CA2406278C - Inhibitors of human phosphatidyl-inositol 3-kinase delta - Google Patents

Abstract

Methods of inhibiting phosphatidylinositol 3-kinase delta isoform (PI3K.delta.) activity, and methods of treating diseases, such as disorders of immunity and inflammation, in which PI3K.delta. plays a role in leukocyte function are disclosed. Preferably, the methods employ active agents that selectively inhibit PI3K.delta., while not significantly inhibiting activity of other PI3K isoforms. Compounds are provided that inhibit PI3K.delta. activity, including compounds that selectively inhibit PI3K.delta. activity. Methods of using PI3K.delta. inhibitory compound s to inhibit cancer cell growth or proliferation are also provided. Accordingly, the invention provides methods of using PI3K.delta. inhibitory compounds to inhibit PI3K.delta.-mediated processes in vitro and in vivo.

Description

INHIBITORS OF HUMAN PHOSPHATIDYL-FIELD OF THE INVENTION

The present invention relates generally to phosphatidylinositol 3-kinase (P13K) enzymes, and more particularly to selective inhibitors of P13K
activity and to methods of using such materials.
BACKGROUND OF THE INVENTION

Cell signaling via 3'-phosphorylated phosphoinositides has been implicated in a variety of cellular processes, e.g., malignant transforma-tion, growth factor signaling, inflammation, and immunity (see Rameh et al., J. Biol Chem, 274:8347-8350 (1999) for a review). The enzyme responsible for generating these phosphorylated signaling prod-ucts, phosphatidylinositol 3-kinase (PI 3-kinase;
P13K), was originally identified as an activity associated with viral oncoproteins and growth factor receptor tyrosine kinases that phosphorylates phos-phatidylinositol (PI) and its phosphorylated deriva-tives at the 3'-hydroxyl of the inositol ring (Panayotou et al., Trends Cell Biol 2:358-60 (1992)).
The levels of phosphatidylinositol-3,4,5-triphosphate (PIP3), the primary product of P1 3-kinase activation, increase upon treatment of cells with a variety of agonists. PI 3-kinase activation, therefore, is believed to be involved in a range of cellular responses including cell growth, differ-entiation, and apoptosis (Parker et al., Current Biology, 5:577-99 (1995); Yao et al., Science, 267:2003-05 (1995)). Though the downstream targets of phosphorylated lipids generated following PI 3-kinase activation have not been well characterized, emerging evidence suggests that pleckstrin-homology domain- and FYVE-finger domain-containing proteins are activated when binding to.various phosphatidyl-inositol lipids (Sternmark et al., J Cell Sci, 112:4175-83 (1999); Lemmon et al., Trends Cell Biol, 7:237-42 (1997)). In vitro, some isoforms of pro-tein kinase C (PKC) are directly activated by PIPS;
and the PKC-related protein kinase, PKB, has been shown to be activated by PI 3-kinase (Burgering et al., Nature, 376:599-602 (1995)).
Presently, the PI 3-kinase enzyme family has been divided into three classes based on their substrate specificities. Class I PI3Ks can phos-phorylate phosphatidylinositol (PI), phosphatidyl-inositol-4-phosphate, and phosphatidylinositol-4,5-biphosphate (PIP2) to produce phosphatidylinositol-3-phosphate (PIP), phosphatidylinositol-3,4-biphos-phate, and phosphatidylinositol-3,4,5-trip hosphate, respectively. Class II PI3Ks phosphorylate PI and phosphatidylinositol-4-phosphate, whereas Class III
PI3Ks can only phosphorylate PI.
The initial purification and molecular cloning of PI 3-kinase revealed that it was a het-erodimer consisting of p85 and p110 subunits (Otsu et al., Cell, 65:91-104 (1991); Hiles et al., Cell, 70:419-29 (1992)). Since then, four distinct Class I PI3Ks have been identified, designated P13K a, (3, 5, and y, each consisting of a distinct 110 kDa catalytic subunit and a regulatory subunit. More specifically, three of the catalytic subunits, i.e., p110a, p110(3 and p1105, each interact with the same regulatory subunit, p85; whereas p1lOyinteracts with a distinct regulatory subunit, p101. As de-scribed below, the patterns of expression of each of these PI3Ks in human cells and tissues are also distinct. Though a wealth of-information has been accumulated in recent past on the cellular functions of PI 3-kinases in general, the roles played by the individual isoforms are largely unknown.
Cloning of bovine p110c1 has been de-scribed. This protein was identified as related to the Saccharomyces cerevisiae protein: Vps34p, a protein involved in vacuolar protein processing.
The recombinant pll0a product was also shown to associate with p85a, to yield a P13K activity in transfected COS-1 cells. See Hiles et al., Cell, 70, 419-29 (1992).
The cloning of a second human p110 iso-form, designated p1101, is described in Hu et al., Mol Cell Biol, 13:7677-88 (1993). This isoform is said to associate with p85 in cells, and to be ubiquitously expressed, as p1101 mRNA has been found in numerous human and mouse tissues as well as in human umbilical vein endothelial cells, Jurkat human leukemic T cells, 293 human embryonic kidney cells, mouse 3T3 fibroblasts, HeLa cells, and NBT2 rat bladder carcinoma cells. Such wide expression suggests that this isoform is broadly important in signaling pathways.
Identification of the p1106 isoform of PI
3-kinase is described in Chantry et al., J Biol Chem, 272:19236-41 (1997). It was observed that the human p1105 isoform is expressed in a tissue-restricted fashion. It is expressed at high levels in lymphocytes and lymphoid tissues, suggesting that.
the protein might play a role in PI 3-kinase-medi ated signaling in the immune system. Details con-, cerning the P1105 isoform also can be found in U.S.
Patent Nos. 5,858,753; 5,822,910; and 5,985,589.
See also, Vanhaesebroeck et al., Proc Nat1 Acad Sci USA, 94:4330-5 (1997), and international publication WO 97/46688.
In each of the PI3Ka, (3, and 5 subtypes, the p85 subunit acts to localize PI 3-=kinase to the plasma membrane by the interaction of its SH2 domain with phosphorylated tyrosine residues (present in an appropriate sequence context) in target proteins (Rameh et al., Cell, 83:821-30 (1995)). Two iso-forms of p85 have been identified, p85a, which is ubiquitously expressed, and p85(3, which is primarily found in the brain and lymphoid tissues (Volinia et al., Oncogene, 7:789-93 (1992)). Association of the p85 subunit to the PI 3-kinase p110a, (3, or 6 cat-alytic subunits appears to be required for the cat-alytic activity and stability of these enzymes. In -addition, the binding of Ras proteins also upreg-ulates PI 3-kinase activity.
The cloning of p110y revealed still fur-ther complexity within the P13K family of enzymes (Stoyanov et al., Science, 269:690-93 (1995)). The p11Oy isoform is closely related to p110CC and p110(3 (45-48% identity in the catalytic domain), but as noted does not make use of p85 as a targeting sub-unit. Instead, p1lOy contains an additional domain termed a "pleckstrin homology domain" near its amino terminus. This domain allows interaction of pllOy with the 1y subunits of heterotrimeric G proteins and.this interaction appears to regulate its activ-ity.
The p101 regulatory subunit for PI3Kgamma was originally cloned. in swine, and the human orth--olog identified subsequently (Krugmann et al., J
Biol Chem, 274:17152-8 (1999)). Interaction between the N-terminal region. of p101 with the N-terminal region of p110y appears to be critical for the PI3Ky activation through G(3y mentioned above.
A constitutively active P13K polypeptide is described in international publication WO 96/25488. This publication discloses preparation of a chimeric fusion protein in which a 102-residue fragment of p85 known as the inter-SH2 (iSH2) region is fused through a linker region to the N-terminus of murine p110. The p85 iSH2 domain apparently is able to activate P13K activity in a manner compar-able to intact p85 (Klippel et al., Mol Cell Biol, 14:2675-85 (1994)).
Thus, PI 3-kinases can be defined by their amino acid identity or by their activity. Addi-tional members of this growing gene family include more distantly related lipid and protein kinases including Vps34 TORT, and TOR2 of Saccharomyces cerevisiae (and their mammalian homologs such as FRAP and mTOR), the ataxia telangiectasia gene product (ATR) and the catalytic subunit of DNA-dependent protein kinase (DNA-PK). See generally, Hunter, Cell, 83:1-4 (1995).
PI 3-kinase also appears to be involved in a number of aspects of leukocyte activation. A p85-associated PI 3-kinase activity has been shown to physically associate with the cytoplasmic domain of CD28, which is an important costimulatory molecule for the activation of T-cells in response to antigen (Pages et al., Nature, 369:327-29 (1994); Rudd, Immunity, 4:527-34 (1996)). Activation of T cells through CD28 lowers the threshold for activation by .antigen and increases the magnitude and duration of the proliferative response. These effects are linked to increases in the transcription of a number of genes including interleukin-2 (IL2), an important T cell growth factor (Fraser et al., Science, 251:313-16 (1991)). Mutation of CD28 such that it can no longer interact with PI 3-kinase leads to a failure to initiate IL2 production, suggesting a critical role for PI 3-kinase in T cell activation.
Specific inhibitors against individual members of a family of enzymes provide invaluable tools for deciphering functions of each enzyme. Two compounds, LY294002 and wortmannin, have been widely used as PI 3-kinase inhibitors. These compounds, however, are nonspecific P13K inhibitors, as they do not distinguish among the four members of Class I PI

3-kinases. For example, the IC50 values of wort-mannin against each of the various Class I PI 3-kinases are in the range of 1-10 nM. Similarly, the IC50 values for LY294002 against each of these PI 3-kinases is about 1 pM (Fruman et al., Ann Rev Bio-chem, 67:481-507 (1998)). Hence, the utility of these compounds in studying the roles of individual Class I PI 3-kinases is limited.
Based on studies using wortmannin, there is evidence that PI 3-kinase function also is re-quired for some aspects of leukocyte signaling through G-protein coupled receptors (Thelen et al., Proc Nati Acad Sci USA, 91:4960-64 (1994)). More-over, it has been shown that wortrnannin and LY294002 block neutrophil migration and superoxide release.
However, inasmuch as these compounds do not disting-uish among the various isoforms of P13K, it remains unclear which particular P13K isoform or isoforms are involved in these phenomena.

O
/ I I
O N

O

wortmannin In view of the above considerations, it is clear that existing knowledge is lacking with re-spect to structural and functional features of the PI 3-kinase enzymes, including subcellular localiza-tion, activation states, substrate affinities, and the like. Moreover, the functions that these.
enzymes perform in both normal and diseased tissues remains to be elucidated. In particular, the func-tion of PI3K5 in leukocytes has not. previously been characterized, and knowledge concerning its function in human physiology remains limited. The coexpres-sion in these tissues of other P13K isoforms has heretofore confounded efforts to segregate the activities of each enzyme. Furthermore, separation of the activities of the various PI3K isozymes may not be possible without identification of inhibitors that demonstrate selective inhibition character-istics. Indeed, Applicants are not presently aware that such selective, or better, specific, inhibitors of P13K isozymes have been demonstrated.
Thus, there exists a need in the art for further structural characterization of the PI3K6 polypeptide. There also exists a need for func-tional characterization of PI3K5. Furthermore, our understanding of P13K5 requires further elaboration of the structural interactions of p1106, both with its regulatory subunit and with other proteins in the cell. There also remains a need for selective or specific inhibitors of P13K isozym-es, in order that the functions of each isozyme can be better characterized. In particular, selective or specific inhibitors of P13K5 are desirable for exploring the role of this isozyme and for development of pharma-ceuticals to modulate the activity of the isozyme.
One aspect of the present invention is to provide compounds that can inhibit the biological activity of human PI3K5. Another aspect of the invention is to provide compounds. that inhibit P13K5 selectively while having relatively low inhibitory potency against the other P13K isoforms. Another aspect of the invention is to provide methods of characterizing the function of human PI3K5. Another aspect of the invention is to provide methods of selectively modulating human P13K5 activity, and thereby promoting medical treatment of diseases mediated by PI3K5 dysfunction. Other aspects and advantages of the invention will be readily apparent to the artisan having ordinary skill in the art.

SUMMARY OF THE INVENTION

It has now been discovered that these and other aspects can be achieved by the present inven-tion, which, in one aspect, is a method for disrup-ting leukocyte function, comprising contacting leukocytes with a compound that selectively inhibits phosphatidylinositol 3-kinase delta (PI3K6) activity in the leukocytes. According to the method, the leukocytes can comprise cells selected from the group consisting of neutrophils, B lymphocytes, T
lymphocytes, and basophils.
For example, in cases in which the leuko-cytes comprise neutrophils, the method can comprise disrupting at least one neutrophil function selected from the group consisting of stimulated superoxide .release, stimulated exocytosis, and chemotactic migration. Preferably, the method does not substan-tially disrupt bacterial phagocytosis or bacterial killing by the neutrophils. In cases wherein the leukocytes comprise B lymphocytes, the method can comprise disrupting proliferation of the B lympho-cytes or antibody production by the B lymphocytes.
In cases wherein the leukocytes comprise T lympho-cytes, the method can comprise disrupting prolifera-tion of the T lymphocytes. In cases wherein the leukocytes comprise basophils, the method can com-prise disrupting histamine release by the basophils.
In the methods of the invention wherein a selective P13K5 inhibitor is employed, it is pre-ferred that the compound be at least about 10-fold selective for inhibition of PI3K5 relative to other Type I P13K isoforms in a cell-based assay. More preferably, the compound is at least about 20-fold selective for inhibition of PI3K5 relative to other Type I P13K isoforms in a cell-based assay. Still more preferably, the compound is at least about 50-fold selective for inhibition of PI3K5 relative to other Type 1 P13K isoforms in a biochemical assay.

Preferred selective compounds useful according to the methods include compounds having the structure (I) :x::Y-(I) wh erein A is an optionally substituted monocyclic or bicyclic ring system containing at least two nitrogen atoms, and at least one ring of the system is aromatic;
X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;
Y is selected from the group consisting of null, S, SO, SO2, NH, 0, C (=O) , OC (=O) , C (=O) O, and NHC (=0) CH2S;
R1 and R2, independently, are selected from the group consisting of hydrogen, C1_6alkyl, aryl, heteroaryl, halo, NHC (=O) C1.3alkyleneN (Ra) 2, NO2, ORa, OCF3, N (Ra) 2, CN, OC (=O) Ra, C (=O) Ra, C (=O) ORa, arylORb, Het, NRaC (=0) C,__3alkyleneC (=O) ORa, arylOC1_3alkylene-N (Ra) 2, arylOC (=O) Ra, Cl_4alkyleneC (=O) ORa, OC1.4alkyl-eneC (=0) ORa, C1alkyleneOC1.4alkyleneC (=U) ORa, C (=0) -NRaS02Ra, C1.4alkyleneN (Ra) 2, c2 -6alkenylen.eN (Ra) 2, C (=0) NRaCl_4alkyleneORa, C (=0) NRaC1_4alkyleneHet, OC2-4-alkyleneN (Ra) 2, OC1_4alkyleneCH (ORb) CH2N (Ra) 2, OC1.4al-kyleneHet, OC2.4alkyleneORa, OC2.4alkyleneNRaC (=0) ORa, NRaC1_4alkyleneN (Ra) 2, NRaC (=O) Ra, NRaC (=O) N (Ra) 2, N (S02C1_,alkyl) 2, NR a (S02C1_,alkyl) , SO2N (Ra) 2, OS02CF3, C1.3alkylenearyl, C1-4alkyleneHet, C1.6alkyleneORb, C1.3alkyleneN (Ra) 2, C (=0) N (Ra) 2, NHC (=0) C1-C3alkylene-aryl, C3.8cycloalkyl, C3.8heterocycloalkyl, aryl-OCl.3alkyleneN (Ra) 2, arylOC (=O) Rb, NHC (=O) C1-3alkylene-C3.8heterocycloalkyl, NHC (=0) C1_3alkyleneHet, OC1_4al-kyleneOC1 4alkyleneC (=O) ORb, C (=0) C1.4alkyleneHet, and NHC (=0) haloCl_6alkyl;
or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;
R3 is selected from the group consisting of optionally substituted hydrogen, C1.6alkyl, C3_3cycl.o-alkyl, C3_8heterocycloalkyl, C1.4alkylenecycloalkyi, C2.6alkenyl, C1.3alkylenearyl, arylCl_3alkyl, C (=0) Ra, aryl, heteroaryl, C (=0) ORa, C (=O) N (Ra) 2, C (=S) N (Ra) 2, SO2Ra, SO2N (Ra) 2, S (=O) Ra, S (=O) N (Ra) 2, C '=O) NR C1.4-alkyleneORa, C (=0) NRaC1_4alkyleneHet, C (=0) C1_4alkyl.-enearyl, C (=0) C1.4alkyleneheteroaryl, C1.4alkylenearyl optionally substituted with one or more of halo, SO2N (Ra) 2, N (Ra) 2, C (=O) ORa, NRaSO2CF3, CN, NO2, C (=O) Ra, ORa, C1_,.alkyleneN (Ra) 2, and OC1_4alkyleneN (Ra) 2, Cz-4-alkyleneheteroaryl, C1.4alkyleneHet, C,__4alkyleneC (=0) -C1_4alkylenearyl, C1.4alkyleneC (=0) C1.4alkylenehetero-aryl, C1.4alkyleneC (=0) Het, C,__4alkyleneC (=O) N (Ra) 2, C1.4alkyleneORa, CI-4alkyleneNRaC (=O) Ra, Cl-4a.lkylene0-C1-4alkyleneORa, C1_4alkyleneN (Ra) 2, Ci_4alkyleneC (=0) -ORa, and C1..4alkyleneOC1 4alkyleneC (=0) ORa;
Ra is selected from the group consisting of hydrogen, Cl_6alkyl, C3_8cycloalkyl, C3.8heterocyclo-alkyl, C1.3alkyleneN(Ra)2, aryl, ary1C1-3alky1., C1-3-alkylenearyl, heteroaryl, heteroarylC,__aalkyl, and Cl_3alkyleneheteroaryl ;
or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom;
Rb is selected from the group consisting of hydrogen, C,-,alkyl, aryl, heteroaryl, arylCl_3a.lkyl, heteroarylCl_3alkyl, C,_3alkylenearyl, ' and C1.3alkyl-eneheteroaryl;
Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1.,4alkyl or C (=0) ORa;
and pharmaceutically acceptable salts and solvates (e.g., hydrates) thereof, wherein the compound has at least about a 10-fold selective inhibition for PI3K5 relative other Type-I P13K isoforms in a cell-based assay.
In another embodiment, the invention is a method for treating a medical condition mediated by neutrophils,.comprising administering to an animal in need thereof an effective amount of a compound that selectively inhibits phosphatidylinositol 3-kinase delta (PI3K5) activity in the neutrophils.
Exemplary medical conditions that can be treated according to the method include those conditions characterized by an undesirable neutrophil function selected from the group consisting of stimulated superoxide release, stimulated exocytosis, and chemotactic migration. Preferably, according to the method, phagocytic activity or bacterial killing by the neutrophils is substantially uninhibited.

In another embodiment, the invention is a method for disrupting a function of osteoclasts comprising contacting osteoclasts with a compound that selectively inhibits phosphatidylinositol 3-kinase delta (P13K5) activity in the osteoclasts.
According to the method, the compound can comprise a moiety that preferentially binds to bone.
In another embodiment, the invention is a method of ameliorating a bone-resorption disorder in an animal in need thereof comprising administering to the animal an effective amount of a compound that inhibits phosphatidylinositol 3-kinase delta (P13K5) activity in osteoclasts of the animal. A preferred bone-resorption disorder amenable to treatment according to the method is osteoporosis.
In another embodiment, the invention is a method for inhibiting the growth or proliferation of cancer cells of hematopoietic origin, comprising contacting the cancer cells with a compound that selectively inhibits phosphatidylinositol 3-kinase delta (PI3K5) activity in the cancer cells. The .method can be advantageous in inhibiting the growth :or proliferation of cancers selected from the group consisting of lymphomas, multiple myelomas, and leukemias.
In another embodiment, the invention is a method of inhibiting kinase activity of a phospha-tidylinositol 3-kinase delta (P13K5) polypeptide, comprising contacting the P13K6 polypeptide with'a compound having the generic structure (I).
Preferred compounds useful according to the method include compounds selected from the group consisting of:

N ,R6 Y - N

Rd q N
N
~-NH
(II) wherein Y.is selected from the group consisting of null, S, and NH;
R4 is selected from the group consisting of H, halogen, NO2, OH, OCH3, CH3, and CF3;
R5 is selected from the group consisting of H, OCH3, and halo;
or R4 and R5 together with C-'6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;
R6 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkoxyphenyl, alkyl-phenyl, biphenyl, benzyl, pyrid.inyl, 4-methylpiper.-azinyl, C (=O) OC2H5, and morpholinyl;
Rd, independently, is selected from the group consisting of NH2, halo, C1.3alkyl, S (C1.3alkyl) , OH, NH (C1.3alkyl) , N (C1_3alkyl) 2, NH (C1.3alkylenephen-yl), and OH
O

and q is 1 or 2, provided that at least one of R4 and R5 is other than H when R6 is phenyl or 2-chlorophenyl.
More preferably, the compound is selected from the group consisting of:

N

Y N N (Rd.) q N
r \-NH
(III) wherein Y is selected from the group con-sisting of null, S, and NH;
R7 is selected from the group consisting of H, halo, OH, OCH3, CH3, and CF3;
R8 is selected from the group consisting of is H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;
R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphen-yl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)-OC2H5 , and morphol inyl ;
Rd, independently, is selected from the group consisting of NH2, halo, C1_3alkyl, S (C1.3alkyl) , OH, NH.(C1.3alkyl) , N (C1-3alkyl) z , NH (C,.-3alkylenephen,-yl); and q is 1 or 2, provided that at least one of R7 and R8 is different from 6--halo or 6,7-dimethoxy groups, and that R9 is different from 4.-chlorophenyl.
In another embodiment, the invention is a method for disrupting leukocyte function, comprising contacting leukocytes with'a compound having a general structure (I).
In another embodiment, the invention is a class of compounds that have been observed to inhibit PI3K5 activity in biochemical and cell-based assays, and are expected to exhibit therapeutic benefit in medical conditions in which PI3K5 activity is excessive or undesirable. Thus, the invention provides a class of compounds having the structure (II) .
Preferably, the compounds have a general structure (IV) N

` (Rd.) q /N
N T
-NH
(IV) wherein Y is selected from the group con-sisting of null, S, and NH;
R10 is selected from the group consisting of H, halo, OH1OCH3, CH3, and CF3;
R" is selected from the group consisting of H, OCH3, and halo;
or R'Q and R11 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;
R12 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)CA, and morpholinyl;
Rd, independently, is selected from the group consisting of NH2, halo, C1.3alkyl, S (C,-,,alkyl) , OH, NH (C,_3alkyl) , N (C1_3alkyl) 2, NH (Cl_3alkylenephen-yl) , and q is 1 or 2, provided that:

(a) at least one of R10and R" is different from 6-halo or 6,7-dimethoxy groups;

(b) R12 is different from 4-chlorophenyl; and (c) at least one of R10 and R11 is different from H when R12 is phenyl or 2-chlorophenyl and X is S.

According to one aspect of the present invention, there is provided a use of a compound having a structure:

N-~
N

Y N
N
NH

wherein Y is selected from the group consisting of null, S. and NH;

R7 is selected from the group consisting of H, halo, OH, OCH3, CH3, and CF3;

R8 is selected from the group consisting of H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;

R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)-OC2H5r and morpholinyl;

78895-27(S) - 19a -Rd, independently, is selected from the group consisting of NH2, halo, C1_3alkyl, S (C1_3alkyl) , OH, NH (C1_3alkyl) , N (C1_3alkyl) 2, and NH (C1.3alkylenephenyl) ;
q is 1 or 2, and pharmaceutically acceptable salts and solvates thereof, provided that at least one of R7 and R8 is different from 6-halo or 6,7-dimethoxy groups, and that R9 is different from 4-chlorophenyl for disrupting leukocyte function.

According to another aspect of the present invention, there is provided a use of a compound having a structure:

O

N~

N X-Y- A

wherein A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N (Ra) 2, halo, C1_3alkyl, S (C1.3a1ky1) , ORa and OH
O

X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;

Y is selected from the group consisting of null, S, SO, SO2, NH, 0, C (=O) , OC (=0) , C (=O) 0, and NHC (=O) CH2S;

78895-27(S) - 19b -R1 and R2, independently, are selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl, halo, NHC (=O) C1_3alkyleneN (Ra) 2, NO2, OR a, OCF3, N (Ra) 2, CN, OC (=O) Ra, C (=0) Ra, C (=O) ORa, arylORb, Het, NRaC (=0) C1_3alkyleneC (=0) ORa, arylOC1_3alkyleneN (Ra) 2, arylOC (=O) Ra, C1.4alkyleneC (=O) ORa, OC1_4alkyleneC (=O) ORa, C1_4alkyleneOC1_4alkyleneC (=0) ORa, C (=O) NRaSO2Ra, C1_4alkyleneN (Ra) 2, C2_6alkenyleneN (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=0) NRaC1_4alkyleneHet, OC2_4alkyleneN (Ra) 2, OC1_4alkyleneCH (ORb) CH2N (Ra) 2, OC1_4alkyleneHet, OC2_4alkyleneORa, OC2_4alkyleneNRaC (=0) ORa, NRaC1_4alkyleneN (Ra) 2, NRaC (=0) Ra, NRaC (=O) N (Ra) 2, N (SO2C1_4alkyl) 2, NRa (SO2CI-4alkyl) , SO2N (Ra) 2, OSO2CF3, C1_3alkylenearyl, C1.4alkyleneHet, C1_6alkyleneORb, C1.3alkyleneN (Ra) 2r C (=O) N (Ra) 2, NHC (=O) Cl-C3alkylenearyl, C3_8cycloalkyl, C3_8heterocycloalkyl, arylOC1.3alkyleneN (Ra) 2, arylOC (=O) Rb, NHC (=0) C1.3alkyleneC3.8heterocycloalkyl, NHC (=0) C1_3-alkyleneHet, OC1_4alkyleneOC1_4alkyleneC (=0) ORb, C (=0) C1_4alkyleneHet, and NHC (=0) haloC1_6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1_6alkyl, C3_8cycloalkyl, C3.8heterocycloalkyl, C1_4alkylenecycloalkyl, C2_6alkenyl, C1_3alkylenearyl, arylC1_3alkyl, C (=O) Ra, aryl, heteroaryl, C (=0) ORa, C (=0) N (Ra) 2, C (=S) N (Ra) 2, SO2Ra, S02N (Ra) 2, S (=0) Ra, S (=0) N (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=O) NRaC1.4alkyleneHet, C (=O) C1_4alkylenearyl, C (=0) C1_4alkyleneheteroaryl, C1_4alkylenearyl substituted with one or more of SO2N(Ra)2, N (Ra) 2, C (=0) ORa, NRaSO2CF3, CN, NO2, C (=0) Ra, OR a, 78895-27(S) - 19c -C1_4alkyleneN (Ra) 2, and OC1_4alkyleneN (Ra) 2, C1_4alkyleneheteroaryl, C1_4alkyleneHet, C1_4alkyleneC (=0) C1_4-alkylenearyl, C1_4alkyleneC (=0) C1_4alkyleneheteroaryl, C1_4alkyleneC (=O) Het, C1_4alkyleneC (=0) N (Ra) 2, Cl_4alkyleneORa, C1_4alkyleneNRaC (=0) Ra, C1_4alkyleneQC1.4alkyleneORa, C1_4alkyleneN (Ra) 2 i C1.4alkyleneC (=0) ORa, and C1.4alkyleneO
C1_4-alkyleneC (=0) ORa;

Ra is selected from the group consisting of hydrogen, C1.6alkyl, C3_8cycloalkyl, C3_8heterocycloalkyl, C1_3alkyleneN(Ra) 2, optionally substituted aryl, arylCl_3alkyl, C1_3alkylenearyl, heteroaryl, heteroarylC1_3alkyl, and C1_3alkyleneheteroaryl ;

or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom;

Rb is selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl, arylC1_3alkyl, heteroarylC1_3alkyl, C1_3alkylenearyl, and C1.3alkyleneheteroaryl;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1_4alkyl or C (=0) ORa;

or a pharmaceutically acceptable salt or solvate thereof for disrupting leukocyte function in leukocytes wherein the compound, salt or solvate is for administration in an amount sufficient to inhibit phosphatidylinositol 3-kinase delta activity in said leukocytes.

78895-27(S) - 19d -According to still another aspect of the present invention, there is provided a use of a compound having a structure:

N' Y N
(R d)q ,N
N
NH
wherein Y is selected from the group consisting of null, S, and NH;

R7 is selected from the group consisting of H, halo, OH, OCH3, CH3, and CF3;

R8 is selected from the group consisting of is H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;

R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)-OC2Hs, and morpholinyl;

Rd, independently, is selected from the group consisting of NH2, halo, C1_3alkyl, S (C1_3alkyl) , OH, NH (C1_3alkyl) , N (C1_3alkyl) 2, and NH (C1.3alkylenephenyl) q is 1 or 2, - l9e -provided that R9 is different from 4-chlorophenyl, for disrupting a function of osteoclasts.

According to yet another aspect of the present invention, there is provided a use of a compound having a structure:

N

81W"
R
X N

N
N
NH
wherein R7 is selected from the group consisting of H, halogen, OH, OCH3, CH3, and CF3;

R8 is selected from the group consisting of H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;

R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, acetic acid ethyl ester, and morpholinyl;

X is NH or S; or a pharmaceutically acceptable salt or solvate thereof, 78895-27(S) - 19f -a pharmaceutically acceptable salt or solvate thereof, provided that at least one of R7 and R8 is different from 6-halo or 6,7-dimethoxy groups, and further provided that R9 is different from 4-chloro-phenyl, for inhibiting growth or proliferation of chronic myelogenous leukemia cells.

According to a further aspect of the present invention, there is provided a use of a compound having a structure O

N~

X-Y-O
A

wherein A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N (Ra) 2, halo, C1_3alkyl, S (C1_3alkyl) , ORa and OH
O
ZL ( X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;

Y is selected from the group consisting of null, S, SO, SO2, NH, 0, C (=O) , OC (=O) , C (=O) O, and NHC (=O) CH2S;
Rl and R2, independently, are selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl, halo, 78895-27(S) - 19g -NHC (=O) C1.3alkyleneN (Ra) 2, NO2, ORa, OCF3, N (Ra) 2, ON, OC (=O) Ra, C (=O) Ra, C (=O) ORa, arylORb, Het, NRaC (=0) C1_3alkyleneC (=O) ORa, arylOC1_3alkyleneN (Ra) 2, arylOC (=O) Ra, C1_4alkyleneC (=O) ORa, OC1_4alkyleneC (=O) ORa, C1_4alkyleneOC1_4alkyleneC (=O) ORa, C (=0) -NRaSO2Ra, C1_4alkyleneN (Ra) 2, C2_6alkenyleneN (Ra) 2, C (=O) NRaC1_4alkyleneORa, C (=O) NRaC1_4alkyleneHet, OC2_4alkyleneN (Ra) 2, OC1_4alkyleneCH (ORb) CH2N (Ra) 2, OC1_4alkyleneHet, OC2_4alkyleneORa, OC2_4alkyleneNRaC (=0) ORa, NRaC1_4alkyleneN (Ra) 2, NRaC (=O) Ra, NRaC (=O) N (Ra) 2, N (SO2C1_4alkyl) 2, NRa (S02C1.4alkyl) , SO2N (Ra) 2, OSO2CF3, C1_3alkylenearyl, C1_4alkyleneHet, C1_6alkyleneORb, C1_3alkyleneN (Ra) 2, C (=O) N (Ra) 2, NHC (=O) C1-C3alkylenearyl, C3_8cycloalkyl, C3_8heterocycloalkyl, arylOC1_3alkyleneN(Ra)2, arylOC (=O) Rb, NHC (=O) C1.3alkyleneC3_8heterocycloalkyl, NHC (=O) C1.3-alkyleneHet, OC1_4alkyleneOC1_4alkyleneC (=0) ORb, C (=0) C1_4alkyleneHet, and NHC (=0) haloC1_6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1.6alkyl, C3_8cyclo-alkyl, C3_8heterocycloalkyl, C1.4alkylenecycloalkyl, C2_6alkenyl, C1.3alkylenearyl, arylC1_3alkyl, C (=O) Ra, aryl, heteroaryl, C(=O)ORa, C(=O)N(Ra)2, C(=S)N(Ra)2, SOZRa, S02N(Ra)2, S(=O)Ra, S (=O) N (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=O) NRa C1_4alkyleneHet, C(=O) C1_4alkylenearyl, C (=0) C1_4alkyleneheteroaryl, C1_4alkylenearyl optionally substituted with one or more of halo, SO2N (Ra) 2, N (Ra) 2, C (=O) ORa, NRaSO2CF3, CN, NO2, C (=0) Ra, ORa, C1_4alkyleneN (Ra) 2, and OC1.4alkyleneN (Ra) 2, C1_4alkyleneheteroaryl, C1_4alkyleneHet, C1_4alkyleneC (=0) C1_4alkylenearyl, C1_4alkyleneC (=0) C1_4-alkyleneheteroaryl, 78895-27(S) - 19h -C1_4alkyleneC (=0) Het, C1_4alkyleneC (=O) N (Ra) 2, C1.4alkyleneORa, C1_4alkyleneNRaC (=O) R', C1_4-alkyleneOC1_4alkyleneORa, C1_4alkyleneN (Ra) 2, C1.4alkyleneC (=O) ORa, and C1.4alkyleneO
C1_4alkyleneC (=0) ORa;

Ra is selected from the group consisting of hydrogen, C1_6alkyl, C3_8cycloalkyl, C3_8heterocycloalkyl, C1_3alkyleneN (Ra) 2, optionally substituted aryl, arylC1_3alkyl, C1_3-alkylenearyl, heteroaryl, heteroarylC1_3alkyl, and C1_3alkyleneheteroaryl ;

or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom;

Rb is selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl, arylC1_3alkyl, heteroarylC1_3alkyl, C1_3alkylenearyl, and C1_3alkyleneheteroaryl;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1_4alkyl or C(=0) ORa;

or a pharmaceutically acceptable salt or solvate thereof, for inhibiting kinase activity of a phosphatidylinositol 3-kinase delta polypeptide.

According to yet a further aspect of the present invention, there is provided a compound having a structure 78895-27(S) - 19i -N' R s N~J~
Y N
~(Rd)q N
N
\ -NH

wherein Y is selected from the group consisting of null and NH;

R4 is selected from the group consisting of H, halogen, NO2, OH, OCH3, CH3, and CF3;

R5 is selected from the group consisting of H, OCH3, and halo;

or R4 and R5 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more 0, N, or S atoms;

R6 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, C1-C6alkoxyphenyl, C1-C6alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)OC2H5r and morpholinyl;

Rd, independently, is selected from the group consisting of NH2, halo, C1_3alkyl, S (C1_3alkyl) , OH, NH (C1_3alkyl) , N (C1-3alkyl) 2, NH (C1-3alkylenephenyl) , and OH
O

q is 1 or 2; and pharmaceutically acceptable salts 78895-27(S) - 19j -and solvates thereof, provided that at least one of R4 and R5 is other than H when R6 is phenyl or 2-chlorophenyl;

wherein aryl is phenyl or naphthyl and wherein heteroaryl is a group having one or two rings, at least one oxygen, nitrogen or sulfur atom and up to ten ring atoms.
According to still a further aspect of the present invention, there is provided a compound having a general structural formula O

N~, A

wherein A is an optionally substituted monocyclic or bicyclic ring system containing at least two nitrogen atoms, and at least one ring of the system is aromatic;

X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;

Y is selected from the group consisting of null, S, SO, SO2, NH, 0, C (=0) , OC (=O) , C (=O) O, and NHC (=O) CH2S;
R1 and R2, independently, are selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl, halo, NHC (=O) C1_3alkyleneN (Ra) 2, NO2, ORa, OCF3, N (Ra) 2, CN, OC (=O) Ra, C (=O) Ra, C (=0) ORa, arylORb, Het, NRaC (=O) C1_3alkyleneC (=0) ORa, arylOC1_3alkyleneN (Ra) 2, arylOC (=O) Ra, C1.4alkyleneC (=O) ORa, OC1_4alkyleneC (=0) ORa, C1_4alkyleneOC1_4alkyleneC (=0) ORa, C (=O) -NRaSO2Ra, C1_4alkyleneN (Ra) 2, C2_6alkenyleneN (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=0) NRaC1_4alkyleneHet, 78895-27(S) - 19k -OC2.4alkyleneN (Ra) 2, OC1.4alkyleneCH (ORb) CH2N (Ra) 2, OC1_4alkyleneHet, OC2_4alkyleneORa, OC2_4alkyleneNRaC (=O) ORa, NRaC1_4alkyleneN (Ra) 2, NRaC (=O) Ra, NRaC (=O) N (Ra) 2, N (S02C1_4alkyl) 2, NRa (S02C1_4alkyl) , SO2N (Ra) 2, OSO2CF3, C1_3alkylenearyl, C1_4alkyleneHet, C1_6alkyleneORb, C1_3alkyleneN (Ra) 2, C (=O) N (Ra) 2, NHC (=O) C1-C3alkylenearyl, C3_scycloalkyl, C3_8heterocycloalkyl, arylOC1_3alkyleneN (Ra) 2, arylOC (=O) Rb, NHC (=O) C1.3alkyleneC3.8heterocycloalkyl, NHC (=O) C1_3-alkyleneHet, OC1_4alkyleneOC1_4alkyleneC (=O) ORb, C (=O) C1_4alkyleneHet, and NHC (=O) haloC1_6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;

R3 is hydrogen or is selected from the group consisting of optionally substituted, C1_6alkyl, C3_8cyclo-alkyl, C3_8heterocycloalkyl, C1_4alkyleneC3-C8cycloalkyl, C2_6alkenyl, C1_3alkylenearyl, arylC1_3alkyl, C (=O) Ra, aryl, heteroaryl, C (=O) ORa, C (=O) N (Ra) 2, C (=S) N (Ra) 2, SO2Ra, SO2N (Ra) 2, S (=O) Ra, S (=O) N (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=O) NRaC1_4alkyleneHet, C (=O) C1_4alkylenearyl, C (=O) C1_4alkyleneheteroaryl, C1_4alkylenearyl optionally substituted with one or more of halo, SO2N (Ra) 2, N (Ra) 2, C (=O) OR,,, NRaSO2CF3, CN, NO2, C (=O) Ra, ORa, C1_4alkyleneN (Ra) 2, and OC1_4alkylene (Ra) 2, C1.4alkyleneheteroaryl, C1.4alkyleneHet, C1_4alkyleneC (=O) C1_4alkylenearyl, C1_4alkyleneC (=O) C1_4-alkyleneheteroaryl, C1_4alkyleneC(=O)Het, C1_4alkyleneC (=O) N (Ra) 2, C1.4alkyleneORa, C1.4alkyleneNRaC (=O) Ra, C1_4-alkylene0C1_4alkyleneORa, C1_4alkyleneN (Ra) 2, C1_4alkyleneC (=O) ORa, and C1_4alkyleneOC1_4alkyleneC (=O) ORa;
Ra is selected from the group consisting of hydrogen, C1_6alkyl, C3_8cycloalkyl, C3_8heterocycloalkyl, 78895-27(S) C1_3alkyleneN(Ra)2, optionally substituted aryl, arylCl_3alkyl, C1_3-alkylenearyl, heteroaryl, heteroarylC1_3alkyl, and C1_3alkyleneheteroaryl ;

or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom;

Rb is selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl, arylC1_3alkyl, heteroarylC1_3alkyl, C1_3alkylenearyl, and C1_3alkyleneheteroaryl;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1_4alkyl or C (=O) ORa;

or a pharmaceutically acceptable salt or solvate thereof, with the provisos that if X-Y is CH2S, then R3 is different from 78895-27(S) - 19m -\ CH3 N .55-k N

CH3 'Jl\ CH3 and if X-Y is CH2S, then R3 is different from -CH2CH (OH) CH2OH substituted phenyl;

wherein aryl is phenyl or naphthyl and wherein heteroaryl is a group having one or two rings, at least one oxygen, nitrogen or sulfur atom and up to ten ring atoms.

According to another aspect of the present invention, there is provided a compound having a general structural formula 78895-27(S) - 19n -O
R

A
Y- O
whe rein:
A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N(Ra)2, halo, C1-3alkyl, S (C1-3alkyl) , ORa and OH
O

X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;

Y is selected from the group consisting of null, NH, 0, C(=O), OC (=0) , C(=O)O, and NHC (=0) CH2S;

R1 and R2, independently, are selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, 0 or S atoms, halo, NHC (=0) C1_3alkyleneN (Ra) 2, NO2, ORa, OCF3, N (Ra) 2, CN, OC (=0) Ra, C (=0) Ra, C (=0) ORa, arylORb, Het, NRaC (=O) C1-3alkyleneC (=O) ORa, arylOC1_3alkyleneN (Ra) 2, arylOC (=0) Ra, C1_4alkyleneC (=0) ORa, OC1-4alkyleneC (=0) ORa, C1-4alkyleneOC1-4alkyleneC (=0) ORa, C (=0) -NRaSO2Ra, C1_4alkyleneN (Ra) 2, C2_6alkenyleneN (Ra) 2, C (=0) NRaC1-4alkyleneORa, C (=0) NRaC1-4alkyleneHet, OC2-4alkyleneN (Ra) 2, OC1-4alkyleneCH (ORb) CH2N (Ra) 2, OC1_4alkyleneHet, OC2-4alkyleneORa, OC2-4alkyleneNRaC (=0) ORa, NRaC1-4alkyleneN (Ra) 2, NRaC (=0) Ra, NRaC (=0) N (Ra) 2, N (SO2C1-4alkyl) 2, NRa (S02C1-4alkyl) , SO2N (Ra) 2, OSO2CF3, 78895-27(S) C1.3alkylenearyl, C1_4alkyleneHet, C1.6alkyleneORb, C1_3alkyleneN (Ra) 2, C (=0) N (Ra) 2, NHC (=0) C1-C3alkylenearyl, C3_8cycloalkyl, C3_8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, arylOC1_3alkyleneN(Ra)2, arylOC (=0) Rb, NHC (=0) C1.3alkyleneC3.8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, NHC(=O)C1_3-alkyleneHet, OC1_4alkyleneOC1_4alkyleneC (=0) ORb, C (=O) C1_4alkyleneHet, and NHC (=0) haloC1_6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom, wherein the at least one hetero atom is independently 1 to 3 N, 0 or S atoms;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1_6alkyl, C3_8cyclo-alkyl, C3_8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkyleneC3-C8cycloalkyl, C2_6alkenyl, C1_3alkylenearyl, arylC1_3alkyl, C (=0) Ra, aryl, heteroaryl comprising independently 1 to 3 N, 0 or S atoms, C(=0)ORa, C (=O) N (Ra) 2, C (=S) N (Ra) 2, SO2Ra, SO2N (Ra) 2, S (=0) Ra, S (=O) N (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=0) NRaC1_4alkyleneHet, C (=O) C1_4alkylenearyl, C (=0) C1.4alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkylenearyl optionally substituted with one or more of halo, S02N (Ra) 2, N (Ra) 2, C (=0) ORa, NRaSO2CF3, CN, NO2, C (=0) Ra, OR a, C1_4alkyleneN (Ra) 2, and OC1.4alkylene (Ra) 2, C1_4alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkyleneHet, C1_4alkyleneC (=0) C1_4alkylenearyl, C1_4alkyleneC (=0) C1_4-alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkyleneC(=0)Het, C1_4alkyleneC (=0) N (Ra) 2, C1.4alkyleneORa, C1.4alkyleneNRaC (=0) Ra, C1_4-alkyleneOC1_4alkyleneORa, C1_4alkyleneN (Ra) 2, 78895-27(S) - 19p -C1_4alkyleneC (=O) ORa, and C1_4alkyleneOC1_4alkyleneC (=O) ORa;
Ra is selected from the group consisting of hydrogen, C1_6alkyl, C3_8cycloalkyl, C3_8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, C1_3alkyleneN(Ra)2, optionally substituted aryl, arylCl_3alkyl, C1_3-alkylenearyl, heteroaryl comprising independently 1 to 3 N, 0 or S atoms, heteroarylC1_3alkyl comprising independently 1 to 3 N, 0 or S atoms, and C1_3alkyleneheteroaryl;

or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom wherein the at least one heteroatom is independently 1 to 3 N, 0 or S atoms;

Rb is selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, 0 or S atoms, arylC1_3alkyl, heteroarylC1_3alkyl comprising independently 1 to 3 N, 0 or S atoms, C1_3alkylenearyl, and C1_3alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1_4alkyl or C (=O) ORa;

or a pharmaceutically acceptable salt or solvate thereof, wherein aryl is phenyl or naphthyl.
According to another aspect of the present invention, there is provided a pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent 78895-27(S) - 19q -and a compound having a general structural formula O
R

Y-O
wher ein:
A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N(Ra)2, halo, C1-3alkyl, S (C1_3alkyl) , ORa and OH
O

X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;

Y is selected from the group consisting of null, NH, 0, C(=0), OC(=0), C(=0)O, and NHC(=O)CH2S;

R1 and R2, independently, are selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, 0 or S atoms, halo, NHC (=O) C1-3alkyleneN (Ra) 2r NO2, ORa, OCF3, N (Ra) 2, CN, OC (=0) Ra, C (=0) Ra, C (=0) ORa, arylORb, Het, NRaC (=0) C1_3alkyleneC (=0) ORa, arylOC1-3alkyleneN (Ra) 2, arylOC (=0) Ra, C1_4alkyleneC (=0) ORa, OC1_4alkyleneC (=0) ORa, C1-4alkyleneOC1-4alkyleneC (=0) ORa, C (=0) -NRaSO2Ra, C1_4alkyleneN (Ra) 2, C2-6alkenyleneN (Ra) 2, C (=0) NRaC1-4alkyleneORa, C (=0) NRaC1_4alkyleneHet, OC2-4alkyleneN (Ra) 2, OC1_4alkyleneCH (ORb) CH2N (Ra) 2, OC1-4alkyleneHet, OC2_4alkyleneOR, OC2_4alkyleneNRaC (=0) ORa, a 78895-27(S) - 19r -NRaCl_4alkyleneN (Ra) 2, NRaC (=0) Ra, NRaC (=O) N (Ra) 2, N (S02C1_4alkyl) 2, NRa (S02C1.4alkyl) , SO2N (Ra) 2, OSO2CF3, C1_3alkylenearyl, C1_4alkyleneHet, C1_6alkyleneORb, C1_3alkyleneN (Ra) 2, C (=0) N (Ra) 2, NHC (=0) C1-C3alkylenearyl, C3_8cycloalkyl, C3_8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, arylOC1_3alkyleneN(Ra)2, arylOC (=0) Rb, NHC (=0) C1.3alkyleneC3.8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, NHC(=O)C1_3-alkyleneHet, OC1_4alkyleneOC1_4alkyleneC (=0) ORb, C (=0) C1_4alkyleneHet, and NHC (=0) haloC1_6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom, wherein the at least one hetero atom is independently 1 to 3 N, 0 or S atoms;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1_6alkyl, C3_8cyclo-alkyl, C3_8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkyleneC3-C8cycloalkyl, C2_6alkenyl, C1_3alkylenearyl, arylC1_3alkyl, C (=O) Ra, aryl, heteroaryl comprising independently 1 to 3 N, 0 or S atoms, C(=0)ORa, C(=O)N(Ra)2, C(=S)N(Ra)2, SO2Ra, SO2N(Ra)2, S(=O)Ra, S (=O) N (Ra) 2, C (=0) NRaC1_4alkyleneORa, C (=0) NRaC1_4alkyleneHet, C (=O) C1_4alkylenearyl, C (=0) C1_4alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkylenearyl optionally substituted with one or more of halo, S02N(Ra)2, N (Ra) 2, C (=0) ORa, NRaSO2CF3, CN, NO2, C (=0) Ra, OR a, C1_4alkyleneN (Ra) 2, and OC1.4alkylene (Ra) 2, C1_4alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms, C1_4alkyleneHet, C1_4alkyleneC (=0) C1.4alkylenearyl, C1_4alkyleneC (=0) C1_4-alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms, Cl_4alkyleneC(=0)Het, 78895-27(S) - 19s -C1-4alkyleneC (=0) N (Ra) 2, Ci-4alkyleneORa, C1-4alkyleneNRaC (=0) Ra, C1-4-alkyleneOC1-4alkyleneORa, C1-4alkyleneN (Ra) 2, C1_4alkyleneC (=0) ORa, and C1_4alkyleneOC1-4alkyleneC (=0) ORa;
Ra is selected from the group consisting of hydrogen, C1-6alkyl, C3_8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, 0 or S atoms, C1-3alkyleneN (Ra) 2, optionally substituted aryl, arylC1_3alkyl, C1-3-alkylenearyl, heteroaryl comprising independently 1 to 3 N, 0 or S atoms, heteroarylC1-3alkyl comprising independently 1 to 3 N, 0 or S atoms, and C1-3alkyleneheteroaryl;

or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom wherein the at least one heteroatom is independently 1 to 3 N, 0 or S atoms;

Rb is selected from the group consisting of hydrogen, C1_6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, 0 or S atoms, arylC1_3alkyl, heteroarylC1_3alkyl comprising independently 1 to 3 N, 0 or S atoms, C1-3alkylenearyl, and C1_3alkyleneheteroaryl comprising independently 1 to 3 N, 0 or S atoms;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1_4alkyl or C (=0) ORa;

or a pharmaceutically acceptable salt or solvate thereof.

