH "will be used as it is to mix with =
the plasmid. in particular .torraci in lynphilid, liould or frozen form.
=
=

=
-ak 02383367 2002-27 T1 polymer concentration in the _inal vaccine composition will be 0.01% to 2% w/v, more particularly 0.06 to 1% w/v, preferably 0.1 to 0.6% w/v.
In a specific embodiment, the immunogenic or vaccine preparation comprises a plasmid or a mixture of plasmids encoding and expressing PCV-2 ORF1 and ORF2.
The invention also provides for combining the vaccination against the porcine circovirus with a vaccination against other pig pathogens, in particular those which may be associated with the PMWS syndrome.
The subject of the present invention is also mixtures of plasmid containing at least one plasmid according to the invention and at least another plasmid encoding and expressing a porcine immunogen, selected for example from the group consisting of the glycoproteins gB and aD of the Aujeszky's disease virus (pseudorabies virus or PRV), the haemagglutinin and the nucleoprotein of the porcine influenza virus H1N1, the haemagglutinin and the nucleoprotein of the porcine influenza virus H3N2, the ORF5 and ORF3 genes of the PRRS virus of the Lelystad and USA strains, the VP2 protein of the porcine parvovirus, the El and E2 proteins of the hog cholera virus (HCV), the deleted apxI, apxII and apxIII genes from Actinobacillus pleuropneumoniae (see for the plasmids for example WO-A-9803658).
These mixtures of plasmids are taken up in a veterinarily acceptable vehicle or diluent, with optionally, in addition, a veterinarily acceptable adjuvant as described above, thus forming immunogenic preparations or multivalent DNA vaccines. These preparations or multivalent vaccines may in particular be advantageously formulated with DMRIE, and preferably coupled with a neutral lipid, DOPE, to foim the DMRIE-DOPE.
The preparations or monovalent or multivalent DNA vaccines according to the invention, formulated or otherwise with adjuvant as described above, may also be advantageously supplemented with a cytokine preferably of oorein origin, in particulax. porcin GM-CS.F. This . addition of porcine GM-0576 (granulocyte macrophage -colony stimlating factor; Clark S.C. et a/, Science 1987, 230: 1229; Grant S.M. eL a/. Drugs, 1992, 53:
516) may be carried out by incorporating into the preparation or into the vaccine either porcine GM-CSF
protein, or a xdasmid encoding and expressing the porcine GM-CSF gene (Inumarli S. and Takamatsu H.
immunol_ Cell. Biol., 1995, 73: 474-476). 'Preferably, the porcine GM-C3' gene is inserted into a. plasmid different from those encoding thR PCV immunogens or the other porcine imnunogons.
In particulaz, the nlasmid encoding and expreSSinO the Porcine GM-CSP may hR the plasmid pZPOSS
(Figure 1.5).
The immunogenic preparations and the monovainnt or multivalent DNA vaccines according to the invention =
may also be combined with at least One conventional vaccine (attenuated live, inactivated or guhunit) or 70 recombinant vaccine (viral vector) directed against at least one porcine pathogen which is different or identical. The invention provides in particular for the ' combination . with adjuvant-containing conventional vaccines (attenuated live; inactivated or subunit) For the inactivated or subunit vaccines, there may be . mentioned those containing in particular alumina gel alone or mixed with saponin as adjuvant, or those termini...Rd in the form of an oil-in-water cmulsion.
The zubjcot of the present invenLion is also a methoa or immunization which makes it possible to induce an immunp response in pigs towards the cireoviruses according to the invention. Its subject is .in particulac a method of vaccination which is effective in pigs_ These method of immunization and vaccination comprise the administration of one of the Preparations or of one ot the monovalent or multivalent DNA vaccines as described above. The of immunization and vaccination comprise the administration of one or morR Allt7cPASiVe doses of these = =

preparaion Oi DNA vaccine. The prepara-aons and DNA
vaccines may be administered, in the contexr of this method of immunization or of vaccination, by various routes of administrataon pioposed iu the prior art for h polynucleotide vaccination, in particular the intramuscular and intradermal routes, and by moans of known administration Lechuioue, in particular iniections with a syringe having a needle, by jet Mirth Pr al. Analytical Pioch., 1992, 205:
385-368) or by projection uf gold particles coated with DNA (Tang et a.2. Nature. 192, 356: 152-154).
This method not only allows for administration to adult pigS, but also to the young and to gestating females: in the latter case, this makes it possible, in ' particular, to confer passive immuaiLy unto the newborns (maternal antibodies).
The quantity of DNA used in the vaccines according to the present invention is between about 10 g and about 2000 4g, and nreferably between about 50 jig nd about 1000 pg. Pcr=onz mkillod in the art will have the competence necessary to precisely define =
the ettective _dose of DNA tn h tised for each immunization or vaccination protocol.
The dos 4 volumes may be between 0.5 and 5 ml.
preferably between 2 and 3 ml.
A preferred method of immunization or of vaccination consists in the administration or the DNA
vaccines according to the invention by the intramuscular route. =
The invention Will now be described in greater detail with the aid of nonlimiting exemplary embodiments, taken with reference to the drawing, in which:
Figure 1.1:plaamid pO7109 Figure 1.2:plasmid pUP111 Figure 1.3:p1Asmja pJP120 =
Figure 1.4:plazmid paP121 Figure 1.5:plasmid pJP058 =
50 =

= CA 02383367 2009-12-16 . y Sequence SEQ ID
SEQ In No.27: oligonucleotice 7P779 SEQ ID No.28: oligonucleotide JP780 SEQ ID No.29: oligonucleotide JP781 SEQ ID No-30: oligonucleotide JP782 SEQ ID Nu.31: oligonucleotide JD783 SFr) TO No.32: oligonucleotide JP784 SEQ ID No.33: oligonucleotide JP78S
SEQ ID No_34: ullgohucleotide JP786 EXAMPLES
Example 1.1 Constractiofl or the 'plasmid pjP109 The plasmid peRM72-Imp1010 Stoon-EcoRI No. la containing the genome of the PCv-2 virus in the form of an EcoRI fragment (B. Meehan ec a/. J. Gen. Wrol.
1998. 79 2171 2179) was digested with EcoRI in order to isolate, after garose gel electrophoresis, the EcoRi-EcoRM fragment of 1768 base pairs (bp). This fragment weLs self-ligated.
The ORF2 gene of the PC-V-2 virus strain 1010-Stoon (E. Meehan et al. J. aen_ Viral. 1998. 79. 2171-2179;
Genbank sequence accession No. Ar055392) wa* amplificd, using the template consisting of the self-ligated 20 ZcoR/.EcoRI fragment, by the polymerase eha.in reaction (PcR1 technique with the following uligonucleotides:
JP779 (SEQ ID NO Z-7) (35 mer):
5'CATCATCATGTCGACATGACOTATCCAAGGAGGCG3' and JP780 (SEQ ID NO2ei (36 mer):
=5'TAcTACTACAGATCTTTAGG4ITTAAGTGGGGGGTC3' in OrdeL LO generate a 730 bp PCR fragment. This fragment was digested With Sail and by 111 in order to loolate, after agarose gel electrophoresis. the 715 bp Sa1I-BglII Lestriction fragment. Thi* fragment was than ligted with the plasmid pVR1012 (Ifilitikka J. et al.
Human Gene Therapy. 1996. 7. 1205-12171. digested beforehand wILL Sall and BglII, to givc the plasmid pJP109 (6567 pb) (Figure 1.1) .
=
SI

Example 1.2: Construction of the plasmid PJ 11 . A polvmerase chain reaction was carried out with thn plasmid pGem7Z imp1010-Stoon (see Example 1) (B- Meehan ec a/. J. Gen. Virol. 199b- 79. 2171-2179). ana the S following oligonucleotides: =
UP781 (SEQ ID NO 29) (35 mer):
5*CATCATCATGTCGACATGCCCAGCAAGAAGA1 .TG(113' and JP782 (SEQ ID NO 30) (36 mer):
TACTACTACAGATCTTCAGTAATTTATTTCA:TATGG3 in order to generate a 970 bp PCR tragment containing the ORF1 gene of the PCV-2 virus. This fragment was digested with SalI and BglII in oLdeL Lu isolate, after agarose gel electrophoresis, the 955, bp Ra1T-Bg1II
r9striction fragment.. This fragment was then ligated with Lhe plasmid pVR1012 (Example 1.1) to give the plasmid pJP111 (9810 hp) (Figure 1.2).
Example 1.3: ConstraCtion of the plasmid paP120 (PC7-1 ORF2) A pulymeLdbe clidan Leaction was carried out with the plasmic' pPCV1 (B. Meehan et a7. 3. Gen_.Virol. 1997.
78. 221-227), and the following oligonucleotides;
JP/83 (SEQ ID N031) (35 met): =
5'CATCATCATGTCGACATGAMTGGCCAACGAGGCC3' and Jp784 (SEQ ID NO 32) (40 mer):
5 TACTACTACAGATCTTTATTTAXTTAGAGGGTCrrMAGG3' in order to generate a 73n hp PCR fragment containing thc ORF2 gene of the rcv 1 virus (PR-15 strain, GenEauk sequence aceesion No. U49186). This fragment was digested with Sail and Egli' in nraer tn isolate. after agarose gcl clectrophoresis, the /15 hp Sali-Sgl/I
restriction fragment. This fragment was then ligated with the. plasmid pVR1012 (Example 1.1) to give the plasmid pJP120 (5565 bp) (Figure 1.3).
3h =
Example 1.4: couctructian of the plammid pJr121 (pcv-1 oRFI) The plasmid pPCV1 containing the Prvl virus genome in the form of a PritI fragment (D. Meehan cc a1. J. Gen.
= 52 .

=
Virol. 19 , 78, 221-227) was digested ith Pstl in order to i$olatp, after garose gel electrophoresis.
thc 1759 base pair (bp) PotI Doti fragment. This tragment was self-licrated.
The ORF1 gene of . the PCV-1 virus strain PK-15 (B. Meehan et al. J. Gen. Viral. 1D)7, 76, 221-227;
GenBank sequence. accession No. U49186) was amplified, using the template consisting of the self-ligatod PoLI-PoLI iiaguient, by the polymereoe chain reaction (PCR) technique with the following eligonuclnatides:
= JP785 (SEQ ID NO 33) (35 nor):
5=CATCPITCATGTCGACATGCCAAGCAAGAMAGCGG3' and 3P786 TD NO 34) (36 nor):
5'TAcTACTACAGATCTTCAGTAATTTATTTTATATGG3' in order to generate a 965 bp PCR fragment containing the ORF1 gene of the PCV-1 virus (strain PR-IS). This LragmoaL was digesLed with Sail and BglII in order to isolate, attar agarose gel eleetrophoresis. thn gfg bp SalI-8g1MI restriction fragment. This fragment was then ligated wiLh Lhe plasmid pVR.1012 (Example 1.1)1 to give the plasmid pJP121 (5804 bp) (Figure 1.4).
=
.Example 1.5: Construction of the plasmid par058 (expressing porcine (M-CSF) 35 Pig blood was collected over a tube containing EDTA by taking blood Lrom the jugular vein. The mononucleated cells were harvested by centrifugation on a Picoll gradient and then cultured La viLzu la RPM' 1640 medium (Gibco-BRL) and stimulated by addition of concanavalinct A (Sigma) at a final concentration of about 5 pg/m1 in the culture umeium. After 72 hours of stimulation, the lymplinblasts.were harvestnd and the total RNA of these cells was extracted with the extraction kit "Micro-Scale Total RNA Separator Kit- (Clontech) following the manufacturer's reCoMmandations. A reverse transcription reaction, carried out with the aid of the kit "1st-Strand CDNA Synthesis Kit" (Perkin Elmer), followed by a polymerase cliain reaction, was carried = =

out on tim. total RNA extracted from .ese porcine =
lymphcblasts with Lhe following oligonutlectides:
RG972 (33 mer):
51TATGCGGCCGCCACCATGTGGCTGCAGAACCTG3=
and RG373 (34 mei.):
. SeTATGCCGCCGCTACGTATCACTTCTCGCCTGCTT3=
in uLdex to generate a PCR fragluent of about 450 base pairs (bps. This fragment was digested with Not' in order to isolate, after agarose gel electrochoresis, the 450 by MAI-Nut:I Ekagment. This fragment was then ligated with the plasmid pVR1012 (Example 1.1), preferably digected With Nati and dcphoophorylated, to .
give the plaamid pJP058 (3405 bp) (Figure 1.5)... The sequence of the pGM-CSF gene cloned into the plagmla p3P058 wac checked and found to be identical to that available in the GenBank database (accession No.
P21074) ' Example 1:6: Production of the purified plasmids for the vaccination of pigs =Escherichia coli H12 bacteria (strains DH105 Ui. SCsi) were transformed with the plasmids pJP109, p010111, pJP058, pJP120 and pJP121 of Examples 1 . 1 to 1 . 5 supra. The five transformed clones obtained respectively" with these five plasmids were then culturnA separately, with shaking at 437 C, in Luria-Broth (L13) medium_ The bacterial cultures Were harvested at the end of the exponential phase and the plasmids were extracted according to the alkaline lysis technique. The' extracted plaSmidS were then purified on a caesium chloride gradient according to the technique described by SaMbrook et al. Molecular Biology: A Laboratory.
Manual. 2nd edition, 1989, cold spring Harbor Laboratory, 'Cold Spring Harbor. NY). A ter final 3S extraction of ethidium.bromide and precipitation in the presence of absolute ethanol, the purified plasmids were rosumpended in TB buffer (1 lal Tris/EDTA, mon 8.0)=
in order to obtain stock solutions containing .2 mg of =

plasmid p.r ml. These stock solutions i.e stored at -20 C before use.
Example 1.7: Control of the expression or Ma's 1 and 2 of the PCV-2 virus In order to control the products of expression of the PCV-2 ORF2 and PCV-2 ORF1 genes, cloned respectively into the plasmids pJP109 and plP111, these placmids were transfocecd into CUO-Ri (Chinese Hamster Ovary) cells (ATCC No. CcL-61) with the Lipofectamine PlusM
transfection kit (Gibco-BRL, Cataloguet 10964-013), following the manufacturer's recommendations for use.
48 hours after transfection. the transfected cells are washed and fixed with a 95% glacial acetone solution for 3 minutes at room .temnerature. Five monoclonal antibodies specific for the PCT-2 ORP1 proteins (F199 1D3G2 and r210 7G5GO) and 0R12 proteins (P190 4C7CF4 F190 2B1idC and P190 3ABBC) were used as first antibodies_ An anti-mouse /gG conjugte, labelled with Cy3, was used to reveal the specific labelling. A
Pev-2 specific fluorescence was observed with the 1-pC17-2 ORF2 monoclonals in the cells-transfectcd with the plammid.pJP109, but; not in Lhose Lransfected with the plasmid pJP111. In contrast, a PCV-2 spec3fic fluorescence was o'berved with the two PCV-2 ORF1 monoclonal in the cells transfected with the plasmid pJP111. but not in those transrected with the plaRmili pJP109. No fluorescence was detected with the PCV-2 monoclonals in CHO cells transfected with the plasmid pVR1U1'2 alone or in the nontransfected The same expreczion result was obtained with 4 polyclonal serum specific for the PCV-2 virus. In this case, a flnorescain-labelled anti-pig IgG conjugate was = 'used to detect. the specific fluorescence. No fluorescence was detected with this polyclonal serum in CHO cells transfected with the plasmid pVR1012 alone or in the uontransfecL=d CHO cells.
. 55 CA 02383367 2009-12-16 =
, .

