CA2391007A1 - Novel human atpase proteins and polynucleotides encoding the same - Google Patents

Abstract

Novel human polynucleotide and polypeptide sequences are disclosed that can be used in therapeutic, diagnostic, and pharmacogenomic applications.

Description

NOVEL HUMAN ATPase PROTEINS AND
POLYNUCLEOTIDES ENCODING THE SAME
The present application claims the benefit of U.S.
Provisional Application Number 60/164,624 which was filed on November 10, 1999 and is herein incorporated by reference in its entirety.
1. INTRODUCTION
The present invention relates to the discovery, identification, and characterization of novel human polynucleotides encoding proteins that share sequence similarity with animal ATPase proteins. The invention encompasses the described polynucleotides, host cell expression systems, the encoded proteins, fusion proteins, polypeptides and peptides, antibodies to the encoded proteins and peptides, and genetically engineered animals that either lack or over express the disclosed genes, antagonists and agonists of the proteins, and other compounds that modulate the expression or activity of the proteins encoded by the disclosed genes that can be used for diagnosis, drug screening, clinical trial monitoring and the treatment of diseases and disorders.

2. BACKGROUND OF THE INVENTION
ATPases are proteins that mediate, facilitate, or "power"
a wide variety of chemical processes within the cell. For example, ATPases have been associated with enzymatic, catabolic, and metabolic processes as well as transport mechanisms, blood coagulation, phagocytosis, etc.

3. SUMMARY OF THE INVENTION
The present invention relates to the discovery, identification, and characterization of nucleotides that encode novel human proteins, and the corresponding amino acid sequences of these proteins. The novel human proteins (NHPs) described for the first time herein share structural similarity with animal ATPases.

WO Ul/34778 CA 02391007 2002-05-09 PCT/US00/31110 The novel human nucleic acid sequences described herein, encode alternative proteins/open reading frames (ORFs) of 972, 124, 1,056, 208, 1,270, 422, 1,426, and 578 amino acids in length (see SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, and 16 respectively).
The invention also encompasses agonists and antagonists of the described NHPs, including small molecules, large molecules, mutant NHPs, or portions thereof that compete with native NHP, peptides, and antibodies, as well as nucleotide sequences that can be used to inhibit the expression of the described NHPs (e.g., antisense and ribozyme molecules, and gene or regulatory sequence replacement constructs) or to enhance the expression of the described NHP genes (e. g., expression constructs that place the described gene under the control of a strong promoter system), and transgenic animals that express a NHP transgene, or "knock-outs" (which can be conditional) that do not express a functional NHP. A knockout ES cell line has been produced that contains a gene trap mutation in the murine ortholog of the described locus.
Further, the present invention also relates to processes for identifying compounds that modulate, i.e., act as agonists or antagonists, of NHP expression and/or NHP activity that utilize purified preparations of the described NHPs and/or NHP
product, or cells expressing the same. Such compounds can be used as therapeutic agents for the treatment of any of a wide variety of symptoms associated with biological disorders or imbalances.

4. DESCRIPTION OF THE SEQUENCE LISTING AND FIGURES
The Sequence Listing provides the sequences of the described NHP ORFs that encode the described NHP amino acid sequences. SEQ ID N0:17 describes a NHP ORF as well as flanking 5' and 3' sequences.

5. DETAILED DESCRIPTION OF THE INVENTION
The NHPs, described for the first time herein, are novel proteins that are expressed in, inter alia, human cell lines, predominantly in human kidney and placenta, as well as human fetal brain, brain, pituitary, cerebellum, spinal cord, thymus, spleen, lymph node, bone marrow, trachea, fetal liver, prostate, testis, thyroid, adrenal gland, salivary gland, stomach, small intestine, colon, uterus, mammary gland, adipose, esophagus, bladder, cervix, rectum, ovary, fetal kidney, fetal lung and gene trapped human cells.
The present invention encompasses the nucleotides presented in the Sequence Listing, host cells expressing such nucleotides, the expression products of such nucleotides, and:
(a) nucleotides that encode mammalian homologs of the described genes, including the specifically described NHPs, and the NHP products; (b) nucleotides that encode one or more portions of the NHPs that correspond to functional domains, and the polypeptide products specified by such nucleotide sequences, including but not limited to the novel regions of any active domain(s); (c) isolated nucleotides that encode mutant versions, engineered or naturally occurring, of the described NHPs in which all or a part of at least one domain is deleted or altered, and the polypeptide products specified by such nucleotide sequences, including but not limited to soluble proteins and peptides in which all or a portion of the signal sequence in deleted; (d) nucleotides that encode chimeric fusion proteins containing all or a portion of a coding region of an NHP, or one of its domains (e.g., a receptor or ligand binding domain, accessory protein/self-association domain, etc.) fused to another peptide or polypeptide; or (e) therapeutic or diagnostic derivatives of the described polynucleotides such as oligonucleotides, antisense polynucleotides, ribozymes, dsRNA, or gene therapy constructs comprising a sequence first disclosed in the Sequence Listing.
As discussed above, the present invention includes:
(a) the human DNA sequences presented in the Sequence Listing (and vectors comprising the same) and additionally contemplates any nucleotide sequence encoding a contiguous NHP
open reading frame (ORF) that hybridizes to a complement of a DNA sequence presented in the Sequence Listing under highly stringent conditions, e.g., hybridization to filter-bound DNA
in 0.5 M NaHP04, 7o sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.lxSSC/0.1o SDS at 68°C (Ausubel F.M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol.
I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, at p. 2.10.3) and encodes a functionally equivalent gene product. Additionally contemplated are any nucleotide sequences that hybridize to the complement of a DNA
sequence that encodes and expresses an amino acid sequence presented in the Sequence Listing under moderately stringent conditions, e.g., washing in 0.2xSSC/0.1o SDS at 42°C (Ausubel et al., 1989, supra), yet still encodes a functionally equivalent NHP product. Functional equivalents of a NHP
include naturally occurring NHPs present in other species and mutant NHPs whether naturally occurring or engineered (by site directed mutagenesis, gene shuffling, directed evolution as described in, for example, U.S. Patent No. 5,837,458). The invention also includes degenerate nucleic acid variants of the disclosed NHP polynucleotide sequences.
Additionally contemplated are polynucleotides encoding NHP ORFs, or their functional equivalents, encoded by polynucleotide sequences that are about 99, 95, 90, or about 85 percent similar or identical to corresponding regions of the nucleotide sequences of the Sequence Listing (as measured by BLAST sequence comparison analysis using, for example, the GCG sequence analysis package using standard default settings).
The invention also includes nucleic acid molecules, preferably DNA molecules, that hybridize to, and are therefore the complements of, the described NHP gene nucleotide sequences. Such hybridization conditions may be highly stringent or less highly stringent, as described above. In instances where the nucleic acid molecules are deoxyoligonucleotides ("DNA oligos"), such molecules are generally about 16 to about 100 bases long, or about 20 to about 80, or about 34 to about 45 bases long, or any variation or combination of sizes represented therein that incorporate a contiguous region of sequence first disclosed in the Sequence Listing. Such oligonucleotides can be used in conjunction with the polymerase chain reaction (PCR) to screen libraries, isolate clones, and prepare cloning and sequencing templates, etc.
Alternatively, such NHP oligonucleotides can be used as hybridization probes for screening libraries, and assessing gene expression patterns (particularly using a micro array or high-throughput "chip" format). Additionally, a series of the described NHP oligonucleotide sequences, or the complements thereof, can be used to represent all or a portion of the described NHP sequences. The oligonucleotides, typically between about 16 to about 40 (or any whole number within the stated range) nucleotides in length can partially overlap each other and/or the NHP sequence may be represented using oligonucleotides that do not overlap. Accordingly, the described NHP polynucleotide sequences shall typically comprise at least about two or three distinct oligonucleotide sequences of at least about 18, and preferably about 25, nucleotides in length that are each first disclosed in the described Sequence Listing. Such oligonucleotide sequences may begin at any nucleotide present within a sequence in the Sequence Listing and proceed in either a sense (5'-to-3') orientation vis-a-vis the described sequence or in an antisense orientation.
For oligonucleotide probes, highly stringent conditions may refer, e.g., to washing in 6xSSC/0.05o sodium pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base oligos), 55°C (for 20-base oligos), and 60°C (for 23-base oligos). These nucleic acid molecules may encode or act as NHP gene antisense molecules, useful, for example, in NHP gene regulation (for and/or as antisense primers in amplification reactions of NHP gene nucleic acid sequences). With respect to NHP gene regulation, such techniques can be used to regulate biological functions. Further, such sequences may be WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 used as part of ribozyme and/or triple helix sequences that are also useful for NHP gene regulation.
Inhibitory antisense or double stranded oligonucleotides can additionally comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense oligonucleotide can also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide will comprise at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual (3-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (moue et al., 1987, Nucl. Acids Res.
15:6131-6148), or a chimeric RNA-DNA analogue ( moue et al., 1987, FEBS Lett. 215:327-330). Alternatively, double stranded RNA can be used to disrupt the expression and function of a targeted NHP.
Oligonucleotides of the invention can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), and methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
Low stringency conditions are well known to those of skill in the art, and will vary predictably depending on the specific organisms from which the library and the labeled sequences are derived. For guidance regarding such conditions see, for example, Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual (and periodic updates thereof), Cold Springs Harbor Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y.
Alternatively, suitably labeled NHP nucleotide probes can be used to screen a human genomic library using appropriately stringent conditions or by PCR. The identification and characterization of human genomic clones is helpful for identifying polymorphisms (including, but not limited to, nucleotide repeats, microsatellite alleles, single nucleotide polymorphisms, or coding single nucleotide polymorphisms), determining the genomic structure of a given locus/allele, and designing diagnostic tests. For example, sequences derived from regions adjacent to the intron/exon boundaries of the human gene can be used to design primers for use in amplification assays to detect mutations within the exons, introns, splice sites (e. g., splice acceptor and/or donor sites), etc., that can be used in diagnostics and pharmacogenomics.
Further, a NHP gene homolog can be isolated from nucleic acid from an organism of interest by performing PCR using two degenerate or "wobble" oligonucleotide primer pools designed on the basis of amino acid sequences within the NHP products disclosed herein. The template for the reaction may be total RNA, mRNA, and/or cDNA obtained by reverse transcription of mRNA prepared from human or non-human cell lines or tissue known or suspected to express an allele of a NHP gene.
The PCR product can be subcloned and sequenced to ensure that the amplified sequences represent the sequence of the desired NHP gene. The PCR fragment can then be used to isolate a full length cDNA clone by a variety of methods. For example, the amplified fragment can be labeled and used to screen a cDNA library, such as a bacteriophage cDNA library.
Alternatively, the labeled fragment can be used to isolate genomic clones via the screening of a genomic library.
PCR technology can also be used to isolate full length cDNA sequences. For example, RNA can be isolated, following standard procedures, from an appropriate cellular or tissue source (i.e., one known, or suspected, to express a NHP gene).
A reverse transcription (RT) reaction can be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis. The resulting RNA/DNA hybrid may then be "tailed"
using a standard terminal transferase reaction, the hybrid may be digested with RNase H, and second strand synthesis may then be primed with a complementary primer. Thus, cDNA sequences upstream of the amplified fragment can be isolated. For a review of cloning strategies that can be used, see e.g., Sambrook et al., 1989, supra.
A cDNA encoding a mutant NHP gene can be isolated, for example, by using PCR. In this case, the first cDNA strand may be synthesized by hybridizing an oligo-dT oligonucleotide to mRNA isolated from tissue known or suspected to be expressed in an individual putatively carrying a mutant NHP

