CA2412701A1 - Methods for producing modified glycoproteins - Google Patents

Methods for producing modified glycoproteins Download PDF

Info

Publication number
CA2412701A1
CA2412701A1 CA002412701A CA2412701A CA2412701A1 CA 2412701 A1 CA2412701 A1 CA 2412701A1 CA 002412701 A CA002412701 A CA 002412701A CA 2412701 A CA2412701 A CA 2412701A CA 2412701 A1 CA2412701 A1 CA 2412701A1
Authority
CA
Canada
Prior art keywords
host
enzymes
glycosylation
enzyme
gnt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002412701A
Other languages
French (fr)
Inventor
Tillman U. Gerngross
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Glycofi Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27395978&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA2412701(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Individual filed Critical Individual
Publication of CA2412701A1 publication Critical patent/CA2412701A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/005Glycopeptides, glycoproteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/02Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477Hemicellulases not provided in a preceding group
    • C12N9/2488Mannanases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01113Mannosyl-oligosaccharide 1,2-alpha-mannosidase (3.2.1.113), i.e. alpha-1,2-mannosidase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/04Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/05Fusion polypeptide containing a localisation/targetting motif containing a GOLGI retention signal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y302/00Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)

Abstract

Cell lines having genetically modified glycosylation pathways that allow them to carry out a sequence of enzymatic reactions, which mimic the processing of glycoproteins in humans, have been developed. Recombinant proteins expressed in these engineered hosts yield glycoproteins more similar, if not substantially identical to their human counterparts. The lower eukaryotes, which ordinarily produce high-mannose containing N-glycans, including unicellular and multicellular fungi are modified to produce N-glycans such as Man5GlcNAc2 or other structures along human glycosylation pathways. This is achieved using a combination of engineering and/or selection of strains which:
do not express certain enzymes which create the undesirable complex structures characteristic of the fungal glycoproteins, which express exogenous enzymes selected either to have optimal activity under the conditions present in the fungi where activity is desired, or which are targeted to an organelle where optimal activity is achieved, and combinations thereof wherein the genetically engineered eukaryote expresses multiple exogenous enzymes required to produce "human-like" glycoproteins.

Description

METHODS FOR PRODUCING MODIFIED GLYCOPROTEINS
Cross Reference To Related Applications Priority is claimed to U.S. Provisional Application Serial No.
60/214,358, filed on June 28, 2000, U.S. Provisional Application Serial No.
60/215,638, filed on June 30, 2000, and U.S. Provisional Application Serial No. 60/279,997, filed on March 30, 2001.
FIELD OF THE INVENTION
The present invention is directed to methods and compositions by which fungi or other eukaryotic microorganisms can be genetically modified to produce glycosylated proteins (glycoproteins) having patterns of glycosylation similar to glycoproteins produced by animal cells, especially human cells, which are useful as human or animal therapeutic agents.
BACKGROUND OF THE INVENTION
Glycosylation Pathway De ~ovo synthesized proteins may undergo further processing in cells, known as post-translational modification. In particular, sugar residues may be added enzymatically, a process known as glycosylation. The resulting proteins bearing covalently linked oligosaccharide side chains are known as glycosylated proteins or glycoproteins. Bacteria typically do not glycosylate proteins; in cases where glycosylation does occur it usually occurs at nonspecific sites in the protein (Moms and Vanderleyden, Arch.
Microbiol. 1997 168(3):169-175).
Eukaryotes commonly attach a specific oligosaccharide to the side chain of a protein asparagine residue, particularly an asparagine which occurs in the sequence Asn-Xaa-Ser/Thr/Cys (where Xaa represents any amino acid). Following attachment of the saccharide moiety, known as an N glycan, further modifications may occur in vivo. Typically these modifications occur via an ordered sequence of enzymatic reactions, known as a cascade. Different organisms provide different glycosylation enzymes (glycosyltransferases and glycosidases) and different glycosyl substrates, so that the final composition of a sugar side chain may vary markedly depending upon the host.
For example, microorganisms such as filamentous fungi and yeast (lower eukaryotes) typically add additional mannose and/or mannosylphosphate sugars. The resulting glycan is known as a "high-mamzose" type or a mannan. By contrast, in animal cells, the nascent oligosaccharide side chain may be trimmed to remove several mannose residues and elongated with additional sugar residues that typically do not occur in the N glycans of lower eukaryotes. See R.K. Bretthauer, et al.
Biotechnology and Applied Biochemistry, 1999, 30, 193-200; W. Martinet, et al. Biotechnology Letters, 1998, 20, 1171-1177; S. Weikert, et al. Nature Biotechnology, 1999, 17, 1116-1121; M. Malissard, et al. Biochemical and Biophysical Research Communications, 2000, 267, 169-173; Jarvis, et al.
1998 Engineering N glycosylation pathways in the baculovirus-insect cell system, Current Opinion in Biotechnology, 9:528-533; and M. Takeuchi, 1997 Trends in Glycoscience arid Glycotechhology, 1997, 9, S29-535.
The N glycans that are produced in humans and animals are commonly referred to as complex N glycans. A complex N glycan means a structure with typically two to six outer branches with a sialyllactosamine sequence linked to an inner core structure Man3GlcNAca. A complex N
glycan has at least one branch, and preferably at least two, of alternating GlcNAc and galactose (Gal) residues that terminate in oligosaccharides such as, for example: NeuNAc-; NeuAca2-6GalNAca1-; NeuAca2-3Ga1(31-3GalNAca1-; NeuAca2-3/6Ga1~31-4GlcNAc~31-; GlcNAca1-4Ga1[31-(mucins only); Fucal-2Ga1(31-(blood group H). Sulfate esters can occur on galactose, GaINAc, and GIcNAc residues, and phosphate esters can occur on mannose residues. NeuAc (Neu: neuraminic acid; Ac:acetyl) can be O-acetylated or replaced by NeuGl (N glycolylneuraminic acid). Complex N
glycans may also have intrachain substitutions of bisecting GIcNAc and core fucose (Fuc).
Human glycosylation begins with a sequential set of reactions in the endoplasmatic reticulum (ER) leading to a core oligosacchaxide structure, which is transferred onto de novo synthesized proteins at the asparagine residue in the sequence Asn-Xaa-Ser/Thr (see Figure 1A). Further processing by glucosidases and mannosidases occurs in the ER before the nascent glycoprotein is transferred to the early Golgi apparatus, where additional mannose residues are removed by Golgi-specific 1,2-mannosidases. Processing continues as the protein proceeds through the Golgi. In the medial Golgi a number of modifying enzymes including N acetylglucosamine transferases (GnT I, GnT II, GnT III, GnT IV GnT V
GnT VI), mannosidase II, fucosyltransferases add and remove specific sugar residues (see Figure 1B). Finally in the trans Golgi, the N glycans are acted on by galactosyl tranferases and sialyltransferases (ST) and the finished glycoprotein is released from the Golgi apparatus. The protein N glycans of animal glycoproteins have bi-, tri-, or tetra-antennary structures, and may typically include galactose, fucose, and N acetylglucosamine. Commonly the terminal residues of the N glycans consist of sialic acid. A typical structure of a human N glycan is shown in Figure 1B.
Sugar Nucleotide Precursors The N glycans of animal glycoproteins typically include galactose, fucose, and terminal sialic acid. These sugars are not generally found on glycoproteins produced in yeast and filamentous fungi. In humans, the full range of nucleotide sugar precursors (e.g. UDP-N acetylglucosamine, UDP-N acetylgalactosamine, CMP-N acetylneuraminic acid, UDP-galactose, GDP-fucose etc.) are generally synthesized in the cytosol and transported into the Golgi, where they are attached to the core oligosaccharide by glycosyltransferases. (Sommers and Hirschberg, 1981 J. Cell Biol. 91(2):
A406-A406; Sommers and Hirschberg 1982 J. Biol.Chem.257(18): 811-817;
Perez and Hirschberg 1987 Methods ih E~zymology 138: 709-715.
Glycosyl transfer reactions typically yield a side product which is a nucleoside diphosphate or monophosphate. While monophosphates can be directly exported in exchange for nucleoside triphosphate sugars by an antiport mechanism, diphosphonucleosides (e.g. GDP) have to be cleaved by phosphatases (e.g. GDPase) to yield nucleoside monophosphates and inorganic phosphate prior to being exported. This reaction is important for efficient glycosylation; for example, GDPase from S. cerevisiae has been found to be necessary for mannosylation. However the GDPase has 90%
reduced activity toward UDP (Berninsone et al., 1994 J. Biol. Chem.
269(1):207-211x,). Lower eukaryotes typically lack UDP-specific diphosphatase activity in the Golgi since they do not utilize UDP-sugar precursors for Golgi-based glycoprotein synthesis. Schizosaccharomyces pombe, a yeast found to add galactose residues to cell wall polysaccharides (from UDP-galactose) has been found to have specific UDPase activity, indicating the requirement for such an enzyme (Berninsone et al., 1994).
UDP is known to be a potent inhibitor of glycosyltransferases and the removal of this glycosylation side product is important in order to prevent glycosyltransferase inhibition in the lumen of the Golgi (I~hatara et al., 1974). See Berninsone, P., et al. 1995. J. Biol. Chem.270(24): 14564-14567;
Beaudet, L., et al. 1998 Abc Transpo~te~s: Biochemical, Cellular, aid Molecular Aspects. 292: 397-413.
Compartmentalization of Glycosylation Enzymes Glycosyltransferases and mannosidases line the inner (luminal) surface of the ER and Golgi apparatus and thereby provide a catalytic surface that allows for the sequential processing of glycoproteins as they proceed through the ER and Golgi network. The multiple compartments of the cis, medial, and trans Golgi and the trans Golgi Network (TGN), provide the different localities in which the ordered sequence of glycosylation reactions can take place. As a glycoprotein proceeds from synthesis in the ER to full maturation in the late Golgi or TGN, it is sequentially exposed to different glycosidases, mannosidases and glycosyltransferases such that a specific N glycan structure may be synthesized. The enzymes typically include a catalytic domain, a stem region, a membrane spanning region and an N-terminal cytoplasmic tail. The latter three structural components are responsible for directing a glycosylation enzyme to the appropriate locus.

Localization sequences from one organism may function in other organisms. For example the membrane spa.niung region of a-2,6-sialyltransferase (a-2,6-ST) from rats, an enzyme known to localize in the rat traps Golgi, was shown to also localize a reporter gene (invertase) in the yeast Golgi (Schwientek, et al., 1995). However, the very same membrane spanning region as part of a full-length of a-2,6-sialyltransferase was retained in the ER and not further transported to the Golgi of yeast (Krezdorn et al., 1994). A full length GaIT from humans was not even synthesized in yeast, despite demonstrably high transcription levels. On the other hand the transmembrane region of the same human GaIT fused to an invertase reporter was able to direct localization to the yeast Golgi, albeit it at low production levels. Schwientek and co-workers have shown that fusing 28 amino acids of a yeast mannosyltransferase (Mntl), a region containing an N-terminal cytoplasmic tail, a transmembrane region and eight amino acids of the stem region, to the catalytic domain of human GaIT are sufficient for Golgi localization of an active GaIT (Schwientek et al. 1995 J. Biol. Chem.
270(10):5483-5489). Other galactosyltransferases appear to rely on interactions with enzymes resident in particular organelles since after removal of their transmembrane region they are still able to localize properly.
Improper localization of a glycosylation enzyme may prevent proper functioning of the enzyme in the pathway. For example Aspe~gillus hidulans, which has numerous a-1,2-mannosidases (Eades and Hintz, 2000 Gene 255(1):25-34), does not add GIcNAc to Man5GlcNAc2 when transformed with the rabbit GnT I gene, despite a high overall level of GnT I
activity (Kalsner et al., 1995). GnT I, although actively expressed, may be incorrectly localized such that the enzyme is not in contact with both of its substrates: the nascent N glycan of the glycoprotein and UDP-GIcNAc.
Alternatively, the host organism may not provide an adequate level of UDP-GIcNAc in the Golgi.

Glycoproteins Used Therapeutically A significant fraction of proteins isolated from humans or other animals are glycosylated. Among proteins used therapeutically, about 70%
are glycosylated. If a therapeutic protein is produced in a microorganism host such as yeast, however, and is glycosylated utilizing the endogenous pathway, its therapeutic efficiency is typically greatly reduced. Such glycoproteins are typically immunogenic in humans and show a reduced half life in vivo after administration (Takeuchi, 1997).
Specific receptors in humans and animals can recognize terminal mannose residues and promote the rapid clearance of the protein from the bloodstream. Additional adverse effects may include changes in protein folding, solubility, susceptibility to proteases, trafficking, transport, compartmentalization, secretion, recognition by other proteins or factors, antigenicity, or allergenicity. Accordingly, it has been necessary to produce therapeutic glycoproteins in animal host systems, so that the pattern of glycosylation is identical or at least similar to that in humans or in the intended recipient species. In most cases a mammalian host system, such as mammalian cell culture, is used.
Systems for Producin T~hera_peutic Glycoproteins In order to produce therapeutic proteins that have appropriate glycoforms and have satisfactory therapeutic effects, animal or plant-based expression systems have been used. The available systems include:
1. Chinese hamster ovary cells (CHO), mouse fibroblast cells and mouse myeloma cells (Arzneimittelforschung. 1998 Aug;48(8):870-880);
2. transgenic animals such as goats, sheep, mice and others (Dente Prog.
Clin. Biol. 1989 Res. 300:85-98, Ruther et al., 1988 Cell 53(6):847-856; Ware, J., et al. 1993 Thrombosis avid Haemostasis 69(6): 1194-1194; Cole, E. S., et al. 1994 J.Cell.Biochem. 265-265);
3. plants (Arabidopsis thaliaha, tobacco etc.) (Staub, et al. 2000 Nature Biotechnology 18(3): 333-338) (McGarvey, P. B., et al. 1995 Bio-Technology 13(13): 1484-1487; Bardor, M., et al. 1999 Trends in Plant Science 4(9): 376-380);
4. insect cells (Spodoptera frugiperda Sf~, Sf2l, Trichoplusia ni, etc. in combination with recombinant baculoviruses such as Autographa californica multiple nuclear polyhedrosis virus which infects lepidopteran cells) (Altmans et al., 1999 Glycoconj. J. 16(2):109-123).
Recombinant human proteins expressed in the above-mentioned host systems may still include non-human glycoforms (Raju et al., 2000 Annals Biochem. 283(2):123-132). In particular, fraction of the N glycans may lack terminal sialic acid, typically found in human glycoproteins. Substantial efforts have been directed to developing processes to obtain glycoproteins that are as close as possible in structure to the human forms, or have other therapeutic advantages. Glycoproteins having specific glycoforms may be especially useful, for example in the targeting of therapeutic proteins. For example, the addition of one or more sialic acid residues to a glycan side chain may increase the lifetime of a therapeutic glycoprotein in vivo after admininstration. Accordingly, the mammalian host cells may be genetically engineered to increase the extent of terminal sialic acid in glycoproteins expressed in the cells. Alternatively sialic acid may be conjugated to the protein of interest in vitro prior to administration using a sialic acid transferase and an appropriate substrate. In addition, changes in growth medium composition or the expression of enzymes involved in human glycosylation have been employed to produce glycoproteins more closely resembling the human forms (S. Weikert, et al., Nature Biotechnology, 1999, 17, 1116-1121; Werner, Noe, et al 1998 Arzneimittelforschung 48(8):870-880; Weikert, Papac et al., 1999; Andersen and Goochee 1994 Cur.
Opin.Biotechuol.5: 546-549; Yang and Butler 2000 Biotechhol.Bioehgiu.68(4): 370-380). Alternatively cultured human cells may be used.
However, all of the existing systems have significant drawbacks.
Only certain therapeutic proteins are suitable for expression in animal or plant systems (e.g. those lacking in any cytotoxic effect or other effect adverse to growth). Animal and plant cell culture systems are usually very slow, frequently requiring over a week of growth under carefully controlled conditions to produce any useful quantity of the protein of interest. Protein yields nonetheless compare unfavorably with those from microbial fermentation processes. In addition cell culture systems typically require complex and expensive nutrients and cofactors, such as bovine fetal serum.
Furthermore growth may be limited by programmed cell death (apoptosis).
Moreover, animal cells (particularly mammalian cells) are highly susceptible to viral infection or contamination. In some cases the virus or other infectious agent may compromise the growth of the culture, while in other cases the agent may be a human pathogen rendering the therapeutic protein product unfit for its intended use. Furthermore many cell culture processes require the use of complex, temperature-sensitive, animal-derived growth media components, which may carry pathogens such as bovine spongiform encephalopathy (BSE) prions. Such pathogens are difficult to detect and/or difficult to remove or sterilize without compromising the growth medium. In any case, use of animal cells to produce therapeutic proteins necessitates costly quality controls to assure product safety.
Transgenic animals may also be used for manufacturing high-volume therapeutic proteins such as human serum albumin, tissue plasminogen activator, monoclonal antibodies, hemoglobin, collagen, fibrinogen and others. While transgenic goats and other transgenic animals (mice, sheep, cows, etc.) can be genetically engineered to produce therapeutic proteins at high concentrations in the milk, the process is costly since every batch has to undergo rigorous quality control. Animals may host a variety of animal or human pathogens, including bacteria, viruses, fungi, and prions. In the case of scrapies and bovine spongiform encephalopathy, testing can take about a year to rule out infection. The production of therapeutic compounds is thus preferably carried out in a well-controlled sterile environment, e.g. under Good Manufacturing Practice (GMP) conditions. However, it is not generally feasible to maintain animals in such environments. Moreover, whereas cells grown in a fermenter are derived from one well characterized Master Cell Bank (MCB), transgenic animal technology relies on different animals and thus is inherently non-uniform. Furthermore external factors such as different food uptake, disease and lack of homogeneity within a herd, may effect glycosylation patterns of the final product. It is known in humans, for example, that different dietary habits result in differing glycosylation patterns.
Transgenic plants have been developed as a potential source to obtain proteins of therapeutic value. However, high level expression of proteins in plants suffers from gene silencing, a mechanism by which the genes for highly expressed proteins are down-regulated in subsequent plant generations. In addition, plants add xylose and/or a,-1,3-linked fucose to protein N glycans, resulting in glycoproteins that differ in structure from animals and are immunogenic in mammals (Altmann, Marz et al., 1995 Glycoconj. J. 12(2);150-155). Furthermore, it is generally not practical to grow plants in a sterile or GMP environment, and the recovery of proteins from plant tissues is more costly than the recovery from fermented microorganisms.
Gl~coprotein Production Using Eukaryotic Mieroor~anisms The lack of a suitable expression system is thus a significant obstacle to the low-cost and safe production of recombinant human glycoproteins.
Production of glycoproteins via the fermentation of microorganisms would offer numerous advantages over the existing systems. For example, fermentation-based processes may offer (a) rapid production of high concentrations of protein; (b) the ability to use sterile, well-controlled production conditions (e.g. GMP conditions); (c) the ability to use simple, chemically defined growth media; (d) ease of genetic manipulation; (e) the absence of contaminating human or animal pathogens; (f) the ability to express a wide variety of proteins, including those poorly expressed in cell culture owing to toxicity etc.; (g) ease of protein recovery (e.g. via secretion into the medium). In addition, fermentation facilities are generally far less costly to construct than cell culture facilities.

As noted above, however, bacteria, including species such as Esche~ichia coli commonly used to produce recombinant proteins, do not glycosylate proteins in a specific manner like eukaryotes. Various methylotrophic yeasts such as Pichia pasto~is, Pichia naethaholica, and Hansenula polymo~pha, are particularly useful as eukaryotic expression systems, since they are able to grow to high cell densities and/or secrete large quantities of recombinant protein. However, as noted above, glycoproteins expressed in these eukaryotic microorganisms differ substantially in N glycan structure from those in animals. This has prevented the use of yeast or filamentous fungi as hosts for the production of many useful glycoproteins.
Several efforts have been made to modify the glycosylation pathways of eukaryotic microorganisms to provide glycoproteins more suitable for use as mammalian therapeutic agents. For example, several glycosyltransferases have been separately cloned and expressed in S cerevisiae (GaIT, GnT I), Aspergillus nidulans (GnT I) and other fungi (Yoshida et al., 1999, I~alsner et al., 1995 Glycoconj. J. 12(3):360-370, Schwientek et al., 1995). However, N glycans with human characteristics were not obtained.
Yeasts produce a variety of mannosyltransferases e.g. 1,3-mannosyltransferases (e.g. MNN1 in S, cerevisiae) (Graham and Emr, 1991 J. Cell. Biol. 114(2):207-218), 1,2-mannosyltransferases (e.g. I~TR/KRE
family from S. cerevisiae), 1,6-mannosyltransferases (OCHl from S.
cerevisiae), mannosylphosphate transferases (MNN4 and MNN6 from S.
cerevisiae) and additional enzymes that are involved in endogenous glycosylation reactions. Many of these genes have been deleted individually, giving rise to viable organisms having altered glycosylation profiles.
Examples are shown in Table 1.

Table 1. Examples of yeast strains having altered mannosylation Strain N glycan (wild Mutation N glycan Reference type) (mutant) S. pombe Man>9GlcNAc2 OCHl Man8GlcNAc2 Yoko-o et al., 2001 FEBS Lett.
489(1):75-80 S. ce~evisiae Man>9GlcNAc2 OCH1/MNN1 Man8GlcNAc2 Nakanishi-Shindo et al,. 1993 J. Biol.
Chem.
268(35):26338-S ce~evisiae Man,9GlcNAca OCH1/MNN1/ Man8GlcNAca Chiba et al., 1998 MNN4 J. Biol. Chem. 273, In addition, Japanese Patent Application Public No. 8-336387 discloses an OCHI mutant strain of Pichia pasto~is. The OCHl gene encodes 1,6-mannosyltransferase, which adds a mannose to the glycan structure Man8GlcNAc2 to yield Man9GlcNAc2. The Man9GlcNAc2 structure is then a substrate for further mannosylation i~ vivo, leading to the hypermannosylated glycoproteins that are characteristic of yeasts and typically may have at least 30-40 mannose residue per N glycan. In the OCHl mutant strain, proteins glycosylated with Man8GlcNAc2 are accumulated and hypermannosylation does not occur. However, the structure MangGlcNAca is not a substrate for animal glycosylation enzymes, such as human UDP-GIcNAc transferase I, and accordingly the method is not useful for producing proteins with human glycosylation patterns.
Martinet et al. (Biotechnol. Lett. 1998, 20(12), 1171-1177) reported the expression of a-1,2-mannosidase from T~ichode~ma reesei in P. pastoris.
Some mannose trimming from the N glycans of a model protein was observed. However, the model protein had no N glycans with the structure Man;GlcNAca, which would be necessary as an intermediate for the generation of complex N glycans. Accordingly the method is not useful for producing proteins with human or animal glycosylation patterns.