Example 1.8: Vaccination of pigs with naked DNA
1.8A,omm-day-old piglets Groups of piglets obtained by Caesarean on Do ot thR
protocol, are placed in an isolating unit. These piglets are vaccinated at the age of 2 days by the intramuscular route with various vaccinal solutions of plasmid. The vaccinal solutions are prepared by diluting the stock solutions in stex:ile physiological saline (0.9% NaC1).
The piglets are vaccinated:
either with the plaamid p1p109 alone or with the mixture of the plasmids nJP10(1 enA p3P113.
= 15 or with the mixture of the plasmids pJP109 and pJP058 or with the mixture of the plasmids pJP109. PJP111 and pJP058 The vaccinal solutions comprise 500 g of each plasmid, Volume: The vaccinal solutions are injected by the intramuscular route in A total volume of 2 ml. In practice, given the ago of the piglets on vmucinatiOn (1-2 days), 1 Injection of 1 ma is given on each side of the neck (= Tx 1 TIM_ Two injections of vaccine are carried uut at two weeks' Interval, that is to say on days Da and 014 of the protocol.
A challenge is made on D21 of the protocol by oronasa]
administration of a viral suspension of a virulent PCV-3 strain.. The piglets are then monitored for 3 weeks Lox Lhe appearance of specific clinical signs ot post-weaning multi systemic wasting syndrome iu piglocs. The signs which are monitored mre:
recLal temperature: daily measurement tor the first 14 days, then two measurements. during the 3rd week following the challenge.
Weight: weighing of the piglets lust betore the challengo then once per week during thc 3 weekm following the challenge.
=
=

=
;

Collection of blood samples to teat for viremie and antibodies: blood samples taken on D2, D14, 021. .1.28, D35 and 042.
Autopsy: on 042, the surviving pigs are humanely killed and undergo autopsy to search for anazomicopatholooical lions and to make histological preparations from the liver, Lhc lymph nodes, the spleen. the kidneys aud the thymus to search tor lesions in these tissues.
1-8=2-5-7-week old piglets 5- to 7-week old piglets. no. longer having maternal antibodies specific for the PCV-2 virus are vaccinated by the intramuscular route;
either with the lolasmid pde109 alone, IS or with the mixture of the plaamids pJP109 and pjpill vs. wiLh the mixture of the plasmids pJP109 and pJP058 or with rhe mixture ot the plasmids pJP109. p7P111 and pJPOSO
the vaccinal doses are the same as those indicated in tX-aittple 1.8.1 (500 pg per plasmid). The vaccinal solutions are injected by the intramuscular route iu a volume of 2 M1 (a single administration of 2 mi. into the neck muscles).
Two vaccinaLiuus axe performed al. 21 days interval (DO and Z121). A challenge is made 14 days after the last vaccination (1)35) by intramuscular administration of a viral suspension of a virulent PCV-2 strain.
Thn pigs are then monitored .tor 8 weeks tor the - occurrence of specific clinical signs- of the post-weaning multisystemio wasting .1,40.1.7oirLe in piglets. The clinical monitoring of the piglets after the challenge in identical to that described in Example 1.8.1 except.
that the Loud duzaLion of observaLion is this Lime A3 weeks.
. =
Example 1=9, vaccination of pigs with DNA formulated with MieRIE-DOPE
It is possible to use, in place of the naked plaid DUA solutions described in Example 1.8, . solutions of . 57 = CA 02383367 2009-12-16 placmid DN. formularpd with DMRTE-DOPE. A gNA solution (containing one .or morc plammido according to Example =
1.6) at1 wg/Ial is prepared in 0.9% NaCl. A ttskIE-popg solution at 0..75 mM is prepared by taking up a iyophilicate of DMRIE-DOPE in a suitable volume of sterile distilled water.
The formation of the plasmid DNA-cationic lipid complexes is achieved by- diluting, In equal parts, the DMRIE-DOPE solution at 0.75 mM with the DNA solution at 1 ma/ml in 0.9t NAC1 The DNA solution is introduced gradually, with the aid of a syringe mounted with a 26O
needle, along the wall of the vial containing the cationic lioid solution so as to avoid the formation of thdlit. Gentle shaking is carried out as soon as Lhu two solutions have been mixnel. A composition comprising 0.375 mM DIE-DOPE and t00 g/m1 of DNA is finally obtained.
It is desirable for all the solutions used to be at room temperature for all the operations described above. The DNA/DMRIE-DOPE complex formation is performed at room temperature for 30 minutes before immunizing the pigs.
The pigs are then vaccinated according to the conditions' dAncribed in Examples 1.8.1. and 1.8.2.
= It should be clearly understood that the invention defined by the appended claims is not limited to the specific embodiments indicated in the .
description above, but encompasses the variants which depart from neither the scope nor the spirit of the .present invention.
=
=
-=

Summary Paragraphs 1.1. Tmmunngenic preparation or vaccine comprising, on the one hand, a plasmid encoding and expressing a gene selected from the group consisting of nRri of PCV-2, ORP2 of PCV-2, ORF1 of PCV-1 and ORF2 of pcv-1, aud, op the othel. hand, an element capable ot increasing the immune response directed against the product of expression of the gene.
1.2. Immunogenic preparation or vaccine according to paragraph.1.1,characterized in that the element capable of increasing the immune response comprises DMILTZ as adjuvant.
1.3. Immunogenic preparation or vaccine according to is paragraph 1.2, characterized in that the DIE is coupled to a umuLLal lipid.
1.4. Immunogenic preparation or vaccine according to paragraph 1. 3 , characterized in that the DMRIE is coupled Lo DOPE.
1.5. Immunogenic preparation or vaccine according to paragraph 1.1, characterized in theLL Lite element capable of increasing the immune response comprises a carbomer adjuvant.
1.6. Immunogenic preparation or vaccine according tn paragraph 1.1, characteri zed in that the element capable of increasing the immune response c:vinpLises a porcine cytokine.
1.7. Immunogenic preparation or vaccine according to paragraph 1. 6 , chere.cterized in the.l. Lhe porcine cytokine is GM-CSF.
1.8. Immunogenic preparation or -vaccine according to paragraph 1 . 6 or 1.7, chaxacteriz.wd in that it comprises a plasmid encoding and expressing the porcine cytokine.
1.9. Immunogenic preparation or vaccine according to 3 5 paragraph 1.1, charactezized LliaL the element capable of increasing the immune response comprises a porcine cytokine and a comceurld =elected from the group comprising nmarE,. DMRIE/DOPE and carbomer, as adjU.Van.L.
=
=

1.10. Iva logenic preparation or voccint iccording to .ainl one of paragraph: 1.1 to 1.9, characterized in that it comprises a plasmid encodina and axnrPssing another porcine immunogen.
=
=
=
= =
=

fi WC-A.7ply L.
CBOSS REFERENC.P, IP RELATED APPLICATIONS
=
Reference is mare to US Serial No. 09/082,35g, filed on May 21, 1998 and to U.S.
Serial No. 09/161,092 filcal on September 2.5, 199R as a Lontinuation-in-Part of Serial No. 09/0E2,55g.
IIELD.D.E.-TRE INVENTION
The present invention relates to modified poxviruses and to methods of marine and using the came. More in particular. the invention =lamb to recorabbrem ALVAC, which virus expresses gene products of porcine circovims 2 (PCV2). and to irnmimological compositions or vaccines which induce an immune rcspouso directed to PCV2 gent products and which confer protective immunity against infection by PCV2.
Severrd publications are referenced in this application.. Pull citation to these documents is found at the end of the specification preceding the claims. These documents pertain to thc field of this inventi9 = ytkeICCR0I1NO OF THE INVENTION
Postweanine multisystrnric wasting syndrome (PMWS) is a recently recognized disease of young pigs. PMWS is characterized clinically by progrcasive weight los.s and other symptoms such as tar-hyper-a, dyspnca and jaundice.

Pathologically, lyrophoeytic and granultunatous infiltrates, lymphadenopatity, and, more rarely, lymphoeytic and irr, anulomittous hepatitis and nephritia have been observed (Clark, 1997; Harding, 1997).
This disesac has been described in different Europwan countries in well as in North America_ Treatment and ;um-cation of this disease are not currently available.
Several lines of evidence point to porcine circovirus as the etiologic agent of PMWS (Ellis et al., 1998). Circoviroses have been recovered from pigs with PMWS, and antibodies to porcine oircovirus have been demonstrated in pigs with the disease.
Circoviruses are single stranded circular DNA viruses found in a range of animal and plant species. Porcine circoviros was originally isolated as a contaminant emu a comb:mous pig kidney cell line. The cell culture isolate has been designated PR-IS (Meehan et al- 1997). More recently, porcine aircovirus obtain' ed from pigs with PMWS has been compared to PXp15. Such viruses differ substantially from plc-Is at the nucleotide and protein sequel= level, and have been designated PCV2 (Mwban at al., 1998; Hamel at al., 1998).
' My SIS thirteen open reading frames (ORFs) have been identified in the PCV2 genome (COL1 to C0L/3 in the French patent application 98 03707). Four of those ORFa share substantial homology with analogous ORFs within the genome of PK-15. ORF1 (Meehan et al., 1998; corresponding to COLA in the French patent application 98 03707), comprising nt 3911-1342 ((lenBank accession number AF055392), has the poundal TO encode a protein with a predicted molecular weight of 37.7 ltD. ORF2 (Meehan at al., 1998; corresponding to COLI1 in the French patent application 9S 03707), comprising nt 1381-1758 joined to 1-314 (GenBank accession number AFO5S392), may encode a protein with a predicted molecular weight of 27.8 Id). ORM (Meehan et al.. 1998; corresponding to C0L7 in the French patent application 98 03707), comprising nt 1018-70 (GenRank arnession number AF055392), may encode a protein with a predicted molecular weight of 11.9 kD.
QRF4 (Meehan et al., 1998; corresponding to COL10 in the French patent application 98 03707), comprising nt 912-733 (CienBanic accession number AF055392), may mends a protem with a predicted molecular weight of 6.5 kD.
oRri of PCV2 is highly homologous (86% identity) to the ORP1 of the PK- =

15 isolate (Meehan et al., 1998). The ORF1 protein bf PIC-15 has been partially characterized (Meehan ct al., 1997 ; Ivlankertz et al., 1992a). It is known to be essential for virus replication, and is probably involved in the viral DNA
replication, Protein sequence identity between the respective ORP25 was lower (66%
identity) 1142,..? that of the ORFle but each of the ORP2s shared a highly conserved basic N-terminal region, similar to that observed in the N-tcno3inal region of the major structural protein of the avian oirsovirus chicken anemia virns (CAV) (Meehan et aL, 1998). Recently, Menke= et al. (1998b) has suggested that the ORF2 of the pr,15 isolate (designated ORP 1 in lviankertz et al., 1992b) codes for a eapsid proteia.
Greater differences were observed between the respective ma and ORP4e of the PK-15 isolate and PCV2. In each cast, there was a deletion of the C-terminal region of PCV2 01UZ4 and ORF3 compared to the corresponding OAPs present in the genome of the P1C-15 isolate. The highest protein sequence homology was observed at the Nterminal regions of both ORM and ORF4 (Meehan at al., 1992).
The transcription analytic of the genome of PC7V2 has not been published yet.
Recent data obtained with the PP-15 isolate indica.tod that the ORF2 transcript is splic-ed (Menke= et al., 1998b).
=

Vaccinia virus has been used successftilly to immunize against smallpox, culminating in the worldwide eradication of smallpux in 1980. With the eradication elf smallpox, a new role fox poxviruses became important, that of a genetically engiucered vector for the expression of foreign genes (Panicali and Paoletti, 1982;
Paaletti et a).. 1984). Genes =ceding heterologous antigens have been expressed in vaccinia,. often resulting in protective immunity against challen,ge by the =responding pathogen (reviewed in Tartaglia et al., 1990). A highly aturauated strain of vaccines, designated MVA, has also been used as a vector for poxvitus-based vaccines. Use of MVA is described intLS. Patent No. 5,185,146. , =
Two additional vaccine vector systems involve the use of naturally host-restricted poxviruses, avirunc viruses. Both fOwlpoxvirus (FPV; Taylor ot al.
1988a, b) and canarypoxvirus (CPV; Taylor et aL, 1991 & 1992) have been engineered to ssonss foreign gene products. Fowlpox virus (FPV) is the prototypic vu us of the =
Avipox genus of the Poxvirus rnily. Thu. virus causes an economically important disease Of poultry which has been well controlled since the 1920's by the use of live attenuated vaccines. Replicatirm of the avipox viruses is limited to avian species (Matthews, 1932) and there ate no reports in the literature of avipoxvitus causing a productive infection in any non-avian species including man. This host restriction provides an inherent safety barrier to trausmissian of the virus to other species and makes use of avipoxvirus based vaccine vectors in veterinary and human applications =
an attractive proposition.
FIN has been used advantageously as a vector expressing antigens from poultry pathogens. The hemagglutiisin protein of a virulent avian influenza virus was expressed in an FIN recombinant (Taylor et at, 19884 After inoculation of the = 64 recombinant into chickens and turkeys. an immune iesponsc was induced which was protective against either a homologous or a hoterologous virulcalt influenza virus challenge (Taylor et al., 19880. FF'V recombinants expressiug the surface glycoproteins of Neweasde Disease Virus have also been developed (Taylor et aL.
1990 ; Edbauer et al:, 1990).
Other attenuated poxvirus vectors have been prepared by genetic modifications of wild type strains of virus. The NYVAC vector, derived by deletion of specific virulence and host-range gents from the Copenhagen strain of vancinia (Tartaglia et 1992) has proven userul as a recombinant vector in eliciting s protective immune response against an expressed foreign antigen. =
Another engineered poxvirus vector is ALVAC, derived from canarypox virus.
ALVAC does not productively replicate in non-avian hosts, a characteristic thought to improve its safety profile (Taylor et al.. 1991 & 1992). Both ALVAC and NYVAC
are BSL-1 vectors.
One approach to the development of a subunit PCV2 vaccine is the use of live viral vectors to express relevant PCV2 ORPt.. Recombinant poxviruses can be constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of poxviruses such as the vaccinia virus and avipox virus desertl)ed. in U.S. Patent Nos., 4,769,330; 4.722.,848; 4.603,112; 5.110,567;
.5,174,993;
5,494.807; and 5,505,941.
It can thus be appreciated that provision of a PCV2 recombinant poxvirus, and of compositions and products therefrom particularly ALVAC based PCV2 recombinants and compositions and products therefrom, especially such recombinants containing ORPt 1 and/nr 2 of PCV2. and compositions and products therefrom wnuld be a highly desirable advance over the current state of technology.
0121.7ECTS AND ThIrMA3Y..Or THUNVENMON
It is therefore an object of this invention to provide compositions and methods for treatment and prophylaxis of infection with PCV2. it is also an object to provide a =
means to treat or prevent PMWS.
In one aspect, the present invention relates to an antigenic, immunological or vaccine composition or a therapeutic composition fez-Inducing an antigenic or immunological response in a host animal inoculated with the composition, said vaccine including a carrier and modified recombinant vials having inactivated nonessential virus-encoded genetic !Unctions so that the recombinant virus has attenuated virulence and enhanced safety. The virus used in the composition according to the present invention is advantageously a poXvires, particularly a vaccinia virus or tan avipox virus, such as fowlpox virus and canarypox virus and more particularly, ALVAC. The modified recombinant virus can include, within a non-essential region of the virus motile, a hetcrologous DNA sequence which encodes an antigenic protein, c.g., derived from PCV2 ORPs, e.g., PCV2 OR!' 1 and/or 2.
In yet mother aspect, the present Invention relates to an immunogenic cotnposidon contahling a modified recombinant virus having inactivated nonessential virus-encoded genetic functions so that the recombinant vtrus has anenuated virulence and enhanced safety. The modified recombinant virus includes, with a non-essential =
region of the virus genome a heterologous DNA sequence which encodes an antigenic protein (e.g., derived from PCV2 ORFs, especially ORES 1 enclior 2) wherein the composition, when administered to a host, is capable ariuducing on immunological response specific to the antigen.
In a still further aspect, the present invention relates to a modified recombintou virus having nonessenttal virus-encoded genetic functions inactivated therein so that the virus hiss attenuated virulence, and wherein the modified recombinant virus further contains DNA from a beterologous source in a none:3=del region of the virus genome. The DNA can code for PCV2 genes such as :my or all of PCV2 0371, ORF2, 0373, or 0AIP4 (Meehan et al. 1998). In particular, the genetic functions are inactivated by deleting an open ceding frame encoding a virulence factor or by utilizing naturally host-restricted viruses. The virus used =cording to the present invention is advantagemiSlY a PoXvirn-% particularly a vacoinia virus or an aviPox virus, such as fowlpos. virus or canarypox virus. Advantageously, the open reading = =
frame is selected front the group consisting of323., 3133. 3143., A26L, A563, ¨ 1C1L, and I4L (by the teuninoIogy maned lu. Goebel et al., 1990); and,, the combination therooL In this respect, the open reading frame comprises athysuldine Irinese gene, a hemorrhagic region, an A typo inclusion body region, a itemagghtfinin lieu; a host range gone region or a large subunit, ribonueleOtide redUctase;
or, die combination thereof. A suitable roodifled Copenhagen strain of vaceinia virus is identified as IslINAC (Tortaglia at al., 1992), or a vaceinia virus from which has been deleted 12.IZõ BI3R+1;114R, AWL., AMR., C7L-KI 1 and 14L or a thymidine Iciness , gene, a hemorrhagic region, an A type inclusion body region, a hentaggiutinin gene, a host range region, and a large subunit, ribormeleoticie reductase U.S.
Patent No. 5,364,773). Preferably. the poxvirus vector is an .ALVAC or, a eariarypox virus (Rentschler vaccine strain) which was attenuated, for instance, through more than 200 =