allele, and by extending the new strand with reverse transcriptase. The second strand of the cDNA is then synthesized using an oligonucleotide that hybridizes specifically to the 5' end of the normal gene. Using these two primers, the product is then amplified via PCR, optionally cloned into a suitable vector, and subjected to DNA sequence analysis through methods well known to those of skill in the art. By comparing the DNA sequence of the mutant NHP allele to that of a corresponding normal NHP allele, the mutations) responsible for the loss or alteration of function of the mutant NHP gene product can be ascertained.
Alternatively, a genomic library can be constructed using DNA obtained from an individual suspected of or known to carry a mutant NHP allele (e. g., a person manifesting a NHP-associated phenotype such as, for example, obesity, high blood pressure, connective tissue disorders, infertility, etc.), or a cDNA library can be constructed using RNA from a tissue known, or suspected, to express a mutant NHP allele. A normal NHP gene, or any suitable fragment thereof, can then be labeled and used as a probe to identify the corresponding mutant NHP allele in such libraries. Clones containing mutant NHP gene sequences can then be purified and subjected to sequence analysis according to methods well known to those skilled in the art.
Additionally, an expression library can be constructed utilizing cDNA synthesized from, for example, RNA isolated from a tissue known, or suspected, to express a mutant NHP
allele in an individual suspected of or known to carry such a mutant allele. In this manner, gene products made by the putatively mutant tissue can be expressed and screened using standard antibody screening techniques in conjunction with antibodies raised against a normal NHP product, as described below. (For screening techniques, see, for example, Harlow, E. and Lane, eds., 1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor Press, Cold Spring Harbor.) Additionally, screening can be accomplished by screening with labeled NHP fusion proteins, such as, for example, alkaline phosphatase-NHP or NHP-alkaline phosphatase fusion proteins.
In cases where a NHP mutation results in an expressed gene product with altered function (e. g., as a result of a missense or a frameshift mutation), polyclonal antibodies to a NHP are likely to cross-react with a corresponding mutant NHP gene product. Library clones detected via their reaction with such labeled antibodies can be purified and subjected to sequence analysis according to methods well known in the art.
The invention also encompasses (a) DNA vectors that contain any of the foregoing NHP coding sequences and/or their complements (i.e., antisense); (b) DNA expression vectors that contain any of the foregoing NHP coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences (for example, baculo virus as described in U.S. Patent No. 5,869,336 herein incorporated by reference); (c) genetically engineered host cells that contain any of the foregoing NHP coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences in the host cell; and (d) genetically engineered host cells that express an endogenous NHP gene under the control of an exogenously introduced regulatory element (i.e., gene activation). As used herein, regulatory elements include, but are not limited to, inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art that drive and regulate expression. Such regulatory elements include but are not limited to the human cytomegalovirus (hCMV) immediate early gene, regulatable, viral elements (particularly retroviral LTR promoters), the early or late promoters of SV40 adenovirus, the 1ac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage lambda, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase (PGK), the promoters of acid phosphatase, and the promoters of the yeast a-mating factors.
The present invention also encompasses antibodies and anti-idiotypic antibodies (including Fab fragments), antagonists and agonists of the NHP, as well as compounds or nucleotide constructs that inhibit expression of a NHP gene (transcription factor inhibitors, antisense and ribozyme molecules, or gene or regulatory sequence replacement constructs), or promote the expression of a NHP (e. g., expression constructs in which NHP coding sequences are operatively associated with expression control elements such as promoters, promoter/enhancers, etc.).
The NHPs or NHP peptides, NHP fusion proteins, NHP
nucleotide sequences, antibodies, antagonists and agonists can be useful for the detection of mutant NHPs or inappropriately expressed NHPs for the diagnosis of disease. The NHP proteins or peptides, NHP fusion proteins, NHP nucleotide sequences, host cell expression systems, antibodies, antagonists, agonists and genetically engineered cells and animals can be used for screening for drugs (or high throughput screening of combinatorial libraries) effective in the treatment of the symptomatic or phenotypic manifestations of perturbing the normal function of NHP in the body. The use of engineered host cells and/or animals may offer an advantage in that such systems allow not only for the identification of compounds that bind to the endogenous receptor for an NHP, but can also identify compounds that trigger NHP-mediated activities or pathways.
Finally, the NHP products can be used as therapeutics.
For example, soluble derivatives such as NHP peptides/domains corresponding the NHPs, NHP fusion protein products (especially NHP-Ig fusion proteins, i.e., fusions of a NHP, or a domain of a NHP, to an IgFc), NHP antibodies and anti-idiotypic antibodies (including Fab fragments), antagonists or agonists (including compounds that modulate or act on downstream targets in a NHP-mediated pathway) can be used to directly treat diseases or disorders. For instance, the administration of an effective amount of soluble NHP, or a NHP-IgFc fusion protein or an anti-idiotypic antibody (or its Fab) that mimics the NHP could activate or effectively antagonize the endogenous NHP receptor. Nucleotide constructs encoding such NHP products can be used to genetically engineer host cells to express such products in vivo; these genetically engineered cells function as "bioreactors" in the body delivering a continuous supply of a NHP, a NHP peptide, or a NHP fusion protein to the body. Nucleotide constructs encoding functional NHPs, mutant NHPs, as well as antisense and ribozyme molecules can also be used in "gene therapy"
approaches for the modulation of NHP expression. Thus, the invention also encompasses pharmaceutical formulations and methods for treating biological disorders.
Various aspects of the invention are described in greater detail in the subsections below.
5.1 THE NHP SEQUENCES
The cDNA sequences and the corresponding deduced amino acid sequences of the described NHPs are presented in the Sequence Listing. The NHP nucleotides were obtained from clustered human gene trapped sequences, ESTs and a human placenta cDNA library (Edge Biosystems, Gaithersburg, MD).
The described sequences share structural similarity with calcium transporting ATPases and aminophospholipid transporters.
5.2 NHPS AND NHP POLYPEPTIDES
NHPs, polypeptides, peptide fragments, mutated, truncated, or deleted forms of the NHPs, and/or NHP fusion proteins can be prepared for a variety of uses. These uses include, but are not limited to, the generation of antibodies, as reagents in diagnostic assays, for the identification of other cellular gene products related to a NHP, as reagents in assays for screening for compounds that can be as pharmaceutical reagents useful in the therapeutic treatment of mental, biological, or medical disorders and disease. Given the similarity information and expression data, the described NHPs can be targeted (by drugs, oligos, antibodies, etc,) in order to treat disease, or to therapeutically augment the efficacy of therapeutic agents.

The Sequence Listing discloses the amino acid sequences encoded by the described NHP genes. The NHPs typically display initiator methionines in DNA sequence contexts consistent with a translation initiation site.
The NHP amino acid sequences of the invention include the amino acid sequence presented in the Sequence Listing as well as analogues and derivatives thereof. Further, corresponding NHP homologues from other species are encompassed by the invention. In fact, any NHP protein encoded by the NHP
nucleotide sequences described above are within the scope of the invention, as are any novel polynucleotide sequences encoding all or any novel portion of an amino acid sequence presented in the Sequence Listing. The degenerate nature of the genetic code is well known, and, accordingly, each amino acid presented in the Sequence Listing, is generically representative of the well known nucleic acid "triplet" codon, or in many cases codons, that can encode the amino acid. As such, as contemplated herein, the amino acid sequences presented in the Sequence Listing, when taken together with the genetic code (see, for example, Table 4-1 at page 109 of "Molecular Cell Biology", 1986, J. Darnell et a1. eds., Scientific American Books, New York, NY, herein incorporated by reference) are generically representative of all the various permutations and combinations of nucleic acid sequences that can encode such amino acid sequences.
The invention also encompasses proteins that are functionally equivalent to the NHPs encoded by the presently described nucleotide sequences as judged by any of a number of criteria, including, but not limited to, the ability to bind and cleave a substrate of a NHP, or the ability to effect an identical or complementary downstream pathway, or a change in cellular metabolism (e. g., proteolytic activity, ion flux, tyrosine phosphorylation, transport, etc.). Such functionally equivalent NHP proteins include, but are not limited to, additions or substitutions of amino acid residues within the amino acid sequence encoded by the NHP nucleotide sequences described above, but which result in a silent change, thus WO 01/34778 CA 02391007 2002-05-09 pCT/US00/31110 producing a functionally equivalent gene product. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
A variety of host-expression vector systems can be used to express the NHP nucleotide sequences of the invention.
Where, as in the present instance, the NHP peptide or polypeptide is thought to be membrane protein, the hydrophobic regions of the protein can be excised and the resulting soluble peptide or polypeptide can be recovered from the culture media. Such expression systems also encompass engineered host cells that express a NHP, or functional equivalent, in situ. Purification or enrichment of a NHP from such expression systems can be accomplished using appropriate detergents and lipid micelles and methods well known to those skilled in the art. However, such engineered host cells themselves may be used in situations where it is important not only to retain the structural and functional characteristics of the NHP, but to assess biological activity, e.g., in drug screening assays.
The expression systems that may be used for purposes of the invention include but are not limited to microorganisms such as bacteria (e. g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA
expression vectors containing NHP nucleotide sequences; yeast (e. g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing NHP nucleotide sequences;
insect cell systems infected with recombinant virus expression vectors (e. g., baculovirus) containing NHP sequences; plant cell systems infected with recombinant virus expression WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 vectors (e. g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e. g., Ti plasmid) containing NHP nucleotide sequences; or mammalian cell systems (e. g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e. g., metallothionein promoter) or from mammalian viruses (e. g., the adenovirus late promoter; the vaccinia virus 7.5K promoter).
In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the NHP product being expressed. For example, when a large quantity of such a protein is to be produced for the generation of pharmaceutical compositions of or containing NHP, or for raising antibodies to a NHP, vectors that direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which a NHP coding sequence may be ligated individually into the vector in frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
264:5503-5509); and the like. pGEX vectors (Pharmacia or American Type Culture Collection) can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The PGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
In an insect system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. A NHP gene coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of NHP gene coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed (e. g., see Smith et al., 1983, ,7. Virol.
46:584; Smith, U.S. Patent No. 4,215,051).
In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the NHP nucleotide sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing a NHP product in infected hosts (e. g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:3655-3659). Specific initiation signals may also be required for efficient translation of inserted NHP nucleotide sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire NHP gene or cDNA, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of a NHP coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG initiation codon, must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (See Bittner et al., 1987, Methods in Enzymol. 153:516-544).
In addition, a host cell strain may be chosen that :Modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and in particular, human cell lines.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the NHP sequences described above can be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e. g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
This method may advantageously be used to engineer cell lines which express the NHP product. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the NHP
product.
A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; 0'Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad.
Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol.
Biol. 150:1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30:147).
Alternatively, any fusion protein can be readily purified by utilizing an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-8976). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading frame is translationally fused to an amino-terminal tag consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2+~nitriloacetic acid-agarose columns and histidine-tagged proteins are selectively eluted with imidazole-containing buffers.

WO 01/34778 CA 02391007 2002-05-09 pCT/US00/31110 5.3 ANTIBODIES TO NHP PRODUCTS
Antibodies that specifically recognize one or more epitopes of a NHP, or epitopes of conserved variants of a NHP, or peptide fragments of a NHP are also encompassed by the invention. Such antibodies include but are not limited to polyclonal antibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.
The antibodies of the invention may be used, for example, in the detection of NHP in a biological sample and may, therefore, be utilized as part of a diagnostic or prognostic technique whereby patients may be tested for abnormal amounts of NHP. Such antibodies may also be utilized in conjunction with, for example, compound screening schemes for the evaluation of the effect of test compounds on expression and/or activity of a NHP gene product. Additionally, such antibodies can be used in conjunction gene therapy to, for example, evaluate the normal and/or engineered NHP-expressing cells prior to their introduction into the patient. Such antibodies may additionally be used as a method for the inhibition of abnormal NHP activity. Thus, such antibodies may, therefore, be utilized as part of treatment methods.
For the production of antibodies, various host animals may be immunized by injection with the NHP, an NHP peptide (e. g., one corresponding the a functional domain of an NHP), truncated NHP polypeptides (NHP in which one or more domains have been deleted), functional equivalents of the NHP or mutated variant of the NHP. Such host animals may include but are not limited to pigs, rabbits, mice, goats, and rats, to name but a few. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's adjuvant (complete and incomplete), mineral salts such as aluminum hydroxide or aluminum phosphate, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 emulsions, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and Corynebacterium parvum.
Alternatively, the immune response could be enhanced by combination and or coupling with molecules such as keyhole limpet hemocyanin, tetanus toxoid, diptheria toxoid, ovalbumin, cholera toxin or fragments thereof. Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of the immunized animals.
Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, can be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and U.S. Patent No.
4,3'76,110), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc.
Natl. Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo.
Production of high titers of mAbs in vivo makes this the presently preferred method of production.
In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc. Natl.
Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature, 314:452-454) by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region. Such technologies are described in U.S. Patents Nos. 6,075,181 and 5,877,397 and their respective disclosures which are herein incorporated by reference in their entirety.
Alternatively, techniques described for the production of single chain antibodies (U. S. Patent 4,946,778; Bird, 1988, Science 242:423-426; Huston et al., 1988, Proc. Natl. Acad.
Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-546) can be adapted to produce single chain antibodies against NHP gene products. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
Antibody fragments which recognize specific epitopes may be generated by known techniques. For example, such fragments include, but are not limited to: the F(ab')z fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed (Ruse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
Antibodies to a NHP can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" a given NHP, using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, 1993, FASEB J 7(5):437-444; and Nissinoff, 1991, J. Immunol. 247(8):2429-2438). For example antibodies which bind to a NHP domain and competitively inhibit the binding of NHP to its cognate receptor can be used to generate anti-idiotypes that "mimic" the NHP and, therefore, bind and activate or neutralize a receptor. Such anti-idiotypic antibodies or Fab fragments of such anti-idiotypes can be used in therapeutic regimens involving a NHP
mediated pathway.
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended as single illustrations of individual aspects of the invention, and functionally equivalent methods and components are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims. All cited publications, patents, and patent applications are herein incorporated by reference in their entirety.

WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 SEQUENCE LISTING
<110> LEXICON GENETICS INCORPORATED
<120> Novel Human ATPase Proteins and Polynucleotides Encoding the Same <130> LEX-0085-PCT
<150> US 60/164,624 <151> 1999-11-10 <160> 17 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 2919 <212> DNA
<213> homo Sapiens <400>