Similarly, Chiba et al. 1998 expressed a-1,2-mannosidase from Aspergillus saitoi in the yeast Saccha~omyces ce~evisiae. A signal peptide sequence (His-Asp-Glu-Leu) was engineered into the exogenous mannosidase to promote retention in the endoplasmic reticulum. In addition, the yeast host was a mutant lacking three enzyme activities associated with hypermannosylation of proteins: 1,6-mannosyltransferase (OCHI); 1,3-mannosyltransferase (MlVNl); and mannosylphosphatetransferase (MNN4).
The N glycans of the triple mutant host thus consisted of the structure Man$GIcNAc2, rather than the high mannose forms found in wild-type S.
ce~evisiae. In the presence of the engineered mannosidase, the N glycans of a model protein (carboxypeptidase ~ were trimmed to give a mixture consisting of 27 mole % Man5GlcNAc2, 22 mole % Man6GlcNAc2, 22 mole Man7GlcNAca, 29 mole % Man8GlcNAc2. Trimming of the endogenous cell wall glycoproteins was less efficient, only 10 mole % of the N glycans having the desired Man5GlcNAc2 structure.
Since only the Man5GlcNAc2 glycans would be susceptible to further enzymatic conversion to human glycoforms, the method is not efficient for the production of proteins having human glycosylation patterns. In proteins having a single N glycosylation site, at least 73 mole % would have an incorrect structure. In proteins having two or three N glycosylation sites, respectively at least 93 or 98 mole % would have an incorrect structure.
Such low efficiencies of coversion are unsatisfactory for the production of therapeutic agents, particularly as the separation of proteins having different glycoforms is typically costly and difficult.
With the object of providing a more human-like glycoprotein derived from a fungal host, U.S. Patent No. 5,834,251 to Maras and Contreras discloses a method for producing a hybrid glycoprotein derived from Trichoderma ~eesei. A hybrid N glycan has only mannose residues on the Manal-6 arm of the core and one or two complex antennae on the Mana,l-3 arm. While this structure has utility, the method has the disadvantage that numerous enzymatic steps must be performed in vitYO, which is costly and time-consuming. Isolated enzymes are expensive to prepare and maintain, may need unusual and costly substrates (e.g. UDP-GIcNAc), and are prone to loss of activity and/or proteolysis under the conditions of use.
It is therefore an object of the present invention to provide a system and methods for humanizing glycosylation of recombinant glycoproteins expressed in Pichia pastoris and other lower eukaryotes such as Hansenula polymorpha, Pichia stiptis, Piclaia ynethauolica, Pichia sp, Kluyve~omyces sp, Ca~dida albicahs, Aspergillus hidulahs, and Ti~ichoderma reseei.
SUMMARY OF THE INVENTION
Cell lines having genetically modified glycosylation pathways that allow them to carry out a sequence of enzymatic reactions, which mimic the processing of glycoproteins in humans, have been developed. Recombinant proteins expressed in these engineered hosts yield glycoproteins more similar, if not substantially identical, to their human counterparts.The lower eukaryotes, which ordinarily produce high-mannose containing N glycans, including unicellular and multicellular fungi such as Pichia pasto~is, Hanse~ula polymo~pha, Pichia stiptis, Pichia methaholica, Pichia sp., Kluyveromyces sp., Caudida albicahs, Aspe~gillus nidulavcs, and T~ichode~ma ~eseei, are modified to produce N glycans such as Man5GlcNAc2 or other structures along human glycosylation pathways. This is achieved using a combination of engineering and/or selection of strains which: do not express certain enzymes which create the undesirable complex structures characteristic of the fungal glycoproteins, which express exogenous enzymes selected either to have optimal activity under the conditions present in the fungi where activity is desired, or which are targeted to an organelle where optimal activity is achieved, and combinations thereof wherein the genetically engineered eukaryote expresses multiple exogenous enzymes required to produce "human-like" glycoproteins.
In a first embodiment, the microorganism is engineered to express an exogenous o~ 1,2-mannosidase enzyme having an optimal pH between 5.1 and 8.0, preferably between 5.9 and 7.5. In an alternative preferred embodiment, the exogenous enzyme is targeted to the endoplasmic reticulum or Golgi apparatus of the host organism, where it trims N glycans such as Man8GlcNAc2 to yield Man5GlcNAc2. The latter structure is useful because it is identical to a structure formed in mammals, especially humans; it is a substrate for further glycosylation reactions in vivo and/or in vitro that produce a finished N glycan that is similar or identical to that formed in mammals, especially humans; and it is not a substrate for hypermannosylation reactions that occur i~ vivo in yeast and other microorganisms and that render a glycoprotein highly immunogenic in animals.
In a second embodiment, the glycosylation pathway of an eukaryotic microorganism is modified by (a) constructing a DNA library including at least two genes encoding exogenous glycosylation enzymes; (b) transforming the microorganism with the library to produce a genetically mixed population expressing at least two distinct exogenous glycosylation enzymes; (c) selecting from the population a microorganism having the desired glycosylation phenotype. In a preferred embodiment, the DNA
library includes chimeric genes each encoding a protein localization sequence and a catalytic activity related to glycosylation. Organisms modified using the method are useful for producing glycoproteins having a glycosylation pattern similar or identical to mammals, especially humans.
In a third embodiment, the glycosylation pathway is modified to express a sugar nucleotide transporter enzyme. In a preferred embodiment, a nucleotide diphosphatase enzyme is also expressed. The transporter and diphosphatase improve the efficiency of engineered glycosylation steps, by providing the appropriate substrates for the glycosylation enzymes in the appropriate compartments, reducing competitive product inhibition, and promoting the removal of nucleoside diphosphates.
DESCRIPTION OF THE FIGTJRES
Figure 1A is a schematic diagram of typical fungal N glycosylation pathway.

Figure 1B is a schematic diagram of a typical human N glycosylation pathway.
DETAILED DESCRIPTION OF THE INVENTION
The methods and recombinant lower eukaryotic strains described herein are used to make "humanized glycoproteins". The recombinant lower eukaryotes are made by engineering lower eukaryotes which do not express one or more enzymes involved in production of high mannose structures to express the enzymes required to produce human-like sugaxs. As used herein, a lower eukaryote is a unicellular or filamentous fungus. As used herein, a "humanized glycoprotein" refers to a protein having attached thereto N-glycans including less than four mannose residues, and the synthetic intermediates (which are also useful and can be manipulated further i~c vitro) having at least five mannose residues. In a preferred embodiment, the glycoproteins produced in the recombinant lower eukaryotic strains contain at least 27 mole % of the Mans intermediate. This is achieved by cloning in a better mannosidase, i.e., an enzyme selected to have optimal activity under the conditions present in the organisms at the site where proteins are glycosylated, or by targeting the enzyme to the organelle where activity is desired.
In a preferred embodiment, eukaryotic strains which do not express one or more enzymes involved in the production of high mannose structures are used. These strains can be engineered or one of the many such mutants already described in yeasts, including a hypermannosylation-minus (OCH1) mutant in Pichia pasto~is.
The strains can be engineered one enzyme at a time, or a library of genes encoding potentially useful enzymes can be created, and those strains having enzymes with optimal activities or producing the most "human-like"
glycoproteins, selected.
Lower eukaryotes that are able to produce glycoproteins having the attached N glycan Man5GlcNAc2 are particularly useful since (a) lacking a high degree of mannosylation (e.g. greater than 8 mannoses per N glycan, or especially 30-40 mannoses), they show reduced immunogenicity in humans;
and (b) the N glycan is a substrate for further glycosylation reactions to form an even more human-like glycoform, e.g. by the action of GIcNAc transferase I to form GIcNAcMan5GlcNAc2. Man5GlcNAc2 must be formed in vivo in a high yield, at least transiently, since all subsequent glycosylation reactions require Man5GlcNAc2 or a derivative thereof. Accordingly, a yield is obtained of greater than 27 mole %, more preferably a yield of 50-100 mole %, glycoproteins in which a high proportion of N glycans have Man5GlcNAca. It is then possible to perform further glycosylation reactions i~c vitro, using for example the method of U.S. Patent No. 5,834,251 to Maras and Contreras. In a preferred embodiment, at least one further glycosylation reaction is performed in vivo. In a highly preferred embodiment thereof, active forms of glycosylating enzymes are expressed in the endoplasmic reticulum and/or Golgi apparatus.
Host Microorganisms Yeast and filamentous fungi have both been successfully used for the production of recombinant proteins, both intracellular and secreted (Cereghino, J. L. and J. M. Cregg 2000 FEMSMic~obiology Reviews 24(1):
45-66; Harkki, A., et al. 1989 Bio-Technology 7(6): 596; Berka, R. M., et al.
1992 Abstr°.Pape~s Amer. Chem.Soc.203: 121-BIOT; Svetina, M., et al.

J.Biotechnol. 76(2-3): 245-251.
Although glycosylation in yeast and fungi is very different than in humans, some common elements are shared. The first step, the transfer of the core oligosaccharide structure to the nascent protein, is highly conserved in all eukaryotes including yeast, fungi, plants and humans (compare Figures 1A and 1B). Subsequent processing of the core oligosaccharide, however, differs significantly in yeast and involves the addition of several mannose sugars. This step is catalyzed by mannosyltransferases residing in the Golgi (e.g. OCH1, MNT1, MNN1, etc.), which sequentially add mannose sugars to the core oligosaccharide. The resulting structure is undesirable for the production of humanoid proteins and it is thus desirable to reduce or eliminate mannosyl transferase activity. Mutants of S. cerevisiae, deficient in mannosyl transferase activity (e.g. ochl or mnn9 mutants) have shown to be non-lethal and display a reduced mannose content in the oligosacharide of yeast glycoproteins. Other oligosacharide processing enzymes, such as mannosylphophate transferase may also have to be eliminated depending on the host's particular endogenous glycosylation pattern. After reducing undesired endogenous glycosylation reactions the formation of complex N-glycans has to be engineered into the host system. This requires the stable expression of several enzymes and sugar-nucleotide transporters. Moreover, one has to locate these enzymes in a fashion such that a sequential processing of the maturing glycosylation structure is ensured.
Targ-et Glycoproteins The methods described herein are useful for producing glycoproteins, especially glycoproteins used therapeutically in humans. Such therapeutic proteins are typically administered by injection, orally, pulmonary, or other means.
Examples of suitable target glycoproteins include, without limitation:
erythropoietin, cytokines such as interferon-a, interferon-(3, interferon-y, interferon-w, and granulocyte-CSF, coagulation factors such as factor VIII, factor IX, and human protein C, soluble IgE receptor a-chain, IgG, IgM, urokinase, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, azmexin V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, amd osteoprotegerin.
Method for Producing Glycoproteins Co ~risina the N-:glycan ManSGlc The first step involves the selection or creation of a lower eukaryote that is able to produce a specific precursor structure of Man5GlcNAc2, which is able to accept in vivo GIcNAc by the action of a GIcNAc transferase I.
This step requires the formation of a particular isomeric structure of Man5GlcNAc2 . This structure has to be formed within the cell at a high yield (in excess of 30%) since all subsequent manipulations are contingent on the presence of this precursor. Man5GlcNAc2 structures are necessary for complex N-glycan formation, however, their presence is by no means sufficient, since Man5GlcNAca may occur in different isomeric forms, wluch may or may not serve as a substrate for GIcNAc transferase I. Most glycosylation reactions are not complete and thus a particular protein generally contains a range of different carbohydrate structures (i.e.
glycoforms) on its surface. The mere presence of trace amounts (less than 5%) of a particular structure like Man5GlcNAc2 is of little practical relevance. It is the formation of a particular, GIcNAc transferase I accepting intermediate (Structure I) in high yield (above 30%), which is required. The formation of this intermediate is necessary and subsequently allows for the ivy vivo synthesis of complex N-glycans.
One can select such lower eukaryotes from nature or alternatively genetically engineer existing fungi or other lower eukaryotes to provide the structure in vivo. No lower eukaryote has been shown to provide such structures in vivo in excess of 1.8% of the total N-glycans (Maras et al., 1997), so a genetically engineered organism is preferred. Methods such as those described in U.S. Patent No. 5,595,900, may be used to identify the absence or presence of particular glycosyltransferases, mannosidases and sugar nucleotide transporters in a target organism of interest.
Inactivation of Fun ag 1 Glycosylation Enzymes such as 1,2- a-mannosidase The method described herein may be used to engineer the glycosylation pattern of a wide range of lower eukaryotes (e.g. Hausenula polymo~pha, Pichia stiptis, Pichia methaholica, Pichia sp, Kluyve~omyces sp, Cahdida albicans, Aspe~gillus nidulans, Trichode~ma reseei etc.). Pichia pastoris is used to exemplify the required manipulation steps. Similar to other lower eukaryotes, P.pasto~is processes Man9GlcNAc2 structures in the ER with a 1,2- oc- mannosidase to yield Man8GlcNAc2. Through the action of several mannosyltransferases, this structure is then converted to hypermannosylated structures (Man,9GlcNAc2), also known as mannans. In addition, it has been found that P. pastoris is able to add non-terminal phosphate groups, through the action of mannosylphosphate transferases to the carbohydrate structure. This is contrary to the reactions found in mammalian cells, which involve the removal of mannose sugars as opposed to their addition. It is of particular importance to eliminate the ability of the fungus to hypermannosylate the existing Man8GlcNAc2 structure. This can be achieved by either selecting for a fungus that does not hypermannosylate, or by genetically engineering such a fungus.
Genes that are involved in this process have been identified in Pichia pasto~is and by creating mutations in these genes one is able to reduce the production of "undesirable" glycoforms. Such genes can be identified by homology to existing mannosyltransferases (e.g. OCHl, MNN4, MNN6, MNN1), found in other lower eukaryotes such as C. albicahs, Pichia angusta or S ce~evisiae or by mutagenizing the host strain and selecting for a phenotype with reduced mannosylation. Based on homologies amongst known mannosyltransferases and mannosylphosphate transferases, one may either design PCR primers, examples of which are shown in Table 2, or use genes or gene fragments encoding such enzymes as probes to identify homologues in DNA libraries of the target orgausm. Alternatively, one may be able to complement particular phenotypes in related organisms. For example, in order to obtain the gene or genes encoding 1,6-mannosyltransferase activity in P. pasto~is, one would carry out the following steps. OCH1 mutants of S. cerevisiae are temperature sensitive and are slow growers at elevated temperatures. One can thus identify functional homologues of OCH1 in P.pasto~is by complementing an OCH1 mutant of S. ce~evisiae with a P.pasto~is DNA or cDNA library. Such mutants of S.ce~evisiae may be found at http://genome-www.stanford.edu/Saccharomyces/ and are commercially available at http://www.resgen.com/products/YEASTD.php3. Mutants that display a normal growth phenotype at elevated temperature, after having been transformed with a P.pastoris DNA library, are likely to carry an OCH1 homologue of P.pastoris. Such a library can be created by partially digesting chromosomal DNA of P.pastoris with a suitable restriction enzyme and after inactivating the restriction enzyme ligating the digested DNA into a suitable vector, which has been digested with a compatible restriction enzyme.
Suitable vectors are pRS314, a low copy (CEN6/ARS4) plasmid based on pBluescript containing the Trpl marker (Sikorski, R. S., and Hieter, P.,1989, Genetics 122, pg 19-27) or pFL44S, a high copy (2~,) plasmid based on a modified pUCl9 containing the URA3 marker (Bonneaud, N., et al., 1991, Yeast 7, pg. 609-615). Such vectors are commonly used by academic researchers or similar vectors are available from a number of different vendors such as Invitrogen (Carlsbad, CA), Pharmacia (Piscataway, NJ), New England Biolabs (Beverly, MA). Examples are pYES/GS, 2p, origin of replication based yeast expression plasmid from Invitrogen, or Yep24 cloning vehicle from New England Biolabs. After ligation of the chromosomal DNA and the vector one may transform the DNA library into strain of S. ce~evisiae with a specific mutation and select for the correction of the corresponding phenotype. After sub-cloning and sequencing the DNA
fragment that is able to restore the wild-type phenotype, one may use this fragment to eliminate the activity of the gene product encoded by OCH1 in P. pastoris.
Alternatively, if the entire genomic sequence of a particular fungus of interest is known, one may identify such genes simply by searching publicly available DNA databases, which are available from several sources such as NCBI, Swissprot etc. For exaanple by searching a given genomic sequence or data base with a known 1,6 mannosyltransferase gene (OCH1) from S.
cerevisiae, one can able to identify genes of high homology in such a genome, which a high degree of certainty encodes a gene that has 1,6 mannosyltransferase activity. Homologues to several known mannosyltransferases from S.cer~evisiae in P.pastor~is have been identified using either one of these approaches. These genes have similar functions to genes involved in the mannosylation of proteins in S cerevisiae and thus their deletion may be used to manipulate the glycosylation pattern in P.pasto~is or any other fungus with similar glycosylation pathways.

The creation of gene knock-outs; once a given target gene sequence has been determined, is a well-established technique in the yeast and fungal molecular biology community, and can be carried out by anyone of ordinary skill in the art (R. Rothsteins, (1991) Methods in Enzymology, vol. 194, p.
281). In fact, the choice of a host organism may be influenced by the availability of good transformation and gene disruption techniques for such a host. If several mannosyltransferases have to be knocked out, the method developed by Alani and Kleckner allows for the repeated use of the URA3 markers to sequentially eliminate all undesirable endogenous mannosyltransferase activity. This technique has been refined by others but basically involves the use of two repeated DNA sequences, flanking a counter selectable marker. For example: URA3 may be used as a marker to ensure the selection of a transformants that have integrated a construct. By flanking the URA3 marker with direct repeats one may first select for transformants that have integrated the construct and have thus disrupted the target gene. After isolation of the transformants, and their characterization, one may counter select in a second round for those that are resistant to 5'FOA. Colonies that able to survive on plates containing 5'FOA have lost the URA3 marker again through a crossover event involving the repeats mentioned earlier. This approach thus allows for the repeated use of the same marker and facilitates the disruption of multiple genes without requiring additional markers.
Eliminating specific mannosyltransferases, such as 1,6 mannosyltransferase (OCHl), mannosylphosphate transferases (MNN4, MNN6, or genes complementing lbd mutants) in P. pastoris, allows for the creation of engineered strains of this organism which synthesize primarily MangGlcNAc2 and thus can be used to further modify the glycosylation pattern to more closely resemble more complex human glycoform structures.
A preferred embodiment of this method utilizes known DNA sequences, encoding known biochemical glycosylation activities to eliminate similar or identical biochemical functions in P. pasto~is, such that the glycosylation structure of the resulting genetically altered P. pasto~is strain is modified.

Table 2.
PCR primer PCR primer Ta:~et Genes). Homologues A B in P.

astoris ATGGCGAAGGCAGATTAGTCCTTCCAAC1,6- OCHl TGGCAGT TTCCTTC mannosyltransferaseS.cerevisiae, Pichia albicans TAYTGGMGNGTNGAGCRTCNCCCCANCK1,2 KTR/KRE family, RCYNGAYATHAA YTCRTA mannosyltransferaseS.cerevisiae s Legena.: M = A or C, R = A or G, W = A or T, S = C or G, Y = C or T, K = G or T, V = A or C or G, H = A or C or T, D =
$ A or G or T, B = C or G or T, N = G or A or T or C.
Incorporation of a Mannosidase into the Genetically E~ineered Host The process described herein enables one to obtain such a structure in high yield for the purpose of modifying it to yield complex N-glycans. A
successful scheme to obtain suitable Man5GlcNAc2 structures must involve two parallel approaches: (1) reducing endogenous mannosyltransferase activity and (2) removing 1,2- a,- mannose by mannosidases to yield high levels of suitable Man5GlcNAca structures. What distinguishes this method from the prior art is that it deals directly with those two issues. As the work of Chiba and coworkers demonstrates, one can reduce Man8GlcNAc2 structures to a Man5GlcNAc2 isomer in S. cer~evisiae, by engineering the presence of a fungal mannosidase from A. saitoi into the ER. The shortcomings of their approach are twofold: (1) insufficient amounts of Man5GlcNAc2 are formed in the extra-cellular glycoprotein fraction (10%) and (2) it is not clear that the ih vivo formed Man5GlcNAc2 structure in fact is able to accept GIcNAc by action of GIcNAc transferase I. If several glycosylation sites are present in a desired protein the probability (P) of obtaining such a protein in a correct form follows the relationship P=(F)°, where n equals the number of glycosylation sites, and F equals the fraction of desired glycoforms. A glycoprotein with three glycosylation sites would have a 0.1 % chance of providing the appropriate precursors for complex and hybrid N-glycan processing on all of its glycosylation sites, which limits the commercial value of such an approach.
Most enzymes that are active in the ER and Golgi apparatus of S. cerevisiae have pH optima that are between 6.5 and 7.5 (see Table 3). All previous approaches to reduce mannosylation by the action of recombinant mannosidases have concentrated on enzymes that have a pH optimum aromid pH 5.0 (Martinet et al., 1998, and Chiba et al., 1998), even though the activity of these enzymes is reduced to less than 10% at pH 7.0 and thus most likely provide insufficient activity at their point of use, the ER and early Golgi of P.pastoris and S. cerevisiae. A preferred process utilizes an a,-mannosidase ih vivo, where the pH optimum of the mannosidase is within 1.4 pH units of the average pH optimum of other representative marker enzymes localized in the same organelle(s). The pH optimum of the enzyme to be targeted to a specific organelle should be matched with the pH
optimum of other enzymes found in the same organelle, such that the maximum activity per unit enzyme is obtained. Table 3 summarizes the activity of mannosidases from various sources and their respective pH
optima. Table 4 summarizes their location.

Table 3. Mannosidases and their pH optimum.
Source Enzyme pH Reference optimum Aspe~gillus saitoi 1,2- a- mannosidase 5.0 Ichishima et al., 1999 Biochem. J. 339(Pt 3):589-597 Trichode~ma reesei 1,2- a- mannosidase 5.0 Maras et al., 2000 J.
Biotechnol. 77(2-3):255-263 Pev~icillium citrinum 1,2-a-D-mannosidase 5.0 Yoshida et al., 1993 Biochem. J. 290(Pt 2):349-354 Aspergillus nidula~cs 1,2- a- mannosidase 6.0 Eades and Hintz, Homo Sapiens 1,2- a- mannosidase 6.0 IA(Golgi) Homo sapiehs 1,2- a- mannosidase6.0 IB

(Golgi) Lepidopte~au Type I 1,2-a-Man6-6.0 Ren et al., 1995 insect cells mannosidase Biochem.