78895-27(S) - 19t -These and other features and advantages of the present invention will be appreciated from the detailed description and examples that are set forth herein. The 78895-27(S) - 19u -detailed description and examples are provided to enhance the understanding of the invention, but are not intended to limit the scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the effect of a selective PI3K5 inhibitor of the invention on the activity of three P13K isoforms.

Figure 2 shows the effect of a selective PI3K6 inhibitor on superoxide generation by human neutrophils in the presence of TNF or IgG.

Figure 3 shows the effect of a selective PI3K6 inhibitor on superoxide generation by human neutrophils in the presence of TNF or fMLP.

Figure 4 shows the effect of a selective PI3K6 inhibitor on elastase exocytosis in the presence of fMLP by human neutrophils.

Figure 5 shows the effect of a selective P13K6 inhibitor on fMLP-induced chemotaxis by human neutrophils.

Figure 6 shows that a'selective PI3K5 inhibitor does not affect phagocytosis and killing of S. aureus by neutrophils.
Figure 7 shows the effect of a selective PI3K6 inhibitor on proliferation and antibody pro-duction by human B lymphocytes. .
Figure 8 shows the effect of a selective PI3K6 inhibitor on anti-IgM stimulated mouse splenic B lymphocyte proliferation.
Figure 9 shows the effect of a selective PI3K5 inhibitor on elastase exocytosis in an animal model.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The invention provides compounds that selectively inhibit the activity of P13K(). The invention further provides methods of inhibiting P13K5 activity, including methods-of selectively modulating the activity.of .the PI3K5 isozyme in cells, especially leukocytes, osteoclasts, and cancer cells. The methods include in vi t.ro, in vivo, and ex vivo applications.
Of particular benefit are methods of selectively modulating PI3K5 activity in the clini-cal setting in order to ameliorate disease or dis-orders mediated by PI3K5 activity. Thus, treatment of diseases or disorders characterized by excessive or inappropriate PI3K6 activity can be treated through use of selective modulators of PI3Ko accord-ing to the invention.
Other methods of the invention include en-abling the further characterization of the physlo-logical role of the isozyme. Moreover; the inven-tion provides pharmaceutical compositions comprising selective PI3K5 inhibitors. Also provided are articles of manufacture comprising a selective P13K5 inhibitor compound (or a pharmaceutical composition comprising the compound) and instructions for using the compound. Details of these and other useful embodiments of the invention are now described.
The methods described herein benefit from .the use of compounds that selectively inhibit, and preferably specifically inhibit, the activity of PI3K5 in cells, including cells in vitro, in vivo, or ex vivo. Cells useful in the methods include those that express endogenous P13K6, wherein endo-genous indicates that the cells express PI3K absent recombinant introduction into the cells of one or more polynucleotides encoding a PI3K6 polypeptide or a biologically active fragment thereof. Methods also encompass use of cells that express exogenous P13K5, wherein one or more polynucleotides encoding PI3K5 or a biologically active fragment thereof have been introduced into the cell using recombinant pro-cedures.
Of particular advantage, the cells can be in vivo, i . e . , in a living subject, e.g., an animal or human, wherein a PI3K5 inhibitor can be used as a therapeutic to inhibit P13K5 activity in the sub-ject. Alternatively, the cells can be isolated as discrete cells or in a tissue, for ex vivo or in vitro methods. In vitro methods also encompassed by the invention can comprise the step of contacting a PI3K5 enzyme or a biologically active fragment thereof with an inhibitor compound of the invention.

The PI3K6 enzyme can include a purified and isolated enzyme, wherein the enzyme is isolated from a nat-ural source (e.g., cells or tissues that normally express a PI3K5 polypeptide absent modification by recombinant technology) or isolated from cells modi-fied by recombinant techniques to express exogenous enzyme.
The term "selective PI3K:6 inhibitor" as used herein refers to a compound that inhibits the PI3K6 isozyme more effectively than other isozymes of the P13K family. A "selective PI3K5 inhibitor"
compound is understood to be more selective for PI3K5 than compounds conventionally and generically designated P13K inhibitors, e.g., wortmannin or LY294002. Concomitantly., wortmannin and LY294002 are deemed "nonselective PI3K inhibitors." Com-pounds of any type that selectively negatively reg-ulate PI3K5 expression or activity can be used as selective PI3K5 inhibitors in the methods of the invention. Moreover, compounds of any type that.
selectively negatively regulate P13K5 expression or activity and that possess acceptable pharmacological properties can be used as selective PI3K5 inhibitors in the therapeutic methods of the invention.
The relative efficacies of compounds as inhibitors of an enzyme activity (or other biologi-cal activity) can be established by determining the concentrations at which each compound inhibits the activity to a predefined extent and then comparing the results. Typically, the preferred determination is the concentration that inhibits 50% of the activ-ity in a biochemical assay, i.e., the 50% inhibitory concentration or "IC50." IC50 determinations can be accomplished using conventional techniques known in the art. In general, an IC50 can be determined by measuring the activity of a given enzyme in the presence of a range of concentrations of the inhib-itor under study. The experimentally obtained values of enzyme activity then are plotted against the inhibitor concentrations used. The concentra-tion of the inhibitor that shows 506 enzyme activity .(as compared to the activity in the absence of any inhibitor) is taken as the IC50 value. Analogously;
other inhibitory concentrations can be defined through appropriate determinations of activity. For example, in some settings it can he desirable to establish a 90% inhibitory. concentration, i.e., IC90, etc.
Accordingly, a "selective PI3K5 inhibitor"
alternatively can be understood tb refer to a compound that exhibits a 50% inhibitory concentra-tion (IC50) with respect to P13K5 that is at least at least 10-fold, preferably at least 20-fold, and more preferably at least 30-fold, lower than the IC50 .value with respect to any or all of the other Class I P13K family members. The term "specific PI3K6 inhibitor" can be understood to refer to a selective PI3K5 inhibitor compound that exhibits an IC50 with respect to PI3K5 that is at least-50-fold, prefer-ably at least 100-fold, more preferably at least 200-fold, and still more preferably at least 500-fold, lower than the IC50 with respect to any or all of the other P13K Class I family members.
Among other things, the invention provides methods of inhibiting leukocyte function. More par-ticularly, the invention provides methods of inhib-iting or suppressing functions of neutrophils and T
and B lymphocytes. With respect to neutrophils, it has unexpectedly been found that inhibition of PI3K5 activity inhibits functions of neutrophils. For example, it has been observed that the compounds of the invention elicit inhibition of classical neutro-phil functions such as stimulated superoxide re-lease, stimulated exocytosis, and chemotactic migra-tion. However, it has been further observed that the method of'the invention permits suppression of certain functions of neutrophils, while not substan-tially affecting other functions of these cells.
For example, it has been observed that phagocytosis of..bacteria by neutrophils is not substantially inhibited by the selective PI3K5 inhibitor compounds of the invention.
Thus, the invention includes methods for inhibiting neutrophil functions, without substan-tially inhibiting phagocytosis of bacteria. Neutro-phil functions suitable for inhibition according to the method include any function that is mediated by PI3K5 activity or expression. Such functions in-clude, without limitation, stimulated superoxide release, stimulated exocytosis or degranulation, chemotactic migration, adhesion to vascular endo-thelium (e.g., tethering/rolling of neutrophils, triggering of neutrophil activity, and/or latching of neutrophils to endothelium), transmural diapede-sis or emigration through the endothelium to periph-eral tissues. in general, these functions can be collectively termed "inflammatory functions," as they are typically related to neutrophil response to inflammation. The inflammatory functions of neutro-phils can be distinguished from the bacterial kill-ing functions exhibited by these cells, e.g., phago-cytosis and killing of bacteria. Accordingly, the invention further includes methods of treating di-sease states in which one or more of the inflamma-tory functions of neutrophils are'abnorma.l or unde-sirable.
It has further been established through the invention that PI3K6 plays a role in the stim-ulated proliferation of lymphocytes, including B
cells and T cells. Moreover, PI3K6 appears to play a role in stimulated secretion of antibodies by B
cells. Selective PI3K5 inhibitor compounds of the invention have been employed to establish that these phenomena can be abrogated by inhibition of PI3K5.
Thus, the invention includes methods of inhibiting lymphocyte proliferation, and methods of.inhibiting antibody production by B lymphocytes. Other methods enabled by the invention include methods of treating disease states in'which one or more of these lympho-cyte functions are abnormal or undesirable.
It has now been determined that PI3K5 activity can be inhibited selectively or specifi-cally to facilitate treatment of a PI3K5-mediated disease while reducing or eliminating complications that are typically associated with concomitant inhi-bition of the activity of other Class I PI 3-kin-ases.. To illustrate this embodiment, methods of the invention can be practiced using members of a class of compounds that have been found to exhibit selec-tive inhibition of PI3K5 relative to other P13K
isoforms.

The methods of this embodiment can be practiced using compounds having the general struc-ture (III). Preferred methods employ compounds that have been empirically determined to exhibit at least 10-fold selective inhibition of PI3K6 relative to other P13K isoforms. For example, the methods can be practiced using the following compounds:
3-(2-isopropylphenyl)-5-met.h.yl-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one;
5-chloro-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
-5-chloro-3-(2-fluorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3- (2-fluorophenyl) -5-methyl.-2- (9H-purin-6--ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-methoxyphenyl)-5-methyl-2-(,9H-purin-y-ylsulfan ='ylmethyl-3H-quinazolin-4-one 3-(2,6-dichlorophenyl)-5-methyl-2-(9H-purin-6-yl--sulfanylmethyl)--3H-quinazolin-4-one;
3- (2-chlorophenyl) -6-fluoro-2-- (9h-purin--6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
5-chloro-3-(2=-chlorophenyl)-2=-(9H-purin-6-ylsulfan-.ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-methyl-2-(9H-purrin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(3-methoxyphenyl-2-(9H-purin-6-ylsulfanylmethyl-3H-quinazolin-4--one;
3.- (2-chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-benzyl-2- (9H-purin-6,-ylsulfanylr.lethyl) -3H-quin-azolin-4-one;
3-butyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quin=-azolin-4-one;

3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-yl sulfan-ylmethyl)-3H-quinazolin-4-one;
3-morpholin-4-yl-2-(9H-purin-6-ylsullfanylmethyl)-3H-quinazolin-4-one, acetate salt;
8-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin--4-one;
3-(2-chlorophenyl)-6,7-difluorc-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one;
3-(2-methoxyphenyl-2-(9H-purin-6-ylsulfanylmethyl.)--3H-quinazolin-4-one;
6-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3 - (3 -chlorophenyl) - 2 - (9H-purin- 6 -yl sul. f anylmethyl) -3H-quinazolin-4-one;
2-(9H-purin-6-ylsulfanylmethyl)-3-pyridin.-4-y1-3H-quinazolin--4-one;
3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)--trifluoromethyl-3H-quinazolin-4-one;
3-benzyl-5-fluoro-2-(9H=purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
3-(4-methylpiperazin-l-yl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one, acetate salt;
3-(2-chlorophenyl)-6-hydroxy-2-(9H-purin-6-ylsui~-fan-ylmethyl)-3H-quinazolin--4-one;
[5-fluoro-4-oxo-2-(9H-purin-6-ylsulfanylmethyl)-4H-quinazolin-3--yl]acetic acid ethyl ester;
3-(2,4--dimethoxyphenyl)-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
3-biphenyl-2-yl-5-chloro-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin--9-ylmethyl)--5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-'(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl--5-chloro-3H-quinazolin-4-one;
5-chloro-3-(2-methoxyphenyl)-2-(9H-purin-6-ylsul-fanyl methyl)-3H-quinazolin-4-one;.
2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin-4-one;.
2-(6-aminopurin-9-ylmethyl)--5-chloro-3-(2-fluoro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4--one;
2-(6-aminopurin-9-ylmethyl)-3-(2-c:ilorophenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5 fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-benzyl-5-fl.uoro.-3H-quinazolin-4-one;
2--(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H,-qu.inazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one;
3-(2-chlorophenyl)-2-(9H-purin-6-ylsulf.anylmethyl)-3H-quinazolin-4-one;
3-phenyl-2-(9H-=purin--6-ylsulfanylmethyl)-.3H-quin-azolin-4-one;
2-(6-aminopurin-9-ylmethyl)'-5-chloro-3-(2-isopropyl-phenyl)-3H-quinazolin-4-one; and 2-(6-aminopurin--9--ylmethyl)-5-chl,oro-3-o-tolyl-3H.-quinazolin-4-one.
It has further been determined" that the methods of the invention can be advantageously practiced using members of a class of compounds that exhibit PI3K6inhibitory activity, thereby facili-tating inhibitions of PI3K5 activity in diseases mediated thereby. For example, in this embodiment, the methods of the invention can be practiced using compounds having the general structure (I).

:x::
.Y
CI) wherein A is an optionally substituted monocyclic or bicyclic ring system containing at least two nitrogen atoms, and at least one ring of the system is aromatic;
X is selected from the group consisting of CHRb, CH2CHRb,- and CH=C (R.b) ;.
Y is selected from the group consisting of null, S, SO, S021 NH, 0, C'(=O) , OC (=O) , C (=0) 0, and NHC (=O) CH2S;
R1 and R2, independently, are selected from the group consisting of hydrogen, C1..Ealkyl, aryl, heteroaryl, halo, NHC (=0) C1.3alkyleneN (Ra) 2, NO2, ORa, OCF3, N(Ra)2, CN, OC(=.O)Ra, C(=O)Ra, C(=O)ORa, arylORb, Het, NRaC (=0) Cl-3alkyleneC (=0) ORa, arylOC1-3alkylene-N (R') 2, arylOC (=0) Ra, C1.4alkyler_eC (=0) 0Ra, OC7_4alkyl-eneC (=0) OR a, C1.4alkyleneOC1-4alkyleneC (=0) ORa, C (=0) -NRaSO2Ra, C1-,alkyleneN (Ra) 2, C2.6alkenyleneN (Ra) 2, C (=0) NRaC1.4al.kyleneORa, C (=0) NRaC1.4alkyleneHet, OC2.4alkyleneN (Ra) 2, OC1.4alkyleneCH (ORb) CH2N (Ra) 2, OC1_4alkyleneHet, OC2.4alkyleneORa, OC2.4alkylene-NRaC (=O) ORa, NRaC1.4alkyleneN (Ra) 2, NRaC (=0) Ra, NRaC (=0) N (Ra) 2, N (S02C1_4alkyl) 2, NR- (SO2C'1 -,alkyl) S02N (Ra) 2, OSO2CF3, C,_3alkyleriearyl, C1_.4alkyleneHet., C1.6alkyleneORb, C1-3alkyleneN (Ra) 2 i C (=O) N (Ra) 2, NHC (=0) C1-C3alkylenearyl, C3-8cycloalkyl, C3..8hetero-cycloalkyl, aryl0C1.3alkyleneN (Ra) 2, arylOC (=0) Rb, NHC (=0) C1.3alkyleneC3.6heterocycloalkyl, NHC (=0) C1.3-alkyleneHet, OC1.4alkyleneOC,._,alkyle'neC (=0) ORb, C(=0) C1-4alkyleneHet, and NHC (=0) haloC,_6alkyl;
or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatorl;
R3 is selected from the group consisting of optionally substituted hydrogen, C1.6alkyl, C3_8cyclo-alkyl , C3-8heterocycloalkyl , C1..4alkylenecycloalkyl , C2.6alkenyl, C1-3alkylenearyl, arylCl_3alkyl, C (=0) Ra, aryl, heteroaryl, C (=0) ORa, C (=0) N (Ra) 2, C (=S) N (Ra) 2, 502Ra, S02N (Ra) 2, S (=0) Ra, S (=O) N (Ra) 2, C (=O) NRaC1-4-alkyleneORa, C (=O)NRaC1.4alkyleneHet, C (=0) Cz_4alkyl-enearyl, C (=0) C1-4alkyleneheteroaryl, C1.4alkylenearyl optionally substituted with one or more of halo S02N (Ra) 2, N (Ra) 2, C (=0) ORa, NRaSO7CF3, CN, NOõ C (=0) Ra, Oka, C,__4alkyleneN (Ra) 2, and OC14alky_leneN (Ra) 2, C1.4alkyleneheteroaryl, C1.4alkyleneHet, C1.4alkylene-C (=0) C1.4alkylenearyl, C1_.4alkyleneC (=0) C1.4alkylene-heteroaryl , C1.4alkyl eneC (=0) Het , C1_4alkyleneC (=0) -.N (Ra) 21 C1.4alkyleneORa, Cl-4alkyleneNRaC (=O) Ra, 'C1_4alkyleneOC1.4alkyleneORa, C1_4alkyleneN (Ra) 2, C1_4alkyleneC (=O) ORa, 'and C1-4alkyleneOC1_4alkylene-C(=O)ORa;
Ra is selected from the group consisting of hydrogen, C1.6alkyl, C3_8cycloalkyl ; C3.8heterocyclo-alkyl, C,_3alkyleneN(Ra)2, aryl, ary1C1-3alkyl, C,_3alkylenearyl, heteroaryl, heteroarylC1._,alkyl, and C1_3alkyleneheter. oaryl ;
or two Ra groups are taken together to form a 5-- or 6-membered ring, optionally containing at least one heteroatom;
Rb is selected from the group consisting of hydrogen, C1-6alkyl, aryl, heteroaryl, ary1C1.3alkyl, heteroarylC1_3alkyl, C,_ 3alkylenearyl,. and1,.3alkyl eneheteroaryl;
Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C,-,alkyl or C (=O) ORa;
and pharmaceutically acceptable'salts and solvates (e.g., hydrates) thereof.
For, example, methods of the invention can employ compounds that possess P13K5 inhibitory activity, as follows:
3-(2-isopropylphenyl)-5-methyl-2-(9H-purin-6-.yl-sulfanylmethyl)-3H-quinazolin-4-one;
5-chloro-2-(9H-purin-6-ylsulfanylmethyl)-3-b-tolyl-3H-quinazolin-4-one;
5-chloro-3- (2-fluorophenyl) --2- (9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;

3-(2-f luorophenyl)-5-methyl-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3- (2-methoxyphenyl) --5-methyl-2- (9H-pur.in-6~-ylsu.lfan-ylmethyl)-3H-quinazolin-4-one;
3-(2,6-dichlorophenyl)-5-methyl-2-(9H-purin-6-ylsul-fanylmethyl) -3H-qui,.nazolin-4-one;
3-(2-chlorophenyl)-6-fluoro-2-(9h-purin-6,-ylsulfan-ylmethyl)-3h-quinazolin--4-one;
5-chloro-3.-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-methyl-2-(9H-purin-6-yisulfan ylmethyl)-3H-quinazolin-4-one;
3-(2-methoxyphenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
3- (2-chlorophenyl) -5--fluoro-2- (9H--purin-6-ylsulfan-ylmethyl) -3H-qu.irlazolin-4-one;
3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quin-azolin-4-one;
3-butyl-2- (9H--purin-6-ylsulfanylmethyl) -3H-quin--azolin-4-one;
3-(2-chlorophenyl)-7-fluoro-2-(9H-purin-6-ylsulfan-yl'methyl) -3H-quinazolin--4-one;
3-morpholin-4-yl-2-(9H-purin-6.-ylsulfanylmethyl)-3H-quinazolin.-4-one, acetate salt;
8-chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfa.n=-ylmethyl)-3H-quinazolin-4-on.e;
3- (2-chlorophenyl) -.6, 7--difluoro-2- (9H-purin-6-ylsul--fanylmethyl)-3H-quinazolin-4-one;
3-(3-methoxyphenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
6-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;

3-(3-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-=
3H-quinazolin-4-one;
2-(9H-purin-6-ylsulfanylmet'hyl)-3-pyridi.n-4-yl-3H-quinazolin-4-one;
3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-trifluoromethyl-3H-quinazolin-=4-one; .
3-benzyl-5-fluoro--2- (9H-purin--6-ylsulfanylmethyl) -3H-quinazolin-4-one;
3-(4-methylpiperazin-l-yl)-2--(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one, acetate salt;
3- (2-chlorophenyl) -6-hydroxy-2- (9H-purin-6--ylsulfan-ylmethyl)-3H-quinazolin-4-one;
[5-fluoro-4-oxo-2-(9H-purin-6-ylsulfanylrnethyl)-4H-quinazolin-3-yl]acetic acid ethyl ester;
'3--biphenyl-2-yl-5-chloro-2- 09H-purin-6-ylsulfanyl--methyl)-3H-quinazolin-4-one;
5-chloro-3- (2-methoxyphenyl) -2- (9H-purin--6-ylsu-lfan-ylmethyl)-3H-quinazolin-4-one;
2- (6-aminopurin-9--ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5.-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl-t-chloro-3H-quinazolin--4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin-4-one;
2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluoro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4=-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;
2- (6-aminopurin-9-ylmethyl) -3- (2-ch.lorophenyl) -5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3--benzyl-5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H-, quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one;`
3- (2-chlorophenyl) -2-- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;
3-phenyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-auin-azolin-4-one=
2-(6-aminopurin-9-ylmethyl)-5-chldro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
3- (4-chlorophenyl) -2.- (9H-purin-6-ylsulfanylmethyl) --3H-quinazolin-4-one;
3-(2-.chlorophenyl)-6,7-dimethoxy-2-(9H-purin-6-ylsulfanylmethyl)-3H--quinazolin-4-one;
3-(2-chlorophenyl)-7-nitro-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4--one;
2-(6-aminopurin-9-ylmethyl)-6-bromo-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-6,7-dimethoxy-3H-quinazolin-4-one;
6-bromo-3-(2-chlorophenyl)--2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-2-(9H-purin-.6-ylsulfanylmethyl)-3H-benzo[g]quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-chloro-3-o-tolyl-3H-quinazolin-4-one; and 2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2--methoxy-phenyl)-3H-quinazolin-4-one.
The invention further provides compounds that are selective inhibitors of PI3K6 activity.
The compounds exhibit inhibition of P13K5 in biochemical assays, and selectively disrupt function of PI3K6-expressing cells in cell-based assays. As described elsewhere herein, the compounds of the invention have been demonstrated to inhibit certain .functions in neutrophils and other leukocytes, as well as functions of osteoclasts.
In general, compounds provided by the invention have the general structure (I), a pharma-ceutically acceptable salt thereof, or a prodrug thereof:

O
R
1N~R3 ~

(I) wherein A is an optionally substituted monocyclic or bicyclic ring system containing at least two nitrogen atoms, and at least one ring of the system is aromatic;
X is selected from the group consisting of CHRb, CH2CHRb, and CH=C (Rb) ;

Y is selected from the group consisting of null, S, SO, SO2, NH1 0, C (=0) , OC (=0) , C (=0) 0, and NHC (=O) CH2S;
R1 and R2, independently, are selected from the group consisting of hydrogen, C1-6alkyl, aryl, heteroaryl, halo, NHC (=0) C1:3alkyleneN (Ra) NO2, ORB, OCF3, N (Ra) 2, CN, OC (=O) Ra, C (.=O) Ra, C (=0) ORa, arylORb, Het, NRaC (=O) C1.3alkyleneC (=0) ORa, arylOC1-3alkylene-. N (Ra) 2, arylOC (=O) Ra, C,.-4alkyleneC (=O) ORa, OC1.4alkyl-eneC (=O) ORa, C1-4alkyleneOC1.4alkyleneC (=0) ORa, C (=O) -= NRaSO2Ra, C1_4alk.yleneN (Ra) 2, C,_6alkenyleneN (Ra) õ
C (=O) NRaC1-4alkyleneORa, C (=0) NRaC1-4alkyleneHet, OC2-4alkyleneN (Ra) 2, OC1-4alkyleneCH (ORb) CH2N (Ra) 21 OC1_4alkyleneHet, OC2-4alkyleneORa, OC2-4alkylene-NRaC (=0) ORa, NRaC1.4alkyleneN (Ra) 2, NRaC (=0) Ra,.
NRaC(=O)N(Ra)2, N(SO2C1-4alkyl)2, NRa(S02C,.4al.kyl) , S02N (Ra) 21 OSO2CF3, C1.,3alkylenearyl, C1..4al.kyleneHet, C1-6alkyleneORb, C,_.3alkyleneN (Ra) 2, C (=O) N (Ra) 2, NHC(=O)C1-C3alkylenearyl, C3_8cycloalkyl, C,_8hetero-cycloalkyl, arylOC1.3alkyleneN (Ra) 2, arylOC (=0) Rb, NHC (=O) C1-3alkyleneC3-8heterocycloalkyl, NHC (=0) C1.-3-alkyleneHet, OC1-4alkyleneOC1-4alkyleneC (=0) ORb, C (=0) C1-4alkyleneHet, and NHC (=0) haloC1_6alkyl;
or R1 and R2 are taken together to form a 3- or 4-membered alkylene or aikenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;
R3 is selected from the group consisting of optionally substituted hydrogen, C,-,alkyl, C3-8cyclo-alkyl, C3-8heterocycloalkyl, C1.4alkylenecycloalkyl, C2-6alkenyl, C1-3alkylenearyl, arylC,-,alkyl, C (=0) Ra, aryl, heteroaryl, C (=0) ORa, C (=O) N (Ra) 2, C (=S) N (Ra) 2, S02Ra1 S02N (Ra) 21 S (=0) Ra, S (=0) N (Ra) 21 C (=0) NRaC1-4-al.kyleneOR2, C (=O) NRIC1_4alkyleneHet, C (=0) C,-4alkyl--enearyl, C (=0) C1.4alkyleneheteroaryl, C1.4alkylenearyl optionally substituted with one or more of halo S02N (Ra) 2, N (Ra) 2, C (==O) ORa, NRaSO2CF3, CN, NO2, C (=O) Ra, ORa, C1_4alkyleneN (Ra) 2, and OC1_.4alkyleneN (Ra) 2, C1-4-alkyleneheteroaryl, C1_4alkyleneHet, C1.4alkyleneC (=O) -C1.4alkylenearyl, C1-4alkyleneC (=0) C1_-4alkylen.ehetero-aryl, C1_4alkyleneC (=O) Het, C1_4alkyleneC (=O) N (Ra) 2, C1.4alkyleneORa, C1_4alkyleneNRaC (=O) Ra, C1.4alkyleneO-Cl.4alkyleneORa, C1.4alkyleneN (Ra) 2, C1.4alkyleneC (=O) -ORa, and C1-4alkyleneOC1_4alk-yl.eneC (=O) ORa;
Ra is selected from the 'group consisting of hydrogen, C1-6alkyl, C3._8cycl.oalkyl, C3_8het:erocyclo-alkyl , C1.3alkyleneN (Re) 2 , aryl., arylcl_3alkvl, C1_3alkylenearyl, heteroaryl, heteroarylC1_3alkyl,' and C, _3alkyleneheteroaryl ;
or two Ra groups are taken together to form a 5- or 6-membered ring, optionally containing at .least one heteroatom;.
Rb is selected from the group consisting of hydrogen, C1.6alkyl, aryl, heteroaryl, arylCl_3alkyl, heteroarylCl_,alkyl, C,_3alkylenearyl, and C-_,alkyl-eneheteroaryl;
Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally .substituted with C1_4alkyl or C (=0) ORa;
and pharmaceutically acceptable salts and solvates (e.g., hydrates) thereof..
As used herein, the term "alkyl" includes straight chained and branched hydrocarbon groups containing the indicated number of carbon atoms, typically methyl, ethyl, and straight chain and branched propyl and butyl groups. The hydrocarbon group can contain up to 16 carbon' atoms,-preferably one to eight carbon atoms. The term="alkyl"
includes "bridged alkyl," i.e., a C6-Ci6 bicyclic or polycyclic hydrocarbon group, for example, norborn-. yl, adamantyl, bicyclo [2 .2 . 2] octyl, bicyclo [2 . 2 .1]
heptyl, bicyclo [3 .2 . 1] octyl, or decahydz:onaphthyl.
The term "cycloalkyl" is defined as a cyclic C3--CII
'hydrocarbon group, e.g., cyclopropyl, cyclobutyl,.
cyclohexyl, and cyclopentyl.
The term "alkenyl" is defined identically as "alkyl," except for containinga carbon-carbon double bond. "Cycloalkenyl" is defined similarly to cycloalkyl, except a carbon--carbon double bond is present in the ring.
The term "alkylene" refers to an alkyl group having a substituent-. For example, the term "C,_-3alkylenearyl" refers to an alkyl. group contain-ing one to three carbon atoms, and substituted with -an aryl group.
The term "halo" or "halogen" is defined herein to include fluorine, bromine, chlorine, and iodine.
The term "haloalkyl" is defined herein as an alkyl group substituted with one or more halo substituents, either fluoro, chloro, bromo, iodo, or combinations thereof. Similarly, "halocycloalkyl"
is defined as a cycloalkyl group having one or more halo substituents.
The term "aryl," alone or in combination, is defined herein as a monocyclic or polycyclic aromatic group, preferably a monocyclic or bicyclic aromatic group, e.g., phenyl or naphthyl: Unless otherwise indicated, an "aryl" group can be unsub-stituted or substituted, for example, with one or more, and in particular one to three, halo, alkyl, phenyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalk-yl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl, and alkylsulfonyl. Exemplary aryl groups include phenyl, naphthyl, biphenyl, tetra-hydronaphthyl, chlorophenyl, fluorophenyl*, amino-'phenyl,' methylphenyl, methoxyphenyl, trifluoro-methylphenyl, nitrophenyl,'carboxyphen.yl, and the like. The terms "arylC1-3alkyl" and "heteroaryl-C1,3alkyl" are defined as an aryl or heteroaryl group having a C1_3alkyl substituent.
The term "heteroaryl" is defined herein as a monocyclic or bicyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring, and which can be'unsubstituted or substituted, for example, with one or more, and in particular one to three, substituents, like halo, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, .amino, alkylamino, acylamino, alkylthio, a_l.kylsul-finyl, and alkylsulfonyl. Examples of heteroaryl groups include thienyl, furyl, pyridyl, oxazolyl, quinolyl, isoquinolyl, indolyl, triazolyl, isothia-zolyl, isoxazolyl, imidizolyl, benzothiazolyl, pyra-zinyl, pyrimidiriyl, thiazolyl, and thiadiazolyl.
The term "Het" is defined as monocyclic, bicyclic, and tricyclic groups containing one or more heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur. A "Het" group also can contain an oxo group (=0);, attached to the ring.

Nonlimiting examples of Net groups include 1,3-dioxolane, 2-pyrazoline, pyrazolidine, pyrrolidine, piperazine, a pyrroline, 2H--pyran, 4H-pyran, morph-oline, thiopholine, piperidine, 1,.4--dithiane, and 1,4-dioxane.
The term "hydroxy" is defined as -OH.
The term "alkoxy!' is defined as .-OR, wherein R is alkyl.
The term "alkoxya.l.kyl" is defined as an alkyl group wherein~a hydrogen has been replaced,by an alkoxy group. The term "(alkylthio)alkyl" is defined similarly as alkoxyalkyl, except-a sulfur atom, rather than an oxygen atom, is present.
The term "h.ydroxyalkyl" is defined as a hydroxy group appended to an alkyl group.
The term "amino"-is defined as -NH2, and the term "alkylamino" is defined as -NR2, wherein at least one R is alkyl and the-second R is alkyl or hydrogen.
The term "acylamino" is defined as RC(=O)N, wherein R is alkyl or aryl.
The term "alkylthio" is defined as -SR, wherein R is alkyl.
The term "alkylsulfinyl" is defined as R-S02; wherein R is alkyl.
The term "amino" is defined as -NH2, and the term "alkylamino" is defined as -NR2,. wherein at least one R is alkyl and the second R is'alkyl or hydrogen.
The term "acylamino" is.defined as RC(=O)N, wherein R is alkyl or aryl.
The term "alkylthio" is defined as -SR, wherein R. is alkyl.

The term "alkylsulfinyl" is defined as R-S02, wherein R is alkyl.
The term "alkylsulfonyl". is defined as R-S03, wherein R is alkyl.
The term "nitro" is defined as -NO2.
The term "trifluoromethyl." is defined as - CF3 .
The term "trifluoromethoxy" is defined as -OCF3 .
The term "cyano" is defined as,-CN.
In preferred embodiments, X is selected from the group consisting of CH2, CH2CH2, CH=CH, CH (CH3) , CH2CH (CH3) , and C (CH3) 2. In-further pre-ferred embodiments, Y is selected from the group consisting of null, S, and NH.
The A ring can be monocyr.1_ic or bicyclic.
Monocyclic A ring systems are aromatic. Bicyclic A
ring systems contain at least one aromatic ring, but both rings can be aromatic. Examples of A ring systems include, but are not limited to, imidazolyl, pyrazolyl, 1,2,3-triazolyl, pyridizinyl, pyrimidin-.yl, pyrazinyl, 1,3,5-triazinyl, purinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, 1H-indazolyl, and benz-imidazolyl.
In a preferred group of compounds of formula (I), A is represented by an optionally substituted ring system selected from the group consisting of N
H
N
N N

N
N
H
N

O
N
N
,N ~" N CH3 and IV

N;,-N
The A ring system optionally can be sub-stituted with one to three, and preferably one to two, substituents selected from the group consisting of N (Ra) 2, halo, C1.3alkyl, S (C1_3alkyl) , ORa, and OH

Specific substituents include, but are not limited to, NH2, NH (CH3) , N (CH3) 2, NHCH2C6H5, NH (C2H5) , Cl, F, CH3, SCH3, OH, and OH

In another preferred group of compounds of formula (I), R' and R2, independently, are repre-sented by hydrogen, ORa, halo, C,-,alkyl, CF3, NO2, N (Ra) 2, NRaCl_3alkyleneN (Ra) 2, and OC1_3alkyleneORa.
Specific substituents include, but are not limited to, H, OCH3, Cl, Br, F, CH3, CF3, NO2, OH, N (CH3) 2, and O (CH2) 20CH2C6H5. R1 and R2 also can be taken together to form a ring, for example, a phenyl ring.
In a preferred embodiment, R3 is selected from the group consisting of optionally substituted C1.6alkyl, aryl, heteroaryl, C3_8cycloalkyl, C3.8hetero-cycloalkyl, C (=O) ORa, C1.4alkyleneHet, C1_4alkylene-cycloalkyl, C1.4alkylenearyl, C1.4alkyleneC (=0) C1-4-alkylenearyl, C1_4alkyleneC (=0) ORa, C1.4alkylene-C (=0) N (Ra) 2, C1.4alkyleneC (=0) Het, C1_4alkyleneN (Ra) 21 and Cl_4alkyleneNRaC (=O) Ra. Specific R3 groups include, but are not limited to -N~~N-CH3 -CH2--<

and The R3 group can be substituted with one to three substituents, for example, halo, OR,-', Cs_6a_kyl, aryl, heteroaryl, NO2, N (Ra) 2, NRaSO2CF3, NRaC (= O) R.`, C (=O) ORa, N (Ra) C1_4alkylene (Ra) SO2N (Ra) 2, CN, C (=O) Ra, C,1_4alkyleneN (Ra) 2, and OC1.4alkyleneN (Ra) 2 . Specific substituents for the R3 group include, but are not limited to, Cl, F, CH3, CH (CH3) 2, OCH3, C6Hs, NO2, NH21 NHC (=O) CH3 , CO2H , and N (CH3) CH2CH2N (CH3) 2 .
As used herein, the quinazoline ring structure, and numbering of the ring structure, is -- 47, -The purine ring structure, and numbering oi~ the ring structure, is 2 4' N) $

The compounds provided by the invention are exemplified as follows:
3-(2-isopropylphenyl)-5-methyl-2-(91l-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one;
5-chloro-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-'3H-quinazolin-4-one;
5-chloro-3- (2-fluorophenyl) -2- (9H-purin-6.-Iylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-fluorophenyl)-5-methyl-2-(9H-purin-6-yisulfan-.ylmethyl)-3H-quinazolin-4-one;
3-(2-methoxyphenyl)-5-methyl-2-(9H-purin-6=-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3--(2,6-dichlorophenyl)-5-methyl-2-(9H-purin--6-ylsul-fanylmethyl)-3H-quinazolin-4-one;

3- (2-chlorophenyl) -6-fluoro-2- (9h-purin-6--ylsulfan.-ylmethyl)-3h-quinazolin-4-one;
5-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-methyl-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3 - (2 -methoxyphenyl) -. 2 - (9H-purin- 6 -yl sul f anylmetliyl) -3H-quinazolin-4-one;
3-- (2-chlorophenyl) -5--fl.uoro-2- (9H-purin-6'=-ylsulfa].i-ylmethyl)-3H-quinazolin-4-one;
3-benzyl-2-(9H-purin-6-ylsu.lfanylmet.hyl)-3H-quin-azolin-4-one;
3-butyl-2-(9H-purin-6-yisulfanylmethyl)-3H-quin-azolin-4-one;
3- (2-chlorophenyl) --7-fluoro-2- (9H-puriin-6--ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-morpholin-4-yl-2-(9H-purin-6-ylsulfanylmethyl)-3H--quinazolin-4-one, acetate salt;

8-chloro-3-(2-chlorophenyl)--2-(9H-purin-6-ylsul.f.an-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-6,7-difluoro-2-(9H-purin-6-ylsul-fanylm.ethyl)-3H-quinazolin-4-one;
3 - (3 -methoxyphenyl) - 2 - (.9H-purin- 6 --ylsulfanylmethyl) -3H-quinazolin-4-one;
6-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-qu.inazolin-4-one;
3 - (3 -chlorophenyl) -2 - (9H-purin-. 6 -yl sul f anyl methy].) -3H.-quinazolin-4-one;
2-(9H-purin-6-ylsulfanylmethyl)-3-pyridin-4-yl-3H-quinazolin-4-one;
3-(2-chlorophenyl)-8-trifluoromethyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;

3-benzyl--5-fluoro-2- (9H-purin--6-ylsulfanylmethyi) -3H-quinazolin-4-one;
3-(4-methylpiperazin-l-yl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one, acetate salt;
3-(2-chlorophenyl)-6-hydroxy-2-(9H-purin"-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
[5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmet:hyl) -4H-quinazoiin-3-yl]acetic acid ethyl ester;
3- (2-methoxyphenyl) -2- (9H-purin-6=-y.lsulfanylmethyl) -3H-quinazolin-4-one;
3-biphenyl-2--y1-5-chloro-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
5-chloro-3- (2-methoxyphenyl.) -2- (9H"-purin-6-ylsulf.an-ylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)--3--(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one;
2-(.6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)--3-biphenyl-2-yl-5.-chloro-3H-quinazolin-4--one;
2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one;
2- (6-aminopurin-9-ylm.ethyl)'-5-chloro-3- (2-fluoro-phenyl)-3H--quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one=;
2-(6-aminopurin-9-ylmethyl)--5-chloro-3-(2-chloro-, phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3--(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-benzyl-5-fluoro-3H--quinazolin-4-one;
2- (6-aminopurin-9-ylmethyl).-3--butyl-3I;i-quinazolin-4-one;
2.-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H-quinazolin-4-one;
2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin- 4-o.ne;
2-.(6-aminopurin-9-ylm.ethyl) -6-chloro-3.- (2-ch.loro-phenyl)-3H-quinazolin-4-one;
3- (4-chlorophenyl) -2-(9H-purin-6-ylsulfanylmeth.yl) -3H-quinazolin-4-one;
3-(2-chlorophenyl)-6,7-dimethoxy-2-(9H-pur.in-6-ylsulfanylmethyl)-3H-quinazoline-4-one;
-3- (2-chlorophenyl) -7-nitro-2- (9H-pu.rin-6-ylsulfan ylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-6-bromo-3-(2-chlorophen yl.)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3--(2-chlorophenyl)-6,7-dimethoxy-3H-quinazolin-4-one;
6-bromo-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin--4-one;
3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-benzo[g]quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro--3-o--tolyl-3H-quinazolin-4-one; and 2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2'-methoxy-phenyl)-3H-quinazolin-4-one.
The preferred compounds provided by the invention have the structure (IV), exemplified as follows:

3- (2-isopropylphenyl) -5--methyl-2- (9H-purin.-6-ylsul--fanylmethyl)-3H-quinazolin-4-one;
5-chloro-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
5-chloro-3-(2-fluorophenyl)-2-(9H-puriri-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3- (2-fluorophenyl) -5-methyl-2- (9H-puri i7.-6--ylsulfan-ylm.ethyl)-3H-quinazolin-4-one;
3-(2,6-dichlorophenyl)-5-methyl-2-(9H-purin-6-ylsul fanylmethyl) -3H-quinazolin-r4-orie;
3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-yl.sulfan-ylmethyl)-3h-quinazolin-4-one;
5-chloro-3- (2-chlorophenyl) =-2--(9H-purin-6-ylsul.fan.-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-methyl-2-(9H-purin-6-ylsul.fan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-fluoro-2-(9H-purin-6--ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3 --benzyl - 2 - (9H=-purin- 6 -yl sul f anylrnethyl) -. 3H-quip-.
azolin-4-one;;
3-butyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quin-azolin-4-one;
-3'-(2-chlorophenyl)-7-fluoro-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-rnorpholin-4-yl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one, acetate gait;
8-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-6,7-difluoro-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-.4-one;
6-chloro-3- (2-chlorophenyl) -2- (9H-purrin-6-ylsulfan-ylmethyl)-3H-quinazolin--4-one;

.3 - (3 -chlorophenyl) - 2 - (9H-purin- 6 -vl sul f anylmethyl) -3H-quinazolin-4-one;
2- (9H-purin-6-ylsulfanylmethyl) -3--pyridin-4-yl-3H-quinazolin-4-one;
3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-trifluoromethyl-3H-quinazolin-4-one;
.3-benzyl-5-f_luoro-2-(9H-purin.--6-ylsul.fanylmethyl)-3H-quinazolin-4-one;
3- (4-methylpiperazin--l-yl) --2- (9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one, acetate salt;
3- (2-chlorophenyl) -6-hydroxy-2- (9H--purin-`6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
[5-fluoro-4-oxo-2-(9H-purin-'6-ylsulfanylmethyl)-4H-quinazolin-3-yl]acetic acid ethyl ester;
3-biphenyl-2-yl-5-chloro-2--(9H-purin-6-ylsulfanyl.-methyl)-3H-quinazolin-4-one;
2- (6-aminopurin-9-ylmethyl) -3- (2-isopropyiphenyl) -5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)=-5-methyl,3-o-tolyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin=-4-one;
2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-f.luoro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2--chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-benzjrl-5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H-' quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlcrophenyl)-7-fluoro-3H-quinazolin-4-one; and 2-(6-aminopurin-9-ylmethyl).-5-c.hloro-3-o--tolyl-3H-quinazoline-4-one.

The term "prodrug" as used herein refers to compounds that are rapidly transformed in vivo to a compound having structural formula (I) herein-above, for example, by hydrolysis. Prodrug design is discussed generally in Hardma et al. (Eds.), Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed., pp. 11-16 (1996). A thorough discussion is provided in Higuchi et al., Prodrugs as Novel Delivery Systems, Vol. 14, ASCD Symposium Series, and in Roche (ed.),'Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press (1987). Briefly, administration of a drug is followed by elimination from the body or some biotransformation whereby biological activity of the drug is reduced or eliminated.
Alternatively, a biotransformation'process can lead to a metabolic by-product, which is itself more active or equally active as compared to the drug initially administered. Increased understanding of these biotransformation processes permits the design of so-called "prodrugs," which, following a bio-.
transformation, become more physiologically active in their altered state. Prodrugs, therefore, en-compass pharmacologically inactive compounds that are converted to biologically active metabolites.
To illustrate, prodrugs can be converted .into a 'pharmacologically active form through hydrol-ysis of, for example, an ester or.amide linkage, thereby introducing or exposing a.functional group on the resultant product. The prodrugs can be de-signed to react with an endogenous compound to form a water-soluble conjugate that further enhances the pharmacological properties of the compound, for .example, increased circulatory half-life. Alter-natively, prodrugs can be designed to undergo covalent modification on a functional group with, for example, glucuronic acid, sulfate, gl_utathione, amino acids, or acetate. The resulting conjugate can be inactivated and excreted in the urine, or, rendered more potent than the parent compound. High molecular weight conjugates. also can be excreted into the bile, subjected to enzymatic cleavage, and released back into the circulation, thereby effec-tively increasing the biological half-life of the originally administered compound.