acrid passages on chick embryn fibroblasts, a master seed th=oftom was subjected to four successive plague purificatious under agar from which a plague clone was amplified through five additional passages.
The invention in yet a firther aspect relates to the product of expression of the Inventive recombinant poxvirus and uses therefor, such as to form antigenic, immunological or vaccine compositions fbr treatment, prevention, diagnosis or testing; and. to DNA from the Lcoombiriant poxvirus which is useful in constructing DNA probes 2nd PCR. primers.
In one aspect, the present Invention relates to a recombinant poxvirus containing therein a DNA sequence from PCV2 in a nomessential region of the poxvirus genome. The pow= is advantageously an avipox YLILS, such as fowlpox virus, especially an attenuated fowlpeot virus, or a canarypox virus, especially an =
attenuated csnarypoy virus, such as ALVAC.
According to the present invention, the recombinant poxvirus expresses gene products of the foreign PCV2. gene. Specific ORPs of PCV2 are inserted into the poxvirus vector, and the resulting recombinant poxvirus is used to infect an animal.
Expression in the animal of PCV2 gene products results in an immune response in the animal to PCV2. Thus, the recombinant poxvirus of the present invention may be used in an immunological composition or vaccine to provide a means to induce an immune response which may, but need not be, protective.
The administration procedure ful recombinant poxvirus-PCV2 or expression product thereof compositions of the invention such as immunological, antigenic or vaccine compositions or therapeutic compositions, can be via a pa:enteral route = 68 (intradermal, intramuscular or subcutaneous). Such an administration enables a systemic immune respoasc, or humoral or cell-mediated responses.
Moro generally, the inventive poxvinis- PCV2 recombinants, antigenic, immunological or vaccine poxvirus- PCV2 compositions or therapentric compositions can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical or veterinary art. Such compositions can be administered in dosages andby techniques well known to those skilled in the medical or veterinary arts taking into consideration such factors hs the age, sex, weight, species and condition of the particular patient, and the route of administration. The composition MIA be adirtinistered alone., or can be co-administeicd or sequentially a.chnizi.' istcred with compositions, e.g., with "other" immunological, antigenic. or vaccine OS

thcrapeutie compositions thereby providing multivalent or "cocktail" or combination compositions of the invention and methods employing them. Again, the ingredients and manner (seqweatial or co-adminiitration) of administration, as well as datgc:s can be determined taking into consideration such factors as the age, scot, weight, species and condition of the particular patient, and, the route of adminithation. in this regard, reference is made to 'U.S. Patent No. 5,843.4561 and directed to rabies compositions and combination compositions and uses thereof.
Examples of coinpositions of the invention include liquid preparations for orifice, e.8_, oral, nasal, anal, vaginal peroral, intragasuic, etc., narniiTistration such as suspensions, syrups km elixirs; and, preparations for parenteral, subcutaneous, intruder-mai, intramuscular or intravenous administration (e.g., injectable administration) such as sterile suspensions or emulsions. in such compositions the recombinant poxvirus or antigens may be in admixture with a suitable carrier, diluent.
or excipient such as sterile water, physiological saline, glucose or the like.
The compositions can also be lyophilix,-.A. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, adjuvants, yelling or viscosity enhancing additives, preservatives.. flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
Standard texts, such as "REMINGTON'S PHARMACEUTICAl SCIENCE-. 17th = mution, 19E5, may be consulted to prepare suitable preparations. Without undue experimentation. Suitable dosages can also be based upon the Examples below.
The compositions can contain at least one adjuvant compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of rnaleie anhydride end acetyl derivative.
The preferred adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-iinked, especially with polyallcenyl ethers of sugars or polyalcohols. These compounds arc known by the term carboxner (Phameuropa Vol.

8, No. 2, June 1996). Persons skilled in the art can also refer to U.S. Patent No.
2,909,462 which describes such acrylic polymers =as-linked with a polyhydroxylated compound having at least 3 hydroxyl ktoups, preferably not more than 8, the hydrogen atoms of at lsast three hydroxyls being replaced by unsauirated aliphatic radicals having at least 2 carbon atOMS. The preferred radicals are those ccraraining from 2 to 4 carbon atoms, e.g.
vinyls, allyls and other ethylc-nieally unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyL The products sold under the ntralt CarbOPOle (Br Goodrich, Ohio, USA) are particularly appropriate. They are cross-. linked with an ally' sucrose or with ally' pentaerytbritol. Among then., there may be mentioned earbopol 974P, 934P and 97IP.
Among the copolymers of =oleic anhydride and alkenyl derivative, the copolymers EMA (Monsanto) which are copolymers of. malcic anhydride and ethylene, linear or cross-linked, fbr example Laws-linked with divinyl ether, are ¨C --(CH2) x ¨C ¨(CH2) y co COON
preferred. Reference may be made to J. Fields et at.. Nature. 186: 778-760,4 Aloe 1960. =
From the paint of view of their structure, the polymers of acrylic or methaerylic acid and the copolymers BMA arc preferably foni-ied of basic uni=
of the fbllowiug formula:
in which :
R, and P.s, which are identical or different, represent H or CH3 - x0or1,preferab1yxl =
= y-1 or2,withx+yT2 =
For the copolymers EMAM, xV and y 2. For the caa-bomerN, = y-1.
The dissolution of these polymers in water leads to an acid solution which will bc neutralized, preferably to physiological pFl, in order to give the adjuvant solution into which the vaccine itself will be incorporated. The carboxyl groups of the polymer are then partly in COO' form Preferatly, a solution of adjuvant according to the invention, especially of carborner, is prcpined in distilled water, preferably in the presence of sodium chloride, = the solution obtained being at acidic pFl. This stock solution is diluted by adding it to =
the desired quantity (for obtaining t.be desired (null concentration), or a substantial part thereof, of water charged with NaCl. preferably physiological saline (NaCL 9 g/r) all at once in several portions with concomitant or subsequent neutralization (p11 7.3 to 7.4), in cfcrably with Na014. This solution at physiological pH will bc used. MS it is for mixing with the vaccine. which may be especially stored in freeze-dried, liquid or frozen form.
The polymer concentration in the final vaccine composition will be 0.01% to 2% w/v, more particularly 0.06 to 1% w/v, preferably 0.1 to 0.6% w/v_ The immunological compositions according to the invention may be associatc.d to at least one live. attenuated, inactivated, or sub-unit vaccine, or recombinant vaccine (e.g.
poxvirus as vector or DNA plastaid) expressing at least one immtmogen from -another pig pathogen.
= These and ether ensibodiments are disclosed or are obvious from and encompassed by aze Mowing detailed description.
3111TRF DESCRIElION OF TI-IC ITRAVVING.5 A barer understanding of the prestztt invention-will be had by referring to the accoutRzying drawings, in which:
= FIG. 2.1 (SEQ ID NO:16) shows the nucleotide sequence of a 3.7 ldlobasc pair fragment of ALVAC ANA containing the C6 open reading frame.
= FIG. 2.2 shows the map of pJP102 donor plasmid.
FIG. 2-3 (SEQ 11) NO:) shriws the nucleotide sequence of the 2..5 'diabase pair frasment from 01'102 donor plaschid from the Kpnl (position 651) to the Sad (position 3166) restriction site.s.
= FIG. 2.4 shows the irlaP of P-7105 donor Plasinid-. = FIG. 2.5 shows the map of prP107 donor pl2crnid. =
=

= FIG.2.6 (8BQ ID NO.11) shows the nucleotide sequence of the 3.6 kilobase pair agmcnt from pIP107 donor plasmid from the Kpal (position 653) to the Sad (position 42.5S)tes1iiction sites.
= t= n W. V NTION
The invention is directed to recombinant poxviruses containing therein a DNA
sequence frum PCV2 in a nonessential region of the poxvirns centime. The recombinant parviruses express gene products of the foreign PCV2 germ. In particular, ORF2 and O1F1 genes encoding PCV2 proteins were isolateri characterized and inserted into AJ.VAC (canatypox vector) recombinants. Thc molecular biology techniques used. are the ones described by Sambrook et al.
(1989).
çii Lings and Virus Strains. The strain of PCV2 designated Imp.1010-Stoen has been previously described (Meehan et a).., 1998). It was isolated from mesenteric lymph node tissues horn a diseased pig otir4nefiag from Canada. Cloning of the PCV2 gonorne was described by Meehan et aL (1998). Flasmid pGeta.7Z-Imp1010-Stoon-F.coR1 No. 14 contains the PCV2 gcriontc as anEcoRI fragment inserted into the EcoR1 site of pLasmid pGem-7Z (Pramega, Madison, WI)._ The complete n.ucleatide serpmce of the Imp.1010-Stoon PCV2 stain has been, dctconin.' ed by Meehan et al.. (1998) and is available under the Gentlank accession number AFOSS392_ The parental cauarypcot virus (Rentschler strain) is a traccinal strain for canaries. The vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passaes on chick embryo fibroblasts. A master viral seed was subjcott:d to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus WES

used es the parental virus in in vitro recombination tests_ Trio plaque purified . canarypoX isolate is designated ALVAC. ALVAC was deposited November 14, under the terms of the Budapest Treaty at the American Type Culture Collection, ATC:C accession number VR-2547-The generation of poxvirus recombinants involves diffestan steps: (I) construction of an insertion plasmid containiz3g sequences ("amie') flanking the = insertion lucus within the poxviruo genanie, anti multiple cloning site (MCS) localized between the. two flanking arms (e.g.. see Example 2.1); (2) construction of donor plasmids consisting of an insertion plastoid into the MCS of which a fnreivi gene .
expression cassette has been insetted (e.g,.. see Examples 2.2 to 2.5); (3) in vitru recombination in cell culture between the vans of the donor plasmic/ and the genome of the parental poxvirus allowing the insertion of the foreign gene expression cassette into the appropriate locus of the poxvirus genotne, and plaque purification of the recombinant virus (e.g. see Example 2.6). =
P0V2 recornhirumt immtmogetns may be used in association with PCVI
immnitogens, for inarnuni7-Ation of =basis against PMWS_ In a least preferred approach, PCV1 immunogens may be used without PCV2 immunogsais.
The present invention is additionally described by the following illustrative, non-limiting Br-ample:1.
Example 2.1 - CONSTRI1CTION OF CAN_ARVPQ.X TNRF.TITTON PLASivim AT Cf_LOCLIS
Figure 2.1 (SEQ ID NO:16) iS tbe sequence of a 3.7 kb segment of canarypox DNA. Analysis Of the sequence revealed an ORF designated C.67._ initiated at position =

377 and terminated at position 22S4. The following describes a C6 insertion plasmid constructed by deleting the C6 OPP rind replacing it with a multiple cloning site (MCS) flanked by transcriptional and irauslinional termination signals. A. 380 bp PCR
fragment was amplified from genomic canarypox DNA nsing oligonueleotide primers C6A1 (SEQ ID NO:21) and C6B1 (SEQ ID NO:22). A 1155 bp PCR fragment was amplified from genomic canszypor DNA using oligonucIeoride printer C6CI
(SEQ ID NO:23) and C6D1 (SEQ ID NO:24). The 380 bp and 1155 bp fragments were fused together by adding them together as template and amplifying a 1613 bp PCR
fragment using oligonucleotide primers C6AI (SEQ ID NO:21) and C6D1 (SEQ ID NO:24).
This fragment was digested with Sacl and Kpnl, and ligated into plilueseript SK+
(Strata2ene, La Jolla. CA., USA) digested with Sacl/KpnI. The resulting plamdd, pC6L was confirmed by DNA sequence analysis. It consists of 370 bp of canarypox DNA upstream of C6 ("C.6 left arm"), vaccinla early termirmliou signal, translation stop codans in six rr-aciing frames, an MCS containing Sraal, Pad., ithol and &val.
sites, vaceinia early termination signal, translation stop cottons in six reading frames and 115h bp of downstream canarypox sequence ("C6 rieu. arm").
Plasanid p.TP099 was derived from pC6L by Heating a cassette containing the vaccinia H6 promoter (described in Taylor et al. (1988c), GU or aL (1989), and Pedsus et al. (1989)) coupled to a foreign gcac into the SmaTJEcoRI sites of pC6L-This pl,=-fri;4p3P099 contains a unique Ece,RV site and a unique Nrzil site located at the 3' end of the 116 promoter, and a unique Sall site located between the STOP nodan of the foreign gene and the C6 left atra_ The --4,5 k'h EcoRV !Sall or NrullSaLt fragment from pJP099 COT11.2illS therefore thc pliistnid sequencc (pBluesoript SK+ ;
= Su:nettle, La. Jolla, CA, USA), the 2 C6 arms and the 5' end of the 116 promoter until the BooRV or Nru.I sits.
Sectimiszn of the_primers=
= Prirner C6A1 (SEQ
ID NO:21) prim= co/ (SEQ ID NO:22) GAATTCC.IfCCIACTCTOCAGCCCGGG i.i.fl I.A.TAGCTAATTAGTCA ______________ rrc GTA.AGTAAGT.A.I I I I ____ lATTTAA
Primer C6C1 (SEQ ID NO:23) CCC000CTGCAGCTCGAGGAATTL...111 liATTGATTAACTAGTCAAATGACI
TATATATAATICIAAAAA.GTAA
Primer C6D1 (SEQ ID NO:24) GATOA.TOGTACCTTCATAA.ATACAAGITTGATTAAACTTAA.GTTG
Example 2.2 - c,VISTRUCTION AT.VA(.1DONOTULASUID POT;
pcv" olz fez Plasmid pCrem7Z-Irnpl 010-Stoois-fr.oRT No. 14.=containing the PCV2 gcaeme as eaEcoRI fragment in plasmid pGem-7Z, was digested vAthEcon end a I7686p fragment was isolated and ligated. .
In order to iusart PCV2 ORF 2 into an appropriate ALVAC insertion vector:
Primers 111760 (SEQ ID NO:25) and JP773 (SEQ ID NO:26) were used to amplify PCV2 ORF 2 from the I768bp ligatcd EcoRI fraement (see above) resulting in PCR