34(8):2489-2495 Homo sapieus a- D-mannosidase 6.0 Chandrasekaran et al., 1984 Cancer Res.

44(9):4059-68 Xanthomonas 1,2,3- a- mannosidase 6.0 mauihotis Mouse IB (Golgi)1,2- a- mannosidase 6.5 Schneikert and Herscovics, 1994 Glycobiology. 4(4):445-Bacillus Sp. 1,2-a-D-mannosidase 7.0 Maruyama et al., (secreted) 1994 Carbohydrate Res. 251:89-98 When one attempts to trim high mannose structures to yield Man5GlcNAc2 in the ER or the Golgi apparatus of S. cerevisiae, one may choose any enzyme or combination of enzymes that (1) has/have a sufficiently close pH optimum (i.e. between pH 5.2 and pH 7.8), and (2) is/are known to generate, alone or in concert, the specific isomeric ManSGIcNAca structure required to accept subsequent addition of GIcNAc by GnT I. Any enzyme or combination of enzymes that has/have shown to generate a structure that can be converted to GIcNAcMan5GlcNAc2 by GnT I
i~ vitro would constitute an appropriate choice. This knowledge may be obtained from the scientific literature or experimentally by determining that a potential mannosidase can convert Man8GlcNAc2-PA to Man5GlcNAc2-PA
and then testing, if the obtained Man5GlcNAc2-PA structure can serve a substrate for GnT I and UDP-GIcNAc to give GIcNAcMan5GlcNAc2 in vitro.
For example, mannosidase IA from a human or marine source would be an appropriate choice.
l, 2-Mav~~cosidase Activity in the ER ahd Golgi Previous approaches to reduce mannosylation by the action of cloned exogenous mannosidases have failed to yield glycoproteins having a sufficient fraction (e.g. >27 mole %) of N glycans having the structure Man5GlcNAc2 (Martinet et al., 1998, and Chiba et al., 1998). These enzymes should function efficiently in ER or Golgi apparatus to be effective in converting nascent glycoproteins. Whereas the two mannosidases utilized in the prior art (from A. saitoi and T. reesei) have pH optima of 5.0, most enzymes that are active in the ER and Golgi apparatus of yeast (e.g. S
cerevisiae) have pH optima that are between 6.5 and 7.5 (see Table 3). Since the glycosylation of proteins is a highly evolved and efficient process, it can be concluded that the internal pH of the ER and the Golgi is also in the range of about 6-8. At pH 7.0, the activity of the mannosidases used in the prior art is reduced to less than 10%, which is insufficient for the efficient production of Man5GlcNAc2 in vivo.

Table 4. Cellular location and pH optima of various glycosylation-related enzymes of S. ce~evisiae.
Gene Activity Location pH Authors) optimum Ktrl a,- 1,2 Golgi 7.0 Romero et al., 1997 mannosyltransferase Biochem. J. 321 (Pt 2):289-295 Mnsl a,- 1,2- mannosidase ER 6.5 CWH41 glucosidase I ER 6.8 -- mannosyltransferase Golgi 7-8 Lehele and Tanner, 1974 Biochim.
Biophys. Acta 350(1):225-235 Kre2 a,- 1,2 Golgi 6.5-9.0 Romero et al., 1997 mannosyltransferase The a-1,2-mannosidase enzyme should have optimal activity at a pH
between 5.1 and 8Ø In a preferred embodiment, the enzyme has an optimal activity at a pH between 5.9 and 7.5. The optimal pH may be determined under in vitro assay conditions. Preferred mannosidases include those listed in Table 3 having appropriate pH optima, e.g. Aspev~gillus nidulahs, Homo Sapiens IA(Golgi), Homo Sapiens IB (Golgi), Lepidopterau insect cells (IPLB-SF21AE), Homo Sapiens, mouse IB (Golgi), andXahthomohas manihotis. In a preferred embodiment, a single cloned mannosidase gene is expressed in the host organism. However, in some cases it may be desirable to express several different mannosidase genes, or several copies of one particular gene, in order to achieve adequate production of Man5GlcNAc2.
In cases where multiple genes are used, the encoded mannosidases should all have pH optima within the preferred range of 5.1 to 8.0, or especially between 5.9 and 7.5. In an especially preferred embodiment mannosidase activity is targeted to the ER or cis Golgi, where the early reactions of glycosylation occur.
Formatio~e of complex N glycans A second step of the process involves the sequential addition of sugars to the nascent carbohydrate structure by engineering the expression of glucosyltransferases into the Golgi apparatus. This process first requires the functional expression of GnT I in the early or medial Golgi apparatus as well as ensuring the sufficient supply of UDP-GIcNAc.
Integration Sites Since the ultimate goal of this genetic engineering effort is a robust protein production strain that is able to perform well in an industrial fermentation process, the integration of multiple genes into the fungal chromosome involves careful planing. The engineered strain will most likely have to be transformed with a range of different genes, and these genes will have to be transformed in a stable fashion to ensure that the desired activity is maintained throughout the fermentation process. Any combination of the following enzyme activities will have to be engineered into the fungal protein expression host: sialyltransferases, mannosidases, fucosyltransferases, galactosyltransferases, glucosyltransferases, GIcNAc transferases, ER and Golgi specific transporters (e.g. sym and antiport transporters for UDP-galactose and other precursors), other enzymes involved in the processing of oligosaccharides, and enzymes involved in the synthesis of activated oligosaccharide precursors such as UDP-galactose, CMP-N-acetylneuraminic acid. At the same time a number of genes which encode enzymes known to be characteristic of non-human glycosylation reactions, will have to be deleted.
Targeting of glycosyltransferases to specific organelles:
Glycosyltransferases and mannosidases line the inner (luminal) surface of the ER and Golgi apparatus and thereby provide a "catalytic"
surface that allows for the sequential processing of glycoproteins as they proceed through the ER and Golgi network. In fact the multiple compartments of the cis, medial, and trans Golgi and the trans-Golgi Network (TGN), provide the different localities in which the ordered sequence of glycosylation reactions can take place. As a glycoprotein proceeds from synthesis in the ER to full maturation in the late Golgi or TGN, it is sequentially exposed to different glycosidases, mannosidases and glycosyltransferases such that a specific carbohydrate structure may be synthesized. Much work has been dedicated to revealing the exact mechanism by which these enzymes are retained and anchored to their respective organelle. The evolving picture is complex but evidence suggests that stem region, membrane spanning region and cytoplasmic tail individually or in concert direct enzymes to the membrane of individual organelles and thereby localize the associated catalytic domain to that locus.
Targeting sequences are well known and described in the scientific literature and public databases, as discussed in more detail below with respect to libraries for selection of targeting sequences and targeted enzymes.
Method for Producing a Library to Produce Modified Glycosylation Pathwavs A library including at least two genes encoding exogeneous glycosylation enzymes is transformed into the host organism, producing a genetically mixed population. Transformants having the desired glycosylation phenotypes are then selected from the mixed population. In a preferred embodiment, the host organism is a yeast, especially P. pasto~is, and the host glycosylation pathway is modified by the operative expression of one or more human or animal glycosylation enzymes, yielding protein N
glycans similar or identical to human glycoforms. In an especially preferred embodiment, the DNA library includes genetic constructs encoding fusions of glycosylation enzymes with targeting sequences for various cellular loci involved in glycosylation especially the ER, cis Golgi, medial Golgi, or trans Golgi.
Examples of modifications to glycosylation which can be effected using method are: (1) engineering an eukaryotic microorganism to trim mannose residues from Man8GlcNAc2 to yield Man5GlcNAc2 as a protein N
glycan; (2) engineering an eukaryotic microorganism to add an N acetylglucosamine (GIcNAc) residue to Man5GlcNAc2 by action of GIcNAc transferase I; (3) engineering an eukaryotic microorganism to functionally express an enzyme such as an N acetylglucosamine transferase (GnT I, GnT II, GnT III, GnT IV, GnT V, GnT VI), mannosidase II, fucosyltransferase, galactosyl tranferase (GaIT) or sialyltransferases (ST).
By repeating the method, increasingly complex glycosylation pathways can be engineered into the target microorganism. In one preferred embodiment, the host organism is transformed two or more times with DNA
libraries including sequences encoding glycosylation activities. Selection of desired phenotypes may be performed after each round of transformation or alternatively after several transformations have occurred. Complex glycosylation pathways can be rapidly engineered in this manner.
DNA Libraries It is necessary to assemble a DNA library including at least two exogenous genes encoding glycosylation enzymes. In addition to the open reading frame sequences, it is generally preferable to provide each library construct with such promoters, transcription terminators, enhancers, ribosome binding sites, and other functional sequences as may be necessary to ensure effective transcription and translation of the genes upon transformation into the host organism. Where the host is Pichia pasto~is, suitable promoters include, for example, the AOXl, AOX~, DAS, and P40 promoters. It is also preferable to provide each construct with at least one selectable marker, such as a gene to impart drug resistance or to complement a host metabolic lesion. The presence of the marker is useful in the subsequent selection of transformants; for example, in yeast the URA3, HIS4, SUC2, 6418, BLA, or SHBLE genes may be used.
In some cases the library may be assembled directly from existing or wild-type genes. In a preferred embodiment however the DNA library is assembled from the fusion of two or more sub-libraries. By the in-frame ligation of the sub-libraries, it is possible to create a large number of novel genetic constructs encoding useful targeted glycosylation activities. For example, one useful sub-library includes DNA sequences encoding any combination of enzymes such as sialyltransferases, mannosidases, fucosyltransferases, galactosyltransferases, glucosyltransferases, and GIcNAc transferases. .Preferably, the enzymes are of human origin, although other mammalian, animal, or fungal enzymes are also useful. In a preferred embodiment, genes are truncated to give fragments encoding the catalytic domains of the enzymes. By removing endogenous targeting sequences, the enzymes may then be redirected and expressed in other cellular loci. The choice of such catalytic domains may be guided by the knowledge of the particular environment in which the catalytic domain is subsequently to be active. For example, if a particular glycosylation enzyme is to be active in the late Golgi, and all known enzymes of the host organism in the late Golgi have a certain pH optimum, then a catalytic domain is chosen which exhibits adequate activity at that pH.
Another useful sub-library includes DNA sequences encoding signal peptides that result in localization of a protein to a particular location within the ER, Golgi, or trans Golgi network. These signal sequences may be selected from the host organism as well as from other related or unrelated organisms. Membrane-bound proteins of the ER or Golgi typically may include, for example, N-terminal sequences encoding a cytosolic tail (ct), a transmembrane domain (tmd), and a stem region (sr). The ct, tmd, and sr sequences are sufficient individually or in combination to anchor proteins to the inner (lumenal) membrane of the organelle. Accordingly, a preferred embodiment of the sub-library of signal sequences includes ct, tmd, and/or sr sequences from these proteins. In some cases it is desirable to provide the sub-library with varying lengths of sr sequence. This may be accomplished by PCR using primers that bind to the 5' end of the DNA encoding the cytosolic region and employing a series of opposing primers that bind to various parts of the stem region. Still other useful sources of signal sequences include retrieval signal peptides, e.g. the tetrapeptides HDEL or KDEL, which are typically found at the C-terminus of proteins that are transported retrograde into the ER or Golgi. Still other sources of signal sequences include (a) type II membrane proteins, (b) the enzymes listed in Table 3, (c) membrane spanning nucleotide sugar transporters that are localized in the Golgi, and (d) sequences referenced in Table 5.
Table 5. Sources of useful compartmental targeting sequences Gene or Sequence Organism Function Location of Gene Product 111nsI S a-1,2-mannosidaseER

cerevisiae OCHI S. 1,6- Golgi (cis) cerevisiae mannosyltransferase MNN2 S. 1,2- Golgi (medial) ce~evisiae mannosyltransferase MNNI S. 1,3- Golgi (trans) cerevisiae mannosyltransferase OCHI P. pastoris1,6- Golgi (cis) mannosyltransferase 2,6 ST H. Sapiens 2,6-sialyltransferasetrans Golgi network UDP-Gal T S. pombe UDP-Gal transporterGolgi Mntl S. 1,2- Golgi (cis) cerevisiae mannosyltransferase HDEL at C- S. retrieval signalER

terminus cerevisiae In any case, it is highly preferred that signal sequences are selected which are appropriate for the enzymatic activity or activities which are to be engineered into the host. For example, in developing a modified microorganism capable of terminal sialylation of nascent N glycans, a process which occurs in the late Golgi in humans, it is desirable to utilize a sub-library of signal sequences derived from late Golgi proteins. Similarly, the trimming of Man8GlcNAca by an a-1,2-mannosidase to give Man5GlcNAc2 is an early step in complex N glycan formation in humans. It is therefore desirable to have this reaction occur in the ER or early Golgi of an engineered host microorganism. A sub-library encoding ER and early Golgi retention signals is used.
In a preferred embodiment, a DNA library is then constructed by the in-frame ligation of a sub-library including DNA encoding signal sequences with a sub-library including DNA encoding glycosylation enzymes or catalytically active fragments thereof. The resulting library includes synthetic genes encoding fusion proteins. In some cases it is desirable to provide a signal sequence at the N-terminus of a fusion protein, or in other cases at the C-terminus. In some cases signal sequences may be inserted within the open reading frame of an enzyme, provided the protein structure of individual folded domains is not disrupted.
The method is most effective when a DNA library transformed into the host contains a large diversity of sequences, thereby increasing the probability that at least one transformant will exhibit the desired phenotype.
Accordingly, prior to transformation, a DNA library or a constituent sub-library may be subjected to one or more rounds of gene shuffling, error prone PCR, or in vitro mutagenesis.
Transformation The DNA library is then transformed into the host organism. In yeast, any convenient method of DNA transfer may be used, such as electroporation, the lithium chloride method, or the spheroplast method. To produce a stable strain suitable for high-density fermentation, it is desirable to integrate the DNA library constructs into the host chromosome. In a preferred embodiment, integration occurs via homologous recombination, using techniques known in the art. For example, DNA library elements are provided with flanking sequences homologous to sequences of the host organism. In this manner integration occurs at a defined site in the host genome, without disruption of desirable or essential genes. In an especially preferred embodiment, library DNA is integrated into the site of an undesired gene in a host chromosome, effecting the disruption or deletion of the gene.
For example, integration into the sites of the OCHl, MNNl, or M1VN4 genes allows the expression of the desired library DNA while preventing the expression of enzymes involved in yeast hypermannosylation of glycoproteins. In other embodiments, library DNA may be introduced into the host via a chromosome, plasmid, retroviral vector, or random integration into the host genome. In any case, it is generally desirable to include with each library DNA construct at least one selectable marker gene to allow ready selection of host organisms that have been stably transformed.
Recyclable marker genes such as u~a3, which can be selected for or against, are especially suitable.
Selection Process After transformation of the host strain with the DNA library, transformants displaying the desired glycosylation phenotype are selected.
Selection may be performed in a single step or by a series of phenotypic enrichment and/or depletion steps using any of a variety of assays or detection methods. Phenotypic characterization may be carried out manually or using automated high-throughput screening equipment. Commonly a host microorganism displays protein N glycans on the cell surface, where various glycoproteins are localized. Accordingly intact cells may be screened for a desired glycosylation phenotype by exposing the cells to a lectin or antibody that binds specifically to the desired N glycan. A wide variety of oligosaccharide-specific lectins are available commercially (EY
Laboratories, San Mateo, CA). Alternatively, antibodies to specific human or animal N glycans are available commercially or may be produced using standaxd techniques. An appropriate lectin or antibody may be conjugated to a reporter molecule, such as a chromophore, fluorophore, radioisotope, or an enzyme having a chromogenic substrate (Guillen et al., 1998. P~oc.
Natl.Acad. Sci. USA 95(14): 7888-7892). Screening may then be performed using analytical methods such as spectrophotometry, fluorimetry, fluorescence activated cell sorting, or scintillation counting. In other cases, it may be necessary to analyze isolated glycoproteins or N glycans from transformed cells. Protein isolation may be carried out by techniques known in the art. In cases where an isolated N glycan is required, an enzyme such as endo-(3-N acetylglucosaminidase (Genzyme Co., Boston, MA) may be used to cleave the N glycans from glycoproteins. Isolated proteins or N glycans may then be analyzed by liquid chromatography (e.g. HPLC), mass spectroscopy, or other suitable means. U.S. Patent No. 5,595,900 teaches several methods by which cells with desired extracellular carbohydrate structures may be identified. Prior to selection of a desired transformant, it may be desirable to deplete the transformed population of cells having undesired phenotypes. For example, when the method is used to engineer a functional mannosidase activity into cells, the desired transformants will have lower levels of mannose in cellular glycoprotein.
Exposing the transformed population to a lethal radioisotope of mannose in the medium depletes the population of transformants having the undesired phenotype, i.e. high levels of incorporated mannose. Alternatively, a cytotoxic lectin or antibody, directed against an undesirable N glycan, may be used to deplete a transformed population of undesired phenotypes.
Methods for Providing Sugar Nucleotide Precursors to the Gobi Apparatus For a glycosyltransferase to function satisfactorily in the Golgi, it is necessary for the enzyme to be provided with a sufficient concentration of an appropriate nucleotide sugar, which is the high-energy donor of the sugar moiety added to a nascent glycoprotein. These nucleotide sugars to the appropriate compartments are provided by expressing an exogenous gene encoding a sugar nucleotide transporter in the host microorganism. The choice of transporter enzyme is influenced by the nature of the exogenous glycosyltransferase being used. For example, a GIcNAc transferase may require a UDP-GIcNAc transporter, a fucosyltransferase may require a GDP-fucose transporter, a galactosyltransferase may require a UDP-galactose transporter, or a sialyltransferase may require a CMP-sialic acid transporter.
The added transporter protein conveys a nucleotide sugar from the cytosol into the Golgi apparatus, where the nucleotide sugar may be reacted by the glycosyltransferase, e.g. to elongate an N glycan. The reaction liberates a nucleoside diphosphate or monophosphate, e.g. UDP, GDP, or CMP. As accumulation of a nucleoside diphosphate inhibits the further activity of a glycosyltransferase, it is frequently also desirable to provide an expressed copy of a gene encoding a nucleotide diphosphatase. The diphosphatase (specific for UDP or GDP as appropriate) hydrolyzes the diphosphonucleoside to yield a nucleoside monosphosphate and inorganic phosphate. The nucleoside monophosphate does not inhibit the glycotransferase and in any case is exported from the Golgi by an endogenous cellular system. Suitable transporter enzymes, which are typically of mammalian origin, are described below.
Examples The use of the above general method may be understood by reference to the following non-limiting examples. Examples of preferred embodiments are also summarized in Table 6.
Example 1: Engineering of P. pastoris with a-1,2-Mannosidase to produce insulin.
An a-1,2-mannosidase is required for the trimming of Man8GlcNAc2 to yield ManSGIcNAc~,, an essential intermediate for complex N glycan formation. An OCHI mutant of P. pasto~is is engineered to express secreted human interferon-a under the control of an aox promoter. A DNA library is constructed by the in-frame ligation of the catalytic domain of human mannosidase IB (an a-1,2-mannosidase) with a sub-library including sequences encoding early Golgi localization peptides. The DNA library is then transformed into the host organism, resulting in a genetically mixed population wherein individual transformants each express interferon-(3 as well as a synthetic mannosidase gene from the library. Individual transformant colonies are cultured and the production of interferon is induced by addition of methanol. Under these conditions, over 90% of the secreted protein includes interferon-/3. Supernatants are purified to remove salts and low-molecular weight contaminants by C18 silica reversed-phase chromatography. Desired transformants expressing appropriately targeted, active a-1,2-mannosidase produce interferon-(3 including N glycans of the structure Man5GlcNAc2, which has a reduced molecular mass compared to the interferon of the parent strain. The purified supernatants including interferon-(3 are analyzed by MALDI-TOF mass spectroscopy and colonies expressing the desired form of interferon-(3 are identified.
Example 2: Engineering of Strain to express GIcNAc Transferase I
GIcNAc Transferase I activity is required for the maturation of complex N glycans. Man5GlcNAc2 may only be trimmed by mannosidase II, a necessary step in the formation of human glycoforms, after the addition of GIcNAc to the terminal a-1,3 mannose residue by GIcNAc Transferase I
(Schachter, 1991 Glycobiology 1(5):453-461). Accordingly a library is prepared including DNA fragments encoding suitably targeted GIcNAc Transferase I genes. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g. an OCHI mutant), provides the substrate UDP-GIcNAc in the Golgi and/or ER, and provides N glycans of the structure Man5GlcNAca in the Golgi and/or ER. After transformation of the host with the DNA library, the transformants are screened for those having the highest concentration of terminal GIcNAc on the cell surface, or alternatively secrete the protein having the highest terminal GIcNAc content.
Such a screen is performed using a visual method (e.g. a staining procedure), a specific terminal GIcNAc binding antibody, or a lectin. Alternatively the desired transformants exhibit reduced binding of certain lectins specific for terminal mannose residues.
Example 3: Engineering of Strains with a Mannosidase II
In another example, it is desirable in order to generate a human glycoform in a microorganism to remove the two remaining terminal mannoses from the structure GIcNAcMan5GlcNAc2 by action of a mannosidase II. A DNA library including sequences encoding cis and medial Golgi localization signals is fused in-frame to a library encoding mannosidase II catalytic domains. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g. an OCHI mutant) and provides N glycans having the structure GIcNAcMan5GlcNAca in the Golgi and/or ER. After transformation, organisms having the desired glycosylation phenotype are selected. An i~ vitro assay is used in one method. The desired structure GIcNAcMan3GlcNAc2 (but not the undesired GIcNAcMan5GlcNAc2) is a substrate for the enzyme GIcNAc Transferase II.
Accordingly, single colonies may be assayed using this enzyme in vitro in the presence of the substrate, UDP-GIcNAc. The release of UDP is determined either by HPLC or an enzymatic assay for UDP. Alternatively radioactively labeled UDP-GIcNAc is used.
The foregoing in vitro assays are conveniently performed on individual colonies using high-throughput screening equipment.
Alternatively a lectin binding assay is used. In this case the reduced binding of lectins specific for terminal mannoses allows the selection of transformants having the desired phenotype. For example, Galantus nivalis lectin binds specifically to terminal a-1,3-mannose, the concentration of which is reduced in the presence of operatively expressed mannosidase II
activity. In one suitable method, G. nivalis lectin attached to a solid agarose support (available from Sigma Chemical, St. Louis, MO) is used to deplete the transformed population of cells having high levels of terminal a-1,3-mannose.
Example 4: Engineering of organisms to express Sialyltransferase The enzymes a2,3-sialyltransferase and a2,6-sialyltransferase add terminal sialic acid to galactose residues in nascent human N glycans, leading to mature glycoproteins. In human the reactions occur in the trans Golgi or TGN. Accordingly a DNA library is constructed by the in-frame fusion of sequences encoding sialyltransferase catalytic domains with sequences encoding trans Golgi or TGN localization signals. The host organism is a strain, e.g. a yeast, that is deficient in hypermannosylation (e.g.
an OCHI mutant), which provides N glycans having terminal galactose residues in the trans Golgi or TGN, and provides a sufficient concentration of CMP-sialic acid in the trans Golgi or TGN. Following transformation, transformants having the desired phenotype are selected using a fluorescent antibody specific for N glycans having a terminal sialic acid.