Methods for Identifying Negative Regulators of PI3K5 Activity The PI3K6 protein, as well as fragments thereof possessing biological activity, can be used for screening putative negative regulator compounds in any of a variety of drug screening techniques. A
negative regulator of PI3K6, is a compound that diminishes or abolishes the ability of PI3K5 to carry out any of its biological functions. An example of such compounds is an agent that decreases the ability of a PI3K5 polypeptide to phosphorylate phosphatidylinositol or to target appropriate struc-tures within a cell. The selectivity of a compound that negatively regulates PI3K5 activity.can be evaluated by comparing its activity on the PI3K6 to its activity on other proteins. Selective negative regulators include, for example, antibodies and other proteins or peptides that specifically bind to a PI3K6 polypeptide, oligonucleotides that specifi-cally bind to PI3K6 polypeptides, and other nonpep-tide compounds (e.g., isolated or synthetic organic molecules) that specifically interact with PI3K6 polypeptides. Negative regulators also include com-pounds as described above, but which interact with a specific binding partner of PI3K5 pol.ypeptides.
Presently preferred targets for the devel-opment of selective negative regulators of PI3K5 include, for example:
(1) cytoplasmic regions of PI3K5 polypep-tides that contact other proteins and/or localize PI3K5 within a cell;

(2) regions of PI3Kb polypeptides that bind specific binding partners;
(3) regions of the PI3K5 polypeptides that bind substrate;
(4) 0allosteric regulatory sites of the PI3K5 polypeptides that can or cannot interact directly with the active site upon regulatory signal;
(5) regions of the PI3K6 polypeptides that mediate multimerization.
For example, one target for development of modu-lators is the identified regulatory interaction of p85 with p1105, which can be involved in activation, and/or subcellular localization of,the p1105 moiety.
Still other selective modulators include those that recognize specific regulatory or PI31(6--encoding nucleotide sequences. Modulators of PI3K6 activity can be therapeutically useful in treatment of a wide range of diseases and physiological conditions in.
which aberrant PI3K6 activity is involved.
Accordingly, the invention provides methods of characterizing the potency of a test compound as an inhibitor of PI3K5 polypeptide, said method comprising the steps of (a) measuring activity of a P13K5 polypept.ide in the presence of a test compound; (b) comparing the activity of the PI3K6 polypeptide in the presence ' o.f the ' test com-pound to the activity of the PI3K6 polypeptide in the presence of an equivalent amount of a reference compound (e.g., a PI3K6 inhibitor compound of the invention as described herein), wherein a lower activity of the PI3K5 polypeptide in the presence of the test compound than in the presence of the refer-ence indicates that the test compound is.a more potent inhibitor than the reference compound, and a higher activity of the PI3K5 polypeptide in the presence of the test compound than in the presence of the reference indicates that the test.. compound is a less potent inhibitor than the reference compound.
The invention further provides methods of characterizing the potency of a test compound as an.
inhibitor of P13K5 polypeptide, comprising the steps of (a) determining an amount of a control com-pound (e.g., a. PI3Kd inhibitor compound of the in-vention as described herein): that inhibits an activ-ity of a PI3K6 polypeptide by a reference percentage of inhibition, thereby defining a reference inhibi-tory amount for the control compound; (b). determin-ing an amount of a test compound that inhibits an activity of a PI3K6 polypeptide by a reference per-centage of inhibition, thereby defining a reference inhibitory amount for the test compound; (c) compar-ing the reference inhibitory amount for the test compound to the reference inhibitory amount for the control compound, wherein a lower reference inhibi-tory amount for the test compound than for the con-trol compound indicates that the.test compound is a more potent inhibitor than the control compound, and a higher reference inhibitory amount'.for the test.
compound than for the control compound, indicates that the test compound is a less potent inhibitor than the control compound. In one aspect, the method uses a reference inhibitory amount which is the amount of the compound than inhibits the activity of the PI3Kd polypeptide by 50%, 60%, 70%, or 80%. In another aspect the method employs a reference inhibitory amount-that is the amount of the compound that inhibits-the activity of the PI3Kb polypeptide by 90%, 95%, or 99%. These methods com-prise determining the reference inhibitory amount of the compounds in an in vitro biochemical assay, in an in ' vi tro cell-based assay, or in an in vivo assay.
The invention further provides methods of identifying a negative regulator of P13K6 activity, comprising the steps. of (i) measuring activity of a P13K5 polypeptide in the presence and absence of a test compound, and (ii) identifying as a negative regulator a test compound that decreases PI3K5 activity and that competes with a compound of the invention for binding to PI3K6. Furthermore, the .invention provides methods for identifying compounds that inhibit PI3K5 activity, comprising the steps of (i) contacting a PI3K5 polypeptide with a compound of the invention in-the presence and absence of a test compound, and (ii) identi.fying a test compound as a negative regulator of PI3K5 activity wherein the compound competes with a compound of the inven-tion for binding to PI3K5. The invention therefore provides a method for screening for candidate nega-tive regulators of PI3K6 activity and/or to confirm the mode of action of candidate such negative reg-ulators. Such methods can be employed against other P13K isoforms in parallel to establish comparative activity of the test compound across the isoforms and/or relative to a compound of the invention.
In these methods, the PI3K5 polypeptide can be a fragment of p1105 that exhibits kinase activity, i.e., a fragment comprising the catalytic site of p1105. Alternatively, the PI3K5 polypeptide can be a fragment from the p1105-binding domain of p85 and provides a method to identify allosteric modulators of PI3K5. The methods can be.employed in cells expressing cells expressing PI3K6 or its sub-units, either endogenously or exogenously. Accord-ingly, the polypeptide employed in such methods can be free in solution, affixed to a solid support,, .modified to be displayed on a cell surface, or located intracellularly. The modulation of activity or the formation of binding complexes,between the PI3K6 polypeptide_. and the agent being tested then can be measured.
Human P13K polypeptides are amenable to biochemical or cell-based high throughput screening (HTS) assays according to methods known and prac-ticed in the art, including melanophore assay sys-tems to investigate receptor-ligand interactions, yeast-based assay systems, and mammalian cell ex-pression systems. For a review, see,Jayawickreme and Kost, Curr Opin Biotechnol, 8:629-34.(1997).
Automated and miniaturized HTS assays also are comprehended as described, for example, in Houston and Banks, Curr Opin Biotechnol, 8:734-40 (1997).
Such HTS assays are used to screen ..libraries of compounds to identify particular com-=
.pounds that exhibit a desired property. Any library of compounds can be used, including chemical librar-ies, natural product libraries, and combinatorial libraries comprising random or designed oligopep-tides, oligonucleotides, or other organic compounds.
Chemical libraries can contain known com-pounds, proprietary structural analogs of known compounds, or compounds that are identified from natural product screening.
Natural product libraries are collections of materials isolated from naturals sources, typi-cally, microorganisms, animals, plants, or marine organisms. Natural products are isolated from their sources by fermentation of microorganisms.followed by isolation and extraction of the, fermentation broths or by direct extraction from the microorgan-isms or tissues (plants or animal) themselves. Nat-ural product libraries include polyketides, nonribo-somal peptides, and variants (including nonnaturally occurring variants) thereof. For a review, see Cane et al., Science, 282:63-68 (1998).
Combinatorial libraries are composed of large numbers of related compounds, such as pep-tides, oligonucl.eotides, or, other;organic. compounds ,as a mixture. Such compounds are relatively straightforward to design and prepare by traditional automated synthesis protocols, PCR, cloning.. or pro-prietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial li-braries.
Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombi,natorial, and polypep-tide libraries. For a review of combinatorial chemistry and libraries created thereby, see Myers, Curr Opin Biotec.hnol, 8:701-07 (1997)..
Once compounds have been identified that show activity as negative regulators of PI3K5 function, a program of optimization can be under-taken in an effort to improve the potency and or selectivity of the activity. This analysis of structure-activity relationships (SAR) typically involves of iterative series of selective modifi-cations of compound structures and their correlation to biochemical or biological activity. Families of related compounds can be designed that all exhibit the desired activity, with certain members of the family, namely those possessing suitable-pharma-cological profiles, potentially qualifying as thera-peutic candidates.

Therapeutic Uses of Inhibitors of PI3K6 Activity The invention provides a method for sel.ec-_ tively or specifically inhibiting PI3K6 activity therapeutically or prophylactically. The method comprises administering a selective or specific inhibitor of PI3K6 activity in. an.amount effective therefor. This method can be employed in treating humans or animals who are or can be subject to any condition whose symptoms or. pathology is mediated by PI3K5 expression or activity.
"Treating" as used herein refers to pre-venting a disorder from occurring in an animal that can be predisposed to the disorder, but has not yet been diagnosed as having it; inhibiting the dis-order, i.e., arresting its development; relieving the disorder, i.e., causing its regression; or ameliorating the disorder, i.e.,' reducing the severity of symptoms associated with the disorder.
"Disorder" is intended to encompass medical dis-orders, diseases, conditions, syndromes, and the like, without limitation.
The methods of the invention embrace various modes of treating an animal subject, prefer-ably a mammal, more preferably a primate, and still more preferably a human. Among the mammalian animals that can be treated are, for example, com-panion animals (pets), including dogs and cats; farm animals, including cattle, horses, sheep., pigs, and goats; laboratory animals, including rats, mice, rabbits, guinea pigs, and nonhuman primates, and zoo specimens. Nonmammalian animals include, for example, birds, fish,'reptiles, and amphibians.
In one aspect, the method of the invention can be employed to treat subjects" therapeutically of prophylactically who have or can be subject to an inflammatory disorder. One aspect of the present invention derives from the involvement of PI3K5 in mediating aspects of the inflammatory process.
Without intending to be bound. by any theory, it is theorized that, because inflammation involves processes are typically mediated by leukocyte (e.g., neutrophil, lymphocyte, etc.) activation and chemo-tactic transmigration, and because PI3K5 can mediate such phenomena, antagonists of PI3K6 can be used. to suppress injury associated with inflammation.
"Inflammatory disorder" as used herein can refer to any disease, disorder, or syndrome in which an excessive or unregulated inflammatory response leads to excessive inflammatory symptoms, host tissue damage, or loss of tissue function. "Inflam-matory disorder" also refers to a pathological state mediated by influx of leukocytes and/or neutrophil chemotaxis.
"Inflammation" as used herein refers to a localized, protective response elicited by injury or destruction of tissues, which serves to destroy, dilute, or wall off (sequester) both the. injurious agent and the injured tissue., Inflammation is notably associated with influx of.leukocytes and/or neutrophil chemotaxis. Inflammation can result from infection with pathogenic organisms and viruses and from noninfectious means such as trauma or reper fusion following myocardial infarction or stroke immune response to foreign antigen,-and autoimmune responses. Accordingly, inflammatory disorders amenable to the invention encompass disorders associated with reactions of the specific defense system as well as with reactions of the nonspecific defense system.
As used herein, the term "specific defense system" refers to the component of the immune system that reacts to the presence of specific antigens.
Examples of inflammation resulting from a response of the specific defense system include the classical response to foreign antigens, autoimmune diseases, and delayed type hypersensitivity response mediated by T-cells. Chronic inflammatory diseases, the rejection of solid transplanted tissue and organs, e.g., kidney and bone marrow transplants, and graft versus host disease (GVHD), are further examples of inflammatory reactions of the specific defense system.
The term "nonspecific defense system" as used herein refers to inflammatory disorders that are mediated by leukocytes that are incapable of immunological memory (e.g., granulocytes, and.
macrophages). Examples of inflammation that result, .at least in part, from a reaction of the'nonspecific defense system include inflammation associated with conditions such as adult (acute) respiratory dis-tress syndrome (ARDS) or multiple organ injury .syndromes; reperfusion injury; acute gloraeruloneph-ritis; reactive arthritis; dermatoses with acute inflammatory components; acute purulent meningitis or other central nervous system inflammatory dis-orders such as stroke; thermal injury; inflammatory bowel disease; granulocyte transfusion associated syndromes; and cytokine-induced toxicity.
"Autoimmune disease" as used herein refers to any group of disorders in which tissue injury is associated with humoral or cell-mediated. responses to the body's own constituents. "Allergic disease"
as used herein refers to any symptoms, tissue damage, or loss of tissue function resulting from allergy. "Arthritic disease" as used herein refers to any disease'that is characterized by inflammatory lesions of the joints attributable to a -variety of etiologies. "Dermatitis" as used. herein refers to any of a large family of diseases of the skin that are characterized by inflammation of the skin attributable to a variety of etiologies. "Trans-plant rejection" as used herein refers to any immune reaction directed against grafted tissue, such as organs or cells (e.g., bone marrow), characterized by a loss of function of the grafted and surrounding tissues, pain, swelling, leukocytosis, and thrombo-cytopenia.

The therapeutic methods of the present invention include methods for the treatment of dis-orders associated with inflammatory cell activation.
"Inflammatory cell activation" refers to the induc-tion by a stimulus (including, but not limited to, cytokines, antigens or auto-antibodies) of a pro-liferative cellular response, the production of, soluble mediators (including but not limited to cytokines, oxygen radicals, enzymes, pzostanoids, or vasoactive amines), or cell surface expression of .new or increased numbers of mediators (including, but not limited to, major histocompatability anti-gens or cell adhesion molecules) in inflammatory cells (including but not limited to monocytes, macrophages, T lymphocytes, B lymphocytes, granulo-cytes (i.e., polymorphonuclear le'ukocSrtes such as neutrophils, basophils, and eosinophils), mast cells, dendritic cells, Langerhans cells, and end(D--thelial cells). It~will be appreciated by persons, skilled in the art that the activation of one or a combination of these phenotypes in these cells can contribute to the initiation, perpetuation, or exacerbation of an inflammatory disorder.
The compounds of the invention have been found to inhibit superoxide release by neutrophils.
Superoxide is released by neutrophils in response to any of a variety of stimuli, including signals of infection, as a mechanism of cell killing. For example, superoxide release is known to be induced by tumor necrosis fa.otor alpha (TNFa), which is released by macrophages, mast cells, and lymphocytes 'upon contact with bacterial cell wall components such as lipopolysaccharide (LPS). TNFa is an extra-ordinarily potent and promiscuous activator of in-'flammatory processes, being involved in activation of neutrophils and various-other cell types, induc-tion of leukocyte/endothelial cell adhesion, pyrexia, enhanced MHC class I production., and stim-ulation of angiogenesis. Alternatively, superoxide release can be stimulated by formyl-Met-Leu-Phe (fMLP) or other peptides blocked at the N-terminus by formylated methionine. Such peptides are not normally found in eukaryotes, but'are fundamentally characteristic of bacteria, and signal the presence of bacteria to the immune.system. Leukocytes expressing the fMLP receptor, e.g:, neutrophils and macrophages, are stimulated to migrate up gradients of these peptides (i.*e., chemotaxis) toward loci of infection. As demonstrated herein, the compounds of the invention inhibit stimulated. superoxide release by neutrophilsin response to either TNFU or fMLP.
Other functions of neutrophils, including stimulated.
exocytosis and directed chemotactic migration, also have been shown to be inhibited by the P13K6 inhibi-tors of the invention. Accordingly, the compounds of the invention can be expected to be useful in treating disorders, such as inflammatory disorders, that are mediated by any or all of these neutrophil functions.
The present invention enables methods of treating such diseases as arthritic diseases, such as rheumatoid arthritis, monoarticular arthritis, osteoarthritis, gouty arthritis, spondylit.is; Behcet .disease; sepsis, septic shock, endotoxic shock, gram negative sepsis, gram positive sepsis-, and toxic shock syndrome; multiple organ injury syndrome secondary to septicemia, trauma, or hemorrhage;
ophthalmic disorders such as allergic conjunctiv-itis, vernal conjunctivitis, uveitis, and thyroid-associated ophthalmopathy; ecsinophilic granuloma;
pulmonary or respiratory disorders such as asthma, chronic bronchitis,.. allergic rhinitis, ARDS, chronic pulmonary inflammatory disease (e.g., chronic ob-structive pulmonary disease), silicosis, pulmonary sarcoidosis, pleurisy, alveolitis, vasculitis, emphysema, pneumonia, bronchiectasis, and pulmonary oxygen toxicity; reperfusior_ injury of the myocardi-um, brain, or extremities; fibrosis such as cystic fibrosis; keloid formation or scar tissue formation;
atherosclerosis; autoimmun.e diseases, such as sys-temic lupus erythematosus (SLE), autoimmune thyroid-itis, multiple sclerosis, some forms of diabetes, and Reynaud's syndrome; and transplant rejection disorders such as GVHD and allograft rejection;
chronic glomerulonephritis; inflammatory bowel diseases such as chronic inflammatory bowel disease (CIBD), Crohn'-s disease, ulcerative colitis, and necrotizing enterocolitis; :inflammatory dermatoses such as contact dermatitis, atopic dermatitis, psoriasis, or urticaria; fever and myalgias due to infection; central or peripheral nervous system inflammatory disorders such as meningitis, enceph--alitis, and brain or spinal cord injury due to minor trauma; Sjogren's syndrome; diseases involving.
leukocyte diapedesis; alcoholic hepatitis; bacterial pneumonia; antigen-antibody complex mediated di-seases; hypovolemic shock; Type I diabetes mellitus;
acute and delayed hypersensitivity; disease states due to leukocyte dyscrasia and metastasis; thermal injury; granulocyte transfusion-associated syn-dromes; and cytokine-induced toxicity.
The method can have utility in treating subjects who are or can be subject to reperfusion injury, i.e., injury resulting from situations in which a tissue or organ experiences a period of ischemia followed by reperfusion.. The term "is-chemia" refers to localized tissue anemia due to obstruction of the inflow of arterial blood.. Tran-sient ischemia followed by reperfusion character-istically results in neutrophil activation and transmigration through the endothelium of the blood vessels in the affected area. Accumulation of acti-vated neutrophils in turn results in generation of reactive oxygen metabolites, which damage components of the involved tissue or organ. This phenomenon of "reperfusion injury" is commonly associated with conditions such as vascular stroke (including global and focal ischemia), hemorrhagic shock, myocardial ischemia or infarction, organ transplantation, and cerebral vasospasm. To illustrate, reperfusion injury occurs at the termination of cardiac bypass procedures or during cardiac arrest when the heart, once prevented from receiving blood, begins to reperfuse. It is expected that inhibition of PI3K5 activity will result in reduced amounts of reper-fusion injury in such situations.
With respect to.the nervous system, global ischemia occurs when blood.-flow to the entire brain ceases for a period. Global ischemia can result from cardiac arrest. Focal ischemia occurs when a portion of the brain is deprived of its normal blood supply. Focal ischemia can result from thromboembo-lytic occlusion of a cerebral vessel, traumatic head injury, edema, or brain tumor. Even if transient, both global and focal ischemia can cause widespread neuronal damage. Although nerve tissue damage occurs over hours or even days following the onset of ischemia, some permanent nerve,tissue.damage can develop in the initial minutes following the cessa-tion of blood flow to the brain.
Ischemia also can occur in the heart in myocardial infarction and other cardiovascular disorders in which the coronary arteries have been obstructed as a result of atherosclerosis, thrombus, or spasm. Accordingly, the invention is.-believed to be useful for treating cardiac tissue damage, par-ticularly damage resulting from cardiac ischemia or caused by reperfusion injury in mammals.
In another aspect, selective inhibitors of PI3K5 activity, such as the compounds of-the inven-tion, can be employed in methods of treating di-seases of bone, especially-.diseases in which osteo-clast function is abnormal or undesirable. As shown in Example 6', below, compounds of the invention inhibit osteoclast function in vitro. Accordingly, the use of such compounds and other PI3Kb selective inhibitors can be of value in treating osteoporosis, Paget's disease, and related bone resorption dis-orders.
In a further aspect, the invention in-cludes methods of using PI3K6 inhibitory compounds to inhibit the growth or proliferation of cancer cells of hematopoietic origin, preferably cancer cells of lymphoid origin, and more preferably cancer cells related to or derived from B lymphocytes or B

lymphocyte progenitors. Cancers 'amenable to treat-ment using the method of the invention include, without limitation, lymphomas, e.g., malignant neo-plasms of lymphoid and reticuloendothelial tissues, such as Burkitt's lymphoma, Hodgkins' lymphoma, non-Hodgkins lymphomas lymphocytic lymphomas and the like; multiple myelomas; as well as leukemias such as lymphocytic leukemias, chronic myeloid (myelo-genous) leukemias, and the like. In a preferred embodiment, PI3K5 inhibitory compounds can be used to inhibit or control the growth or proliferation of chronic myeloid (myelogenous) leukemia cells.
In,another aspect, the invention includes a method for suppressing a function of basophils and/or mast cells, and thereby. enabling treatment of diseases or disorders characterized by excessive or undesirable basophil and/or mast cell activity.
According to the method, a compound of the invention can be used that selectively inhibits the expression or activity of phosphatidylinositol 3-kin.ase delta (PI3K5) in the basophils and/or mast cells. Prefer-ably, the method employs a PI3K5 inhibitor in an amount sufficient to inhibit stimulated histamine release by the basophils and/or mast cells. Accord-ingly, the use.of such compounds and other PI3K6 selective inhibitors,. can be of value in treating diseases characterized by histamine release, i.e., allergic disorders, including disorders such as chronic obstructive pulmonary disease (COPD), asthma, ARDS, emphysema, and related disorders.

Pharmaceutical Compositions of Inhibitors of PI3K5 Activity A compound of the present invention can. be administered as the neat chemical, but it is typi-cally preferable to administer the compound in the .form of a pharmaceutical composition or formulation.
Accordingly, the present invention also provides pharmaceutical compositions that comprise a chemical .or biological compound ("agent") that is. active as a modulator of P13K6 activity and a,biocompatible pharmaceutical carrier, adjuvant, or vehicle. The composition can include the agent as the.only active moiety or in combination with other agents, such as oligo- or polynucleotides, oligo- or polypeptides, drugs, or hormones mixed with excipient(s) or other pharmaceutically acceptable carriers. Carriers and other ingredients can be deemed. pharmaceutically acceptable insofar as they are compatible with other ingredients of the formulation and not deleterious to the recipient thereof.
Techniques for formulation and administra-tion of pharmaceutical compositions can be found in Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co, Easton, PA, 1990. The pharmaceutical compositions of the present invention can be manu-factured using any conventional method, e.g., mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, melt-spinning, spray-drying, or lyophilizing proces-ses. However, the optimal pharmaceutical formula-tion will be determined by one of skill in the art depending on the route of administration and the desired dosage. Such formulations can influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the administered agent. Depending on the condition being treated, these pharmaceutical compositions can be formulated and administered systemically or locally.
The pharmaceutical compositions are forn1u-lated to contain suitable pharmaceutically accept-able carriers, and can optionally comprise excipi-ents and auxiliaries that facilitate processing of the active compounds into preparations that can be used pharmaceutically. The administration: modality will generally determine the nature of the carrier.
For example, formulations for parenteral administra-tion can comprise aqueous solutions of the active compounds in water-soluble form. Carriers suitable for parenteral administration can be selected from among saline, buffered saline, dextrose, water, and other physiologically compatible solutions. Pre-ferred, carriers for parenteral administration are physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline. For tissue or cellular adminis-tration, penetrants appropriate to the particular barrier to be permeated are used in the formulation.
Such penetrants are generally known in the art. For preparations comprising proteins, the formulation can include stabilizing materials, such as polyols (e.g., sucrose) and/or surfactants (e.g., nonionic surfactants), and the like.
Alternatively, formulations for parenteral use can comprise dispersions or suspensions of the active compounds prepared as appropriate oily injec-tion suspensions. Suitable ]._poph_i.lic solvents or vehicles include fatty oils, such as sesame oil, and synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxy-methylcellulose, sorbitol, or dextran. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the com-pounds to allow for the preparation of highly con-centrated solutions. Aqueous polymers that provide pH-sensitive solubilization and/or sustained release of the active agent also can be used as coatings or matrix structures, e.g., methacrylic polymers, such as the EUDRAGIT series available from Rohm America Inc. (Piscataway, NJ). Emulsions, e.g., oil-in-water and water-in-oil dispersions, also can be used, optionally stabilized by an emulsifying agent or dispersant (surface active materials; surfac-tants). Suspensions. can contain suspending agents such as ethoxylated isostearyl alcohols, polyoxy-ethlyene sorbitol and sorbitan esters, micro-crystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, gum tragacanth, and mixtures thereof.
Liposomes containing the active agent also can be employed for parenteral administration.
Liposomes generally are derived from phospholipids or other lipid substances.. The compositions in liposome form also can contain other ingredients, such as stabilizers, preservatives., excipients, and the like. Preferred lipids include phospholipids and phosphatidyl cholines (lecithins), both natural and synthetic. Methods of forming liposomes are known in the art. See, e.g., Prescott (Ed.), Methods in Cell Biology, Vol. XIV, p. 33, Academic Press, New York (1976).
The pharmaceutical compositions comprising the agent in dosages suitable for oral administra-tion can be formulated using pharmaceutically acceptable carriers well. known in the art. The preparations formulated for oral administration can be in the form of tablets, pills, capsules, cachets, dragees, lozenges, liquids, gels, syrups; slurries, elixirs, suspensions, or powders.-, To illustrate, pharmaceutical preparations for oral use can be obtained by combining the active compounds with a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries-if desired, to obtain tablets or dragee cores. oral formulations can employ liquid carriers similar in type to those described for parenteral use, e.g., buffered aqueous solutions, suspensions, and the like.
Preferred oral formulations include tablets, dragees, and gelatin capsules. These prep-arations can contain one or excipients, which in-.-clude, without limitation:
a) diluents, such as sugars, including lactose, dextrose, sucrose, mannitol, or sorbitol.;
b) binders, such as magnesium aluminum silicate, starch from corn, wheat, rice, potato, etc.;
c) cellulose materials, such as methyl-cellulose, hydroxypropylmethyl cellulose., and sodium carboxymethylcellulose, polyvinylpyrrolidone, gums, such as gum arabic and gum tragacanth, and proteins, such as gelatin and collagen;
d) disintegrating or sblubilizing agents such as cross-linked polyvinyl pyrrolidone, starches, agar, alginic acid or a salt thereof, such as sodium alginate, or effervescent compositions;
e) lubricants, such as silica, talc, stearic acid or its magnesium or calcium salt, and polyethylene glycol;
f) flavorants and sweeteners;
g), colorants or pigments, e.g., to identify the product or to characterize the quantity (dosage) of active compound; and h) other ingredients, such as preserva-tives, stabilizers, swelling agents, emulsifying agents, solution promoters, salts for regulating osmotic pressure, and buffers.
Gelatin capsules include push-fit capsules made of gelatin, as well as soft, sea.led~capsules made of gelatin and a coating such; as glycerol or sorbitol. Push-fit capsules can contain the active ingredient(s) mixed with fillers, binders, lubri-cants, and/or stabilizers,. etc. In soft. capsules, the active compounds can be dissolved or suspended in suitable fluids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers..
Dragee cores can be provided with suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinyl pyrrol-idone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.

The pharmaceutical composition can be provided as a salt of the active agent.. Salts tend to be more soluble in aqueous or other protonic solvents than the corresponding free acid or base forms. Pharmaceutically acceptable salts are well known in the art. Compounds that-contain acidic moieties can form pharmaceutically acceptable salts with suitable cations. Suitable pharmaceutically acceptable cations include, for example, alkali metal (e.g., sodium or potassium) and alkaline earth (e.g., calcium or magnesium) cations.
Compounds of structural formula (I) that contain basic moieties can form pharmaceutically acceptable acid addition salts with suitable acids.
For example, Berge et a.l. describe pharmaceutically acceptable salts in detail in J Pharm Sci, 66:1 (2.977). The salts can be prepared in situ during the final isolation and purification of the com-pounds of the invention or separately by reacting a free base function with a suitable acid.
Representative acid addition salts in-clude, but are not limited to, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesul-fonate, bisulfate, butyrate, camphorate, camphorol-sulfonate, digluconate, glycerophosphate, hemisul-fate, heptanoate, hexanoate, fumarate, hydrochlor-ide, hydrobromide, hydroiodide, 2-hydroxyethane--sulfonate (isothionate), lactate, maleate, methane-sulfonate or sulfate, nicotinate, 2-naphthalene-sulfonate, oxalate, pamoate, pectinate, perstlfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate or hydrogen phosphate, glutamate, bicarbonate, p-toluenesulfonate, and undecanoate. Examples of..
acids that can be employed to form pharmaceutically acceptable acid addition salts include, without limitation, such inorganic acids as hydrochloric acid, hydrobromic acid, sulfuric acid, and phos-phoric acid, and such organic acids as oxalic acid, maleic acid, succinic acid,, and citric acid.
In light of the foregoing, any reference to compounds of the present invention appearing .
herein is intended to include compounds of struc-tural formula (I)-(V), as well as pharmaceutically acceptable salts and solvates, as well as prodrugs, thereof.
Basic addition salts can be prepared in situ during the final isolation and purification of the compounds of the invention or separately by reacting a carboxylic acid-containing moiety with a suitable base such as the hydroxide, carbonate, or.
.bicarbonate of a pharmaceutically acceptable metal cation, or with ammonia or organic primary, second-ary, or tertiary amine. Pharmaceutically acceptable basic addition salts include, but are not limited to, cations based on-alkali metals or alkaline earth metals such as lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like, and nontoxic quaternary ammonium and amine cations including ammonium, tetramethylammonium, tetraethyl-ammonium, methylammonium, dimethylammonium, tri--methylammonium, ethylammonium, diethylammonium, triethylammonium, and the _li.ke. Other representa-tive organic amines useful for the formation of base addition salts include ethylenediamine, ethanol-amine, diethanolamine, piperidine, piperazine, and the like.
Basic nitrogen-containing groups can be quaternized with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dialkyl sulfates like di-methyl, diethyl, dibutyl,.and diamyl sulfates; long chain alkyl halides such as decyl; lauryl, myristyl, and stearyl chlorides, bromides, and iodides; aryl--alkyl halides such as benzyl and phenethyl bromides;
and others. Products having modified solubility or dispersibility are thereby obtained.
Compositions comprising a compound of the invention formulated in a pharmaceutical acceptable carrier can be prepared, placed in an appropriate container, and labeled for treatment of an indicated.
condition. Accordingly, there also is contemplated an article of manufacture, such as a container com-prising a dosage form of a compound of the invention and a label containing instructions for use of the compound. Kits are also contemplated under the .invention. For example, the kit.can comprise a dosage form of a pharmaceutical composition and a package insert containing instructions for use of the composition in treatment of a medical condition.
In either case, conditions indicated on the label can include treatment of inflammatory disorders, cancer, etc.

Methods of Administration of Inhibitors of PI3K5 Activity Pharmaceutical compositions comprising an inhibitor of P13K5 activity can be administered to the subject by any conventional method, including parenteral and enteral techniques, Parenteral ad-ministration modalities include those in which the composition is administered by a route other than through the gastrointestinal tract, for example, intravenous, intraarterial, intraperitoneal, intra-medullary, intramuscular, intraarticular, intra-thecal, and intraventricular injections. Enteral administration modalities include, for example, oral (including buccal and sublingual), and rectal admin-istration. Transepithelial.administration modali-ties include, for example, transmucosal administra-tion and transdermal administration. Transmucosal administration includes, for example, enteral administration as well as nasal., inhalation, and.
deep lung administration; vaginal administration;
and rectal administration. Transdermal administra-tion includes passive or active transdermal or transcutaneous modalities, including, for example, patches and iontophoresis devices,.as well. as topical application of pastes, salves, or ointments.
Parenteral administration also can be accomplished using a high-pressure technique, e.g., POWDERJECT .
Surgical techniques include implantation of depot (reservoir) compositions, osmotic pumps, and the like. A preferred route of administration for treatment of inflammation can be local or topical delivery for localized disorders such as arthritis, or systemic delivery for distributed disorders, e.g., intravenous delivery for reper-fusion injury or for systemic conditions such as septicemia. For other diseases, including those involving the respiratory tract, e.g., chronic obstructive pulmonary disease, asthma, and emphy-' sema, administration can be accomplished by inhalation or deep lung administration of sprays, 'aerosols, powders, and the like.
For the treatment of neoplastic diseases, especially leukemias and other distributed, cancers, parenteral administration is'typically preferred.
Formulations of the compounds to optimize them for biodistri_bution following parenteral administration would be desirable. The PI3K6 inhibitor compounds' can be administered before, during, or after adm.in=-istration of chemotherapy, radiotherapy, and/or surgery.
Moreover, the therapeutic index of the P13K5 inhibitor compounds can be enhanced by modi-fying or derivatizing the compounds for targeted delivery to cancer cells expressing a marker that identifies the cells as such. For example, the compounds can be linked to an antibody that recog-nizes a marker that is selective or specific for cancer cells; so that the compounds are brought into the vicinity of the cells to exert their effects locally, as previously described (see for example, Pietersz et al., Immunol Rev,' 129:57 (1992); Trail et al., Science, 261:212 (19'93); and Rowlinson-Busza et al., Curr Opin Oncol, 4:1142 (1.992)). Tumor-directed delivery of these compounds enhances the therapeutic benefit by, inter alia, minimizing potential nonspecific toxicities that can result from radiation treatment or chemotherapy. In another aspect, P13K6 inhibitor compounds and radio-isotopes or chemotherapeutic agents can be conju-gated to the same anti-tumor antibody.
For the treatment-of bone resorption dis-orders or osteoclast-mediated disorders, the PI3K5 inhibitors can be delivered by any suitable method..
Focal administration can be,desirable, such as by intraarticular injection. In some cases, it can be .desirable to couple the compounds to a moiety that can target the compounds to bone. For example, a PI3K6 inhibitor can be coupled to compounds with high affinity for hydroxyapatite, which is a major constituent of bone. This can be'accomp_l.ished, for example, by adapting a tetracycline-coupling method developed for targeted, delivery of estrogen to bone (Orme et al., Bioorg Med Chem Lett, 4(11):1375-80 (1994)).
To be effective therapeutically in modulating central nervous system targets, the agents used in the methods of the-invention should readily penetrate the blood brain barrier when peripherally administered. Compounds that cannot penetrate the blood brain barrier, however, can still be effectively administered-by an intravenous route.
As noted above, the characteristics of the agent itself and the formulation of the agent can -influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the administered agent. Such pharmacokinetic and pharm-acodynamic information can be collected through preclinical in vitro and in vivo studies, later confirmed in humans during the course of clinical trials. Thus, for any compound used in the method of the invention, a therapeutically effective dose can be estimated initially from biochemical and/or cell-based assays. Then, dosage can be formulated in animal models to achieve a desirable circulating concentration range that modulates PI3K5 expression or activity. As human studies are conducted, fur-ther information will emerge regarding the appropri-ate dosage levels and duration of .treatment for various diseases and conditions.
Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceut-ical procedures in cell cultures or experimental animals, e.g., for determining the LDs" (the dose lethal to 50% of the population) and the ED,(, (the dose therapeutically effective in 50% of the pop-ulation). The dose ratio between toxic and thera-peutic effects is the "therapeutic index," which typically is expressed as the ratio LD50/ED50.
Compounds that exhibit large therapeutic indices, i.e., the toxic dose is substantially higher than the effective dose, are preferred. The data obtained from such cell culture assays and addi-tional animal studies can be used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circu-lating concentrations that include the ED,, with, little or no toxicity.
For the methods of the invention, any effective administration regimen regulating the timing and sequence of doses can be used. Doses of the agent preferably include pharmaceutical dosage units comprising an effective amount of the agent.
As used herein, "effective amount" refers to an amount. sufficient to modulate P13K6 expression or activity and/or derive a measurable change in a physiological parameter of the subject through administration of one or more of the pharmaceutical .dosage units.
Exemplary dosage levels for a human sub-ject are of the order of from about 0.001 milligram of active agent per kilogram body weight ;mg/kg) to about 100 mg/kg. Typically, dosage units of the active agent comprise from about 0.01 mg to about 10,000 mg, preferably from about 0.1 mg to about 1,000 mg, depending upon the indication, route of administration, etc. Depending on the route of administration, a suitable dose can be calculated according to body weight, body surface area, or organ size. The final dosage regimen will be determined by the attending physician in ,view of good medical practice, considering various factors that modify the action of drugs, e.g., the agent's specific activity, the identity and severity of the disease state, the responsiveness of the patient, the age, condition, body weight, sex, and diet of the patient, and the severity of any infection.
Additional factors that can, be taken into-account .include time and frequency'of administration, drug combinations, reaction sensitivities, and toler-ance/response to therapy. Further refinement of the dosage appropriate for treatment involving any of the formulations mentioned herein is done routinely by the skilled practitioner without undue experimen-tation, especially in light of the dosage informa-tion and assays disclosed, as well as the pharmaco-kinetic data observed in human clinical trials.
Appropriate dosages can be ascertained through use of established assays for determining concentration of the agent in a body fluid or other sample to-gether with dose response data.
The frequency of dosing will depend on the pharmacokinetic parameters of the agent and the route of administration. Dosage and administration are adjusted to provide sufficient levels of the.
active moiety or to maintain the desired effect.
Accordingly, the pharmaceutical compositions can be administered in a single dose, multiple discrete doses, continuous infusion, sustained release depots, or combinations thereof, as required to maintain desired minimum level of the agent. Short-acting pharmaceutical compositions (i.e., short half-life) can be administered'once a day or more than once a day (e.g., two, three, or four times a day). Long acting pharmaceutical compositions might be administered every 3 to'4 days, every week, or once every two weeks. Pumps, such as. subcutaneous, intraperitoneal, or subdural pumps, can be preferred for continuous infusion.

The following Examples are provided to further aid in understanding the invention, and pre-suppose an understanding of conventional methods well-known to those persons having ordinary skill in the art to which the examples pertain, e.g., the construction of vectors and plasmids, the insertion of genes encoding polypeptides into such vectors and plasmids, or the introduction of vectors and plas-mids into host cells. Such methods are described in detail in numerous publications including, for ex-ample, Sambrook et al., Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), Ausubel et al. (Eds.), Current Proto-cols in Molecular Biology, John Wiley & Sons, Inc.
(1994); and Ausubel et al. (Eds.); Short Protocols in Molecular Biology, 4th ed., John. Wiley & Sons, Inc. (1999). The particular materials and condi-tions described hereunder are intended to exemplify particular aspects of.the invention and should not be construed to limit the reasonable scope thereof.

Preparation and Purification. of Recombinant PI3Ka, 5, and 6 Recombinant P13K.heterodimeric complexes consisting of a p110 catalytic subunit and a p85 regulatory subunit were overexpressed using the BAC-.TO-BAC HT baculovirus expression system (GIBCO/-BRL), and then purified for use in biochemical assays. The four Class I PI 3-kinases were cloned into baculovirus vectors as follows:
p1106: A FLAG -tagged version of human p1105 (SEQ ID NO:1) (see Chantry et al., J Biol Chem, 272:19236-41 (1997) ). was subcloned using standard recombinant DNA techniques into the BarHl-Xbal site of the insect cell expression vector pFastbac HTb (Life Technologies, Gaithersburg, MD), such that the clone was in frame with the His tag of ,the vector. The FLAG`S system is described in U.S.
Patent Nos. 4,703,004; 4,782,137; 4,851,341; and 5,011,912, and reagents are available from Eastman Kodak Co.
p110c: Similar to the method used for p1106, described above, a FLAG -tagged version of plloa (see Volinia et al., Genomics, 24(.3):427-477 (1.994) ) was subcloned in Ba.mH1--.HindIII sites of pFastbac HTb (Life Technologies) such that the clone was in frame with the His tag of the ,vector.
pli0~: A p110(3 (see Hu et al.,...Mol Cell Biol, 13:7677-88. (1993)) clone was amplified from the human. MARATHON Ready spleen cDNA library (Clontech, Palo Alto CA) according to the manufac-turer's protocol using the following primers:
5' Primer 5'-GATCGAATTCGGCGCCACCATGGACTACAAGGACGACGATGACAA.GTGCT'TC
AGTTTCATAATGCCTCC-3' (SEQ ID NO:3) 3' Primer 5'- GATCGCGGCCGCTTAAGATCTGTAGTCTTTCCGAACTGTG'TG-3' (SEQ ID NO:4) The 5' primer was built to contain a .FLAG tag in frame with the pll0(3 sequence. After amplification, the FLAG -p110~ sequence was subcloned using standard recombinant techniques into the' EcoRl-Not1 sites of pFastbac HTa'(Life Technologies), such that the clone was in frame with the His tag of the vector.
p110y: The pllO' cDNA (see Stoyanov et al., Science, 269:690-93 (1995)) was amplified from a human Marathon Ready spleen. cDNA library (Clon-tech) according to the manufacturer's protocol using the following primers:
5' Primer 5'-AGAAI'GCGGCCGCATGGAGCTGGAGAACTATAAACAGCCC-3' (SEQ
ID NO:5) 3' Primer =5'-CGCGGATCCTTAGGCTGAA.TGTTTCTCTCCTTGTTTG-3' (SEQ ID
NO:6) A FLAG tag was subsequently attached to the 5' end of the pil0y sequence and was cloned in the BamH1 Spel sites of pFastbac HTb (Life Technologies) using standard recombinant DNA techniques, with the FLAG -110y sequence in-frame with the His tag of the -vector.
p85a: A Ea.mH1-EcoR.l. fragment of FLAGC"1-tagged p85 cDNA. (see Skolnik et al , , Sell, 65:83--89 (1991)) was subcloned into the BamHl-EcoRl sites of the vector pFastbac dual (Life Technologies).
Recombinant baculoviruses containing the above clones were generated using manufacturer's recommended protocol,(Life Technologies). Baculo-viruses expressing His-tagged p110a, p110P, or p1J05 catalytic subunit and p85 subunit were coinfected into Sf21 insect cells. To enrich the hFterodimeric enzyme complex, an excess amount of baculoviirus expressing p85 subunit was infected, and~the His-tagged'p110 catalytic subunit complexed with p85 was purified on nickel affinity column. Since p110y does not associate with p85, Sf21 cells were infec-ted with recombinant baculoviruses-express-ng His-tagged pllOy only. In an alternate approach, p101 ,can be cloned into baculovirus, to.permit coexpres-sion with its preferred binding partner p110y.

The 72-hour post-infected Sf21 cells (3 liters) were harvested and-homogenized in'a hypo-tonic buffer (20 mM HEPES-KOH, pH 7.8, 5 mM KC1, complete protease inhibitor cocktail (Roche Biochem-icals, Indianapolis, IN), using a Dounce homogen-izer. The homogenates were centrifuged at 1,000 x g for 15 min. The supernatants were further centri-fuged at 10,000 x g for 20 min, followed.by ultra--centrifugation at 100,000 x g for 60 mina The soluble fraction was immediately loaded onto 10 mL
of HITRAP nickel affinity column (Pharmacia, Piscataway, NJ) equilibrated with 50 mL of Buffer A
(50 mM HEPES-KOH, pH 7.8, 0.5 M NaCl, 10 mM imid-azole). The column was washed extensively with Buffer A, and eluted with a linear gradient of 10-500 mM imidazole. Free p85 subunit was removed from the column during the washing step and only the heterodimeric enzyme complex eluted at 250 mM
imidazole. Aliquots of nickel fractions were analyzed by 10% SDS-polyacrylamide gel electrophore-sis (SDS-PAGE), stained with SYPRO Red (Molecular Probes, Inc., Eugene, OR), and quantitated with STORM Phospholmager (Molecular Dynamics, Sunnyvale, CA). The active fractions,were pooled and directly loaded onto a 5 mL Hi-trap heparin column preequili-brated with Buffer B containing 50 mM HEPES-KOH, pH
7.5, 50 mM NaCl, 2 mM dithiothreitol (DTT). The column was washed with 50.mL of Buffer B and eluted with a linear gradient of 0.05-2 M NaCl. A single peak containing P13K enzyme complex eluted at 0.8 M
NaCl. SDS-polyacrylamide gel analysis showed that the purified PI3K enzyme fractions contained a 1:1 stoichiometric complex of p110 and. p85 subunits.

The protein profile of the enzyme complex during heparin chromatography corresponded to that of lipid kinase activity. The active fractions were pooled and frozen under liquid nitrogen.

PI3K6 High Throughput Screen (HTS) and Selectivity Assay A high throughput screen of a proprietary chemical library was performed to identify candidate inhibitors of PI3K5 activity. PI3K6 catalyzes a phosphotransfer from y- [32P] ATP to -PIP2/PS liposomes at the D3' position of the PIP2 lipid inositol ring.
This reaction is MgCl2 dependent and is quenched in high molarity potassium phosphate buffer pH 8.0 containing 30 mM EDTA. In the screen, this reaction is performed in the presence or absence of library compounds. The reaction products (and all unlabel-led products) are transferred to a 96-well, pre-wetted PVDF filter plate, filtered, and washed in high molarity potassium phosphate. Scintillant is added to the dried wells and the incorporated radio-activity is quantitated.
The majority of assay operations were performed using a BIOMEK 1000 robotics workstations (Beckman) and all plates were read-using Wallac liquid scintillation plate counter protocols.
The 3X assay stocks of substrate and enzyme were made and stored in a trough (for robotics assays) or a 96-well, V-bottom, polypropyl-ene plate (for manual assays). Reagents were stable for at least 3 hours at room temperature.
The 3X substrate for the HTS contained 0.6 mM Na2ATP, 0.10 mCi/mL y- [32P] ATP (NEN, Pittsburgh, PA), 6 1.1M PIP2/PS liposomes (Avanti Polar Lipids, Inc., Atlanta, GA), in 20 mM HEPES, pH 7.4.
The 3X enzyme stock for the HTS contained 1.8 nM PI3K5, 150 fag/mL horse IgG (used only as a stabilizer), 15 mM MgCl2, 3 mM DTT in 20 mM HEPES, pH
7.4.
The chemical high throughput screen (HTS) library'samples (each containing a pool of 22 com-pounds) in dimethyl sulfoxide (DMSO) were diluted to 18.75 pM or 37.8 pM in double distilled water, and 20 pL of the dilutions were placed in the wells of a 96--well polypropylene plate for assaying The nega-tive inhibitor control (or positive' enzyme control) was DMSO diluted in water, and the positive inhibi--tor controls employed concentrations of LY294002 sufficient to provide 50% and 100% inhibition.
To the 20 1t pooled chemical library dilu-tions, 20 pL of 3X substrate was added. The reac-tion was initiated with 20 pL of 3X enzyme, incu-bated at room temperature for 10 minutes: This dilution established a final concentration of 200 pM
ATP in the reaction volume. The reaction was stopped with 150 p.L~quench buffer (1.0 M potassium phosphate pH '8.0, 30 mM EDTA). A:portion of the quenched solution (180 I1L) 'was then transferred to a PVDF filter plate (Millipore #MAIP NOB prewetted with sequential 200 pL washes of 100% methanol, water, and finally 1.0 M potassium phosphate pH 8.0 wash buffer).

The PVDF filter plate was aspirated under moderate vacuum (2-5 mm Hg), washed with 5 x 200 ~iL
of wash buffer, and then dried by aspiration. The filter was subsequently blotted, all.owed.to air dry completely, and inserted into a Wallac counting cassette with 50 p.L of Ecoscint scintillation cock-tail added per well. The incorporated radioactivity was quantitated, and data were analyzed, after normalizing to the enzyme positive control (set at 100%), to identify the curve intersection at the 50%
inhibition value to estimate.IC50 values for the inhibitors.
A total'of 57 pooled master wells were selected for deconvolution, based on combined criteria of <42% residual activity at the tested .concentration, and a total accepted hit rate of no more than 0.2%. At 22 compounds per well, a total of 1254 compounds were identified through this deconvolution and individually assayed, at the 1X
concentration of 27.7 IiM to identify which compounds exhibited the desired activity. From these assays, 73 compounds were selected and assayed further to develop IC50 curves. From the IC5 curve results, 34 compounds were selected for selectivity assays against PI3Ko( and PI3K(3 (see assay protocol in Example 11).
From the selectivity assays, one compound, 3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (Compound D-000), was selected as being a relatively potent and selective compound.
Catalog searches and selectivity assays of many analogous compounds of the potent and/or selective hits yielded only one compound that was both an active and selective analogue of D-000. This com-pound was purchased from Contract Services Corpora-tion (Catalog #7232154) and differed from D-000 in.
substituting a phenyl group for the 2-chlorophenyl group of D-000.