atgactgaggctctccaatgggccagatatcactggcgacggctgatcagaggtgcaacc 60 agggatgatgattcagggccatacaactattcctcgttgctcgcctgtgggcgcaagtcc 120 tctcagatccctaaactgtcaggaaggcaccggattgttgttccccacatccagcccttc 180 aaggatgagtatgagaagttctccggagcctatgtgaacaatcgaatacgaacaacaaag 240 tacacacttctgaattttgtgccaagaaatttatttgaacaatttcacagagctgccaat 300 ttatatttcctgttcctagttgtcctgaactgggtacctttggtagaagccttccaaaag 360 gaaatcaccatgttgcctctggtggtggtccttacaattatcgcaattaaagatggcctg 420 gaagattatcggaaatacaaaattgacaaacagatcaataatttaataactaaagtttat 480 agtaggaaagagaaaaaatacattgaccgatgctggaaagacgttactgttggggacttt 540 attcgcctctcctgcaacgaggtcatccctgcagacatggtactactcttttccactgat 600 ccagatggaatctgtcacattgagacttctggtcttgatggagagagcaatttaaaacag 660 aggcaggtggttcggggatatgcagaacaggactctgaagttgatcctgagaagttttcc 720 agtaggatagaatgtgaaagcccaaacaatgacctcagcagattccgaggcttcctagaa 780 cattccaacaaagaacgcgtgggtctcagtaaagaaaatttgttgcttagaggatgcacc 840 attagaaacacagaggctgttgtgggcattgtggtttatgcaggccatgaaaccaaagca 900 atgctgaacaacagtgggccacggtataagcgcagcaaattagaaagaagagcaaacaca 960 gatgtcctctggtgtgtcatgcttctggtcataatgtgcttaactggcgcagtaggtcat 1020 ggaatctggctgagcaggtatgaaaagatgcattttttcaatgttcccgagcctgatgga 1080 catatcatatcaccactgttggcaggattttatatgttttggaccatgatcattttgtta 1140 caggtcttgattcctatttctctctatgtttccatcgaaattgtgaagcttggacaaata 1200 tatttcattcaaagtgatgtggatttctacaatgaaaaaatggattctattgttcagtgc 1260 cgagccctgaacatcgccgaggatctgggacagattcagtacctcttttccgataagaca 1320 ggaaccctcactgagaataagatggtttttcgaagatgtagtgtggcaggatttgattac 1380 tgccatgaagaaaatgccaggaggttggagtcctatcaggaagctgtctctgaagatgaa 1440 gattttatagacacagtcagtggttccctcagcaatatggcaaaaccgagagcccccagc 1500 tgcaggacagttcataatgggcctttgggaaataagccctcaaatcatcttgctgggagc 1560 tcttttactctaggaagtggagaaggagccagtgaagtgcctcattccagacaggctgct 1620 ttcagtagccccattgaaacagacgtggtaccagacaccaggcttttagacaaatttagt 1680 cagattacacctcggctctttatgccactagatgagaccatccaaaatccaccaatggaa 1740 actttgtacattatcgactttttcattgcattggcaatttgcaacacagtagtggtttct 1800 gctcctaaccaaccccgacaaaagatcagacacccttcactgggggggttgcccattaag 1860 tctttggaagagattaaaagtcttttccagagatggtctgtccgaagatcaagttctcca 1920 tcgcttaacagtgggaaagagccatcttctggagttccaaacgcctttgtgagcagactc 1980 cctctctttagtcgaatgaaaccagcttcacctgtggaggaagaggtctcccaggtgtgt 2040 gagagcccccagtgctccagtagctcagcttgctgcacagaaacagagaaacaacacggt 2100 gatgcaggcctcctgaatggcaaggcagagtccctccctggacagccattggcctgcaac 2160 ctgtgttatgaggccgagagcccagacgaagcggccttagtgtatgccgccagggcttac 2220 caatgcactttacggtctcggacaccagagcaggtcatggtggactttgctgctttggga 2280 ccattaacatttcaactcctacacatcctgccctttgactcagtaagaaaaagaatgtct 2340 gttgtggtccgacaccctctttccaatcaagttgtggtgtatacgaaaggcgctgattct 2400 gtgatcatggagttactgtcggtggcttccccagatggagcaagtctggagaaacaacag 2460 atgatagtaagggagaaaacccagaagcacttggatgactatgccaaacaaggccttcgt 2520 actttatgtatagcaaagaaggtcatgagtgacactgaatatgcagagtggctgaggaat 2580 cattttttagctgaaaccagcattgacaacagggaagaattactacttgaatctgccatg 2640 aggttggagaacaaacttacattacttggtgctactggcattgaagaccgtctgcaggag 2700 ggagtccctgaatctatagaagctcttcacaaagcgggcatcaagatctggatgctgaca 2760 ggggacaagcaggagacagctgtcaacatagcttatgcatgcaaactactggagccagat 2820 gacaagctttttatcctcaatacccaaagtaaagtgcgtatattgagattaaatctgttc 2880 ttctgtattttcaaaggcattggaacatttgagatttga 2919 <210> 2 <211> 972 <212> PRT
<213> homo sapiens <400> 2 Met Thr Glu Ala Leu Gln Trp Ala Arg Tyr His Trp Arg Arg Leu Ile Arg Gly Ala Thr Arg Asp Asp Asp Ser Gly Pro Tyr Asn Tyr Ser Ser Leu Leu Ala Cys Gly Arg Lys Ser Ser Gln Ile Pro Lys Leu Ser Gly Arg His Arg Ile Val Val Pro His Ile Gln Pro Phe Lys Asp Glu Tyr Glu Lys Phe Ser Gly Ala Tyr Val Asn Asn Arg Ile Arg Thr Thr Lys Tyr Thr Leu Leu Asn Phe Val Pro Arg Asn Leu Phe Glu Gln Phe His Arg Ala Ala Asn Leu Tyr Phe Leu Phe Leu Val Val Leu Asn Trp Val Pro Leu Val Glu Ala Phe Gln Lys Glu Ile Thr Met Leu Pro Leu Val Val Val Leu Thr Ile Ile Ala Ile Lys Asp Gly Leu Glu Asp Tyr Arg Lys Tyr Lys Ile Asp Lys Gln Ile Asn Asn Leu Ile Thr Lys Val Tyr Ser Arg Lys Glu Lys Lys Tyr Ile Asp Arg Cys Trp Lys Asp Val Thr Val Gly Asp Phe Ile Arg Leu Ser Cys Asn Glu Val Ile Pro Ala Asp Met Val Leu Leu Phe Ser Thr Asp Pro Asp Gly Ile Cys His Ile Glu Thr Ser Gly Leu Asp Gly Glu Ser Asn Leu Lys Gln Arg Gln Val Val Arg Gly Tyr Ala Glu Gln Asp Ser Glu Val Asp Pro Glu Lys Phe Ser Ser Arg Ile Glu Cys Glu Ser Pro Asn Asn Asp Leu Ser Arg Phe Arg Gly Phe Leu Glu His Ser Asn Lys Glu Arg Val Gly Leu Ser Lys Glu Asn Leu Leu Leu Arg Gly Cys Thr Ile Arg Asn Thr Glu Ala Val Val Gly Ile Val Val Tyr Ala Gly His Glu Thr Lys Ala Met Leu Asn Asn Ser Gly Pro Arg Tyr Lys Arg Ser Lys Leu Glu Arg Arg Ala Asn Thr Asp Val Leu Trp Cys Val Met Leu Leu Val Ile Met Cys Leu Thr Gly Ala Val Gly His Gly Ile Trp Leu Ser Arg Tyr Glu Lys Met His Phe Phe Asn Val Pro Glu Pro Asp Gly His Ile Ile Ser Pro Leu Leu Ala Gly Phe Tyr Met Phe Trp Thr Met Ile Ile Leu Leu Gln Val Leu Ile Pro Ile Ser Leu Tyr Val Ser Ile Glu Ile Val Lys Leu Gly Gln Ile Tyr Phe Ile Gln Ser Asp Val Asp Phe Tyr Asn Glu Lys Met Asp Ser Ile Val Gln Cys Arg Ala Leu Asn Ile Ala Glu Asp Leu Gly Gln Ile Gln Tyr Leu Phe Ser Asp Lys Thr Gly Thr Leu Thr Glu Asn Lys Met Val Phe Arg Arg Cys Ser Val Ala Gly Phe Asp Tyr Cys His Glu Glu Asn Ala Arg Arg Leu Glu Ser Tyr G1n Glu Ala Val Ser Glu Asp Glu Asp Phe Ile Asp Thr Val Ser Gly Ser Leu Ser Asn Met Ala Lys Pro Arg Ala Pro Ser Cys Arg Thr Val His Asn Gly Pro Leu Gly Asn Lys Pro Ser Asn His Leu Ala Gly Ser Ser Phe Thr Leu Gly Ser Gly Glu Gly Ala Ser Glu Val Pro His Ser Arg Gln Ala Ala Phe Ser Ser Pro Ile Glu Thr Asp Val Val Pro Asp Thr Arg Leu Leu Asp Lys Phe Ser Gln Ile Thr Pro Arg Leu Phe Met Pro Leu Asp Glu Thr Ile Gln Asn Pro Pro Met Glu Thr Leu Tyr Ile Ile Asp Phe Phe Ile Ala Leu Ala Ile Cys Asn Thr Val Val Val Ser Ala Pro Asn Gln Pro Arg Gln Lys Ile Arg His Pro Ser Leu Gly Gly Leu Pro Ile Lys Ser Leu Glu Glu Ile Lys Ser Leu Phe Gln Arg Trp Ser Val Arg Arg Ser Ser Ser Pro Ser Leu Asn Ser Gly Lys Glu Pro Ser Ser Gly Val Pro Asn Ala Phe Val Ser Arg Leu Pro Leu Phe Ser Arg Met Lys Pro Ala Ser Pro Val Glu Glu Glu Val Ser Gln Val Cys Glu Ser Pro Gln Cys Ser Ser Ser Ser Ala Cys Cys Thr Glu Thr Glu Lys Gln His Gly Asp Ala Gly Leu Leu Asn Gly Lys Ala Glu Ser Leu Pro Gly Gln Pro Leu Ala Cys Asn Leu Cys Tyr Glu Ala Glu Ser Pro Asp Glu Ala Ala Leu Val Tyr Ala Ala Arg Ala Tyr Gln Cys Thr Leu Arg Ser Arg Thr Pro Glu Gln Val Met Val Asp Phe Ala Ala Leu Gly Pro Leu Thr Phe Gln Leu Leu His Ile Leu Pro Phe Asp Ser Val Arg Lys Arg Met Ser Val Val Val Arg His Pro Leu Ser Asn Gln Val Val Val Tyr Thr Lys Gly Ala Asp Ser Val Ile Met Glu Leu Leu Ser Val Ala Ser Pro Asp Gly Ala Ser Leu Glu Lys Gln Gln Met Ile Val Arg Glu Lys Thr Gln Lys His Leu Asp Asp Tyr Ala Lys Gln Gly Leu Arg Thr Leu Cys Ile Ala Lys Lys Val Met Ser Asp Thr Glu Tyr Ala Glu Trp Leu Arg Asn His Phe Leu Ala Glu Thr Ser Ile Asp Asn Arg Glu Glu Leu Leu Leu Glu Ser Ala Met WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 Arg Leu Asn Lys Leu Thr Leu Gly Thr Gly Glu Asp Glu Leu Ala Ile Arg Leu Glu Gly Val Pro Ser Ile Ala Leu Lys Ala Gln Glu Glu His Gly Ile Ile Trp Met Leu Gly Asp Gln Glu Ala Val Lys Thr Lys Thr Asn Ile Tyr Ala Cys Lys Leu Glu Asp Asp Leu Phe Ala Leu Pro Lys Ile Leu Thr Gln Ser Lys Arg Ile Arg Leu Leu Phe Asn Val Leu Asn Phe Cys Phe Lys Gly Ile Thr Phe Ile Ile Gly Glu <210>

<211>

<212>
DNA

<213> sapiens homo <400>

atgagtgacactgaatatgc agagtggctgaggaatcattttttagctgaaaccagcatt 60 gacaacagggaagaattact acttgaatctgccatgaggttggagaacaaacttacatta 120 cttggtgctactggcattga agaccgtctgcaggagggagtccctgaatctatagaagct 180 cttcacaaagcgggcatcaa gatctggatgctgacaggggacaagcaggagacagctgtc 240 aacatagcttatgcatgcaa actactggagccagatgacaagctttttatcctcaatacc 300 caaagtaaagtgcgtatatt gagattaaatctgttcttctgtattttcaaaggcattgga 360 acatttgagatttga 375 <210>

<211>

<212>
PRT

<213> Sapiens homo <400>

Met Ser Thr Glu Tyr Ala Trp Leu Asn His Leu Ala Asp Glu Arg Phe Glu Thr Ile Asp Asn Arg Glu Leu Leu Glu Ala Met Ser Glu Leu Ser Arg Leu Asn Lys Leu Thr Leu Gly Thr Gly Glu Asp Glu Leu Ala Ile Arg Leu Glu Gly Val Pro Ser Ile Ala Leu Lys Ala Gln Glu Glu His Gly Ile Ile Trp Met Leu Gly Asp Gln Glu Ala Val Lys Thr Lys Thr Asn Ile Tyr Ala Cys Lys Leu Glu Asp Asp Leu Phe Ala Leu Pro Lys Ile Leu Thr Gln Ser Lys Arg Ile Arg Leu Leu Phe Asn Val Leu Asn Phe Cys Phe Lys Gly Ile Thr Phe Ile Ile Gly Glu <210>