Example 5: Method of engineering strains to express UDP-GIcNAc Transporter The cDNA of human Golgi UDP-GIcNAc transporter has been cloned by Ishida and coworkers. (Isluda, N., et al. 1999 J. Biochem.126(1):
68-77. Guillen and coworkers have cloned the canine kidney Golgi UDP-GIcNAc transporter by phenotypic correction of a Kluyve~omyces lactis mutant deficient in Golgi UDP-GIcNAc transport. (Guillen, E., et al. 1998).
Thus a mammalian Golgi UDP-GIcNAc transporter gene has all of the necessary information for the protein to be expressed and targeted functionally to the Golgi apparatus of yeast.
Example 6: Method of engineering strains to express GDP-Fucose Transporter.
The rat liver Golgi membrane GDP-fucose transporter has been identified and purified by Puglielli, L. and C. B. Hirschberg 1999 J. Biol.
Chem. 274(50):35596-35600. The corresponding gene can be identified using standard techniques, such as N terminal sequencing and Southern blotting using a degenerate DNA probe. The intact gene can is then be expressed in a host microorganism that also expresses a fucosyltransferase.
Example 7: Method of engineering strains to express UDP-Galactose Transporter Human UDP-galactose (UDP-Gal) transporter has been cloned and shown to be active in S. cerevisiae. (Kainuma, M., et al. 1999 Glycobiology 9(2): 133-141). A second human UDP-galactose transporter (hUGTl) has been cloned and functionally expressed in Chinese Hamster Ovary Cells.
Aoki, K., et al. 1999 J.Biochem. 126(5): 940-950. Likewise Segawa and coworkers have cloned a UDP-galactose transporter from Schizosaccharomyces pombe (Segawa, H., et al. 1999 Febs Letters 451(3):
295-298).
CMP-Sialic Acid Transporter Human CMP-sialic acid transporter (hCST) has been cloned and expressed in Lec 8 CHO cells by Aoki and coworkers (1999). Molecular cloning of the hamster CMP-sialic acid transporter has also been achieved (Eckhardt and Gerardy Schahn 1997 Eur. J. Biochem. 248(1): 187-192). The functional expression of the marine CMP-sialic acid transporter was achieved in Saccharomyces cerevisiae by Berninsone, P., et al. 1997 J.
Biol. Chem.272(19):12616-12619.
Table6. Examples of preferred embodiments of the methods for modifying glycosylation in a eukaroytic microorganism, e.g. Pichia pastoris Desired Suitable Suitable Sources of Suitable Suitable Structure Catalytic Localization Gene Transporters Activities Sequences Deletions andlor Phosphatases Man5GlcNAca a-1,2- Mnsl (N-terminus, OCH1 none mannosidase S cerevisiae) MNN4 (marine, Ochl (N-terminus, MNN6 human, S. cerevisiae, Bacillus sp., P. pastoris) A. nidulans ) Ktrl Mnn9 Mntl (S. cerevisiae) KDEL, HDEL

(C-terminus) GIcNAcManSGlc GIcNAc Ochl (N-terminus, OCH1 UDP-GIcNAc NAc2 Transferase S cerevisiae, MNN4 transporter I, (human, P. pastoris) MNN6 (human, marine, rat KTRl (N-terminus) marine, etc.) KDEL, HDEL K. lactis) (C-terminus) UDPase Mnnl (N-terminus, (human) S cerevisiae) Mntl (N-terminus, S. cerevisiae) GDPase (N-terminus, S. cerevisiae) GlcNAcMan3Glc mannosidaseKtrl OCH1 UDP-GIcNAc NAc2 II Mnnl (N-terminus,MNN4 transporter S ce~evisiae) MNN6 (human, Mntl (N-terminus, marine, S cerevisiae) K. lactic) Kre2/Mntl UDPase (S ce~evisiae) (human) Kre2 (P. pasto~is) Ktrl (S cerevisiae) Ktrl (P. pasto~is) Mnnl (S ee~evisiae) GIcNAc~2_4~ GIcNAc Mnnl (N-terminus,OCH1 UDP-GIcNAc Man3GlcNAc2 TransferaseS. cerevisiae) MNN4 transporter II, III, Mntl (N-terminus,MNN6 (human, IV, V

(human, S. ce~evisiae) marine, marine) Kre2/Mntl K.lactis) (S. ce~evisiae) UDPase Kre2 (P. pasto~is) (human) Ktrl (S. cerevisiae) Ktr1 (P. pastoris) Nlim1 (S cerevisiae) Gal~l_4~Glc (3-1,4- Mnnl (N-terminus,OCH1 UDP-Galactos NAct2_4~- Galactosyl S ce~evisiae) MNN4 a transporter ~

Man3GlcNAca transferaseMntl(N-terminus,MNN6 (human, (human) S ce~evisiae) S pombe) Kre2/Mntl (S cerevisiae) Kre2 (P. pastoris) Ktrl (S cerevisiae) Ktrl (P. pastoris) Mnnl (S. cerevisiae) NANAtI_4>- oc-2,6- KTRl OCH1 CMP-Sialic Gal~l_4~GlcNAc~2_SialyltransferMNN1 (N-terminus,MNN4 acid a~- ace (human)S cerevisiae) MNN6 transporter Man3GlcNAc2 a,-2,3- MNT1 (N-terminus, (human) SialyltransferS cerevisiae) ace Kre2/Mntl (S ce~evisiae) Kre2 (P. pasto~is) Ktrl (S. ce~evisiae) Ktrl (P. pasto~is) (S. cerevisiae) Table 7: DNA and Protein Sequence Resources 1. European Bioinformatics Institute (EBI) is a centre for research and services in bioinformatics: httb://www.ebi.ac.ul~/
2. Swissprot database: http://www.expasy.ch/spr 3. List of known glycosyltransferases and their origin.
X31,2 (GnT Il EC 2.4.1.101 4. human cDNA, Kumar et al (1990) Proc. Natl. Acad. Sci. USA
87:9948-9952 5. human gene, Hull et al (1991) Biochem. Biophys. Res. Commun.
176:608-615 6. mouse cDNA, Kumar et al (1992) Glycobiology 2:383-393 7. mouse gene, Pownall et al (1992) Genomics 12:699-704 8. marine gene (5' flanking, non-coding), Yang et al (1994) Glycobiology 5:703-712 9. rabbit cDNA, Sarkar et al (1991) Proc. Natl. Acad. Sci. USA 88:234-10. rat cDNA, Fukada et al (1994) Biosci.Biotechnol.Biochem. 58:200-1 2 (GnT II) EC 2.4.1.143 11. human gene, Tan et al (1995) Eur. J. Biochem. 231:317-328 12. rat cDNA, D'Agostaro et al (1995) J. Biol. Chem. 270:15211-15221 13. [31,4 (GnT III) EC 2.4.1.144 14. human cDNA, Ihara et al (1993) J. Biochem.l 13:692-698 15. marine gene, Bhaumik et al (1995) Gene 164:295-300 16. rat cDNA, Nishikawa et al (1992) J. Biol. Chem. 267:18199-18204 ~ 1,4 (GnT IV SEC 2.4.1.145 17. human cDNA, Yoshida et al (1998) Glycoconjugate Journal 15:1115-18. bovine cDNA, Minowa et al., European Patent EP 0 905 232 ~ (31,6 (GnT V) EC 2.4.1.155 19. human cDNA, Saito et al (1994) Biochem. Biophys. Res. Commun.
198:318-327 20. rat cDNA, Shoreibah et al (1993) J. Biol. Chem. 268:15381-15385 i1,4 Galactosyltransferase, EC 2.4.1.90 (LacNAc synthetas~ EC
2.4.1.22 (lactose synthetase) 21. bovine cDNA, D'Agostaro et al (1989) Eur. J. Biochem. 183:211-217 22. bovine cDNA (partial), Narimatsu et al (1986) Proc. Natl. Acad. Sci.
USA 83:4720-4724 23. bovine cDNA (partial), Masibay & Qasba (1989) Proc. Natl. Acad.
Sci. USA 86:5733-5377 24. bovine cDNA (5' end), Russo et al (1990) J. Biol. Chem. 265:3324 25. chicken cDNA (partial), Ghosh et al (1992) Biochem. Biophys. Res.
Commun. 12 I 5-1222 26. human cDNA, Masri et al (1988) Biochem. Biophys. Res. Commun.
157:657-663 27. human cDNA, (HeLa cells) Watzele & Berger (1990) Nucl. Acids Res. 18:7174 28. human cDNA, (partial) Uejima et al (1992) Cancer Res. 52:6158-29. human cDNA, (carcinoma) Appert et al (1986) Biochem. Biophys.
Res. Commun. 139:163-168 30. human gene, Mengle-Gaw et al (1991) Biochem. Biophys. Res.
Commun. 176:1269-1276 31. marine cDNA, Nakazawa et al (1988) J. Biochem. 104:165-168 32. marine cDNA, Shaper et al (1988) J. Biol. Chem. 263:10420-10428 33. marine cDNA (novel), Uehara & Muramatsu unpublished 34. marine gene, Hollis et al (1989) Biochem. Biophys. Res. Commun.
162:1069-1075 35. rat protein (partial), Bendiak et al (1993) Eur. J. Biochem. 216:405-2,3-Sialyltransferase, (ST3Ga1 II) (N linked~(Gal-1,3/4-GIcNAc) EC
2.4.99.6 36. human cDNA, Kitagawa & Paulson (1993) Biochem. Biophys. Res.
Commun. 194:375-3 82 37. rat cDNA, Wen et al (1992) J. Biol. Chem. 267:21011-21019 2 6-Sialyltransferase, (ST6Ga1 I) EC 2.4.99.1 38. chicken, Kurosawa et al (1994) Eur. J. Biochem 219:375-381 39. human cDNA (partial), Lance et al (1989) Biochem. Biophys. Res.
Commun. 164:225- 232 40. human cDNA, Grundmann et al (1990) Nucl. Acids Res. 18:667 41. human cDNA, Zettlmeisl et al (1992) Patent EP0475354-A/3 42. human cDNA, Stamenkovic et al (1990) J. Exp. Med. 172:641-643 (CD75) 43. human cDNA, Bast et al (1992) J. Cell Biol. 116:423-435 44. human gene (partial), Wang et al (1993) J. Biol. Chem. 268:4355-45. human gene (5' flank), Aasheim et al (1993) Eur. J. Biochem.
213:467-475 46. human gene (promoter), Aas-Eng et al (1995) Biochim. Biophys.
Acta 1261:166-169 47. mouse cDNA, Hamamoto et al (1993) Bioorg. Med. Chem. 1:141-48. rat cDNA, Weinstein et al (1987) J. Biol. Chem. 262:17735-17743 49. rat cDNA (transcript fragments), Wang et al (1991),Glycobiology 1:25-31, Wang et al (1990) J. Biol. Chem. 265:17849-17853 50. rat cDNA (5' end), O'Hanlon et al (1989) J. Biol. Chem. 264:17389-17394; Wang et al (1991) Glycobiology 1:25-31 51. rat gene (promoter), Svensson et al (1990) J. Biol. Chem. 265:20863-52. rat mRNA (fragments), Wen et al (1992) J. Biol. Chem. 267:2512-Additional methods and reagents which can be used in the methods for modifying the glycosylation are described in the literature, such as IJ.S.

Patent No. 5,955,422, U.S. Patent No. 4,775,622, U.S. Patent No. 6,017,743, U.S. Patent No. 4,925,796, U.S. Patent No. 5,766,910, U.S. Patent No.
5,834,251, U.S. Patent No. 5,910,570, U.S. Patent No. 5,849,904, U.S.
Patent No. 5,955,347, U.S. Patent No. 5,962,294, U.S. Patent No. 5,135,854, U.S. Patent No. 4,935,349, U.S. Patent No. 5,707,828, and U.S. Patent No.
5,047,335.
Appropriate yeast expression systems can be obtained from sources such as the American Type Culture Collection, Rockville, MD. Vectors are commercially available from a variety of sources.

Claims (34)

I claim:
1. A method for producing glycoproteins having carbohydrate structures similar to those produced by human cells in a lower eukaryote comprising providing a unicellular or multicellular fungal host, which does not express one or more enzymes involved in production of high mannose structures, and introducing into the host one or more enzymes for production of a carbohydrate structure selected from the group consisting of Man5GlcNAc2, Man8GlcNAc2 and Man9GlcNAc2, wherein the enzymes are selected to have optimal activity at the pH of the location in the host where the carbohydrate structure is produced or which are targeted to a subcellular location in the host where enzyme will have optimal activity to produce the carbohydrate structure.
2. The method of claim 1 wherein the host is deficient in the activity of one or more enzymes selected from the group consisting of mannosyltransferases and phosphomannosyltransferases.
3. The method of claim 2 wherein the host does not express an enzyme selected from the group consisting of 1,6 mannosyltransferase, 1,3 mannosyltransferase, and 1,2 mannosyltransferase.
4. The method of claim 1 wherein the host is selected from the group consisting of Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces sp., Candida albicans, Aspergillus nidulans, and Trichoderma reesei.
5. The method of claim 2 wherein the host is an OCH1 mutant of P.pastoris.
6. The method of claim 1 comprising introducing into the host a nucleotide molecule encoding one or more mannosidases involved in the production of Man5GlcNAc2 from Man8GlcNAc2 or Man9GlcNAc2.
7. The method of claim 6 where the at least one mannosidase has a pH optimum within 1.4 pH units of the average pH optimum of other representative enzymes in the organelle in which the mannosidase is localized, or having optimal activity at a pH between 5.1 and 8Ø
8. The method of claim 7 wherein the mannosidase enzyme has optimal activity at a pH between 5.9 and 7.5.
9. The method of claim 8 wherein the mannosidase enzyme is an .alpha.-1,2-mannosidase derived from mouse, human, Lepidoptera, Aspergillus nidulans, or Bacillus sp.
10. The method of claim 1 comprising providing a host that is able to form Man5GlcNAc2 structures, displaying GnT I activity and having UDP-Gn transporter activity.
11. The method of claim 1 comprising providing a host which has a UDP specific diphosphatase activity.
12. The method of claim 1 comprising introducing into the host one or more enzymes selected from the group consisting of mannosidases, glycosyltransferases and glycosidases, wherein the enzymes are targeted to the endoplasmic reticulum, the early, medial, late Golgi or the trans Golgi network.
13. The method of claim 12 wherein the mannosidase enzyme is predominantly localized in the Golgi apparatus or the endoplasmic reticulum.
14. The method of claim 12 wherein the enzymes are localized by forming a fusion protein between a catalytic domain of the enzyme and a chimeric localization region encoded by at least one genetic construct formed by the in-frame ligation of a DNA fragment encoding a cellular targeting signal peptide with a DNA fragment encoding a glycosylation enzyme or catalytically active fragment thereof
15. The method of claim 14 comprising providing a chimeric localization region from an enzyme selected from the group of mannosyltransferases, diphosphotases, proteases, GnT I, GnT II, GnT III, GnT
IV, GnT V, GnT VI, GalT, FT, and ST.
16. The method of claim 14 providing a catalytic domain encoding a glycosidase or glycosyltransferase selected from the group consisting of GnT
I, GnT II, GnT III, GnT IV, GnT V, GnT VI, GaIT, Fucosyltransferase and ST, that has a pH optimum within 1.4 pH units of the average pH optimum of other representative enzymes in the organelle in which the enzyme is localized, or having optimal activity at a pH between 5.1 and 8Ø
17. The method of claim 1 comprising introducing into the host nucleotide molecules encoding one or more enzymes selected from the group of nucleoside sugar transporters consisting of UDP-GlcNAc transferase, UDP-galactosyltransferase, GDP-fucosyltransferase, CMP-sialyltransferase, UDP-GlcNAc transporter, UDP-galactose transporter, GDP-fucose transporter, CMP-sialic acid transporter, and nucleotide diphosphatases.
18. The method of claim 17 comprising genetically engineering the fungal strain to remove UDP or GDP by action of a diphosphatase.
19. The method of claim 1 wherein the glycoprotein includes N-glycans of which greater than 27 mole percent comprise fewer than six mannose residues.
20. The method of claim 1 wherein the glycoprotein comprises one or more sugars selected from the group consisting of galactose, sialic acid, and fucose.
21. The method of claim 1 wherein the glycoprotein comprises at least one oligosaccharide branch comprising the structure NeuNAc-Gal-GlcNAc-Man.
22. The method of claim 1 wherein the glycoprotein comprises N-glycans having fewer than four mannose residues.
23. The method of claim 1 wherein subsequent to isolation from the host, the glycoprotein is subjected to at least one further glycosylation or carboxylation reaction in vitro.
24. The method of claim 1 comprising the steps of (a) providing a DNA library comprising at least two genes encoding exogenous glycosylation enzymes;
(b) transforming the host with the library to produce a genetically mixed population expressing at least two distinct exogenous glycosylation enzymes;
and (c) selecting from the population a host producing the desired glycosylation phenotype.
25. The method of claim 24 wherein the host is transformed two or more times with the library prior to the selection of a desired glycosylation phenotype.
26. The method of claim 24 wherein the library comprises at least one wild-type gene encoding a glycosylation enzyme.
27. The method of claim 24 wherein the library comprises at least one synthetic gene encoding a glycosylation enzyme.
28. The method of claim 24 wherein the library comprises at least one gene previously subjected to a technique selected from the list: gene shuffling, in vitro mutagenesis, and error-prone polymerase chain reaction.
29. The method of claim 24 wherein the library comprises at least one genetic construct formed by the in-frame ligation of a DNA fragment encoding a cellular targeting signal peptide with a DNA fragment encoding a glycosylation enzyme or catalytically active fragment thereof.
30. The method of claim 29 wherein a DNA fragment encodes an activity selected from the group consisting of mannosidase, UDP-GlcNAc transferase, UDP-galactosyltransferase, and CMP-sialyltransferase and the cellular targeting signal peptide is predominantly localizes the enzyme in an organelle selected from the group consisting of endoplasmic reticulum, cis Golgi, medial Golgi, and trans Golgi.
31. The method of claim 24 wherein the selection comprises the step of analyzing a glycosylated protein or isolated N-glycan by one or more methods selected from the group consisting of mass spectroscopy, liquid chromatography, characterizing cells using a fluorescence activated cell sorter, spectrophotometer, fluorimeter, or scintillation counter, exposing host cells to a lectin or antibody having a specific affinity for a desired oligosaccharide moiety, and exposing cells to a cytotoxic or radioactive molecule selected from the group consisting of sugars, antibodies, and lectins.
32. The host produced by the method of any of claims 1-31.
33. The glycoprotein produced by the method of any of claims 1-31.
34. The library of claims 24-30.
CA002412701A 2000-06-28 2001-06-27 Methods for producing modified glycoproteins Abandoned CA2412701A1 (en)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US21435800P 2000-06-28 2000-06-28
US60/214,358 2000-06-28
US21563800P 2000-06-30 2000-06-30
US60/215,638 2000-06-30
US27999701P 2001-03-30 2001-03-30
US60/279,997 2001-03-30
PCT/US2001/020553 WO2002000879A2 (en) 2000-06-28 2001-06-27 Methods for producing modified glycoproteins

Publications (1)

Publication Number Publication Date
CA2412701A1 true CA2412701A1 (en) 2002-01-03

Family

ID=27395978

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002412701A Abandoned CA2412701A1 (en) 2000-06-28 2001-06-27 Methods for producing modified glycoproteins

Country Status (15)

Country Link
US (13) US7029872B2 (en)
EP (5) EP2322644A1 (en)
JP (2) JP2004501642A (en)
KR (1) KR100787073B1 (en)
AT (2) ATE440959T1 (en)
AU (2) AU2001276842B2 (en)
CA (1) CA2412701A1 (en)
CY (1) CY1109639T1 (en)
DE (2) DE60114830T2 (en)
DK (2) DK1297172T3 (en)
ES (2) ES2252261T3 (en)
MX (1) MXPA03000105A (en)
NZ (1) NZ523476A (en)
PT (1) PT1522590E (en)
WO (1) WO2002000879A2 (en)