11304. Primer 3P760 (SEQ ID NO:25) contains the 3' end of the H6 promoter from = EcoRV =date 5' end of PCV2 oRr 2. Primer 1P773 (SEQ ID NO:26) contains the 3' = end ofPCV2 011.F 2 followed by a Sall site. The product of PCR 11304 was then digeeted with EenRV/Sail and cloned as a ¨750 bp fragment into a ¨CS kb EcoRVISall fragment from pI1099 (see above in Example 2.1).. The resulting plasmid was confirmed by sequence analysis and designatml pJP102 (see the map of p/P102 in Figure 2.2 and the sequence (SEQ ID NO:8) in Figure 2.3). The sequence of OAF

matelics sequence available in Gentlank, Accession Number AP055392. The donor plasmid p]11102 (linearized wilt Nod) was used in an in vizro recombination (TVR) = =
test to gem:tate ALVAC recombinant vCP1614 (see Example 2.6).
SPAN enGe Of the prim=
JP760 (SEQ ID NO:25) CAT-CAT-CAT-GAT-ATC-CGT-TAA-OTT-TGT-ATC-GTA-ATG-ACG-TAT-CCA.-AGG-AGG-CG
.7773 (SEQ ID NO:26) TAC-TAC.TAC-GTC-GAC.-TTA-CiGG-TIT-AAG-TGO-GGG-CTC
Example 2.3 esINSTRUCTION OF AN ALLVAC TIMOR PLASMID FOR
PC'V7 ORF2 AMID e =
PCV2 ORP 1 was amplified by PCB. using primars 2P774 (SEQ lD NO:9) and .11775 (5E0 ID NO:10) MI plasaaid pGem7Z-Inrp1010-Stoon-Eco.RI No. 14 resulting in PCP. 31311. Primer IP774 (SEQ ID NO:9) contains the 3' end of the 116 protnnter from NruI and the 5 cud of PCV2 ORF1. Primer TP775 (SEQ ID NO:10) contains the .3' end of PCV2 ORF1 followed by a Safi site. The product of PCR 31311 (-'1 Kb) was cloned into pCR2.1 (Invitrogen, Carlsbad, CA). The resulting plasmid was confillned by sequence analysis and designated pJP1M. The sequence uroBri matches sequence available in GenBank, Accession Number AF055392. A ¨970 bp Nrul/SaZI fragment was isolated from 011104 and cloned into a ¨4.5 kb .Nrul Sall fragment from pIP099 (see Example 2.1), resulting in a plesmid which was confirmed . by restriction eaalysis and designated ?DIOS (see Figure 2.4). The donor plastnid pIP105 could be used in an in vitro -recombination test ( Example 2.6) tode-scribed in fenerate AINAC recombinant =pressing the PCV2 ORF1. =
A ¨838bp BarnIIIISall from piP102 (see Example 2.2) was blunted u_ving the Klenow frarnent of DNA poiymerase, and was cloned into the Klenow-blunted Ecel sitc of 01'105. Clones were checked for orientation of insert by restriction analysis and a head-to-head orientarion was chosen. This plasuild was confirmed by sequence analysis %Ind designated p3I3107 (see the map of p3PI 07 in Figure 2.5 atxi The sequence (SEQ ID 140:11) in Figure 2.6). The nor pd p1P107 (1.1Licalizod with Nna) was used in an in vitro recombination 5 (IVR) test to generate the ALVAC
recombinant vCP1615 (Bee Example 2.6)..
5.KU21122411112.1263:11=i 31:3774 (SEQ 11) NO:9) CAT-CAT-CAT-TCG-CC3A-TAT-CCG-TTA-ACT.TTG-TAT-CGT-A AT-GCC-C.AG-CAA-GAA-GAA-TGG

JP775 (SEQ NO:10) TAC-TAC-TAC-GTC-GAC-TCA-GTA=ATT-TAT-TTC-.ATA-TC.iti Example 2.4 .c_QEEmszrgias2LeasAanQN_QR.ELAsmmmR.
pcvl ORM
Placmid pPC7. (1-.1. Meehan et al. J. Gen. Virol. 1997. 78.221-227), containing the PCV1 ganome as a PstI fragment in plasrnid pGern-7Z, was used as a template to amplify the PCV1 ORFZ.
In order to insert PCV2 ORF 2 into an appropriate ALVAC insertion vector ?this= 31'787 (SEQ ED NO:12) mid JF792 (SEQ ID NO:73) were used to amplify PCV1 ORF 2 from plasmid pPCV1 (see above) resulting in PCR .71315. Primer W787 (SEQ ID NO:12) contains tbe 3' end of the H6 promoter from F.coRV and ORF 2 . followed by a Sian site. The product of P. 71315 was awn &gusted with EcoRWSu11 and cloned as a -.750 bp frapnent into a -4.5 kb EttoRV tragraent from RIP099 (see above in Example 2.1). The resulting plaszuld was confirmed by sequence analysis and designated p.71'113. The coquence of ORP 2 =Latches sequence available in GenBank, Accession Number1349186. The donor plasmid p11'113 (linearized with 'vel(I) was used in an in virro zucombinarion (TVR) test to generate ALVAC recombinant vCP1621 (sec Example 2.7).
Sequence of the primers-JP7S7 (SEQ ID NO:12) CAT-CAT-CAT-GAT-A.TC-CGT-TAA-L41. i. -TGT-ATC.-GTA-ATG-ACG-TGG-=
CCA-AGG-AGG-CG

jr788 (SEQ ID NO:13) TAC-TA.C-TAC-GTC-GAC-7TA-TTT-ATT-TAG-AGG-GTC-TTT-TAG-Ci Example 2.5 - LIINSIEILZELON OF AN_ALVAC_PON a ' A. La I. I

Plaemid pPCV1 (Kee Example 2.4 above), containing ux pcvi gnome P.S11 fragment in plasmid pGcm-7Z, was digested with Pstl, and a 1759 bp fragment was isolated and ligated.
Primers JP789 (SEQ ID NO:14) and 1P790 (SEQ ID NO:15) were used to amplify PCV1 ORFI from the 1759 bp ligared Pstl fragment (see above), resulting in PCIR..11316. Primer JP789 (SEQ ID NO:14) contains tho 3' end of the 116 promoter from Nrul and the 5' cad of PCV1 ORF1. Primer J1P790 (SEQ ID NO:15) contains the 3' end of PCV1 ORF1 followed by a Sail site. The product of PCR J1316 (-1 n) . was cloned into pCR2..1 (Invitrogen, Carlsbad, CA). The resulting plaernid was confirmed by sequence analysis and designated plP114. The sequtaace of ORF1 Maid= sequence available in ClunBank, Accossiou Number U49186. A ¨970 bp Nrul/Sair fragment was isolated froze )311'114 and cloned into a-4.5 kb NruilSall fragment from p1P099 (see Example 2.1), resulting in a plasmid which was confirmed by restriction analysis and designated 01'115. The donor plasmid p1P11 could be used in an in vitro recombination test (described in Example 2.7) to scar:rate ALV.A.0 recombinant expressing the PCVI ORF1.
=
=

Example 2.4) w2S bit:trued using the A ¨838bp BarnHI/Sall from p3P113 (see Klenow fragment of DNA polymer, and was cloned into the Mellow-blunted EcoRI site of p.TP115. Clones wet c checked for orientation. of insert by restriction analysis iuni a head-to=head orientation was chosen- This plascnitl was confirmed by sequence analysis and designated p=7117. The donor plasmid pW117 (linearized With Notl) vras used in an in vitro recombination (1VR) test to generate thc ALVAC
recombinant vCP1622 (see Example 2.7).
= cwt.= dthe prim=
JP7139 (SF.Q 1.1) NO:14) CAT-CAT-CAT-TCG-CGA-TAT-CCG-TTA-AGT-TTG-TAT-CGT-AAT-GCC-AAG CAA-GAA-AAG-CCIU
3P790 (E ID 11/410:15) =
TAC-TAC-TAC-GTC-GAC-TC-A-GTA-ATT-TAT-TIT-ATA-TGG ' Example 2.6 = GENEZATION OF AL,VAC,PCV2,. RECOMItTN ANTS
Plasreids p..7102 Example 2.2 and Figure 2.2) , A õ
and r(SCO Example 2.3 ' - = and Figure 2.5) were linearized with Noll and transfeernd into ALVAC infected primary = CEF cells by rising the calchun phosphate precipitation method previously described (Panicali and Paaletd, 1982 ; Picculi et aL, 1987). Positive plaques wcro selected on thebasis of hybridization to specific PCV2 radioleboled probes and subjected to tour sequential rounds of plaque purification until n pure population was achiovcd.
Onc representative plaque from each IVR was then amplified and tic resulting ALVAC
=

recombinants were designated vCP1614 and vC111615. The vCF'1614 virus is the result of recombination events between ALVAC and the donor plasmid pJ12102, and it contains the PCV2 ORF2 inserted into the ALVAC C6 locus. The vCP1615 virus is the re.sult of recombination events between ALVAC and the donor plastniapir 107, and it contains the PCV2 ORF2 and ORF1 inserted into the ALVAC C6 locus in a head-to-head orientation.
In a similar fashion, a recombinant ALVAC expressing only PCV2 ORFI can bc generated using the donor plasmid pIP105 described in Example 2.3.
Trntrarnoiluorescenee. In order to determine if the PCV2 proteins were expressed in ALVAC recombinant infected Vero cells, imuzunefluorcacenoe (1--F) analysis was performed. Infected Vero cells wore washed with PBS 74 hrs after infection (mai of approx. 10) and fixed with 95% cold anemia fur. 3 minutes at roam tempernnire. Five monoclonal antibody (MAb) preparations (hybridoma supernatant) specific fur PCV2 ORP1 (PCV2 199 1D3GA. & PC:V2. 210 7050D) oz ORF2 (PCV2 190 4C7CF, PCV2 190 2B1BC & PCV2. 190 3A8BC) were used as the first antibody-.
These Specific monoclonal antibodies were obtained from Metial-Lyon.
Monoclonal antibodies can also be obtained following the teachings of doctuncnts cited herein, e.g.
'US_ Ser. Nas. 09/082_358 and 09/161,092, The IF
reaction was peziormed as descaibed by Taylor et al, (1990).
PCV2 specific immtmotlnorescence with the duce 0BM-specific antibodies could be detected in cells infected with vCP1614 and cells infected with vCP1615.
PCV2 specific imeaunefinere-seence with the two ORP1-specific antibodies could be detected in celliinfeeted with vCP1615 only. These results indicated that, as expected, vC.11614 expresses oely.ORF2, whereas vCP1615 explesses both ORFI

and or,rz. No fluorescence was detected in parental ALVAC infected Vero eells, nor in uninfected Vero cells.
Example 2.7 ¨ GrNF.RATION 1.1F" ALVA C-PC_V1 RECOMIINANZE
PlasMids pIP113 (sec Example 2.4) and p.IP 117 (tee Example 2.5) were linearized with Nail and transfected into ALVAC Infected primary CEF cells by using thc calcium phosphate precipitation method previously described (Panicali and Paoletti, 1982; Pieeini et al., 1987). Positive plaques were selected on the basis of hybridisation to specific PCV1 rediolabeled probes and subjected to four sequential rounds of.
plaque purification until a pure population was arthived. One representative plaque front each IVR was then amplified and the resulting ALVAC recombinants were desiZnated vCP1621 and vCP1622. The vCP1621 virus is the rem+ of recombination events between ALVAC and. the donor plasmid pJP113. and it contains the PCV1 =

ORM inserted into the ALVAC C6 locus. The vC1'1622 virus is the =oh of recombination events between ALVAC and the donor plasrnid pJP117, and it contains the PCV1 O1F2 and ORFI inserted into tbe ALVAC C6 locus in a head-to-head orientation.
'La st similar.fashion, a recombinant ALVAC expressing only PCV1 OR31 can be generated using tbe donor plasmid p.TP115 described in Example 2.5.
knrrignoiluoritcenrte. In order to determine if the PCV1 proteins were expressed in ALVAC recombinant infected Vero cells, iratuunoftuorescenr.e (IF) analysis was performed. Infected Vero cells were washed with PISS 241115 after infection (nLo.i. of app. rox. I 0) and fixed with 95% cold action dor 3 minutes at mom temperature. A specific anti-PCV1 pig polyelonal scrum (Allan G. e/ aL Vet.
=

1ViiczobioL 1999. 66: 115-123) was used as the first antibody. Tlic LE
reaction was performed as described by Taylor ei al. (1990).
PCV1 specific immunofluorescence could be detected in cells infected with vCP1621 and cells infected with vCP1622. These result; indicated that, as expected, vCP1621 and vCP1622 express FCV1-specific products. No fluMeSCence was detected with a PCV2-specifir. pig polyclonal serum in cells infected with vCP1621.
and in cells infected with vCP1622. No fluorescence was detected in parental ALVAC
infr.eted Vero cull; nor in uninfected Vern cells.
Example 2.8; FORMULATION a = ki = e it WITH CARD 0_1017'4974P
For the preparation of vaccines, recombinant eanatypox virusm vCP1614 and vCP16151 (Example 2.6), can be mixed with solutions of earborner. Iii the saute f7c=ilion, recombinant c.anarypox viruses van 621 and vCP1622 (Example 2.7) can he mixed with solutions of carbomer. The carbomer component used for vaeciusliou of pigs according to the present invention is the CarbopolTM 974? manufactured by the company Dr Goodrich (moleenlar weight of 3,000,0011). A 1.5 % Carbopol114 974?

stock solution is first prepared in distilled water contmiping 1 el of soditmi chloride.
This stock solution is then used for manufanturing a 4 mg/tal Carbopoim 974?
solution in physiological water. The stock solution is mixed with the requited volume of physiological water, either in one step tn in several successive step;
adjusting the pH value at each step with a 1N (or more concentrated) sodium hydroXide Spina=
to get a final pH value of 7.3-7,4. This final CarbopoPm 974P solution is a.
ready-to-use solution for reconstituting a lyophilized recombinant virus or for dilutina a =

=

concentrated recombinant virus stock. For example, to get a final viral suspension containing 1(11 pfu per dose uf 2 ml, ono can dilute 0,1 ml of a 1 0s9 pfu/nil cock solution into 1,9 ml of the above Carbopollm 9141' 4 me/m1 ready-to-use solution. In the same fashion, Carbopoirm 974? 2 mghnl rr.ady-to-use solutions can also be prepared.
Example 2.9 ¨ imiyrurazATIors or PIGS AND SUBSEQUENT CHALLENGE
2.91 IIIIMUNTLZATIM 1W! DAY-OLD Pr(iLF-ra Groups of piglets, carsazian-dcrived at Day 0, are placed into isolators. The piglets c vaccinated by intramusen)ar route at Day 2 with various vaccine solutions.
Vaccine viral stmpensions are prepared by dilution of recombinant viruses stocks in sterile physiological water (liaC1 0.9 %). Suitable ranges far viral fillSpensions can be determined errtpiracally, but will generally range from 106 to I Ow, and preferably about 10. ...pfu/dose. Vaccine solutions can also be prepared by mixing the = recombinant virus suspension with a solution of Cathopo11'4 974P, as deseeibad in Example 2.8.
Piglets are vaccinated either with Recombinant virus vCP1614 (Example 2.2) =
Recombinant virus vCP1615 (Example 2.3) Recombinant virus vCP1614 mixed with Carbopol (4 ing/m1 solution) Recombinant virus vCP1615 mixed with Corhopol (4 mg/m1 solution) The viral suspensions ccmtain 10% plaque fanning units (pru) per dose. Bach viral suspension is injected by ituratuuscular route under a volume of 1 nil. The =
= intramuscular injection is administered into the muscles of the neck-= =

'Two injections of viral suspensions arc aarni.nistcred at Day 2 and Day 34 of the experiment. A challenge is done on Day 21 by an oronasal administration of a viral s-uspension prepared from a culture of PCV-2 virulent strain. After challenge, piglets arc monitored during 3 weal= for clinical signs specific nf the post-weaning multisystemie syndrome. The following signs aro scored :
Rectal tcorprzature : daily monitoring for 2 weeks post-ch2llenge, then 2 measures of rectal temperature during the third week.
Weigbt : piglets are weighed right before the challenge, and then weekly during the first 3 weeks post-challenge.
Illnnd samples are taken at Day 2, day 14, Day 21, Day 28, Day 35 and Day 42 of the experiment in order to monitor viremia levels and anti-PCV-2 specific antibody titers.
Necropsies: at Day 42, all surviving piglets are humanely enttmnizml and uccropsicd to look for specific PWMS macroscopic lesions. Tissue samples are prepared from liver, lymph nodes, cpleen, kidneys and throtts in artier to look for specific histologiCal lesions.
2.9.2. WITITTNIZATI c_ar.z./E1C-QI,13 PIGLETS
5-7 week-old piglets, free of anii-PCV-2 specific maternal antibodies, are vaccinated by in route with various vaccine solutions. Vaeciac viral suspensions are prepared by dilution of tecombinant -viruses stooks in sterile physiological water (NaC10.9 %). Vaccine solutions can also be prepared by mixing the recombinant virus suspensicm with a solution of Carbopolm, 9741", as described in Example 2.8.
Piglets are vaccinated either with :
Recombinant virus vCP1614 (Example 2.2) =

Recombinant Vir1.15 VCP 61 5 (Example 2.3) Recombinant virus vCP1614 mixed with Carbopol (4 mg/ml solution) Recombinant virus vCP1615 mixed with Carbopnl (4 mg/ml solution) Tho viral suspensions contain 108 plaque forming units (pfu).per dose. Each viral suspension is injected by intramuscular route under a volume of 2 mL The intramuscular injection is adrrthrktered into the museles of the neck.
Two injections of the viral =suspensions arc administered at Day 0 and Day 21 of the experiment. A clallengc is done at Day 35 by an oronasal Administration of a viral suspensiop prepared from a culture of PCV-2 virulent strain. After challenge, piglets are monitored during 8 weeks for clinical signs specific of the post-weaning multisysternic syndrome. The clinical monitoring is identical to the one described in Example 2.9.1. except that total duration of monitoring is 8 weeks instead of 3 weeks.
Necropsies arc done throughout thc experiment for piglets dying from the challenge and at the end of the experinseast (Day 97) for all surviving piglets. Tissue samples are = thc sarne.113 deSClibed in Example 2.9.1.
=