<211>

<212>
DNA

<213> sapiens homo <400>

atgactgaggctctccaatg ggccagatatcactggcgacggctgatcagaggtgcaacc 60 agggatgatgattcagggcc atacaactattcctcgttgctcgcctgtgggcgcaagtcc 120 tctcagatccctaaactgtc aggaaggcaccggattgttgttccccacatccagcccttc 180 aaggatgagtatgagaagtt ctccggagcctatgtgaacaatcgaatacgaacaacaaag 240 tacacacttctgaattttgt gccaagaaatttatttgaacaatttcacagagctgccaat 300 ttatatttcctgttcctagt tgtcctgaactgggtacctttggtagaagccttccaaaag 360 gaaatcaccatgttgcctctggtggtggtccttacaattatcgcaattaaagatggcctg420 gaagattatcggaaatacaaaattgacaaacagatcaataatttaataactaaagtttat480 agtaggaaagagaaaaaatacattgaccgatgctggaaagacgttactgttggggacttt540 attcgcctctcctgcaacgaggtcatccctgcagacatggtactactcttttccactgat600 ccagatggaatctgtcacattgagacttctggtcttgatggagagagcaatttaaaacag660 aggcaggtggttcggggatatgcagaacaggactctgaagttgatcctgagaagttttcc720 agtagga.tagaatgtgaaagcccaaacaatgacctcagcagattccgaggcttcctagaa780 cattccaacaaagaacgcgtgggtctcagtaaagaaaatttgttgcttagaggatgcacc840 attagaaacacagaggctgttgtgggcattgtggtttatgcaggccatgaaaccaaagca900 atgctgaacaacagtgggccacggtataagcgcagcaaattagaaagaagagcaaacaca960 gatgtcctctggtgtgtcatgcttctggtcataatgtgcttaactggcgcagtaggtcat1020 ggaatctggctgagcaggtatgaaaagatgcattttttcaatgttcccgagcctgatgga1080 catatcatatcaccactgttggcaggattttatatgttttggaccatgatcattttgtta1140 caggtcttgattcctatttctctctatgtttccatcgaaattgtgaagcttggacaaata1200 tatttcattcaaagtgatgtggatttctacaatgaaaaaatggattctattgttcagtgc1260 cgagccctgaacatcgccgaggatctgggacagattcagtacctcttttccgataagaca1320 ggaaccctcactgagaataagatggtttttcgaagatgtagtgtggcaggatttgattac1380 tgccatgaagaaaatgccaggaggttggagtcctatcaggaagctgtctctgaagatgaa1440 gattttatagacacagtcagtggttccctcagcaatatggcaaaaccgagagcccccagc1500 tgcaggacagttcataatgggcctttgggaaataagccctcaaatcatcttgctgggagc1560 tcttttactctaggaagtggagaaggagccagtgaagtgcctcattccagacaggctgct1620 ttcagtagccccattgaaacagacgtggtaccagacaccaggcttttagacaaatttagt1680 cagattacacctcggctctttatgccactagatgagaccatccaaaatccaccaatggaa1740 actttgtacattatcgactttttcattgcattggcaatttgcaacacagtagtggtttct1800 gctcctaaccaaccccgacaaaagatcagacacccttcactgggggggttgcccattaag1860 tctttggaagagattaaaagtcttttccagagatggtctgtccgaagatcaagttctcca1920 tcgcttaacagtgggaaagagccatcttctggagttccaaacgcctttgtgagcagactc1980 cctctctttagtcgaatgaaaccagcttcacctgtggaggaagaggtctcccaggtgtgt2040 gagagcccccagtgctccagtagctcagcttgctgcacagaaacagagaaacaacacggt2100 gatgcaggcctcctgaatggcaaggcagagtccctccctggacagccattggcctgcaac2160 ctgtgttatgaggccgagagcccagacgaagcggccttagtgtatgccgccagggcttac2220 caatgcactttacggtctcggacaccagagcaggtcatggtggactttgctgctttggga2280 ccattaacatttcaactcctacacatcctgccctttgactcagtaagaaaaagaatgtct2340 gttgtggtccgacaccctctttccaatcaagttgtggtgtatacgaaaggcgctgattct2400 gtgatcatggagttactgtcggtggcttccccagatggagcaagtctggagaaacaacag2460 atgatagtaagggagaaaacccagaagcacttggatgactatgccaaacaaggccttcgt2520 actttatgtatagcaaagaaggtcatgagtgacactgaatatgcagagtggctgaggaat2580 cattttttagctgaaaccagcattgacaacagggaagaattactacttgaatctgccatg2640 aggttggagaacaaacttacattacttggtgctactggcattgaagaccgtctgcaggag2700 ggagtccctgaatctatagaagctcttcacaaagcgggcatcaagatctggatgctgaca2760 ggggacaagcaggagacagctgtcaacatagcttatgcatgcaaactactggagccagat2820 gacaagctttttatcctcaatacccaaagtaaagatgcctgtgggatgctgatgagcaca2880 attttgaaagaacttcagaagaaaactcaagccctgccagagcaagtgtcattaagtgaa2940 gatttacttcagcctcctgtcccccgggactcagggttacgagctggactcattatcact3000 gggaagaccctggagtttgccctgcaagaaagtctgcaaaagcagttcctggaactgaca3060 tcttggtgtcaagctgtggtctgctgccgagccacaccgctgcagaaaagtgaagtggtg3120 aaattggtccgcagccatctccaggtgatgacccttgctattggtgagtga 3171 <210> 6 <211> 1056 <212> PRT
<213> homo sapiens <400> 6 Met Thr Glu Ala Leu Gln Trp Ala Arg Tyr His Trp Arg Arg Leu Ile Arg Gly Ala Thr Arg Asp Asp Asp Ser Gly Pro Tyr Asn Tyr Ser Ser Leu Leu Ala Cys Gly Arg Lys Ser Ser Gln Ile Pro Lys Leu Ser Gly Arg His Arg Ile Val Val Pro His Ile Gln Pro Phe Lys Asp Glu Tyr Glu Lys Phe Ser Gly Ala Tyr Val Asn Asn Arg Ile Arg Thr Thr Lys WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 Tyr Thr Leu Leu Asn Phe Val Pro Arg Asn Leu Phe Glu Gln Phe His Arg Ala Ala Asn Leu Tyr Phe Leu Phe Leu Val Val Leu Asn Trp Val Pro Leu Val Glu Ala Phe Gln Lys Glu Ile Thr Met Leu Pro Leu Val Val Val Leu Thr Ile Ile Ala Ile Lys Asp Gly Leu Glu Asp Tyr Arg Lys Tyr Lys Ile Asp Lys Gln Ile Asn Asn Leu Ile Thr Lys Val Tyr Ser Arg Lys Glu Lys Lys Tyr Ile Asp Arg Cys Trp Lys Asp Val Thr Val Gly Asp Phe Ile Arg Leu Ser Cys Asn Glu Val Ile Pro Ala Asp Met Val Leu Leu Phe Ser Thr Asp Pro Asp Gly Ile Cys His Ile Glu Thr Ser Gly Leu Asp Gly Glu Ser Asn Leu Lys Gln Arg Gln Val Val Arg Gly Tyr Ala Glu Gln Asp Ser Glu Val Asp Pro Glu Lys Phe Ser Ser Arg Ile Glu Cys Glu Ser Pro Asn Asn Asp Leu Ser Arg Phe Arg Gly Phe Leu Glu His Ser Asn Lys Glu Arg Val Gly Leu Ser Lys Glu Asn Leu Leu Leu Arg Gly Cys Thr Ile Arg Asn Thr Glu Ala Val Val Gly Ile Val Val Tyr Ala Gly His Glu Thr Lys Ala Met Leu Asn Asn Ser Gly Pro Arg Tyr Lys Arg Ser Lys Leu Glu Arg Arg Ala Asn Thr Asp Val Leu Trp Cys Val Met Leu Leu Val Ile Met Cys Leu Thr Gly Ala Val Gly His Gly Ile Trp Leu Ser Arg Tyr Glu Lys Met His Phe Phe Asn Val Pro Glu Pro Asp Gly His Ile Ile Ser Pro Leu Leu Ala Gly Phe Tyr Met Phe Trp Thr Met Ile Ile Leu Leu Gln Val Leu Ile Pro Ile Ser Leu Tyr Val Ser Ile Glu Ile Val Lys Leu Gly Gln Ile Tyr Phe Ile Gln Ser Asp Val Asp Phe Tyr Asn Glu Lys Met Asp Ser Ile Val Gln Cys Arg Ala Leu Asn Ile Ala Glu Asp Leu Gly Gln Ile Gln Tyr Leu Phe Ser Asp Lys Thr Gly Thr Leu Thr Glu Asn Lys Met Val Phe Arg Arg Cys Ser Val Ala Gly Phe Asp Tyr Cys His Glu Glu Asn Ala Arg Arg Leu Glu Ser Tyr Gln Glu Ala Val Ser Glu Asp Glu Asp Phe Ile Asp Thr Val Ser Gly Ser Leu Ser Asn Met Ala Lys Pro Arg Ala Pro Ser Cys Arg Thr Val His Asn Gly Pro Leu Gly Asn Lys Pro Ser Asn His Leu Ala Gly Ser Ser Phe Thr Leu Gly Ser Gly Glu Gly Ala Ser Glu Val Pro His Ser Arg Gln Ala Ala Phe Ser Ser Pro Ile Glu Thr Asp Val Val Pro Asp Thr Arg Leu Leu Asp Lys Phe Ser Gln Ile Thr Pro Arg Leu Phe Met Pro Leu Asp Glu Thr Ile Gln Asn WO 01/34778 CA 02391007 2002-05-09 pCT/US00/31110 Pro Pro Met Glu Thr Leu Tyr Ile Ile Asp Phe Phe Ile Ala Leu Ala Ile Cys Asn Thr Val Val Val Ser Ala Pro Asn Gln Pro Arg Gln Lys Ile Arg His Pro Ser Leu Gly Gly Leu Pro Ile Lys Ser Leu Glu Glu Ile Lys Ser Leu Phe Gln Arg Trp Ser Val Arg Arg Ser Ser Ser Pro Ser Leu Asn Ser Gly Lys Glu Pro Ser Ser Gly Val Pro Asn Ala Phe Val Ser Arg Leu Pro Leu Phe Ser Arg Met Lys Pro Ala Ser Pro Val Glu Glu Glu Val Ser Gln Val Cys Glu Ser Pro Gln Cys Ser Ser Ser Ser Ala Cys Cys Thr Glu Thr Glu Lys Gln His Gly Asp Ala Gly Leu Leu Asn Gly Lys Ala Glu Ser Leu Pro Gly Gln Pro Leu Ala Cys Asn Leu Cys Tyr Glu Ala Glu Ser Pro Asp Glu Ala Ala Leu Val Tyr Ala Ala Arg Ala Tyr Gln Cys Thr Leu Arg Ser Arg Thr Pro Glu Gln Val Met Val Asp Phe Ala Ala Leu Gly Pro Leu Thr Phe Gln Leu Leu His Ile Leu Pro Phe Asp Ser Val Arg Lys Arg Met Ser Val Val Val Arg His Pro Leu Ser Asn Gln Val Val Val Tyr Thr Lys Gly Ala Asp Ser Val Ile Met Glu Leu Leu Ser Val Ala Ser Pro Asp Gly Ala Ser Leu Glu Lys Gln Gln Met Ile Val Arg Glu Lys Thr Gln Lys His Leu Asp Asp Tyr Ala Lys Gln Gly Leu Arg Thr Leu Cys Ile Ala Lys Lys Val Met Ser Asp Thr Glu Tyr Ala Glu Trp Leu Arg Asn His Phe Leu Ala Glu Thr Ser Ile Asp Asn Arg Glu Glu Leu Leu Leu Glu Ser Ala Met Arg Leu Glu Asn Lys Leu Thr Leu Leu Gly Ala Thr Gly Ile Glu Asp Arg Leu Gln Glu Gly Val Pro Glu Ser Ile Glu Ala Leu His Lys Ala Gly Ile Lys Ile Trp Met Leu Thr Gly Asp Lys Gln Glu Thr Ala Val Asn Ile Ala Tyr Ala Cys Lys Leu Leu Glu Pro Asp Asp Lys Leu Phe Ile Leu Asn Thr Gln Ser Lys Asp Ala Cys Gly Met Leu Met Ser Thr Ile Leu Lys Glu Leu Gln Lys Lys Thr Gln Ala Leu Pro Glu Gln Val Ser Leu Ser Glu Asp Leu Leu Gln Pro Pro Val Pro Arg Asp Ser Gly Leu Arg Ala Gly Leu Ile Ile Thr Gly Lys Thr Leu Glu Phe Ala Leu Gln Glu Ser Leu Gln Lys Gln Phe Leu Glu Leu Thr Ser Trp Cys Gln Ala Val Val Cys Cys Arg Ala Thr Pro Leu Gln Lys Ser Glu Val Val Lys Leu Val Arg Ser His Leu Gln Val Met Thr Leu Ala Ile Gly Glu <210> 7 <211> 627 WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 <212> DNA

<213> homosapiens <400> 7 atgagtgacactgaatatgc agagtggctgaggaatcattttttagctgaaaccagcatt60 gacaacagggaagaattact acttgaatctgccatgaggttggagaacaaacttacatta120 cttggtgctactggcattga agaccgtctgcaggagggagtccctgaatctatagaagct180 cttcacaaagcgggcatcaa gatctggatgctgacaggggacaagcaggagacagctgtc240 aacatagcttatgcatgcaa actactggagccagatgacaagctttttatcctcaatacc300 caaagtaaagatgcctgtgg gatgctgatgagcacaattttgaaagaacttcagaagaaa360 actcaagccctgccagagca agtgtcattaagtgaagatttacttcagcctcctgtcccc420 cgggactcagggttacgagc tggactcattatcactgggaagaccctggagtttgccctg480 caagaaagtctgcaaaagca gttcctggaactgacatcttggtgtcaagctgtggtctgc540 tgccgagccacaccgctgca gaaaagtgaagtggtgaaattggtccgcagccatctccag600 gtgatgacccttgctattgg tgagtga 627 <210> 8 <211> 208 <212> PRT

<213> homoSapiens <400> 8 Met Ser Thr Glu Tyr Ala Trp Leu Asn His Leu Ala Asp Glu Arg Phe Glu Thr Ile Asp Asn Arg Glu Leu Leu Glu Ala Met Ser Glu Leu Ser Arg Leu Asn Lys Leu Thr Leu Gly Thr Gly Glu Asp Glu Leu Ala Ile Arg Leu Glu Gly Val Pro Ser Ile Ala Leu Lys Ala Gln Glu Glu His Gly Ile Ile Trp Met Leu Gly Asp Gln Glu Ala Val Lys Thr Lys Thr Asn Ile Tyr Ala Cys Lys Leu Glu Asp Asp Leu Phe Ala Leu Pro Lys Ile Leu Thr Gln Ser Lys Ala Cys Met Leu Ser Thr Asn Asp~ Gly Met Ile Leu Glu Leu Gln Lys Thr Gln Leu Pro Gln Val Lys Lys Ala Glu Ser Leu Glu Asp Leu Leu Pro Pro Pro Arg Ser Gly Ser Gln Val Asp Leu Arg Gly Leu Ile Ile Gly Lys Leu Glu Ala Leu Ala Thr Thr Phe Gln Glu Leu Gln Lys Gln Leu Glu Thr Ser Cys Gln Ser Phe Leu Trp Ala Val Cys Cys Arg Ala Pro Leu Lys Ser Val Val Val Thr Gln Glu Lys Leu Arg Ser His Leu Val Met Leu Ala Gly Glu Val Gln Thr Ile <210> 9 <211> 3813 <212> DNA