Families Citing this family (470)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5545553A (en) * 1994-09-26 1996-08-13 The Rockefeller University Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
DK1137789T3 (en) 1998-12-09 2010-11-08 Phyton Holdings Llc Process for preparing a glycosylation of human type glycosylation
NZ518532A (en) 1999-10-26 2004-02-27 Plant Res Internat B Transgenic plant expressing mammalian beta-1,4- galactosyltransferase
US7198921B2 (en) * 2000-05-17 2007-04-03 Mitsubishi Pharma Corporation Process for producing protein with reduction of acidic sugar chain and glycoprotein produced thereby
US7598055B2 (en) * 2000-06-28 2009-10-06 Glycofi, Inc. N-acetylglucosaminyltransferase III expression in lower eukaryotes
US7795002B2 (en) 2000-06-28 2010-09-14 Glycofi, Inc. Production of galactosylated glycoproteins in lower eukaryotes
US20060024304A1 (en) * 2000-06-28 2006-02-02 Gerngross Tillman U Immunoglobulins comprising predominantly a Man5GlcNAc2 glycoform
US20060034828A1 (en) * 2000-06-28 2006-02-16 Gerngross Tillman U Immunoglobulins comprising predominantly a GlcNAcMAN5GLCNAC2 glycoform
US7863020B2 (en) * 2000-06-28 2011-01-04 Glycofi, Inc. Production of sialylated N-glycans in lower eukaryotes
US20060029604A1 (en) * 2000-06-28 2006-02-09 Gerngross Tillman U Immunoglobulins comprising predominantly a GlcNAc2Man3GlcNAc2 glycoform
US7449308B2 (en) 2000-06-28 2008-11-11 Glycofi, Inc. Combinatorial DNA library for producing modified N-glycans in lower eukaryotes
US20060034830A1 (en) * 2000-06-28 2006-02-16 Gerngross Tillman U Immunoglobulins comprising predominantly a GalGlcNAcMan5GLcNAc2 glycoform
EP2322644A1 (en) * 2000-06-28 2011-05-18 GlycoFi, Inc. Methods for producing modified glycoproteins
US7625756B2 (en) 2000-06-28 2009-12-01 GycoFi, Inc. Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells
US8697394B2 (en) 2000-06-28 2014-04-15 Glycofi, Inc. Production of modified glycoproteins having multiple antennary structures
EP1294910B1 (en) 2000-06-30 2008-11-19 VIB vzw Protein glycosylation modification in pichia pastoris
WO2002051438A2 (en) 2000-12-22 2002-07-04 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Use of repulsive guidance molecule (rgm) and its modulators
CN100385006C (en) 2001-01-19 2008-04-30 陶氏化学公司 Method for secretory production of glycoprotein having human-type sugar chain using plant cell
TWI377253B (en) 2001-04-16 2012-11-21 Martek Biosciences Corp Product and process for transformation of thraustochytriales microorganisms
US7125843B2 (en) 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
US7399613B2 (en) * 2001-10-10 2008-07-15 Neose Technologies, Inc. Sialic acid nucleotide sugars
US7179617B2 (en) 2001-10-10 2007-02-20 Neose Technologies, Inc. Factor IX: remolding and glycoconjugation of Factor IX
US7795210B2 (en) 2001-10-10 2010-09-14 Novo Nordisk A/S Protein remodeling methods and proteins/peptides produced by the methods
US7297511B2 (en) * 2001-10-10 2007-11-20 Neose Technologies, Inc. Interferon alpha: remodeling and glycoconjugation of interferon alpha
US7439043B2 (en) * 2001-10-10 2008-10-21 Neose Technologies, Inc. Galactosyl nucleotide sugars
US7226903B2 (en) 2001-10-10 2007-06-05 Neose Technologies, Inc. Interferon beta: remodeling and glycoconjugation of interferon beta
DK1578771T3 (en) * 2001-10-10 2013-06-10 Novo Nordisk As Remodeling and glycoconjugation of peptides
US7157277B2 (en) * 2001-11-28 2007-01-02 Neose Technologies, Inc. Factor VIII remodeling and glycoconjugation of Factor VIII
US8008252B2 (en) * 2001-10-10 2011-08-30 Novo Nordisk A/S Factor VII: remodeling and glycoconjugation of Factor VII
US7173003B2 (en) 2001-10-10 2007-02-06 Neose Technologies, Inc. Granulocyte colony stimulating factor: remodeling and glycoconjugation of G-CSF
US7214660B2 (en) 2001-10-10 2007-05-08 Neose Technologies, Inc. Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7265084B2 (en) * 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycopegylation methods and proteins/peptides produced by the methods
EP2322229B1 (en) 2001-10-10 2016-12-21 Novo Nordisk A/S Remodeling and glycoconjugation of Factor IX
US7265085B2 (en) * 2001-10-10 2007-09-04 Neose Technologies, Inc. Glycoconjugation methods and proteins/peptides produced by the methods
US7696163B2 (en) 2001-10-10 2010-04-13 Novo Nordisk A/S Erythropoietin: remodeling and glycoconjugation of erythropoietin
US7473680B2 (en) * 2001-11-28 2009-01-06 Neose Technologies, Inc. Remodeling and glycoconjugation of peptides
US20060024292A1 (en) * 2001-12-27 2006-02-02 Gerngross Tillman U Immunoglobulins comprising predominantly a Gal2GlcNAc2Man3GlcNAc2 glycoform
MXPA04006357A (en) 2001-12-27 2005-03-31 Glycofi Inc Methods to engineer mammalian-type carbohydrate structures.
US20060034829A1 (en) * 2001-12-27 2006-02-16 Gerngross Tillman U Immunoglobulins comprising predominantly a MAN3GLCNAC2 glycoform
US6964784B2 (en) * 2002-03-07 2005-11-15 Optigenex, Inc. Method of preparation and composition of a water soluble extract of the bioactive component of the plant species uncaria for enhancing immune, anti-inflammatory, anti-tumor and dna repair processes of warm blooded animals
AU2003219418B2 (en) * 2002-03-19 2008-02-28 Stichting Dienst Landbouwkundig Onderzoek Optimizing glycan processing in plants
NZ546945A (en) 2002-03-19 2008-04-30 Plant Res Int Bv A plant host cell system for the expression of human GnTIII
US7972809B2 (en) 2002-04-26 2011-07-05 National Institute Of Advanced Industrial Science & Technology Methylotrophic yeast producing mammalian type sugar chain
MXPA04012496A (en) 2002-06-21 2005-09-12 Novo Nordisk Healthcare Ag Pegylated factor vii glycoforms.
US7252933B2 (en) * 2002-06-26 2007-08-07 Flanders Interuniversity Institute For Biotechnology Protein glycosylation modification in methylotrophic yeast
KR20040004089A (en) * 2002-06-29 2004-01-13 한국생명공학연구원 Hansenula polymorpha mutant strains with defect in outer chain biosynthesis and the production of recombinant glycoproteins using the same strains
AU2003263717A1 (en) * 2002-09-25 2004-04-19 Astrazeneca Ab A COMBINATION OF A LONG-ACTING Beta2-AGONIST AND A GLUCOCORTICOSTEROID IN THE TREATMENT OF FIBROTIC DISEASES
AR042145A1 (en) 2002-11-27 2005-06-08 Dow Agrociences Llc IMMUNOGLOBULIN PRODUCTION IN PLANTS WITH A REDUCED FUCOCILATION
RU2407796C2 (en) * 2003-01-22 2010-12-27 Гликарт Биотекнолоджи АГ FUSION DESIGNS AND THEIR APPLICATION FOR PRODUCING ANTIBODIES WITH HIGH BINDING AFFINITY OF Fc-RECEPTOR AND EFFECTOR FUNCTION
PL222219B1 (en) 2003-01-22 2016-07-29 Glycart Biotechnology Ag Host cells, method for producing a polypeptide, antibody, pharmaceutical composition and method for treating cancer
DE10303974A1 (en) 2003-01-31 2004-08-05 Abbott Gmbh & Co. Kg Amyloid β (1-42) oligomers, process for their preparation and their use
AU2012227297B2 (en) * 2003-02-20 2013-11-14 Glycofi, Inc. Combinatorial DNA Library for Producing Modified N-Glycans in Lower Eukaryotes
US7332299B2 (en) 2003-02-20 2008-02-19 Glycofi, Inc. Endomannosidases in the modification of glycoproteins in eukaryotes
NZ542094A (en) 2003-03-14 2008-12-24 Neose Technologies Inc Branched polymer conjugates comprising a peptide and water-soluble polymer chains
US7691603B2 (en) * 2003-04-09 2010-04-06 Novo Nordisk A/S Intracellular formation of peptide conjugates
SG155777A1 (en) 2003-04-09 2009-10-29 Neose Technologies Inc Glycopegylation methods and proteins/peptides produced by the methods
WO2007022512A2 (en) * 2005-08-19 2007-02-22 Neose Technologies, Inc. Glycopegylated factor vii and factor viia
WO2006127896A2 (en) 2005-05-25 2006-11-30 Neose Technologies, Inc. Glycopegylated factor ix
US8791070B2 (en) 2003-04-09 2014-07-29 Novo Nordisk A/S Glycopegylated factor IX
EP1624847B1 (en) 2003-05-09 2012-01-04 BioGeneriX AG Compositions and methods for the preparation of human growth hormone glycosylation mutants
WO2005012484A2 (en) 2003-07-25 2005-02-10 Neose Technologies, Inc. Antibody-toxin conjugates
US9357755B2 (en) * 2003-10-28 2016-06-07 The University Of Wyoming Production of human glycosylated proteins in silk worm
US20070067855A1 (en) * 2003-10-28 2007-03-22 Chesapeake Perl, Inc. Production of human glycosylated proteins in transgenic insects
US20050100965A1 (en) 2003-11-12 2005-05-12 Tariq Ghayur IL-18 binding proteins
US7507573B2 (en) 2003-11-14 2009-03-24 Vib, Vzw Modification of protein glycosylation in methylotrophic yeast
US7842661B2 (en) 2003-11-24 2010-11-30 Novo Nordisk A/S Glycopegylated erythropoietin formulations
US7405198B2 (en) * 2003-11-24 2008-07-29 Neose Technologies, Inc. Glycopegylated erythropoietin
US20080305992A1 (en) 2003-11-24 2008-12-11 Neose Technologies, Inc. Glycopegylated erythropoietin
US8633157B2 (en) 2003-11-24 2014-01-21 Novo Nordisk A/S Glycopegylated erythropoietin
US20080318850A1 (en) * 2003-12-03 2008-12-25 Neose Technologies, Inc. Glycopegylated Factor Ix
US7956032B2 (en) * 2003-12-03 2011-06-07 Novo Nordisk A/S Glycopegylated granulocyte colony stimulating factor
US20060040856A1 (en) 2003-12-03 2006-02-23 Neose Technologies, Inc. Glycopegylated factor IX
AU2004311545B2 (en) * 2003-12-24 2008-11-06 Glycofi, Inc. Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins
EP1765853B1 (en) 2004-01-08 2015-10-28 ratiopharm GmbH O-linked glycosylation of G-CSF peptides
KR100604994B1 (en) * 2004-01-30 2006-07-26 한국생명공학연구원 A novel Hansenula polymorpha gene coding for ?1,6- mannosyltransferase and process for the production of recombinant glycoproteins with Hansenula polymorpha mutant strain deficient in the same gene
WO2005090552A2 (en) * 2004-03-17 2005-09-29 Glycofi, Inc. Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast
WO2005089047A2 (en) * 2004-03-18 2005-09-29 Glycofi, Inc. Glycosylated glucocerebrosidase expression in fungal hosts
CA2562772A1 (en) * 2004-04-15 2005-10-27 Glycofi, Inc. Production of galactosylated glycoproteins in lower eukaryotes
JP5752582B2 (en) * 2004-04-29 2015-07-22 グライコフィ, インコーポレイテッド Methods for reducing or eliminating alpha-mannosidase resistant glycans in the production of glycoproteins
AU2005238308B8 (en) * 2004-04-29 2009-10-08 Glycofi, Inc. Methods for reducing or eliminating alpha-mannosidase resistant glycans in the production of glycoproteins
RU2006138181A (en) * 2004-05-04 2008-06-10 Ново Нордиск Хелс Кеа Аг (Ch) O-RELATED Glycoforms of Polypeptides and a Method for Their Production
WO2006010143A2 (en) 2004-07-13 2006-01-26 Neose Technologies, Inc. Branched peg remodeling and glycosylation of glucagon-like peptide-1 [glp-1]
JP2008512355A (en) * 2004-07-21 2008-04-24 グライコフィ, インコーポレイテッド Immunoglobulin containing predominantly GlcNAcMan5Man3GlcNAc2 glycoform
WO2006026992A1 (en) * 2004-09-07 2006-03-16 Novozymes A/S Altered structure of n-glycans in a fungus
WO2006031811A2 (en) 2004-09-10 2006-03-23 Neose Technologies, Inc. Glycopegylated interferon alpha
US20080108557A1 (en) * 2004-09-29 2008-05-08 Novo Nordisk Healthcare A/G Modified Proteins
EP3061461A1 (en) 2004-10-29 2016-08-31 ratiopharm GmbH Remodeling and glycopegylation of fibroblast growth factor (fgf)
WO2006071856A2 (en) * 2004-12-23 2006-07-06 Glycofi, Inc. Immunoglobulins comprising predominantly a man5glcnac2 glycoform
ES2449195T3 (en) 2005-01-10 2014-03-18 Ratiopharm Gmbh Glycopegylated granulocyte colony stimulating factor
DE602006011132D1 (en) * 2005-03-07 2010-01-28 Plant Res Int Bv Glycoengineering in pilzen
WO2006105426A2 (en) * 2005-03-30 2006-10-05 Neose Technologies, Inc. Manufacturing process for the production of peptides grown in insect cell lines
WO2006121569A2 (en) * 2005-04-08 2006-11-16 Neose Technologies, Inc. Compositions and methods for the preparation of protease resistant human growth hormone glycosylation mutants
GB0510390D0 (en) 2005-05-20 2005-06-29 Novartis Ag Organic compounds
US7700739B2 (en) * 2005-06-30 2010-04-20 Abbott Laboratories IL-12/p40 binding proteins
US7612181B2 (en) * 2005-08-19 2009-11-03 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
US20090215992A1 (en) * 2005-08-19 2009-08-27 Chengbin Wu Dual variable domain immunoglobulin and uses thereof
CN101370525B (en) 2005-08-19 2013-09-18 Abbvie公司 Dual variable domain immunoglobin and uses thereof
US20070105755A1 (en) 2005-10-26 2007-05-10 Neose Technologies, Inc. One pot desialylation and glycopegylation of therapeutic peptides
EP2500359A3 (en) 2005-08-19 2012-10-17 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
WO2007028144A2 (en) * 2005-09-02 2007-03-08 Glycofi, Inc Immunoglobulins comprising predominantly a glcnacman3glcnac2 glycoform
AU2005336263A1 (en) * 2005-09-09 2007-03-15 Glycofi, Inc. Immunoglobulin comprising predominantly a man7GlcNAc2, Man8GlcNAc2 glycoform
CA2623197A1 (en) * 2005-09-22 2007-03-29 Prosci Incorporated Glycosylated polypeptides produced in yeast mutants and methods of use thereof
ES2542501T3 (en) 2005-09-30 2015-08-06 Abbvie Deutschland Gmbh & Co Kg Protein binding domains of the protein family of repulsive targeting molecules (RGM) and functional fragments thereof, as well as their use
KR101105718B1 (en) 2005-10-27 2012-01-17 한국생명공학연구원 A novel Hansenula polymorpha gene coding for dolichyl-phosphate-mannose dependent ?-1,3-mannosyltransferase and process for the production of recombinant glycoproteins with Hansenula polymorpha mutant strain deficient in the same gene
WO2007056191A2 (en) 2005-11-03 2007-05-18 Neose Technologies, Inc. Nucleotide sugar purification using membranes
EP1954815B1 (en) * 2005-11-15 2015-02-25 GlycoFi, Inc. Production of glycoproteins with reduced o-glycosylation
CN102898519B (en) 2005-11-30 2015-10-28 Abbvie公司 Monoclonal antibody of anti-amyloid beta protein and uses thereof
EP2289909B1 (en) 2005-11-30 2014-10-29 AbbVie Inc. Screening method, process for purifying of non-diffusible a-beta oligomers, selective antibodies against said non-diffusible a-beta oligomers and a process for manufacturing of said antibodies
US7884264B2 (en) * 2006-01-17 2011-02-08 Biolex Therapeutics, Inc. Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in duckweed plants
US20090060921A1 (en) * 2006-01-17 2009-03-05 Biolex Therapeutics, Inc. Glycan-optimized anti-cd20 antibodies
US20070190057A1 (en) 2006-01-23 2007-08-16 Jian Wu Methods for modulating mannose content of recombinant proteins
US20090181041A1 (en) * 2006-01-23 2009-07-16 Jan Holgersson Production of proteins carrying oligomannose or human-like glycans in yeast and methods of use thereof
EP2264061A1 (en) * 2006-01-26 2010-12-22 Recopharma AB Compositions and methods for inhibiting viral adhesion
US20110104750A1 (en) * 2006-04-05 2011-05-05 Michael Ward Filamentous Fungi Having Reduced UDP-Galactofuranose Content
MX2008013394A (en) * 2006-04-21 2008-10-31 Wyeth Corp Methods for high-throughput screening of cell lines.
JP5424871B2 (en) * 2006-05-19 2014-02-26 グライコフィ, インコーポレイテッド Recombinant vector
MX2008014744A (en) * 2006-05-19 2009-02-10 Glycofi Inc Erythropoietin compositions.
ATE516346T1 (en) * 2006-05-24 2011-07-15 Univ Provence Aix Marseille 1 PREPARATION AND USES OF CHIMERIC GLYCOSYL TRANSFERASES WITH GENE SEQUENCES ENCODING OPTIMIZED GLYCOSYLATION ACTIVITY
AR078117A1 (en) 2006-06-20 2011-10-19 Protech Pharma S A A RECOMBINANT MUTEIN OF THE GLICOSILATED HUMAN ALPHA INTERFERON, A CODIFYING GENE FOR SUCH MUTEIN, A METHOD OF PRODUCTION OF SUCH GENE, A METHOD FOR OBTAINING A EUCARIOTE CELL MANUFACTURING THIS MUTEINE, A METHOD FOR A MUTE DIFFERENT PROCEDURE
US20080274958A1 (en) * 2006-07-21 2008-11-06 Neose Technologies, Inc. Glycosylation of peptides via o-linked glycosylation sequences
US7879799B2 (en) * 2006-08-10 2011-02-01 Institute For Systems Biology Methods for characterizing glycoproteins and generating antibodies for same
HUE052220T2 (en) 2006-09-08 2021-04-28 Abbvie Bahamas Ltd Interleukin -13 binding proteins
US8969532B2 (en) 2006-10-03 2015-03-03 Novo Nordisk A/S Methods for the purification of polypeptide conjugates comprising polyalkylene oxide using hydrophobic interaction chromatography
CA2665644A1 (en) * 2006-10-12 2008-05-29 Genentech, Inc. Antibodies to lymphotoxin-alpha
EP1916259A1 (en) 2006-10-26 2008-04-30 Institut National De La Sante Et De La Recherche Medicale (Inserm) Anti-glycoprotein VI SCFV fragment for treatment of thrombosis
WO2008073620A2 (en) * 2006-11-02 2008-06-19 Neose Technologies, Inc. Manufacturing process for the production of polypeptides expressed in insect cell-lines
US8455626B2 (en) 2006-11-30 2013-06-04 Abbott Laboratories Aβ conformer selective anti-aβ globulomer monoclonal antibodies
TW200833711A (en) * 2006-12-22 2008-08-16 Genentech Inc Antibodies to insulin-like growth factor receptor
FR2912154B1 (en) 2007-02-02 2012-11-02 Glycode GENETICALLY MODIFIED YEASTS FOR THE PRODUCTION OF HOMOGENEOUS GLYCOPROTEINS
DK2148691T3 (en) 2007-02-05 2015-08-17 Apellis Pharmaceuticals Inc Compstatinanaloger for use in the treatment of inflammatory states of the respiratory system
US8895004B2 (en) 2007-02-27 2014-11-25 AbbVie Deutschland GmbH & Co. KG Method for the treatment of amyloidoses
CN101679934B (en) 2007-03-07 2014-04-02 格利科菲公司 Production of glycoproteins with modified fucosylation
WO2008112192A2 (en) 2007-03-08 2008-09-18 Kalobios Pharmaceuticals, Inc. Epha3 antibodies for the treatment of solid tumors
MX2009010120A (en) 2007-03-22 2009-10-19 Ucb Pharma Sa Binding proteins, including antibodies, antibody derivatives and antibody fragments, that specifically bind cd154 and uses thereof.
CA2682578C (en) 2007-04-03 2015-05-26 Oxyrane Uk Limited Glycosylation of molecules
NZ580030A (en) 2007-04-03 2012-06-29 Biogenerix Ag Methods of treatment using glycopegylated g-csf
US20080256056A1 (en) * 2007-04-10 2008-10-16 Yahoo! Inc. System for building a data structure representing a network of users and advertisers
NZ580510A (en) 2007-04-17 2011-06-30 Stichting Dienst Landbouwkundi Mammalian-type glycosylation in plants by expression of non-mammalian glycosyltransferases
EP2703011A3 (en) 2007-05-07 2014-03-26 MedImmune, LLC Anti-icos antibodies and their use in treatment of oncology, transplantation and autoimmune disease
WO2008143878A1 (en) 2007-05-14 2008-11-27 Medimmune, Llc Methods of reducing eosinophil levels
US20090053167A1 (en) * 2007-05-14 2009-02-26 Neose Technologies, Inc. C-, S- and N-glycosylation of peptides
US20090232801A1 (en) * 2007-05-30 2009-09-17 Abbot Laboratories Humanized Antibodies Which Bind To AB (1-42) Globulomer And Uses Thereof
PE20090329A1 (en) * 2007-05-30 2009-03-27 Abbott Lab HUMANIZED ANTIBODIES AGAINST GLOBULOMER AB (20-42) AND ITS USES
WO2008154639A2 (en) 2007-06-12 2008-12-18 Neose Technologies, Inc. Improved process for the production of nucleotide sugars
US8207112B2 (en) 2007-08-29 2012-06-26 Biogenerix Ag Liquid formulation of G-CSF conjugate
US8637435B2 (en) * 2007-11-16 2014-01-28 Merck Sharp & Dohme Corp. Eukaryotic cell display systems
SG10201406572TA (en) 2007-12-19 2014-11-27 Glycofi Inc Yeast strains for protein production
EP2240595B2 (en) * 2008-01-03 2019-07-24 Cornell Research Foundation, Inc. Glycosylated protein expression in prokaryotes
EP2245151B1 (en) * 2008-02-20 2014-12-24 GlycoFi, Inc. Vectors and yeast strains for protein production
KR101582841B1 (en) 2008-02-27 2016-01-11 노보 노르디스크 에이/에스 Conjugated factor viii molecules
US8962803B2 (en) 2008-02-29 2015-02-24 AbbVie Deutschland GmbH & Co. KG Antibodies against the RGM A protein and uses thereof
WO2009111183A1 (en) 2008-03-03 2009-09-11 Glycofi, Inc. Surface display of recombinant proteins in lower eukaryotes
CA2717614A1 (en) * 2008-03-11 2009-09-17 Genentech, Inc. Antibodies with enhanced adcc function
SG190572A1 (en) 2008-04-29 2013-06-28 Abbott Lab Dual variable domain immunoglobulins and uses thereof
PT2439212T (en) 2008-05-02 2017-03-29 Novartis Ag Improved fibronectin-based binding molecules and uses thereof
JP5890174B2 (en) 2008-05-09 2016-03-22 アッヴィ・ドイチュラント・ゲー・エム・ベー・ハー・ウント・コー・カー・ゲー Antibody against terminal glycation end product receptor (RAGE) and use thereof
MX2010013059A (en) * 2008-05-30 2010-12-20 Glycofi Inc Yeast strain for the production of proteins with terminal alpha-1,3-linked galactose.
RU2010153580A (en) 2008-06-03 2012-07-20 Эбботт Лэборетриз (Us) IMMUNOGLOBULINS WITH TWO VARIABLE DOMAINS AND THEIR APPLICATION
US9109026B2 (en) 2008-06-03 2015-08-18 Abbvie, Inc. Dual variable domain immunoglobulins and uses thereof
MX2010014574A (en) 2008-07-08 2011-04-27 Abbott Lab Prostaglandin e2 dual variable domain immunoglobulins and uses thereof.
BRPI0915825A2 (en) 2008-07-08 2015-11-03 Abbott Lab prostaglandin binding proteins and uses thereof
US8067339B2 (en) 2008-07-09 2011-11-29 Merck Sharp & Dohme Corp. Surface display of whole antibodies in eukaryotes
EP2331701B1 (en) 2008-08-08 2013-03-20 Vib Vzw Cells producing glycoproteins having altered glycosylation patterns and methods and use thereof
AU2009282228A1 (en) 2008-08-12 2010-02-18 Glycofi, Inc. Improved vectors and yeast strains for protein production: Ca2+ ATPase overexpression
US20100120701A1 (en) 2008-09-25 2010-05-13 Glycosyn, Inc. Compositions and Methods For Engineering Probiotic Yeast
KR20110063650A (en) 2008-10-01 2011-06-13 아사히 가라스 가부시키가이샤 Host, transformant, method for producing the transformant, and method for producing heterogeneous protein containing o-glycoside type sugar chain
US20110293605A1 (en) 2008-11-12 2011-12-01 Hasige Sathish Antibody formulation
US20100233079A1 (en) * 2008-12-04 2010-09-16 Abbott Laboratories Dual Variable Domain Immunoglobulins and Uses Thereof
SG171814A1 (en) 2008-12-19 2011-07-28 Jennewein Biotechnologie Gmbh Synthesis of fucosylated compounds
AU2009327435A1 (en) * 2008-12-19 2010-06-24 Momenta Pharmaceuticals, Inc. Methods related to modified glycans
WO2010075249A2 (en) 2008-12-22 2010-07-01 Genentech, Inc. A method for treating rheumatoid arthritis with b-cell antagonists
US20110165063A1 (en) * 2009-01-29 2011-07-07 Abbott Laboratories Il-1 binding proteins
BRPI1007371A2 (en) * 2009-01-29 2018-03-27 Abbott Lab il-1 binding proteins
US8030026B2 (en) 2009-02-24 2011-10-04 Abbott Laboratories Antibodies to troponin I and methods of use thereof
JP2012518419A (en) 2009-02-25 2012-08-16 メルク・シャープ・エンド・ドーム・コーポレイション Metabolic manipulation of the galactose assimilation pathway in the sugar-engineered yeast Pichia pastoris
TWI541021B (en) 2009-03-05 2016-07-11 艾伯維有限公司 Il-17 binding proteins
CA2753995A1 (en) 2009-03-06 2010-09-10 Kalobios Pharmaceuticals, Inc. Treatment of leukemias and chronic myeloproliferative diseases with antibodies to epha3
US8283162B2 (en) 2009-03-10 2012-10-09 Abbott Laboratories Antibodies relating to PIVKAII and uses thereof
AU2010225930B2 (en) * 2009-03-16 2017-01-12 Dsm Ip Assets B.V. Protein production in microorganisms of the phylum Labyrinthulomycota
BRPI1009460A2 (en) 2009-03-16 2016-03-01 Cephalon Australia Pty Ltd antibody binding domain, antibody, use of a binding domain or antibody, method for detecting the presence of cancer cells in a sample.
EP2424894A1 (en) 2009-04-27 2012-03-07 Novartis AG Composition and methods of use for therapeutic antibodies specific for the il-12 receptore betal subunit
EP3275900A1 (en) 2009-04-27 2018-01-31 Novartis AG Compositions and methods for increasing muscle growth
US20120329709A1 (en) * 2009-05-26 2012-12-27 Brian Edward Collins Production of glycoproteins
WO2010138184A2 (en) * 2009-05-27 2010-12-02 Synageva Biopharma Corp. Avian derived antibodies
US20120121630A1 (en) * 2009-07-24 2012-05-17 Bryan Janine T Recombinant ectodomain expression of herpes simplex virus glycoproteins in yeast
CN105131112A (en) 2009-08-29 2015-12-09 Abbvie公司 Therapeutic dll4 binding proteins
WO2011028811A2 (en) 2009-09-01 2011-03-10 Abbott Laboratories Dual variable domain immunoglobulins and uses thereof
WO2011029823A1 (en) 2009-09-09 2011-03-17 Novartis Ag Monoclonal antibody reactive with cd63 when expressed at the surface of degranulated mast cells
CN104651428A (en) 2009-09-29 2015-05-27 根特大学 Hydrolysis of mannose-1-phospho-6-mannose linkage to phospho-6-mannose
PL2488554T3 (en) 2009-10-14 2020-03-31 Humanigen, Inc. Antibodies to epha3
CN102666875A (en) 2009-10-15 2012-09-12 雅培制药有限公司 Dual variable domain immunoglobulins and uses thereof
CA2776392A1 (en) 2009-10-16 2011-04-21 Merck Sharp & Dohme Corp. Method for producing proteins in pichia pastoris that lack detectable cross binding activity to antibodies against host cell antigens
UY32979A (en) * 2009-10-28 2011-02-28 Abbott Lab IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME
EP2494030A4 (en) 2009-10-30 2013-03-27 Merck Sharp & Dohme Method for producing therapeutic proteins in pichia pastoris lacking dipeptidyl aminopeptidase activity
WO2011053545A1 (en) * 2009-10-30 2011-05-05 Merck Sharp & Dohme Corp. Granulocyte-colony stimulating factor produced in glycoengineered pichia pastoris
WO2011051327A2 (en) 2009-10-30 2011-05-05 Novartis Ag Small antibody-like single chain proteins
AU2010313608A1 (en) 2009-10-30 2012-06-07 Merck Sharp & Dohme Corp. Methods for the production of recombinant proteins with improved secretion efficiencies
US8420083B2 (en) * 2009-10-31 2013-04-16 Abbvie Inc. Antibodies to receptor for advanced glycation end products (RAGE) and uses thereof
WO2011051466A1 (en) 2009-11-02 2011-05-05 Novartis Ag Anti-idiotypic fibronectin-based binding molecules and uses thereof
EP2496257A4 (en) 2009-11-05 2013-02-27 Cephalon Australia Pty Ltd Treatment of cancer involving mutated kras or braf genes
JP2013511272A (en) 2009-11-19 2013-04-04 オキシレイン ユーケー リミテッド Yeast strain producing mammalian-like complex N-glycans
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
AU2010329955A1 (en) 2009-12-08 2012-05-24 Abbott Gmbh & Co. Kg Monoclonal antibodies against the RGM A protein for use in the treatment of retinal nerve fiber layer degeneration
MX2012007318A (en) 2009-12-22 2012-07-20 Novartis Ag Tetravalent cd47-antibody constant region fusion protein for use in therapy.
AU2010339544B2 (en) * 2009-12-28 2015-11-12 Merial Limited Production of hemagglutinin-neuraminidase protein in microalgae
WO2011090730A1 (en) * 2009-12-28 2011-07-28 Martek Biosciences Corporation Recombinant thraustochytrids that grow on xylose, and compositions, methods of making, and uses thereof
EP2519635B1 (en) * 2009-12-28 2018-11-21 Sanofi Vaccine Technologies, S.A.S. Production of heterologous polypeptides in microalgae, microalgal extracellular bodies, compositions, and methods of making and uses thereof
WO2011092233A1 (en) 2010-01-29 2011-08-04 Novartis Ag Yeast mating to produce high-affinity combinations of fibronectin-based binders
US8715963B2 (en) * 2010-02-24 2014-05-06 Merck Sharp & Dohme Corp. Method for increasing N-glycosylation site occupancy on therapeutic glycoproteins produced in Pichia pastoris
KR20180044441A (en) 2010-03-02 2018-05-02 애브비 인코포레이티드 Therapeutic dll4 binding proteins
CN102869784A (en) 2010-04-07 2013-01-09 动量制药公司 High mannose glycans
WO2011130377A2 (en) 2010-04-15 2011-10-20 Abbott Laboratories Amyloid-beta binding proteins
WO2011139714A2 (en) 2010-04-26 2011-11-10 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of cysteinyl-trna synthetase
CN103096911B (en) 2010-04-27 2018-05-29 Atyr 医药公司 Treatment relevant with the protein fragments of Isoleucyl-tRNA synthetase, diagnosis and the innovation of antibody compositions are found
WO2011139853A2 (en) 2010-04-28 2011-11-10 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl trna synthetases
WO2011150279A2 (en) 2010-05-27 2011-12-01 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glutaminyl-trna synthetases
AU2011248457B2 (en) 2010-04-29 2017-02-16 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of valyl tRNA synthetases
CN103097523B (en) 2010-04-29 2016-09-28 Atyr医药公司 The innovation for the treatment of, diagnosis and the antibody compositions relevant to the protein fragments of Asparaginyl-tRNA synthetase finds
US8981045B2 (en) 2010-05-03 2015-03-17 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of methionyl-tRNA synthetases
US8961961B2 (en) 2010-05-03 2015-02-24 a Tyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related protein fragments of arginyl-tRNA synthetases
CN105820252B (en) 2010-05-03 2020-07-21 Atyr 医药公司 Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl- α -tRNA synthetases
CA2798139C (en) 2010-05-04 2019-09-24 Atyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of p38 multi-trna synthetase complex
CN103200953B (en) 2010-05-14 2017-02-15 Atyr 医药公司 Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of phenylalanyl-beta-trna synthetases
LT2571532T (en) 2010-05-14 2017-08-10 Abbvie Inc. Il-1 binding proteins
JP5956982B2 (en) 2010-05-27 2016-07-27 メルク・シャープ・エンド・ドーム・コーポレイション Method for producing antibodies having improved properties
EP2575857B1 (en) 2010-06-01 2018-01-24 aTyr Pharma, Inc. Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of lysyl-trna synthetases
US20120009196A1 (en) 2010-07-08 2012-01-12 Abbott Laboratories Monoclonal antibodies against hepatitis c virus core protein
UY33492A (en) 2010-07-09 2012-01-31 Abbott Lab IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME
AU2011289831C1 (en) 2010-07-12 2017-06-15 Pangu Biopharma Limited Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of glycyl-tRNA synthetases
US9120862B2 (en) 2010-07-26 2015-09-01 Abbott Laboratories Antibodies relating to PIVKA-II and uses thereof
WO2012013823A2 (en) * 2010-07-30 2012-02-02 Glycode A yeast artificial chromosome carrying the mammalian glycosylation pathway
PE20131412A1 (en) 2010-08-03 2014-01-19 Abbvie Inc IMMUNOGLOBULINS WITH DUAL VARIABLE DOMAIN AND USES OF THE SAME
AU2011288412A1 (en) 2010-08-13 2013-02-21 Medimmune Limited Monomeric polypeptides comprising variant Fc regions and methods of use
CA2808187A1 (en) 2010-08-14 2012-02-23 Abbvie Inc. Amyloid-beta binding proteins