BEPIRRENCEC
1. Clark, B.O. Proc. AnIcr. Assoc. Swine ?net., pp.. 499-501 (1997).
Edbaucr, C., R. Weinberg, J. Taylor, A. Rey-Senelonge, LP. Bouquet, P.
Dearneuro and E. Paoletti, Virology 179, 901-904 (1990).
3. Ellie, J., L. Hanard, E. Clark, L Hauling, G. Allan, P. Willson, J.
Stralcappeõ
X. Martin, F. McNeilly, B. Meehan, D. Todd, D. Haines, Can. Vet. J. 39, 44-51 (1998).
4. Goebel. G.P. Johnson, M.E. Peticus, S.W. Davis, LP. Winslow, B.
PaoIelti, Vinilogy 179, 247-266, 517-563 (1990).
5. Gus, P., S. Goebel, S. Davis, M.B. Perkin, B. Languti, P. Desmettre, G.
and E. Paoletti, S. Viral. 63, 41894198 (1989)-6. Hamel, AL., L.L. Lin and G. P.S. Nayar, J. Visa 72, 5262-5267 (1998).
7. Harding LC., Proc. Mn. Assoc. Swine Pram. 28,503 (1997).
E. Mankertz, A., J. Ivlanktatz., K. Wolf H.-J. Bak, Geri- Viral- 79,381-(1998a).
9. Mankertz, J., H.-J. Buhk, G. Bluest, A. Masilcertz, Virus Gene 16. 267-(1998h).
10. Matthews, ILEX., Interviroingy 17.42-44 (1982)-11. Meeban,13.1V1., J.L. Cream, M.S. McNulty,' D. Todd, T. Gen. Virol. 72, 227 (1997).
12. Meehan, B.M., P. McNealy, D. Todd, S. ICemierly, V.A. JewhUrst, 3.A. UL

L.E. Hassard, E.G. Clark, D.M. Haines, G.M. Allan, J. Gen. Vicrul. 79, 2171-2179 (1998).
13. Nayar, G.P.S., A. Hamel and L. Lin. Can. Vet. J. 38, 385-386 (1997).
14. Panicali, D, and E Panletti, Proc. Natl. Acad. Sci. USA 79,4927-4931 (1982).
15. Paoletti, Lipinskaks, C. Sauisonoff, S. Mercer, and 13. Panica1i, Proc.
Natl. Acad. Sci. U.S.A. 81. 193-197 (1984).
1.6 Perkus, ME.. K. Limbach, and E. Paoletti, J. Viral. 63, 3829-3836 (1989)-17. Piculuis'A., M.B. Perkus, and B. Paoletti, In Methods in Enzyroolugy, Vol.
153, eds. Wtt, it, and Grossman, L., (Academic Press) pp. 545-563 (1927).

=

=
18. sambreek, J., ES. Fritsch, and T. Marnatis, In Maitcuiar cloning: A
laboratcny manual, 2nd edition, (Cold Spring Harbin Prom, NY) (1999).
19. = Tartanlia, J., J. Winslow, S. Goebel, 02. Johnson, J. Taylor, and E.
Paoletti, J.
Gen. Virol. '71, 1517-1524 (1990).
20. Tartaalia, J., Pericus ME, Taylor 3, Norton EIC, Audonnat JC, Cox WI, Davis SW, van der Hoeven I, Meignior B, Riviera M, and E. Paoletti. Virology lad' 217-32 (1992).
21. Taylor, .1.. It Weinberg, B. Languet, Ph. Desmettra and!. Pauletti, Vaccine 6, 497-503 (1988a).
22 Taylor, 3. and E. Paolerti., Vaccine 6,466.468 (19886).
23. Taylor, J., R. Weinberg, Y. KAWROka, R. Webstcr and E. Paoletti, Vaccina 6, 504-508 (1988c).
24. Taylor, J., C. Edhauer, A. Rey-Sentlungc, IF. Bouquet, R. Norton, S.
Goebel, P. Destnettre and E. Paoletti, J. Virol. 64, 1441-1450 (199(1).
25. Taylor, J., C. Trimarchl, R.. Wcinberg, B. Languet, F. Guillentini P.
Dosmerde and E. Paolcal, Vanoino 9, 190-193 (1991).
= 26. Taylot 3, Weinberg R, Tartaglia 3, Richardson C, 0, Briedis D, Appel NT, Norton E, Paoletti E., Virology187, 321-328 (1992).
27. Todd, D., RD. Niagro, B.W. Ritohic, W. Curran, G.M. Allan, P.D.
Luken, X.S. Latimer, w_L. Steffens, M,S. McNulty, Arch. Viral. 117, 129-135 (1991).
=

Summary Paragraphs 2.1. A recombinant virus comprising DNA from porcine ciroovirus 2.
2.2, The recombinant virus of paragraph 2.1 which is a poxvirus.
2.3. The recombinant poxvitus of Paragraph 2.2 which is an avipox virus.
2.4. The recombinant avipox virus of paragraph 2.3 which is ALVAC.
2.5. The recombinant ALVAC virus of, paragraph 2.4 wherein the DNA from porcine circovirus 2 codes for anti is expressed as the porcine circoviras major eapsid protein.
2.6. The recombinant ALVAC virus of Paragraph 2.4, wherein the DNA from porcine CITCOViTUS 2 COI1SiStS of the open reading. frame 2 (ORF2) of porcine cirr,ovirus 2.
2.7. The recombinant ALVAC virus of, paragraph 2.4,wherein the DNA from porcine ciroovirus 2 consists of the open reading frame 1 (O1F1) of porcine circovirus 2.
2.8. The recombinant Al....VAc virus of paragraph 2.4, wherein the DNA from porcine circovinis 2 consists of the upou roerling franaes 1 and. 2 (CIRF1 and 2) of-Imo:Inc circovims.
2,9. The recombinant ALVAC virtu of paragraph 2.4 which is vCP1614 or vCP1615.
Ito. An immunological composition for inducing an immunoloaical response in a host inoculated with the immunological composition, the immunological composition comprisine a carrier and the recombinant virus of paragraph 2.1.
. 2.11. Atl, immunolotoal composition for inducing an immunological tesponse in a. host inoculated with the immunological composition, the immunological composition comprising a carrier and the recombinant virus of paragraph 2.5.
=

2.12. An immunological composition for inducing an immunological rcsponse in a host inoculated with the immunological composition, the immunological composition comprising a carrier and the recombinant virus of Paragraph 2.6.
2.13. An immunological composition for inducing an irrmiunol rocal response in a host inoculated with the immunological composition, the immunological composition compri.sing a carrier and the recombinant virus of paragraph 2.7.
2.14. An immunological composition for inducing an inonunological response in a host inoculated with the immunological compositioia, thc immunological composition comprising a carrier and the recombinant virus of paragraph 2.8.
2.15. An immunological composition for inducing an immunological response in a host inoculated with thc immunological composition, the immunological composition - comprising a carrier and the recombinant virus of paragraph 2.9.
2.16. A method for indtininfr an immunological response in a host comprising administering to the host the immunological composition of Paragraph 2.11.
2.17. A method for inducing an immunological response in a host comprising kulniinistering to the host the immunological composition of paragraph 2.12.
2.18. A method for inducing an immunological response in a host comprising riirering to the host the-Immunological composition of paragraph 2.13.
2.19. A method for inducing an immunological rcsponsc in a host comprising administering to the host the inurnmological composition of paragraph 2.14.
2.20. A method for inducing an immunological response in a host comprising administering to dm host the immunological composition of paragraph 2.15.