U

N
~ Cl _~T CH2 S N

N

\~---NH
As described above, the PI 3-kinase inhibitor LY294002 (C.albiochem, La Jolla, CA) does not. have significant selectivity among the different PI 3-kinase isoforms tested. Under our assay condi-tions, LY294002 inhibited all three isoforms of PI
3-kinases with an IC50 of 0.3 to 1 liM. However, when the compound D-000 was tested against the same PI 3-kinase isoforms distinct selectivity was observed.
Specifically, as shown. in Figure 1, D-000 inhibited the activity of the 5 isofdrm of P13K with an IC., of approximately 0.3 jaM, whereas under similar condi-tions it did not inhibit activities of the a and (3 isoforms at a limit of 100 pM compound. These results show that D-000 selectively inhibits P13K5 activity.

Since P13K6 is expressed. at significant .levels only in leukocytes, it is important to study the effects of the P13K5-selective inhibitor on leukocyte functions. Accordingly, the effects of PI3K6 inhibition in several types of leukocytes were examined. Neutrophils were examined to determine the effects that selective inhibition of PI3K6 might elicit (Example 3, below). It surprisingly was found that selective inhibition of P13K6 activity appears to be significantly associated with inhibi-tion of some but not all functions characteristic of activated neutrophils. In addition, the effects of PI3K5 inhibition on B cell and T cell function also were tested (Examples 4-5, below). Moreover, as P13K5 also is expressed in osteoclasts, the effect of PI3K5 inhibition on the function of these =specia.lized cells was studied (Example 6, below).

Characterization of Role of .PI3K5 in Neutrophil Function The effects of a PI3K5 inhibitor of the invention., i.e., D-000, on.neutrophil functions such as superoxide generation, elastase exocytosis, chemotaxis, and bacterial killing.were tested.

A. Preparation of neutrophils from human blood Aliquots (8 mL) of heparinized blood from healthy volunteers were layered on 3 mL cushions of 7.3% FICOLL (Sigma, St. Louis, MO) and 15.4%
HYPAQUE (Sigma) and centrifuged at 900 rpm for 30 min at room temperature in a table top centrifuge (Beckman). The neutrophil-rich band just above the FICOLL -HYPAQUE cushion was collected and washed with Hanks' balanced salt solution (HBSS) containing 0.1% gelatin. Residual erythrocytes were removed by hypotonic lysis with 0.2% NaCl. The neutrophil preparation was washed twice with HBSS containing 0.1% gelatin and used immediately.

B. Measurement of superoxide production from neutrophils Superoxide generation is one of the hall-marks of neutrophil activation. A variety of acti-vators potentiate superoxide generation by neutro-phils. The effect of the PI3K6 inhibitor D-000 on superoxide generation by three different agonises:
TNFla, IgG, and fMLP, each. representing separate classes of activator, was measured. Superoxide generated by the neutrophils was measured by moni-toring the change in absorbance upon reduction of cytochrome C by modification of the method described by Green et al., (pp. 14.5.1-14.5.11 in Supp. 12, Curr Protocols Immunol (Eds., Colligan et al.) (1994)), as follows. Individual wells of a 96-well plate were coated overnight at 4 C with 50 p.L of 2 mg/mL solution of human fibrinogen or IgG. The wells were washed with PBS and the following re-agents were added to each well: 50 UL of HBSS or superoxide dismutase (1 mg/mL), 50 ~iL of HBSS or TNF1c( (50 ng/m'L), 50 ~.iL cytochrome C (2.7 mg/mL), and 100 iL of purified human neutrophil suspension (2 x 106 cells/mL) The plate was centrifuged for 2 min at 200 rpm and absorbance at 550 nm was moni-tored for. 2 hr. To measure the relative amounts of superoxide generated, values obtained from the superoxide dismutase-containing wells were subtrac-ted from all, and normalized to the values obtained from the wells without any inhibitor.
As shown in Figure 2, the PI3K5 inhibitor D-000 inhibits TNF-induced superoxide generation by neutrophils in a concentration dependent manner.
Superoxide generation induced by TNF was reduced to its half-maximal value at about 3 }1M D-000. Figure 2 also reveals that superoxide generation induced by IgG was not significantly inhibited by D-000. In fact, even at 10 pM this PI3K5 inhibitor did not have any effect on superoxide generation induced by IgG.
Next, the effect of D-000 on superoxide generation induced by another potent inducer, the bacterial peptide, formylated-Met-Leu-Phe (fMLP) was studied. Like the TNF-induced superoxide genera-tion, fMLP-induced superoxide generation also was inhibited by D-000 (Figure 3). These results show that the PI3K6 inhibitor D--000 can prevent stimulus specific induction of superoxide generation by neutrophils, indicating that PI3K5 is involved in this process.

C. Measurement of elastase exocytosis from neutrophils In addition to superoxide generation, activated neutrophils also respond by releasing several proteases that are responsible for the de-struction of tissues and cartilage during inflamma-tion. As an indication of protease release, the effect of D-000 on elastase exocytosis was measured.
Elastase exocytosis was quantitated by modification of. the procedure described by Ossanna et al. (J Clin Invest, 77:1939-1951 (1986)), as follows. Purified human neutrophils (0.2 x 106) (treated with either DMSO or a serial dilution of D-000 in DMSO) were stimulated with fMLP in PBS containing 0.01 mg/mL
cytochalasin B, 1.0 pM sodium azide (NaN3) .. 5 ug/mL
L-methionine and 1 uM fMLP for 90 min at 37 C in a .96-well plate. At the end of the incubation period, the plate was centrifuged for 5 min at 1000 rpm, and 90 uL of the supernatant was transferred to 10 pL of mM solution of an elastase substrate peptide, MeO-suc-Ala-Ala-Pro-Val-pNA, wherein MeO-suc =
methoxy-succinyl; pNA = p-nitroanilide (Calbiochem, San Diego, CA). Absorbance at 410 nm was monitored for 2 hr in a 96-well plate reader. To measure the relative amounts of elastase excytosed, all absorb-ance values were normalized to the values without any inhibitor. As shown in Figure 4, the PI3K5 inhibitor D-000 inhibits fMLP-induced elastase exocytosis significantly, and does so in a dose-dependent fashion. Inhibition was half-maximal at a concentration of about 2-3 jiM D-000.

D. Measurement of fMLP-induced human neutrophil migration Neutrophils have the intrinsic capacity to migrate through tissues, and are one of the first cell types to arrive at the sites of inflammation or tissue injury. The effect of D-000 on neutrophil migration towards a concentration gradient of fMLP
was measured. The day before the .nigration- assays were performed, 6-we-11 plates were-coated with 'recombinant ICAM-1/rc fusion protein (Van der Vieren et al.., Immunity, 3:683-690 (1995)') (25 .g/mL in bicarbonate buffer, pH 9.3) and left overnight at 4 C. After washing, 1% agarose solution, in RPMI-1640 with 0.5% bovine serum albumin (BSA), was added to wells with or without an inhibitor, and plates were placed into a refrigerator before punching :holes in the gelled agarose to create plaques (1 central hole surrounded by'6 peripheral ones per well). .
Human neutrophils were obtained as de-scribed above, and resuspended in RPMI medium supplemented with 0.5% BSA at 5 x 106 cells/mL.
After combining equal volumes of neutrophil suspen-sion and medium (either with DMSO or a serial dilu-tion of the test, compound in DMSO.), neutrophils-were aliquoted into the peripheral holes, while the central hole received fMLP - (5 p.M). Plates were incubated at 37 C in the presence' of 5% CO, for 4 hr, followed by termination of migration by the addition of 1% glutaraldehyde-solution in D-PBS. After re-moving the agarose layer, wells were washed with distilled water and dried.

Analysis of neutrophil migration was con-ducted on a Nikon DIAPHOT 'inverted microscope (1x objective) video workstation using the NIH 1.61 program. Using Microsoft Excel and Table Curve 4 (SSPS Inc., Chicago IL) programs, a migration index was obtained for each of the studied conditions.
Migration index was defined as the area under a curve representing number of migrated neutrophils versus the net distance of migration per cell.
As shown in Figure 5, the PI3K5 inhibitor D-000 had a profoun:d'effect on neutrophil migration, inhibiting this activity in'a dose-dependent manner.
The EC50 of this compound for inhibition of neutro-phil migration in this assay is about 1M. Based on a visual inspection of the recorded paths of the cells in this assay, it app>ears that the total path length for the neutrophils was'not significantly affected by the test compound. Rather, the compound affected neutrophil orientation or sense of direc-tion, such that instead of migrating along the axis of the chemoattractant gradient, the cells migrated in an undirected or'less directed manner.

E. Measurement of bactericidal capacity ofneutrophils Given that the PI3K6 inhibitor D-000 affects certain neutrophil functions detailed above, it was of interest to see whether the compound affects neutrophil-mediated bacterial killing. The effect of D-000 on neutrophil-mediated Staphylo-coccus aureus killing was studied according to-the method described by Clark and Nauseef (pp. '7.23.4-7.23.6 in Vol. 2, Supp. 6, Curr Protocols Immunol (Eds., Colligan et al.) (1994)). Purified human neutrophils (5 x 105 cells/mL) (treated with either DMSO or a serial dilution of D-000 in DMSO) were mixed with autologous'serum. Overnight-grown S.
aureus cells were washed, resuspended in HBSS, and added to the serum-opsonized neutrophils at a 10:1 ratio. Neutrophils were allowed to internalize the bacteria by phagocytosis by incubation at 37 C for 20 min. The noninternalized bacteria were killed by units/mL lysostaphin,at 37 C for 5 min and the total mixture was rotated at 37 C. Samples were withdrawn at various times for up to 90 min. and the neutrophils were lysed by dilution in water. Viable bacteria were counted by plating appropr:Late dilu-tions on trypticase--soy-agar plate and counting the S. aureus colonies after overnight growth.
As' shown in Figure 6, neutrophil-mediated killing of S. aureus was similar in samples treated with DMSO (control) and with D--000. These results indicate that the P13K5 inhibitor does not signifi-cantly affect the ability of neuttophils to kill S.
aureus, suggesting that PI3K6 is not involved in this pathway of neutrophil function.

Characterization of Role of PI3K5 in B Lymphocyte Function The effects of the PI 3-kinase inhibitor on B cell functions including classical indices such as antibody production and specific stimulus-induced proliferation also were studied.

A. Preparation and stimulation. of B
cells from peripheral human blood Heparinized blood (200 mL) from healthy volunteers was mixed with an equal volume of D-PBS, layered on 10 x 10 mL FICOLL-PAQLTE (Phar.m.acia), and centrifuged at 1600 rpm for 30 min at room tempera-ture. Peripheral blood mononuclear cells (PBMC) were collected from the FICOLL /serum interface, overlayed on 10 mL fetal bovine serum (FBS) and centrifuged at 800 rpm for 10 min to remove plate-lets. After washing, cells were incubated with LYNAL ' Antibody Mix (B cell kit) (Dyi?al Corp. , Lake Success, NY) for 20 min at 4-8 C. Following the removal of unbound antibody, PBL were mixed with anti-mouse IgG coated magnetic beads (Dynal) for 20 min at 4-8 C with gentle shaking followed by elimi-nation of labeled non-B cells on the magnetic bead separator. This procedure was repeated once more.
The B cells were resuspended in RPMI-1.640 with 10-0c FBS, and kept on ice until further use.

B. Measurement of antibody production by human B cells To study antibody production, B cells were aliquoted at 50-75 x 103 cells/well into .96-weli plate with or without inhibitor, to which IL-2 (100 U/mL) and PANSORBIN (Calbiochem) Staphylococcus aureus cells (1:90,000) were added. Part of the media was removed after. 24-36 hr, and fresh media (with or without inhibitor) and IL-2 were added.
Cultures were incubated at 37 C, in the presence of a CO2 incubator for additional 7 days. Samples from each condition (in triplicate) were removed, and analyzed for IgG and IgM, as measured by ELISA.
Briefly, IMMULON 4 96-well plates were coated (50 liL/well) with either 150 nq/mL donkey antihuman IgG
(H+L) (Jackson ImmunoResearch, West Grove PA), or 2 p /mL donkey antihuman IgG+IgM (H+L) (Jackson ImmunoResearch) in bicarbonate buffer, and left overnight at 4 C. After 3x washing'with phosphate buffered saline containing !b.1% TWEEN -80 (PBST) (350 4L/well), and blocking with 3% goat serum in PBST (100 pL/well) for 1 hr at room temperature, samples (100 pL/well) of B cell spent media diluted in PBST were added. For IgG plates the dilution range was 1:500 to 1:10000, and for IgM 1:50 to 1:1000. After 1 hr, plates were exposed to biotin--conjugated antihuman IgG (100 ng/mL) or antihuman IgM (200 ng/mL) (Jackson ImmunoResearch) for 30 min, following by streptavidin-HRP (1:20000) for 30 min, and finally, to TMB solution (1:l00) with H202 (1:10000) for 5 min, with 3 x PBST,washing between steps. Color development was stopped by H2SO4 solu-tion, and plates were read on an ELISA plate reader.
As shown in Figure 7, D-000 significantly inhibited antibody production. IgM production was affected more than IgG production: half--maximal inhibition of IgM production was observed at about 1 i1M, versus about 71aM for comparable inhibition of IgG production.

C. Measurement of B Cell Proliferation in response to cell surface IgM
stimulation In the above experiment, the B cells were stimulated using PANSORBIN . The effect of D-000 on B cell proliferation response when they were stimu-lated through their cell surface 1gM using anti-IgM
antibody also was measured. Murine splenocytes (Balb/c) were plated into 96--well nmicrotiter plates at 2 x 105 cells per well in 106 FBS/RPMI. Approp-riate dilutions of test inhibitor in complete medium were added to the cells and the plates were incubat-ed for 30-60 minutes prior to the addition of stim-ulus. Following the preincubation with test inhibi-tor an F (ab') 2 preparation of goat antibody specific for the p-chain of mouse Ig.M was added to the wells at a final concentration of 25 p.a.g/mL. The plates were incubated at 370C for 3 days and 1 pCi of [3H1 --thymidine was added to each.ivell for the final four hours of culture. The plates were harvested onto fiber filters washed and the incorporation of radio-label was determined using a beta counter (Matrix 96, Packard Instrument Co., Downers Grove, IL) and expressed as counts per minute (CPM).
Figure 8 shows the effect of D-000 on anti-IgM stimulated proliferation of B cells. The compound inhibited anti-IgM-stimulated B cell pro-liferation in a dose-dependent manner. At about 1 pM, proliferation was reduced to its half-maximal value.
Because the compound D-000 inhibits B cell proliferation, it is envisioned that this compound and other PI3K5 inhibitors could be used to suppress undesirable proliferation of B cells in clinical settings. For example, in B cell malignancy, B
cells of various stages of differentiation show un-regulated proliferation. Based on the results shown above, one can infer that PI3K6 selective inhibitors could be used to control, limit, or inhibit growth of such cells.

Characterization of Role of PI3K(5in T Lymphocyte Function T cell proliferation in response to cdstimulation of CD3+CD28 was measured. T cells were purified from healthy human blood by *negative selection using antibody coated. magnetic beads according to the manufacturer's protocol (Dynal) and resuspended in RPMI. The cells were treated with either DMSO or a serial dilution of D-000 in DMSO
and plated at 1 x 105 cells/well on a 96 'well plate precoated with goat'antimouse IgG. Mouse monoclonal anti-CD3 and anti-CD28 antibodies were then added to each well at 0.2 ng/mL and 0..2 [ig/mL, respectively.
The plate was incubated at 37 C for 24 hr and. [3H] -'thymidine (1 p Ci/well) was added.-' After another 18 hr incubation the cells were harvested with an automatic cell harvester, washed and theincorp-orated radioactivity was quantified.
Although the PI3K5 inhibitor D-000 inhib-ited anti-CD3- and anti-CD28-induced proliferation of T cells, its effect is not as strong as its effect on B cells or on some of the functions of neutrophils. Half-maximal. inhibition of.thymidine incorporation was not achieved at the highest tested concentration, i.e., 10 ~.1.M D-000.

Characterization of Role of PI3K5 in Osteoclast Function To analyze the effect of the PI3K5 inhib-.
itor D-000 on osteoclasts, mouse bone marrow cells were isolated and differentiated them to osteoclasts by treating the cells with Macrophage Colony Stimu-lating Factor`' (mCSF-1) and- Osteoprotegerin Ligand (OPGL) in serum-containing medium (otMEM with 10%
heat-inactivated FBS; Sigma) for 3 days. On day four, when the osteoclasts' had developed, the medium was removed and cells were harvested. The osteo-clasts were plated on dentine slices at 1.01 cells/-well in growth medium, i.e., <MEM containing 1%
serum and 2%.BSA with 55 p.g/mL OPGL and 10 ng/mL
,mCSF-1. After 3 hr, the medium was changed to serum and 1% BSA, with or without.osteopontin (25 lig/mL) and the P13K inhibitors (100 nM). The medium ,was changed every 24 hours with fresh osteopont.in .and the inhibitors. At 72 'hr, the medium was removed, and the dentine suifaces were washed with water to remove cell debris and stained with acid hematoxylin. Excess stain was washed and the pit depths were quantitated using confocal microscopy.
As shown in Table 1, in'two experiments, the PI 3-kinase inhibitors had an-inhibitory effect on osteoclast function. Both the nonspecific inhib-itors LY294002 and wortmannin inhibited osteoclast activity. However, the PI3K6 inhibitor D-000 had the most profound effect, as at 100 nM this compound almost completely inhibited the osteoclast activity.

Table 1 Osteopontin LY294002 Wor,tmann!n (OPN), D-000 + OPN + OPN + OPN
0.5 1 4.6 0.22 5.7 0.6 9 0.4 1 5.8 0.5 5 0.5"

Characterization of Role of PI3K6 in Basophil Function Assessment'of the effect of a compound of the invention on basophil function was tested using a conventional histamine release assay, generally in accordance with the method described in Miura et al., J Immunol; 162:4198-206 (1999) Briefly, en-riched basophils were preincubated with test com-pounds at several concentrations from 0.1 nM to 1,000 nM, for 10 min at 37 C. Then, polyclonal goat antihuman IgE (0.1 ~ig/mL) or fMLP was added, and allowed to incubate for an additional 30 min.
Histamine released into the supernatant was measured using an automated fluorometric technique. Two compounds were tested, shown below.

N
Cl N

S N

N
N
--NH

O

N
N

S N "'), N
d N-NH

A dose-dependent decrease in histamine release was observed for 3-(2-chl.orophenyl)-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-026) when the basophils were stimulated with anti-1gE. This suppression of histamine release was essentially 100% at 1,000 nM, with an EC., of about 25 nM. Another compound, 3-(2-chlorophenyl)-2-(1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanylmethyl)-3H-quinazolin-4-one (D--999), in which the purine ring structure is rearranged, was less efficacious in the inhibition of histamine release. Neither compound elicited any effect when the basophils were stimu-lated with fMLP. For comparison, the nonselective P13K inhibitor LY294002 was tested at 0.1 nM and 10,000 nM, showing close to 100% -inhibition of histamine release at the highest concentration.
These data indicate that inhibitors of PI
3-kinase delta activity can be used to suppress release of histamine, which is one of the mediators of allergy. Since the activity of various PI 3-kinases are required for protein trafficking, secre-tion, and exocytosis in many cell types, the above data suggest that histamine release by other cells, such as mast cells, also can be disrupted by PI 3-kinase delta-selective inhibitors.

CHEMICAL SYNTHESIS EXAMPLES

Specific nonlimiting examples of compounds of the invention are provided below. It is under-stood in the art that protecting groups can be em-ployed where necessary in accordance with general principles of synthetic chemistry. These protecting groups are removed in the final steps of the syn-thesis under basic, acidic,'or hydrogenolytic con-ditions readily apparent to those'persons skilled in the art. By employing appropriate manipulation and protection of any chemical functionaiities, synthe-sis of compounds of structural formula (I) not specifically set forth herein can be accomplished by methods analogous to the schemes set forth below.
Unless otherwise noted, all starting materials were obtained from commercial suppliers and used without further purification. All reac-tions and chromatography fractions were analyzed by thin-layer chromatography (TLC) on 250 mm silica, gel plates, visualized with ultraviolet (UV) light or iodine (I2) stain. Products and intermediates were purified by flash chromatography or reverse-phase high performance liquid chromatography.
The following abbreviations are used in the synthetic examples: aq (a.queous), H2O (water), CHC.7.3 (chloroform), HCl (hydrochloric acid.), MeOH
(methanol), NaOH (sodium hydroxide), NaOMe (sodium methoxide), TFA (trifluoroacetic acid), K,CO, (potassium carbonate), SOC12 (thionyl chlor_ide), CH2C12 (methylene chloride), EtOAC (ethyl acetate) DMF (dimethylformamide), EtOH (ethanol), IlMSO (di-methyl sulfoxide) , NaHCO3 (sodium bicarbonate) , TLC
(thin layer chromatography), HPLC (high performance liquid chromatography), HOST (hydroxybenzotriazole), EDC (ethyldiethylaminopropylcarbodiimide),, DIEA
(diisopropylethylamine), and HOAc (acetic acid).

I. General Procedures Procedure A

Thionyl chloride was added to a rapidly stirring solution of anthranilic acid or benzoic acid in benzene, and the mixture was stirred at reflux for 5 to 18 hours. The reaction was concentrated in vacuo, and stripped down twice with benzene. The resulting oil was dissolved in CHC1-, and to that solution was added the appropriate aniline. The reaction mixture was heated to reflux and stirred. until complete, as determined by TLC, at which point the reaction mixture was cooled to ambient temperature. The precipitate was removed by filtration, and the filtrate concentrated Jr., vacuo.
The crude product was purified by chromatography and/or recrystallization from MeOH to provide amides la-1r.

Procedure B

To a rapidly stirring suspension of an amide in glacial acetic acid was added chloroacetyl chloride. The reaction mixture was heated to 120 C, and allowed to stir at that temperature until com-plete, as determined by TLC. After brief cooling, the reaction mixture was concentrated in vacuo. The 'crude residue was purified by extraction, chroma-tography, and/or recrystallization to provide chlor-ides 2a-2r.

Procedure C

A mixture of a chloride, either a nitrogen or a sulfur nucleophile, for example, mercaptopurine monohydrate or adenine, and K2CO3 in DMF,was stirred .at room temperature for 1.5-72 hours. The resulting suspension was poured into water, and kept at 4 C
for several hours. The crude solid was filtered, washed with water, and purified by chromatography or _r.ecrystallization to provide.the final products.

Preparation of, Intermediate Compounds: Amides 2-Amino-N-(2-chlorophenyl)-4.,5-dimethoxybenzamide' (la) Prepared according to Procedure A using 4,5-dimethoxyanthranilic acid (5.0 g, 25.4 mmol) and SOC12 (5.5 mL, 76.1 mmol) in benzene (100 mL), followed by 2-chloroaniline (6.7 mL, 63.5 mmol) and CHC13 (75 mL). The product was washed with aqueous NaHCO3 (2 x 25 mL) and HC1 (0.5 M, 75 mL) and puri-fied by chromatography in CH2C12 to provide 4.3 g of a brown foam (55%). 1H NMR (CDC13) r5: 8.42 (dd, J=1.5, 8.3 Hz, 1H); 8.32 (br s, 1H); 7.40 (dd, J=1.4, 8.0 Hz, 1H); 7.31 (dt, J=1.4, 7.9 Hz, 1H);
7.05 (dt, J=1.5, 7.7 Hz, 1H) ; 7.03 (s, 1H) ; 6.24 (s, 1H) ; 3.88 (s, 3H) ; 3.87 (s, 3H). MS (ES) : m/z 307.0 (M+).

2-Amino-5-bromo-N-(2-chlorophenyl)benzamide (lb) Prepared according.to Procedure A using 2-.amino-5-bromobenzoic acid (5,0 g, 23.1 mmol) and SOC12 (7.0 mL, 95.9 mmol) in benzene (50 mL), followed by 2-chloroaniline (7.3 mL, 69.3 mmol) and CHC13 (50 mL). The product was purified by two chromatographies in CH2C12 to provide 1.48 g of a' .yellow orange solid (20o) . 1H NMR (CDC.13) 5: 8.36 (dd, J=1.2, 8.2 Hz, 1H); 8.20 (br s, 1H); 7.62 (d, J=2.1 Hz, 1H); 7.42 (dd, J=1.3, 8.0 Hz, 1H); 7.34 (dd, J=2.2, 8.8 Hz, 1H); 7.28-7.33 (m, 1H); 7.09 (dt, J=1.4, 7.7 Hz, 1H); 6.62 (d, J=8.7 Hz, 1H);
5.57 (br s, 2H).

2-Amino-N-(2-chlorophenyl)-4-fluorohenzam de (ic) Prepared according to Procedure A using 2-amino-4-fluorobenzoic acid (1.15 g, 7.41 mmol) and SOC12 (1.4 mL, 18.5 mmol) in benzene (25 mL), followed by 2-chloroaniline (1.6 mL, 14.8 mmol) and CHC13 (25 mL). The product was chromatographed in.
CH2C12, then triturated from hexanes to provide 1.02 'g of an off-white solid (52%). 'H NMR (CDC13) 6:
12.91 (br s, 1H); 8.72 (dd, J=2.7, 12 Hz, 1H); 8.34 (dd, J=6.4, 9.2 Hz, 1H); 8.29 (dd, J=5.9, 8.8 Hz, 1H); 7.81 (dd, J=6.2, 8.8 Hz, 1H);.7.28 (dt, J=2.4, .8.4 Hz, 1H); 7.21 (dd, J=2.4, 9.0 Hz, 1H); 6.92 (ddd, J=2.4, 7.3, 9.1 Hz, 1H); 6.54 (ddd, J=2.4, 7.8, 8.8 Hz, 1H); 6.45 (dd, J=2.4, 11 Hz,, 1H); 5.93 (br s, 2H). MS (ES) : m/z 265.0 (M+).

2-Amino-5-chloro-N-(2-chlorophenyl)benzamide (ld) Prepared according to Procedure A using 2-amino-5-chlorobenzoic acid (2.0 g, 1.1.7 mmol) and SOC12 (2.2 mL, 29.2 mmol) in benzene (50 mL), followed by 2-chloroaniline (2.5 mL, 23.3mmol).and.
CHC13 (5U mL). The product was purified by recrys tallization from MeOH to provide 1.72 g of a dark yellow solid (52%) . 1H NMR (CDC13) b: 8.37 (dd, .J=1.5, 8.3 Hz, 1H) ; 8.22 (br s, 1H).; 7.48 (d, J=2.3 Hz, 1H); 7.42 (dd, J=1.5, 8.1 Hz, 1H); 7.31 (dt, J=1.4, 7.8 Hz, 1H); 7.22 (dd, J=2.4, 8.8 Hz, 1H);
7.09 (dt, J=1.5, 7.7 Hz, 1H); 6.67 (d, J=8.8 Hz, 1H) ; 5.56 (br s, 2H), 2-Amino-N-(2-chlorophenyl)-6-fluorobenzami.de (le) Prepared according to Procedure A using 2-amno-6-fluoro.benzoic acid (2.0 g, 12.9 mmol) and.
SOC12 (2.3 mL, 32.2 mmol) in-benzene (50 mL), followed by 2-chloroaniline (2.7 mL, 25.8 mmol) and CHC13 (50 mL). The product was purified by chroma-tography in EtOAc/hexanes to provide 2.06 g of a pale orange solid (60-0.). 1H NMR (CDC13) 6 : 9.00 (d, J=17 Hz, 1H); 8.47 (d, J=8.3 Hz, 1H); 7.41 (d, J=8.0 Hz, 1H); 7.30 (t, J=7.9 Hz, 1H); 7.10-7.20 (m, 1H);
7.07 (t, J=7.7 Hz, 1H); 6.49 (d, J=8.3 Hz, 1H); 6.03 (br s, 2H). MS (ES) : m/z 265.0 (M+).

2-Amino-6-chloro-N-,(2-chlorophenyl)benzamide (if) Prepared according to Procedure A using 2-amino-6-chlorobenzoic acid (2.5 g, 14.6 mmol) and SOC12 (2.7 mL, 36.4 mmol) in benzene (75 mL), followed by 2-chloroaniline (3.1 mL, 29.1 mmol) and, CHC13 (75 mL) . The product ch.romatographed in CHzC12 to provide 1.05 g of a yellow orange solid (26%).. 'H
NMR (CDC13) d : 8.54 (d, J=8.1 Hz, 1H) ; 8.30 (br s, 1H); 7.41 (dd, J=1.5, 8.0 Hz, 1H); 7.33 (t, J=7.8 Hz, 1H) ; 7.10 (t, J=8.1 Hz, 1H) ; 7.09 (dt, J=1.6.,, 7.8 Hz, 1H); 6.78 (dd, J=0.4, 7.9 Hz, 1H); 6.63 (dd, J=0.9, 8.2 Hz, 1H) ; 4..69 (br s, 2H). MS (ES) : m/z 303.0 (M+22), 281.0 (M+).

2-Amino-N-(2-chlorophenyl)-6-methylbenzamide (ig) Prepared according to Procedure A using 2-=
.amino-6-methylbenzoic. acid (2.5 g, 16.5 mmol) and SOC12 (3. 0 mL, 41.3 mmol) in. benzene (75 mL) , followed by 2-chloroaniline (3.5 mL, 33.0 mmol) and CHC13 (75 mL). The product was chromatographed in CH2C12 to provide 2.19 g of a brown oil (51%) . 1H
NMR (CDC13) 6: 8.58 (d, J=8.1 Hz, 1H); 7.99 (br s, 1H); 7.40 (dd,.J=1.4, 8.0 Hz, 1H); 7.34 (t, J=7.7 Hz, 1H); 7.11 (t, J=7.8 Hz, 1H); 7.09 (dt, J=1.5, 7.7 Hz, 1H) ; 6.64 (d, J=7.5 Hz, 1H); 6.59 (d, J=8.1 Hz, 1H); 4.29 (br s, 2H) ; 2.45 (s, 3H). MS (ES) :
m/z 283.0 (M+22) .

2-Amino-3-chloro-N-(2-chlorophenyl)benzamide (lh) Prepared according to Procedure A using 2-=amino-3-chlorobenzoic acid (1.0 g,.5.82 mm.ol) and SOC12 (1.1 mL, 14.6 mmol) in benzene (25 mL), followed by 2-chloroaniline (1.2 mL, 11.7 mmol) and CHC13 (25 mL). The product was recrystallized from MeOH to provide 1.29 g of a yellow solid (78%). 1H
NMR (CDCl~} o : 8.43 (dd, J=1.4, 8.3 Hz, 1H) ; 8.30 (br s, 1H); 7.47 (dd, J=1.1, 8.0 Hz, 1H); 7.42 (d, J=8.0 Hz, 2H); 7.33 (dt, J=1.4, 7.9 Hz, 1H); 7.09 (dt, J=1.5, 7.7 Hz, 1H); 6.68 (t, J=7.9 Hz, 1H);
6.13 (br s, 2H). MS (ES) : m/z 281.0 (M+).
2-Amino-N-biphenyl-2-yl-6-chloroben.zamide (Ii) Prepared according to Procedure A. using 2-amino-6-chlorobenzoic acid (2.0 g,.11..7 rnmol) and SOC12 (2.1 mL, 29.3 mmol) in benzene (60 mL) , followed by 2-aminobiphenylamine (4.15 g, 24.5 mmol) and CHC13 (60 mL). The product was chromatographed.
in CH2C12 to provide 2.16 g of a foamy dark-amber residue (57%) . 'H NMR (CDCl,) 5: . 8.48 (d, J=8.2 Hz, 1H); 7.79 (br s, 1H); 7.34-7.46 (m., 6H); 7.20-=7.30 .(m, 2H) ; 7.00 (t, J=8.1 Hz, 1H) ; 6.63 (dd, J=0.6, 7.9 Hz, 1H); 6.54 (d, J=8.3 Hz, 1H); 4.58 (br s, 2H) . MS (ES) : m/z 323.1 (M+) .

.2-Amino-6-chloro-N-o-tolylbenzamide,(lj) Prepared according to Procedure A using 2-amino-6-chlorobenzoic acid (1.0 g, 5.83 mrnol) and SOC12 (1.1 mL, 14.6 mmol) in benzene (30 mL), followed by o-toluidine (1.4 mL, 12.8 mmol) and CHC13 (30 mL) . The product was chromatographed in CH2C12 to provide 840 mg of an oily yellow solid (55%). 'H
NMR (CDC13) 6: 7.96 'd, J=7.9 Hz, 1H); 7.60 (br s, 1H); 7.23-7.30 (m, 2H); 7.14 (t, J=7.5 Hz, 1H); 7.1.1 (t, J=8.3 Hz, 1H); 6,78 (d, J=7.9 Hz, 1H); 6.64 (d, J=8.2 Hz, 1H); 4.73 (br s, 2H); 2.35 (s, 3H). MS
(ES) : m/z 261.0 (M+) 2-Amino-6-chloro-N-(2-fluorophenyl)benzamide (1k) Prepared according to Procedure A using 2-amino-6-chlorobenzoic acid (2.0 g, 11.7 mmol) and SOC12 (2.1 mL, 29.1 mmol) in benzene (60 mL), followed by 2-fluoroaniline (2.3 mL, 23.4 mmol) and CHC13 (60 mL). The product was chromatographed in CH2C12 to provide 1.05 g of a yellow solid (34%) . 'H
NMR (CDC13) 5: 8.45 (t, J=8. 0 Hz, 1H) ; 8 .01 (br s, 1H); 7.02-7.22 (m, 4H); 6.78 (dd, J=0.5, 7.9 Hz, 1H); 6.64 (dd, J=0.8, 8.2 Hz, 1H); 4.73 (br s, 2H).
MS (ES) : m/z 265.0 (M+).

2-Amino-6-chloro-N--(2-methoxyphenyl)benzamide (11) Prepared according to Procedure A using 2-amino-6-chlorobenzoic acid (2.0 g, 1.1.7 mmol) and.
SOC12 (2 .1 mL, 29.1 mmol) in benzene (60 mL) , followed by o-anisidine (2.6 mL, 23.4 mmol) and CHC13 (60 mL). The product, was chromatographed in CH2C1, to provide 2.61 g of a dark yellow oil (81%). 'H NMR
(CDC13) b : 8.53 (dd, J=-I. 7, . 7 . 9 Hz, 1H:) ; 8.39 (br ,s, .1H); 7.11 (dt, J=1.6, 7.8,Hz, 1H); 7.09 (t, J=8,1 .Hz, 1H); 7.02 (dt, J=1.4, 7.8 Hz, 1H); 6.92 (dd, J=1.4, 8.0 Hz, 1H); 6.62 (dd, J=0.9, 8.2 Hz, 1H);
4.66 (br s, 2H) ; 3.87 (s, 3H). MS (ES) : m/z 277.0 (M+).

2-Amino-N-(2-chlorophenyl),-3-trifluoromethylbenz-amide (im) Prepared according to Procedure A using 3-trifluoromethylanthranilic acid (2.0 g, 9.75 mmol) and SOC12 (1.8 mL, 24.4 mmol) in benzene (50 mL), followed by 2-chloroaniline (2.1 mL, 19.5 mmel) and CHC13 (50 mL). The product was purified by recrys-tallization from MeOH to provide 2.38 g yellow crystals (78%) . '-H NMR (CDC13) 5: 8.40 (dd, J=1.4, 8.3 Hz, 1H); 8.25 (br s, 1H); 7.71 (d, J=7.8 Hz, 1H); 7.60 (d, J=7.8 Hz, 1H); 7.43 (dd, J=1.4, 8.0 Hz, 1H); 7.34 (dt, J=1.3, 7.9 Hz, 1H); 7.11 (dt, J=1.5, 7.7 Hz, 1H); 6.77 (t, J=7.8 Hz, 1H); 6.24 (br s, 2H) . MS (ES) : m/z 315.0 (M+) .

3-Aminonaphthalene-2-carboxylic acid (2-chlorophen-yl)amide (in) Prepared according to Procedure A using 3-amino-2-napthoic acid (2.0 g, 10.7 mmol) and SOC1, (1.9 mL, 26.7 mmol) in benzene (50 mL), followed by 2-chloroaniline (2.3 mL, 21.4 mmol) and CHC13 (50 mL). The product was recrystallized from MeOH to provide 1.71 g of a brown solid (549H. 1H N'MR
(CDC13) c5: 10.88 (br s, 1H) ; 9.21.. (s, 1H) ; 8.91 (s, 1H); 8.70 (dd, J=1.0, 8.3 Hz, 1H); 7.95-8.01 (m, 1H); 7.87-7.94 (m, 1H); 7.60-7.68 (m, 2H); 7.41 (dd, J=1.3, 8.0 Hz, 1H); 7.34 (dt, J=1.2, 7.8 Hz, 1H);
7.07 (dt, J=1.4, 7.7 Hz, 1H). MS (ES) : m/z 297.:1.
(M+) 2-Amino-N-(2-chlorophenyl)-4-nitrobenzamide (10) Prepared according to Procedure A using 4-nitroanthranil.ic acid (5.0 g, 27.5 mmol) and SOC12 (5.0 mL, 68.6 mmol) in benzene (150'mL), followed by 2-chloroaniline (5.8 mL, 55.0 mmol) and CHC13 (150 mL). The product was purified by chromatography in CH2C12 followed by recrystallization from MeOH to provide 2.20 g of an orange brown 'solid (31%) . 1H
NMR (CDC13) 5: 8.41(dd, J=1.3, 8.3 Hz, lH); 8.31 (br s, 1H) ; 7.67 (d, j=8.6 Hz, 1H) ; 7.57 (d, J=2.1 Hz, 1H); 7.52 (dd, J=2.2, 8.5 Hz, 1H); 7.44 (dd, J=1.3, 8.1 Hz, 1H); 7.35 (dt, J=1.3, 7.9 Hz, 1H);
7.13 (dt, J=1.4, 7.8 Hz, 1H); 5.88 (br s, 2H). MS
(ES) : m/z 292.0 (M+) .

2-Amino-N-(2-chlorophenyl)-5-hydroxybenzarmide (lp) Prepared according to Procedure A using 2-amino-5-hydroxybenzoic acid (5.0 g, 32.7 mmol) and SOC12 (6.0 mL, 81.6 mmol) in benzene (150 mL) followed by 2-chloroaniline (6.9 mL, 65.4 mmol) and CHC13 (150 mL). The product was purified' by two chromatographz_es in MeOH/CH,C12 to provide 990 mg of a brown solid (12%). 'H NMR (MeOH--d4) 5: 7.92 (dd, J=1.6, 8.1 Hz, 1H); 7.48 (dd, J=1.5, 7.7 Hz, 1H);
7.34 (dt, J=1.5, 7.7 Hz, 1H); 7.20 (dt, J=1.7, 7.7 Hz, 1H); 7.16 (d, J=2.7 Hz, 1H); 6.83 (dd, J=2.7, 8.7 Hz, 1H); 6.76 (d, J=8.7 Hz, 1H); '[6.24 (br s, 2H)). MS (ES) : m/z 263.0 (M+).
2-Amino-N-(2-chlorophenyl)-4,5-difluorobenzamide (lq) Prepared according to Procedure A using 4,5-difluoroanthranilic acid (2.0 g, 11.6 mmol) and SOC12 (2.1 mL; 28.9 mmol) in benzene (60 mL), followed by 2-chloroaniline (2.4 mL, 23.2 mmol) and CHC13 (60 mL) The product was purified by two :chromatographies in CH2C12 and EtOAc/hexanes to pro-vide 769 mg of a yellow solid (23-0.). 1H NMR (CDC13) 5: 8.69-8.82 (m, 1H); 8.00 (dd, J=8.4, 9.0 Hz, 1H);
..7.90 (dd, J=8.9, 12 Hz, 1H) ; 7.39 (dd, J=6.8, 10 Hz, 1H); 6.53 (dd, J=6.6, 12 Hz, 1H); 6.41 (br s, 2H);
5.79 (br s, 1H). MS (ES) : in/z 283.1 (M+).

,2-Amino-N- (2-chlorophenyl) -5-fluorobenzamide (ir) Prepared according to Procedure A using 2-amino-5-fluorobenzoic acid (1.0 g, 6.45 mmo?.) and SOC12 (1.2 mL, 16.1 mmol) in benzene (30 mL), followed by,2-chloroaniline=(1.4 mL, 12.9 mmol) and CHC13 (30 rL) . The product was triturated from CH2C12 to provide 985'mg of a mustard-yellow solid (58%). 1H NMR (CDC13) b: 7.66 (dd, J=2.9, 8.7 Hz, 1H); 7.52-7.55 (m, 1H); 7.32-7.37 (m, 3H); 7.09 (dt, J=3.0, 8.5 Hz, 1H); 6.71 (dd, J=4.3, 8.7 Hz, 1H), MS (ES) : m/z 305.0 (M+40).

Preparation of Intermediate Compounds: Chlorides 2-Chloromethyl-3-(2-chlorophenyl)-6,7-dimethoxy-3H=-quinazo.lin-4-one (2a) Prepared according to Procedure B with Ia (2.95 g, 9.63 mmol) and chloroacetyl chloride (2.3 mL,.28.9 mmol) in acetic acid (30 mL). Purified by extraction from aq. K2CO3 and recrystallization from isopropanol to afford 1.61 g of a brown crystalline 'solid (46%) . 'H NMR (CDC13) 5: 7.59-7.66 (m, 2H) ;
7.45-7.56 (m, 3H); 7.20 (s, 1H); 4.37 (d, J=12 Hz, 1H), 4.08 (d, J=12 Hz, 1H); 4.04 (s, 3H); 4.00 (s, 3H). MS (ES): m/z 365.0 (M+).

6-Bromo-2-chloromethyl-3-(2-chlorophenyl)-3H-quin-azolin-4-one (2b) Prepared according to Procedure B with lb (500 mg, 1.54 mmol) and chloroacetyl chloride (0.37 mL, 4.61 mmol) in acetic acid (10 mL). Purified by recrystallization from isopropanol to afford 490 mg of an off-white solid (83%). 'H NMR (CDC13) 6: 8.43 (d, J=2.3 Hz, 1H); 7.91 (dd, j=2.3, 8.7 Hz, 1H);
7.67 (d, J=8.7 Hz, 1H); 7.60-7.65 (m, 1H); 7.47-7.56 (m, 2H) ; 7.52 (t, J=5.3 Hz, 1H) ; 7.,47-7.56 (m, 1H);
4.37 (d, J=12 Hz, 1H) , 4.06 (d, J=12 Hz, 1H) . MS
(ES) : m/z 385.0 (M+).

2-Chloromethyl-3- (2-chlorophenyl) -7-fluoro-3H-qu:i.n-azolin-4-one (2c) Prepared according to Procedure B with 1c.
(500 mg, 1.89 mmol) and chloroacetyl chloride (0.45 mL, 5.67 mmol) in acetic acid (10 mL). Purified by extraction from aqueous K2C03, followed by recrys-tallization from isopropanol to afford 501 mg of a yellow crystalline solid (82 0) . 'H NMR (CDC13) 6:
8.32 (dd, J=6.0, 8.9 Hz, 1H); 7.59-7.66 (m, 1H);
7.50-7.55 (m, 3H); 7.44 (dd; J=2.4, 9.4 Hz, 1H);
7.27 (dt, J=2.5, 8.5 Hz, 1H) ; 4.37 (d, J=12 Hz, 1H), 4.07 (d, J=12 Hz, 1H). MS (ES): m/z 323.0 (M+).

6-Chloro-2-chloromethyl-3-(2-chlorophenyl)-3H-quin-azolin-4-one (2d) Prepared according to Procedure B with id (500 mg, 1.78 mmol) and chloroacetyl chloride (0.42 mL, 5.33 mmol) in acetic acid (10 mL). Purified by recrystallization from isopropanol=to afford 555 mg of a yellow solid (92%). 'iH NMR (CDC13) 5: 8.27 (d, J=1.9 Hz, 1H)-; 7.74-7.78 (m, 2H);'7.60-7.66 (m, 1H);
7.48-7.57 (m, 3H) ; 4.37 (d, `J=12 H'z, 1H), 4.07 (d, J=12 Hz, 1H). MS (ES) : m/z. 339.0 (M+).
2-Chloromethyl-3-(2-chlorophenyl)-5-fluoro-3H-quin-azolin-4-one (2e) Prepared according to Procedure B with le (500 mg, 1.89 mmol) and chloroacetyl chloride (0.45 mL., 5.57 mmol) in acetic acid (10 mL). Purified by extraction from aq. K2C03 and recrystallization from isopropanol to afford 430 mg of an off-white crystalline solid (70%). '-H NMR (CDC13) d: 7.76 (dt, J=5.3, 8.2 Hz, 1H); 7.56-7.65 (m, 2H); 7.47-7.56 (m, 3H) ; 7.16-7.25 (m, 1H) ; 4.35 (d,. J=12 Hz, 1H), 4.07 (d, J=12 Hz, 1H). MS (ES) : m/z 323.0 (M+) 5-Chloro-2-chloromethyl-=3- (2-chlorophenyl) -3H-quinazolin-4-one (2f) Prepared according to Procedure B with if (1.00 g, 3.56 mmol) and chloroacetyl chloride (0.85 mL, 10.7 mmol) in acetic acid (15 mL). Purified by recrystallization from isopropanol to afford 791 mg of an off-white crystalline solid (65%) . 'H NMR

(CDC13) 6: 7.70 (s, 1H); 7.68 (d, J=3.8 Hz, 1H);
7.61-7.65 (m, 1H); 7.55 (dd, J=2.7, 6.4 Hz, 1H);
7.51 (d, J=3.1 Hz, 1H); 7.50 (s, 2H); 4.35 (d, J=12 Hz, 1H), 4.05 (d, J=12 Hz, 1H). MS (ES): m/z 339.0 (M+).