WO2012022734A2 (en) 2010-08-16 2012-02-23 Medimmune Limited Anti-icam-1 antibodies and methods of use
PT3333188T (en) 2010-08-19 2022-03-28 Zoetis Belgium S A Anti-ngf antibodies and their use
CN103108650A (en) 2010-08-25 2013-05-15 Atyr医药公司 Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of tyrosyl-trna synthetases
TW201211252A (en) 2010-08-26 2012-03-16 Abbott Lab Dual variable domain immunoglobulins and uses thereof
WO2012042387A2 (en) 2010-09-29 2012-04-05 Oxyrane Uk Limited De-mannosylation of phosphorylated n-glycans
WO2012042386A2 (en) 2010-09-29 2012-04-05 Oxyrane Uk Limited Mannosidases capable of uncapping mannose-1-phospho-6-mannose linkages and demannosylating phosphorylated n-glycans and methods of facilitating mammalian cellular uptake of glycoproteins
JP2013543384A (en) 2010-10-05 2013-12-05 ノバルティス アーゲー Anti-IL12Rbeta1 antibody and its use in the treatment of autoimmune and inflammatory diseases
EP2646606B1 (en) 2010-12-01 2018-10-10 Merck Sharp&Dohme Corp. Surface-anchored fc-bait antibody display system
WO2012076670A2 (en) 2010-12-10 2012-06-14 Novartis Ag Antibody formulation
PE20141060A1 (en) 2010-12-21 2014-09-26 Abbvie Inc IL-1 ALPHA AND BETA DUAL VARIABLE DOMAIN IMMUNOGLOBULINS AND THEIR USE
US20120275996A1 (en) 2010-12-21 2012-11-01 Abbott Laboratories IL-1 Binding Proteins
CN103443285B9 (en) 2011-02-08 2018-04-24 米迪缪尼有限公司 Antibodies that specifically bind staphylococcus aureus α toxin and methods of use
JP2014518608A (en) 2011-02-25 2014-08-07 メルク・シャープ・アンド・ドーム・コーポレーション Yeast strains for the production of proteins with modified O-glycosylation
WO2012125553A2 (en) 2011-03-12 2012-09-20 Momenta Pharmaceuticals, Inc. N-acetylhexosamine-containing n-glycans in glycoprotein products
JP2014509864A (en) 2011-03-23 2014-04-24 グリコド Yeast recombinant cells capable of producing GDP-fucose
EP2702077A2 (en) 2011-04-27 2014-03-05 AbbVie Inc. Methods for controlling the galactosylation profile of recombinantly-expressed proteins
DK2707391T3 (en) 2011-05-13 2018-02-05 Gamamabs Pharma ANTIBODIES AGAINST HER3
CA2834589A1 (en) 2011-05-25 2012-11-29 Merck Sharp & Dohme Corp. Method for preparing fc-containing polypeptides having improved properties
WO2012172521A1 (en) 2011-06-16 2012-12-20 Novartis Ag Soluble proteins for use as therapeutics
FR2976811A1 (en) 2011-06-22 2012-12-28 Lfb Biotechnologies USE OF A HIGH ADCC ANTI-CD20 ANTIBODY FOR THE TREATMENT OF WALDENSTROM'S DISEASE
KR20140104944A (en) 2011-06-22 2014-08-29 인쎄름 (엥스띠뛰 나씨오날 드 라 쌍떼 에 드 라 흐쉐르슈 메디깔) Anti-axl antibodies and uses thereof
US9409988B2 (en) 2011-06-22 2016-08-09 Inserm (Institut National De La Sante Et De La Recherche Medicale) Anti-Axl antibodies and uses thereof
PL2726099T3 (en) 2011-07-01 2018-12-31 Novartis Ag Method for treating metabolic disorders
AU2012283039A1 (en) 2011-07-13 2014-01-30 Abbvie Inc. Methods and compositions for treating asthma using anti-IL-13 antibodies
EP2734537B1 (en) 2011-07-20 2022-12-21 Zepteon, Incorporated Polypeptide separation methods
US9371519B2 (en) * 2011-10-03 2016-06-21 National Institute Of Advanced Industrial Science And Technology Complex type sugar chain hydrolase
TW201323440A (en) 2011-10-24 2013-06-16 Abbvie Inc Immunobinders directed against sclerostin
AR088512A1 (en) 2011-10-24 2014-06-18 Abbvie Inc ANTIBODIES DIRECTED AGAINST TNF
BR112014009925B1 (en) 2011-10-28 2022-09-20 Teva Pharmaceuticals Australia Pty Ltd POLYPEPTIDE BUILDERS AND THEIR USES
KR20140091018A (en) 2011-10-28 2014-07-18 머크 샤프 앤드 돔 코포레이션 Engineered lower eukaryotic host strains for recombinant protein expression
WO2013066685A1 (en) * 2011-10-31 2013-05-10 Merck Sharp & Dohme Corp. Engineered pichia strains with improved fermentation yield and n-glycosylation quality
US9580509B2 (en) 2011-11-07 2017-02-28 Medimmune, Llc Multispecific and multivalent binding proteins and uses thereof
KR101457514B1 (en) 2011-11-21 2014-11-03 한국생명공학연구원 Sialyltransferase of Halocynthia rorentzi and a method for synthesis of sialoglycoconjugates using it
JP6392123B2 (en) 2011-12-20 2018-09-19 インディアナ ユニバーシティー リサーチ アンド テクノロジー コーポレーションIndiana University Research And Technology Corporation CTP-based insulin analog for diabetes treatment
TW201333035A (en) 2011-12-30 2013-08-16 Abbvie Inc Dual specific binding proteins directed against IL-13 and/or IL-17
EP2617732A1 (en) 2012-01-19 2013-07-24 Vib Vzw Tools and methods for expression of membrane proteins
KR102129234B1 (en) 2012-01-27 2020-07-02 아비에 도이치란트 게엠베하 운트 콤파니 카게 Composition and method for the diagnosis and treatment of disease associated with neurite degeneration
EP3311847A1 (en) 2012-02-16 2018-04-25 Atyr Pharma, Inc. Histidyl-trna synthetases for treating autoimmune and inflammatory diseases
BR112014022624A2 (en) 2012-03-15 2017-07-11 Oxyrane Uk Ltd Methods and Materials for Treatment of Pompe Disease
US9067990B2 (en) 2013-03-14 2015-06-30 Abbvie, Inc. Protein purification using displacement chromatography
WO2013158279A1 (en) 2012-04-20 2013-10-24 Abbvie Inc. Protein purification methods to reduce acidic species
US9181572B2 (en) 2012-04-20 2015-11-10 Abbvie, Inc. Methods to modulate lysine variant distribution
CN104271816A (en) 2012-05-11 2015-01-07 默沙东公司 Surface anchored light chain bait antibody display system
EP2852610B1 (en) 2012-05-23 2018-07-11 Glykos Finland Oy Production of fucosylated glycoproteins
US9695244B2 (en) 2012-06-01 2017-07-04 Momenta Pharmaceuticals, Inc. Methods related to denosumab
US9617334B2 (en) 2012-06-06 2017-04-11 Zoetis Services Llc Caninized anti-NGF antibodies and methods thereof
US9216219B2 (en) 2012-06-12 2015-12-22 Novartis Ag Anti-BAFFR antibody formulation
WO2014004549A2 (en) 2012-06-27 2014-01-03 Amgen Inc. Anti-mesothelin binding proteins
WO2014011955A2 (en) 2012-07-12 2014-01-16 Abbvie, Inc. Il-1 binding proteins
AU2013291964B2 (en) 2012-07-18 2017-12-14 Glycotope Gmbh Novel therapeutic treatments with anti-HER2 antibodies having a low fucosylation
US9512214B2 (en) 2012-09-02 2016-12-06 Abbvie, Inc. Methods to control protein heterogeneity
JOP20200308A1 (en) 2012-09-07 2017-06-16 Novartis Ag IL-18 binding molecules
AU2013335065B2 (en) 2012-10-22 2018-10-25 Merck Sharp & Dohme Llc CRZ1 mutant fungal cells
AU2013334652B2 (en) 2012-10-23 2019-02-21 Research Corporation Technologies, Inc. Pichia pastoris strains for producing predominantly homogeneous glycan structure
WO2014064203A1 (en) 2012-10-26 2014-05-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Lyve-1 antagonists for preventing or treating a pathological condition associated with lymphangiogenesis
KR20190107184A (en) 2012-11-01 2019-09-18 애브비 인코포레이티드 Anti-vegf/dll4 dual variable domain immunoglobulins and uses thereof
EP2733153A1 (en) 2012-11-15 2014-05-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the preparation of immunoconjugates and uses thereof
JP6735561B2 (en) 2012-12-03 2020-08-05 メルク・シャープ・アンド・ドーム・コーポレーションMerck Sharp & Dohme Corp. O-glycosylated carboxy-terminal portion (CTP) peptide-based insulin and insulin analogs
WO2014093240A1 (en) 2012-12-10 2014-06-19 The General Hospital Corporation Bivalent il-2 fusion toxins
WO2014090948A1 (en) 2012-12-13 2014-06-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Serpin spn4a and biologically active derivatives thereof for use in the treatment of cancer
EP2931749B1 (en) 2012-12-17 2019-04-24 Laboratoire Francais du Fractionnement et des Biotechnologies Societe Anonyme Use of monoclonal antibodies for the treatment of inflammation and bacterial infections
EP2934589B1 (en) 2012-12-18 2021-01-13 The Rockefeller University Glycan-modified anti-cd4 antibodies for hiv prevention and therapy
WO2014100542A1 (en) 2012-12-21 2014-06-26 Abbvie, Inc. High-throughput antibody humanization
US9458244B2 (en) 2012-12-28 2016-10-04 Abbvie Inc. Single chain multivalent binding protein compositions and methods
WO2014106015A2 (en) 2012-12-28 2014-07-03 Abbvie, Inc. Multivalent binding protein compositions
WO2014111744A1 (en) 2013-01-16 2014-07-24 INSERM (Institut National de la Santé et de la Recherche Médicale) A soluble fibroblast growth factor receptor 3 (fgr3) polypeptide for use in the prevention or treatment of skeletal growth retardation disorders
WO2014116596A1 (en) 2013-01-22 2014-07-31 Abbvie, Inc. Methods for optimizing domain stability of binding proteins
MX371052B (en) 2013-02-08 2020-01-14 Novartis Ag Anti-il-17a antibodies and their use in treating autoimmune and inflammatory disorders.
US9534041B2 (en) 2013-02-12 2017-01-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Monoclonal antibodies that neutralize a norovirus
ES2755181T3 (en) 2013-02-13 2020-04-21 Lab Francais Du Fractionnement Highly galactosylated anti-TNF-alpha antibodies and uses thereof
WO2014138188A1 (en) 2013-03-07 2014-09-12 The General Hospital Corporation Human ctla4 mutants and use thereof
WO2014143205A1 (en) 2013-03-12 2014-09-18 Abbvie Inc. Human antibodies that bind human tnf-alpha and methods of preparing the same
CA2902877A1 (en) 2013-03-13 2014-10-02 Jeffrey Boyington Prefusion rsv f proteins and their use
BR112015023071A2 (en) 2013-03-14 2017-07-18 Univ Indiana Res & Tech Corp insulin-incretin conjugates
US9017687B1 (en) 2013-10-18 2015-04-28 Abbvie, Inc. Low acidic species compositions and methods for producing and using the same using displacement chromatography
US9499614B2 (en) 2013-03-14 2016-11-22 Abbvie Inc. Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosaccharides
EP3564384A1 (en) 2013-03-14 2019-11-06 Abbott Laboratories Hcv core lipid binding domain monoclonal antibodies
CN105228649B (en) 2013-03-14 2019-01-18 雅培制药有限公司 HCV Ag-Ab combination measurement is with method and used in composition therein
US9790478B2 (en) 2013-03-14 2017-10-17 Abbott Laboratories HCV NS3 recombinant antigens and mutants thereof for improved antibody detection
WO2014149067A1 (en) 2013-03-15 2014-09-25 Momenta Pharmaceuticals, Inc. Methods related to ctla4-fc fusion proteins
BR112015023797A2 (en) 2013-03-15 2017-10-24 Abbvie Inc dual specificity binding proteins directed against il-1b and / or il-17
EP3460054B1 (en) 2013-03-15 2020-10-21 aTyr Pharma, Inc. Histidyl-trna synthetase-fc conjugates
MX2015014773A (en) 2013-04-22 2016-03-04 Glycotope Gmbh Anti-cancer treatments with anti-egfr antibodies having a low fucosylation.
US11117975B2 (en) 2013-04-29 2021-09-14 Teva Pharmaceuticals Australia Pty Ltd Anti-CD38 antibodies and fusions to attenuated interferon alpha-2B
EA033115B1 (en) 2013-04-29 2019-08-30 Тева Фармасьютикалз Острэйлиа Пти Лтд. Anti-cd38 antibodies and fusion proteins with attenuated interferon alpha-2b
EP2994163B1 (en) 2013-05-09 2019-08-28 The United States of America, as represented by The Secretary, Department of Health and Human Services Single-domain vhh antibodies directed to norovirus gi.1 and gii.4 and their use
WO2014186310A1 (en) 2013-05-13 2014-11-20 Momenta Pharmaceuticals, Inc. Methods for the treatment of neurodegeneration
MX2016001969A (en) 2013-08-14 2016-06-02 Novartis Ag Methods of treating sporadic inclusion body myositis.
KR102232348B1 (en) 2013-09-05 2021-03-29 브이아이비 브이지더블유 Cells producing fc containing molecules having altered glycosylation patterns and methods and use thereof
WO2015044379A1 (en) 2013-09-27 2015-04-02 INSERM (Institut National de la Santé et de la Recherche Médicale) A dyrk1a polypeptide for use in preventing or treating metabolic disorders
WO2015050959A1 (en) 2013-10-01 2015-04-09 Yale University Anti-kit antibodies and methods of use thereof
BR112016006999B1 (en) 2013-10-02 2023-11-14 Medimmune, Llc ANTI-INFLUENZA NEUTRALIZING ANTIBODIES AND THEIR USES, THEIR PRODUCTION METHOD, COMPOSITION THAT COMPRISES THEM, NUCLEIC ACID AND VECTOR
WO2015051293A2 (en) 2013-10-04 2015-04-09 Abbvie, Inc. Use of metal ions for modulation of protein glycosylation profiles of recombinant proteins
WO2015057622A1 (en) 2013-10-16 2015-04-23 Momenta Pharmaceuticals, Inc. Sialylated glycoproteins
US9085618B2 (en) 2013-10-18 2015-07-21 Abbvie, Inc. Low acidic species compositions and methods for producing and using the same
US9181337B2 (en) 2013-10-18 2015-11-10 Abbvie, Inc. Modulated lysine variant species compositions and methods for producing and using the same
ES2759252T3 (en) 2013-10-31 2020-05-08 Resolve Therapeutics Llc Nuclease-albumin fusions and therapeutic methods
ES2865196T3 (en) 2013-11-07 2021-10-15 Inst Nat Sante Rech Med Neuregulin allosteric anti-human HER3 antibodies
WO2015073884A2 (en) 2013-11-15 2015-05-21 Abbvie, Inc. Glycoengineered binding protein compositions
FR3016633B1 (en) 2014-01-17 2018-04-13 Laboratoire Francais Du Fractionnement Et Des Biotechnologies IMMUNOGLOBULIN ANTI-TOXIN CARBON
EP3495482B1 (en) 2014-01-21 2020-09-02 Synplogen Co., Ltd. Method for preparing dna unit composition, and method for creating concatenated dna
TW202214691A (en) 2014-03-21 2022-04-16 美商艾伯維有限公司 Anti-egfr antibodies and antibody drug conjugates
TW201622746A (en) 2014-04-24 2016-07-01 諾華公司 Methods of improving or accelerating physical recovery after surgery for hip fracture
UA119352C2 (en) 2014-05-01 2019-06-10 Тева Фармасьютикалз Острейліа Пті Лтд Combination of lenalidomide or pomalidomide and cd38 antibody-attenuated interferon-alpha constructs, and the use thereof
US20170291939A1 (en) 2014-06-25 2017-10-12 Novartis Ag Antibodies specific for il-17a fused to hyaluronan binding peptide tags
US10294292B2 (en) 2014-07-15 2019-05-21 Medimmune, Llc Neutralizing anti-influenza B antibodies and uses thereof
US10513724B2 (en) 2014-07-21 2019-12-24 Glykos Finland Oy Production of glycoproteins with mammalian-like N-glycans in filamentous fungi
JO3663B1 (en) 2014-08-19 2020-08-27 Merck Sharp & Dohme Anti-lag3 antibodies and antigen-binding fragments
UA122395C2 (en) 2014-08-19 2020-11-10 Мерк Шарп Енд Доум Корп. ANTIBODY AGAINST TIGIT
US10232020B2 (en) 2014-09-24 2019-03-19 Indiana University Research And Technology Corporation Incretin-insulin conjugates
WO2016050867A1 (en) 2014-10-01 2016-04-07 Medimmune Limited Antibodies to ticagrelor and methods of use
CN107106656A (en) 2014-10-29 2017-08-29 梯瓦制药澳大利亚股份有限公司 Interferon alpha 2 b variant
WO2016069889A1 (en) 2014-10-31 2016-05-06 Resolve Therapeutics, Llc Therapeutic nuclease-transferrin fusions and methods
US11518797B2 (en) 2014-11-11 2022-12-06 Clara Foods Co. Methods and compositions for egg white protein production
WO2016090170A1 (en) 2014-12-05 2016-06-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A potent anti-influenza a neuraminidase subtype n1 antibody
US10398774B2 (en) 2014-12-09 2019-09-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies against AXL
US10093733B2 (en) 2014-12-11 2018-10-09 Abbvie Inc. LRP-8 binding dual variable domain immunoglobulin proteins
WO2016135041A1 (en) 2015-02-26 2016-09-01 INSERM (Institut National de la Santé et de la Recherche Médicale) Fusion proteins and antibodies comprising thereof for promoting apoptosis
WO2016160976A2 (en) 2015-03-30 2016-10-06 Abbvie Inc. Monovalent tnf binding proteins
EP3091033A1 (en) 2015-05-06 2016-11-09 Gamamabs Pharma Anti-human-her3 antibodies and uses thereof
TWI820377B (en) 2015-05-07 2023-11-01 美商艾吉納斯公司 Anti-ox40 antibodies and methods of use thereof
JP6770533B2 (en) 2015-05-22 2020-10-14 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル A human monoclonal antibody fragment that inhibits both the catalytic activity of Cath-D and its binding to the LRP1 receptor.
RU2715597C2 (en) 2015-05-29 2020-03-02 Эббви Инк. Antibodies to cd40 and methods of use thereof
MX2017015189A (en) 2015-06-01 2018-04-13 Medimmune Llc Neutralizing anti-influenza binding molecules and uses thereof.
TW201710286A (en) 2015-06-15 2017-03-16 艾伯維有限公司 Binding proteins against VEGF, PDGF, and/or their receptors
FR3038517B1 (en) 2015-07-06 2020-02-28 Laboratoire Francais Du Fractionnement Et Des Biotechnologies USE OF MODIFIED FC FRAGMENTS IN IMMUNOTHERAPY
AU2016290670B2 (en) 2015-07-09 2020-11-05 Universiteit Gent Cells producing glycoproteins having altered n- and o-glycosylation patterns and methods and use thereof
WO2017058944A1 (en) 2015-09-29 2017-04-06 Amgen Inc. Asgr inhibitors
RU2694903C1 (en) 2015-10-12 2019-07-18 АПРОДЖЕН КейАйСи ИНК. Cd43 antibodies and use thereof for treating cancer
JO3555B1 (en) 2015-10-29 2020-07-05 Merck Sharp & Dohme Antibody neutralizing human respiratory syncytial virus
WO2017106129A1 (en) 2015-12-16 2017-06-22 Merck Sharp & Dohme Corp. Anti-lag3 antibodies and antigen-binding fragments
US11414477B2 (en) 2016-01-27 2022-08-16 Medimmune, Llc Methods for preparing antibodies with a defined glycosylation pattern
NZ743881A (en) 2016-02-06 2023-11-24 Epimab Biotherapeutics Inc Fabs-in-tandem immunoglobulin and uses thereof
MA44236A (en) 2016-02-17 2018-12-26 Novartis Ag ANTI-TGFBETA ANTIBODY 2
KR102438140B1 (en) 2016-03-22 2022-08-31 엥스띠뛰 나씨오날 드 라 쌍떼 에 드 라 흐쉐르슈 메디깔 Humanized anti-claudin-1 antibodies and uses thereof
LT3458479T (en) 2016-06-08 2021-02-25 Abbvie Inc. Anti-b7-h3 antibodies and antibody drug conjugates
JP2019521973A (en) 2016-06-08 2019-08-08 アッヴィ・インコーポレイテッド Anti-BH7-H3 antibody and antibody drug conjugate
BR112018075651A2 (en) 2016-06-08 2019-04-09 Abbvie Inc. anti-cd98 antibodies and drug antibody conjugates
BR112018075653A2 (en) 2016-06-08 2019-08-27 Abbvie Inc anti-b7-h3 antibodies and drug antibody conjugates
JP2019521975A (en) 2016-06-08 2019-08-08 アッヴィ・インコーポレイテッド Anti-EGFR antibody drug conjugate
PE20190512A1 (en) 2016-06-08 2019-04-10 Abbvie Inc ANTI-EGFR AND FARMACO ANTIBODY CONJUGATES
WO2017214233A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-egfr antibody drug conjugates
CA3027033A1 (en) 2016-06-08 2017-12-14 Abbvie Inc. Anti-cd98 antibodies and antibody drug conjugates
MX2018015272A (en) 2016-06-08 2019-08-12 Abbvie Inc Anti-cd98 antibodies and antibody drug conjugates.
MA45554A (en) 2016-07-01 2019-05-08 Resolve Therapeutics Llc OPTIMIZED BINUCLEASE FUSIONS.
CN117717604A (en) 2016-07-19 2024-03-19 梯瓦制药澳大利亚股份有限公司 anti-CD 47 combination therapy
US11186634B2 (en) 2016-07-29 2021-11-30 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies targeting tumor associated macrophages and uses thereof
NL2017267B1 (en) 2016-07-29 2018-02-01 Aduro Biotech Holdings Europe B V Anti-pd-1 antibodies
NL2017270B1 (en) 2016-08-02 2018-02-09 Aduro Biotech Holdings Europe B V New anti-hCTLA-4 antibodies
WO2018026969A2 (en) 2016-08-03 2018-02-08 Achaogen, Inc. Plazomicin antibodies and methods of use
TWI672317B (en) 2016-08-16 2019-09-21 英屬開曼群島商岸邁生物科技有限公司 Monovalent asymmetric tandem fab bispecific antibodies
JP7174691B2 (en) 2016-08-23 2022-11-17 メディミューン リミテッド Anti-VEGF-A and anti-ANG2 antibodies and uses thereof
AU2017315076B2 (en) 2016-08-23 2020-10-08 Medimmune Limited Anti-VEGF-A antibodies and uses thereof
US20190270821A1 (en) 2016-09-13 2019-09-05 Humanigen, Inc. Epha3 antibodies for the treatment of pulmonary fibrosis
JOP20190055A1 (en) 2016-09-26 2019-03-24 Merck Sharp & Dohme Anti-cd27 antibodies
US11186635B2 (en) 2016-10-25 2021-11-30 Institut National De La Santé Et De La Recherché Médical (Inserm) Monoclonal antibodies binding to the CD160 transmembrane isoform
JP7274417B2 (en) 2016-11-23 2023-05-16 イミュノア・セラピューティクス・インコーポレイテッド 4-1BB binding protein and uses thereof
CN110300599A (en) 2016-12-07 2019-10-01 艾吉纳斯公司 Antibody and its application method
WO2018146253A1 (en) 2017-02-10 2018-08-16 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of cancers associated with activation of the mapk pathway
JP2020510432A (en) 2017-03-02 2020-04-09 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Antibodies with specificity for NECTIN-4 and uses thereof
WO2018170332A1 (en) * 2017-03-15 2018-09-20 Nutech Ventures Extracellular vesicles and methods of using
CA3054837A1 (en) 2017-03-24 2018-09-27 Novartis Ag Methods for preventing and treating heart disease
TWI796329B (en) 2017-04-07 2023-03-21 美商默沙東有限責任公司 Anti-ilt4 antibodies and antigen-binding fragments
EP3609922A2 (en) 2017-04-13 2020-02-19 Aduro Biotech Holdings, Europe B.V. Anti-sirp alpha antibodies
EP3612567A4 (en) 2017-04-19 2020-11-11 Bluefin Biomedicine, Inc. Anti-vtcn1 antibodies and antibody drug conjugates
WO2018219956A1 (en) 2017-05-29 2018-12-06 Gamamabs Pharma Cancer-associated immunosuppression inhibitor
UY37758A (en) 2017-06-12 2019-01-31 Novartis Ag METHOD OF MANUFACTURING OF BIESPECTIFIC ANTIBODIES, BISPECTIFIC ANTIBODIES AND THERAPEUTIC USE OF SUCH ANTIBODIES
GB201710838D0 (en) 2017-07-05 2017-08-16 Ucl Business Plc Bispecific antibodies
US11898187B2 (en) 2017-08-15 2024-02-13 Northwestern University Protein glycosylation sites by rapid expression and characterization of N-glycosyltransferases
MX2020002070A (en) 2017-08-22 2020-03-24 Sanabio Llc Soluble interferon receptors and uses thereof.
MA49950A (en) 2017-08-25 2020-07-01 Five Prime Therapeutics Inc ANTI-B7-H4 ANTIBODIES AND PROCEDURES FOR USE
WO2019075090A1 (en) 2017-10-10 2019-04-18 Tilos Therapeutics, Inc. Anti-lap antibodies and uses thereof
WO2019148412A1 (en) 2018-02-01 2019-08-08 Merck Sharp & Dohme Corp. Anti-pd-1/lag3 bispecific antibodies
CA3091174A1 (en) 2018-02-21 2019-08-29 Five Prime Therapeutics, Inc. B7-h4 antibody formulations
SG11202007820QA (en) 2018-02-21 2020-09-29 Five Prime Therapeutics Inc B7-h4 antibody dosing regimens
WO2019169212A1 (en) 2018-03-02 2019-09-06 Five Prime Therapeutics, Inc. B7-h4 antibodies and methods of use thereof
MX2020009526A (en) 2018-03-12 2020-10-28 Zoetis Services Llc Anti-ngf antibodies and methods thereof.
US11530432B2 (en) 2018-03-19 2022-12-20 Northwestern University Compositions and methods for rapid in vitro synthesis of bioconjugate vaccines in vitro via production and N-glycosylation of protein carriers in detoxified prokaryotic cell lysates
WO2019204346A1 (en) 2018-04-16 2019-10-24 Northwestern University METHODS FOR CO-ACTIVATING IN VITRO NON-STANDARD AMINO ACID (nsAA) INCORPORATION AND GLYCOSYLATION IN CRUDE CELLLYSATES
WO2020041483A1 (en) * 2018-08-21 2020-02-27 Clara Foods Co. Modification of protein glycosylation in microorganisms
CN112672760A (en) 2018-09-13 2021-04-16 德克萨斯大学体系董事会 Novel LILRB4 antibodies and uses thereof
EP3853251A1 (en) 2018-09-19 2021-07-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for the treatment of cancers resistant to immune checkpoint therapy
WO2020076969A2 (en) 2018-10-10 2020-04-16 Tilos Therapeutics, Inc. Anti-lap antibody variants and uses thereof
WO2020081497A1 (en) 2018-10-15 2020-04-23 Five Prime Therapeutics, Inc. Combination therapy for cancer
EP3877413A1 (en) 2018-11-06 2021-09-15 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of acute myeloid leukemia by eradicating leukemic stem cells
US20220064260A1 (en) 2018-12-14 2022-03-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Isolated mhc-derived human peptides and uses thereof for stimulating and activating the suppressive function of cd8+cd45rclow tregs
CN113597319A (en) 2019-01-04 2021-11-02 分解治疗有限责任公司 Treatment of xerosis with nuclease fusion proteins
WO2020148207A1 (en) 2019-01-14 2020-07-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Human monoclonal antibodies binding to hla-a2
WO2020234399A1 (en) 2019-05-20 2020-11-26 INSERM (Institut National de la Santé et de la Recherche Médicale) Novel anti-cd25 antibodies
CR20210607A (en) 2019-06-12 2022-01-21 Novartis Ag Natriuretic peptide receptor 1 antibodies and methods of use
MX2022000374A (en) 2019-07-11 2022-03-25 Clara Foods Co Protein compositions and consumable products thereof.
WO2021009263A1 (en) 2019-07-16 2021-01-21 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity for cd38 and uses thereof
US10927360B1 (en) 2019-08-07 2021-02-23 Clara Foods Co. Compositions comprising digestive enzymes
US20220356234A1 (en) 2019-10-02 2022-11-10 Alexion Pharmaceuticals, Inc. Complement inhibitors for treating drug-induced complement-mediated response
US20220363776A1 (en) 2019-10-04 2022-11-17 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical composition for the treatment of ovarian cancer, breast cancer or pancreatic cancer
US20230040928A1 (en) 2019-12-09 2023-02-09 INSERM (Institut National de la Santé et de la Recherche Médicale) Antibodies having specificity to her4 and uses thereof
IL294936A (en) 2020-01-21 2022-09-01 Yissum Res Dev Co Of Hebrew Univ Jerusalem Ltd Utilization of plant protein homologues in culture media
WO2021159024A1 (en) 2020-02-05 2021-08-12 Larimar Therapeutics, Inc. Tat peptide binding proteins and uses thereof
WO2021207449A1 (en) 2020-04-09 2021-10-14 Merck Sharp & Dohme Corp. Affinity matured anti-lap antibodies and uses thereof
WO2021219871A2 (en) 2020-04-30 2021-11-04 Aduro Biotech Holdings, Europe B.V. Anti-cd103 antibodies
JP2023525053A (en) 2020-05-12 2023-06-14 インサーム(インスティテュ ナシオナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシェ メディカル) A new method to treat cutaneous T-cell lymphoma and TFH-derived lymphoma
WO2021233834A1 (en) 2020-05-17 2021-11-25 Astrazeneca Uk Limited Sars-cov-2 antibodies and methods of selecting and using the same
JP2023528535A (en) 2020-06-25 2023-07-04 メルク・シャープ・アンド・ドーム・エルエルシー High Affinity Antibodies Targeting Tau Phosphorylated at Serine 413
CA3165342A1 (en) 2020-06-29 2022-01-06 James Arthur Posada Treatment of sjogren's syndrome with nuclease fusion proteins
WO2022029080A1 (en) 2020-08-03 2022-02-10 INSERM (Institut National de la Santé et de la Recherche Médicale) Population of treg cells functionally committed to exert a regulatory activity and their use for adoptive therapy
WO2022034044A1 (en) 2020-08-10 2022-02-17 Astrazeneca Uk Limited Sars-cov-2 antibodies for treatment and prevention of covid-19
JP2024504547A (en) 2020-11-20 2024-02-01 インセルム(インスティチュート ナショナル デ ラ サンテ エ デ ラ リシェルシェ メディカル) Anti-CD25 antibody
AR124123A1 (en) 2020-11-20 2023-02-15 Inst Nat Sante Rech Med ANTI-CD25 ANTIBODIES
WO2022130182A1 (en) 2020-12-14 2022-06-23 Novartis Ag Reversal binding agents for anti-natriuretic peptide receptor 1 (npr1) antibodies and uses thereof
JP2024503394A (en) 2021-01-08 2024-01-25 北京韓美薬品有限公司 Antibodies that specifically bind to 4-1BB and antigen-binding fragments thereof
EP4276113A1 (en) 2021-01-08 2023-11-15 Beijing Hanmi Pharmaceutical Co., Ltd. Antibody specifically binding to cd47 and antigen-binding fragment thereof
KR20230129483A (en) 2021-01-08 2023-09-08 베이징 한미 파마슈티컬 컴퍼니 리미티드 Antibodies and antigen-binding fragments that specifically bind to PD-L1
WO2022153212A1 (en) 2021-01-13 2022-07-21 Axon Neuroscience Se Antibodies neutralizing sars-cov-2
AR124681A1 (en) 2021-01-20 2023-04-26 Abbvie Inc ANTI-EGFR ANTIBODY-DRUG CONJUGATES
EP4313317A1 (en) 2021-03-23 2024-02-07 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the diagnosis and treatment of t cell-lymphomas
WO2022214681A1 (en) 2021-04-09 2022-10-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for the treatment of anaplastic large cell lymphoma
IL308134A (en) 2021-06-22 2023-12-01 Novartis Ag Bispecific antibodies for use in treatment of hidradenitis suppurativa
TW202342095A (en) 2021-11-05 2023-11-01 英商阿斯特捷利康英國股份有限公司 Composition for treatment and prevention of covid-19
EP4186529A1 (en) 2021-11-25 2023-05-31 Veraxa Biotech GmbH Improved antibody-payload conjugates (apcs) prepared by site-specific conjugation utilizing genetic code expansion
WO2023094525A1 (en) 2021-11-25 2023-06-01 Veraxa Biotech Gmbh Improved antibody-payload conjugates (apcs) prepared by site-specific conjugation utilizing genetic code expansion
WO2023110937A1 (en) 2021-12-14 2023-06-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Depletion of nk cells for the treatment of adverse post-ischemic cardiac remodeling
WO2023144303A1 (en) 2022-01-31 2023-08-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Cd38 as a biomarker and biotarget in t-cell lymphomas
WO2023187657A1 (en) 2022-03-30 2023-10-05 Novartis Ag Methods of treating disorders using anti-natriuretic peptide receptor 1 (npr1) antibodies
WO2023198648A1 (en) 2022-04-11 2023-10-19 Institut National de la Santé et de la Recherche Médicale Methods for the diagnosis and treatment of t-cell malignancies
WO2023198874A1 (en) 2022-04-15 2023-10-19 Institut National de la Santé et de la Recherche Médicale Methods for the diagnosis and treatment of t cell-lymphomas
CN115386009B (en) * 2022-04-26 2023-12-01 江苏靶标生物医药研究所有限公司 Construction method and application of annexin V and angiogenesis inhibitor fusion protein
WO2023209177A1 (en) 2022-04-29 2023-11-02 Astrazeneca Uk Limited Sars-cov-2 antibodies and methods of using the same
WO2023222886A1 (en) 2022-05-20 2023-11-23 Depth Charge Ltd Antibody-cytokine fusion proteins
WO2024003310A1 (en) 2022-06-30 2024-01-04 Institut National de la Santé et de la Recherche Médicale Methods for the diagnosis and treatment of acute lymphoblastic leukemia
EP4309666A1 (en) 2022-07-21 2024-01-24 Technische Universität Dresden M-csf for use in the prophylaxis and/or treatment of viral infections in states of immunosuppression
WO2024017998A1 (en) 2022-07-21 2024-01-25 Technische Universität Dresden M-csf for use in the prophylaxis and/or treatment of viral infections in states of immunosuppression
WO2024018046A1 (en) 2022-07-22 2024-01-25 Institut National de la Santé et de la Recherche Médicale Garp as a biomarker and biotarget in t-cell malignancies
WO2024023283A1 (en) 2022-07-29 2024-02-01 Institut National de la Santé et de la Recherche Médicale Lrrc33 as a biomarker and biotarget in cutaneous t-cell lymphomas
WO2024052503A1 (en) 2022-09-08 2024-03-14 Institut National de la Santé et de la Recherche Médicale Antibodies having specificity to ltbp2 and uses thereof
WO2024079192A1 (en) 2022-10-12 2024-04-18 Institut National de la Santé et de la Recherche Médicale Cd81 as a biomarker and biotarget in t-cell malignancies
CN115590017B (en) * 2022-11-04 2023-09-12 中国农业大学 Method for improving oocyte freezing effect by reducing mitochondrial temperature