<213> homosapiens <400> 9 atgactgaggctctccaatg ggccagatatcactggcgacggctgatcagaggtgcaacc60 agggatgatgattcagggcc atacaactattcctcgttgctcgcctgtgggcgcaagtcc120 tctcagatccctaaactgtc aggaaggcaccggattgttgttccccacatccagcccttc180 aaggatgagtatgagaagtt ctccggagcctatgtgaacaatcgaatacgaacaacaaag240 tacacacttctgaattttgt gccaagaaatttatttgaacaatttcacagagctgccaat300 ttatatttcctgttcctagt tgtcctgaactgggtacctttggtagaagccttccaaaag360 gaaatcaccatgttgcctct ggtggtggtccttacaattatcgcaattaaagatggcctg420 gaagattatcggaaatacaa aattgacaaacagatcaataatttaataactaaagtttat480 agtaggaaagagaaaaaatacattgaccgatgctggaaagacgttactgttggggacttt 540 attcgcctctcctgcaacgaggtcatccctgcagacatggtactactcttttccactgat 600 ccagatggaatctgtcacattgagacttctggtcttgatggagagagcaatttaaaacag 660 aggcaggtggttcggggatatgcagaacaggactctgaagttgatcctgagaagttttcc 720 agtaggatagaatgtgaaagcccaaacaatgacctcagcagattccgaggcttcctagaa 780 cattccaacaaagaacgcgtgggtctcagtaaagaaaatttgttgcttagaggatgcacc 840 attagaaacacagaggctgttgtgggcattgtggtttatgcaggccatgaaaccaaagca 900 atgctgaacaacagtgggccacggtataagcgcagcaaattagaaagaagagcaaacaca 960 gatgtcctctggtgtgtcatgcttctggtcataatgtgcttaactggcgcagtaggtcat 1020 ggaatctggctgagcaggtatgaaaagatgcattttttcaatgttcccgagcctgatgga 1080 catatcatatcaccactgttggcaggattttatatgttttggaccatgatcattttgtta 1140 caggtcttgattcctatttctctctatgtttccatcgaaattgtgaagcttggacaaata 1200 tatttcattcaaagtgatgtggatttctacaatgaaaaaatggattctattgttcagtgc 1260 cgagccctgaacatcgccgaggatctgggacagattcagtacctcttttccgataagaca 1320 ggaaccctcactgagaataagatggtttttcgaagatgtagtgtggcaggatttgattac 1380 tgccatgaagaaaatgccaggaggttggagtcctatcaggaagctgtctctgaagatgaa 1440 gattttatagacacagtcagtggttccctcagcaatatggcaaaaccgagagcccccagc 1500 tgcaggacagttcataatgggcctttgggaaataagccctcaaatcatcttgctgggagc 1560 tcttttactctaggaagtggagaaggagccagtgaagtgcctcattccagacaggctgct 1620 ttcagtagccccattgaaacagacgtggtaccagacaccaggcttttagacaaatttagt 1680 cagattacacctcggctctttatgccactagatgagaccatccaaaatccaccaatggaa 1740 actttgtacattatcgactttttcattgcattggcaatttgcaacacagtagtggtttct 1800 gctcctaaccaaccccgacaaaagatcagacacccttcactgggggggttgcccattaag 1860 tctttggaagagattaaaagtcttttccagagatggtctgtccgaagatcaagttctcca 1920 tcgcttaacagtgggaaagagccatcttctggagttccaaacgcctttgtgagcagactc 1980 cctctctttagtcgaatgaaaccagcttcacctgtggaggaagaggtctcccaggtgtgt 2040 gagagcccccagtgctccagtagctcagcttgctgcacagaaacagagaaacaacacggt 2100 gatgcaggcctcctgaatggcaaggcagagtccctccctggacagccattggcctgcaac 2160 ctgtgttatgaggccgagagcccagacgaagcggccttagtgtatgccgccagggcttac 2220 caatgcactttacggtctcggacaccagagcaggtcatggtggactttgctgctttggga 2280 ccattaacatttcaactcctacacatcctgccctttgactcagtaagaaaaagaatgtct 2340 gttgtggtccgacaccctctttccaatcaagttgtggtgtatacgaaaggcgctgattct 2400 gtgatcatggagttactgtcggtggcttccccagatggagcaagtctggagaaacaacag 2460 atgatagtaagggagaaaacccagaagcacttggatgactatgccaaacaaggccttcgt 2520 actttatgtatagcaaagaaggtcatgagtgacactgaatatgcagagtggctgaggaat 2580 cattttttagctgaaaccagcattgacaacagggaagaattactacttgaatctgccatg 2640 aggttggagaacaaacttacattacttggtgctactggcattgaagaccgtctgcaggag 2700 ggagtccctgaatctatagaagctcttcacaaagcgggcatcaagatctggatgctgaca 2760 ggggacaagcaggagacagctgtcaacatagcttatgcatgcaaactactggagccagat 2820 gacaagctttttatcctcaatacccaaagtaaagatgcctgtgggatgctgatgagcaca 2880 attttgaaagaacttcagaagaaaactcaagccctgccagagcaagtgtcattaagtgaa 2940 gatttacttcagcctcctgtcccccgggactcagggttacgagctggactcattatcact 3000 gggaagaccctggagtttgccctgcaagaaagtctgcaaaagcagttcctggaactgaca 3060 tcttggtgtcaagctgtggtctgctgccgagccacaccgctgcagaaaagtgaagtggtg 3120 aaattggtccgcagccatctccaggtgatgacccttgctattggtgatggtgccaatgat 3180 gttagcatgatacaagtggcagacattgggataggggtctcaggtcaagaaggcatgcag 3240 gctgtgatggccagtgactttgccgtttctcagttcaaacatctcagcaagctccttctt 3300 gtccatggacactggtgttatacacggctttccaacatgattctctattttttctataag 3360 aatgtggcctatgtgaacctccttttctggtaccagttcttttgtggattttcaggaaca 3420 tccatgactgattactgggttttgatcttcttcaacctcctcttcacatctgcccctcct 3480 gtcatttatggtgttttggagaaagatgtgtctgcagagaccctcatgcaactgcctgaa 3540 ctttacagaagtggtcagaaatcagaggcatacttaccccataccttctggatcacctta 3600 ttggatgctttttatcaaagcctggtctgcttctttgtgccttattttacctaccagggc 3660 tcagatactgacatctttgcatttggaaaccccctgaacacagccactctgttcatcgtt 3720 ctcctccatctggtcattgaaagcaagagtttgaccaggtgcagtgactcacacctgcaa 3780 ttccagagctttgggaggctgtggatcacatga 3813 <210> 10 <211> 1270 <212> PRT
<213> homo Sapiens <400> 10 Met Thr Glu Ala Leu Gln Trp Ala Arg Tyr His Trp Arg Arg Leu Ile Arg Gly Ala Thr Arg Asp Asp Asp Ser Gly Pro Tyr Asn Tyr Ser Ser Leu Leu Ala Cys Gly Arg Lys Ser Ser Gln Ile Pro Lys Leu Ser Gly Arg His Arg Ile Val Val Pro His Ile Gln Pro Phe Lys Asp Glu Tyr Glu Lys Phe Ser Gly Ala Tyr Val Asn Asn Arg Ile Arg Thr Thr Lys Tyr Thr Leu Leu Asn Phe Val Pro Arg Asn Leu Phe Glu Gln Phe His Arg Ala Ala Asn Leu Tyr Phe Leu Phe Leu Val Val Leu Asn Trp Val Pro Leu Val Glu Ala Phe Gln Lys Glu Ile Thr Met Leu Pro Leu Val Val Val Leu Thr Ile Ile Ala Ile Lys Asp Gly Leu Glu Asp Tyr Arg Lys Tyr Lys Ile Asp Lys Gln Ile Asn Asn Leu Ile Thr Lys Val Tyr Ser Arg Lys Glu Lys Lys Tyr Ile Asp Arg Cys Trp Lys Asp Val Thr Val Gly Asp Phe Ile Arg Leu Ser Cys Asn Glu Val Ile Pro Ala Asp Met Val Leu Leu Phe Ser Thr Asp Pro Asp Gly Ile Cys His Ile Glu Thr Ser Gly Leu Asp Gly Glu Ser Asn Leu Lys Gln Arg Gln Val Val Arg Gly Tyr Ala Glu Gln Asp Ser Glu Val Asp Pro Glu Lys Phe Ser Ser Arg Ile Glu Cys Glu Ser Pro Asn Asn Asp Leu Ser Arg Phe Arg Gly Phe Leu Glu His Ser Asn Lys Glu Arg Val Gly Leu Ser Lys Glu Asn Leu Leu Leu Arg Gly Cys Thr Ile Arg Asn Thr Glu Ala Val Val Gly Ile Val Val Tyr Ala Gly His Glu Thr Lys Ala Met Leu Asn Asn Ser Gly Pro Arg Tyr Lys Arg Ser Lys Leu Glu Arg Arg Ala Asn Thr Asp Val Leu Trp Cys Val Met Leu Leu Val Ile Met Cys Leu Thr Gly Ala Val Gly His Gly Ile Trp Leu Ser Arg Tyr Glu Lys Met His Phe Phe Asn Val Pro Glu Pro Asp Gly His Ile Ile Ser Pro Leu Leu Ala Gly Phe Tyr Met Phe Trp Thr Met Ile Ile Leu Leu Gln Val Leu Ile Pro Ile Ser Leu Tyr Val Ser Ile Glu Ile Val Lys Leu Gly Gln Ile Tyr Phe Ile Gln Ser Asp Val Asp Phe Tyr Asn Glu Lys Met Asp Ser Ile Val Gln Cys Arg Ala Leu Asn Ile Ala Glu Asp Leu Gly Gln Ile Gln Tyr Leu Phe Ser Asp Lys Thr Gly Thr Leu Thr Glu Asn Lys Met Val Phe Arg Arg Cys Ser Val Ala Gly Phe Asp Tyr Cys His Glu Glu Asn Ala Arg Arg Leu Glu Ser Tyr Gln Glu Ala Val Ser Glu Asp Glu Asp Phe Ile Asp Thr Val Ser Gly Ser Leu Ser Asn Met Ala Lys Pro Arg Ala Pro Ser Cys Arg Thr Val His Asn Gly Pro Leu Gly Asn Lys WO 01/34778 CA 02391007 2002-05-09 pCT/US00/31110 Pro Ser Asn His Leu Ala Gly Ser Ser Phe Thr Leu Gly Ser Gly Glu Gly Ala Ser Glu Val Pro His Ser Arg Gln Ala Ala Phe Ser Ser Pro Ile Glu Thr Asp Val Val Pro Asp Thr Arg Leu Leu Asp Lys Phe Ser Gln Ile Thr Pro Arg Leu Phe Met Pro Leu Asp Glu Thr Ile Gln Asn Pro Pro Met Glu Thr Leu Tyr Ile Ile Asp Phe Phe Ile Ala Leu Ala Ile Cys Asn Thr Val Val Val Ser Ala Pro Asn Gln Pro Arg Gln Lys Ile Arg His Pro Ser Leu Gly Gly Leu Pro Ile Lys Ser Leu Glu Glu Ile Lys Ser Leu Phe Gln Arg Trp Ser Val Arg Arg Ser Ser Ser Pro Ser Leu Asn Ser Gly Lys Glu Pro Ser Ser Gly Val Pro Asn Ala Phe Val Ser Arg Leu Pro Leu Phe Ser Arg Met Lys Pro Ala Ser Pro Val Glu Glu Glu Val Ser Gln Val Cys Glu Ser Pro Gln Cys Ser Ser Ser Ser Ala Cys Cys Thr Glu Thr Glu Lys Gln His Gly Asp Ala Gly Leu Leu Asn Gly Lys Ala Glu Ser Leu Pro Gly Gln Pro Leu Ala Cys Asn Leu Cys Tyr Glu Ala Glu Ser Pro Asp Glu Ala Ala Leu Val Tyr Ala Ala Arg Ala Tyr Gln Cys Thr Leu Arg Ser Arg Thr Pro Glu Gln Val Met Val Asp Phe Ala Ala Leu Gly Pro Leu Thr Phe Gln Leu Leu His Ile Leu Pro Phe Asp Ser Val Arg Lys Arg Met Ser Val Val Val Arg His Pro Leu Ser Asn Gln Val Val Val Tyr Thr Lys Gly Ala Asp Ser Val Ile Met Glu Leu Leu Ser Val Ala Ser Pro Asp Gly Ala Ser Leu Glu Lys Gln Gln Met Ile Val Arg Glu Lys Thr Gln Lys His Leu Asp Asp Tyr Ala Lys Gln Gly Leu Arg Thr Leu Cys Ile Ala Lys Lys Val Met Ser Asp Thr Glu Tyr Ala Glu Trp Leu Arg Asn His Phe Leu Ala Glu Thr Ser Ile Asp Asn Arg Glu Glu Leu Leu Leu Glu Ser Ala Met Arg Leu Glu Asn Lys Leu Thr Leu Leu Gly Ala Thr Gly Ile Glu Asp Arg Leu Gln Glu Gly Val Pro Glu Ser Ile Glu Ala Leu His Lys Ala Gly Ile Lys Ile Trp Met Leu Thr Gly Asp Lys Gln Glu Thr Ala Val Asn Ile Ala Tyr Ala Cys Lys Leu Leu Glu Pro Asp Asp Lys Leu Phe Ile Leu Asn Thr Gln Ser Lys Asp Ala Cys Gly Met Leu Met Ser Thr Ile Leu Lys Glu Leu Gln Lys Lys Thr Gln Ala Leu Pro Glu Gln Val Ser Leu Ser Glu Asp Leu Leu Gln Pro Pro Val Pro Arg Asp Ser Gly Leu Arg Ala Gly Leu Ile Ile Thr Gly Lys Thr Leu Glu Phe Ala Leu Gln Glu Ser Leu Gln Lys Gln Phe Leu Glu Leu Thr Ser Trp Cys Gln Ala Val Val Cys Cys Arg Ala Thr Pro Leu Gln Lys Ser Glu Val Val Lys Leu Val Arg Ser His Leu Gln Val Met Thr Leu Ala Ile Gly Asp Gly Ala Asn Asp Val Ser Met Ile Gln Val Ala Asp Ile Gly Ile Gly Val Ser Gly Gln Glu Gly Met Gln Ala Val Met Ala Ser Asp Phe Ala Val Ser Gln Phe Lys His Leu Ser Lys Leu Leu Leu Val His Gly His Trp Cys Tyr Thr Arg Leu Ser Asn Met Ile Leu Tyr Phe Phe Tyr Lys Asn Val Ala Tyr Val Asn Leu Leu Phe Trp Tyr Gln Phe Phe Cys Gly Phe Ser Gly Thr Ser Met Thr Asp Tyr Trp Val Leu Ile Phe Phe Asn Leu Leu Phe Thr Ser Ala Pro Pro Val Ile Tyr Gly Val Leu Glu Lys Asp Val Ser Ala Glu Thr Leu Met Gln Leu Pro Glu Leu Tyr Arg Ser Gly Gln Lys Ser Glu Ala Tyr Leu Pro His Thr Phe Trp Ile Thr Leu Leu Asp Ala Phe Tyr Gln Ser Leu Val Cys Phe Phe Val Pro Tyr Phe Thr Tyr Gln Gly Ser Asp Thr Asp Ile Phe Ala Phe Gly Asn Pro Leu Asn Thr Ala Thr Leu Phe Ile Val Leu Leu His Leu Val Ile Glu Ser Lys Ser Leu Thr Arg Cys Ser Asp Ser His Leu Gln Phe Gln Ser Phe Gly Arg Leu Trp Ile Thr <210> 11 <211> 1269 <212> DNA
<213> homo sapiens <400>