2-Chloromethyl-3-(2-'chlorophenyl)-5-methyl-3H-quinazolin-4-one (2g) Prepared according to Procedure B with lg (2.18 g, 8.36 mmol) and chloroacetyl chloride (2.0 mL, 25.1 mmol) in acetic acid (40 mL). Purified by two chromatographies -in CH2C12 and EtOAc/hexanes, followed by redrystallization from isopropanol to afford 638 mg of an off-white crystalline solid (24%). 1H NMR (DMSO-d6) 5: 7.73-7'.80 (m, 3H) ; 7.S8-T.64 (m, 3H) ; 7.41 (d, J=7.4 Hz, 1U)=; 4.40 (d, J=12 Hz, 1H), 4.26-('d, J=12 Hz, 1H) 2.74 (s, 3H). MS
(Es) : m/z 319.0 (M+) 8-Chloro-2-ch'loromethyl-3-(2-chlor6phenyl)-3H-quinazolin-4-one (2h.) Prepared according to ProcedureB with lh (500 mg, 1.78 mmol) and chloroacetyl chloride (0.49 mL, 6.13 mmol) in acetic acid (10 mL). Purified. by extraction from aqueous K2CO3, followed by recrys-tallization from .isopropanol to afford 448 mg of a yellow solid (74%) . 1H NMR (CDC13) 5: 8.23 (dd, J=1.4, 8.0 Hz, 1H); 7.90 (dd, J=1.4, 7.8'Hz, 1H);
7.61-7.66 (m, 1H); 7.51-7.55 (m, 3H); 7.47 (t, J=8.0 Hz, 1H) ; 4.48 (d, J=12 Hz, 1H), 4.12 (d, J=12 Hz, IH). MS (ES): m/z 339.0 (M+)., 3-Biphenyl-2-yl-5-chloro-2-chloromethyl-3H-quinazo-lin-4-one (2i) Prepared according to Procedure B with 1i (2.0 g, 6.20 mmol) and chloroacetyl chloride (1.5 mL, 18.6 mmol) in acetic acid (30 mL). Purified by chromatography in CH2C12, followed by recrystalli-zation from isopropanol to afford 1.44 g of an off-white solid (61%) . iH NMR (CDC13) 5: 7.61-7.64 (m, 1H); 7.58-7.59 (m, 1H); 7.54-7.57 (m, 2H); 7.52-7.53 (m, 1H); 7.45-7.52 (m; 2H); 7.24 (s, 5H);' 3.92-4.03 (m, 2H) . -MS (ES) : m/z 381.0 (M+) .
5-Chloro-2-chloromethyl-3-o-tolyl-3H--quinazolin-4-one (2j) Prepared, according to Procedure B with 1;
(750 mg, 2.88 mmol) and chloroacetyl chloride (0.69 mL, 8.63 mmol) in acetic acid (15 mL). Purified by chromatography in CH2C12, followed by recrystalli-zation from isopropanol to afford 340 mg of a white solid (37%). 1H NMR (CDC13) 6: 7.69 (d, J=2.1 Hz, 1H); 7.68 (q, J=7.4 Hz, 1H); 7.54 (dd, J=2.2, 7.0 Hz, 1H); 7.35-7.47 (m, 3H);-7.21-7.25 (m, 1H); 4.27 (d, J=12 Hz, 1H); 4.11 (d, J=12 Hz, 1H); 2.18 (s, 3H} . MS (ES) m/z 319.0 (M+).
5-Chloro-2-chloromethyl-3-(2'-fluorophenyl)-3H-quinazolin-4-one (2k) Prepared according to Procedure B with 1k (1.0 g, 3.78 mmol) and chloroacetyl, chloride (0.90 mL, 11.3 mmol) in acetic acid (20 rnL). Purified by chromatography in CH2C12 to afford 484 mg of a pale pink solid (40%). 1H NMR (CDC13) d: 7.69 (s, 1H) ;
7.68 (d, J=3.2 Hz, 1H); 7.56 (d, J=3.0 Hz, 1H); 7.54 (d, J=3.0 Hz, 1H); 7.40-7.47 (m, 1H); 7.35-7.38 (m, 1H); 7.27-7.32 (m, 1H); 4.35 (d, J=12.Hz, 1H); 4.18 (d, J=12 Hz, 1H). MS (ES) : m/z 323.0 (M+/).

5-Chloro-2-chloromethyl-3-(2-methoxyphenyl)-3H-quinazolin-4-one (21) Prepared according to Procedure B with 11 (2.6 g, 9.41 mmol) and chloroaeetyl chloride (2.2 mL, 28.2 mmol) in acetic acid (40 tnL). Purified by chromatography in CH2C12, followed by recrystalli-zation from isopropanol to afford 874 mg of a pale yellow solid (28%). 1H NMR (CDC13) 5: 7.55-7.74 (m, 2H); 7.47-7.54 (m, 2H); 7.34 (dd, J=1.7, 7.8 Hz, 1H); 7.13 (dt, J=1.2', 7.7 Hz, 1H) 7.08 (dd, J=1.0, 8.4 Hz, 1H) ; 4.29 (d, J=12 Hz, 1H) ; 4,11 (d, J=12 Hz, 1H) ; 3.80 (s, 3H). MS ' (ES) : m/z 335.0 (M+).
2-Chloromethyl-3- (2-'chlorophenyl) -8-trifluoromethyl-3H-quinazolin-4-one (2m) Prepared according co Procedure B with im (500 mg, 1.59 mmol) and chloroacetyl. chloride (0.38 mL, 4.77 mmol) in acetic acid (10'irmL). Purified by recrystallization from isopropanol to afford 359 mg of a white crystalline solid (61%). 1H NMR (CDC13) d: 8.51 (dd, J=1.0, 8.0 Hz, 1H); 8.14 (d, J=7.3 Hz, 1H); 7.65 (dd, J=2.5, 5.6 Hz, 1H); 7.62 (d, J=3.9 Hz, 1H'); 7.48-7.60 (m, 3H) ; 4'.44 (d, J=12 Hz, 1H), 4.12 (d, J=12 Hz, 1H) . MS (ES) : m/z 373.0 (M+) .

2-Chloromethyl-3-(2-chlorophenyl)-3H-benzo[g]quin-.azolin-4-one (2n) Prepared according to Procedure B with In (500 mg, 1.68 mmol) and chloroacetyl chloride (0.40 mL, 5.05 mmol) in acetic acid (10 mL). Purified by chromatography in CH2C12 followed by recrystalli-zation from isopropanol to afford 232 mg of a light-brown solid (39%). 1H NMR (CDC13) 5: 8.92 (s, 1");
8.29 (s, 1H); 8.81 (d, J=8.3, 1H);'.8.32 (d, J=8.3 -Hz, 1H); 7.51-7.69 (m, 4H); 7.55 (d, J=5.2 Hz, 1H) 7.53 (d, J=3.8 Hz, 1H); 4.43 (d, J'=12 'Hz, 1H), 4,.12 (d, J=12 Hz, 1H). MS (ES) : m/z 355.0 (M+).
2-0hloromethyl-3-(2-chlorophenyl)-7-.nitro-3H-quin-' azolin-4-one (2o) Prepared according to Procedure B with Io (500 mg, 1.71 mmol) and chloroacetyl-chloride (0.4:1.
mL, 5.14 mmol) in acetic acid (10 mL).. Purified by extraction from aqueous K2CO3. followed by two chromatographies in CH2C12 to afford 338 mg of a yellow oil (56%). 1H NMR (CDC13) C5.: 8.64 (d, J=2.2 Hz, 1H); 8.48 (d, J=8.8 Hz, 1H); 8.32 (dd, J=2.2, 8.7 Hz, 1H); 7.66 (dd, J=2.5, 6.0 Hz, 1H); 7.52-7.59 (m, 3H) ; 4.41 (d, J=12 Hz, 1H), 4.10 (d, J=12 Hz, 1H). MS (ES) : m./z 350.0 (M+).

.Acetic acid 2-chloromethyl-3-(2-chlorophenyl)-4-oxo-3,4-dihydro-quinazolin-6-yl ester (.2p) Prepared according to Procedure,B with lp (670 mg, 2.55 mmol) and chloroacetyl chloride (0.61 mL, 7.65 mmol) in acetic acid (10 mL). Purified by chromatography in 0-3% MeOH/CH2C12, followed by recrystallization from isopropanol to afford 523 mg of the acetate as pale-peach crystals (57%). 'H NMR
(CDC13) c6: 8.00 (d, J=2.7 Hz, 1H); 7.82 (d, J=8.8 Hz, 1H); 7.60-7.66 (m, 1H); 7.56 (dd, J=2.7, 8.8 Hz, 1H); 7.51 (t, J=4.7 Hz, 2H) ; 7.50 (s, 1H); 4.38 (d, J=12 Hz, 1H) , 4.,08 (d, J=12 Hz, 1H) ; 2.36 (s, 3H) MS (ES), m/z 363.0 (M+).
2-Chloromethyl-3-(2-chlorophenyl)-6,7-difluoro-3H-quinazolin-4-one (2q) Prepared according to Procedure B with lq (700 mg, 2.48 mmcl) and chloroacetyl chloride (0.60 ML, 7.43 mmol) in acetic acid (12 mL).- Purified by chromatography in CH2C12, followed by recrystalli-zation from isopropanol to afford 219 mg of a yellow crystalline solid (26%). 'H NMR. (CDC13) 6: 8.07 (dd, J=8.5, 9.7 Hz, 1H); 7.64 (dd, J=2.5, 5.6 Hz, iH); 7.60 (dd, J=3.5, 11 Hz, 1H); 7.55-(q, J=2.9 Hz, 3H); 7.52 (d, J=1.9 Hz, 1H)"; 7.49-7.51 (m, 1H); 4,36 (d, J=12 Hz, 1H), 4.06 (d, J=12 Hz, 1H). MS (ES') :
m/z 341.0 (M+) .

2-Chloromethyl-3-(2-chlorophenyl)-6-fluoro-3H-quinazolin-4-one (2r) Prepared according to Procedure B with it ,(850 mg, 3.21 mmol) and chloroacetyl chloride (0.77 mL, 9.63 mmol) in acetic acid (15 mL). Purified by extraction from aqueous K2CO3, followed by chromatog-raphy in EtOAc/hexanes. A second chromatography in acetone/hexanes afforded 12'5 mg of a white solid (12%) . 1H NMR (CDC13) 5: 7.95 (dd, J=2.9, 8.2 Hz, 1H); 7.81 (dd, J=4.8, 9.0 Hz, 1H);.7.61-7.66 (m, 1H); 7.57 (dd, J=2.7, 8.6 Hz, 1H); 7.57 (dd, J=2.7, 8.6 Hz, 1H); 7.52 (dd, J=3.2, 6.9 Hz, 1H); 7.52 (br s, 2H); 4.38 (d, J=12 Hz, 1H), 4.08 (d, J=12 Hz, 1H). MS (ES) : m/z 323.0 (M+) .

Preparation of PI3Kb Inhibitor Compounds Compound D-001 2-(6-Aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-6,7-dimethoxy-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2a (200 mg, 0.546 mmol), adenine (81 mg, 0.601 mmol), K2C03 (83 mg, 0.601 mmol) , and DMF
(4 mL). The crude product was recrystallized from ethanol (EtOH) to provide 164 mg of a beige solid (650-.), mp 281.5-282.7 C (decomposes) . 1H NMR (DMSO-d6) b: 8.06 (s, 1H) ; 8.04 (s, 1H) ;' 7.76-7.81 (m, 1H); 7.70-7.76 (m, 1H); 7.60-7.67 (m, 2H); 7.45 (s, 1H) ; 7.22 (s, 2H) ; 6.90 (s, 1H) ; 5.08 (d, J=17 Hz, 1H) ; 4.91. (d, J=17 Hz, 1H) ; 3.87 (s, 3H) ; 3.87 (s, 3H). 13C NMR (DMSO-d6) ppm: 159.9, 156.2, 155.4, 152.9, 150.0, 149.7, 149..4, 143.0, 141.9, 133.7, 132.1, 131.9, 131.2, 130.8, 129.3, 118.4, 113.6, 108.4, 105.8, 56.5, 56.1, 44.7. MS (ES): m/z 464.1 (M+). Anal. calcd. for C22H3.8ClN7O3=0.1C2HEOØ05KCl:
C, 56.47; H, 3.97; Cl, 7.88; N, 20.76. Found: C, 56.54; H, 4.05; Cl,"7.77; N, 20.55.

Compound D-002 2-(6-Aminopurin-o-ylmethyl)-6-bromo-3-(2-chlorophenyl)-,3H-quinazolin-4-cne Prepared according to Procedure C using Intermediate 2b (100 mg, 0.260 mmol), adenine (39 mg, 0.286 mmol) , K2CO3 (40 mg, 0.286 mmol) , and DMF
(2 mL). The crude product was recrystallized from EtOH to provide 52 mg of an off-white solid (41%), mp 284.2-284.7 C (decomposes). 'H NMR (DMSO-d6) 5:
8.24 (d, J=2.0 Hz, 1H); 8.05 (s, 1H); 8.03 (s, 1H);
7.98 (dd, J=1.9, 8.6 Hz, 1H); '7.74-7.83 (m, 2H);
7.59-7.68 (m, 2H); 7.46 (d, J=8.7 Hz, 1H); 7.22 (s, 2H); 5.12 (d, J=17 Hz, 1H); 4.94 (d, J=17 Hz, 1H).
13C NMR (DMSO-d6) ppm: 159.5, 156.2, 152.9, 152.0, 150.1, 145.8, 141.8, 138.4, 133.1, 1:32.2, 1.31.9, 131.1, 130.9, 130.1, 129.4, 128.9, 122.4, 120.4, 118.4, 45Ø MS (ES): m/z 482.0 (M+). Anal, calcd.
for C20H13ClBrN7O90.1KC1: C, 49.01; H, 2.67; Cl, 7.96; N, 20.00. Found: C, 48.82; H, 2.82; Cl, 8.00;
N, 19.79.

Compound D-003 '2-(6-Aminopurin-o-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2c (100 mg, 0.310 mmol), adenine (46 mg, 0.340 mmol) , K2CO3 (47 mg, 0.34Q mmol) , and DMF
(1 mL). The crude product was recrystallized from EtOH to provide 57 mg of a beige solid (44%), mp 216.8-217.2 C. 1H NMR (DMSO-d6) 5: 8.22 (dd, J=6.3, 8.7 Hz, 1H) ; 8.05 (s, 1H) ; 8.03 (s, 1H) ; '7.78-7.80 (m, 2H); 7.61-7.64 (m, 2H); 7.46 (dt, J=2.1, 8.6 Hz, 1H) ; 7.32 (d, J=9.8 Hz, 1H) ; 7.22 .(s, 2H),; 5.13 (d, J=17 Hz, 1H); 4.95 (d, J=17 Hz, 1H). 13C NMR (DMSO-d6) ppm: 166.1 (d, J=253 Hz), 159.6, 155.8, 152.5, 149.7, 148.6 (d, J=14 Hz), 141.4, 132.8, 131.8, 131.6, 130.8, 130.5,129.8 (d, J=11 Hz), 129.0, 118.1, 117.4, 116.2 (d, J=24 Hz), 112.7 (d, J=22 Hz), 44.6. MS (ES) : m/z 422, 0 (M ) . Anal. calcd.
for C20H13C1FN70=0. 1H20 (0 . 15KC1 : C, 55.25; ' H, 3.06;
Cl, 9.38; N, 22.55. Found: C, 55.13; H, 2.92; Cl, 9.12; N, 22.30.

Compound D-004 2-(6-Aminopurin-9-ylmethyl)-6-chloro-3-(2-=
chlorophenyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2d (100 mg, 0.294 mmol), adenine (44 mg, 0.323 mmol) , K2C03 (45 mg, 0. 323 mmol) , and DMF
(1 mL). The crude product was rectystall zed from.
EtOH to provide 50 mg of a yellow solid (39%), mp 294.5-294.8 C (decomposes). 1H NMR (DMSO-d5) 5:
8.10 (d, J=2.2 Hz, 1H); 8.05 (s, 1H); 8.03 (s, 1H);
7.86 (dd, J=2.4, 8.8 Hz, 1H); 7.75-7.82 (m, 2H);
7.59-7.67 (m, 2H); 7.53 (d, J=8.7 Hz, 1H); 7.22 (br s, 2H); 5.13 (d, J=17 Hz, 1H); 4.95 (d, J=17 Hz, 1H). 13C NMR (DMSO-d6) ppm: 159.7, 156.2, 152.9, '151.9, 150.1, 145.5, 141.8, 135.7, 133.1, 132.3, 132.2,,131.9, 131.1, 130.9,'130.0,'129.4, 125.9, 122.0, 118.4, 44.9. MS (ES): m/z 438.0 (M ) . Anal.
calcd. for C20H13C12N70: C, 54.81; H, 2.99; N, 22.37.
Found: C, 54.72; H, 2.87; N, 22.18.

Compound D-005 2-(6-Aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2e (200 mg, 0.619 mmol), adenine (92 mg, 0.681 mmol) , K2CO3 (94 mg, 0.680 mmol) , and DMF
(4 mL). The crude product was chromatographed in MeOH/CH2C12 to provide 168 mg of an off-white solid (64%), mp 159-172 C (gradually decomposes) . 1H NMR
(DMSO-d6) 6: 8.10 (s, 1H) ; 8.08 (s, 1H) ; '7.73-7.89 (m, 3H); 7.57-7.71 (m; 2H); 7.37-7.48 (m, 2H); 7.34 (d, J=11 Hz, 1H); 7.30 (d, J=8.3 Hz, 1H);. 5.14 (d, J=17 Hz, 1H) ; 4.94 (d, J=17 Hz, 1H) . 13C NMR (DMSO-d6) ppm: 160.8 (d, J=264 Hz), 157.5 (d, J=4.2 Hz), 155.8, 152.4, 152.4, 150.0, 148.7, 142.1, 136.4 (d:
J=11 Hz), 133.0, 132.2, 132.1, 131.2, 130.9, 129.4, 123.8 (d, J=3.6 Hz), 118.4, 114.5 (d, J=20 Hz), 110.2 (d, J=6.0 Hz), 44.9. MS (ES) : m/z 422.0 (M+).
Anal. calcd. for C20H13C1FN70: C, 56.95; H, 3.11; Cl, 8.40; N, 23.24. Found: C, 54.62; H, 3.32; Cl, 9.40;
N, 21.29.

Compound D-006 2-(6-Aminopurin-o-ylmethyl)-5--chloro-3-(2--chlorophenyl)-3H-quinazolin-4--one Prepared according to Procedure C using Intermediate 2f (300 mg, 0.883 mmol), adenine (131 mg, 0.972 mmol) , K2CO3 (134 tng, 0.972 mmol.) , and DMF
(4 mL). The crude product was chromatographed in MeOH/CH2C12 and recrystallized from EtOH to provide 188 mg of a pale orange crystalline solid (49%), mp 245.7-246.0 (starts to sweat at 220 C). 1H NMR
(DMSO-d6) d : 8.06 (.s, 1H);.8.04 (s, 1H) ; 7.76-7.81 (m, 2H); 7.72 (d, J=8.0 Hz, 1H); 7.59-7.66 (m, 3H);
7.41 (d, J=8.1 Hz, 1H); 7.26 (br s, 2H); 5.11 (d, J=17 Hz, 1H) ; 4'.93 (d, J=17 Hz, 1H). 13C NMR (DMSO-d6) ppm: 158.5, 156.2, 152.9, 152.2, 150.1, 149.2, 141.8, 135.4, 133.3, 133.2, 132.1, 132.0, 131.2, 130.9, 130.4, 129.4, 127.3, 118.4, 11.7.7, 44.9. MS
(ES) : m/z 438.0 (M+). Anal. calcd. for C20H13C12N70= 0 . 1C2H60' 0 . 05H20: C, 54.67;* H, 3.11; Cl, 15.98; N, 22.09. Found: C, 54.35; H, 3.00; Cl, 15.82; N, 22.31.

Compound D-007 2 - (6 -Aminopurin- 9 -ylmethyl) - 3 (2 - chloropherivl) - 5 -methyl-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2g (250 mg, 0.783 mmol), adenine (116 mg, 0.862 mmol) , K2CO3 (119 mg, 0.862 mmol) , and DMF
(4 mL) The crude product was recrystallized 'from EtOH to provide 93 mg of a pale yellow solid (280), nip 190.7-190.9 C. 1H NMR (DMSO-d6) o: 8.05 (s, 1H) ;
8.03 (s, 1H); 7.76-7.79 (m, 1H); 7..71-7.74 (m, 1H);
7.59-7.67 (m, 1H); 7.34 (d, J=7.4 Hz, 1H); 7.28 (d, J=8.2 Hz, 1H); 7.24 (br s, 2H); 5.07 (d, J=17 Hz, 1H) ; 4.92 (d, J=17 Hz, 1H) ; 2.73 (s, 3H). 13C NMR
=(DMSO-d6) ppm: 161.1, 156.2, 152.8, 150.9, 150.1, 148.3, 141.9, 141.0, =134.6, 133.6, 132.2,'131.9, 131.3, 130.8, -130.3, 129.3, 125.9,=119.1, 118.4, 44.8, 22.8. MS (ES) m/z 418.1 (M+). Anal. calcd.
for C21H,6C1N7O=H20: C, 57.87; H, 4=.16; Cl, 8.13; N, 22.49. Found: C, 57.78; H, 3.99; Cl, 8.38; N, 22.32.

Compound D-008 2- (6-Aminopurin'-9-ylmethyl) -8-chloro-3- (2-chlorophenyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2h (100 mg, 0.294 mmol), adenine (44 mg, 0.324 mmol), K2CO3 (45 mg, 0.324 mmol), and DMF
(1 mL). The crude product was chromatographed in MeOH/CH2C12 to provide 50 mg of a pale yellow solid (39%), mp 273.3-273.5 C (discolors). 1H NMR (DMSO-d6) 5: 8.11 (dd, J=1.3, 8.0 Hz, 1H); 8.08 (s, 1H);
8.05 (s, 1H) ; 8.00 (dd, J=.1.3, 7.8 Hz, 1H) ; 7.79-7.83 (m, 2H) ; 7.63-7.66 (m, 2H) ; 7.56 (t, J=7.9 Hz, 1H); 7.21 (br s, 2H); 5.17 (d, J=17 Hz, 7.H); 4.97 (d, J=17 Hz, 1H). 13C NMR (DMSO-d6) ppm: 160.2, 156.1, 152.8, 152.2, 150.2, 143.3, 142.0, 135.6, 133.1,.132.3, 131.9, 131.1,131.0, 130.9, 129.4, 128.4, 126.0, 122.5, 118.4, 45Ø MS (ES): m/z 438.0 (M ). Anal. calcd. for C20H13C12N7O=0 . 1CH40.0 . 6H20 (0 . 15KC1 : ' C, 52.09; H, 3.18; N, 21.15. Found: C, 51.85; H, 2.93; N, 21.01.
Compound D-009 2-(6-Aminopurin-9-ylmethyl)-3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2i (400. mg, 1.05 mmol), adenine (155 mg, 1.15 mmol), K2C03 (159 mg, 1.15 mmol), and DMF (5 mL). The crude product was recrystallized from EtOH

to provide 344 mg of a white solid (680), mp 299.9-300.1 C (discolors). 'H NMR (DMSO-d6) 5: 8.08 (s, 1H); 7.89 (s, 1H); 7.58-7.73 (m, 5H); 7.51 (d, J=7.9 Hz, 1H) ; 7.46 (d, J=7.5 Hz, 2H) ; 7.27-7.41 (m, 3H) ;
7.14-7.27 (m, 3H); 5.14 (d, J=17 Hz, 1H); 4.82 (d, J=17 Hz, 1H). 13C NMR (DMSO-d6) ppm: 159.6, 156.2, 152.8, 152.5, 150.0, 149.0, 141.7, 140.2, 137.7, 135.0, 133.3, 133.2, 131.8, 130.7, 130.1, 129.8, 129.5, 128.8, 128.6, 1.28.4, 127.1, 118.4, 117.6;
45.3. MS (ES): m/z 480.1 (M+). Anal. calcd. for C26H18C1N70: C, 65.07; H, 3.78; Cl, 7.39; N, 20.43.
Found: C, 64.77; H, 3.75; Cl, 7.43; N, 20.35.
Compound D-010 5-Chloro-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2j (200 mg, 0.626 mmol), 6-mercaptopurine monohydrate (93 mg, 0.546 mmol), K,C03 (95 mg, 0.689 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 125 mg of an off-white solid (46%), mp 213.9 C. 'H NMR
(DMSO-d6) 5: 13.53 (br s, 1H) ; 8.49 (s, 1H) ; 8.44 (s, 1H); 7.78 (t, J=7.9 Hz, 1H); 7.63 (d, J=8.2 Hz, 111); 7.59 (d, J=7.7 Hz, 1H) ; 7.49 (d, J=6.9 Hz, 1H) ;
7.24-7.41 (m, 3H); 4.32-4.45 (m, 2H); 2.14 (s, 3H).
z3C NMR (DMSO-d6) ppm: 158.9, 157.2, 154.2, 151.5, 149.7, 149.6, 143.5, 136.1, 135.9, 135.1, 133.2, 131.3, 130.3, 130.0, 129.9, 129.1, 127.6, 127.1, 117.8, 32.4, 17.5. MS (ES)': m/z 438.0 (M+']. Anal.
calcd. for C2iH,5C1N6OS: C, 58.00; H, 3.48; Cl, 8.15;

N, 19.32; S, 7.37. Found: C, 58.05; H, 3.38; Cl, 8.89; N, 18.38; S, 7.00.

Compound D-011 5-Chloro-3-(2-fluorophenyl)-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2k (210 mg, 0.650 mmol), 6-mercapto--purine monohydrate (122 mg, 0.715 mmol),=K2C03 (99 mg, 0.715 mmol), and DMF (4 mL).. The crude product was recrystallized from EtOH to provide 240 mg of an off-white solid (84%), mp 244.0 C. 1H NMR (DMSO-d6) b: 13.56 (br s, 1H); 8.50 (s, 1H); 8.45 (s, 1H);
7.81 (t, J=8.0 Hz, 1H) ; 7.74 (t, J=7.7 Hz, 1H) ; 7.67 (d, J=8.1 Hz, 1H); 7.62 (d, J=7.7 Hz, 1H); 7.46-7.55 (m, 1H) ; 7.29-7.42 (m, 2H) ; 4.47-4.59 (m, 2H). 13C
NMR (DMSO--d6) ppm: 158.4, 157.3 (d, J=249 Hz), 156.4, 153.8, 151.0, 149.1, 143.2, 135.0, 132.9, 131.8 (d, J=8.0 Hz), 130.8, 129.9, 126.7, 125.3 (d, J=3.5 Hz), 123.6 (d, J=13 Hz), 117.0, 116.2 (d, J=19 Hz), 31.7. MS (ES): m/z 439.0 (M+). Anal. calcd.
for C20H12ClFN6OS: C, 54.74; H, 2.76; Cl, 8.08; N, 19.15; S, 7.31. Found: C, 54.42; H, 2.88; Cl, 8.08;
N, 18.87; S, 7.08.

Compound D-012 2-(6-Aminopurin-9-ylmethyl)-5-chloro-3-(2-fluorophenyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2k (210 mg, 0.650 mmol), adenine (97 mg, 0. 715 mmol) , K2CO3 (99 mg, 0. 715 mmol) , and DMF
(4 mL). The crude product was recrystallized from EtOH to provide 137 Mg of a tan solid. (501), mp 295.6-295.8 C (decomposes). 1H NMR (DMSO-d6) 5:
8.05 (s, 1H) ; 8.04 (s, 1H) ; 7.75 (t, J=7.6 Hz, 1H) ;
7.74 (t, J=7.9 Hz, 1H) ; 7.62-7.69 (m, 1H) ; 7.61 (d, J=7.6 Hz, 1H) ; 7.47-7.55 (m, 1H) ; 7.48 (d, J=7.8 Hz, 1H); 7.41 (d, J=8.0 Hz, 1H); 7.24 (br s,'2H); 5.19 (d, J=17 Hz, 1H); 5.03 (d, J=17 Hz, 1H). '-3C NMR
(DMSO-d6) ppm: 158.7, 157.6 (d, J=250 HQ, 156.2, 152.8, 152.4, 150.0; 149.2, 141.8, 135.4, 133.3, 132.5 (d, J=8.0 Hz), 131.0, 130.4, 127.3, 12V2 (d, J=3.5 Hz), 123.1 (d, J=14 Hz), 118.4, 117.6, 117.2 (d, J=19 Hz), 45.1. MS (ES): m/z 422.0 (M-). Anal.
calcd. for C20H13ClFN70=0.05C2H60: C, 56.92; H, 3.16;
Cl, 8.36; N, 23.12. 'Found: C, 56.79; H, 3.20; Cl, 8.46; N, 22.79.

Compound D-013 3-Biphenyl-2-yl-5-chloro-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2i (400 mg, 1.05 mmol), 6-mercapto-purine monohydrate (196 mg, 1.15 mmol.), KZC03 (159 mg, 1.15 mmol), and DMF (5 mL). The crude product was chromatographed in MeOH/CH2C12 and subsequently recrystallized from EtOH to provide 439 mg of a pale yellow crystalline solid (84%), mp 222.0-222.5 C
(dec) . 'H NMR (DMSO-d6) d: 13.56 (br s, 1H) ; 8.55 (s, 1H); 8.45 (s, 1H); 7.73 (t, J=8.0 Hz, 1H); 7.64 (d, J=7.7 Hz, 1H); 7.50-7.59 (m, 4H); 7.41-7.48 (m, 1H); 7.25-7.38 (m, 5H); 4.41 (d, J=16 Hz, 1H); 4.16 (d, J=16 Hz, 1H). 13C NMR (DMSO-d6) ppm: 160.2, 157.0, 153.7, 151.5, 149.7, 149.3, 143.5, 139.9, 137.8, 135.1, 134.1, 133.3, 131.5, 130.5, 130.3, 130.1, 129.1, 128.9, 128.4, 128.4, 126.9, 117.5, 32.3. MS (ES): m/z 497.0 (M+). Anal. calcd. for C26H17C1N60S: C, 62.84; H, 3.45; Cl, 7.13; N, 16.91;
S, 6.45. Found: C, 62.60; H, 3.47; Cl, 7.15; N, 16.65; S, 6.41.

Compound D-014 5-Chloro-3-(2-methoxyphenyl)-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 21 (250 mg, 0.746 mmol), 6-mercapto-purine monohydrate (140 mg, 0.821 mmol), K2CO3 (113 mg, 0.821 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 254 mg of an off-white solid (76%), mp 237.0 C (dec; discolors at 154.60C). 1H NMR (DMSO-d6) 5: 13.53 (br s, 1H) ;
8.52 (s, 1H); 8.45 (s, 1H); 7.78 (t, J=7.9 Hz, 1H);
7.64 (d, J=8.0 Hz, 1H); 7.59 (d, J=7.7 Hz, 1H); 7.48 (d, J=7.3 Hz, 1H); 7.42 (t, J=7.7 Hz, 1H); 7.15 (d, J=8.2 Hz, 1H); 7.03 (t, J=7.5 Hz, 1H); 4.45 (s, 2H);
3.76 (s, 3H). 13C NMR (DMSO-d6) ppm: 158.9, 157.1, 154.8, 154.7, 151.5, 149.6, 143.6, 135.1, 133.2, 131.3, 130.4, 130.0, 127.0, 124.8, 121.2, 117.8, 112.7, 56.1, 32Ø MS (ES): m/z 451.0 (M+). Anal.
calcd. for C21H,5C1N6O2S=0.15C2H60=0.05KC1: C, 55.43;
H, 3.47; Cl, 8.07; N, 18.21; S, 6.95. Found: C, 55.49; H, 3.68; Cl, 7.95; N, 17.82; S, 6.82.
Compound D-015 3-(2-Chlorophenyl)-5-fluoro-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2e (200 mg, 0.619 mmol), 6-mercapto-purine monohydrate (116 mg, 0.681 mmol), K2C03 (94 mg, 0.681 mmol), and DMF (5 mL). The crude product was recrystallized from EtOH to provide 152 mg of a white solid (56%), mp 222.7-223.8 C (discolors). 1H
NMR (DMSO-d6) 5: 13.56 (br s, 1H) ; 8.48 (s, 1H) ;
8.44 (s, 1H) ; 7.89 (dt, J=5.6, 8.1 Hz, 1H) ; 71.76 (dd, J=1.6, 7.3 Hz, 1H); 7.67 (d, J=7.4 Hz, 1H);
7.56 (d, J=8.1. Hz, 1H) ; 7.47 (t, J=7.1 Hz, 1H), 7.41-7.53 (m, 2H); 7.37 (dd, J=8.7, 11 Hz, 1H);
4.38-4.52 (m, 2H). 13C NMR (DMSO-d6) ppm: 160.9 (d, J=264 Hz), 157.6, 156.8, 154.1, 151.5, 149.6, 149.0, 143.6, 136.4 (d, J=11 Hz), 133.9, 132.2, 131.7, 131.6, 130.5, 130.2, 128.8, 123.6, 114.4 (d, J=20 Hz), 110.2, 32Ø MS (ES): m/z-439.0 (M+). Anal.
calcd. for C20H12ClFN6OS=0.5C2H60: C, 54.61; H, 3.27;
Cl, 7,.68; N, 18.19; S, 6.94. Found: C, 54.37; H, 3.26; Cl, 7.89; N, 18.26; S, 6.55.

Compound D-016 3-(2-Chlorophenyl)-6,7-dimethoxy-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2a (200 mg, 0.546 mmol), 6-mercapto-purine monohydrate (102 mg, 0.601 mmol), K2C03 (83 mg, 0.601 mmol), and DMF (5 mL). The crude product was recrystallized from EtOH to provide 172 mg of an off-white solid (65%), mp 160-180 C (gradually decomposes). 1H NMR (DMSO-d6) 5: 13.55 (br s, 1H) ;
8.49 (s, 1H) ; 8.44 (s, 1H) ; 7.72 (d, J=6.9 Hz, 1H) ;
7.66 (d, J=6.9 Hz, 1H) 7.38-7.54 (m, 3H); 7.22 (s, 1H) ; 4.36-4.52 (m, 2H) ; 3.94 (s, 3H) ; 3.89 (s, 3H).
13C NMR (DMSO-d6) ppm: 160.1, 155.4, 151.5, 151.1, 149.4, 143.2, 134.6, 132.3, 131.6, 131.5, 130.4, 128.7, 113.6, 108.4, 105.8, 56.5, 56.1, 32Ø MS
(ES): m/z 481.1 (M+). Anal. calcd. for C22H17C1N603S=0 . 5C2H60=0 . 05KC1 : C, 54.41; H, 3.97; Cl, 7.33; N, 16.55; S, 6.32. Found: C, 54.43; H, 3.94;
Cl, 7.69; N, 16.69; S, 6.52.

Compound D-017 6-Bromo-3-(2-chlorophenyl)-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2b (200 mg, 0.519 mmol), 6-mercapto-purine monohydrate (97 mg, 0.570 mmol), K2CO3 (79 mg, 0.572 mmol), and DMF (5 mL). The crude product was recrystallized from EtOH to provide 123 mg of an off-white solid (47%), mp 212-242 C (gradually decomposes) . 1H NMR (DMSO-d6) 5: 13.07 (br s, 1H) ;

8.48 (s, 1H); 8.44 (s, 1H); 8.24 (d, J=2.3 Hz, 1H);
8.06 (dd, J=2.3, 8.7 Hz, 1H); 7.76 (dd, J=1.9, 7.4 Hz, 1H) ; 7.70 (d, J=8.7 Hz, 1H) ; 7.66 (d, J=8.1 Hz, 1H); 7.51 (dd, J=2.1, 7.9 Hz, 1H); 7.46 (dd, J=1.9, 7.9 Hz, 1H) ; 4.47 (s, 2H) . 13C NMR (DMSO-d6) ppm:
159.7, 156.8, 153.6, 151.5, 146.1, 143.6, 138.5, 134.0, 132.1, 131.8, 131.5, 130.5, 130.2, 129.9, 128.9, 128.8, 122.2, 120.3, 32Ø MS (ES): m/z 499.0 (M+). Anal. calcd. for C20H12C1BrN6OS=0.2C2H60Ø05KC1: C, 47.79; H, 2.59; N, 16.39; S, 6.25. Found: C, 47.56; H, 2.54; N, 16.25;
S, 6.58.

Compound D-018 3-(2-Chlorophenyl)-(9H-purin-6-ylsulfanylmethyl)-trifluoromethyl-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2m (200 mg, 0.536 mmol), 6-mercapto-purine monohydrate (100 mg, 0.588 mmol), K2CO3 (82 mg, 0.593 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 148 mg of a white solid (56%), mp 218.5-219.4 C. 1H NMR (DMSO-d6) 5: 13.52 (br s, 1H) ; 8.48 (s, 1H) ; 8.44 (s, 1H) ; 8.43 (d, J=6.0 Hz, 1H) ; 8.26 (d, J=7.5 Hz, 1H) 7.84 (dd, J=2.5, 6.7 Hz, 1H); 7.70-7.75 (m, 2H);
7.51-7.59 (m, 2H) ; 4.40-4.55 (m, 2H). 13C NMR (DMSO-d6) ppm: 160.0, 157.2, 154.2, 151.4, 149.6, 144.4, 143.4, 133.8, 133.0 (q, J=5.1 Hz), 132.0, 131.9, 131.6, 131.4, 130.6, 129.0, 127.3, 125.2 (q, J=30 Hz), 123.6 (q, J=273 Hz), 121.8, 32.6. MS (ES): m/z 489.0 (M+). Anal. calcd. for C21H12C1F3N6OS : C, 51.59; H, 2.47; Cl, 7.25; N, 17.19; S, 6.56. Found:
C, 51.51; H, 2.55; Cl, 7.37; N, 17.05; S, 6.38.
Compound D-019 3-(2-Chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-benzo[glquinazolin-4-one Prepared according to Procedure C using Intermediate 2n (200 mg, 0.563 mmol), 6-mercapto-purine monohydrate (105 mg, 0.619 mmol), K2C03 (86 mg, 0.619 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 128 mg of a dark yellow solid (48%), mp 247.8-254.4 C (decom-poses). 1H NMR (DMSO-d6) 5: 13.56 (br s, 1H) ; 8.90 (s, 1H) ; 8.50 (s, 1H) ; 8.46 (s, 1H) ; 8.34 (s, 1H) ;
8.27 (d, J=8.2 Hz, 1H); 8.16 (d, J=8.2 Hz, 1H); 7.81 (dd, J=1.6, 7.3 Hz, 1H); 7.70 (t, J=7.5 Hz, 1H);
7.61-7.74 (m, 2H); 7.49 (t, J=7.5 Hz, 1H); 7.44-7.53 (m, 1H) ; 4.44-4.56 (m, 2H) . 13C NMR (DMSO-d6) ppm:
161.3, 151.6, 151.5, 143.9, 142.2, 136.7, 134.4, 132.5, 131.8, 131.6, 130.5, 129.7, 129.3, 128.8, 128.6, 128.3, 128.3, 127.1, 125.2, 119.5, 32.4. MS
(ES) : m/z 471.0 (M+). Anal. calcd. for C24H,5C1N6OSØ2C2H60Ø05KC1: C, 60.57; H, 3.37; Cl, 7.69; N, 17.37; S, 6.63. Found: C, 60.24.; H, 3.46;
Cl, 7.50; N, 17.34; S, 6.69.

Compound D-020 6-Chloro-3-(2-chlorophenyl)-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2d (200 mg, 0.587 mmol), 6-mercapto-purine monohydrate (110 mg, 0.646 mmol), K2CO3 (90 mg, 0.651 mmol), and DMF (5 mL). The crude product was recrystallized from EtOH to provide 113 mg of a yellow crystalline solid (42%), mp 237.1-238.2 C
(decomposes) . 1H NMR (DMSO-d6) 5: 13.55 (hr s, 1H) ;
8.48 (s, 1H); 8.44 (s, 1H); 8.11 (s, 1H); 7.94 (d, J=8.3 Hz, 1H); 7.78 (d, J=8.1 Hz, 2H); 7.66 (d, J=6.7 Hz, 1H) ; 7.48-7.56 =(m, 2H) ; 4.48 (s, 2H) . 13C
NMR (DMSO-d6) ppm: 159.8, 156.8, 153.5, 151.5, 149.6, 145.8, 143.6, 135.7, 134.0, 132.2, 132.1, 131.7, 131.5, 130.5, 130.2, 129.8, 128.8, 125.8, 121.9, 32Ø MS (ES) : m/z 455.0 (M+). Anal. calcd.
for C20H12C12N6OS=0.1C2H6O=0.6H20(0.15KC1: C, 50.34; H, 2.89; Cl, 15.82; N, 17.44; S, 6.65. Found: C, 50.02; H, 2.63;_C1, 15.51; N, 17.39; S, 6.81.
Compound D-021 8-Chloro-3-(2-chlorophenyl)-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2h (200 mg, 0.589 mmol), 6-mercapto-purine monohydrate (124 mg, 0.726 mmol), K2CO3 (100 mg, 0.726 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 202 mg of a white solid (75%), mp 211.9-212.7 (decomposes). 1H
NMR (DMSO-d6) 5: 13.54 (br s, 1H) ; 8.47 (s, 1H) ;

8.44 (s, 1H); 8.12 (d, J=7.9 Hz, 1H); 8.07 (d, J=7.6 Hz, 1H); 7.78 (d, J=7.5 Hz, 1H); 7.67 (d, J=7.1 Hz, 1H); 7.58 (t, J=7.9 Hz, 1H); 7.42-7.54 (m, 2H); 4.52 (s, 2H). 13C NMR (DMSO-d6) ppm: 160.3, 156.9, 153.9, 151.5, 149.7, 143.5, 135.7, 134.0, 132.1, 131.8, 131.4, 131.1, 130.5, 130.3, 128.9, 128.3, 126.1, 122.4, 32.5. MS (ES): m/z 455.0 (M+). Anal.
calcd. for C20H12Cl2N60S: C, 52.76; H, 2.66; Cl, 15.57; N, 18.46; S, 7.04. Found: C, 52.65; H, 2.79;
Cl, 15.32; N, 18.47; S, 7.18.

Compound D-022 3-(2-Chlorophenyl)-7-fluoro-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2c (200 mg, 0.619 mmol), 6-mercapto-purine monohydrate (116 mg, 0.681 mmol), K2CO3 (95 mg, 0.687 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 143 mg of a white crystalline solid (53%), mp 151.4-154.2 C
(discolors) . 1H NMR (DMSO-d6) 5: 13.55 (br s, 1H) ;
8.48 (s, 1H) ; 8.44 (s, 1H) ; 8.23 (dd, J=6.3, 8.7 Hz, 1H); 7.77 (dd, J=1.7, 7.4 Hz, 1H); 7.64 (d, J=7.4 Hz, 1H); 7.57 (d, J=9.8 Hz, 1H); 7.45-7.52 (m, 3H);
4.48 (s, 2H). 13C NMR (DMSO-d6) ppm: 169.0 (d, J=253 Hz), 162.6, 159.3, 157.0,'154.0, 152.2, 151.7 (d, J=13 Hz), 146.1, 136.5, 134.7, 134.2, 134.0, 133.0, 132.6 (d, J=11 Hz), 131.3, 120.2, 118.9 (d, J=24 Hz), 115.3 (d, J=22 Hz), 34.6. MS (ES): m/z 439.0 (M+). Anal. calcd. for C20H12C1FN6OS=0.4- -C2H60. 0. 4H20 (0. 15KC1 : C, 52.52; H, 3.22; Cl, 8.57;

N, 17.67. Found: C, 52.25; H, 3.11; Cl, 8.20; N, 17.69.

Compound D-023 3-(2-Chlorophenyl)-7-nitro-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 20 (216 mg, 0.617 mmol), 6-mercapto-purine monohydrate (116 mg, 0.681 mmol), K2CO3 (94 mg, 0.680 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 212 mg of a yellow crystalline solid (74%), mp 218.0-218.3 C
(decomposes). 1H NMR (DMSO-d6) 5: 13.56 (br s, 1H) ;
8.49 (s, 1H) ; 8.42 (s, 1H) ; 8.38-8.45 (m, 2H) ; 8.31 (d, J=8.4 Hz, 1H); 7.81 (d, J=6.5 Hz, 1H); 7.68 (d, J=6.7 Hz, 1H); 7.43-7.58 (m, 2H); 4.53 (s, 2H). 13C
NMR (DMSO-d6) ppm: 157.7, 154.4, 153.3, 149.8, 149.3, 147.6, 145.2, 141.4, 131.5, 129.8, 129.7, 129.2, 128.4, 127.1, 126.7, 122.7, 120.3, 119.4, 29.9. MS (ES): m/z 466.0 (M+). Anal. calcd. for C20H12C1N7O3SØ4C2H6Os0.05KC1: C, 51.19; H, 2.97; Cl, 7.63; N, 20.09; S, 6.57. Found: C, 51.27; H, 2.88;
Cl, 7.40; N, 20.04; S, 6.52.

Compound D-024 3-(2-Chlorophenyl)-6-hydroxy-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2p (200 mg, 0.552 mmol), 6-mercapto-purine monohydrate (117 mg, 0.685 mmol), K2CO3 (95 mg, 0.687 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 182 mg of a white solid, a mixture of the desired product and the acetyl derivative. A portion of this material (120 mg) was suspended in a mixture of MeOH (2 mL) and aqueous NaHCO3 (satd., 1 mL) and stirred rapidly for 4 hours. The mixture was concentrated in vacuo, suspended in H2O (10 mL), and stored at 4 C over-night. The white solid was collected and dried to 103 mg (660), mp 186-214 C (gradually decomposes).
1H NMR (DMSO-d6) 5: 8.48 (s, 1H)-; 8.45 (s, 1H) ; 7.71 (d, J=6.8 Hz, 1H); 7.62-7.64 (m, 2H); 7.43-7.51 (m, 2H); 7.40-7.43 (m, 1H); 7.35 (d, J=8.8 Hz, 1H);
4.39-4.52 (m, 2H). 13C NMR (DMSO-d6) ppm: 160.6, 157.1, 156.2, 151.4, 150.8, 149.3, 144.1, 140.2, 134.5, 132.2, 131.6, 131.4, 130.4, 129.3, 128.7, 124.8, 121.7, 109.3, 32Ø MS (ES): m/z 437.0 (M+).
Anal. calcd. for (2 C20H13ClN602S=0.1C2H60.6H20: C, 49.68; H, 3.88; Cl, 7.26; N, 17.21; S, 6.57. Found:
C, 49.43; H, 3.62; Cl, 7.32; N, 17.07; S, 6.58.
Compound D-025 5-Chloro-3-(2-chlorophenyl)-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2f (300 mg, 0.883 mmol), 6-mercapto-purine monohydrate (165 mg, 0.972 mmol), K2C03 (134 mg, 0.972 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 341 mg of a pale orange crystalline solid (85%), mp 233.7-234.4 C (decomposes). 1H NMR (DMSO-d6) `5: 13.58 (br s, 1H); 8.50 (s, 1H); 8.47 (s, 1H); 7.77-7.85 (m, 2H); 7.68 (d, J=8.1 Hz, 2H); 7.65 (d, J=7.7 Hz, 1H);

7.41-7.56 (m, 2H); 4.45 (d, J=1.2 Hz, 2H). 13C NMR
(DMSO-d6) ppm: 158.7, 156.8, 153.8, 151.5, 149.6, 149.5, 143.5, 135.4, 134.1, 133.3, 132.2, 131.6, 131.6, 130.5, 130.2, 128.8, 127.1, 117.6, 32Ø MS
(ES) : m/z 455.0 (M+). Anal. calcd. for C20H12C12N6-OS=C2H60Ø3H2: C, 52.14; H, 3.70; Cl, 13.99; N, 16.58; S, 6.33. Found: C, 52.07; H, 3.37; Cl, 13.40; N, 16.65; S, 6.42.