Family Cites Families (115)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US513854A (en) * 1894-01-30 Clevis
US4166329A (en) * 1978-10-10 1979-09-04 Herbig Charles A Adjustable arch support for shoes
US4414329A (en) 1980-01-15 1983-11-08 Phillips Petroleum Company Biochemical conversions by yeast fermentation at high cell densities
NZ199722A (en) 1981-02-25 1985-12-13 Genentech Inc Dna transfer vector for expression of exogenous polypeptide in yeast;transformed yeast strain
US4617274A (en) 1981-10-29 1986-10-14 Phillips Petroleum Company Biochemical conversions by yeast fermentation at high cell densities
US4775622A (en) 1982-03-08 1988-10-04 Genentech, Inc. Expression, processing and secretion of heterologous protein by yeast
KR850004274A (en) 1983-12-13 1985-07-11 원본미기재 Method for preparing erythropoietin
US4655231A (en) * 1984-01-09 1987-04-07 Advanced Tobacco Products, Inc. Snuff and preparation thereof
US4808537A (en) 1984-10-30 1989-02-28 Phillips Petroleum Company Methanol inducible genes obtained from pichia and methods of use
US4837148A (en) 1984-10-30 1989-06-06 Phillips Petroleum Company Autonomous replication sequences for yeast strains of the genus pichia
US4879231A (en) 1984-10-30 1989-11-07 Phillips Petroleum Company Transformation of yeasts of the genus pichia
US4885242A (en) 1984-10-30 1989-12-05 Phillips Petroleum Company Genes from pichia histidine pathway and uses thereof
US4855231A (en) 1984-10-30 1989-08-08 Phillips Petroleum Company Regulatory region for heterologous gene expression in yeast
US5166329A (en) 1985-10-25 1992-11-24 Phillips Petroleum Company DNA encoding the alcohol oxidase 2 gene of yeast of the genus Pichia
US5032516A (en) 1985-10-25 1991-07-16 Phillips Petroleum Company Pichia pastoris alcohol oxidase II regulatory region
US4882279A (en) 1985-10-25 1989-11-21 Phillips Petroleum Company Site selective genomic modification of yeast of the genus pichia
US4818700A (en) 1985-10-25 1989-04-04 Phillips Petroleum Company Pichia pastoris argininosuccinate lyase gene and uses thereof
US4935349A (en) 1986-01-17 1990-06-19 Zymogenetics, Inc. Expression of higher eucaryotic genes in aspergillus
US5837518A (en) * 1986-01-31 1998-11-17 Genetics Institute, Inc. Thrombolytic proteins
US4812405A (en) 1986-02-18 1989-03-14 Phillips Petroleum Company Double auxotrophic mutants of Pichia pastoris and methods for preparation
US5272066A (en) 1986-03-07 1993-12-21 Massachusetts Institute Of Technology Synthetic method for enhancing glycoprotein stability
US4925796A (en) 1986-03-07 1990-05-15 Massachusetts Institute Of Technology Method for enhancing glycoprotein stability
US4857467A (en) 1986-07-23 1989-08-15 Phillips Petroleum Company Carbon and energy source markers for transformation of strains of the genes Pichia
US5002876A (en) 1986-09-22 1991-03-26 Phillips Petroleum Company Yeast production of human tumor necrosis factor
US4683293A (en) 1986-10-20 1987-07-28 Phillips Petroleum Company Purification of pichia produced lipophilic proteins
US4929555A (en) 1987-10-19 1990-05-29 Phillips Petroleum Company Pichia transformation
US5135854A (en) 1987-10-29 1992-08-04 Zymogenetics, Inc. Methods of regulating protein glycosylation
US4816700A (en) * 1987-12-16 1989-03-28 Intel Corporation Two-phase non-overlapping clock generator
US5004688A (en) 1988-04-15 1991-04-02 Phillips Petroleum Company Purification of hepatitis proteins
US5047335A (en) 1988-12-21 1991-09-10 The Regents Of The University Of Calif. Process for controlling intracellular glycosylation of proteins
US5122465A (en) 1989-06-12 1992-06-16 Phillips Petroleum Company Strains of pichia pastoris created by interlocus recombination
US5032519A (en) 1989-10-24 1991-07-16 The Regents Of The Univ. Of California Method for producing secretable glycosyltransferases and other Golgi processing enzymes
US5595900A (en) 1990-02-14 1997-01-21 The Regents Of The University Of Michigan Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids, or as free molecules, and for the isolation of cloned genetic sequences that determine these structures
US5324663A (en) 1990-02-14 1994-06-28 The Regents Of The University Of Michigan Methods and products for the synthesis of oligosaccharide structures on glycoproteins, glycolipids, or as free molecules, and for the isolation of cloned genetic sequences that determine these structures
DE4028800A1 (en) 1990-09-11 1992-03-12 Behringwerke Ag GENETIC SIALYLATION OF GLYCOPROTEINS
CA2058820C (en) 1991-04-25 2003-07-15 Kotikanyad Sreekrishna Expression cassettes and vectors for the secretion of human serum albumin in pichia pastoris cells
US5962294A (en) 1992-03-09 1999-10-05 The Regents Of The University Of California Compositions and methods for the identification and synthesis of sialyltransferases
US5602003A (en) 1992-06-29 1997-02-11 University Of Georgia Research Foundation N-acetylglucosaminyltransferase V gene
WO1994026906A2 (en) 1993-05-14 1994-11-24 The Upjohn Company CLONED DNA ENCODING A UDP-GALNAc:POLYPEPTIDE,N-ACETYLGALACTOS AMINYLTRANSFERASE
US5484590A (en) 1993-09-09 1996-01-16 La Jolla Cancer Research Foundation Expression of the developmental I antigen by a cloned human cDNA encoding a member of a β-1,6-N-acetylglucosaminyltransferase gene family
US6300113B1 (en) * 1995-11-21 2001-10-09 New England Biolabs Inc. Isolation and composition of novel glycosidases
US5683899A (en) 1994-02-03 1997-11-04 University Of Hawaii Methods and compositions for combinatorial-based discovery of new multimeric molecules
US6069235A (en) * 1994-02-23 2000-05-30 Monsanto Company Method for carbohydrate engineering of glycoproteins
US6204431B1 (en) 1994-03-09 2001-03-20 Abbott Laboratories Transgenic non-human mammals expressing heterologous glycosyltransferase DNA sequences produce oligosaccharides and glycoproteins in their milk
HU221001B1 (en) * 1994-03-17 2002-07-29 Merck Patent Gmbh. Anti-egfr single-chain fvs, anti-egfr antibodies
US5861293A (en) 1994-06-13 1999-01-19 Banyu Pharmaceutical Co., Ltd. Gene encoding glycosyltransferase and its uses
US5545553A (en) 1994-09-26 1996-08-13 The Rockefeller University Glycosyltransferases for biosynthesis of oligosaccharides, and genes encoding them
ATE209644T1 (en) * 1994-09-27 2001-12-15 Yamanouchi Pharma Co Ltd 1,2,3,4-TETRAHYDROQUINOXALINDIONE DERIVATIVES AND THEIR USE AS GLUTAMATE RECEPTOR ANTAGONISTS
DE4439759C1 (en) * 1994-11-07 1996-02-01 Siemens Ag Photodiode array for X=ray computer tomography
US5849904A (en) 1994-12-22 1998-12-15 Boehringer Mannheim Gmbh Isolated nucleic acid molecules which hybridize to polysialyl transferases
US5834251A (en) 1994-12-30 1998-11-10 Alko Group Ltd. Methods of modifying carbohydrate moieties
JP2810635B2 (en) 1995-04-03 1998-10-15 理化学研究所 New sugar chain synthase
JPH08336387A (en) 1995-06-12 1996-12-24 Green Cross Corp:The Sugar chain-extended protein derived from pichia yeast and dna of the protein
CZ89098A3 (en) * 1995-09-29 1998-09-16 Glycim Oy SYNTHETIC POLYLACTOSAMINES CONTAINING UP TO MULTIVALENT sLEX AND METHODS OF THEIR USE
JP3348336B2 (en) * 1995-10-26 2002-11-20 株式会社豊田中央研究所 Adsorption heat pump
US5910570A (en) 1995-11-13 1999-06-08 Pharmacia & Upjohn Company Cloned DNA encoding a UDP-GalNAc: polypeptide N-acetylgalactosaminy-ltransferase
CA2233705A1 (en) 1996-08-02 1998-02-12 The Austin Research Institute Improved nucleic acids encoding a chimeric glycosyltransferase
ES2235259T3 (en) 1996-12-12 2005-07-01 Kirin Beer Kabushiki Kaisha BETA-1-4 N-ACETYLGLUCOSAMINYLTRANSPHERASE AND GEN THAT CODIFIES IT.
US5945314A (en) 1997-03-31 1999-08-31 Abbott Laboratories Process for synthesizing oligosaccharides
US20040191256A1 (en) 1997-06-24 2004-09-30 Genentech, Inc. Methods and compositions for galactosylated glycoproteins
US7029870B1 (en) * 1997-07-03 2006-04-18 Human Genome Sciences, Inc. Gabaa receptor epsilon subunits
WO1999012944A2 (en) * 1997-09-05 1999-03-18 Glycim Oy SYNTHETIC DIVALENT sLex CONTAINING POLYLACTOSAMINES AND METHODS FOR USE
JPH11103158A (en) 1997-09-26 1999-04-13 Olympus Optical Co Ltd Flip-chip mounting to printed wiring board and mounting structure
US7244601B2 (en) 1997-12-15 2007-07-17 National Research Council Of Canada Fusion proteins for use in enzymatic synthesis of oligosaccharides
JPH11221079A (en) 1998-02-04 1999-08-17 Kyowa Hakko Kogyo Co Ltd Transglycosidase and dna encoding the same enzyme
WO1999040208A1 (en) 1998-02-05 1999-08-12 The General Hospital Corporation In vivo construction of dna libraries
ES2340112T3 (en) 1998-04-20 2010-05-28 Glycart Biotechnology Ag ANTIBODY GLICOSILATION ENGINEERING FOR THE IMPROVEMENT OF DEPENDENT CELLULAR CYTOTOXICITY OF ANTIBODIES.
US6324663B1 (en) * 1998-10-22 2001-11-27 Vlsi Technology, Inc. System and method to test internal PCI agents
US6870565B1 (en) 1998-11-24 2005-03-22 Micron Technology, Inc. Semiconductor imaging sensor array devices with dual-port digital readout
DK1137789T3 (en) * 1998-12-09 2010-11-08 Phyton Holdings Llc Process for preparing a glycosylation of human type glycosylation
EP1176195B1 (en) 1999-04-09 2013-05-22 Kyowa Hakko Kirin Co., Ltd. Method for controlling the activity of immunologically functional molecule
CN1379811A (en) * 1999-08-19 2002-11-13 麒麟麦酒株式会社 Novel yeast variants and process for producing glycoprotein containing mammalian type sugar chain
AU7849200A (en) 1999-10-01 2001-05-10 University Of Victoria Innovation And Development Corporation Mannosidases and methods for using same
AU1604401A (en) 1999-11-19 2001-05-30 Human Genome Sciences, Inc. 18 human secreted proteins
WO2001060860A2 (en) 2000-02-17 2001-08-23 Millennium Predictive Medicine, Inc. Genes differentially expressed in human prostate cancer and their use
US6410246B1 (en) * 2000-06-23 2002-06-25 Genetastix Corporation Highly diverse library of yeast expression vectors
US20060024304A1 (en) 2000-06-28 2006-02-02 Gerngross Tillman U Immunoglobulins comprising predominantly a Man5GlcNAc2 glycoform
US20060034828A1 (en) 2000-06-28 2006-02-16 Gerngross Tillman U Immunoglobulins comprising predominantly a GlcNAcMAN5GLCNAC2 glycoform
US20060034830A1 (en) 2000-06-28 2006-02-16 Gerngross Tillman U Immunoglobulins comprising predominantly a GalGlcNAcMan5GLcNAc2 glycoform
US8697394B2 (en) 2000-06-28 2014-04-15 Glycofi, Inc. Production of modified glycoproteins having multiple antennary structures
US7625756B2 (en) 2000-06-28 2009-12-01 GycoFi, Inc. Expression of class 2 mannosidase and class III mannosidase in lower eukaryotic cells
EP2322644A1 (en) 2000-06-28 2011-05-18 GlycoFi, Inc. Methods for producing modified glycoproteins
US7449308B2 (en) 2000-06-28 2008-11-11 Glycofi, Inc. Combinatorial DNA library for producing modified N-glycans in lower eukaryotes
US7863020B2 (en) 2000-06-28 2011-01-04 Glycofi, Inc. Production of sialylated N-glycans in lower eukaryotes
US20060029604A1 (en) 2000-06-28 2006-02-09 Gerngross Tillman U Immunoglobulins comprising predominantly a GlcNAc2Man3GlcNAc2 glycoform
US7795002B2 (en) 2000-06-28 2010-09-14 Glycofi, Inc. Production of galactosylated glycoproteins in lower eukaryotes
US20060257399A1 (en) 2000-06-28 2006-11-16 Glycofi, Inc. Immunoglobulins comprising predominantly a Man5GIcNAc2 glycoform
US7598055B2 (en) 2000-06-28 2009-10-06 Glycofi, Inc. N-acetylglucosaminyltransferase III expression in lower eukaryotes
EP1294910B1 (en) * 2000-06-30 2008-11-19 VIB vzw Protein glycosylation modification in pichia pastoris
US6946292B2 (en) 2000-10-06 2005-09-20 Kyowa Hakko Kogyo Co., Ltd. Cells producing antibody compositions with increased antibody dependent cytotoxic activity
US7064191B2 (en) * 2000-10-06 2006-06-20 Kyowa Hakko Kogyo Co., Ltd. Process for purifying antibody
JP4655388B2 (en) 2001-03-05 2011-03-23 富士レビオ株式会社 Protein production method
CA2448148A1 (en) 2001-05-25 2002-12-05 Incyte Genomics, Inc. Carbohydrate-associated proteins
EP2180044A1 (en) * 2001-08-03 2010-04-28 GlycArt Biotechnology AG Antibody glycosylation variants having increased anti-body-dependent cellular cytotoxicity
GB0120311D0 (en) * 2001-08-21 2001-10-17 Immunoporation Ltd Treating cells
CA2460621A1 (en) 2001-09-19 2003-03-27 Nuvelo, Inc. Novel nucleic acids and polypeptides
WO2003035835A2 (en) 2001-10-25 2003-05-01 Genentech, Inc. Glycoprotein compositions
US20060024292A1 (en) 2001-12-27 2006-02-02 Gerngross Tillman U Immunoglobulins comprising predominantly a Gal2GlcNAc2Man3GlcNAc2 glycoform
MXPA04006357A (en) 2001-12-27 2005-03-31 Glycofi Inc Methods to engineer mammalian-type carbohydrate structures.
US20060034829A1 (en) 2001-12-27 2006-02-16 Gerngross Tillman U Immunoglobulins comprising predominantly a MAN3GLCNAC2 glycoform
US7332299B2 (en) 2003-02-20 2008-02-19 Glycofi, Inc. Endomannosidases in the modification of glycoproteins in eukaryotes
US7514253B2 (en) 2003-05-16 2009-04-07 Glycofi, Inc. URA5 gene and methods for stable genetic integration in yeast
WO2005018539A2 (en) * 2003-06-16 2005-03-03 Medimmune Vaccines, Inc. Influenza hemagglutinin and neuraminidase variants
AU2004311545B2 (en) 2003-12-24 2008-11-06 Glycofi, Inc. Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins
US20070154591A1 (en) * 2003-12-30 2007-07-05 Lone Andersen Chewing gum comprising biodegradable polymers and having accelerated degradability
WO2005090552A2 (en) 2004-03-17 2005-09-29 Glycofi, Inc. Method of engineering a cytidine monophosphate-sialic acid synthetic pathway in fungi and yeast
WO2005089047A2 (en) 2004-03-18 2005-09-29 Glycofi, Inc. Glycosylated glucocerebrosidase expression in fungal hosts
AU2005238308B8 (en) 2004-04-29 2009-10-08 Glycofi, Inc. Methods for reducing or eliminating alpha-mannosidase resistant glycans in the production of glycoproteins
US7849651B2 (en) * 2005-05-31 2010-12-14 Kubota Matsushitadenko Exterior Works, Ltd. Wall materials bracket and insulating wall structure
WO2007028144A2 (en) 2005-09-02 2007-03-08 Glycofi, Inc Immunoglobulins comprising predominantly a glcnacman3glcnac2 glycoform
EP1954815B1 (en) * 2005-11-15 2015-02-25 GlycoFi, Inc. Production of glycoproteins with reduced o-glycosylation
US20080274162A1 (en) * 2007-05-04 2008-11-06 Jeffrey Nessa Method, composition, and delivery mode for treatment of prostatitis and other urogenital infections using a probiotic rectal suppository
TW201028431A (en) * 2008-10-31 2010-08-01 Lonza Ag Novel tools for the production of glycosylated proteins in host cells
JP2011039027A (en) * 2009-07-14 2011-02-24 Pacific Ind Co Ltd Metallic resin cover, method for producing the same, and door handle for vehicle
US9439972B2 (en) * 2012-09-10 2016-09-13 Ad Lunam Labs, Inc. Antifungal serum