atgagtgacactgaatatgcagagtggctgaggaatcattttttagctgaaaccagcatt60 gacaacagggaagaattactacttgaatctgccatgaggttggagaacaaacttacatta120 cttggtgctactggcattgaagaccgtctgcaggagggagtccctgaatctatagaagct180 cttcacaaagcgggcatcaagatctggatgctgacaggggacaagcaggagacagctgtc240 aacatagcttatgcatgcaaactactggagccagatgacaagctttttatcctcaatacc300 caaagtaaagatgcctgtgggatgctgatgagcacaattttgaaagaacttcagaagaaa360 actcaagccctgccagagcaagtgtcattaagtgaagatttacttcagcctcctgtcccc420 cgggactcagggttacgagctggactcattatcactgggaagaccctggagtttgccctg480 caagaaagtctgcaaaagcagttcctggaactgacatcttggtgtcaagctgtggtctgc540 tgccgagccacaccgctgcagaaaagtgaagtggtgaaattggtccgcagccatctccag600 gtgatgacccttgctattggtgatggtgccaatgatgttagcatgatacaagtggcagac660 attgggataggggtctcaggtcaagaaggcatgcaggctgtgatggccagtgactttgcc720 gtttctcagttcaaacatctcagcaagctccttcttgtccatggacactggtgttataca780 cggctttccaacatgattctctattttttctataagaatgtggcctatgtgaacctcctt840 ttctggtaccagttcttttgtggattttcaggaacatccatgactgattactgggttttg900 atcttcttcaacctcctcttcacatctgcccctcctgtcatttatggtgttttggagaaa960 gatgtgtctgcagagaccctcatgcaactgcctgaactttacagaagtggtcagaaatca1020 gaggcatacttaccccataccttctggatcaccttattggatgctttttatcaaagcctg1080 gtctgcttctttgtgccttattttacctaccagggctcagatactgacatctttgcattt1140 ggaaaccccctgaacacagccactctgttcatcgttctcctccatctggtcattgaaagc1200 aagagtttgaccaggtgcagtgactcacacctgcaattccagagctttgggaggctgtgg1260 atcacatga 1269 <210> 12 <211> 422 <212> PRT
<213> homo Sapiens <400> 12 Met Ser Asp Thr Glu Tyr Ala Glu Trp Leu Arg Asn His Phe Leu Ala Glu Thr Ser Ile Asp Asn Arg Glu Glu Leu Leu Leu Glu Ser Ala Met Arg Leu Glu Asn Lys Leu Thr Leu Leu Gly Ala Thr Gly Ile Glu Asp Arg Leu Gln Glu Gly Val Pro Glu Ser Ile Glu Ala Leu His Lys Ala Gly Ile Lys Ile Trp Met Leu Thr Gly Asp Lys Gln Glu Thr Ala Val Asn Ile Ala Tyr Ala Cys Lys Leu Leu Glu Pro Asp Asp Lys Leu Phe Ile Leu Asn Thr Gln Ser Lys Asp Ala Cys Gly Met Leu Met Ser Thr Ile Leu Lys Glu Leu Gln Lys Lys Thr Gln Ala Leu Pro Glu Gln Val Ser Leu Ser Glu Asp Leu Leu Gln Pro Pro Val Pro Arg Asp Ser Gly Leu Arg Ala Gly Leu Ile Ile Thr Gly Lys Thr Leu Glu Phe Ala Leu Gln Glu Ser Leu Gln Lys Gln Phe Leu Glu Leu Thr Ser Trp Cys Gln Ala Val Val Cys Cys Arg Ala Thr Pro Leu Gln Lys Ser Glu Val Val Lys Leu Val Arg Ser His Leu Gln Val Met Thr Leu Ala Ile Gly Asp Gly Ala Asn Asp Val Ser Met Ile Gln Val Ala Asp Ile Gly Ile Gly Val Ser Gly Gln Glu Gly Met Gln Ala Val Met Ala Ser Asp Phe Ala Val Ser Gln Phe Lys His Leu Ser Lys Leu Leu Leu Val His Gly His Trp Cys Tyr Thr Arg Leu Ser Asn Met Ile Leu Tyr Phe Phe Tyr Lys Asn Val Ala Tyr Val Asn Leu Leu Phe Trp Tyr Gln Phe Phe Cys Gly Phe Ser Gly Thr Ser Met Thr Asp Tyr Trp Val Leu Ile Phe Phe Asn Leu Leu Phe Thr Ser Ala Pro Pro Val Ile Tyr Gly Val Leu Glu Lys Asp Val Ser Ala Glu Thr Leu Met Gln Leu Pro Glu Leu Tyr Arg Ser Gly Gln Lys Ser Glu Ala Tyr Leu Pro His Thr Phe Trp Ile Thr Leu Leu Asp Ala Phe Tyr Gln Ser Leu Val Cys Phe Phe Val Pro Tyr Phe Thr Tyr Gln Gly Ser Asp Thr Asp Ile Phe Ala Phe Gly Asn Pro Leu Asn Thr Ala Thr Leu Phe Ile Val Leu Leu His Leu Val Ile Glu Ser Lys Ser Leu Thr Arg Cys Ser Asp Ser His Leu Gln Phe Gln Ser Phe Gly Arg Leu Trp Ile Thr <210> 13 <211> 4281 WU ~l/34778 CA 02391007 2002-05-09 PCT/US00/31110 <212> DNA
<213> homo Sapiens <400>