SEQUENCE LISTING
<110> Merial, University of Saskatchewan and The Queen's University of Belfast.
<120> Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2.
<130> P020090EP
<140> PCT/EP00/08781 <141> 2000-08-28 <150> US 60/151,564 <151> 1999-08-31 <150> US 09/583,350 <151> 2000-05-31 <160> 36 <170> PatentIn version 3.3 <210> 1 <211> 1767 <212> DNA
<213> Porcine circovirus <400> 1 aattcaacct taacctttct tattctgtag tattcaaagg gcacagagcg ggggtttgag 60 ccccctcctg ggggaagaaa gtcattaata ttgaatctca tcatgtccac cgcccaggag 120 ggcgttctga ctgtggttcg cttgacagta tatccgaagg tgcgggagag gcgggtgttg 180 aagatgccat ttttccttct ccagcggtaa cggtggcggg ggtggacgag ccaggggcgg 240 cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctccg gtaacgcctc 300 cttggatacg tcatatctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc 360 ggcagcggca gcacctcggc agcacctcag cagcaacatg ccgagcaaga agaatggaag 420 aagcggaccc caaccccata aaaggtgggt gttcactctg aataatcctt ccgaagacga 480 gcgcaagaaa atacgggatc ttccaatatc cctatttgat tattttattg ttggcgagga 540 gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca 600 gacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagcgaaagg 660 aacagatcag cagaataaag aatactgcag taaagaaggc aacttactga tggagtgtgg 720 agctcctaga tctcagggac aacggagtga cctgtctact gctgtgagta ccttgttgga 780 gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg 840 cgggctggct gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagactaa 900 tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc 960 agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg 1020 tgaagaagtg gttgttattg atgactttta tggctggctg ccctgggatg atctactgag 1080 actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc 1140 ccgcagtatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt 1200 cccagctgta gaagctcttt atcggaggat tacttccttg gtattttgga agaatgctac 1260 agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt 1320 tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat 1380 taagggttaa gtggggggtc tttaagatta aattctctga attgtacata catggttaca 1440 cggatattgt attcctggtc gtatatactg ttttcgaacg cagtgccgag gcctacgtgg 1500 tctacatttc cagcagtttg tagtctcagc cacagctggt ttcttttgtt gtttggttgg 1560 aagtaatcaa tagtggaatc taggacaggt ttgggggtaa agtagcggga gtggtaggag 1620 aagggctggg ttatggtatg gcgggaggag tagtttacat aggggtcata ggtgagggct 1680 gtggcctttg ttacaaagtt atcatctaga ataacagcac tggagcccac tcccctgtca 1740 ccctgggtga tcggggagca gggccag 1767 , ' <210> 2 <211> 1767 <212> DNA
<213> Porcine circovirus <400> 2 aattcaacct taacctttct tattctgtag tattcaaagg gcacagagcg ggggtttgag GO
ccccctcctg ggggaagaaa gtcattaata ttgaatctca tcatgtccac cgcccaggag ggcgttttga ctgtggttcg cttgacagta tatccgaagg tgcgggagag gcgggtgttg aagatgccat ttttccttct ccagcggtaa cggtggcggg ggtggacgag ccaggggcgg cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctccg gtaacgcctc cttggatacg tcatatctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc ggcagcggca gcacctcggc agcacctcag cagcaacatg cccagcaaga agaatggaag aagcggaccc caaccccata aaaggtgggt gttcactctg aataatcctt ccgaagacga gcgcaagaaa atacgggatc ttccaatatc cctatttgat tattttattg ttggcgagga gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg taaagaagga gacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagcgaaagg aacagatcag cagaataaag aatactgcag taaagaaggc aacttactga tggagtgtgg agctcctaga tctcagggac aacggagtga cctgtctact gctgtgagta ccttgttgga gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg cgggctggct gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagactaa tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg 1020 tgaagaagtg gttgttattg atgactttta tggctggctg ccctgggatg atctactgag 1080 actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc ccgcagtatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt cccagctgta gaagctcttt atcggaggat tacttccttg gtattttgga agaatgctac agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat taagggttaa gtggggggtc tttaagatta aattctctga attgtacata catggttaca 1440 cggatattgt attcctggtc gtatatactg ttttcgaacg cagtgccgag gcctacgtgg 1500 tctacatttc cagtagtttg tagtctcagc cacagctgat ttcttttgtt gtttggttgg 1560 aagtaatcaa tagtggaatc taggacaggt ttgggggtaa agtagcggga gtggtaggag 1620 aagggctggg ttatggtatg gcgggaggag tagtttacat aggggtcata ggtgagggct gtggcctttg ttacaaagtt atcatctaga ataacagcac tggagcccac tcccctgtca 1740 ccctgggtga tcggggagca gggccag <210> 3 <211> 1768 <212> DNA
<213> Porcine circovirus <400> 3 aattcaacct taaccttttt tattctgtag tattcaaagg gtatagagat tttgttggtc ccccctcccg ggggaacaaa gtcgtcaata ttaaatctca tcatgtccac cgcccaggag ggcgttctga ctgtggtagc cttgacagta tatccgaagg tgcgggagag gcgggtgttg aagatgccat ttttccttct ccaacggtag cggtggcggg ggtggacgag ccaggggcgg cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctgcg gtaacgcctc cttggatacg tcatagctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc ggcagcggca gcacctcggc agcacctcag cagcaacatg cccagcaaga agaatggaag aagcggaccc caaccacata aaaggtgggt gttcacgctg aataatcctt ccgaagacga gcgcaagaaa atacgggagc tcccaatctc cctatttgat tattttattg ttggcgagga gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca aacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagccaaagg aactgatcag cagaataaag aatattgcag taaagaaggc aacttactta ttgaatgtgg agctcctcaa tctcaaggac aacggagtga cctgtctact gctgtgagta ccttgttgga gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg cgggctggct gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagaccaa tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg 1020 tgaagaagtg gttgttattg atgactttta tggctggctg ccgtgggatg atctactgag 1080 actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttgtc ccgcagtatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt , ' cccagctata gaagctctct atcggaggat tacttccttg gtattttgga agaatgctac 1260 agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt 1320 tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat 1380 ttagggttta agtggggggt ctttaagatt aaattctctg aattgtacat acatggttac 1440 acggatattg tagtcctggt cgtatatact gttttcgaac gcagtgccga ggcctacgtg 1500 gtccacattt ctagaggttt gtagcctcag ccaaagctga ttccttttgt tatttggttg 1560 gaagtaatca atagtggagt caagaacagg tttgggtgtg aagtaacggg agtggtagga 1620 gaagggttgg gggattgtat ggcgggagga gtagtttaca tatgggtcat aggttagggc 1680 tgtggccttt gttacaaagt tatcatctag aataacagca gtggagccca ctcccctatc 1740 accctgggtg atgggggagc agggccag <210> 4 <211> 1768 <212> DNA
<213> Porcine circovirus <400> 4 aattcaacct taacctttct tattctgtag tattcaaagg gtatagagat tttgttggtc GO
ccccctcccg ggggaacaaa gtcgtcaatt ttaaatctca tcatgtccac cgcccaggag 120 ggcgttgtga ctgtggtacg cttgacagta tatccgaagg tgcgggagag gcgggtgttg 180 aagatgccat ttttccttct ccaacggtag cggtggcggg ggtggacgag ccaggggcgg 240 cggcggagga tctggccaag atggctgcgg gggcggtgtc ttcttctgcg gtaacgcctc 300 cttggatacg tcatagctga aaacgaaaga agtgcgctgt aagtattacc agcgcacttc 360 ggcagcggca gcacctcggc agcacctcag cagcaacatg cccagcaaga agaatggaag 420 aagcggaccc caaccacata aaaggtgggt gttcacgctg aataatcctt ccgaagacga 480 gcgcaagaaa atacgggagc tcccaatctc cctatttgat tattttattg ttggcgagga 540 gggtaatgag gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca 600 aacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagccaaagg 660 aactgatcag cagaataaag aatattgcag taaagaaggc aacttactta ttgaatgtgg 720 agctcctcga tctcaaggac aacggagtga cctgtctact gctgtgagta ccttgttgga 780 gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg 840 cgggctggct gaacttttga aagtgaccgg gaaaatgcag aagcgtgatt ggaagaccaa 900 tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc 960 agacccggaa accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg 1020 tgaagaagtg gttgttattg atgactttta tggctggctg ccgtgggatg atctactgag 1080 actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc 1140 ccgcagtatt ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt 1200 cccagctgta gaagctctct atcggagtat tacttccttg gtattttgga agaatgctac 1260 agaacaatcc acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt 1320 tccatatgaa ataaattact gagtcttttt tatcacttcg taatggtttt tattattcat 1380 ttagggttta agtggggggt ctttaagatt aaattctctg aattgtacat acatggttac 1440 acggatattg tagtcctggt cgtatttact gttttcgaac gcagcgccga ggcctacgtg 1500 gtccacattt ccagaggttt gtagtctcag ccaaagctga ttccttttgt tatttggttg 1560 gaagtaatca atagtggagt caagaacagg tttgggtgtg aagtaacggg agtggtagga 1620 gaagggttgg gggattgtat ggcgggagga gtagtttaca tatgggtcat aggttagggc 1680 tgtggccttt gttacaaagt tatcatctag aataacagca gtggagccca ctcccctatc 1740 accctgggtg ataggggagc agggccag <210> 5 <211> 1759 <212> DNA
<213> Porcine circovirus <400> 5 aattcatatt tagcctttct aatacggtag tattggaaag gtaggggtag ggggttggtg 60 ccgcctgagg gggggaggaa ctggccgatg ttgaatttga ggtagttaac attccaagat 120 ggctgcgagt atcctccttt tatggtgagt acaaattctg tagaaaggcg ggaattgaag 180 atacccgtct ttcggcgcca tctgtaacgg tttctgaagg cggggtgtgc caaatatggt 240 cttctccgga ggatgtttcc aagaaggctg cgggggcggg tccttcttct gcggtaacgc 300 ctccttggcc acgtcatcct ataaaagtga aagaagtccg ctgctgtagt attaccagcg 360 cacttcggca gcggcagcac ctcggcagcg tcagtgaaaa tgccaagcaa gaaaagcggc 420 ccgcaacccc ataagaggtg ggtgttcacc cttaataatc cttccgagga ggagaaaaac 480 , aaaatacggg agcttccaat ctcccttttt gattattttg tttgcggaga ggaaggtttg 540 gaagagggta gaactcctca cctccagggg tttgcgaatt ttgctaagaa gcagactttt 600 aacaaggtga agtggtattt tggtgcccgc tgccacatcg agaaagcgaa aggaaccgac 660 cagcagaata aagaatactg cagtaaagaa ggccacatac ttatcgagtg tggagctccg 720 cggaaccagg ggaagcgcag cgacctgtct actgctgtga gtaccctttt ggagacgggg 780 tctttggtga ctgtagccga gcagttccct gtaacgtatg tgagaaattt ccgcgggctg 840 gctgaacttt tgaaagtgag cgggaagatg cagcagcgtg attggaagac agctgtacac 900 gtcatagtgg gcccgcccgg ttgtgggaag agccagtggg cccgtaattt tgctgagcct 960 agggacacct actggaagcc tagtagaaat aagtggtggg atggatatca tggagaagaa 1020 gttgttgttt tggatgattt ttatggctgg ttaccttggg atgatctact gagactgtgt 1080 gaccggtatc cattgactgt agagactaaa gggggtactg ttcctttttt ggcccgcagt 1140 attttgatta ccagcaatca ggccccccag gaatggtact cctcaactgc tgtcccagct 1200 gtagaagctc tctatcggag gattactact ttgcaatttt ggaagactgc tggagaacaa 1260 tccacggagg tacccgaagg ccgatttgaa gcagtggacc caccctgtgc ccttttccca 1320 tataaaataa attactgagt cttttttttt atcacatcgt aatggttttt atttttattt 1380 atttagaggg tcttttagga taaattctct gaattgtaca taaatagtca gccttaccac 1440 ataattttgg gctgtggctg cattttggag cgcatagccg aagcctgtgt gctcgacatt 1500 ggtgtgggta tttaaatgga gccacagctg gtttctttta ttatttgggt ggaaccaatc 1560 aattgtttgg tccagctcag gtttgggggt gaagtacctg gagtggtagg taaagggctg 1620 ccttatggtg tggtggaagg agtagttaat ataggggtca taggccaagt tggtggaggg 1680 ggttacaaag ttggcatcca agataacaac agtggaccca acacctcttt gattagaggt 1740 gattggttct ctggggtaa <210> 6 <211> 1768 <212> DNA
<213> Porcine circovirus <400> 6 accagcgcac ttcggcagcg gcagcacctc ggcagcacct cagcagcaac atgcccagca 60 agaagaatgg aagaagcgga ccccaaccac ataaaaggtg ggtgttcacg ctgaataatc 120 cttccgaaga cgagcgcaag aaaatacggg agctcccaat ctccctattt gattatttta 180 ttgttggcga ggagggtaat gaggaaggac gaacacctca cctccagggg ttcgctaatt 240 ttgtgaagaa kcaaactttt aataaagtga agtggtattt gggtgcccgc tgccacatcg 300 agaaagccaa aggaactgat cagcagaata aagaatattg cagtaaagaa ggcaacttac 360 ttattgaatg tggagctcct cgagctcaag gacaacggag tgacctgtct actgctgtga 420 gtaccttgtt ggagaacggg agtctggtga ccgttgcaga gcagcaccct gtaacgtttg 480 tcagaaattt ccgcgggctg gctgaacttt tgaaagtgag cgggaaaatg cagaagcgtg 540 attggaagac caatgtacac gtcattgtgg ggccacctgg gtgtggtaaa agcaaattgg 600 ctgctaattt tgcagacccg gaaaccacat actggaaacc acctagaaac aagtggtggg 660 atggttacca tggtgaagaa gtggttgtta ttgatgactt ttatggctgg cttccggggg 720 atgatctact gagactgtgt gatcgatatc cattgactgt agagactaaa ggtggaactg 780 tacctttttt ggcccgcagt attctgatta ccagcaatca gaccccgttg gaatggtact 840 cctcaactgc tgtcccagct gtagaagctc tctatcggag gattacttcc ttggtatttt 900 ggaagaatgc tacagaacaa tccacggagg aagagggcca gttcgtcacc ctttcccccc 960 catgccctga atttccatat gaaataaatt actgagtcyt ttttatcact tcgtaatggt 1020 ttttattatt catttagggg ttaagtgggg ggtctttaag attaaattcc ctgaattgta 1080 catacagggt tacacggata ttttagtcct ggtcgtattt actgttttcg aacgcagtgc 1140 cgaggcctac gtggtccaca tttctagagg tttgtagcct cagccaaagc tgattccttt 1200 tgttatttgg ttggaagtaa tcaatagtgg agtcaagaac aggtttgggt gtgaagtaac 1260 gggagtggta ggagaagggt tgggggattg tatggcggga ggagtagttt acatatgggt 1320 catatgtttg ggctgtggcc tttggtacaa agttatcatc tagaataaca gcagtggagc 1380 ccactcccct atcaccctgg gtgatggggg agcagggcca gaattcaacc ttaacctttc 1440 ttattctgta gtattcaaag ggtatagaga ttttgttggt cccccctccc gggggaacaa 1500 agtcgtcaat tttaaatctc atcatgtcca ccgcccagga gggcgttgtg actgtggtac 1560 gcttgacagt atatccgaag gtgcgggaga ggcgggtgtt gaagatgcca tttttccttc 1620 tccaacggta gcggtggcgg gggtggacga gccaggggcg gcggcggagg atctggccaa 1680 gatggctgcg ggggcggtgt cttcttctgc ggtaacgcct ccttggatat gtcatagctg 1740 aaaacgaaag aagtgcgctg taagtatt <210> 7 <211> 1768 <212> DNA
<213> Porcine circovirus <400> 7 accagcgcac ttcggcagcg gcagcacctc ggcagcacct cagcagcaac atgcccagca 60 agaagaatgg aagaagcgga ccccaaccac ataaaaggtg ggtgttcacg ctgaataatc 120 cttccgaaga cgagcgcaag aaaatacggg agctcccaat ctccctattt gattatttta 180 ttgttggcga ggagggtaat gaggaaggac gaacacctca cctccagggg ttcgctaatt 240 ttgtgaagaa gcaaactttt aataaagtga agtggtattt gggtgcccgc tgccacatcg 300 agaaagccaa aggaactgat cagcagaata aagaatattg cagtaaagaa ggcaacttac 360 ttattgaatg tggagctcct cgatcgcaag gacaacggag tgacctgtct actgctgtga 420 gtaccttgtt ggagaacggg agtctggtga ccgttgcaga gcagcaccct gtaacgtttg 480 tcagaaattt ccgcgggctg gctgaacttt tgaaagtgag cgggaaaatg cagaagcgtg 540 attggaagac caatgtacac gtcattgtgg ggccacctgg gtgtggtaaa agcaaattgg GOO
ctgctaattt tgcagacccg gaaaccacat actggaaacc acctagaaac aagtggtggg 660 atggttacca tggtgaagaa gtggttgtta ttgatgactt ttatggctgg ctgccgtggg 720 atgatctact gagactgtgt gatcgatatc cattgactgt agagactaaa ggtggaactg 780 tacctttttt ggcccgcagt attctgatta ccagcaatca gaccccgttg gaatggtact 840 cctcaactgc tgtcccagct gtagaagctc tctatcggag gattacttcc ttggtatttt 900 ggaagaatgc tacagaacaa tccacggagg aagggggcca gttcgtcacc ctttcccccc 960 catgccctga atttccatat gaaataaatt actgagtctt ttttatcact tcgtaatggt 1020 ttttattatt catttagggg ttaagtgggg ggtctttaag attaaattct ctgaattgta 1080 catacatggt tacacggata ttgtactcct ggtcgtattt actgttttcg aacgcagtgc 1140 cgaggcctac gtggtccaca tttctagagg tttgtagcct cagccaaagc tgattccttt 1200 tgttatttgg ttggaagtaa tcaatagtgg agtcaagaac aggtttgggt gtgaagtaac 1260 gggagtggta ggagaagggt tgggggattg tatggcggga ggagtagttt acatatgggt 1320 cataggttag ggctgtggcc tttggtacaa agttatcatc tagaataaca gcagtggagc 1380 ccactcccct atcaccctgg gtgatggggg agcagggcca gaattcaacc ttaacctttt 1440 ttattctgta gtattcaaag ggtatagaga ttttgttggt cccccctccc gggggaacaa 1500 agtcgtcaat tttaaatctc atcatgtcca ccgcccagga gggcgttgtg actgtagtac 1560 gcttgacagt atatccgaag gtgcgggaga ggcgggtgtt gaagatgcca tttttccttc 1620 tccaacggta gcggtggcgg gggtggacga gccaggggcg gcggcggagg atctggccaa 1680 gatggctgcg ggggcggtgt cttcttctgc ggtaacgcct ccttggatac gtcatagctg 1740 aaaacgaaag aagtgcgctg taagtatt 1768 <210> 8 <211> 1680 <212> DNA
<213> Artificial <220>
<223> Plasmid construct <400> 8 ggtaccttca taaatacaag tttgattaaa cttaagttgt tctaaagttc tttcctccga 60 aggtatagaa caaagtattt cttctacatc cttactattt attgcagctt ttaacagcct 120 atcacgtatc ctatttttag tattggtaga acgttttagt tctaaagtta aaatattaga 180 cataattggc atattgctta ttccttgcat agttgagtct gtagatcgtt tcagtatatc 240 actgattaat gtactactgt tatgatgaaa tatagaatcg atattggcat ttaactgttt 300 tgttatacta agtctagatt ttaaatcttc tagtaatatg ctatttaata taaaagcttc 360 cacgtttttg tatacatttc tttccatatt agtagctact actaaatgat tatcttcttt 420 catatcttgt agataagata gactatcttt atctttatta gtagaaaata cttctggcca 480 tacatcgtta aatttttttg ttgttgttag atataatatt aaatatctag aggatcctat 540 tatttgtggt aaaatgttta tagagtaaaa tgatctggct attaaacata ggccagttac 600 catagaatgc tgcttcccgt tacagtgttt taccataacc atagatctgc ctgtattgtt 660 gatacatata acagctgtaa atcctaaaaa attcctatca taattattaa tattaggtaa 720 ttcatttcca tgtgaaagat agactaattt tatatccttt acctccaaat aattatttac 780 atctcttaaa caatctattt taatatcatt aactggtatt ttataatatc cagaaaggtt 840 tgaaggggtt gatggaataa gtctattaac atcgttaagt aaattattaa tatcatgaat 900 ctttattata ttatagcgat aagttaaatt tatatttact ttctcatcat ctgacttagt 960 tagtttgtaa taaggtgtgt ctgaaagaat taaaaggtaa ttcgttgaat gaagctgtat 1020 ttgctgtatc atttttatct aattttggag atttagcagt acttacttca ttagaagaag 1080 aatctgccag ttcctgtcta ttactgatat ttcgtttcat tattatatga tttatatttt 1140 actttttcaa ttatatatac tcatttgact agttaatcaa taaaaagaat tcctgcagcc 1200 ctgcagctaa ttaattaagc tacaaatagt ttcgttttca ccttgtctaa taactaatta 1260 attaaggatc ccccagcttc tttattctat acttaaaaag tgaaaataaa tacaaaggtt 1320 cttgagggtt gtgttaaatt gaaagcgaga aataatcata aattacttca ttatcgcgat 1380 atccgttaag tttgtatcgt aatgacgtat ccaaggaggc gttaccgcag aagaagacac 1440 cgcccccgca gccatcttgg ccagatcctc cgccgccgcc cctggctcgt ccacccccgc 1500 caccgctacc gttggagaag gaaaaatggc atcttcaaca cccgcctctc ccgcaccttc 1560 ggatatactg tcaagcgtac cacagtcaca acgccctcct gggcggtgga catgatgaga 1620 tttaaaattg acgactttgt tcccccggga ggggggacca acaaaatctc tatacccttt 1680 <210> 9 <211> 57 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 9 catcatcatt cgcgatatcc gttaagtttg tatcgtaatg cccagcaaga agaatgg 57 <210> 10 <211> 36 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 10 tactactacg tcgactcagt aatttatttc atatgg 36 <210> 11 <211> 3609 <212> DNA