Compound D-026 3-(2-Chlorophenyl)-5-methyl-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2g (300 mg, 0.940 mmol), 6-mercapto-purine monohydrate (176 mg, 1.03 mmol), K2CO3 (142 mg, 1.03 mmol), and DMF (5 mL). The crude product was recrystallized from EtOH to provide 324 mg of a white crystalline solid (79%), mp 227.8-230.1 C
(decomposes) . 'H NMR (DMSO-d6) (5: 13.57 (br s, 1H) ;
8.49 (s, 1H); 8.47 (s, 1H); 7.69-7.78 (m, 2H); 7.66 (d, J=7.3 Hz, 1H); 7.55 (d, J=7.9 Hz, 1H); 7.39-7.52 (m, 2H); 7.36 (d, J=6.9 Hz, 1H); 4.38-4.50 (m, 2H);
2.74 (s, 3H). 13C NMR (DMSO-d6) ppm: 161.2, 156.3, 152.4, 151.5, 148.6, 143.9, 141.0, 134.6, 134.5, 132.3, 131.7, 131.4, 130.4, 130.2, 128.7, 125.7, 119.0, 32.0, 22.8. MS (ES): m/z:435.0 (M+). Anal.
calcd. for C21H15ClN6OS=0.65C2H6O=0.1H2O: C, 57.40; H, 4.13; Cl, 7.60; N, 18.01; S, 6.87. Found: C, 57.11;
H, 3.96; Cl, 7.45; N, 17.79; S, 6.90.

Compound D-027 3-(2-Chlorophenyl)-6,7-difluoro-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Prepared according to Procedure C using Intermediate 2q (200 mg, 0.586 mmol), 6-mercapto-purine monohydrate, (110 mg, 0.645 mmol) , K2CO3 (89 mg, 0.645 mmol), and DMF (4 mL). The crude product was recrystallized from EtOH to provide 143 mg of a pale yellow crystalline solid (53%), mp 207.8 C
(discolors; sweats at 136(C). 1H NMR (DMSO-d6) b:
13.57 (br s, 1H) ; 8.49 (s, 1H) ; -8.46 (s', 1H) ; 8.11 (t, J=9.4 Hz, 1H); 7.88 (dd, J=7.3, 11 Hz, 1H); 7.77 (dd, J=1.7, 7.3 Hz, 1H); 7.67 (d, J=7.4 Hz, 1H);
7.42-7.55 (m, 2H) ; 4.48 (s, 2H). 13C NMR (DMSO-d6) ppm: 159.5 (d, J=2.5 Hz), 154.6 (dd, J=14, 255 Hz), 154.0 (d, J=1.5 Hz), 151.5, 149.3 (dd, J=14, 250 Hz), 145.1 (d, J=12 Hz), 143.9, 133.9, 132.1, 131.8, 131.4, 130.5, 128.9, 118.0 (d, J=4.9 Hz), 115.8 (d, J=18 Hz), 114.6 (d, J=20 Hz), 32Ø MS (ES) : m/z 457.0 (M+). Anal. calcd. for C20H11ClF2N60S : C, 52.58; H, 2.43; Cl, 7.76; N, 18.40; S, 7.02. Found:
C, 51.81; H, 2.37; Cl, 7.49; N, 18.04; S, 7.55.
Compound D-028 3-(2-Chlorophenyl)-6-fluoro-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-,one Prepared according to Procedure C using Intermediate 2r (118 mg, 0.365 mmol), 67mercapto-purine monohydrate (68 mg, 0.402 mmol), K2C03 (56 mg, 0.402 mmol), and DMF (2 mL). The crude product was recrystallized from EtOH to provide 103 mg of an off-white crystalline solid (64%), mp 232.8-233.0 C
(discolors) . 1H NMR (DMSO-d6) 5: 13.56 (br s, 1H) ;
8.48 (s, 1H); 8.44 (s, 1H); 7.81-7.86 (m, 3H); 7.76 (d, J=7.5 Hz, 1H); 7.67 (d, J=7.5 Hz, 1H); 7.40-7.54 (m, 2H) ; 4.48 (br s, 2H). 13C NMR (DMSO-d6) ppm:
160.8 (d, J=247 Hz), 160.2 (d, J=3.3 Hz'), 156.9, 152.3 (d, J=1.9 Hz), 151.5, 149.7, 144.0, 143.6, 134.1, 132.1, 131.7, 131.5, 130.5, 130.4, 130.2, 128.8, 124.0 (d, J=24 Hz), 122.0 (d, J=8.7 Hz), 111.7 (d, J=24 Hz), 32Ø MS (ES): m/z 439.0 (M+).
Anal. calcd. for C20H12C1FN6OS=0.2C2H6O=0.1H2O: C, 54.46; H, 3.00; Cl, 7.88; N, 18.68. Found: C, 54.09; H, 2.73; Cl, 7.80; N, 18.77.

Compound D-029 2-(6-Aminopurin-9-ylmethyl)-3-(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one Thionyl chloride (2.2 mL, 30 mmol) was added to a stirred solution of 2-amino-6-methylbenz-oic acid (1.51 g, 10 mmol) in benzene (50 mL) and the mixture was heated at ref lux for 18.h. Once cooled, the solvent was removed in vacuo and stripped down twice with benzene (25 mL). The residue was dissolved in CHC13 (50 mL) and treated with 2-isopropylaniline (2.83 mL, 20 mmol). The slurry was then heated at reflux for 3 h. At that time TLC (50% EtOAc/hexane) indicated that the reaction was complete. After cooling to room temp-erature, the reaction mixture was poured atop a 4 cm plug of silica gel and flushed through with 20%
EtOAc/hexane. The product containing fractions were combined and concentrated in vacuo. The residue was dissolved in HOAc (50 mL)=and treated with chloro-actyl chloride (1.6 mL, 20 mmol) and the mixture was heated at reflux for 18 h. The reaction was cooled and concentrated in vacuo. The remaining HOAc was removed by azeotroping with toluene (25 mL) three times. The residue was dissolved in toluene (10 mL) and poured through a 4 cm plug of silica gel, flush-ing through with 20 % EtOAc/hexane. The product containing fractions were identified by LCMS (MS
(ES): m/z 327 (M+)), and concentrated in vacuo to afford 975 mg (30%) as awhite foam. The white foam chloride (450 mg, 1.36 mmol) was dissolved in DMF
(10 mL) and treated with adenine (275 mg, 2.04 mmol) and K2C03 (281 mg, 2.04 mmol) and the mixture was stirred overnight at room temperature. The suspen-sion was then poured into 200 mL of water, stirred at room temperature for 30 min then chilled in the refrigerator for 30 min. The resultant solid was collected by vacuum filtration and recrystallized from EtOH to afford 285 mg (49%) of an off white solid. mp 258.0-258.2 C. 'H NMR (DMSO-d6) 5: 8.19 (s, 1H), 8.09 (s, 1H), 7.'60 (m, 3H), 7.45 (m, 2H), 7.23 (m, 3H), 5.11 (d, J=17.5 Hz, 1H), 4.71 (d, J=17.5 Hz, 1H), 2.68 (s, 3H), 2.73 (q, J=6.9 Hz, 1H) , 1.34 (d, J=6.8 Hz, 3H) , 1.13 (d, J=6.8 Hz, 3H) 13C NMR (DMSO-d6) ppm: 161.9, 156.2, 152.8, 151.6, 150.1, 148.4, 146.1, 142.2, 140.8, 134.3, 133.7, 130.6, 130.0, 129.0, 127.7, 127.6, 125.'8, 119.2, 118.4, 44.8, 28.3, 24.4, 23.3, 22.9. MS (ES): m/z 426.4 (M+). Anal. calcd. for C24H23N7O: C, 67.75; H, 5.45; N, 23.04. Found: C, 67.60; H, 5.45; N, 22.82.

Compound D-030 2-(6-Aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one Thionyl chloride (2.2 mL, 30 mmol) was added to a stirred solution of 2-amino-6-methylbenz-oic acid (1.51 g, 10 mmol) in benzene (50 mL) and the mixture was heated at reflux for 18 h. Once cooled, the solvent was removed in vacuo and stripped down twice with benzene (25 mL). The residue was dissolved in CHC13 (50 mL) and treated with o-toluidine (2.13 mL, 20 mmol). The slurry was then heated at reflux for. 3 h. At that, time TLC
(50% EtOAc/hexane) indicated that the reaction was complete. After cooling to room temperature, the reaction mixture was poured atop,a 4 cm plug of silica gel and flushed through with 20% EtOAc/hex-ane. The product containing fractions were combined and concentrated in vacuo. The residue was dis-solved in HOAc (50 mL) and treated with chloroactyl chloride (1.6 mL, 20 mmol) and the mixture was heated at reflux for 18 h. The reaction was cooled and concentrated in vacuo. The, remaining HOAc was removed by azeotroping with toluene (25 mL) three times. The residue was dissolved in toluene (10 mL) and poured through a 4 cm plug of silica gel, flushing through with 20 % EtOAc/hexane: The product containing fractions were identified by LCMS
[MS (ES) : m/z 299 (M+)), and concentrated in vacuo to afford 476 mg (16%) as a white foam. The white foam chloride (470 mg, 1.57 mmol) was dissolved in DMF (10 mL) and treated with adenine (423 mg, 3.14 mmol) and K2CO3 (433 mg, 3.14 mmol) and the mixture was stirred overnight at room temperature. The suspension was then poured into 200 mL of H2O, stirred at room temperature for 30 min then chilled in the refrigerator for 30 min. The resultant solid was collected by vacuum filtration and recrystal-lized from EtOH to afford 123 mg (20%) of an off white solid. mp 281.5-282.7 C (decomposes). 1H NMR
(DMSO-d6) 5: 8.07 (s, 1H)'; 8.05 (s, 1H) ; 7.61 (t, J=7.8 Hz, 1H), 7.48 (m, 4H), 7.25 (m, 3H), 5.09 (d, J=17.4 Hz, 1H), 4.76 (d, J=17.4 Hz, 1H) 2.73 (s, 3H), 2.18 (s, 3H). 13C NMR (DMSO-d6) ppm: 161.3, 156.2, 152.8, 151.4, 150.0, 148.5, 142.2, 140.9, 136.1, 135.4, 134.3, 131.7, 130.1, 130.0, 129.0, 128.0, 125.8, 119.2, 118.5, 44.8, 22.9, 17.4. MS
(ES) : m/z 398.2 (M+) . Anal. calcd. for C22H19N70: C, 66.49; H, 4.82; N, 24.67. Found: C, 66.29; H, 4.78;
N, 24.72.

Compound D-031 3-(2-Fluorophenyl)-5-methyl-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one Thionyl chloride (2.2 mL, 30 mmol) was added to a stirred solution of 2-amino-6-methyl-benzoic acid (1.51 g, 10 mmol) in benzene (50 mL) and the mixture was heated at reflux for 18 h.. Once cooled, the solvent was removed in vacuo and stripped down twice with benzene,(25 mL). The residue was dissolved in CHC13 (50 mL) and treated with 2-fluoroaniline (1.93 mL, 20 mmol). The slurry was then heated at reflux for 3 h. At that time TLC
(50% EtOAc/hexane) indicated that the reaction was complete. After cooling to room temperature, the reaction mixture was poured atop.a 4 cm plug of silica gel and flushed through with 20%'EtOAc/hex-ane. The product containing fractions were combined and concentrated in vacuo. The residue was dis-solved in HOAc (50 mL) and treated with chloroactyl chloride (1.6 mL, 20 mmol) and the mixture was heated at reflux for 18 h. The reaction was cooled and concentrated in vacua. The remaining HOAc was removed by azeotroping with toluene (25 mL) three times. The residue was dissolved in toluene (10 mL) and poured through a 4 cm plug of silica gel, flush-ing through with 20 % EtOAc/hexane. The product containing fractions were identified by LCMS [MS
(ES): m/z 303 (M+)), and concentrated in vacuo to afford 1.12 g (37%) as a white foam. The white foam chloride (455 mg, 1.50 mmol) was dissolved in DMF
(10 mL) and treated with 6-mercaptopurine mono-hydrate (510 mg, 3.0 mmol) and K2CO3 (414 mg, 3.0 mmol) and the mixture was stirred overnight at room temperature. The suspension was then poured into 200 mL of water, stirred at room temperature for 30 min then chilled in the refrigerator for 30 min.
The resultant solid was collected by vacuum filtra-tion and recrystallized from EtOH to afford 487 mg (77%) of an off white solid. mp 151.9-152.2 C. 1H
NMR (DMSO-d6) 5: 8.48 (s, 1HO, 8'.44 (s, 1H), 7.70 (m, 2H), 7.48 (m, 2H), 7.33 (m, 3H), 4.55 (d, J=15.1 Hz, 1H), 4.48 (d, J=15.1 Hz, 1H), 2.73 (s, 3H). 13C
NMR (DMSO-d6) ppm: 161.3, 157.8 (d, J=249.1 Hz), 156.9, 152.8, 151.5, 149.6, 148.'6, 143.6, 140.9, 134.7, 131.9 (d, J=8.0 Hz), 131.4, 130.2, , 125.6 (d, J=3.6 Hz), 125.5, 124.4 (d, J=13.5 Hz), 118.8, 116.6 (d, J=19.6 Hz), 56.4, 22.9. MS (ES): m/z 419.5 (M+) . Anal. calcd. for C21H15FN60S=0.15 C2H60:
C, 60.14; H, 3.77; F, 4.47; N, 19.76; S, 7.54.
Found: C,59.89; H,3.88; F,4.42; N,19.42; 5,7.23.
Compound D-032 2-(6-Aminopurin-9-ylmethyl)-5-chloro-3-o-tolyl-3H-quinazolin-4-one Prepared according to Procedure C using 2j (200 mg, 0.626 mmol), adenine (93 mg, 0=.689 mmol), K2CO3 (95 mg, 0.689 mmol) , and DMF (3 mL) . The crude product was chromatographed in MeOH/CH2C12 to provide 101 mg of an off-white solid (39%), mp 262.0-266.5 C. 1H NMR (DMSO-d6) 5: 8.08 (s, -1H) ; 8.07 (s, 1H); 7.70 (t, J=8.0 Hz, 1H); 7.58 (dd, J=0.6, 7.9 Hz, 1H); 7.43-7.57 (m, 4H); 7.36 (dd, J=0.7, 8.0 Hz, 1H); 7.26 (br s, 2H); 5.12 (d, J=18 Hz,'1H); 4.78 (d, J=18 Hz, 1H) ; 2.20 (s, 3H) . 13C NMA- (DMSO-d6) ppm: 158.7, 156.2, 152.9, 152.7, 150.0, 149.4, 142.1, 136.1, 135.1, 135.0, 133.2, 131.8, 130.3, 130.1, 128.9, 128.1, 127.2, 118.5, 117.9, 44.9, 17.4. MS (ES) : m/z 418.1 (M+). Anal. calcd. for C21H16C1N70=0.1H20=0.05KC1: C, 59.57; H, 3.86; Cl, 8.79; N, 23.16. Found: C, 59.65; H, 3.`80; Cl, 8.70;
N, 22.80.

Compound D-033 2-(6-Aminopurin-9-ylmethyl)-5-chloro-3-(2-methoxy-phenyl)-3H-quinazolin-4-one Prepared according to Procedure C using 21 (250 mg, 0.746 mmol), adenine (111 mg, 0.821 mmol), K2CO3 (113 mg, 0.821 mmol) , and DMF (4 mL) . The crude product was chromatographed in MeOH/CH2CI2 and recrystallized from EtOH to provide 124 mg of a brown solid (38%), mp 257.0-257.1 C. 'H NMR (DMSO-d6) b: 8.06 (s, 1H) ; 8.01 (s, 1H) ; 7.71 (t, J=8.0 Hz, 1H); 7.57 (dd, J=0.9, 7.9 Hz, 1H); 7.52-7.59 (m, 1H); 7.50 (dd, J=1.6, 7.8 Hz, 1H); 7.38 (dd, J=1.1, 8.2 Hz, 1H); 7.27 (dd, J=0.6, 8.3 Hz, 1H); 7.24 (br s, 2H); 7.17 (dt, J=0.9, 7.6 Hz,.1H); 5.07 (d, J=17 Hz, 1H) ; 4.97 (d, J=17 Hz, 1H); 3.79 (s, 3H). 13C
NMR (DMSO-d6) ppm: 158.8, 156.2, 154.7, 153.2, 152.8, 150.1, 149.3, 142.0, 135.1, 133.2, 131.8, 130.1, 130.1, 127.2, 123.,8, 121.6, 118.4, 117.9, 113.1, 56.2, 44.8. MS (ES): m/z 434.0 (M+). Anal.
calcd. for C21H16C1N702=0.5H20=0.04KC1: C, 56.57; H, 3.84; Cl, 8.27; N, 21.99. Found: C, 56.29; H, 3.75;
Cl, 8.21; N, 21.61.

The following compounds were made gener-ally in accordance with the above-described methods and serve to further illustrate specific embodiments of the compounds of the invention:
3-(2,6-dichlorophenyl)-5-methyl-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one (D-034) 3-(2-isopropylphenyl)-5-methyl-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one (D-035) 3-(2-methoxyphenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-036) 3-benzyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quin-azolin-4-one (D-037) 3-butyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quin-azolin-4-one (D-038) 3-morpholin-4-yl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one, acetate salt (D-039) 3-(3-methoxyphenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-040) 3-(3-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-041) 2-(9H-purin-6-ylsulfanylmethyl)=3-pyridin-4-yl-3H-quinazolin-4-one (D-042) 3-benzyl-5-fluoro-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-043) 3-(4-methylpiperazin-l-yl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one, acetate salt (D-044) [5-fluoro-4-oxo-2-(9H-purin-6-ylsulfanylmethyl)-4H-quinazolin-3-yl] acetic acid ethyl ester (D-045) 3-(2-methoxyphenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-046) 3-(2-methoxyphenyl)-5-methyl-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one (D-047) 2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin-4-one (D-048) 2-(6-aminopurin-9-ylmethyl)-3-benzyl-5-fluoro-3H-quinazolin-4-one (D-049) 2-(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one (D-050) 2-(6-aminopurin-9-ylmethy.l)-3-morpholin-4-yl-3H-quinazolin-4-one, acetate salt (D-051) 3-(4-chlorophenyl)-.2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-052).

Additional compounds of the present invention were prepared by the following synthetic procedures.
The following intermediates were prepared by the above-described Procedure A.

eN NCl 3a R=cyclopropyl 3b R=cyclopropylmethyl 3c R=phenethyl 3d R=cyclopentyl 3e R=3-(2-chloro)pyridyl 3f R=4-(2-methyl)benzoic acid 3g R=4-nitrobenzyl 3h R=cyclohexyl 3i R=E-(2-phenyl)cyclopropyl Additional compounds of the present inven-tion (D-053 through D-070) having the following core structure are discussed in the following Experimen-tal Section. All were prepared following Procedure C.

Core structure:

N

R' Compound No. R R' D-053 cyclopropyl C
D-054 cyclopropylmethyl B
D-055 cyclopropylmethyl A
D-056 cyclopropylmethyl. C
D-057 phenethyl B
D-058 phenethyl C
D-059 cyclopentyl B
D-060 cyclopentyl A
D-061 3-(2-chloro)pyridyl B
D-062 3-(2-chloro)pyridyl A
D-063 4-(2-methyl)benzoic acid B
D-064 cyclopropyl B
D-065 cyclopropyl A
D-066 4-nitrobenzyl B

B
D-067 cyclohexyl D-068 cyclohexyl A
D-069 cyclohexyl C
D-070 E-(2-phenyl)cyclopropyl B

N
\ N

A
I W
S N

N
N' ~--H
B

N
T
C
~H

C

2-(2-Amino-9H-purin-6-ylsulfanylmethyl)-3-cyclopropyl-5-methyl-3H-quinazolin-4-one (D-053) Prepared according to procedure C using 3a (100mg, 0.4 mmol), 2-amino-6-mercaptopurine (80 mg, 0.48 mmol), and K2CO3 (77 mg, 0.56 mmol) . The product was purified by trituration from H2O. 1H NMR
(DMSO-d6) 5: 7.89 (d, J=0.9 Hz, 1H) ; 7.54 (t, J=7.4 Hz, 1H) ; 7.34 (d, J=8.1 Hz, 1H) ; 7.19 (d, J=7.2 Hz, 1H); 6.28 (s, 2H); 4.94 (s, 2H); 2.70 (s, 3H); 1.24 (d, J=6.5 Hz, 2H); 0.91 (s, 2H). MS (ES): m/z 380 (M+H), 190.

3-Cyclopropylmethyl-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-054) Prepared according to procedure C using 3b (300mg, 1.14 mmol), 6-mercaptopurine monohydrate (214 mg, 1.26 mmol) , and K2CO3 (189 mg, 1.37 mmol) .
The product was purified by trituration from H2O, followed by recrystallization from MeOH. 1H NMR
(DMSO-d6) 5: 13.60 (br s, 1H); 8.72 (s, 1H); 8.48 (s, 1H) ; 7.63 (t, J=7.8 Hz, 1H) ; 7.42 (d, J=8.0 Hz, 1H); 7.28 (d, J=7.3 Hz, 1H); 5.01 (s, 2H); 4.11 (d, J=6.8 Hz, 2H); 2.78 (s, 3H); 1.35 (quint, J=6.2 Hz, 1H); 0.44-0.59 (m, 4H). MS (ES): m/z 379 (M+H), 325.

2-(6-Aminopurin-9-ylmethyl)-3-cyclopropylmethyl-5-methyl-3H-quinazolin-4-one (D-055) Prepared according to procedure C using 3b (300mg, 1.14 mmol), adenine (170 mg, 1.26 mmol), and K2CO3 (189 mg, 1.37 mmol). The product-was purified by trituration from H20, followed by recrystalli-zation from MeOH. 1H NMR (DMSO-d6) 5: 8.21 (s, 1H) ;
8.10 (s, 1H) ; 7.52 (t, J=7.7 Hz, 1H) ; 7.18-7.31 (m, 3H) ; 7.06 (d, J=8.1 Hz, 1H) ; 5.6:8 (s, 2H) ; 4.14 (d, J=6.8 Hz, 2H); 2.77 (s, 3H); 1.34 (quint, J=6.4 Hz, 1H) ; 0.45-0.60 (m, 4H). MS (ES) : m/z 362 (M+H), 308.

2-(2-Amino-9H-purin-6-ylsulfanylmethyl)'-3-cyclo-propylmethyl-5-methyl-3H-quinazolin-4-one (D-056) Prepared according to procedure C using 3b (280mg, 1.1 mmol), 2-amino-6-mercaptopurine (200 mg, 1.2 mmol) , and K2C03 (18 0 : mg, 1.3 mmol) .. The product was purified by trituration from. MeOH. 1H NMR (DMSO-d6) 5: 12.70 (br s, 1H) ; 7.95 (s, 1H) ; 7.64 (t, J=7.8 Hz, 1H); 7.44 (d, J=7.9 Hz, 1H); 7.28 (d, J=7.4 Hz, 1H); 6.41 (s, 2H); 4.91 (s, 2H); 4.05 (d, J=6.8 Hz, 2H); 2.78 (s, 3H); 1.26-1.43 (m, 1H);
0.36-0.56 (m, 4H). MS (ES): m/z 394 (M+H), 340.
5-Methyl-3-phenethyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one (D-057) Prepared according to procedure C using 3c (750mg, 2.4 mmol), 6-mercaptopurine monohydrate (442 mg, 2.6 mmol), and K2CO3 (398 mg, 2.9 mmol). The product was purified by trituration from H20. 1H NMR

(DMSO-d6) b : 13.61 (s, 1H) ; 8. 71 (s, 1H) ; 8.48 (s, 1H); 7.65 (t, J=7.7 Hz, 1H); 7.44 (d, J=7.9 Hz, 1H);
7.16-7.35 (m, 6H); 4.89 (s, 2H); 4.29 (br t, J=7.9 Hz, 2H) ; 3.08 (br t, J=7.8 Hz, 2H) ; 2.81 (s, 3H).
MS (ES) : m/z 429 (M+H), 105.
2-(2-Amino-9H-purin-6-ylsulfanylmethyl)-5-methyl-3-phenethyl-3H-quinazolin-4-one (D-058) Prepared according to.procedure C using 3c (750mg, 2.4 mmol), 2-amino-6-mercaptopurine (435 mg, 2.6 mmol) , and K2CO3 (398 mg, 2.9 mmol) . The product was purified by trituration from H2O. 1H NMR (DMSO-d6) 5: 12.61 (s, 1H) ; 7.95 (s, 1H) ; 7.65 (t, J=7.7 Hz, 1H) ; 7.45 (d, J=7.9 Hz, 1H) ; 7.14-7..32 (m, 6H) ;
6.44 (s, 2H) ; 4.81 (s, 2H) ; 4.24' (br t, J=7.9 Hz, 2H); 3.04 (br t, J=7.8 Hz, 2H); 2.81 (s, 3H). MS
(ES): m/z 444 (M+H), 340.

3-Cyclopentyl-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one (D-059) Prepared according to"procedure C using 3d (100mg, 0.36 mmol), 6-mercaptopurine monohydrate (73 mg, 0.43 mmol), and K2CO3 (100 mg, 0.72 mmol). The product was purified by recrystallization from MeOH.
1H NMR (DMSO-d6) 5: 13.62 (br s, 1H); 8.77 (s, 1H) ;
8.48 (s, 1H) ; 7.62 (t, J=7.7 Hz, 1H) ; 7.42 (d, J=7.8 Hz, 2H); 7.26 (d, J=7.4 Hz, 1H); 5.03 (s, 2H); 4.80 (quint, J=8.0 Hz, 1H); 2.76 (s, 3H); 2.12-2.31 (m, 2H); 1.79-2.04 (m, 4H); 1.44-1.58 (m, 2H). MS (ES):
m/z 393 (M+H) , 325.

2-(6-Aminopurin-9-ylmethyl)-3-cyclopentyl-5-methyl-3H-quinazolin-4-one (D-060) Prepared according to procedure C using 3d (100mg, 0.36 mmol), adenine (58 mg, 0.43 mmol), and K2C03 (100 mg, 0.72 mmol). The product was purified by recrystallization from MeOH. , 'H NMR (DMSO-d6) b :
8.15 (s, 1H) ; 8.11 (s, 1H) ; 7.52 (t, J=7.7 Hz, 1H) ;
7.16-7.31 (m, 3H); 7.10 (d, J=8.0 Hz, 2H); 5.68 (s, 2H); 4.78 (quint, J=8.3 Hz, 1H);. 2.74 (s, 3H); 2.09--2.32 (m, 2H); 1.86-2.04 (m, 2H); 1.68-1.86 (m, 2H);
1.43-1.67 (m, 2H). MS (ES): m/z 376 (M+H), 308, 154.

3-(2-Chloro-pyridin-3-yl)-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one .(D-061) Prepared according to procedure C using 3e (500mg, 1.6 mmol), 6-mercaptopurine monohydrate (289 mg, 1.7 mmol), and K2CO3 (.262 mg, 1.9 mmol). The product was purified by trituration from H2O. MS
(ES) : m/z 436 (M+H), 200.

2-(6-Aminopurin-9-ylmethyl)-3-(2-chloro-pyridin-3-yl)-5-methyl-3H-quinazolin-4-one (D-062) Prepared according to procedure C using 3e (500mg, 1.6 mmol), adenine (230 mg, 1.7 mmol), and K2C03 (262 mg, 1.9 mmol). The product was purified by trituration from H2O. lH NMR (DMSO-d6) b : 8.59 (dd,,J=1.7, 4.8 Hz, 1H); 8.22 (dd, J=1.7, 7.8 Hz, 1H): 8.025 (s, 1H); 8.017 (s, 1H); 7.60-7.72 (m, 2H); 7.35 (t, J=8.2 Hz, 2H); 7.22 (s, 2H); 5.12 (d, J=17.0 Hz, 1H) ; 5.02 (d, J=17.0 Hz, 1H); 2.72 (s, 3H)- MS (ES) : m/z 419 (M+H).
3-Methyl-4-[5-methyl-4-oxo-2-(9H-purin-6-ylsulfanyl-methyl)-4H-quinazolin-3-yl]-benzoic acid (D-063) Prepared according to procedure C using 3f (400mg, 1.17 mmol), 6-mercaptopurine monohydrate (219 mg, 1. 29 mmol) , and K2CO3 (226 mg, 1.64 mmol) .
The product was purified by recrystallization from MeOH. 1H NMR (DMSO-d6) 5: 13.54 .(br s, 1H) ; 8.44 (s, 1 H ) ; 8.42 ( s , 1H) 7.80 (s, 2H);..7.71 (t, J=7.7 Hz, 1H); 7.59 (d, J=8.6 Hz, 1H); 7.52 (d, J=7.9 Hz, 1H);
7.34 (d, J=7.4 Hz, 1H); 4.46 (d, J=15.4 Hz, 1H);
4.34 (d, J=15.7 Hz, 1H); 3.17 (d, J=4.4 Hz, 1H);
2.73 (s, 3H) ; 2.17 (s, 3H). MS (ES) : m/z 459 (M+H).

3-Cyclopropyl-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one (D-064) Prepared according to procedure C using 3a (100mg, 0.40 mmol), 6-mercaptopurine monohydrate (90 mg, 0.53 mmol), and K2CO3 (97 mg, 0.7 mmol). The product was purified by trituration from H2O. 'H NMR
(DMSO-d6) 5: 8.69 (d, J=0.8 Hz, 1H) ; 8.47 (s, 1H);
7.57 (d, J=7.9 Hz, 1H); 7.37 (d, J=8.1 Hz, 1H); 7.23 (d, J=7.3 Hz, 1H); 5.08 (s, 2H); 3.06-3.18 (m, 1H);
2.74 (s, 3H); 1.14-1.36 (m, 2H); 0.92-1.06 (m, 2H).

2-(6-Aminopurin-9-vlmethyl)-3-cyclopropyl-5-methyl-3H-quinazolin-4-one (D-065) Prepared according to procedure C using 3a (100mg, 0.40 mmol), adenine (94 mg, 0.7 mmol), and K2CO3 (121 mg, 0.88 mmol). The product was purified by trituration from H2O. 1H NMR (DMSO-d6) 5: 8.19 (d, J=0.9 Hz, 1H); 8.09 (d, J=1.0 Hz, 1H); 7.48 (t, J=7.8 Hz, 1H); 7.13-7.29 (m, 3H); 7.04.(d, J=8.1 Hz,' 1H); 5.74 (s, 2H) ; 3.00-3.13 (m, 1H) ; 2_.73 (s, 3H) ;
1.18-1.38 (m, 2H) ; 0.94-1.09 (m, 2H).
5-Methyl-3-(4-nitro-benzyl)-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one (D-066) Prepared according to procedure C using 3g (200mg, 0.58 mmol), 6-mercaptopurine monohydrate (148 mg, 0.87 mmol) , and K2CO3 (160 mg, 1.16 mmol) The product was purified by trituration from NeOH. 1H
NMR (DMSO-d6) 5: 13.44 (br s, 1H) ; 8.50 (s, 1H) ;
8.31 (s, 1H); 8.03 (d, J=8.6 Hz, 2H); 7.58 (t, J=7.9 Hz, 1H); 7.37 (d, J=8.3 Hz, 3H);'.7.22 (d, J=7.5 Hz, 1H) ; 5.44 (s, 2H) ; 4.70 (s, 2H) ; 2.66 (s, 3H). MS
(ES) : m/z 460 (M+H).

3-Cyclohexyl-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one (D-067) Prepared according to procedure C using 3h (150mg, 0.52 mmol), 6-mercaptopurine monohydrate (97 mg, 0.57 mmol), and K2CO3 (86 mg, 0.62 mmol). The product was purified by trituration from MeOH. 1H NMR
(DMSO-d6) 5: 13.66 (br s, 1H) ; 8.82 (s, 1H) ; 8.50 (s, 1H); 7.62 (t, J=7.7 Hz, 1H); 7.42 (d, J=8.0 Hz, 1H); 7.26 (d, J=7.3 Hz, 1H); 5.01 (s, 2H); 4.11 (br s, 1H); 2.75 (s, 3H); 2.3'8-2.65 ~(m, 2H); 1.58-1.90 (m, 4H); 1.37-1.57 (m, 1H); 0.71-1.26 (m, 3H). MS
(ES): m/z 407 (M+H), 325.

2-(6-Aminopurin-9-ylmethyl)-3-cyclohexyl-5-methyl-3H-quinazolin-4-one (D-068) Prepared according to procedure C using 3h (150mg, 0.52 mmol), adenine (77 mg, 0.57 mmol), and K2C03 (86 mg, 0.62 mmol). The product was purified by trituration from MeOH. 1H NMR (DMSO-d6) 5: 8.15 (s, 2H); 7.54 (t, J=7.9 Hz, 1H); 7.06-7.35 (m, 4H);
5.65 (s, 2H); 4.09 (br s 1H); 2.73 (s, 3H); 1.41-1.90 (m, 6H) ; 0.99-1.34 (m, 4H). MS (ES) : m/z 390 (M+H), 308.

2-(2-Amino-9H-purin-6-ylsulfanylmethyl)-3-cyclo-hexyl-5-methyl-3H-quinazolin-4-one (D-069) Prepared according to procedure C using 3h (150mg, 0.52 mmol), 2-amino-6-mercaptopurine (95 mg, 0.57 mmol) , and K2C03 (86 mg, 0.62 mmol) . The product was purified by reversed-phase HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-750 acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220 ) . MS (ES) : m/z 422 (M+H), 340, 170.

5-Methyl-3-(E-2-phenyl-cyclopropyl)-2-(9H--purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-070) Prepared according to procedure C using 3i and 6-mercaptopurine monohydrate). The product was purified by reversed-phase HPLC."(C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220 ) . MS (ES) : m/z 441.

Additional compounds of the invention follow, together with the synthetic route to com-pounds D-071 to D-118.

O
O / I \ N
Procedure D \ \ I / N

NH2 5a NH2 4a F 0 F 0 e,Np I \Cl / NH2 Cl NH2 5b 4 b Cl / N I N> O
Procedure E O N

\ N\ x \N H I/ N-/ NH
N HN` ~ p NH 2 ~t~" /`~N

5a Cl x N N> F O / I
NIN I N

F 5LN9 0 X / N ' N\
Cl HN` /NH
NN N iN
5b 2 Cl N O

O xIN I \> N
\ N \ a I /
N N=\
HN NH
HZN T 5c Procedure F F 0 F o /
~ I _ \ N ~ i eNH2 N I
H
4b 6a Procedure D: A mixture of amide 4a or 4b, FMOC-glycyl-chloride, and glacial acetic acid was heated to 120 C for 1 to 4 hours. The resulting mixture was concentrated in vacuo and purified by flash chromatography to provide the protected, cyclized amine. This material was combined with 10 equivalents octanethiol and a catalytic amount of DBU in THE and stirred at ambient temp until consumption of starting material was indicated by LCMS. The reaction was poured directly onto a flash column (equilibrated in CH2C12) and eluted with 0-5%
MeOH/CH2C12 to provide the free amine, 5a or 5b.
Compound 5c was prepared in an analogous manner using ( ) FMOC-alanyl-chloride in place of FMOC-glycyl chloride.

Procedure E: Equimolar amounts of 5a or 5b, the appropriate 6-chloropurine, and DIEA were combined with EtOH in a small vial and heated to 80 C. The reaction was monitored regularly by LCMS
and purified as stated.

Procedure F: A mixture of amide 4b, acetoxyacetyl chloride, and glacial acetic acid was heated to 120 C and stirred for 2 hours. The cooled reaction was filtered and the solids washed with CH2C12 to provide the cyclized acetate as a white solid. This material was combined with K2C03 in aqueous methanol and stirred for one hour, then concentrated in vacuo. The resulting solids were triturated from H2O to provide 6a as a white solid.

CI
HN\ NH

NON

3-(2-Chlorophenyl)-5-fluoro-2-[,(9H-purin-6-ylamino) methyl]-3H-quinazolin-4-one (D-072) Prepared according to procedure E using 5b (50 mg, 0.165 mmol) and 6-chloropurine (26 mg, 0.165 mmol) in 1 mL EtOH. After 5 days, reaction purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100%
acetonitrile at 18 min, detector at 220A). 1H NMR
(DMSO-d6) 5: 12.99 (br s, 1H) ; 8.14 (br s, 1H) ;
8.12 (s, 1H); 7.85 (dt, J=5.7, 8.1 Hz., 1H); 7.68-7.79 (m, 3H) ; 7.57 (t, J=6.2 Hz., 1H) ; 7.57 (d, J=7.7 Hz., 1H); 7.50 (d, J=8.1 Hz., 1H); 7.35 (dd, J=8.4, 10.7 Hz., 1H); 4.15-4.55 (m, 2H). MS (ES):
m/z 422 (M+H), 211.

F O' N
CI Nom.
HN\ NH
NY N

2-[(2-Amino-9H-purin-6-ylamino)methyl]-3-(2-chlorophenyl)-5-fluoro-3H.-quinazolin-4-one (D-074) Prepared according to procedure E using 5b (50 mg, 0.165 mmol) and 2-amino-6-chloropurine (28 mg, 0.165 mmol) in 1 mL EtOH. After 5 days, reaction purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector,at 220A) . 'H NMR (DMSO-d6) 5: 12.13 (br s, 1H) ; 7.86 (dt, J=5.6, 8.2 Hz., 1H); 7.76-7.83 (m, 2H); 7.68 (br s, 1H); 7.61 (t, J=5.7 Hz. 1H); 7.61 (d, J=7.2 Hz., 1H); 7.53 (d, J=8.2 Hz., 1H); 7.35 (dd, J=8.2, 10.9 Hz., 1H) ; 5.66 (br s, 2 H).;. 4.16-4.50 (m, 1H) ;
4.09 (q, J=5.3 Hz., 2H). MS (ES) : m/z 437 (M+H), 219.

N
N~') N=\
HN\ NH
TTI ``ll NON

5-Methyl-2-[(9H-purin-6-ylamino)methyl]-3-o-tolyl-3H-quinazolin-4-one (D-071) Prepared according toprocedure E using 6-chloropurine (11 mg, 0.072 mmol) and 5a (20 mg, 0.072 mmol). After 5 days, the reaction was quenched with water and the resulting suspension filtered. The solids were purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75%
acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 2201x) . 1H NMR (DMSO-d6) 5:

12.98 (br s, 1H) 8.14 (br s, 1H) ; 8.10 (s, 1H) 7.58-7.79 (m, 2H); 7.37-7.48 (m, 4H); 7.26-7.36 (m, 2H); 3.93-4.39 (m, 2H); 2.75 (s, 3H); 2.18 (s, 3H).
MS (ES): m/z 398 (M+H), 199.

o it N
W"~ N~
HN\I /NH

NN

2-[(2-Amino-9H-purin-6-ylamino)methyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-073) Prepared according to procedure E using 5a (189 mg, 0.677 mmol) and 2-amino-6-chloropurine (115 mg, 0.677) in 3 mL EtOH. After 3 days, the reaction was filtered to remove excess purine and the fil-trate purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220A) to provide 7 mg of the product as the TFA salt. 'H
NMR (DMSO-d6) 5: 8.88 (br s, 1H) ; 8.21 (s, 1H) ;
7.71 (t, J=7.7 Hz., 1H); 7.45-7.56 (m, 2H); 7.38-7.44 (m, 3H); 7.35 (d, J=7.5 Hz., 1H); 7.30 (br s, 1H); 4.40 (dd, J=4.5, 17.5 Hz.,'1H); 4.27 (dd, J=5.3, 17.4 Hz., 1H); 2.75 (s, 3H); 2.09 (s, 3H).
MS (ES): m/z 413 (M+H), 207, 163.

o N
N: N=~
HN_ /NH

NT N
F

2-[(2-Fluoro-9H-purin-6-ylamino)methyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-076) Prepared according to procedure E using 5a (20 mg, 0.072 mmol) and 2-fluoro-6-chloropurine (16 mg, 0.094 mmol) in 1 mL EtOH. After 18 hours, the reaction was purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220A) and subsequently recrystallized from EtOH to provide 14 mg of the product as a yellow solid. 'H
NMR (DMSO-d6) 6: 13.12 (br s, 1H) ; 8.40 (br s, 1H) ;
8.15 (s, 1H); 7.66 (t, J=7.7 Hz, 1H); 7.35-7.49 (m, 4H); 7.31 (d, J=7.2 Hz., 1H); 4.00-4.22 (m, 2H);
3.17 (s, 1H); 2.74 (s, 3H) ; 2.18 (s, 3H). MS (ES) :
m/z 416 (M+H), 208.

N/ O /
N \

/ N CI N-gNH

NON

(2-Chlorophenyl)-dimethylamino-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-075) D-015 (100 mg, 0.228 mmol) was combined with ammonium hydroxide (28-30%, 1 mL) in DMF (2 mL) and heated to 80 C. After 2 days, the reaction was purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100%
acetonitrile at 18 min, detector at 220X) to provide the product as a yellow solid, -2mg. 1H NMR (DMSO-d6) 5: 13.52 (br s, 1H) ; 8.46 (s, 1H) ; 8.42 (s, 1H); 7.69 (dd, J=2.1, 7.3 Hz, 1H); 7.62 (dd, J=1.6, 7.6 Hz., 1H) ; 7.61 (t, J=8.0 Hz., 1H) ; .7.37-7.48 (m, 2H); 7.05 (d, J=7.9 Hz., 1H); 6.96 (d, J=7.8 Hz., 1H); 4.32-4.45 (m; 2H); 2.80 (s, 6H). MS (ES): m/z 464 (M+H),'232.

\ N \
N CI N=
S ~NH
NON

5-(2-Benzyloxyethoxy)-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-078) To a solution of 2-benzyloxyethanol (0.3 mL) in DMF (1.0 mL) was added NaH (50 mg, 2.08 mmol). After stirring for 5 minutes, 0.5 mL was added to a solution of IC-87185 (50 mg, 0.114 mmol) in anhydrous DMF (Ø75 mL). The reaction was heated to 50 C and stirred for 3 days. Purification by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100%
acetonitrile at 18 min, detector at 220A) provided the product as a heterogenous solid, 150 p.g. MS
(ES) : m/z 571 (M+H), 481.

F O
N
a W') OYO

G N ~N
N
'N
ItN

6-Aminopurine-9-carboxylic acid 3-(2-chlorophenyl)-5-f luoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl ester (D-079) To a solution of 3b (20 mg, 0.066 mmol) in CH2C12 (500 uL) at 0 C was added phosgene (2M/tolu-ene, 36 pL, 0.072 mmol), followed by adenine (10 mg, 0.072 mmol), and DIEA (25 pL, 0.145 mmol). The reaction was allowed to attain ambient temperature and stir for 8 days. Purification by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% aceto-nitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220X) provided the product as a mixture. 1H NMR (DMSO-d6) 5: 11.04 (br s, 1H) ; 8.61 (s, 1H); 8.40 (s, 1H); 7.85-7.95 (m, 1H); 7.76 (dd, J=5.4, 9.6 Hz, 1H); 7.70-7.78 (m, 1H); 7.52-7.63 (m, 3H); 7.38 (dt, J=8.3, 10.6 Hz., 1H); 4.76-4.89 (m, 2H). MS (ES) : m/z 466 (M+H), 331, 305.

N
N') O\ NH
N
H
N-[3-(2-Chlorophenyl)-5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl]-2-(9H-purin-6-ylsulfanyl)-acetamide (D-077) (9H-Pur-in-6-ylsulfanyl)-acetic acid (63 mg, 0.296 mmol), 5b (108 mg, 0.355 mmol), EDC (68 mg, 0.355 mmol), HOBT (48 mg, 0.355 mmol), DIEA (62 jiL, 0.355 mmol), and DMF (1 mL) were combined in a flask and stirred at ambient temperature for one hour. The reaction was diluted with EtOAc (20 mL) and washed with dilute brine (2 x 13 mL). The organic phase was concentrated in vacuo and chroma-tographed in 5% MeOH/CH2C12 to provide the 91 mg of the product as a viscous, peach foam. 'H NMR (DMSO-d6) b : 12.88 (br s, 1H) ; 8.72 (s, 1H) ; 8.62 (t, J=5.0 Hz, 1H); 8.49 (s, 1H); 7.88 (dt, J=5.6, 8.2 Hz, 1H); 7.73-7.78 (m, 1H); 7.67-7.72 (m, 1H); 7.57-7.65 (m, 2H); 7.38 (d, J=8.1 Hz., 1H); 7.36 (dd, J=8.3, 11.1 Hz., 1H); 4.11-4.24 (m, 2H); 3.96 (dd, J=5.0, 17.4 Hz, 1H); 3.78 (dd, J=5.2, 17.4 Hz, 1H).
MS (ES) : m/z 496 (M+H) , , 248 .

o N
N N-HN\I` ~1ONH
N\/N
F

2-[1-(2-Fluoro-9H-purin-6-ylamino)ethyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-080) Prepared according to procedure E using 5c (50 mg, 0.17 mmol) and 2-fluoro-6-chloropurine (35 mg, 0.204 mmol) in 1.2 mL EtOH. Purification by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetoni-trile at 18 min, detector at 220A) provided two atropisomers as white solids. Data for one of these follows: 1H NMR (DMSO-d6) 5: 8.48 (br d, J=6.4 Hz, 1H); 8.17 (s, 1H); 7.69 (t, J=7.8 Hz,'1H); 7.53 (d, J=7.8 Hz, 1H); 7.44 (d, J=7.8 Hz, 2H);' 7.33 (d, J=7.2 Hz, 2H) ; 7.07 (br t, J=7.2 Hz, 1H); 4.80 (br t, J=6.8 Hz, 1H); 2.74 (s, 3H); 2.09 (s, 3H); 1.38 (d, J=6.7 Hz, 3H). MS (ES): m/z 430 (M+H), 215.

o N
N '~Y N=\
HN\ NH

NON
5-Methyl-2-[1-(9H-purin-6-ylamino)ethyl]-3-o-tolyl-3H-quinazolin-4-one (D-081) Prepared according to procedure E using 5c (50 mg, 0.17 mmol) and 6-chloropurine (32 mg, 0.204 mmol) in 1.2 mL EtOH. Purification byBPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75%
acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220X) provided two atropisomers as yellow solids. Data'for one. of these follows: 'H
NMR (DMSO-d6) 5: 8.39 (br s, 1H) ; 8.34 (s, 1H) ;
8.18 (s, 1H); 7.71 (t, J=7.7 Hz, 1H); 7.56 (d, J=7.9 Hz, 1H); 7.49 (d, J=6.9 Hz, 1H); 7.28 -7.43 (m, 3H);
7.20 (br s, 1H) ; 5.06 (br s, 1H) ; 2.73 (s, 3H) ; 2.04 (s, 3H) ; 1.51 (d, J=6.6 Hz, 3H),. MS (ES) m/z 412 (M+H), 206.