Also Published As

Publication number Publication date
DE60114830D1 (en) 2005-12-15
DK1297172T3 (en) 2006-02-13
KR100787073B1 (en) 2007-12-21
US20060177898A1 (en) 2006-08-10
ATE440959T1 (en) 2009-09-15
NZ523476A (en) 2004-04-30
US20020137134A1 (en) 2002-09-26
WO2002000879A3 (en) 2002-09-06
DK1522590T3 (en) 2009-12-21
EP1297172B1 (en) 2005-11-09
CY1109639T1 (en) 2014-08-13
US20080274498A1 (en) 2008-11-06
ES2252261T3 (en) 2006-05-16
MXPA03000105A (en) 2004-09-13
DE60114830T2 (en) 2006-08-03
US7923430B2 (en) 2011-04-12
US7326681B2 (en) 2008-02-05
EP1522590A1 (en) 2005-04-13
US20160068880A1 (en) 2016-03-10
EP2322644A1 (en) 2011-05-18
US20140234902A1 (en) 2014-08-21
EP2339013A1 (en) 2011-06-29
PT1522590E (en) 2009-10-26
US7629163B2 (en) 2009-12-08
US20110020870A1 (en) 2011-01-27
AU2001276842B2 (en) 2007-04-26
US8211691B2 (en) 2012-07-03
EP2119793A1 (en) 2009-11-18
US20070178551A1 (en) 2007-08-02
US7981660B2 (en) 2011-07-19
US20060148035A1 (en) 2006-07-06
EP2339013B1 (en) 2014-07-02
WO2002000879A2 (en) 2002-01-03
ES2330330T3 (en) 2009-12-09
EP1522590B1 (en) 2009-08-26
US20060078963A1 (en) 2006-04-13
US7029872B2 (en) 2006-04-18
JP2004501642A (en) 2004-01-22
US20120322100A1 (en) 2012-12-20
JP2011167194A (en) 2011-09-01
AU7684201A (en) 2002-01-08
DE60139720D1 (en) 2009-10-08
US20100021991A1 (en) 2010-01-28
EP1297172A2 (en) 2003-04-02
KR20030031503A (en) 2003-04-21
US20130295604A1 (en) 2013-11-07
ATE309385T1 (en) 2005-11-15
US20070105127A1 (en) 2007-05-10

Similar Documents

Publication Publication Date Title
EP1297172B1 (en) Methods for producing modified glycoproteins
AU2001276842A2 (en) Methods for producing modified glycoproteins
AU2001276842A1 (en) Methods for producing modified glycoproteins
US8067551B2 (en) Combinatorial DNA library for producing modified N-glycans in lower eukaryotes
CA2650734A1 (en) Production of sialylated n-glycans in lower eukaryotes

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued

Effective date: 20170929