<213> Artificial <220>
<223> Plasmid construct <400> 11 ggtaccttca taaatacaag tttgattaaa cttaagttgt tctaaagttc tttcctccga 60 aggtatagaa caaagtattt cttctacatc cttactattt attgcagctt ttaacagcct 120 atcacgtatc ctatttttag tattggtaga acgttttagt tctaaagtta aaatattaga 180 cataattggc atattgctta ttccttgcat agttgagtct gtagatcgtt tcagtatatc 240 actgattaat gtactactgt tatgatgaaa tatagaatcg atattggcat ttaactgttt 300 tgttatacta agtctagatt ttaaatcttc tagtaatatg ctatttaata taaaagcttc 360 cacgtttttg tatacatttc tttccatatt agtagctact actaaatgat tatcttcttt 420 catatcttgt agataagata gactatcttt atctttatta gtagaaaata cttctggcca 480 tacatcgtta aatttttttg ttgttgttag atataatatt aaatatctag aggatcctat 540 tatttgtggt aaaatgttta tagagtaaaa tgatctggct attaaacata ggccagttac 600 catagaatgc tgcttcccgt tacagtgttt taccataacc atagatctgc ctgtattgtt 660 gatacatata acagctgtaa atcctaaaaa attcctatca taattattaa tattaggtaa 720 ttcatttcca tgtgaaagat agactaattt tatatccttt acctccaaat aattatttac 780 atctcttaaa caatctattt taatatcatt aactggtatt ttataatatc cagaaaggtt 840 tgaaggggtt gatggaataa gtctattaac atcgttaagt aaattattaa tatgatgaat 900 ctttattata ttatacccat aagttaaatt tatatttact ttctcatcat ctgacttagt 960 tagtttgtaa taaggtgtgt ctgaaaaaat taaaaggtaa ttcgttgaat gaagctgtat 1020 ttgctgtatc atttttatct aattttggag atttagcagt acttacttca ttagaagaag 1080 aatctgccag ttcctgtcta ttactgatat ttcgtttcat tattatatga tttatatttt 1140 actttttcaa ttatatatac tcatttgact agttaatcaa taaaaagaat ttcgacttag 1200 , ggtttaagtg gggggtcttt aagattaaat tctctgaatt gtacatacat ggttacacgg atattgtagt cctggtcgta tttactgttt tcgaacgcag cgccgaggcc tacgtggtcc acatttccag aggtttgtag tctcagccaa agctgattcc ttttgttatt tggttggaag 1380 taatcaatag tggagtcaag aacaggtttg ggtgtgaagt aacgggagtg gtaggagaag 1440 ggttggggga ttgtatggcg ggaggagtag tttacatatg ggtcataggt tagggctgtg 1500 gcctttgtta caaagttatc atctagaata acagcagtgg agcccactcc cctatcaccc tgggtgatgg gggagcaggg ccagaattca accttaacct ttcttattct gtagtattca 1620 aagggtatag agattttgtt ggtcccccct cccgggggaa caaagtcgtc aattttaaat ctcatcatgt ccaccgccca ggagggcgtt gtgactgtgg tacgcttgac agtatatccg aaggtgcggg agaggcgggt gttgaagatg ccatttttcc ttctccaacg gtagcggtgg 1800 cgggggtgga cgagccaggg gcggcggcgg aggatctggc caagatggct gcgggggcgg tgtcttcttc tgcggtaacg cctccttgga tacgtcatta cgatacaaac ttaacggata 1920 tcgcgataat gaaataattt atgattattt ctcgctttca atttaacaca accctcaaga 1980 acctttgtat ttattttcac tttttaagta tagaataaag aagctggggg atcaattcct gcagccctgc agctaattaa ttaagctaca aatagtttcg ttttcacctt gtctaataac 2100 taattaatta aggatccccc agcttcttta ttctatactt aaaaagtgaa aataaataca aaggttcttg agggttgtgt taaattgaaa gcgagaaata atcataaatt atttcattat 2220 cgcgatatcc gttaagtttg tatcgtaatg cccagcaaga agaatggaag aagcggaccc 2280 caaccacata aaaggtgggt gttcacgctg aataatcctt ccgaagacga gcgcaagaaa 2340 atacgggagc tcccaatctc cctatttgat tattttattg ttggcgagga gggtaatgag 2400 gaaggacgaa cacctcacct ccaggggttc gctaattttg tgaagaagca aacttttaat aaagtgaagt ggtatttggg tgcccgctgc cacatcgaga aagccaaagg aactgatcag 2520 cagaataaag aatattgcag taaagaaggc aacttactta ttgaatgtgg agctcctcga 2580 tctcaaggac aacggagtga cctgtctact gctgtgagta ccttgttgga gagcgggagt ctggtgaccg ttgcagagca gcaccctgta acgtttgtca gaaatttccg cgggctggct 2700 gaacttttga aagtgagcgg gaaaatgcag aagcgtgatt ggaagaccaa tgtacacgtc attgtggggc cacctgggtg tggtaaaagc aaatgggctg ctaattttgc agacccggaa 2820 accacatact ggaaaccacc tagaaacaag tggtgggatg gttaccatgg tgaagaagtg 2880 gttgttattg atgactttta tggctggctg ccgtgggatg atctactgag actgtgtgat cgatatccat tgactgtaga gactaaaggt ggaactgtac cttttttggc ccgcagtatt 3000 ctgattacca gcaatcagac cccgttggaa tggtactcct caactgctgt cccagctgta gaagctctct atcggaggat tacttccttg gtattttgga agaatgctac agaacaatcc 3120 acggaggaag ggggccagtt cgtcaccctt tcccccccat gccctgaatt tccatatgaa ataaattact gagtcgaccc cgggttttta tagctaatta gtcatttttt cgtaagtaag tatttttatt taatactttt tattgtactt atgttaaata taactgatga taacaaaatc cattatgtat tatttataac tgtaatttct ttagcgtagt tagatgtcca atctctctca aatacatcgg ctatcttttt agtgagattt tgatctatgc agttgaaact tatgaacgcg 3420 tgatgattaa aatgtgaacc gtccaaattt gcagtcatta tatgagcgta tctattatct actatcatca tctttgagtt attaatatca tctactttag aattgatagg aaatatgaat acctttgtag taatatctat actatctaca cctaactcat taagactttt gataggcggc cgcgagctc <210> 12 <211> 53 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 12 catcatcatg atatccgtta agtttgtatc gtaatgacgt ggccaaggag gcg <210> 13 <211> 40 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 13 tactactacg tcgacttatt tatttagagg gtcttttagg 40 <210> 14 <211> 57 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 14 catcatcatt cgcgatatcc gttaagtttg tatcgtaatg ccaagcaaga aaagcgg 57 <210> 15 <211> 36 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 15 tactactacg tcgactcagt aatttatttt atatgg 36 <210> 16 <211> 3701 <212> DNA
<213> Artificial <220>
<223> Plasmid construct <400> 16 aagcttctat caaaagtctt aatgagttag gtgtagatag tatagatatt actacaaagg 60 tattcatatt tcctatcaat tctaaagtag atgatattaa taactcaaag atgatgatag 120 tagataatag atacgctcat ataatgactg caaatttgga cggttcacat tttaatcatc 180 acgcgttcat aagtttcaac tgcatagatc aaaatctcac taaaaagata gccgatgtat 240 ttgagagaga ttggacatct aactacgcta aagaaattac agttataaat aatacataat 300 ggattttgtt atcatcagtt atatttaaca taagtacaat aaaaagtatt aaataaaaat 360 acttacttac gaaaaaatgt cattattaca aaaactatat tttacagaac aatctatagt 420 agagtccttt aagagttata atttaaaaga taaccataat gtaatattta ccacatcaga 480 tgatgatact gttgtagtaa taaatgaaga taatgtactg ttatctacaa gattattatc 540 atttgataaa attctgtttt ttaactcctt taataacggt ttatcaaaat acgaaactat 600 tagtgataca atattagata tagatactca taattattat atacctagtt cttcttcttt 660 gttagatatt ctaaaaaaaa gagcgtgtga tttagaatta gaagatctaa attatgcgtt 720 aataggagac aatagtaaat tatattataa agatatgact tacatgaata attggttatt 780 tactaaagga ttattagatt acaagtttgt attattgcgc gatgtagata aatgttacaa 840 acagtataat aaaaagaata ctataataga tataatacat cgcgataaca gacagtataa 900 catatgggtt aaaaatgtta tagaatactg ttctcctggc tatatattat ggttacatga 960 tctaaaagcc gctgctgaag atgattggtt aagatacgat aaccgtataa acgaattatc 1020 tgcggataaa ttatacactt tcgagttcat agttatatta gaaaataata taaaacattt 1080 acgagtaggt acaataattg tacatccaaa caagataata gctaatggta catctaataa 1140 tatacttact gattttctat cttacgtaga agaactaata tatcatcata attcatctat 1200 aatattggcc ggatattttt tagaattctt tgagaccact attttatcag aatttatttc 1260 ttcatcttct gaatgggtaa tgaatagtaa ctgtttagta cacctgaaaa cagggtatga 1320 agctatactc tttgatgcta gtttattttt ccaactctct actaaaagca attatgtaaa 1380 atattggaca aagaaaactt tgcagtataa gaactttttt aaagacggta aacagttagc 1440 aaaatatata attaagaaag atagtcaggt gatagataga gtatgttatt tacacgcagc 1500 tgtatataat cacgtaactt acttaatgga taactttaaa attcctggtt ttaattttaa 1560 attctccgga atgatagata tactactgtt tggaatattg cataaggata atgagaatat 1620 attttatccg aaacgtgttt ctgtaactaa tataatatca gaatctatct atgcagattt 1680 ttactttata tcagatgtta ataaattcag taaaaggata gaatataaaa ctatgtttcc 1740 tatactcgca gaaaactact atccaaaagg aaggccctat tttacacata catctaacga 1800 agatcttctg tctatctgtt tatgcgaagt aacagtttgt aaagatataa aaaatccatt 1860 attatattct aaaaaggata tatcagcaaa acgattcata ggtttattta catctgtcga 1920 tataaatacg gctgttgagt taagaggata taaaataaga gtaataggat gtttagaatg 1980 gcctgaaaag ataaaaatat ttaattctaa tcctacatac attagattat tactaacaga 2040 aagacgttta gatattctac attcctatct gcttaaattt aatataacag aggatatagc 2100 taccagagat ggagtcagaa ataatttacc tataatttct tttatcgtca gttattgtag 2160 atcgtatact tataaattac taaattgcca tatgtacaat tcgtgtaaga taacaaagtg 2220 taaatataat caggtaatat ataatcctat ataggagtat atataattga aaaagtaaaa 2280 tataaatcat ataataatga aacgaaatat cagtaataga caggaactgg cagattcttc 2340 ttctaatgaa gtaagtactg ctaaatctcc aaaattagat aaaaatgata cagcaaatac 2400 agcttcattc aacgaattac cttttaattt tttcagacac accttattac aaactaacta 2460 agtcagatga tgagaaagta aatataaatt taacttatgg gtataatata ataaagattc 2520 atgatattaa taatttactt aacgatgtta atagacttat tccatcaacc ccttcaaacc 2580 tttctggata ttataaaata ccagttaatg atattaaaat agattgttta agagatgtaa 2640 ataattattt ggaggtaaag gatataaaat tagtctatct ttcacatgga aatgaattac 2700 ctaatattaa taattatgat aggaattttt taggatttac agctgttata tgtatcaaca 2760 atacaggcag atctatggtt atggtaaaac actgtaacgg gaagcagcat tctatggtaa 2820 ctggcctatg tttaatagcc agatcatttt actctataaa cattttacca caaataatag 2880 gatcctctag atatttaata ttatatctaa caacaacaaa aaaatttaac gatgtatggc 2940 cagaagtatt ttctactaat aaagataaag atagtctatc ttatctacaa gatatgaaag 3000 aagataatca tttagtagta gctactaata tggaaagaaa tgtatacaaa aacgtggaag 3060 cttttatatt aaatagcata ttactagaag atttaaaatc tagacttagt ataacaaaac 3120 agttaaatgc caatatcgat tctatatttc atcataacag tagtacatta atcagtgata 3180 tactgaaacg atctacagac tcaactatgc aaggaataag caatatgcca attatgtcta 3240 atattttaac tttagaacta aaacgttcta ccaatactaa aaataggata cgtgataggc 3300 tgttaaaagc tgcaataaat agtaaggatg tagaagaaat actttgttct ataccttcgg 3360 aggaaagaac tttagaacaa cttaagttta atcaaacttg tatttatgaa cactataaaa 3420 aaattatgga agatacaagt aaaagaatgg atgttgaatg tcgtagttta gaacataact 3480 atacggctaa cttatataaa gtgtacggac aaaacgaata tatgattact tatatactag 3540 ctctcataag taggattaat aatattatag aaactttaaa atataatctg gtggggctag 3600 acgaatctac aatacgtaat ataaattata taatttcaca aagaacaaaa aaaaatcaag 3660 tttctaatac cttatagata aactatattt tttaccactg a 3701 <210> 17 <211> 625 <212> PRT
<213> Artificial <220>
<223> Plasmid construct <400> 17 Met Ser Leu Leu Gin Lys Leu Tyr Phe Thr Glu Gin Ser Ile Val Glu Ser Phe Lys Ser Tyr Asn Leu Lys Asp Asn His Asn Val Ile Phe Thr Thr Ser Asp Asp Asp Thr Val Val Val Ile Asn Glu Asp Asn Val Leu Leu Ser Thr Arg Leu Leu Ser Phe Asp Lys Ile Leu Phe Phe Asn Ser Phe Asn Asn Gly Leu Ser Lys Tyr Glu Thr Ile Ser Asp Thr Ile Leu Asp Ile Asp Thr His Asn Tyr Tyr Ile Pro Ser Ser Ser Ser Leu Leu Asp Ile Leu Lys Lys Arg Ala Cys Asp Leu Glu Leu Glu Asp Leu Asn Tyr Ala Leu Ile Gly Asp Asn Ser Lys Leu Tyr Tyr Lys Asp Met Thr Tyr Met Asn Asn Trp Leu Phe Thr Lys Gly Leu Leu Asp Tyr Lys Phe Val Leu Leu Arg Asp Val Asp Lys Cys Tyr Lys Gin Tyr Asn Lys Lys Asn Thr Ile Ile Asp Ile Ile His Arg Asp Asn Arg Gin Tyr Asn Ile Trp Val Lys Asn Val Ile Glu Tyr Cys Ser Pro Gly Tyr Ile Leu Trp Leu His Asp Leu Lys Ala Ala Ala Glu Asp Asp Trp Leu Arg Tyr Asp Asn Arg Ile Asn Glu Leu Ser Ala Asp Lys Leu Tyr Thr Phe Glu Phe Ile Val Ile Leu Glu Asn Asn Ile Lys His Leu Arg Val Gly Thr Ile Ile Val His Pro Asn Lys Ile Ile Ala Asn Gly Thr Ser Asn Asn Ile Leu Thr Asp Phe Leu Ser Tyr Val Glu Glu Leu Ile Tyr His His Asn Ser Ser Ile Ile Leu Ala Gly Tyr Phe Leu Glu Phe Phe Glu Thr Thr Ile Leu Ser Glu Phe Ile Ser Ser Ser Ser Glu Trp Val Met Asn Ser Asn Cys Leu Val His Leu Lys Thr Gly Tyr Glu Ala Ile Leu Phe Asp Ala Ser Leu Phe Phe Gin Leu Ser Thr Lys Ser Asn Tyr Val Lys Tyr Trp Thr Lys Lys Thr Leu Gin Tyr Lys Asn Phe Phe Lys Asp Gly Lys Gin Leu Ala Lys Tyr Ile Ile Lys Lys Asp Ser Gin Val Ile Asp Arg Val Cys Tyr Leu His Ala Ala Val Tyr Asn His Val Thr Tyr Leu Met Asp Asn Phe Lys Ile Pro Gly Phe Asn Phe Lys Phe Ser Gly Met Ile Asp Ile Leu Leu Phe Gly Ile Leu His Lys Asp Asn Glu Asn Ile Phe Tyr Pro Lys Arg Val Ser Val Thr Asn Ile Ile Ser Glu Ser Ile Tyr Ala Asp Phe Tyr Phe Ile Ser Asp Val Asn Lys Phe Ser Lys Arg Ile Glu Tyr Lys Thr Met Phe Pro Ile Leu Ala Glu Asn Tyr Tyr Pro Lys Gly Arg Pro Tyr Phe Thr His Thr Ser Asn Glu Asp Leu Leu Ser Ile Cys Leu Cys Glu Val Thr Val Cys Lys Asp Ile Lys Asn Pro Leu Leu Tyr Ser Lys Lys Asp Ile Ser Ala Lys Arg Phe Ile Gly Leu Phe Thr Ser Val Asp Ile Asn Thr Ala Val Glu Leu Arg Gly Tyr Lys Ile Arg Val Ile Gly Cys Leu Glu Trp Pro Glu Lys Ile Lys Ile Phe Asn Ser Asn Pro Thr Tyr Ile Arg Leu Leu Leu Thr Glu Arg Arg Leu Asp Ile Leu His Ser Tyr Leu Leu Lys Phe Asn Ile Thr Glu Asp Ile Ala Thr Arg Asp Gly Val Arg Asn Asn Leu Pro Ile Ile Ser Phe Ile Val Ser Tyr Cys Arg Ser Tyr Thr Tyr Lys Leu Leu Asn Cys His Met Tyr Asn Ser Cys Lys Ile Thr Lys Cys Lys Tyr Asn Gin Val Ile Tyr Asn Pro Ile <210> 18 <211> 93 <212> PRT
<213> Artificial <220>
<223> Plasmid construct <400> 18 Met Thr Tyr Pro Arg Arg Arg Tyr Arg Arg Arg Arg His Arg Pro Arg Ser His Leu Gly Gin Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Phe Gly Tyr Thr Val Lys Arg Thr Thr Val Thr Thr Pro Ser Trp Ala Val Asp Met Met Arg Phe Lys Ile Asp Asp Phe Val Pro Pro Gly Gly Gly Thr Asn Lys Ile Ser Ile Pro Phe <210> 19 <211> 233 <212> PRT
<213> Artificial <220>
<223> Plasmid construct <400> 19 Met Thr Tyr Pro Arg Arg Arg Tyr Arg Arg Arg Arg His Arg Pro Arg Ser His Leu Gly Gln Ile Leu Arg Arg Arg Pro Trp Leu Val His Pro Arg His Arg Tyr Arg Trp Arg Arg Lys Asn Gly Ile Phe Asn Thr Arg Leu Ser Arg Thr Phe Gly Tyr Thr Val Lys Arg Thr Thr Val Thr Thr Pro Ser Trp Ala Val Asp Met Met Arg Phe Lys Ile Asp Asp Phe Val Pro Pro Gly Gly Gly Thr Asn Lys Ile Ser Ile Pro Phe Glu Tyr Tyr Arg Ile Arg Lys Val Lys Val Glu Phe Trp Pro Cys Ser Pro Ile Thr Gin Gly Asp Arg Gly Val Gly Ser Thr Ala Val Ile Leu Asp Asp Asn Phe Val Thr Lys Ala Thr Ala Leu Thr Tyr Asp Pro Tyr Val Asn Tyr Ser Ser Arg His Thr Ile Pro Gin Pro Phe Ser Tyr His Ser Arg Tyr Phe Thr Pro Lys Pro Val Leu Asp Ser Thr Ile Asp Tyr Phe Gin Pro Asn Asn Lys Arg Asn Gin Leu Trp Leu Arg Leu Gin Thr Ser Gly Asn Val Asp His Val Gly Leu Gly Ala Ala Phe Glu Asn Ser Lys Tyr Asp Gin Asp Tyr Asn Ile Arg Val Thr Met Tyr Val Gin Phe Arg Glu Phe Asn Leu Lys Asp Pro Pro Leu Lys Pro ' <210> 20 <211> 314 <212> PRT
<213> Artificial <220>
<223> Plasmid construct <400> 20 Met Pro Ser Lys Lys Asn Gly Arg Ser Gly Pro Gin Pro His Lys Arg Trp Val Phe Thr Leu Asn Asn Pro Ser Glu Asp Glu Arg Lys Lys Ile Arg Glu Leu Pro Ile Ser Leu Phe Asp Tyr Phe Ile Val Gly Glu Glu Gly Asn Glu Glu Gly Arg Thr Pro His Leu Gin Gly Phe Ala Asn Phe Val Lys Lys Gin Thr Phe Asn Lys Val Lys Trp Tyr Leu Gly Ala Arg Cys His Ile Glu Lys Ala Lys Gly Thr Asp Gin Gin Asn Lys Glu Tyr Cys Ser Lys Glu Gly Asn Leu Leu Ile Glu Cys Gly Ala Pro Arg Ser Gin Gly Gin Arg Ser Asp Leu Ser Thr Ala Val Ser Thr Leu Leu Glu Ser Gly Ser Leu Val Thr Val Ala Glu Gin His Pro Val Thr Phe Val Arg Asn Phe Arg Gly Leu Ala Glu Leu Leu Lys Val Ser Gly Lys Met Gin Lys Arg Asp Trp Lys Thr Asn Val His Val Ile Val Gly Pro Pro Gly Cys Gly Lys Ser Lys Trp Ala Ala Asn Phe Ala Asp Pro Glu Thr Thr Tyr Trp Lys Pro Pro Arg Asn Lys Trp Trp Asp Gly Tyr His Gly Glu Glu Val Val Val Ile Asp Asp Phe Tyr Gly Trp Leu Pro Trp Asp Asp Leu Leu Arg Leu Cys Asp Arg Tyr Pro Leu Thr Val Glu Thr Lys Gly Gly Thr Val Pro Phe Leu Ala Arg Ser Ile Leu Ile Thr Ser Asn Gln Thr Pro Leu Glu Trp Tyr Ser Ser Thr Ala Val Pro Ala Val Glu Ala Leu Tyr Arg Arg Ile Thr Ser Leu Val Phe Trp Lys Asn Ala Thr Glu Gin Ser Thr Glu Glu Gly Gly Gin Phe Val Thr Leu Ser Pro Pro Cys Pro Glu Phe Pro Tyr Glu Ile Asn Tyr <210> 21 <211> 42 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 21 atcatcgagc tcgcggccgc ctatcaaaag tcttaatgag tt 42 <210> 22 <211> 73 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 22 gaattcctcg agctgcagcc cgggttttta tagctaatta gtcatttttt cgtaagtaag 60 tatttttatt taa 73 <210> 23 <211> 72 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 23 cccgggctgc agctcgagga attcttttta ttgattaact agtcaaatga gtatatataa 60 ttgaaaaagt aa 72 <210> 24 <211> 45 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 24 gatgatggta ccttcataaa tacaagtttg attaaactta agttg 45 <210> 25 <211> 53 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 25 catcatcatg atatccgtta agtttgtatc gtaatgacgt atccaaggag gcg 53 <210> 26 <211> 36 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 26 tactactacg tcgacttagg gtttaagtgg ggggtc 36 <210> 27 <211> 35 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 27 catcatcatg tcgacatgac gtatccaagg aggcg 35 <210> 28 <211> 36 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 28 tactactaca gatctttagg gtttaagtgg ggggtc 36 <210> 29 <211> 35 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 29 catcatcatg tcgacatgcc cagcaagaag aatgg 35 <210> 30 <211> 36 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 30 tactactaca gatcttcagt aatttatttc atatgg 36 <210> 31 <211> 35 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 31 catcatcatg tcgacatgac gtggccaagg aggcg 35 <210> 32 <211> 40 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 32 tactactaca gatctttatt tatttagagg gtcttttagg 40 <210> 33 <211> 35 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 33 catcatcatg tcgacatgcc aagcaagaaa agcgg 35 <210> 34 <211> 36 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 34 tactactaca gatcttcagt aatttatttt atatgg 36 <210> 35 <211> 33 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 35 tatgcggccg ccaccatgtg gctgcagaac ctg 33 <210> 36 <211> 34 <212> DNA
<213> Artificial <220>
<223> Oligonucleotide primer <400> 36 tatgcggccg ctacgtatca cttctgggct ggtt 34