O O
N XH N

DMF

The following compounds of the present invention (D-082 through D-109) were prepared as outlined in Procedure C, using 2-chloromethyl-5-methyl-3-o-tolyl-3H-quinazolin-4-one (10 mg), the appropriate nucleophile XH (20 mg, excess), and potassium carbonate (10 mg) in DMF (0.25 mL). The reaction mixture was stirred 16 h at room tempera-ture, quenched with water, and the crude solid product was collected by filtration and air dried.
The crude material was dissolved in 0.5 mL of DMSO
and purified by reversed-phase HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% aceto-nitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220A). Appropriate fractions were concentrated in vacuo to yield the final products.
2-(6-Dimethylaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-082) N N
x= ( __N
~N
Yield: 8.1 mg.
1H NMR (300 MHz, d6-DMSO) 5: 8.13 (s, 1H) , 8.11 (s, 1H), 7.60 (t, J=7.8 Hz, 1H), 7.54-7.38 (m, 4H), 7.30 (d, J=7.4 Hz, 1H), 7.20 (d, J=8.1 Hz, 1H), 5.11 (d, J=17.4 Hz, 1H), 4.76 (d, J=17.4 Hz, 1H), 3.33 (s, 6H), 2.73 (s, 3H), 2.20 (s, 3H).
LRMS (ES pos.) m/z = 426 (M+1).

5-Methyl-2-(2-methyl-6-oxo-1,6-dihydro-purin-7-ylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-083) -r 0 ~N
X= \N NH
N~
Yield: 3.3 mg 1H NMR (300 MHz, d6-DMSO) 5: 12'.06 (s, 1H), 8.12 (s, 1H), 7.60 (t, J=7.8 Hz, 1H), 7.55-7.38 (m, 4H), 7.30 (d, J=7.4 Hz, 1H), 7.15 (d, J=7.9 Hz, 1H), 5.26 (d, J=17.4 Hz, 1H), 4.94 (d, J=17.4 Hz, 1H), 2.73 (s, 3H), 2.32 (s, 3H), 2.24 (s, 3H). Alkylation at purine N7 assigned arbitrarily based on downfield shift of methylene protons due to the carbonyl group.
LRMS (ES pos.) m/ z = 413 (M+1).

5-Methyl-2-(2-methyl-6-oxo-l,6-dihydro-purin-9-ylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-084) N' N N

N
O

Purified from same reaction mixture as D-083. Yield: 3.6 mg.
1H NMR (300 MHz, d6-DMSO) 12.17 (s, 1H) , 7.96 (s, 1H), 7.63 (t, J=7.8 Hz, 1H), 7.57-7.39 (m, 4H), 7.32 (d, J=7.4 Hz, 1H), 7.26 (d, J=8.1 Hz, 1H), 5.08 (d, J=17.2 Hz, 1H), 4.70 (d, J=17.2 Hz, 1H), 2.73 (5, 3H), 2.27 (s, 3H), 2.17 (s, 3H).
LRMS (ES pos.) m/z = 413 (M+1).
2-(Amino-dimethylaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-085) N
X= N~-N
/ N

Yield: 6.7 mg.
1H NMR (300 MHz, d6-DMSO) 6: 7.66 (s, 1HO, 7.61 (d, J=7.8 Hz, 1H), 7.55-7.40 (m, 4H), 7.32-7.26 (m, 2H), 6.74 (s, 2H), 4.94 (d, J=17.2 Hz, 1H), 4.63 (d, J=17.2 Hz, 1H), 4.63 (d, J=17.2 Hz, 1H), 2.97 (s, 6H), 2.73 (s, 3H), 2.17 (s, 3H), 2.08 (s, 3H).
LRMS (ES pos.) m/z = 441 (M+1).

2-(2-Amino-9H-purin-6-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-086) X=
N
N
-NH
Yield: 9.5 mg.
1H NMR (300 MHz, d6-DMSO) (5: 12.54 (s, 1H) , 7.89 (s, 1H), 7.69 (t, J=7.8 Hz, 1H),, 7.51 (d, J=8.0 Hz, 1H), 7.51 (d, J=8.0 Hz, 1H), 7.43 (t, J=3.9 Hz, 1H), 7.34 = 7.26 (m, 4H), 6.16 (s, 2H), 4.32 (AB quartet, JAB=14.8 Hz, Z~n=23 .7) , 2.74 (s, 3H) , 2.09 (s, 3H) LRMS (ES pos.) m/z = 430 (M+1).
2-(4-Amino-1,3,5-triazin-2-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-087) X= s N Y N

Yield: 5.8 mg.
1H NMR (300 MHz, d6-DMSO) 6: 8.10 (s, 1H), 7.70 (t, J=7.8 Hz, 1H), 7.58 (s, 1H), 7.52 (d, J=8.0 Hz, 1H), 7.48-7.26 (m, 6H), 4.08 (s, 2H), 2.73 (s, 3H), 2.09 (s, 3H).
LRMS (ES pos.) m/z = 391 (M+1).

5-Methyl-2-(7-methyl-7H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-088) S N
X=
'N
\N
Yield: 3.1 mg.
1H NMR (300 MHz, d6-DMSO) 5: 8.52 (s, 1H), 8.49 (s, 1H), 7.70 (t, J=7.8 Hz, 1H), 7.50 (d, J=7.8 Hz, 1H), 7.45 (d, J=7.1 Hz, 1H), 7.35-7.20 (m, 4H), 4.41 (AB
quartet, JA,=15.3 Hz, Ov=19.2 Hz), 4.08.(s, 3H), 2.73 (s, 3H) , 2.12 (s, 3H) .
LRMS (ES pos.) m/z = 406 (M+1).
5-Methyl-2-(2-oxo-1,2-dihydro-pyrimidin-4-ylsul-fanylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-089) X=
~NF!
O
Yield: 2.4 mg.
1H NMR (300 MHz, d6-DMSO) 5: 11.49 (s, 1H), 7.70 (t, J=7.8 Hz, 1H), 7.60 (brt, J=6.0 Hz, 1H), 7.53-7.48 (m, 2H), 7.46-7.28 (m, 4H), 6.31 (d, J=6.7 Hz, 1H), 4.05 (s, 2H), 2.73 (s, 3H), 2.12 (s, 3H).
LRMS (ES pos.) m/z = 391 (M+1).

5-Methyl-2-purin-7-ylmethyl-3-o-tolyl-3H-quinazolin-4-one (D-090) X= N
c N _ 1H NMR (300 MHz, d6-DMSO) 5: 9.04 (s, 1H), 8.97 (s, 1H), 8.48 (s, 1H), 7.65-7.54 (m, 2H), 7.53-7.39 (m, 3H) , 7.31 (d, J=7.4 Hz, 1H) , 7.13 (d, J=8. 0 Hz, 1H) 5.31 (d, J=17.6 Hz, 1H), 5.16 (d, J-17.6 Hz, 1H), 2.73 (s, 3H), 2.09 (s, 3H). Alkylation at purine N7 was determined by NOE enhancement between the purine 6-position proton and methylene protons on the linker between the purine and quinazolinone groups.
LRMS (ES pos.) m/z = 383 (M+l).
5-Methyl-2-purin-9-ylmethyl-3-o-tolyl-3H-quinazolin-4-one (D-091) X= N N
N N

From same reaction that produced D-090.
1H NMR (300 MHz, d6-DMSO) 5: 9.17 (s, 1H) , 8.86 (s, 1H), 8.55 (s, 1H), 7.59 (t, J-7.8 Hz, 1H), 7.55-7.42 (m, 4H), 7.30 (d, J=7.4 Hz, 1H), 7.13 (d, J=8.0 Hz, 1H), 5.26 (d, J=17.5 Hz, 1H), 4.92 (d, J=17.5 Hz, 1H), 2.73 (s, 3H), 2.19 (s, 3H). Alkylation at purine N9 suggested by the lack of NOE enhancement between purine 6-position protons and the linker methylene protons.
LRMS (ES pos.) m/z = 383 (M+1).
5-Methyl-2-(9-methyl-9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-092) X= S N
lN' N
N
1H NMR (300 MHz, d6-DMSO) 5: 8.52 (s, 1H), 8.42 (s, 1H), 7.69 (t, J=7.7 Hz, 1H), 7.50 (d, J=8.0 Hz, 1H), 7.44 (d, J=7.6 Hz, 1H), 7.36-7.27 (m, 4H), 4.38 (AB
quartet, J,,,=15.5 Hz, Av=21.0 Hz), 3.80 (s, 3H), 2.73 (s, 3H) , 2.12 (s, 3H) LRMS (ES pos.) m/z = 429 (M+1) . ..
2-(2,6-Diamino-pyrimidin-4-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-093) S NyNHS
X= N

1H NMR (300 MHz, d6-DMSO) 5: 7.70 (t, J--7.7 Hz, 1H), 7.54 (d, J=8.0 Hz, 1H), 7'.45-7.27 (m, 5H), 6.22 (br s, 1H) , 5.80 (br s, 1H) , 3.99 (AB quartet, JAB=14.6 Hz, A v=26.9 Hz, 2H), 2.73 (s, 3H), 2.08 (s, 3H).
LRMS (ES pos.) m/z = 405 '(M+1).

5-Methyl-2-(5-methyl-[1,2,4]triazolo[1,5-a]pyri-midin-7-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-094) s / Y
X- N N
N~1 1H NMR (300 MHz, d6-DMSO) 5: 8.57 (s, 1H), 7.73 (t, J=7.8 Hz, 1H), 7.55-7.35 (m, 4H), 7.18 (s, 1H), 4.27 (s, 2H), 2.74 (s, 3H0, 2.55 (s, 3H), 2.08 (s, 3H).
LRMS (ES pos.) m/.z = 429 (M+1).
5-Methyl-2-(2-methylsulfanyl-9H-purin-6-ylsulfanyl-methyl)-3-o-tolyl-3H-quinazolin-4-one (D-095) N\ S
x= I
N
%-NH
1H NMR (300 MHz, d6-DMSO) 5: 13.30 (s, 1H), 8.29 (s, 1H), 7.72 (t, J=7.8 Hz, 1H), 7.54 (d, J=7.8 Hz, 1H), 7.47 9d, J=6.3 Hz, 1H), 7.38-7.26 (m, 4H), 4.34 (AB
quartet, JAB=16.1 Hz, A\=23.6 Hz, 2H), 2.74 (s, 3H), 2.32 (s, 3H), 2.10 (s, 3H).
LRMS (ES pos.) m/z = 461 (M+1).

2-(2-Hydroxy-9H-purin-6-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-096) S OH
X=
i N N
`-NH
aH NMR (300 MHz, d6-DMSO) b: 8.08 (s, 1H), 7.69 (t, J=7.8 Hz, 1H), 7.50 (brd, J=t.8 Hz, 2H), 7.33-7.50 (m, 4H) , 4.28 (AB quartet, J,,,=15.5 Hz, Lv=21.3 Hz, 2H), 2.74 (s, 3H), 2.12 (s, 3H).
LRMS (ES pos.) m/z = 431 (M+1).
5-Methyl-2-(l-methyl-lH-imidazol-2-ylsulfanyl-methyl)-3-o-tolyl-3H-quinazolin-4-one (D-097) X= SIN\

1H NMR (300 MHz, d6-DMSO) b: 7.69 t, J=7.8 Hz, 1H), 7.46-7.37 (m, 5H), 7.32 (d, J=7.3 Hz, 1H), 7.20 (d, J=1.0 Hz, 1H), 6.48 (d, J=1.0 Hz), 3.83 (AB quartet, JAB=15.0 Hz, nv=18.8 Hz, 1H), 3.55 (s, 3H), 2.73 (s, 3H) , 2.09 (s, 3H) LRMS (ES pos.) m/z = 364 (M+1) 5-Methyl-3-o-tolyl-2-(1H-[1,2,4]triazol-3-ylsul-fanylmethyl)-3H-quinazolin-4-one (D-098) m X=
srl N-N
lH NMR (300 MHz, d6-DMSO) 5: 13.98 (s, 1H), 8.47 (s, 1H), 7.70 (t, J=7.8 Hz, 1H), 7.49 (d, J=7.9 Hz, 1H), 7.44-7.31 (m, 5H) , 4.04 (AB quartet, JA2=15.5 Hz, Av=19.1 Hz, 1H), 2.74 (s, 3H), 2.10 (s, 3H).
LRMS (ES pos.) m/z = 364 (M+1).
2-(2-Amino-6-chloro-purin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-099) X=
N,NHZ
N N

CI
LRMS (ES pos.) 432 (M+1).

2-(6-Aminopurin-7-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-100) X= N
~ `N
NJ
1H NMR (300 MHz, d6-DMSO) 5: 8.19 (s, 3H), 7.66 (t, J=7.8 Hz, 1H), 7.59-7.43 (m, 5H), 7.34 9d, J=7.4 Hz, 1H), 7.23 (d, J=8.0 Hz, 1H), 6.90 (s, 2H), 5.21 (AB
quartet, J,,=17.4 Hz, v=22.1 Hz, 2H), 2.72 (s, 3H), 1.93 (s, 3H). Alkylation at purine N7 was confirmed by NOE enhancements between the following protons:
1) Exocyclic amine and methylene, protons; 2) Exo-cyclic amine and toluyl methyl protons.
LRMS (ES pos.) m/z = 398 (M+1).
2-(7-Amino-1,2,3-triazolo(4,5-d]pyrimidin-3-yl-methyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-101) X= NIN Nl N ~ N

1H NMR (300 MHz, d6-DMSO) b : 8.43 (br s, 1H) , 8.19 (s, 1H), 8.10 (br s, 1H), 7.62 (t, J=7.8 Hz, 1H), 7.49-7.28 (m, 5H), 7.22 (d, J=8.1 Hz, 1H), 5.49 (d, J=17.0 Hz, 1H), 5.19 (d, J=17.0 Hz, 1H), 2.73 (s, 3H), 2.11 (s, 3H). Alkylation at purine N7 determined by similarity to nmr spectrum of D-030.
LRMS (ES pos.) m/z = 399 (M+1) .

2- (7-Amino-1, 2, 3-triazolo [4, 5-d] pyrimidin-1-yl-methyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-102) NHz X= IN

N / J

From same reaction mixture as D-101.
1H NMR (300 MHz, d6--DMSO) 6: 8.2.7 (s, 1H), 8.20 (br s, 1H), 8.05 (br s. 1H), 7.70 (t, J=7.8 Hz, 1H), 7.47-7.26 (m, 6H) , 5.61 (AB quartet, J,,=16.0 Hz, Lv=20.7 Hz, 2H), 2.75 (s, 3H), 1:98 (s, 3H)).
Alkylation at purine N7 determined by similarity to nmr spectrum of D-100.
LRMS (ES pos.) m/z = 399 '(M+l).
2-(6-Amino-9H-purin-2-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-103) X= S( N NHz I I
N
NN ~N

1H NMR (300 MHz, d6-DMSO) 5: 12.62 (s, 1H), 7.93 (s, 1H), 7.69 (t, J=7.7 Hz, 1H), 7.51 (d, J=8.1 Hz, 1H), 7.42 (dd, J=7.6,1.7 Hz, 1H), 7.35-7.15 (m, 6H), 4.12 (AB quartet, JA,=14.5 Hz, Ov=18.2 Hz, 2H)', 2.73 (s, 3H) , 2.10 (s, 3H) .
LRMS (ES pos.) m/z = 430 (M+1).
2-(2-Amino-6-ethylamino-pyrimidin-4-ylsulfanyl-methyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-104) X= s NYNH2 N
/NH

lH NMR (300 MHz, d6-DMSO) 5: 7.70 (T, J=7.8 Hz, 1H), 7.53 (d, J=8.0 Hz, 1H), 7.44-7.31 (m, 5.H), 6.69 (br s, 1H), 5.83, (br s, 2H), 5.61 (s, 1H), 4.03 (d, J=14.6 Hz, 1H), 3.95 (d, J=14.6 Hz, 1H), 3.22-3.11 (m, 2H), 2.73 (s, 3H), 2.08 (s, 3H), 1.06 (t, J=7.1 Hz, 3H).
LRMS (ES pos.) m/z = 433 (M+1).

2-(3-Amino-5-methylsulfanyl-1,2,4-triazol-l-yl-methyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-105) X N\NS
N
HZN
Yield: 5.0 mg.
1H NMR (300 MHz, d4-MeOH) 6: 7.67 (t, J=7.8 Hz, 1H), 7.55-7.37 (m, 4H), 7.35-7.27 (m, 2H), 4.77 (d, J=17.lHz, 1H), 4.60 (d, J=17.1 Hz, 1H), 2.80 (s, 3H) , 2.43 (s, 3H) , 2.14 (s, 3H) LRMS (ES pos.) m/z = 393 (M+1) 2-(5-Amino-3-methylsulfanyl-1,2,4-triazol-l-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-106) X = H2NYN,N
\NA
S-Yield: 0.6 mg.
Purified from same reaction mixture as D-105.
1H NMR (300 MHz, d4-MeOH) d: 7.67 (t, J=7.8 Hz, IH), 7.50-7.24 (m, 6H), 4.83 (d, J=16.5 Hz, 1H), 4.70 (d, J=16.5 Hz, 1H), 2.79 (s, 3H), 2.47 (s, 3H), 2.14 (s, 3H).
LRMS (ES pos.) m/z = 393 (M+1).

5-Methyl-2-(6-methylaminopurin-9-ylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-107) X= CN N
N
HN
Yield: 5.0 mg 1H NMR (300 MHz, d4-MeOH) 5: 8.17 (s, 1H) , 8.03 (s, 1H), 7.54-7.43 (m 4H), 7.31-7.23 (m, 2H), 5.14 (d, J=17.5 Hz, 1H), 4.90 (d, J=17.5 Hz, 1H), 3.14 (br s, 3H), 2.79 (s, 3H), 2.22 (s, 3H).
LRMS (ES pos.) m/z = 412 (M+1) .
2-(6-Benzylaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-108) -I-X= (N N\
N N
HN /

Yield: 6.7 mg.
1H NMR (300 MHz, d4-MeOH) 5: 8.13 (s, 1H), 8.04 (s, 1H), 7.58 (t, J=7.8 Hz, 1H), 7.51-7.21 (m, 11H), 5.15 (d, J=17.5 Hz, 1H), 4.91 (d, J=17.5 Hz, 1H), 4.83 (s, 2H, under H2O Peak), 2.79 (s, 3H), 2.22 (s, 3H).
LRMS (ES pos.) m/z = 488 (M+1).

2-(2,6-Diaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-109) -T-X= / N\rNH2 N
/ N

Doubled the amounts of all reactants. Yield: 14 mg.

1H NMR (300 MHz, d6-DMSO) 5: 8.53 (br s, 2H) , 8.01 (s, 1H), 7.64 (t, J=7.8 Hz, 1H), 7.53-7.40 (m, 4H), 7.33 (d, J=7.4 Hz, 1H), 7.27 9d, J=7.9 Hz, 1H), 4.96 (d, J=17.5 Hz, 1H) , 4.64 (d, J=17. 5 Hz, 1H) , 2.74 (s, 3H) , 2.17 (s, 3H) .
LRMS (ES pos.) m/z = 413''(M+1).

Compounds D-110 through D-115 of the following general structure were prepared from the following Intermediates E-1 through E-3.

neat I-ly N N
S N S

N N
N N
~--NH ~-NH
Intermediate E-1.

5-Methyl-2-(9H-purin-6-ylsulfanylmethyl)-3,1-benzoxazin-4-one Step 1 Step 2 HS OH &\-' N
+ CI neat p - _ N
NH CI 115 deg C N S \
Z K2CO3, DMF
CI I i N
N
% -NH

Intermediate E-1 Step 1. A suspension of 6-methylanthran-ilic acid (2 g, 13.2 mmol) in chloroacetyl chloride (12 mL, large excess) was stirred at 115 C in a sealed vial for 30 min. The resulting solution was cooled to room temperature and treated with ether (-5 mL). After cooling at 4 C overnight, the re-suiting tan precipitate was collected by filtration, washed with ether, and dried in vacuo to yield the chloro intermediate (1.39. g, 500).
1H NMR (300 MHz, CDC13) d: 7.67 (t, J=7.8 Hz, 1H), 7.46 (d, J=7.9 Hz, 1H), 7.35 (d, J=7.6 Hz, 1H), 4.39 (s, 2H), 2.81 (s, 3H).
LRMS (ES pos.) m/z = 210, (M+1).

Step 2. A mixture of the chloro intermed-iate (50 mg, 0.25 mmol), 6-mercaptopurine monohy-drate (43 mg, 0.25 mmol), and potassium carbonate (25 mg, 0.25 mmol) in dry DMF (0.5 mL) was stirred at room temperature for 30 min. The mixture was poured into ethyl acetate (20 mL) and all insoluble material was filtered off and discarded. The fil-trate was concentrated in vacuo to remove all ethyl acetate, and the residue was treated with ether, re-sulting in a light orange precipitate. The precipi-tate was collected by filtration, washed with ether, and dried in vacua to afford Intermediate E-1 (41 mg, 510).
'-H NMR (300 MHz, d6-DMSO) 5: 8.64 (s, 1H), 8.39 (s, 1H), 7.73 (t, J=7.8 Hz, 1H), 7.44-7.37 (m, 2H), 4.69 (s, 2H), 2.69 (s, 3H).
LRMS (ES pos.) m/z = 326 (M+1).

Intermediate E-2 H2, Pd/C
02N EtOH H2N
HN HNO
Intermediate E-2 A solution of 2-nitroacetanilide (1.0 g, 5.6 mmol) in EtOH was purged with nitrogen, treated with Pd(OH)2 (20% by wt. on C, 200 mg, cat.), and shaken for 2 h under H2 (20 psi). The catalyst was removed by filtration through a.Ø22 um cellulose acetate membrane (Corning'), and the filtrate was concentrated in vacuo to afford the white crystal-line solid product (800 mg, 960).
1H NMR (300 MHz, d6-DMSO) 5: 9.12 (s, 1H) , 7.14 (dd, J=7.8, 1.3 Hz, 1H), 6.88 (dt, J=7.6, 1.5 Hz, 1H), 6.70 (dd, J=8.0, 1.3 Hz, 1H), 6.52 (dt, J=7.5; 1.4 Hz, 1H) , 4.85 (br s, 2H) 2.03 ('s, 3H) LRMS (ES pos.) m/z = 151 (M+1).
Intermediate E-3 i I \ H2, Pd/C
\
02N 02N EtOH H2N
F NaHCO3, EtOH N/ N

Intermediate E-3 A mixture of 2-fluoro-nitrobenzene (1.41 g, 10 mmol) and NaHCO3 in EtOH (20 mL) was treated with (N,N,N'-trimethyl)-1,2-diaminoethane (1.1 g, 11 mmol) and was stirred 16 h at 80 C. Solvent was removed in vacuo, residue was treated with 0.1 M
NaOH (120 mL), and the mixture was extracted with ethyl acetate (2 x 50 mL).. The organic layers were combined and washed with,20 mL of water (lx).and brine (2x), dried with sodium sulfate, and concentrated in vacuo to an orange liquid (2.2 g, 100%; ESMS: m/z = 224, M+1) .
This intermediate was dissolved in EtOH, the solution was purged with nitrogen, treated with Pd(OH)2 (20% by wt. on C,'180 mg, cat.), and shaken for 2 h under H2 (50psi) . The catalyst was removed by filtration through a 0.22 um cellulose acetate membrane (Corning), and the filtrate was concentrated in vacuo to afford the red liquid product E-3 (1.8 g, 95%).
1H NMR (300 MHz, CDC13) 6: 8,.64 (s, 1H), 7.03 (dd, J=8.3, 1.4 Hz,-1H), 6.91 (ddd, J=7.6, 7.2, 1.4 Hz, 1H), 6.73-6.67 (m, 2H), 4.20 (br s, 2H), 2.95 (t, J=6.7 Hz, 2H), 2.68 (s, 3H), 2.41 (t, J=6.7 Hz, 1H) , 2.26 (s, 6H) .
LRMS (ES pos.) m/z=194 (M+l).

Compounds D-110 through D-115 were prepared as follows: 0 5-Methyl-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one (D-110) Y=
A mixture of Intermediate E-1 (40 mg) and o-tolui-dine (0.3 mL, large excess) was warmed at 100 C in a sealed vial for 16 h. The reaction mixture was cooled, treated with iN HC1 (2 mL) and.ether (2 mL), and the resulting gray precipitate was collected by filtration, washed with ether, and air dried (19 mg crude). The crude solid was dissolvedlin 0.5 mL
DMSO and purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 2201). Appropriate fractions were concentrated in vacuo to yield the final product as a white solid (4 mg).

1H NMR (300 MHz, d6-DMSO) b: 13.52 (s, 1H), 8.47 (s, 1H), 8.43 (s, 1H), 7.69 (t, J=7:8 Hz, 1H), 7.50 (d, J=7.9 Hz, 1H), 7.46-7/43 (m, 1H), 7.37-7.25 (m, 4H), 4.37 (AB quartet, j.=15.4 Hz, Ov=22.4 Hz, 2H), 2.74 (5, 3H) , 2.12 (5, 3H) .
LRMS (ES pos.) m/z = 415 (M+1).

3-Isobutyl-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-111) 'VY

Y=
A mixture of Intermediate E-1 (40 mg) and isobutyl-amine (0.4 mL, large excess) was warmed at 120 C in a sealed vial for 16 h. Excess.isobutylamine was allowed to evaporate, residue was dissolved in 1 mL
DMSO and purified in two portions by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetoni-trile/water over 15 min, 100% acetonitrile at 18 min, detector at 220A). Appropriate fractions were concentrated in vacuo to yield the final product as a white solid (4 mg).
'H NMR (300 MHz, d6-DMSO) 5: 13.75 (br s, 1H)', 8.73 (s, 1H), 8.50 (s, 1H), 7.63 (t, J=7.7 Hz, 1H), 7.42 (d, J=8.0 Hz, 1H), 7.28 (d, J=7.3 Hz, 1H), 4.96 (s, 2H), 4.00 (d, J=7.5 Hz, 2H), 2.77 (s, 3H), 2.30-2.15 (m, 1H), 0.98 (d, J=6.7 Hz, 1H).
LRMS (ES pos.) m/z = 381, (M+1) .

N-{2-[5-Methyl-4-oxo-2-(9H-purin-6-ylsulfanyl-methyl)-4H-quinazolin-3-yl]-phenyl}-acetamide (D-112) Y=
HNTO

A mixture of Intermediate E-1 (80 mg, 0.25 mmol) and Intermediate E-2 (75 mg, 0.5 mmol, 2 eq) was warmed until melted in a sealed vial using a heat gun. The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in'1 mL DMSO and purified in two portions by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220)).
Appropriate fractions were concentrated in vacuo to yield the final product as a white solid.
1H NMR (300 MHz, d6-DMSO) 5: 13.52 (s, 1H), 9.52 (s, 1H), 8.48 (s, 3H), 8.42 (s, 3H) 8.02 (d, J=8.0 Hz, 1H), 7.69 (t, J=7.8 Hz, 1H), 7.51 (d, J=7.9 Hz, 1H), 7.45-7.37 (m, 2H), 7.31 (d, J=7.3 Hz, 1H), 7.19 (t, J=7.5 Hz, 1H), 4.38 (s, 2H), 2.74 (s, 3H), 1.93 (s, 3H).
LRMS (ES pos.) m/z = 458 (M+l).

5-Methyl-3-(E-2-methyl-cyclohexyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-113) Y=
A mixture of Intermediate E-1 (80 mg, 0.25 mmol) and trans-2-methyl-i-aminocyclohexane (0.25 mL, large excess) was warmed in a sealed at 100 C for 16 h.
The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column,- 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% aceto-nitrile at 18 min, detector at 220X). Appropriate fractions were concentrated in vacuo to yield the final product as a white'solid (1.5 mg).
1H NMR (300 MHz, d6-DMSO). 5: 13,.5 (br =s, 1H) , 8.82 (s, , 1H) , 8.51 (s, 1H), 7-.63 (t, J=7.7 Hz, 1H), 7.43 (d, J=7.9 Hz, 1H), 7.27 (d, J=7.4 Hz,.1H), 5.11 (d, J=14.5 Hz, 1H), 3.78-3.69 (m, 1H), 2.73 (s, 3H), 2.55-2.40 (m, 3H), 1.88-1.46 (m, 4H), 1.31-1.11 (m, 1H), 0.90-0.65 (m, 1H), 0.74 (d, J=6.7 Hz, 3H).
LRMS (ES pos.) m/z = 421 (M+1).

2-[5-Methyl-4-oxo-2-(9H-purin-6-ylsulfanylmethyl)-4H-quinazolin-3-yl]-benzoic acid (D-114) Y=

A mixture of Intermediate E-1 (80 mg, 0.25 mmol) methyl anthranilate (0.25 mL, large excess) was warmed in a sealed vial at 100 C for 16 h. The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x,250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% aceto-nitrile at 18 min, detector at 220A). Appropriate fractions were concentrated in vacuo to yield the final product as a white solid (8 mg).
1H NMR (300 'MHz, d6-DMSO) d: 13.51 (s, 1H), 8.51 (s, 1H), 8.42 (s, 1H), 8.11 (dd, J=7.4, 1.1 Hz, 1H), 7.88 (dt, J=7.7, 1.4 Hz, 1H), 7.70 (d, J=8.0 Hz, 1H), 7.57 (t, J=7.2 Hz, 1H), 7.49-7.35 (m, 3H), 4.58 (d, J=15.5 Hz, 1H), 4.35 (d, J=15.5 Hz, 1H), 2.44 (s, 3H).
LRMS (ES pos.) m/z = 445 (M+1).

3-{2-[(2-Dimethylamino-ethyl)-methyl-aminol-phenyl}-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-115) Y=
qN/
A mixture of Intermediate E-1 (40 mg, 0.25 mmol) Intermediate E-3 (0.2 mL,' large excess) was warmed in a sealed vial at 100 C for 16 h. The reaction mixture was triturated with ether and the solids were collected by,filtration. The crude material was dissolved in 1 mL DMSO and purified by HPLC in two portions (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100%
acetonitrile at 18 min, 0..05% TFA in all solvents, detector at 220)Q. Appropriate fractions were concentrated in vacuo to yield the final product as the TFA salt (11 mg).
'-H NMR (300 MHz, d6-DMSO) b : 13.4 (br s, 1H), 9.27 (s, 1H), 8.52 (s, 1H), 8.44 (s,:1H), 7.72 (t, J=7.8 Hz, 1H), 7.53 (d, J=7.9 Hz, 1H), 7.40-7.33 (m, 4H), 7.10-7.04 (m, 1H), 4.42 (s, 3H), 3.5 (m, 2H), 3.23-3.03 (m, .3H) , 2.75 (s, 3H), 2.68-2.56 (m, 8H).
LRMS (ES pos.) m/z = 501 (M+1).

Compounds D-116.through D-118 were prepared as follows:

F 0 I R\X 0 tN'q R-NH2 or R-ONa S N ~) S \
r N
N
N
T
----NH ~ -NH
3-(2-Chlorophenyl)-5-methoxy-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one (D-116) (R = Me, X = 0) A mixture of D-015 (25 mg) in 0.5 M NaOMe (2 mL in MeOH; large excess) was stirred at 50 C for 16 h in a sealed vial. The reaction mixture was cooled to room temperature, treated with water (5 mL), and the resulting precipitate was collected by filtration, washed with water, and air dried. The crude material was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100% acetonitrile at 18 min, detector at 220A). Appropriate fractions were concentrated in vacuo to yield the final product as a white solid (5.3 mg).

1H NMR (300 MHz, d6-DMSO) 6: 13.52 (s, 1H) , 8.48 (s, 1H), 8.44 (br s, 1H), 7.77 (t, J=8.2 Hz, 1H), 7.71-7.60 (m, 2H), 7.51-7.34 (m, 2H), 7.23 (d, J=8.2 Hz, 1H), 7.10 (d, J=8.4 Hz, 1H), 4.39 (AB quartet, JAB=5.2 Hz, A\=23.2 Hz, 2H) , 3.85 (s, 3H).
LRMS (ES positive) m/z = 451 (M+1).
3-(2-Chlorophenyl)-5-(2-morpholin-4-yl-ethylamino)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-117) R= ON X=NH

A mixture of D-015 (25 mg) and 4-(aminoeth-2-yl)-morpholine (650 mg, large excess) was stirred at 50 C for 16 h. The crude reaction mixture was purified by HPLC (C18 Luna column, 4.6 x'250 mm, 4.7 mL/min, 10-75% acetonitrile/water over 15 min, 100%
acetonitrile at 18 min, detector at 2201\). Appro-priate fractions were concentrated in vacuo to yield the final product.
1H NMR (300 MHz, d6-acetone) 5: 8.57 (br s, 1H), 8.47 (s, 1H), 8.37 (s, 1H), 7.72 (dd, J=7.7, 1.6 Hz, 1H), 7.65 (dd, J=8.0, 1.2 Hz, 1H), 7.57 (t, J=8.1 Hz, 1H), 7.49 (dt, J=7.7,1.6 Hz, ' 1H) , 7.40 (dt, J=7.7,1.5 Hz, 1H), 6.86 (d, J=7.4 Hz, 1H), 6.82 (d, J=8.3 Hz, 1H), 4.55 (d, J=15.0 Hz, 1H), 4.42 (d, J=15.1 Hz, 1H), 4.05-3.90 (m, 4H)., 3.90 (t, J=6.9 Hz, 2H), 3.75-3.4 (m, 4H), 3.54 (t, J=6.9 Hz, 2H).
LRMS (ES positive) m/z = 549 (M+1).

3-Benzyl-5-methoxy-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one (D-118) N N CH3ONa eN N

S N 50 deg C S N

N%-NH Nth--NH

A mixture of D-043 (25 mg) in 0.5 M NaOMe (2 mL in MeOH; large excess) was stirred at 50 C for 16 h in a sealed vial. The reaction mixture was treated with 1 N HC1 (1 mL) and aliquots of this solution (0.5 mL each) were purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL/min, 10-75% acetoni-trile/water over 15 min, 100% acetonitri'le at 18 min, detector at 220X). Appropriate fractions were concentrated in vacuo to yield the final product as a white solid (6.6 mg).
lH NMR (300 MHz, d6-DMSO) 6: 13.57 (s, 1H), 8.60 (S, 1H), 8.45 (s, 1H), 7.72 (t, J=8.1 Hz,, 1H), 7'.42-7.30 (m, 2H), 7.30-7.19 (m, 3H), 7.15 (d, J=8.0 Hz, 1H), 7.06 (d, J=8.3 Hz, 1H), 5.43 (s, 2H), 4.80 (s, 2H), 3.87 (s, 3H).
LRMS (ES positive) m/z = 431 (M+1).

Compound D-999 (comparative) 3-(2-Chlorophenyl)-2-(1H-pyrazolo[3,4-d]pyrimidin-4-ylsulfanylmethyl)-3H-quinazolin-4'-one An analog compound, 3-(2-chlorophenyl)-2-(lH-pyrazolo[3,4-d]pyrimidin-4-ylsulfanylmethyl)-3H-quinazolin-4-one, also was synthesized generally in accordance with the described methods, except that a 4-mercapto-lH-pyrazolo[3,4-d]pyrimidine was substi-tuted for the mercaptopurine in the final step.

Biochemical Assays of P13K Potency and Selectivity A. Biochemical. Assay using 20 TIM ATP
Using the method described in Example 2, above, compounds of the invention were tested for inhibitory activity and potency against PI3K5, and for selectivity for PI3K5,versus.,other Class IPI3K
isozymes. In Table 2, IC50 values (jaM) are given for PI3Ka ("Alpha") , PI3K(3 ("Beta") , P13y ("Gamma"), and PI3K5 ("Delta"). To illustrate selectivity of the compounds, the ratios of the IC50 values=of the com-pounds for PI3KU, PI3K(3, and PI3Ky relative to PI3K5 are given, respectively, as "Alpha/Delta Ratio,"
"Beta/Delta Ratio," and "Gamma/Delta Ratio."
The initial selectivity assays were done identically to the selectivity assay protocol in Example 2, except using 100 pL Ecoscint for radio-label detection. Subsequent selectivity assays were done similarly using the same 3X substrate stocks except they contained 0.05 mCi/mL y [32P] ATP and 3 mM

PIP2. Subsequent selectivity assays also used the same 3X enzyme stocks, except they now contained 3 nM of any given P13K isoform.
For all selectivity assays, the test compounds were weighed out and dissolved into 10-50 mM stocks in 100% DMSO (depending on their respec-tive solubilities) and stored at -20 C. Compounds were thawed (to room temperature or 37 C), diluted to 300M in water from which a 3-fold dilution series into water was done. From these dilutions, 20 pL was added into the assay wells alongside water blanks used for the enzyme (positive) control and the no enzyme (background) control. The rest of the assay was essentially done according to.-the selec-tivity assay protocol in Example:2.
For those cases in which the greatest con-centration used in the assay, i.e., 100 'aM, did not inhibit activity of the enzyme by at least 50%, the table recites the percent activity remaining at that concentration (i.e., at 100 pM). In these cases, the true activity ratio(s) for the compounds cannot be calculated, since one of the required ICS0 values is missing. However, to provide some insight into the characteristics of these compounds, a hypothet-ical activity ratio is calculated using-100 pM sub-stituted for the missing value. In such cases, the selectivity ratio must in fact be greater than the hypothetical value, and this is indicated by use of a greater than (>) symbol.

m a) o Q j N 0 N N
LC Ld N H H d H
1.) r-l o Q O 10 [h 0 00 00 N O' L) 0 0 CD M
N N rl N M CO Ln LO LO 10 10 cf' A
() A O A A H H Ln N A
.LJ
a) .a=L
r-I
O O N
A 0 N In M H N rn .- O O 00 0 1D 0 Ln 4.3 0 N N N LO H O O O OD 0 14 co .~ a Co r-l N N A H 1D 10 A 10 00 - L!1 't N
A A A A A= A r-1 A N rl A A
A A A

U
H
N O r-I I 10 O rl N M
N
r-i H ti H M Ln ' 1D N 1D c r 1n 1D H
M 00 IN d1 co H H H 0 H H 0 0 N O
0 O O O O O . O O O O
U) Q
H 0\o Ln o10 o\o o%o, w O CO H Ln rl M 1D o\o l0 r- L M n O OD D M w H L! 1 rl H M 1W 00 aq U
H
-No OP 010 0\0 010 010 010 o10 N o10 010 010 010 o10 010 (0 10 M OD N M 0) OD N N IT N 0) H M Ln H
00 00 00 m 00 N OD N N . CD N lD 1D 0) co PA
ri O r-I N M -T Ln 10 N 00 m 0 H N M Ln 1D
0 0 0 0 O 0 0 0 0 0 1-1 r-I H rl H H r-I

L I L I L L I I I I I I I I L I I
A A A A A A A A A A A A A A A A A

U

ro 4.) -1 o d+ r1 4.) LA H N
Ld .41 r-I O O
d) 0 In 0') rn Ln M OD 00 N In 00 0 N N (Y) dl O M dl in 41 .. A A H A LA N M A dl 41 LA In N co \ ro N LA
rtt cn A A H
.u H A
d) H O
N 0 N m Ln m A M
p co 0 r1 N N CO O N 10 Ln N co M r1 Ol .11 \ .. A N H LO l0 H A M d> -1 LA 00 Ln M
c (d A A A A H A A O r- 00 A 1-1 rl n C
U
H
o Ln N
H H
N

Ld H H co co A N N Ln LA
N N co LA H O H O O H H O
fd N o d~ H rl O N 0 0 0 O O O O O O
m U
H O ow Ln o\o 0 0 ow Op oW o\O co (+'1 O O rl M O rn 1-1 H H ... 10 H v Lo r) 4) H 0) rl LA H H rn N l0 Ln rl m rl rl U
H
O\0 010 oVo O oW o\o 0 o10 010 010 o10 Ld 81 O N 81 0 H M 0 cn 00 rn N 01 o d a) 01 A 00 00 kD l0 rH 00 co c-I LN l0 In L IzH Ln t- H
H

N 0u 0) 0 H N rl dl Ln A N 00 01 O H zJ4 Lf) H r1 r1 N N N N N N N N N N M M M rl p A A A A A A A A A A A A A A A A A
U

a) H
a) o -i o J-) N C) LIS (d H Ln a H
a) .0 0 o H C) r I Ln N M C) H M
(.~ 41 Ol O i-i h l0 N 00 LO 1-I r-I O O O l0 M H
to a A A A A A H a\ M N A A
a-1 a) Li r-I
a) O
rl N N kD c-i U) N l~ u) M H M 0) 0 M r-I 0O
4J l0 N M ~N H r-I M d{ l0 M
d A A A A A A A A N A A M A A A O

U
H
a0 O LLl I M l0 =
N

a) of o H U
H
i O cO l0 N H N 00 H O l.0 M
N
.u O O O O ri N d{ L~ O O ~--I rl M
r1 a) A
U
O o\o oW oo o\o o\o Op to o\o o\o La M 00 l0 M ^3v Ln N dl 0) r-I M Ln Ol 4.) tlo %D w r-4) I
C) H
o\o o\o o\o o\o o\O \o o\o oW Lf) o\o oW o'P o\o o\o r La M lzH N N N N 0 M O 00 I;di O (D O 0) Ol ,L," Lo \0 N N N \0 E N H 0) l0 M N H 0\ co O
R+
r=
la' eCs l0 N 0) co O r-1 N M di LO l0 N co 0) 0 H N
M M M M dl d{ di d di ddd dl u) In Ln O 01 O O O O O 0 0 0 O 0 O O C) O O O 0 I I I I i I I 1 I I I I I I I 1 O A A A A A A A A A A A A. A A A A A
U

m r-I
a) 0 A {

n 1p A rt rH-1 H N
rt a n 04 N rI
as 4) (1) 0 =rI
'u -1 N M O cli rd (a Lr) ,.0 N A N fi3 P

b x M
H

N
a) ri 1Z
H G 4-4 U]

d+ L~ N -1 x 4J C. u Q ~I
O Z
¾I
L) x / \
o\ oW ~ 41 ra Co r-I
4J L~ L~ O
Pq r- 1 a) U I
H r~
o\ Lfl N
ai m 0 m a ra q~' N

rd cq a r; 0) 0 U Q A a u B. Biochemical Assay using 200 UM ATP
In Part A, above, compounds of the inven-tion were tested to establish their IC50 for inhibi-tion of the alpha, beta, delta, and gamma isoforms of P13K using 20 pM-ATP. A further screen was performed to establish the IC50 for inhibition of the four P13K isoforms at a final concentration of 200 }M ATP, 10-fold greater, and substantially closer to the normal physiological concentration of ATP in cells. This"selectivity protocol is identical to that described above, except the 3X stock ATP con-centration was 600 p.M. Data from this assay are summarized in Table 3, below. The observed sensi-tivity to ATP concentration suggests that these P13K5 inhibitor compounds act as ATP competitors.

H

-ri \ 4.1 co N Lf1 N l0 N O d~ O loo H of d1 d{ Lfl CO N
rt 0 H H m H N N N M N rl H N N M rI H M

N =rl d 0 rn a) H H H
w co 0) kv 00 H a) 0) N m 00 N Lfl M N H N 0 0 H N r-I dl M H H
.4L
N

Id .41 r=I

(a =rl O 10 N 0 N 0 1- rl Co 0 LD M LO M
r-I
\ .{.) N (14 LO 0 Ln 0 O 0 0) a0 L~ N Ln lzzt N ~ Ln N N N l0 N H d1 M H Ln 'T M H l0 r-i ut H Lfl M O )P M O
M p m +I M M +I + (Y) rri M a + o 0) O
1 LI m tI 00 Lf) ~I O N LL+II +I M 0 co M l0 N +I
M 0o O l0 LO r-I M M
O rI
U
r-1 ro o H U ri N N N l4 Lfl M N 0 H ' H +1 +I N +1 +1 o 0+1 o o N +1 +I to 0 (d +I r-I N M M L11 +I H +1 +I M N 00 +I
H 43 N Ol O N N M LO Ln c-I ~ M H M
Q O O O O H O O H O O
U o\o N LO d4 )O oo o\ o\o H N o\o LO H M +1 "M 0 M 0 Op l0 N 0 o\o +1 +I H 00 +I +I N +I H +I
N +1 00 +1 0 +I +1 H H
00 N rl M Lfl O +I M H H O N N H OD
U) co LN M H H N H co H N N M
pq U o\o o\o oW o\o ow o\o o\o o%0 H o\ o\o 1-1 rH 00 0\0 \0 00 l0 N o\o r-1 \ o\ N
r-I lzN +1 rI o\o di 'di +1 +1 N 0 o\o r1 0\0 0 r-I
r I r I
ro +I O cV +1 o +1 +I +I N 0 +1 o 00 +1 +I +I
H r-I 0 N cN O O r-I 0 Ln r-I 00 rn M r H O
P4 0) r- 00 H H 0', r O H r~ m 00 c rd 0 0 Lfl W N a O H N M 1*1 Ln rn N LO l0 N 00 rn p 0 O O 0 0 H H r-I H H H H N N N N N N
a 0 O 0 0 0 O 0 0 0 0 O 0 0 0 O 0 0 0 1 I I I I I 1 1 I I i I I I 1 I 1 A q q A A A A A A A q A A A q A A A

U

Cd a) o rl J 4 m N N co dl 00 m H . df m H (n H m (d (d Lt') 00 N H r1 rl M V~ N Ol rl 4) r1 0 a) =rl N r Ln Ol 10 m N . O O 0 00 HH-I N 00 \O (n m O Ln H r m N N
.) a) (d a) o.
.r{ N m m m O r Ln 0 r O rl 4J ' lO 0 Ln O H Ln N
rti (a m o H r-i r W co \o H H

O O
H H
+I +I I1 N Ln Ln ah to +1 o\o O rm-I
H1 Ln IN 00 , r d Ln LO IV m loo 1 0) Ln m N N
M
a) rl V N Ln O o m rn Ln H
O O O H Ln co to N O m rl o I +1 Ln 4J ml +1 N m rl N O del O r H
r q Ln a) O r-1 O ~-1 N
O

ut U d m d CV
H H N +1 o\ oW o\o o\o r OP o\o +1 +1 +1 m +1 m 00 ~I Ln 0 +1 N H r P O M 0 M C-- Ln r l0 m 0 r co H r-I m ,p lP 0\0 H H 1+01 0\0 CV o\o o\o o\o Ln o\o NO +1 N
+I +I +I Lo rt 00 M

Pa Ln r N O1 H N
rn 00 rn N
O rl dl LU Lo r 00 01 r co H Ol O
m m m m m m (n m dl W N 0) 0 O 0 0 0 0 0 O 0 0 O 0 H 0) ~v a 1 1 1 I I I I I i I I 1 0) U A A A A A A A A A A A A a Cell-Based Assay Data for Inhibitors of PI3K6 Activity Using the methods described in Examples 3-5, above, compounds of the invention were tested for inhibitory activity and potency in assays of stim-ulated B and T cell proliferation, neutrophil (PMN) migration, and neutrophil (PMN).elastase release.
Data from these assays are set forth in-Table 4, below. In Table 4, the values shown are effective concentrations of the compound (ECso; }JM) . Where no value is given, no assay was performed..