atgactgaggctctccaatgggccagatatcactggcgacggctgatcagaggtgcaacc 60 agggatgatgattcagggccatacaactattcctcgttgctcgcctgtgggcgcaagtcc 120 tctcagatccctaaactgtcaggaaggcaccggattgttgttccccacatccagcccttc 180 aaggatgagtatgagaagttctccggagcctatgtgaacaatcgaatacgaacaacaaag 240 tacacacttctgaattttgtgccaagaaatttatttgaacaatttcacagagctgccaat 300 ttatatttcctgttcctagttgtcctgaactgggtacctttggtagaagccttccaaaag 360 gaaatcaccatgttgcctctggtggtggtccttacaattatcgcaattaaagatggcctg 420 gaagattatcggaaatacaaaattgacaaacagatcaataatttaataactaaagtttat 480 agtaggaaagagaaaaaatacattgaccgatgctggaaagacgttactgttggggacttt 540 attcgcctctcctgcaacgaggtcatccctgcagacatggtactactcttttccactgat 600 ccagatggaatctgtcacattgagacttctggtcttgatggagagagcaatttaaaacag 660 aggcaggtggttcggggatatgcagaacaggactctgaagttgatcctgagaagttttcc 720 agtaggatagaatgtgaaagcccaaacaatgacctcagcagattccgaggcttcctagaa 780 cattccaacaaagaacgcgtgggtctcagtaaagaaaatttgttgcttagaggatgcacc 840 attagaaacacagaggctgttgtgggcattgtggtttatgcaggccatgaaaccaaagca 900 atgctgaacaacagtgggccacggtataagcgcagcaaattagaaagaagagcaaacaca 960 gatgtcctctggtgtgtcatgcttctggtcataatgtgcttaactggcgcagtaggtcat 1020 ggaatctggctgagcaggtatgaaaagatgcattttttcaatgttcccgagcctgatgga 1080 catatcatatcaccactgttggcaggattttatatgttttggaccatgatcattttgtta 1140 caggtcttgattcctatttctctctatgtttccatcgaaattgtgaagcttggacaaata 1200 tatttcattcaaagtgatgtggatttctacaatgaaaaaatggattctattgttcagtgc 1260 cgagccctgaacatcgccgaggatctgggacagattcagtacctcttttccgataagaca 1320 ggaaccctcactgagaataagatggtttttcgaagatgtagtgtggcaggatttgattac 1380 tgccatgaagaaaatgccaggaggttggagtcctatcaggaagctgtctctgaagatgaa 1440 gattttatagacacagtcagtggttccctcagcaatatggcaaaaccgagagcccccagc 1500 tgcaggacagttcataatgggcctttgggaaataagccctcaaatcatcttgctgggagc 1560 tcttttactctaggaagtggagaaggagccagtgaagtgcctcattccagacaggctgct 1620 ttcagtagccccattgaaacagacgtggtaccagacaccaggcttttagacaaatttagt 1680 cagattacacctcggctctttatgccactagatgagaccatccaaaatccaccaatggaa 1740 actttgtacattatcgactttttcattgcattggcaatttgcaacacagtagtggtttct 1800 gctcctaaccaaccccgacaaaagatcagacacccttcactgggggggttgcccattaag 1860 tctttggaagagattaaaagtcttttccagagatggtctgtccgaagatcaagttctcca 1920 tcgcttaacagtgggaaagagccatcttctggagttccaaacgcctttgtgagcagactc 1980 cctctctttagtcgaatgaaaccagcttcacctgtggaggaagaggtctcccaggtgtgt 2040 gagagcccccagtgctccagtagctcagcttgctgcacagaaacagagaaacaacacggt 2100 gatgcaggcctcctgaatggcaaggcagagtccctccctggacagccattggcctgcaac 2160 ctgtgttatgaggccgagagcccagacgaagcggccttagtgtatgccgccagggcttac 2220 caatgcactttacggtctcggacaccagagcaggtcatggtggactttgctgctttggga 2280 ccattaacatttcaactcctacacatcctgccctttgactcagtaagaaaaagaatgtct 2340 gttgtggtccgacaccctctttccaatcaagttgtggtgtatacgaaaggcgctgattct 2400 gtgatcatggagttactgtcggtggcttccccagatggagcaagtctggagaaacaacag 2460 atgatagtaagggagaaaacccagaagcacttggatgactatgccaaacaaggccttcgt 2520 actttatgtatagcaaagaaggtcatgagtgacactgaatatgcagagtggctgaggaat 2580 cattttttagctgaaaccagcattgacaacagggaagaattactacttgaatctgccatg 2640 aggttggagaacaaacttacattacttggtgctactggcattgaagaccgtctgcaggag 2700 ggagtccctgaatctatagaagctcttcacaaagcgggcatcaagatctggatgctgaca 2760 ggggacaagcaggagacagctgtcaacatagcttatgcatgcaaactactggagccagat 2820 gacaagctttttatcctcaatacccaaagtaaagatgcctgtgggatgctgatgagcaca 2880 attttgaaagaacttcagaagaaaactcaagccctgccagagcaagtgtcattaagtgaa 2940 gatttacttcagcctcctgtcccccgggactcagggttacgagctggactcattatcact 3000 gggaagaccctggagtttgccctgcaagaaagtctgcaaaagcagttcctggaactgaca 3060 tcttggtgtcaagctgtggtctgctgccgagccacaccgctgcagaaaagtgaagtggtg 3120 aaattggtccgcagccatctccaggtgatgacccttgctattggtgatggtgccaatgat 3180 gttagcatgatacaagtggcagacattgggataggggtctcaggtcaagaaggcatgcag 3240 gctgtgatggccagtgactttgccgtttctcagttcaaacatctcagcaagctccttctt 3300 gtccatggacactggtgttatacacggctttccaacatgattctctattttttctataag 3360 aatgtggcctatgtgaacctccttttctggtaccagttcttttgtggattttcaggaaca 3420 tccatgactgattactgggttttgatcttcttcaacctcctcttcacatctgcccctcct 3480 gtcatttatggtgttttggagaaagatgtgtctgcagagaccctcatgcaactgcctgaa 3540 WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 ctttacagaagtggtcagaaatcagaggcatacttaccccataccttctggatcacctta 3600 ttggatgctttttatcaaagcctggtctgcttctttgtgccttattttacctaccagggc 3660 tcagatactgacatctttgcatttggaaaccccctgaacacagccactctgttcatcgtt 3720 ctcctccatctggtcattgaaagcaagagtttgacttggattcacttgctggtcatcatt 3780 ggtagcatcttgtcttattttttatttgccatagtttttggagccatgtgtgtaacttgc 3840 aacccaccatccaacccttactggattatgcaggagcacatgctggatccagtattctac 3900 ttagtttgtatcctcacgacgtccattgctcttctgcccaggtttgtatacagagttctt 3960 cagggatccctgtttccatctccaattctgagagctaagcactttgacagactaactcca 4020 gaggagaggactaaagctctcaagaagtggagaggggctggaaagatgaatcaagtgaca 4080 tcaaagtatgctaaccaatcagctggcaagtcaggaagaagacccatgcctggcccttct 4140 gctgtatttgcaatgaagtcagcaacttcctgtgctattgagcaaggaaacttatctctg 4200 tgtgaaactgctttagatcaaggctactctgaaactaaggcctttgagatggctggaccc 4260 tccaaaggtaaagaaagctag 4281 <210> 14 <211> 1426 <212> PRT
<213> homo Sapiens <400> 14 Met Thr Glu Ala Leu Gln Trp Ala Arg Tyr His Trp Arg Arg Leu Ile Arg Gly Ala Thr Arg Asp Asp Asp Ser Gly Pro Tyr Asn Tyr Ser Ser Leu Leu Ala Cys Gly Arg Lys Ser Ser Gln Ile Pro Lys Leu Ser Gly Arg His Arg Ile Val Val Pro His Ile Gln Pro Phe Lys Asp Glu Tyr Glu Lys Phe Ser Gly Ala Tyr Val Asn Asn Arg Ile Arg Thr Thr Lys Tyr Thr Leu Leu Asn Phe Val Pro Arg Asn Leu Phe Glu Gln Phe His Arg Ala Ala Asn Leu Tyr Phe Leu Phe Leu Val Val Leu Asn Trp Val Pro Leu Val Glu Ala Phe Gln Lys Glu Ile Thr Met Leu Pro Leu Val Val Val Leu Thr Ile Ile Ala Ile Lys Asp Gly Leu Glu Asp Tyr Arg Lys Tyr Lys Ile Asp Lys Gln Ile Asn Asn Leu Ile Thr Lys Val Tyr Ser Arg Lys Glu Lys Lys Tyr Ile Asp Arg Cys Trp Lys Asp Val Thr Val Gly Asp Phe Ile Arg Leu Ser Cys Asn Glu Val Ile Pro Ala Asp Met Val Leu Leu Phe Ser Thr Asp Pro Asp Gly Ile Cys His Ile Glu Thr Ser Gly Leu Asp Gly Glu Ser Asn Leu Lys Gln Arg Gln Val Val Arg Gly Tyr Ala Glu Gln Asp Ser Glu Val Asp Pro Glu Lys Phe Ser Ser Arg Ile Glu Cys Glu Ser Pro Asn Asn Asp Leu Ser Arg Phe Arg Gly Phe Leu Glu His Ser Asn Lys Glu Arg Val Gly Leu Ser Lys Glu Asn Leu Leu Leu Arg Gly Cys Thr Ile Arg Asn Thr Glu Ala Val Val Gly Ile Val Val Tyr Ala Gly His Glu Thr Lys Ala Met Leu Asn Asn Ser Gly Pro Arg Tyr Lys Arg Ser Lys Leu Glu Arg Arg Ala Asn Thr Asp Val Leu Trp Cys Val Met Leu Leu Val Ile Met Cys Leu Thr Gly Ala Val Gly His Gly Ile Trp Leu Ser Arg Tyr Glu Lys Met His Phe WO 01/34778 CA 02391007 2002-05-09 pCT~S00/31110 Phe Asn Val Pro Glu Pro Asp Gly His Ile Ile Ser Pro Leu Leu Ala Gly Phe Tyr Met Phe Trp Thr Met Ile Ile Leu Leu Gln Val Leu Ile Pro Ile Ser Leu Tyr Val Ser Ile Glu Ile Val Lys Leu Gly Gln Ile Tyr Phe Ile Gln Ser Asp Val Asp Phe Tyr Asn Glu Lys Met Asp Ser Ile Val Gln Cys Arg Ala Leu Asn Ile Ala Glu Asp Leu Gly Gln Ile Gln Tyr Leu Phe Ser Asp Lys Thr Gly Thr Leu Thr Glu Asn Lys Met Val Phe Arg Arg Cys Ser Val Ala Gly Phe Asp Tyr Cys His Glu Glu Asn Ala Arg Arg Leu Glu Ser Tyr Gln Glu Ala Val Ser Glu Asp Glu Asp Phe Ile Asp Thr Val Ser Gly Ser Leu Ser Asn Met Ala Lys Pro Arg Ala Pro Ser Cys Arg Thr Val His Asn Gly Pro Leu Gly Asn Lys Pro Ser Asn His Leu Ala Gly Ser Ser Phe Thr Leu Gly Ser Gly Glu Gly Ala Ser Glu Val Pro His Ser Arg Gln Ala Ala Phe Ser Ser Pro Ile Glu Thr Asp Val Val Pro Asp Thr Arg Leu Leu Asp Lys Phe Ser Gln Ile Thr Pro Arg Leu Phe Met Pro Leu Asp Glu Thr Ile Gln Asn Pro Pro Met Glu Thr Leu Tyr Ile Ile Asp Phe Phe Ile Ala Leu Ala Ile Cys Asn Thr Val Val Val Ser Ala Pro Asn Gln Pro Arg Gln Lys Ile Arg His Pro Ser Leu Gly Gly Leu Pro Ile Lys Ser Leu Glu Glu Ile Lys Ser Leu Phe Gln Arg Trp Ser Val Arg Arg Ser Ser Ser Pro Ser Leu Asn Ser Gly Lys Glu Pro Ser Ser Gly Val Pro Asn Ala Phe Val Ser Arg Leu Pro Leu Phe Ser Arg Met Lys Pro Ala Ser Pro Val Glu Glu Glu Val Ser Gln Val Cys Glu Ser Pro Gln Cys Ser Ser Ser Ser Ala Cys Cys Thr Glu Thr Glu Lys Gln His Gly Asp Ala Gly Leu Leu Asn Gly Lys Ala Glu Ser Leu Pro Gly Gln Pro Leu Ala Cys Asn Leu Cys Tyr Glu Ala Glu Ser Pro Asp Glu Ala Ala Leu Val Tyr Ala Ala Arg Ala Tyr Gln Cys Thr Leu Arg Ser Arg Thr Pro Glu Gln Val Met Val Asp Phe Ala Ala Leu Gly Pro Leu Thr Phe Gln Leu Leu His Ile Leu Pro Phe Asp Ser Val Arg Lys Arg Met Ser Val Val Val Arg His Pro Leu Ser Asn Gln Val Val Val Tyr Thr Lys Gly Ala Asp Ser Val Ile Met Glu Leu Leu Ser Val Ala Ser Pro Asp Gly Ala Ser Leu Glu Lys Gln Gln Met Ile Val Arg Glu Lys Thr Gln Lys His Leu Asp Asp Tyr Ala Lys Gln Gly Leu Arg Thr Leu Cys Ile Ala Lys Lys Val Met Ser Asp Thr Glu Tyr Ala Glu Trp Leu Arg Asn His Phe Leu Ala Glu Thr Ser Ile Asp Asn Arg Glu Glu Leu Leu Leu Glu Ser Ala Met Arg Leu Glu Asn Lys Leu Thr Leu Leu Gly Ala Thr Gly Ile Glu Asp Arg Leu Gln Glu Gly Val Pro Glu Ser Ile Glu Ala Leu His Lys Ala Gly Ile Lys Ile Trp Met Leu Thr Gly Asp Lys Gln Glu Thr Ala Val Asn Ile Ala Tyr Ala Cys Lys Leu Leu Glu Pro Asp Asp Lys Leu Phe Ile Leu Asn Thr Gln Ser Lys Asp Ala Cys Gly Met Leu Met Ser Thr Ile Leu Lys Glu Leu Gln Lys Lys Thr Gln Ala Leu Pro Glu Gln Val Ser Leu Ser Glu Asp Leu Leu Gln Pro Pro Val Pro Arg Asp Ser Gly Leu Arg Ala Gly Leu Ile Ile Thr Gly Lys Thr Leu Glu Phe Ala Leu Gln Glu Ser Leu Gln Lys Gln Phe Leu Glu Leu Thr Ser Trp Cys Gln Ala Val Val Cys Cys Arg Ala Thr Pro Leu Gln Lys Ser Glu Val Val Lys Leu Val Arg Ser His Leu Gln Val Met Thr Leu Ala Ile Gly Asp Gly Ala Asn Asp Val Ser Met Ile Gln Val Ala Asp Ile Gly Ile Gly Val Ser Gly Gln Glu Gly Met Gln Ala Val Met Ala Ser Asp Phe Ala Val Ser Gln Phe Lys His Leu Ser Lys Leu Leu Leu Val His Gly His Trp Cys Tyr Thr Arg Leu Ser Asn Met Ile Leu Tyr Phe Phe Tyr Lys Asn Val Ala Tyr Val Asn Leu Leu Phe Trp Tyr Gln Phe Phe Cys Gly Phe Ser Gly Thr Ser Met Thr Asp Tyr Trp Val Leu Ile Phe Phe Asn Leu Leu Phe Thr Ser Ala Pro Pro Val Ile Tyr Gly Val Leu Glu Lys Asp Val Ser Ala Glu Thr Leu Met Gln Leu Pro Glu Leu Tyr Arg Ser Gly Gln Lys Ser Glu Ala Tyr Leu Pro His Thr Phe Trp Ile Thr Leu Leu Asp Ala Phe Tyr Gln Ser Leu Val Cys Phe Phe Val Pro Tyr Phe Thr Tyr Gln Gly Ser Asp Thr Asp Ile Phe Ala Phe Gly Asn Pro Leu Asn Thr Ala Thr Leu Phe Ile Val Leu Leu His Leu Val Ile Glu Ser Lys Ser Leu Thr Trp Ile His Leu Leu Val Ile Ile Gly Ser Ile Leu Ser Tyr Phe Leu Phe Ala Ile Val Phe Gly Ala Met Cys Val Thr Cys Asn Pro Pro Ser Asn Pro Tyr Trp Ile Met Gln Glu His Met Leu Asp Pro Val Phe Tyr Leu Val Cys Ile Leu Thr Thr Ser Ile Ala Leu Leu Pro Arg Phe Val Tyr Arg Val Leu Gln Gly Ser Leu Phe Pro Ser Pro Ile Leu Arg Ala Lys His Phe Asp Arg Leu Thr Pro Glu Glu Arg Thr Lys Ala Leu Lys Lys Trp Arg Gly Ala Gly Lys Met Asn Gln Val Thr Ser Lys Tyr Ala Asn Gln Ser Ala Gly Lys Ser Gly Arg Arg Pro Met Pro Gly Pro Ser Ala Val Phe Ala Met Lys Ser Ala Thr Ser Cys Ala Ile Glu Gln Gly Asn Leu Ser Leu Cys Glu Thr Ala Leu Asp Gln Gly Tyr Ser Glu Thr Lys Ala Phe Glu Met Ala Gly Pro Ser Lys Gly Lys Glu Ser <210> 15 <211> 1737 <212> DNA
<213> homo Sapiens <400>

atgagtgacactgaatatgcagagtggctgaggaatcattttttagctgaaaccagcatt 60 gacaacagggaagaattactacttgaatctgccatgaggttggagaacaaacttacatta 120 cttggtgctactggcattgaagaccgtctgcaggagggagtccctgaatctatagaagct 180 cttcacaaagcgggcatcaagatctggatgctgacaggggacaagcaggagacagctgtc 240 aacatagcttatgcatgcaaactactggagccagatgacaagctttttatcctcaatacc 300 caaagtaaagatgcctgtgggatgctgatgagcacaattttgaaagaacttcagaagaaa 360 actcaagccctgccagagcaagtgtcattaagtgaagatttacttcagcctcctgtcccc 420 cgggactcagggttacgagctggactcattatcactgggaagaccctggagtttgccctg 480 caagaaagtctgcaaaagcagttcctggaactgacatcttggtgtcaagctgtggtctgc 540 tgccgagccacaccgctgcagaaaagtgaagtggtgaaattggtccgcagccatctccag 600 gtgatgacccttgctattggtgatggtgccaatgatgttagcatgatacaagtggcagac 660 attgggataggggtctcaggtcaagaaggcatgcaggctgtgatggccagtgactttgcc 720 gtttctcagttcaaacatctcagcaagctccttcttgtccatggacactggtgttataca 780 cggctttccaacatgattctctattttttctataagaatgtggcctatgtgaacctcctt 840 ttctggtaccagttcttttgtggattttcaggaacatccatgactgattactgggttttg 900 atcttcttcaacctcctcttcacatctgcccctcctgtcatttatggtgttttggagaaa 960 gatgtgtctgcagagaccctcatgcaactgcctgaactttacagaagtggtcagaaatca 1020 gaggcatacttaccccataccttctggatcaccttattggatgctttttatcaaagcctg 1080 gtctgcttctttgtgccttattttacctaccagggctcagatactgacatctttgcattt 1140 ggaaaccccctgaacacagccactctgttcatcgttctcctccatctggtcattgaaagc 1200 aagagtttgacttggattcacttgctggtcatcattggtagcatcttgtcttatttttta 1260 tttgccatagtttttggagccatgtgtgtaacttgcaacccaccatccaacccttactgg 1320 attatgcaggagcacatgctggatccagtattctacttagtttgtatcctcacgacgtcc 1380 attgctcttctgcccaggtttgtatacagagttcttcagggatccctgtttccatctcca 1440 attctgagagctaagcactttgacagactaactccagaggagaggactaaagctctcaag 1500 aagtggagaggggctggaaagatgaatcaagtgacatcaaagtatgctaaccaatcagct 1560 ggcaagtcaggaagaagacccatgcctggcccttctgctgtatttgcaatgaagtcagca 1620 acttcctgtgctattgagcaaggaaacttatctctgtgtgaaactgctttagatcaaggc 1680 tactctgaaactaaggcctttgagatggctggaccctccaaaggtaaagaaagctag 1737 <210> 16 <211> 578 <212> PRT
<213> homo Sapiens <400> 16 Met Ser Asp Thr Glu Tyr Ala Glu Trp Leu Arg Asn His Phe Leu Ala Glu Thr Ser Ile Asp Asn Arg Glu Glu Leu Leu Leu Glu Ser Ala Met Arg Leu Glu Asn Lys Leu Thr Leu Leu Gly Ala Thr Gly Ile Glu Asp Arg Leu Gln Glu Gly Val Pro Glu Ser Ile Glu Ala Leu His Lys Ala Gly Ile Lys Ile Trp Met Leu Thr Gly Asp Lys Gln Glu Thr Ala Val Asn Ile Ala Tyr Ala Cys Lys Leu Leu Glu Pro Asp Asp Lys Leu Phe Ile Leu Asn Thr Gln Ser Lys Asp Ala Cys Gly Met Leu Met Ser Thr Ile Leu Lys Glu Leu Gln Lys Lys Thr Gln Ala Leu Pro Glu Gln Val Ser Leu Ser Glu Asp Leu Leu Gln Pro Pro Val Pro Arg Asp Ser Gly Leu Arg Ala Gly Leu Ile Ile Thr Gly Lys Thr Leu Glu Phe Ala Leu Gln Glu Ser Leu Gln Lys Gln Phe Leu Glu Leu Thr Ser Trp Cys Gln Ala Val Val Cys Cys Arg Ala Thr Pro Leu Gln Lys Ser Glu Val Val Lys Leu Val Arg Ser His Leu Gln Val Met Thr Leu Ala Ile Gly Asp Gly Ala Asn Asp Val Ser Met Ile Gln Val Ala Asp Ile Gly Ile Gly Val Ser Gly Gln Glu Gly Met Gln Ala Val Met Ala Ser Asp Phe Ala Val Ser Gln Phe Lys His Leu Ser Lys Leu Leu Leu Val His Gly His Trp Cys Tyr Thr Arg Leu Ser Asn Met Ile Leu Tyr Phe Phe Tyr Lys Asn Val Ala Tyr Val Asn Leu Leu Phe Trp Tyr Gln Phe Phe Cys Gly Phe Ser Gly Thr Ser Met Thr Asp Tyr Trp Val Leu Ile Phe Phe Asn Leu Leu Phe Thr Ser Ala Pro Pro Val Ile Tyr Gly Val Leu Glu Lys Asp Val Ser Ala Glu Thr Leu Met Gln Leu Pro Glu Leu Tyr Arg Ser Gly Gln Lys Ser Glu Ala Tyr Leu Pro His Thr Phe Trp Ile Thr Leu Leu Asp Ala Phe Tyr Gln Ser Leu Val Cys Phe Phe Val Pro Tyr Phe Thr Tyr Gln Gly Ser Asp Thr Asp Ile Phe Ala Phe Gly Asn Pro Leu Asn Thr Ala Thr Leu Phe Ile Val Leu Leu His Leu Val Ile Glu Ser Lys Ser Leu Thr Trp Ile His Leu Leu Val Ile Ile Gly Ser Ile Leu Ser Tyr Phe Leu Phe Ala Ile Val Phe Gly Ala Met Cys Val Thr Cys Asn Pro Pro Ser Asn Pro Tyr Trp Ile Met Gln Glu His Met Leu Asp Pro Val Phe Tyr Leu Val Cys Ile Leu Thr Thr Ser Ile Ala Leu Leu Pro Arg Phe Val Tyr Arg Val Leu Gln Gly Ser Leu Phe Pro Ser Pro Ile Leu Arg Ala Lys His Phe Asp Arg Leu Thr Pro Glu Glu Arg Thr Lys Ala Leu Lys Lys Trp Arg Gly Ala Gly Lys Met Asn Gln Val Thr Ser Lys Tyr Ala Asn Gln Ser Ala Gly Lys Ser Gly Arg Arg Pro Met Pro Gly Pro Ser Ala Val Phe Ala Met Lys Ser Ala Thr Ser Cys Ala Ile Glu Gln Gly Asn Leu Ser Leu Cys Glu Thr Ala Leu Asp Gln Gly Tyr Ser Glu Thr Lys Ala Phe Glu Met Ala Gly Pro Ser Lys Gly Lys Glu Ser <210> 17 <211> 5958 <212> DNA
<213> homo sapiens <400>