Claims (72)

CLAIMS:

1. Use of an immunogenic composition in the manufacture of a medicament for reducing the viral load of porcine circovirus-2 (PCV-2) in the mesenteric nodes of a pig;
wherein said immunogenic composition comprises a PCV2 immunogen and at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
wherein said PCV-2 immunogen is an inactivated PCV-2; an attenuated PCV-2; or capable of being expressed from a first vector comprising a DNA
fragment containing a first nucleotide sequence encoding ORF 13 of PCV-2.

2. The use according to claim 1 wherein said first vector is an expression vector and is a DNA plasmid, E. coli, a baculovirus, a herpes virus, Aujeszky's disease virus, a porcine adenovirus, a poxvirus, vaccinia virus, avipox virus, canarypox virus, or swinepox virus.

3. The use according to claim 2 wherein said first vector is a DNA plasmid vector.

4. The use according to claim 2 wherein said first vector is a canarypox virus vector.

5. The use according to any one of claims 1-4 wherein said immunogenic composition additionally comprises at least one immunogen from at least one additional pig pathogen or a vector expressing such an immunogen.

6. The use according to claim 5 wherein the additional pig pathogen is porcine reproductive and respiratory syndrome (PRRS), Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Escherichia coli, pseudorabies, hog cholera, Bordetella bronchispetica, Pasteurella multocida, Erysipelothrix rhusiopathiae, swine influenza, or porcine parvovirus (PPV).

7. The use according to claim 5 wherein the additional pig pathogen is PPV.

8. The use according to any one of claims 1-7 wherein the at least one of PCV-2 immunogen or the at least one additional pig pathogen is recombinantly produced.

9. The use according to any one of claims 1-8 wherein the first vector expressing the PCV-2 immunogen also expresses at least one additional pig pathogen.

10. The use according to any one of claims 1-9 wherein the first vector contains and expresses ORF 13 of PCV-2 or ORF4 and ORF 13 of PCV-2.

11. The use according to any one of claims 1-10 wherein said medicament is for administration to female pig prior to breeding.

12. The use according to any one of claims 1 to 10 wherein said medicament is for administration to a pregnant female pig.

13. The use according to any one of claims 1 to 12 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80% identity with ORF13 of PCV-2 strain lmp1010.

14. The use according to any one of claims 1 to 12 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95% identity with ORF13 of PCV-2 strain lmp1010.

15. The use according to any one of claims 1 to 14 wherein said immunogenic composition further comprises a second vector comprising a DNA
fragment containing a second nucleotide sequence encoding ORF4 of PCV-2.

16. The use according to claim 15 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 88% identity with ORF4 of PCV-2 strain Imp1010.

17. The use according to claim 15 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 95% identity with ORF4 of PCV-2 strain Imp1010.

18. Use of:
a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2; and b) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
in the manufacture of a medicament for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig.

19 Use of:
a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
b) a second DNA plasmid vector comprising a second nucleotide sequence encoding ORF4 of PCV-2; and c) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
in the manufacture of a medicament for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig.

20. The use according to claim 19 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 88% identity with ORF4 of PCV-2 strain Imp1010.

21. The use according to claim 19 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 95% identity with ORF4 of PCV-2 strain Imp1010.

22. The use according to any one of claims 18 to 21 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80% identity with ORF13 of PCV-2 strain Imp1010.

23. The use according to any one of claims 18 to 21 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95% identity with ORF13 of PCV-2 strain Imp1010.

24. Use of an immunogenic composition for reducing the viral load of porcine circovirus-2 (PCV-2) in the mesenteric nodes of a pig;
wherein said immunogenic composition comprises a PCV2 immunogen and at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
wherein said PCV-2 immunogen is an inactivated PCV-2; an attenuated PCV-2; or capable of being expressed from a first vector comprising a DNA
fragment containing a first nucleotide sequence encoding ORF 13 of PCV-2.

25. The use according to claim 24 wherein said first vector is an expression vector and is a DNA plasmid, E. coli, a baculovirus, a herpes virus, Aujeszky's disease virus, a porcine adenovirus, a poxvirus, vaccinia virus, avipox virus, canarypox virus, or swinepox virus.

26. The use according to claim 25 wherein said first vector is a DNA
plasmid vector.

27. The use according to claim 25 wherein said first vector is a canarypox virus vector.

28. The use according to any one of claims 24-27 wherein said immunogenic composition additionally comprises at least one immunogen from at least one additional pig pathogen or a vector expressing such an immunogen.

29. The use according to claim 28 wherein the additional pig pathogen is porcine reproductive and respiratory syndrome (PRRS), Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Escherichia coli, pseudorabies, hog cholera, Bordetella bronchispetica, Pasteurella multocida, Erysipelothrix rhusiopathiae, swine influenza, or porcine parvovirus (PPV).

30. The use according to claim 28 wherein the additional pig pathogen is PPV.

31. The use according to any one of claims 24-30 wherein the at least one of PCV-2 immunogen or the at least one additional pig pathogen is recombinantly produced.

32. The use according to any one of claims 24-31 wherein the first vector expressing the PCV-2 immunogen also expresses at least one additional pig pathogen.

33. The use according to any one of claims 24-32 wherein the first vector contains and expresses ORF 13 of PCV-2 or ORF4 and ORF 13 of PCV-2.

34. The use according to any one of claims 24-33 for reducing viral load of PCV-2 in a female pig prior to breeding.

35. The use according to any one of claims 24-33 for reducing viral load of PCV-2 in a pregnant female pig.

36. The use according to any one of claims 24 to 35 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80% identity with ORF13 of PCV-2 strain Imp1010.

37. The use according to any one of claims 24 to 35 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95% identity with ORF13 of PCV-2 strain Imp1010.

38. The use according to any one of claims 24 to 37 wherein said immunogenic composition further comprises a second vector comprising a DNA
fragment containing a second nucleotide sequence encoding ORF4 of PCV-2.

39. The use according to claim 38 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 88% identity with ORF4 of PCV-2 strain Imp1010.

40. The use according to claim 38 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 95% identity with ORF4 of PCV-2 strain Imp1010.

41. Use of:
a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2; and b) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
for reducing the viral load of PCV-2 in the mesenteric nodes of a pig.

42. Use of:
a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
b) a second DNA plasmid vector comprising a second nucleotide sequence encoding ORF4 of PCV-2; and c) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
for reducing the viral load of PCV-2 in the mesenteric nodes of a pig.

43. The use according to claim 42 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 88% identity with ORF4 of PCV-2 strain lmp1010.

44. The use according to claim 42 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 95% identity with ORF4 of PCV-2 strain Imp1010.

45. The use according to any one of claims 41 to 44 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80% identity with ORF13 of PCV-2 strain lmp1010.

46. The use according to any one of claims 41 to 44 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95% identity with ORF13 of PCV-2 strain lmp1010.

47. An immunogenic composition for use in reducing the viral load of porcine circovirus-2 (PCV-2) in the mesenteric nodes of a pig;

wherein said immunogenic composition comprises a PCV2 immunogen and at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant;
wherein said PCV-2 immunogen is an inactivated PCV-2; an attenuated PCV-2; or capable of being expressed from a first vector comprising a DNA
fragment containing a first nucleotide sequence encoding ORF 13 of PCV-2.

48. The immunogenic composition according to claim 47 wherein said vector is an expression vector and is a DNA plasmid, E. coil, a baculovirus, a herpes virus, Aujeszky's disease virus, a porcine adenovirus, a poxvirus, vaccinia virus, avipox virus, canarypox virus, or swinepox virus.

49. The immunogenic composition according to claim 48 wherein said first vector is a DNA plasmid vector.

50. The immunogenic composition according to claim 48 wherein said first vector is a canarypox virus vector.

51. The immunogenic composition according to any one of claims 47-50 additionally comprising at least one immunogen from at least one additional pig pathogen or a vector expressing such an immunogen.

52. The immunogenic composition according to claim 51 wherein the additional pig pathogen is porcine reproductive and respiratory syndrome (PRRS), Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Escherichia coli, pseudorabies, hog cholera, Bordetella bronchispetica, Pasteurella multocida, Erysipelothrix rhusiopathiae, swine influenza, or porcine parvovirus (PPV).

53. The immunogenic composition according to claim 51 wherein the additional pig pathogen is PPV.

54. The immunogenic composition according to any one of claims 47-53 wherein the at least one of PCV-2 immunogen or the at least one additional pig pathogen is recombinantly produced.

55. The immunogenic composition according to any one of claims 47-54 wherein the first vector expressing the PCV-2 immunogen also expresses at least one additional pig pathogen.

56. The immunogenic composition according to any one of claims 47-55 wherein the first vector contains and expresses ORF 13 of PCV-2 or ORF4 and ORF 13 of PCV-2.

57. The immunogenic composition according to any one of claims 47-56 for reducing viral load of PCV-2 in a female pig prior to breeding.

58. The immunogenic composition according to any one of claims 47-56 for reducing viral load of PCV-2 in a pregnant female pig.

59. The immunogenic composition according to any one of claims 47 to 58 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80%
identity with ORF13 of PCV-2 strain Imp1010.

60. The immunogenic composition according to any one of claims 47 to 58 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95%
identity with ORF13 of PCV-2 strain Imp1010.

61. The immunogenic composition according to any one of claims 47 to 58 wherein said immunogenic composition further comprises a second vector comprising a DNA fragment containing a second nucleotide sequence encoding ORF4 of PCV-2.

62. The immunogenic composition according to claim 61 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 88% identity with ORF4 of PCV-2 strain Imp1010.

63. The immunogenic composition according to claim 61 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 95% identity with ORF4 of PCV-2 strain Imp1010.

64. An immunogenic composition for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig wherein said immunogenic composition comprises:
a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2; and b) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant.

65. An immunogenic composition for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig wherein said immunogenic composition comprises:
a) a first DNA plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV2;
b) a second DNA plasmid vector comprising a second nucleotide sequence encoding ORF4 of PCV-2; and c) at least one of a pharmaceutically or veterinarily acceptable carrier, a pharmaceutically or veterinarily acceptable vehicle, a pharmaceutically or veterinarily acceptable excipient, or a pharmaceutically or veterinarily acceptable adjuvant.

66. The immunogenic composition according to claim 65 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 88% identity with ORF4 of PCV-2 strain Imp1010.

67. The immunogenic composition according to claim 65 wherein said second nucleotide sequence encoding ORF4 of PCV-2 has at least 95% identity with ORF4 of PCV-2 strain Imp1010.

68. The immunogenic composition according to any one of claims 64 to 67 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80%
identity with ORF13 of PCV-2 strain Imp1010.

69. The immunogenic composition according to any one of claims 64 to 68 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95%
identity with ORF13 of PCV-2 strain Imp1010.

70. A first plasmid vector comprising a first nucleotide sequence encoding ORF13 of PCV-2 for use in reducing the viral load of PCV-2 in the mesenteric nodes of a pig.

71. The first plasmid vector according to claim 70 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 80% identity with ORF13 of PCV-2 strain Imp1010.

72. The first plasmid vector according to claim 70 wherein said first nucleotide sequence encoding ORF13 of PCV-2 has at least 95% identity with ORF13 of PCV-2 strain Imp1010.