Table 4 Human PMN Human PMN
Mouse BCR Mouse TCE Elastase Migration Compound Stim (EC50) Stim (EC50) (EC50) (EC50) D-000 0.9+0.4 5.5+4 2.2+2 1-5 D-003 3.9 5.7 D-005 0.7+0.1 3.9 4.3+1 D-006 0.2 0.1 5.3 0.3 0.1 D-007 0.3+0.1 4.2 0.4 D-008 1.0 D-009 0.3 0.2 10.5 D-010 0.2+0.1 0.3+0.3 D-011 0.3 0.1 0.9 0.7, D-012 0.3 0.2 0.3 D-013 1.4 D-014 0.2+0.1 4.3 D-015 1.2+0.2 1.8 1.3+0.4 2.0 D-019 0.9+0.01 0.9 D-021 1.8 3.5 D-022 . 1.8 2.3 D-024 2.9 D-025 0.3+0.1 4.4+0.6 0.3+0.2 0.3+0.3 D-026 0.3+0.1 3.5 0.2+0.2 0.3+0.3 D-027 >2 2 D-028 0.4+0.2 1 D-029 0.1 0.03 3.4 2 0.5 0.6 0.3 D-030 0.1+0.1 6 0.4+0.5 0.2 D-031 0.2+0.1 0.7+0.1 D-034 0.6+0.4 D-035 0.2+0.1 2.9+0.7 0.3+0.1 D-036 0.9 0.04 4.1 5.5 5 0.2 D-037 1.2+0.4 1.3+0.4 2.0 F D-038 1.4+0.1 2.9 5 Table 4 Human PMN Human PMN
Mouse BCR Mouse TCE Elastase Migration Compound Stim (ECSO) Stim (ECSO) (EC,,) (ECSO) D-039 0.9+0.1 5 D-043 1.4 2.6 D-045 9.0 D-047 0.3+01. 0.5+0.2 D--048 0.4+0.2 5 0.9 0.2 D-049 2.0 6.3 5.0 D-121 1.4 D-999 3.1+0.7 5.9 >20' 1 LY294002 0.9+0.5 Assay of Inhibitors of PI3K6 Activity in Cancer Cells The effect of compounds of the invention on cancer cell proliferation was evaluated by test-ing one of the compounds against a panel of Chronic Myeloid Leukemia (CML) cell lines, including KU812, RWLeu4, K562, and MEG-01.
The inhibitory activity of the compound (D-000, dissolved in DMSO) was determined as follows. The tested compound was added in a series of concentrations (0.001 ~aM to 20 h7M) to 96-well microtiter plates with cells (1000 to 5000 cells/-well). Plates were incubated for five days at 37 C
during which the control cultures without test com-pound were able to undergo at least two cell-divi-sion cycles. Cell growth was measured by incorp-oration of [3H]-thymidine for eighteen hours added at days three, four, and five. Cells were transferred to a filter, washed and the radioactivity counted using a Matrix 96 beta counter (Packard). The percentage of cell growth was measured as follows:

(average counts of cells incubated with a given inhibitor concentration) x 100 Cell growth =
(average counts of the cells without inhibitor) The EC50 value in these experiments was determined by the concentration of the test compound that resulted in a radioactivity count 500 lower than that ob-tained using the control without inhibitor. The D-000 compound exhibited inhibitory activity with an EC50 of approximately 2 p.M for the KU812 and RWLeu4 lines. The compound was not found to exhibit an effect in the K562 and MEG-01 lines.
PI3K5 inhibitors of the invention appear to inhibit CML cell growth and therefore could be useful in the treatment of benign or malignant tumors. PI3K5 expression has been demonstrated so far mostly in cells of hematopoietic origin. How-ever, it could be present in a broader variety of proliferating cells. Therefore, the compounds of the invention could be used to induce tumor re-gression and to prevent the formation of tumor metastasis in both leukemia and solid tumor or in proliferation of nontumoral origin. In addition, the compounds could be used both alone and in com-bination with other pharmacologically active com-pounds or in combination with radiation as a sensitizing agent.

Measurement of elastase exocytosis in mouse air pouch lavage The effect of D-030 on leukocyte influx and neutrophil elastase exocytosis in animal models was tested. The six-day air pouch model is an in vivo inflammation model that histologically resembles a joint synovium. A lining of organized mononuclear cells and fibroblasts develops that closely resembles a synovial cavity. The model represents an "acute" model of a chronic disease (e.g., rheumatoid arthritis). This model allows for the in vivo evaluation of agents to block cellular influx into the air pouch under the influence of an inflammatory stimulus.

N\

N
N N
~~ I N
N

The test was performed as follows: on day zero , groups of rats were shaved and 10 ml of air was injected subcutaneously on the back of each, forming a pouch. On day three, 10 ml of air was reinjected. Six hours prior to TNF challenge on day six, one group of rats (n=6) received D-030 (100 mg/kg-in PEG 400 vehicle) orally, and another group (n=12) received vehicle alone orally. Six hours following dosing, the air pouches of both groups received 2.5 ng of TNF. Twelve hours following dosing, the pouches were washed with saline, and the resulting lavage fluid was analyzed for leukocyte counts and neutrophil elastase activity. In addi-tion, blood was drawn to determine the levels of D-030 in circulation. The results were as follows:
rats that received D-030 for twelve hours had an average of 8.7 JIM of compound in circulation and had an 82% reduction in total leukocytes in the lavage fluid compared to vehicle controls. Reductions in specific leukocyte counts were as follows: neutro-phils (90%), eosinophils (66%), and lymphocytes (70%). Quantitation of neutrophil elastase showed that D-030-treated rats had elastase levels that were somewhat reduced (15%) versus vehicle controls.
In another test, an area of the mouse back was shaved using clippers, and an air pouch was created by injecting 3 ml air subcutaneously. On day three, the air injection was repeated. On day six, the animals were dosed with either D-030 (32 mg/kg in LABRAFIL ) or LABRAFIL only one hour be-fore and two hours after challenge with TNF-U (0.5 ng in 1 ml PBS), or PBS only. PBS is phosphate buffered saline. Four hours after TNF challenge, the animals were anesthetized and the pouches. were lavaged with 2 mL of 0.9% saline with 2 mM EDTA.
The lavages were centrifuged at 14,000 rpm in a microcentrifuge. Fifty microliters of the supernatant was used to measure elastase exocytosis according to the procedure described above.
As shown in Figure 9, TNF challenge in-duced a high level of elastase exocytosis compared to PBS challenged animals. However, when the TNF
challenged animals were treated with D-030, a sig-nificant decrease in the elastase activity in the air pouch lavages was observed.

While the present invention has been de-scribed with specific reference to certain preferred embodiments for purposes of clarity and understand-ing, it will be apparent to the skilled artisan that further changes and modifications can be practiced within the scope of the invention as it is defined in the claims set forth below. Accordingly, no limitations should be placed on the invention other than those specifically recited in the claims.

Claims (78)

CLAIMS:

1. A use of a compound having a structure:
wherein Y is selected from the group consisting of null, S, and NH;

R7 is selected from the group consisting of H, halo, OH, OCH3, CH3, and CF3;

R8 is selected from the group consisting of H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more O, N, or S atoms;

R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)-OC2H5, and morpholinyl;

R d, independently, is selected from the group consisting of NH2, halo, C1-3alkyl, S(C1-3alkyl), OH, NH (C1-3alkyl), N(C1-3alkyl)2, and NH(C1-3alkylenephenyl);

q is 1 or 2, and pharmaceutically acceptable salts and solvates thereof, provided that at least one of R7 and R8 is different from 6-halo or 6,7-dimethoxy groups, and that R9 is different from 4-chlorophenyl for disrupting leukocyte function.

2. The use of claim 1, wherein the compound is selected from the group consisting of:
2-(6-aminopurin-9-ylmethyl)-3-(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-fluoro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-benzyl-5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-isopropyl-phenyl)-3H-quinazolin-4-one; and 2-(6-aminopurin-9-ylmethyl)-5-chloro-3-o-tolyl-3H-quinazolin-4-one.

3. The use of claim 1 or 2, wherein the leukocyte function is in leukocytes comprising cells selected from the group consisting of neutrophils, B lymphocytes, T lymphocytes, and basophils.

4. The use of claim 1 or 2, wherein the leukocyte function is in leukocytes comprising neutrophils, and wherein said disrupting leukocyte function comprises disrupting at least one neutrophil function selected from the group consisting of stimulated superoxide release, stimulated exocytosis, and chemotactic migration.

5. The use of claim 4, wherein bacterial phagocytosis or bacterial killing by said neutrophils is substantially undisrupted.

6. The use of claim 1 or 2, wherein the leukocyte function is in leukocytes comprising B lymphocytes, and wherein said disrupting leukocyte function comprises disrupting proliferation of said B lymphocytes or antibody production by said B lymphocytes.

7. The use of claim 1 or 2, wherein the leukocyte function is in leukocytes comprising T lymphocytes and wherein the disrupting leukocyte function comprises disrupting proliferation of said T lymphocytes.

8. The use of claim 1 or 2, wherein the leukocyte function is in leukocytes comprising basophils, and wherein said disrupting leukocyte function comprises disrupting histamine-release by the basophils.

9. The use of any one of claims 1 to 8, wherein said compound exhibits at least about a 10-fold selectivity for inhibition of PI3K.delta. (phosphatidyl-inositol-3-kinase delta) relative to PI3K-.alpha., PI3K-.beta. and PI3K-.delta. isoforms in a cell-based assay.

10. The use of any one of claims 1 to 8, wherein said compound exhibits at least about a 20-fold selectivity for inhibition of PI3K.delta. (phosphatidyl-inositol-3-kinase delta) relative to PI3K-.alpha., PI3K-.beta. and PI3K-.delta. isoforms in a cell-based assay.

11. The use of any one of claims 1 to 8, wherein said compound exhibits at least about a 50-fold selectivity for inhibition of PI3K.delta. (phosphatidyl-inositol-3-kinase delta) relative to PI3K-.alpha., PI3K-.beta. and PI3K-.delta. isoforms in a biochemical assay.

12. A use of a compound having a structure:
wherein A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N(R a) 2, halo, C1-3alkyl, S(C1-3alkyl), OR a and X is selected from the group consisting of CHR b, CH2CHR b, and CH=C(R b);

Y is selected from the group consisting of null, S, SO, SO2, NH, O, C(=O), OC(=O), C(=O)O, and NHC(=O)CH2S;
R1 and R2, independently, are selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, halo, NHC(=O)C1-3alkyleneN(R a)3, NO2, OR a, OCF3, N(R a)2, CN, OC(=O)R a, C(=O)R a, C(=O) OR a, arylOR b, Het, NR a C(=O)C1-3alkyleneC(=O) OR a, arylOC1-3alkyleneN(R a)2, arylOC(=O)R a, C1-4alkyleneC(=O)OR a, OC1-4alkyleneC(=O)OR a, C1-4alkyleneOC1-4alkyleneC(=O)OR a, C(=O)NR a SO2R a, C1-4alkyleneN(R a)2, C2-6alkenyleneN(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, OC2-4alkyleneN(R a)2, OC1-4alkyleneCH(OR b)CH2N(R a)2, OC1-4alkyleneHet, OC2-4alkyleneOR a, OC2-4alkyleneNR a C(=O)OR a, NR a C1-4alkyleneN(R a)2, NR a C(=O)R a, NR a C(=O)N(R a)2, N(SO2C1-4alkyl)2, NR a(SO2C1-4alkyl), SO2N(Ra)2, OSO2CF3, C1-3alkylenearyl, C1-4alkyleneHet, C1-6alkyleneOR b, C1-3alkyleneN(R a)2, C(=O)N(R a)2, NHC(=O)C1-C3alkylenearyl, C3-8cycloalkyl, C3-8heterocycloalkyl, arylOC1-3alkyleneN(R a)2, arylOC(=O)R b, NHC(=O)C1-3alkyleneC3-8heterocycloalkyl, NHC(=O)C1-3-alkyleneHet, OC1-4alkyleneOC1-4alkyleneC(=O)OR b, C(=O)C1-4alkyleneHet, and NHC(=O)haloC1-6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1-6alkyl, C3-8cycloalkyl, C3-8heterocycloalkyl, C1-4alkylenecycloalkyl, C2-6alkenyl, C1-3alkylenearyl, arylC1-3alkyl, C(=O)R a, aryl, heteroaryl, C(=O)OR a, C(=O)N(R a)2, C(=S)N(R a)2, SO2R a, SO2N(R a)2, S(=O)R a, S(=O)N(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, C(=O)C1-4alkylenearyl, C(=O)C1-4alkyleneheteroaryl, C1-4alkylenearyl substituted with one or more of SO2N(R a)2, N(R a)2, C(=O)OR a, NR a SO2CF3, CN, NO2, C(=O)R a, OR a, C1-4alkyleneN(R a)2, and OC1-4alkyleneN(R a)2, C1-4alkyleneheteroaryl, C1-4alkyleneHet, C1-4alkyleneC (=O)C1-4-alkylenearyl, C1-4alkyleneC (=O)C1-4alkyleneheteroaryl, C1-4alkyleneC(=O)Het, C1-4alkyleneC(=O)N(R a)2, C1-4alkyleneOR a, C1-4alkyleneNR a C(=O)R a, C1-4alkyleneOC1-4alkyleneOR a, C1-4alkyleneN(R a)2, C1-4alkyleneC(=O)OR a, and C1-4alkyleneOC1-4-alkyleneC(=O)OR a;

R a is selected from the group consisting of hydrogen, C1-6alkyl, C3-8cycloalkyl, C3-8heterocycloalkyl, C1-3alkyleneN(R a)2, optionally substituted aryl, arylC1-3alkyl, C1-3alkylenearyl, heteroaryl, heteroarylC1-3alkyl, and C1-3alkyleneheteroaryl;

or two R a groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom;

R b is selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, arylC1-3alkyl, heteroarylC1-3alkyl, C1-3alkylenearyl, and C1-3alkyleneheteroaryl;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1-4alkyl or C(=O)OR a;

or a pharmaceutically acceptable salt or solvate thereof for disrupting leukocyte function in leukocytes wherein the compound, salt or solvate is for administration in an amount sufficient to inhibit phosphatidylinositol 3-kinase delta activity in said leukocytes.

13. The use of claim 12, wherein X is CHR b;

Y is NH;

R3 is optionally substituted phenyl; and R b is C1-6alkyl.

14. The use of claim 13, wherein R b is methyl.

15. The use of claim 13, wherein, R3 is phenyl, optionally substituted with one to three substituents selected from the group consisting of OR a, halo, C1-4alkyleneN(R a)2, OC1-4alkyleneN(R a)2, C(=O)R a, C(=O) OH, and N(R a)2.

16. The use according to claim 13, wherein R3 is phenyl, optionally substituted with one to three substituents selected from the group consisting of F, Cl, OH, OC1-4alkyl, OC1-4alkyleneNMe2, C(=O)Me,

17. The use of claim 13, wherein R1 and R2 are independently selected from the group consisting of H, halo and C1-6alkyl; and R a is selected from the group consisting of hydrogen, C1-6alkyl, and C3-8heterocycloalkyl; or two R a groups are taken together to form a 5- to 6- membered ring, optionally containing at least one heteroatom.

18. The use of claim 13, wherein R1 is H, halo or C1-6alkyl; and R2 is H.

19. The use of claim 13, wherein R1 and R2 are independently attached to the quinazoline ring at position 5, 6 or 7.

20. The use of claim 13, wherein the purine ring is unsubstituted.

21. The use according to claim 12, wherein the compound is selected from the group consisting of 2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-6,7-dimethoxy-3H-quinazolin-4-one;
2-(6-aminopurin-o-ylmethyl)-6-bromo-3-(2-chlorophen-yl)-3H-quinazolin-4-one;
2-(6-aminopurin-o-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-6-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one;
2-(6-aminopurin-o-ylmethyl)-5-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;
5-chloro-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
5-chloro-3-(2-fluorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-fluoro-phenyl)-3H-quinazolin-4-one;
3-biphenyl-2-yl-5-chloro-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
5-chloro-3-(2-methoxyphenyl)-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-fluoro-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;

3-(2-chlorophenyl)-6,7-dimethoxy-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
6-bromo-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-8-trifluoromethyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-benzo[g]quinazolin-4-one;
6-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
8-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-7-fluoro-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-7-nitro-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-6-hydroxy-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
5-chloro-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-methyl-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-6,7-difluoro-2-(9H-purin-6-yl-sulfanylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-6-fluoro-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
3-(2-fluorophenyl)-5-methyl-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-chloro-3-o-tolyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-methoxy-phenyl)-3H-quinazolin-4-one;
2-(2-amino-9H-purin-6-ylsulfanylmethyl)-3-cycloprop-yl-5-methyl-3H-quinazolin-4-one;
3-cyclopropylmethyl-5-methyl-2-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-cyclopropylmethyl-5-methyl-3H-quinazolin-4-one;
2-(2-amino-9H-purin-6-ylsulfanylmethyl)-3-cyclo-propylmethyl-5-methyl-3H-quinazolin-4-one;
5-methyl-3-phenethyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
2-(2-amino-9H-purin-6-ylsulfanylmethyl)-5-methyl-3-phenethyl-3H-quinazolin-4-one;
3-cyclopentyl-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-cyclopentyl-5-methyl-3H-quinazolin-4-one;
3-(2-chloropyridin-3-yl)-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-(2-chloropyridin-3-yl)-5-methyl-3H-quinazolin-4-one;
3-methyl-4-[5-methyl-4-oxo-2-(9H-purin-6-ylsulfanyl-methyl)-4H-quinazolin-3-yl]-benzoic acid;
3-cyclopropyl-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-cyclopropyl-5-methyl-3H-quinazolin-4-one;
5-methyl-3-(4-nitrobenzyl)-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;

3-cyclohexyl-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-cyclohexyl-5-methyl-3H-quinazolin-4-one;
2-(2-amino-9H-purin-6-ylsulfanylmethyl)-3-cyclo-hexyl-5-methyl-3H-quinazolin-4-one;
5-methyl-3-(E-2-phenylcyclopropyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-fluoro-2-[(9H-purin-6-ylamino)-methyl]-3H-quinazolin-4-one;
2-[(2-amino-9H-purin-6-ylamino)methyl]-3-(2-chloro-phenyl)-5-fluoro-3H-quinazolin-4-one;
5-methyl-2-[(9H-purin-6-ylamino)methyl]-3-o-tolyl-3H-quinazolin-4-one;
2-[(2-amino-9H-purin-6-ylamino)methyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-[(2-fluoro-9H-purin-6-ylamino)methyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
(2-chlorophenyl)-dimethylamino-(9H-purin-6-ylsulfan-ylmethyl)-3H-quinazolin-4-one;
5-(2-benzyloxyethoxy)-3-(2-chlorophenyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
6-aminopurine-9-carboxylic acid-3-(2-chlorophenyl)-5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl ester;
N-[3-(2-chlorophenyl)-5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl]-2-(9H-purin-6-ylsulfanyl)-acetamide;
2-[1-(2-fluoro-9H-purin-6-ylamino)ethyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-[1-(9H-purin-6-ylamino)ethyl]-3-o-tolyl-3H-quinazolin-4-one;

2-(6-dimethylaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(2-methyl-6-oxo-1,6-dihydro-purin-7-ylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(2-methyl-6-oxo-1,6-dihydro-purin-9-ylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
2-(amino-dimethylaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(2-amino-9H-purin-6-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(7-methyl-7H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-purin-7-ylmethyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-purin-9-ylmethyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(9-methyl-9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(2-methylsulfanyl-9H-purin-6-ylsulfanyl-methyl)-3-o-tolyl-3H-quinazolin-4-one;
2-(2-hydroxy-9H-purin-6-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2-(2-amino-6-chloro-purin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(6-aminopurin-7-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(6-amino-9H-purin-2-ylsulfanylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(6-methylaminopurin-9-ylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
2-(6-benzylaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
2-(2,6-diaminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;
5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3-o-tolyl-3H-quinazolin-4-one;
3-isobutyl-5-methyl-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
N-{2-[5-Methyl-4-oxo-2-(9H-purin-6-ylsulfanyl-methyl)-4H-quinazolin-3-yl]-phenyl}-acetamide;
5-methyl-3-(E-2-methyl-cyclohexyl)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one;
2-[5-methyl-4-oxo-2-(9H-purin-6-ylsulfanylmethyl)-4H-quinazolin-3-yl]-benzoic acid;
3-(2-[(2-dimethylaminoethyl)methylamino]phenyl}-5-methyl-2-(9H-purin-6-ylsulfanyl-methyl)-3H-quin-azolin-4-one;
3-(2-chlorophenyl)-5-methoxy-2-(9H-purin-6-ylsul-fanylmethyl)-3H-quinazolin-4-one;
3-(2-chlorophenyl)-5-(2-morpholin-4-yl-ethylamino)-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one; and 3-benzyl-5-methoxy-2-(9H-purin-6-ylsulfanylmethyl)-3H-quinazolin-4-one.

22. A use of a compound having a structure:

wherein Y is selected from the group consisting of null, S, and NH;

R7 is selected from the group consisting of H, halo, OH, OCH3, CH3, and CF3;

R8 is selected from the group consisting of H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more O, N, or S atoms;

R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)-OC2H5, and morpholinyl;

R d, independently, is selected from the group consisting of NH2, halo, C1-3alkyl, S(C1-3alkyl) , OH, NH (C1-3alkyl) , N(C1-3alkyl)2, and NH(C1-3alkylenephenyl) ;
q is 1 or 2, or a pharmaceutically acceptable salt or solvate thereof, provided that at least one of R7 and R8 is different from 6-halo or 6,7-dimethoxy groups, and further provided that R9 is different from 4-chlorophenyl, for disrupting a function of osteoclasts.

23. The use of claim 22, wherein said compound comprises a moiety that binds to bone.

24. A use of a compound having a structure:

wherein R7 is selected from the group consisting of H, halogen, OH, OCH3, CH3, and CF3;

R8 is selected from the group consisting of H, OCH3, and halogen;

or R7 and R8 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more O, N, or S atoms;

R9 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, acetic acid ethyl ester, and morpholinyl;

X is NH or S; or a pharmaceutically acceptable salt or solvate thereof, provided that at least one of R7 and R8 is different from 6-halo or 6,7-dimethoxy groups, and further provided that R9 is different from 4-chloro-phenyl, for inhibiting growth or proliferation of chronic myelogenous leukemia cells.

25. A use of a compound having a structure wherein A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N(R a)2, halo, C1-3alkyl, S(C1-3alkyl), OR a and X is selected from the group consisting of CHR b, CH2CHR b, and CH=C(R b) ;

Y is selected from the group consisting of null, S, SO, SO2, NH, O, C(=O), OC(=O), C(=O)O, and NHC(=O)CH2S;
R1 and R2, independently, are selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, halo, NHC(=O)C1-3alkyleneN(R a)2, NO2, OR a, OCF3, N(R a)2, CN, OC (=O)R a, C(=O) R a, C(=O) OR a, arylOR b, Het, NR a C (=O) C1-3alkyleneC (=O) OR a, arylOC1-3alkyleneN(R a)2, arylOC(=O)R a, C1-4alkyleneC(=O)OR a, OC1-4alkyleneC(=O)OR a, C1-4alkyleneOC1-4alkyleneC(=O)OR a, C(=O)-NR a SO2R a, C1-4alkyleneN(R a)2, C2-6alkenyleneN(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, OC2-4alkyleneN(R a)2, OC1-4alkyleneCH(OR b)CH2N(R a)2, OC1-4alkyleneHet, OC2-4alkyleneOR a, OC2-4alkyleneNR a C(=O)OR a, NR a C1-4alkyleneN(R a)2, NR a C(=O)R a, NR a C(=O)N(R a)2, N(SO2C1-4alkyl)2, NR a(SO2C1-4alkyl), SO2N(R a)2, OSO2CF3, C1-3alkylenearyl, C1-4alkyleneHet, C1-6alkyleneOR b, C1-3alkyleneN(R a)2, C(=O)N(R a)2, NHC(=O)C1-C3alkylenearyl, C3-8cycloalkyl, C3-8heterocycloalkyl, arylOC1-3alkyleneN(R a)2, arylOC(=O)R b, NHC(=O)C1-3alkyleneC3-8heterocycloalkyl, NHC(=O)C1-3-alkyleneHet, OC1-4alkyleneOC1-4alkyleneC(=O)OR b, C(=O)C1-4alkyleneHet, and NHC(=O)haloC1-6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1-6alkyl, C3-8cyclo-alkyl, C3-8heterocycloalkyl, C1-4alkylenecycloalkyl, C2-6alkenyl, C1-3alkylenearyl, arylC1-3alkyl, C(=O)R a, aryl, heteroaryl, C(=O)OR a, C(=O)N(R a)2, C(=S)N(R a)2, SO2R a, SO2N(R a)2, S(=O)R a, S(=O)N(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, C(=O)C1-4alkylenearyl, C(=O)C1-4alkyleneheteroaryl, C1-4alkylenearyl optionally substituted with one or more of halo, SO2N(R a)2, N(R a)2, C(=O)OR a, NR a SO2CF3, CN, NO2, C(=O)R a, OR a, C1-4alkyleneN(R a)2, and OC1-4alkyleneN(R a)2, C1-4alkyleneheteroaryl, C1-4alkyleneHet, C1-4alkyleneC(=O) C1-4alkylenearyl, C1-4alkyleneC(=O)C1-4alkyleneheteroaryl, C1-4alkyleneC(=O)Het, C1-4alkyleneC(=O)N(R a)2, C1-4alkyleneOR a, C1-4alkyleneNR a C(=O)R a, C1-4-alkyleneOC1-4alkyleneOR a, C1-4alkyleneN(R a)2, C1-4alkyleneC(=O)OR a, and C1-4alkyleneO

C1-4alkyleneC(=O)OR a;

R a is selected from the group consisting of hydrogen, C1-6alkyl, C3-8cycloalkyl, C3-8heterocycloalkyl, C1-3alkyleneN(R a)2, optionally substituted aryl, arylC1-3alkyl, C1-3-alkylenearyl, heteroaryl, heteroarylC1-3alkyl, and C1-3alkyleneheteroaryl;

or two R a groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom;

R b is selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, arylC1-3alkyl, heteroarylC1-3alkyl, C1-3alkylenearyl, and C1-3alkyleneheteroaryl;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1-4alkyl or C(=O) OR a;

or a pharmaceutically acceptable salt or solvate thereof, for inhibiting kinase activity of a phosphatidylinositol 3-kinase delta polypeptide.

26. The use of claim 25, wherein R1 is selected from the group consisting of H, halo, OH, OCH3, and CH3; and R3 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)C2H5, and morpholinyl;

wherein at least one of R1 and R2 is different from 6-halo or 6,7-dimethoxy, and R3 is different from 4-chlorophenyl.

27. A compound having a structure wherein Y is selected from the group consisting of null and NH;

R4 is selected from the group consisting of H, halogen, NO2, OH, OCH3, CH3, and CF3;

R5 is selected from the group consisting of H, OCH3, and halo;

or R4 and R5 together with C-6 and C-7 of the quinazoline ring system define a 5- or 6-membered aromatic ring optionally containing one or more O, N, or S atoms;

R6 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, C1-C6alkoxyphenyl, C1-C6alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)OC2H5, and morpholinyl;

R d, independently, is selected from the group consisting of NH2, halo, C1-3alkyl, S(C1-3alkyl), OH, NH(C1-3alkyl), N(C1-3alkyl)2, NH(C1-3alkylenephenyl), and q is 1 or 2; and pharmaceutically acceptable salts and solvates thereof, provided that at least one of R4 and R5 is other than H when R6 is phenyl or 2-chlorophenyl.

28. The compound of claim 27 selected from the group consisting of:

2-(6-aminopurin-9-ylmethyl)-3-(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-fluoro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-benzyl-5-fluoro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-6-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-6-bromo-3-(2-chlorophenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-6,7-dimethoxy-3H-quinazolin-4-one;
2-(6-aminopurin-9-ylmethyl)-5-chloro-3-o-tolyl-3H-quinazolin-4-one; and 2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-methoxyphenyl)-3H-quinazolin-4-one.

29. The compound of claim 27 wherein R4 is selected from the group consisting of H, halo, OH, OCH3, CH3, and CF3;
R6 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, C1-C6alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C(=O)-OC2H5, and morpholinyl; wherein (a) R4 and R5, independently, are different from 6-halo or 6,7-dimethoxy groups; and (b) R6 is different from 4-chlorophenyl.

30. The compound of claim 28 selected from the group consisting of 2-(6-aminopurin-9-ylmethyl)-3-(2-isopropylphenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-fluorophenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-fluoro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-8-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-5-chloro-3-(2-chloro-phenyl)-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-methyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-5-fluoro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-benzyl-5-fluoro-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-butyl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-morpholin-4-yl-3H-quinazolin-4-one;

2-(6-aminopurin-9-ylmethyl)-3-(2-chlorophenyl)-7-fluoro-3H-quinazolin-4-one; and 2-(6-aminopurin-9-ylmethyl)-5-chloro-3-o-tolyl-3H-quinazoline-4-one.

31. A compound having a general structural formula wherein:

A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N(R a)2, halo, C1-3alkyl, S(C1-3alkyl) , OR a and X is selected from the group consisting of CHR b, CH2CHR b, and CH=C (R b);
Y is selected from the group consisting of null, NH, O, C(=O) , OC(=O), C(=O)O, and NHC(=O)CH2S;

R1 and R2, independently, are selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, O or S atoms, halo, NHC(=O)C1-3alkyleneN(R a)2, NO2, OR a, OCF3, N(R a)2, CN, OC(=O)R a, C(=O)R a, C(=O)OR a, arylOR b, Het, NR a C(=O)C1-3alkyleneC(=O)OR a, arylOC1-3alkyleneN(R a)2, arylOC(=O)R a, C1-4alkyleneC(=O)OR a, OC1-4alkyleneC(=O)OR a, C1-4alkyleneOC1-4alkyleneC(=O)OR a, C(=O)-NR a SO2R a, C1-4alkyleneN(R a)2, C2-6alkenyleneN(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, OC2-4alkyleneN(R a)2, OC1-4alkyleneCH(OR b)CH2N(R a)2, OC1-4alkyleneHet, OC2-4alkyleneOR a, OC2-4alkyleneNR a C(=O)OR a, NR a C1-4alkyleneN(R a)2, NR a C(=O)R a, NR a C(=O)N(R a)2, N(SO2C1-4alkyl)2, NR a(SO2C1-4alkyl), SO2N(R a)2, OSO2CF3, C1-3alkylenearyl, C1-4alkyleneHet, C1-6alkyleneOR b, C1-3alkyleneN(R a)2, C(=O)N(R a)2, NHC(=O)C1-C3alkylenearyl, C3-8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, arylOC1-3alkyleneN(R a)2, arylOC(=O)R b, NHC(=O)C1-3alkyleneC3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, NHC(=O)C1-3-alkyleneHet, OC1-4alkyleneOC1-4alkyleneC(=O)OR b, C(=O)C1-4alkyleneHet, and NHC(=O)haloC1-6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom, wherein the at least one hetero atom is independently 1 to 3 N, O or S atoms;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1-6alkyl, C3-8cyclo-alkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, C1-4alkyleneC3-C8cycloalkyl, C2-6alkenyl, C1-3alkylenearyl, arylC1-3alkyl, C(=O)R a, aryl, heteroaryl comprising independently 1 to 3 N, O or S atoms, C(=O)OR a, C(=O)N(R a)2, C(=S)N(R a)2, SO2R a, SO2N(R a)2, S(=O)R a, s(=O)N(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, C(=O)C1-4alkylenearyl, C(=O)C1-4alkyleneheteroaryl comprising independently 1 to 3 N, O or S atoms, C1-4alkylenearyl optionally substituted with one or more of halo, SO2N(R a)2, N(R a)2, C(=O)OR a, NR a SO2CF3, CN, NO2, C(=O)R a, OR a, C1-4alkyleneN(R a)2, and OC1-4alkylene(R a)2, C1-4alkyleneheteroaryl comprising independently 1 to 3 N, O
or S atoms, C1-4alkyleneHet, C1-4alkyleneC(=O)C1-4alkylenearyl, C1-4alkyleneC(=O)C1-4-alkyleneheteroaryl comprising independently 1 to 3 N, O or S atoms, C1-4alkyleneC(=O)Het, C1-4alkyleneC(=O)N(R a)2, C1-4alkyleneOR a, C1-4alkyleneNR a C(=O)R a, C1-4-alkyleneOC1-4alkyleneOR a, C1-4alkyleneN(R a)2, C1-4alkyleneC(=O)OR a, and C1-4alkyleneOC1-4alkyleneC(=O)OR a;
R a is selected from the group consisting of hydrogen, C1-6alkyl, C3-8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, C1-3alkyleneN(R a)2, optionally substituted aryl, arylC1-3alkyl, C1-3-alkylenearyl, heteroaryl comprising independently 1 to 3 N, O or S atoms, heteroarylC1-3alkyl comprising independently 1 to 3 N, O or S atoms, and C1-3alkyleneheteroaryl;

or two R a groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom wherein the at least one heteroatom is independently 1 to 3 N, O or S atoms;

R b is selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, O
or S atoms, arylC1-3alkyl, heteroarylC1-3alkyl comprising independently 1 to 3 N, O or S atoms, C1-3alkylenearyl, and C1-3alkyleneheteroaryl comprising independently 1 to 3 N, O
or S atoms;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1-4alkyl or C(=O)OR a;

or a pharmaceutically acceptable salt or solvate thereof, wherein aryl is phenyl or naphthyl.

32. The compound of claim 31, wherein X is selected from the group consisting of CH2, CH2CH2, CH=CH, CH(CH3), CH2CH(CH3), and C(CH3)2.

33. The compound of claim 31, wherein Y is selected from the group consisting of null, and NH.

34. The compound of claim 31, wherein the purine is substituted with one to three substituents selected from the group consisting of N(R a)2, halo, C1-3alkyl, S(C1-3alkyl), OR a, and

35. The compound of claim 31, wherein the A ring system is substituted with one to three substituents selected from the group consisting of NH2, NH(CH3), N(CH3)2, NHCH2C6H5, NH(C2H5), Cl, F, CH3, SCH3, OH, and

36. The compound of claim 31, wherein R1 and R2 are, independently, selected from the group consisting of hydrogen, OR a, halo, C1-6alkyl, NO2, N(R a)2, NR a C1-3alkyleneN(R a)2, and OC2-4alkyleneOR a.

37. The compound of claim 31, wherein R1 and R2 are, independently, selected from the group consisting of H, OCH3, Cl, Br, F, CH3, NO2, OH, N(CH3)2, and O(CH2)2OCH2C6H5.

38. The compound of claim 31, wherein R1 and R2 are taken together to form a five- or six-membered ring.

39. The compound of claim 31, wherein R3 is selected from the group consisting of C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, C3-8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, C(=O)OR a, C1-4alkyleneHet, C1-4alkyleneC3-C8cycloalkyl, C1-4alkylenearyl, C1-4alkyleneC(=O)C1-4alkylenearyl, C1-4alkyleneC(=O)OR a, C1-4alkyleneC(=O)N(R a)2, C1-4alkyleneC(=O)Het, C1-4alkyleneN(R a)2, and C1-4alkyleneNR a C-(=O)R a.

40. The compound of claim 31, wherein R3 is selected from the group consisting of C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, C(=O)OC2H5, CH2CH(CH3)2,

41. The compound of claim 31, wherein R3 is substituted with a substituent selected from the group consisting of halo, OR a, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, NO2, N(R a)2, NR a SO2CF3, NR a C(=O)R a, C(=O)OR a, SO2N(R a)2, CN, C(=O)R a, C1-4alkyleneN(R a)2, OC1-4alkyleneN(R a)2, and N(R a)C1-4alkyleneN(R a)2.

42. The compound of claim 31, wherein R3 is substituted with a substituent selected from the group consisting of Cl, F, CH3, CH(CH3)2, OCH3, C6H5, NO2, NH2, NHC(=O)CH3, CO2H, and N(CH3)CH2CH2N(CH3)2.

43. The compound of claim 31 wherein:
X is CHR b;

R3 is optionally substituted phenyl;
Y is NH; and R b is C1-6alkyl.

44. The compound of claim 43, wherein R b is methyl.

45. The compound of claim 43, wherein R3 is phenyl, optionally substituted with one to three substituents selected from the group consisting of OR a, halo, C1-4alkyleneN(R a)2, OC1-4alkyleneN(R a)2, C(=O)R a, C(=O)OH, and N(R a)2.

46. The compound of claim 43, wherein R3 is phenyl, optionally substituted with one to three substituents selected from the group consisting of F, Cl, OH, OC1-4alkyl, OC1-4alkyleneNMe2, C(=O)Me,

47. The compound of 43, wherein R1 and R2 are independently selected from the group consisting of H, halo and C1-6alkyl.

48. The compound of claim 43, wherein R1 is H, halo or C1-6alkyl; and R2 is H.

49. The compound of claim 43, wherein R1 and R2 are independently attached to the quinazoline ring at position 5, 6 or 7.

50. The compound of claim 43, wherein R a is selected from the group consisting of hydrogen, C1-6alkyl, and C3-8heterocycloalkyl ; or two R a groups are taken together to form a 5- to 6- membered ring, optionally containing at least one heteroatom.

51. The compound of claim 43, wherein the purine ring is unsubstituted.

52. The compound of claim 43, wherein said compound is 2-[1-(2-fluoro-9H-purin-6-ylamino)ethyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one; or 5-methyl-2-[1-(9H-purin-6-ylamino)ethyl]-3-o-tolyl-3H-quinazolin-4-one.

53. A pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and a compound having a general structural formula wherein:

A is a purine, optionally substituted with 1 to 3 substituents selected from the group consisting of N(R a)2, halo, C1-3alkyl, S(C1-3alkyl) , OR a and X is selected from the group consisting of CHR b, CH2CHR b, and CH=C(R b);

Y is selected from the group consisting of null, NH, O, C(=O), OC(=O), C(=O)O, and NHC(=O)CH2S;

R1 and R2, independently, are selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, O or S atoms, halo, NHC(=O)C1-3alkyleneN(R a)2, NO2, OR a, OCF3, N(R a)2, CN, OC(=O)R a, C(=O)R a, C(=O)OR a, arylOR b, Het, NR a C(=O)C1-3alkyleneC(=O)OR a, arylOC1-3alkyleneN(R a)2, arylOC(=O)R a, C1-4alkyleneC(=O)OR a, OC1-4alkyleneC(=O)OR a, C1-4alkyleneOC1-4alkyleneC(=O)OR a, C(=O)-NR a SO2R a, C1-4alkyleneN(R a)2, C2-6alkenyleneN(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, OC2-4alkyleneN(R a)2, OC1-4alkyleneCH(OR b)CH2N(R a)2, OC1-4alkyleneHet, OC2-4alkyleneOR a, OC2-4alkyleneNR a C(=O)OR a, NR a C1-4alkyleneN(R a)2, NR a C(=O)R a, NR a C(=O)N(R a)2, N(SO2C1-4alkyl)2, NR a (SO2C1-4alkyl), SO2N(R a)2, OSO2CF3, C1-3alkylenearyl, C1-4alkyleneHet, C1-6alkyleneOR b, C1-3alkyleneN(R a)2, C(=O)N(R a)2, NHC(=O)C1-C3alkylenearyl, C3-8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, arylOC1-3alkyleneN(R a)2, arylOC(=O)R b, NHC(=O)C1-3alkyleneC3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, NHC(=O)C1-3-alkyleneHet, OC1-4alkyleneOC1-4alkyleneC(=O)OR b, C(=O)C1-4alkyleneHet, and NHC(=O)haloC1-6alkyl;

or R1 and R2 are taken together to form a 3- or 4-membered alkylene or alkenylene chain component of a 5- or 6-membered ring, optionally containing at least one heteroatom, wherein the at least one hetero atom is independently 1 to 3 N, O or S atoms;

R3 is hydrogen or is an optionally substituted substituent, wherein the substituent is selected from the group consisting of C1-6alkyl, C3-8cyclo-alkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, C1-4alkyleneC3-C8cycloalkyl, C2-6alkenyl, C1-3alkylenearyl, arylC1-3alkyl, C(=O)R a, aryl, heteroaryl comprising independently 1 to 3 N, O or S atoms, C(=O)OR a, C(=O)N(R a)2, C(=S)N(R a)2, SO2R a, SO2N(R a)2, S(=O)R a, S(=O)N(R a)2, C(=O)NR a C1-4alkyleneOR a, C(=O)NR a C1-4alkyleneHet, C(=O)C1-4alkylenearyl, C(=O)C1-4alkyleneheteroaryl comprising independently 1 to 3 N, O or S atoms, C1-4alkylenearyl optionally substituted with one or more of halo, SO2N(R a)2, N(R a)2, C(=O)OR a, NR a SO2CF3, CN, NO2, C(=O)R a, OR a, C1-4alkyleneN(R a)2, and OC1-4alkylene (R a)2, C1-4alkyleneheteroaryl comprising independently 1 to 3 N, O
or S atoms, C1-4alkyleneHet, C1-4alkyleneC(=O)C1-4alkylenearyl, C1-4alkyleneC(=O)C1-4-alkyleneheteroaryl comprising independently 1 to 3 N, O or S atoms, C1-4alkyleneC(=O)Het, C1-4alkyleneC(=O)N(R a)2, C1-4alkyleneOR a, C1-4alkyleneNR a C(=O)R a, C1-4-alkyleneOC1-4alkyleneOR a, C1-4alkyleneN(R a)2, C1-4alkyleneC(=O)OR a, and C1-4alkyleneOC1-4alkyleneC(=O)OR a;
R a is selected from the group consisting of hydrogen, C1-6alkyl, C3-8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, C1-3alkyleneN(R a)2, optionally substituted aryl, arylC1-3alkyl, C1-3-alkylenearyl, heteroaryl comprising independently 1 to 3 N, O or S atoms, heteroarylC1-3alkyl comprising independently 1 to 3 N, O or S atoms, and C1-3alkyleneheteroaryl;

or two R a groups are taken together to form a 5- or 6-membered ring, optionally containing at least one heteroatom wherein the at least one heteroatom is independently 1 to 3 N, O or S atoms;

R b is selected from the group consisting of hydrogen, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl comprising independently 1 to 3 N, O
or S atoms, arylC1-3alkyl, heteroarylC1-3alkyl comprising independently 1 to 3 N, O or S atoms, C1-3alkylenearyl, and C1-3alkyleneheteroaryl comprising independently 1 to 3 N, O
or S atoms;

Het is a 5- or 6-membered heterocyclic ring, saturated or partially or fully unsaturated, containing at least one heteroatom selected from the group consisting of oxygen, nitrogen, and sulfur, and optionally substituted with C1-4alkyl or C(=O)OR a;

or a pharmaceutically acceptable salt or solvate thereof.

54. The pharmaceutical composition of claim 53, wherein X is selected from the group consisting of CH2, CH2CH2, CH=CH, CH ( CH3 ), CH2CH (CH3), and C(CH3)2.

55. The pharmaceutical composition of claim 53, wherein Y is selected from the group consisting of null and NH.

56. The pharmaceutical composition of claim 53, wherein the A ring system is substituted with one to three substituents selected from the group consisting of N(R a)2, halo, C1-3alkyl, S(C1-3alkyl) , OR a, halo, and

57. The pharmaceutical composition of claim 53, wherein the A ring system is substituted with one to three substituents selected from the group consisting of NH2, NH(CH3), N(CH3)2, NHCH2C6H5, NH(C2H5) , Cl, F, CH3, SCH3, OH, and

58. The pharmaceutical composition of claim 53, wherein R1 and R2 are, independently, selected from the group consisting of hydrogen, OR a, halo, C1-6alkyl, NO2, N(R a)2, NR a C1-3alkyleneN (R a)2, and OC2-4alkyleneOR a.

59. The pharmaceutical composition of claim 53, wherein R1 and R2 are, independently, selected from the group consisting of H, OCH3, Cl, Br, F, CH3, NO2, OH, N(CH3)2, and O(CH2)2OCH2C6H5.

60. The pharmaceutical composition of claim 53, wherein R1 and R2 are taken together to form a five- or six-membered ring.

61. The pharmaceutical composition of claim 53, wherein R3 is selected from the group consisting of C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, C3-8cycloalkyl, C3-8heterocycloalkyl comprising independently 1 to 3 N, O or S atoms, C(=O)OR a, C1-4alkyleneHet, C1-4alkyleneC3-C8cycloalkyl, C1-4alkylenearyl, C1-4alkyleneC (=O) C1-4alkylenearyl, C1-4alkyleneC (=O) OR a, C1-4alkyleneC (=O) N(R a) 2, C1-4alkyleneC (=O) Het, C1-4alkyleneN (R a) 2, and C1-4alkyleneNR a C- (=O) R a.

62. The pharmaceutical composition of claim 53, wherein R3 is selected from the group consisting of C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, C(=O) OC2H5, CH2CH (CH3) 2,

63. The pharmaceutical composition of claim 53, wherein R3 is substituted with a substituent selected from the group consisting of halo, OR a, C1-6alkyl, optionally substituted aryl, optionally substituted heteroaryl, NO2, N(R a)2, NR a SO2CF3, NR a C (=O) R a, C(=O) OR a, SO2N (R a) 2, CN, C(=O) R a, C1-4alkyleneN (R a) 2, OC1-4alkyleneN (R a) 2, and N(R a) C1-4alkyleneN (R a) 2.

64. The pharmaceutical composition of claim 53, wherein R3 is substituted with a substituent selected from the group consisting of Cl, F, CH3, CH (CH3) 2, OCH3, C6H5, NO2, NH2, NHC (=O) CH3, CO2H , and N( CH3 ) CH2CH2N ( CH3 )2.

65. The pharmaceutical composition of claim 53 wherein:

X is CHR b ;

R3 is optionally substituted phenyl;
Y is NH; and R b is C1-6alkyl.

66. The pharmaceutical composition of claim 65, wherein R b is methyl.

67. The pharmaceutical composition of claim 65, wherein R3 is phenyl, optionally substituted with one to three substituents selected from the group consisting of OR a, halo, C1-4alkyleneN (R a)2, OC1-4alkyleneN (R a) 2, C(=O) R a, C(=O) OH, and N ( R a )2.

68. The pharmaceutical composition of claim 65, wherein R3 is phenyl, optionally substituted with one to three substituents selected from the group consisting of F, Cl, OH, OC1-4alkyl, OC1-4alkyleneNMe2, C(=O)Me,

69. The pharmaceutical composition of 65, wherein R1 and R2 are independently selected from the group consisting of H, halo and C1-6alkyl.

70. The pharmaceutical composition of claim 65, wherein R1 is H, halo or C1-6alkyl; and R2 is H.

71. The pharmaceutical composition of claim 65, wherein R1 and R2 are independently attached to the quinazoline ring at position 5, 6 or 7.

72. The pharmaceutical composition of claim 65, wherein R a is selected from the group consisting of hydrogen, C1-6alkyl, and C3-8heterocycloalkyl ; or two R a groups are taken together to form a 5- to 6- membered ring, optionally containing at least one heteroatom.

73. The pharmaceutical composition of claim 65, wherein the purine ring is unsubstituted.

74. The pharmaceutical composition of claim 65, wherein said compound is 2-[1-(2-fluoro-9H-purin-6-ylamino)ethyl]-5-methyl-3-o-tolyl-3H-quinazolin-4-one; or 5-methyl-2-[1-(9H-purin-6-ylamino)ethyl]-3-o-tolyl-3H-quinazolin-4-one.

75. The use according to claim 2, wherein the compound is 2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one.

76. The use according to claim 21, wherein the compound is 2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one.

77. The compound of claim 27, wherein the compound is 2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one.

78. The pharmaceutical composition of claim 53, wherein the compound is 2-(6-aminopurin-9-ylmethyl)-5-methyl-3-o-tolyl-3H-quinazolin-4-one.