gtcagctacacaacctggatcttaccacagtttggatatgactgaggctctccaatgggc 60 cagatatcactggcgacggctgatcagaggtgcaaccagggatgatgattcagggccata 120 caactattcctcgttgctcgcctgtgggcgcaagtcctctcagatccctaaactgtcagg 180 aaggcaccggattgttgttccccacatccagcccttcaaggatgagtatgagaagttctc 240 cggagcctatgtgaacaatcgaatacgaacaacaaagtacacacttctgaattttgtgcc 300 aagaaatttatttgaacaatttcacagagctgccaatttatatttcctgttcctagttgt 360 cctgaactgggtacctttggtagaagccttccaaaaggaaatcaccatgttgcctctggt 420 ggtggtccttacaattatcgcaattaaagatggcctggaagattatcggaaatacaaaat 480 tgacaaacagatcaataatttaataactaaagtttatagtaggaaagagaaaaaatacat 540 tgaccgatgctggaaagacgttactgttggggactttattcgcctctcctgcaacgaggt 600 catccctgcagacatggtactactcttttccactgatccagatggaatctgtcacattga 660 gacttctggtcttgatggagagagcaatttaaaacagaggcaggtggttcggggatatgc 720 agaacaggactctgaagttgatcctgagaagttttccagtaggatagaatgtgaaagccc 780 aaacaatgacctcagcagattccgaggcttcctagaacattccaacaaagaacgcgtggg 840 tctcagtaaagaaaatttgttgcttagaggatgcaccattagaaacacagaggctgttgt 900 gggcattgtggtttatgcaggccatgaaaccaaagcaatgctgaacaacagtgggccacg 960 gtataagcgcagcaaattagaaagaagagcaaacacagatgtcctctggtgtgtcatgct 1020 tctggtcataatgtgcttaactggcgcagtaggtcatggaatctggctgagcaggtatga 1080 aaagatgcattttttcaatgttcccgagcctgatggacatatcatatcaccactgttggc 1140 aggattttatatgttttggaccatgatcattttgttacaggtcttgattcctatttctct 1200 ctatgtttccatcgaaattgtgaagcttggacaaatatatttcattcaaagtgatgtgga 1260 tttctacaatgaaaaaatggattctattgttcagtgccgagccctgaacatcgccgagga 1320 tctgggacagattcagtacctcttttccgataagacaggaaccctcactgagaataagat 1380 ggtttttcgaagatgtagtgtggcaggatttgattactgccatgaagaaaatgccaggag 1440 gttggagtcctatcaggaagctgtctctgaagatgaagattttatagacacagtcagtgg 1500 ttccctcagcaatatggcaaaaccgagagcccccagctgcaggacagttcataatgggcc 1560 tttgggaaataagccctcaaatcatcttgctgggagctcttttactctaggaagtggaga 1620 aggagccagtgaagtgcctcattccagacaggctgctttcagtagccccattgaaacaga 1680 cgtggtaccagacaccaggcttttagacaaatttagtcagattacacctcggctctttat 1740 gccactagatgagaccatccaaaatccaccaatggaaactttgtacattatcgacttttt 1800 cattgcattggcaatttgcaacacagtagtggtttctgctcctaaccaaccccgacaaaa 1860 gatcagacacccttcactgggggggttgcccattaagtctttggaagagattaaaagtct 1920 tttccagagatggtctgtccgaagatcaagttctccatcgcttaacagtgggaaagagcc 1980 atcttctggagttccaaacgcctttgtgagcagactccctctctttagtcgaatgaaacc 2040 agcttcacctgtggaggaagaggtctcccaggtgtgtgagagcccccagtgctccagtag 2100 ctcagcttgctgcacagaaacagagaaacaacacggtgatgcaggcctcctgaatggcaa 2160 ggcagagtccctccctggacagccattggcctgcaacctgtgttatgaggccgagagccc 2220 agacgaagcggccttagtgtatgccgccagggcttaccaatgcactttacggtctcggac 2280 accagagcaggtcatggtggactttgctgctttgggaccattaacatttcaactcctaca 2340 catcctgccctttgactcagtaagaaaaagaatgtctgttgtggtccgacaccctctttc 2400 caatcaagttgtggtgtatacgaaaggcgctgattctgtgatcatggagttactgtcggt 2460 ggcttccccagatggagcaagtctggagaaacaacagatgatagtaagggagaaaaccca 2520 gaagcacttttttcttccatttcaggtgtcgtgaaaagcttgaattcggcgcgccagata 2580 tcacgcgtgccaagggactggctcaggatgactatgccaaacaaggccttcgtactttat 2640 gtatagcaaagaaggtcatgagtgacactgaatatgcagagtggctgaggaatcattttt 2700 tagctgaaaccagcattgacaacagggaagaattactacttgaatctgccatgaggttgg 2760 agaacaaacttacattacttggtgctactggcattgaagaccgtctgcaggagggagtcc 2820 ctgaatctatagaagctcttcacaaagcgggcatcaagatctggatgctgacaggggaca 2880 agcaggagacagctgtcaacatagcttatgcatgcaaactactggagccagatgacaagc 2940 tttttatcctcaatacccaaagtaaagtgcgtatattgagattaaatctgttcttctgta 3000 ttttcaaaggcattggaacatttgagatttgatgtatgcaaggattaaaaaaatgcctgt 3060 gggatgctgatgagcacaattttgaaagaacttcagaagaaaactcaagccctgccagag 3120 caagtgtcattaagtgaagatttacttcagcctcctgtcccccgggactcagggttacga 3180 gctggactcattatcactgggaagaccctggagtttgccctgcaagaaagtctgcaaaag 3240 cagttcctggaactgacatcttggtgtcaagctgtggtctgctgccgagccacaccgctg3300 cagaaaagtgaagtggtgaaattggtccgcagccatctccaggtgatgacccttgctatt3360 ggtgagtgaggatgaatctgagtcctgctcttctccctttcacaccacaccagacaccga3420 tccttctgtctctttcttctcccactgttccttccattttcctcctccctttttctctac3480 cacattcatgccttcccatcacctatttgagcaccttcctccatcacctatttgagcacc3540 ttctgtgaaccaggtaatagggatgtgacatggtaaacaatacagtagtccagacttctt3600 agttcagtgtcagacccccaaatcaacaagcttaaatcaagtaataaactgaatcacaga3660 actgaaaaatccatgtgttctaccttcaggaaagctaaattcaaggacatgagaattcat3720 ttctttatccattccacaagtatttatcaagtgccttttttgtaccaggcatttttctag3780 atggagatacaagagtatataaaattggcaaactacctttttacaaggaacttacatcta3840 gtaggaaggcatgcagttaaacaaagcataatctgtcaggttcaggtagtgataagtact3900 attggaaaaataagtggatgaggacacgtatagcactggagatgggctggggctgctctt3960 taaatcgatttcaagagctactgtaagttgactgggagcagagatgtgaaggaaatcata4020 aggggccatggagacatggtggtgccaatgatgttagcatgatacaagtggcagacattg4080 ggataggggtctcaggtcaagaaggcatgcaggctgtgatggccagtgactttgccgttt4140 ctcagttcaaacatctcagcaagctccttcttgtccatggacactggtgttatacacggc4200 tttccaacatgattctctattttttctataagaatgtggcctatgtgaacctccttttct4260 ggtaccagttcttttgtggattttcaggaacatccatgactgattactgggttttgatct4320 tcttcaacctcctcttcacatctgcccctcctgtcatttatggtgttttggagaaagatg4380 tgtctgcagagaccctcatgcaactgcctgaactttacagaagtggtcagaaatcagagg4440 catacttaccccataccttctggatcaccttattggatgctttttatcaaagcctggtct4500 gcttctttgtgccttattttacctaccagggctcagatactgacatctttgcatttggaa4560 accccctgaacacagccactctgttcatcgttctcctccatctggtcattgaaagcaaga4620 gtttgaccaggtgcagtgactcacacctgcaattccagagctttgggaggctgtggatca4680 catgaagctaagagttcaagaccagcctgggcaacataacttggattcacttgctggtca4740 tcattggtagcatcttgtcttattttttatttgccatagtttttggagccatgtgtgtaa4800 cttgcaacccaccatccaacccttactggattatgcaggagcacatgctggatccagtat4860 tctacttagtttgtatcctcacgacgtccattgctcttctgcccaggtttgtatacagag4920 ttcttcagggatccctgtttccatctccaattctgagagctaagcactttgacagactaa4980 ctccagaggagaggactaaagctctcaagaagtggagaggggctggaaagatgaatcaag5040 tgacatcaaagtatgctaaccaatcagctggcaagtcaggaagaagacccatgcctggcc5100 cttctgctgtatttgcaatgaagtcagcaacttcctgtgctattgagcaaggaaacttat5160 ctctgtgtgaaactgctttagatcaaggctactctgaaactaaggcctttgagatggctg5220 gaccctccaaaggtaaagaaagctagataccctccttggagttgcaagtattctttcaag5280 gttggaagagggattttgaagaggtatctctccaagcaagaatgacttgtttttccataa5340 gggacatgagcattttactaggcttggaagagctgacatgatgagcattattgtatgttt5400 gtatatacatttgtgatagagggctagagtttgacctagagagagtttaaggaagtgaaa5460 tatttaattcagaaccaaatgcttttgtaaaactttttggattttgtaaaagcattttca5520 ttctcttagaaattcaagtattttcaaggggagtcatttgagatatatttattttactag5580 gagatcttatattctagggaaatgctttaaatggtcaggctccaatcggaatttttttaa5640 gaaaaaagtagtttttaatacattggttaggactcagaggaaatacggaaaaaacattgt5700 agatggtaatttacagataaaatcccaagagcctttaaacaacaaggtacctaaataggg5760 tataattatactgcttaaaatacaggtagtgcctattaatagctttttatttcctatggg5820 gagatgctttggtcttctggctgagatgtaggcatacctctcactcatttcaatgctttc5880 ctgaggtggagccttcattggaaaggggaaagagggttctaggttcatcagggaccagga5940 atgctttcctctggcagg 5958

Claims (3)

WHAT IS CLAIMED IS:

1. An isolated nucleic acid molecule comprising at least 24 contiguous bases of nucleotide sequence first disclosed in the NHP gene described in SEQ ID NO: 13.

2. An isolated nucleic acid molecule comprising a nucleotide sequence that:
(a) encodes the amino acid sequence shown in SEQ ID
NO: 14; and (b) hybridizes under stringent conditions to the nucleotide sequence of SEQ ID NO: 13 or the complement thereof.

3. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:14.