CA2577660A1 - Nucleic acid constructs and cells, and methods utilizing same for modifying the electrophysiological function of excitable tissues - Google Patents

Abstract

Polynucleotide expression constructs, populations of cells and methods of treating diseases caused by dysfunction in, or damage to, excitable tissues are provided.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

NUCLEIC ACID CONSTRUCTS AND CELLS, AND METHODS UTILIZING
SAME FOR MODIFYING THE ELECTROPHYSIOLOGICAL FUNCTION OF
EXCITABLE TISSUES
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to nucleic acid constructs and cells, and further to methods utilizing same for modifying the electrophysiological function of excitable tissues. More particularly, embodiments of the present invention relate to the use of cells having gap junctions and ion channels or transporters for modifying the electrophysiological function of excitable tissues.
The biological cell membrane, the interface between the cell and its environment, is a complex biochemical entity one of whose major involvement is the directed transport of specific substances. A related major involvement of the cell membrane is the maintenance of chemical gradients, particularly electrochemical gradients, across this interface. These gradients are of great functional significance (e.g., in the production of action potentials in nerve and muscle cells).
Ion channels are macromolecular protein pores, which span the cell membrane lipid bilayer. While approximately 30% of the energy expended in cells goes to maintain the ionic gradient across the cell membrane, it is the ion channel that dissipates this stored energy, much as a switch releases the electrical energy of a battery.
Ion channels are efficient compared to enzymes; small conformational changes gate a single channel between "closed" and "open" states, allowing up to 107 ions to flow in one second, amounting to approximately 10-12 Amperes of highly selected ions flow during the channel opening. Since they are efficient, the number of ion channels per cell is relatively low; a few thousand channels of a given subtype/cell are usually sufficient to perform their task while orders of magnitude higher numbers of receptors or enzymes are required to carry out their tasks.

Ion channels are usually classified by the type of ion they selectively pass (sodium, potassium, calcium, or chloride) although some are indiscriminate.
Different ion channels are activated (or gated) by either extracellular ligands, transmembrane voltage, or intracellular second messengers.

Ion channel conductance Conductance quantifies the ease with which ions flow through a material and is expressed in units of charge/sec/volt. Single channel conductance, g, as distinguished from the membrane conductance (G) of the entire population of channels, is defined as the ratio of single channel current amplitude (i ) to the electromotive force, or voltage (V):
g=i/V
The direction of ion movement through channels is governed by electrical and chemical concentration gradients. Entropy dictates that ions will flow passively through ion channels down a chemical gradient. Electrically charged ions will also move in an electrical field, just as ions in solution flow to one of the poles of a battery connected to the solution. The point at which the chemical driving force is just balanced by the electrical driving force is called the Nernst equilibrium (or reversal) potential. Above or below this point, a particular ion species will flow in the direction of the dominant force. The net electrical flow across a cell membrane is predictable given the concentrations of ions, the number, conductances, and selectivities of the channels, and their gating properties.
The modern method of deciphering ion channel function is by using patch clamp technology. In the patch clamp technique, a small polished electrode is pressed against the plasma membrane. For unknown reasons, the affinity between glass and cellular membrane is incredibly high; very few ions leak through this tight seal. In essence, the electrode isolates and captures all ions flowing through the 1-3 square microns of the cell membrane defined by the circular border of the glass pipette. The result is that the ionic current passing through a single ion channel can be collected and measured. The current through the attached patch (cell-attached), a detached patch (inside-out or outside-out), or the whole cell can be measured.

Ion channel building blocks Since ion channel function is easily measured in real time, most ion channels were cloned using the South African clawed toad (Xenopus laevis) oocyte. These oocytes are large enough to inject with exogenous mRNA and are capable of synthesizing the resulting foreign proteins. In expression cloning, in vitro transcripts (mRNA) from a cDNA library derived from a source of tissue/cell known to be rich in a particular current are injected into individual oocytes. The proteins encoded by this library are allowed several days to be translated and processed before the oocyte currents are measured by voltage clamp techniques. The cDNA
library (with - 1 million unique clones) is serially subdivided until injected messenger RNA from a single cDNA clone is isolated that confers novel ion channel activity. Moreover, mutant cDNA clones with engineered alterations in the protein's primary structure can be expressed and the ion channel properties studied in order to determine regions of the protein critical for channel activation, inactivation, ion permeation, or drug interaction.
The building blocks for most channel proteins are individual polypeptide subunits or domains of subunits each containing six hydrophobic transmembrane regions labeled S 1 through S6. The Na+ and Ca2+ channel pores are single (a) subunits in which 4 repeats of the six transmembrane spanning domain surround the pore. Voltage-gated K+ channels (Kv; nomenclature refers to K channel, voltage-dependent) are encoded by a tetramer of separate six-transmembrane spanning motifs. Coassembly of the linked domains form the central pore and confer the basic gating and permeation properties characteristic of the channel type. The peptide chain (H5 or P loop) juxtaposed between the membrane spanning segments S5 and S6 project into and line the water-filled channel pore. Mutations in this region alter the channel's permeation properties. S4 is probably the major channel voltage sensor since it contains a cluster of positively charged amino acids (lysines and arginines). Voltage-dependent channel inactivation is mediated by a tethered amino terminal blocking particle (called the ball and chain mechanism) which swings in to occlude the permeation pathway (inactivation). Amino acids in the transmembrane segment participate in another inactivation pathway named C-type inactivation.
The most recently discovered family of channel proteins are the inward rectifier K+-selective channels (Kir; K channel, inward rectifier). These channels determine the resting membrane potential in most cells because they are open at rest.

Kir channel topography is similar to the Kv channel class but the subunits lack the S 1 to S4 segments present in Kv channels. The two transmembrane spanning domain surrounding the conserved H5 pore domain is deceptively simple;
heteromultimeric channel formation, direct G protein gating, and interactions with other proteins by some Kir subtypes considerably increases the complex behavior of this channel class.
Ion transporters:
Yet another class of molecules which participate in ion transport across cellular membranes are the ion transporters. Ion transporters are integral membrane proteins capable of pumping one ion out of the cell while pumping another ion into the cell.
In, for example, Na/K ion transporters, the Na+ , K+ pump activity is the result of an integral membrane protein called the Na+ , K+ -ATPase. The Na+ , K+ -ATPase consists of a "catalytic" ?? subunit of about 100,000 daltons and a glycoprotein ?? subunit of about 50,000 daltons. When operating near its capacity for ion transport, the Na+ , K+ -ATPase transport three sodium ions out of the cell and transport two potassium ions into the cell for each ATP hydrolyzed. The cyclic phosphorylation and dephosphorylation of the protein causes it to alternate between two conformations, El and E2. In El the ion-binding sites of the protein have high affinity for Na+ and face the cytoplasm. In the E2 confonnation the ion-binding sites favor the binding of K+ and face the extracellular fluid.
Examples of other ion transporters include the Na/Ca exchange system which participates in regulation of intracellular Ca+; the Na/H exchange system which function in concert with a Cl/HCO3 exchange system to regulate intracellular pH;
and the Na-K-CI exchange system which contributes to smooth muscle function and which is regulated by a number of vasoactive agents.

Excitable tissues Myocardium: Myocardial contraction depends on the opening and closing of a complex series of ion channels in myocardial cell membranes.
The most prominent of these channels are the K+ Ca++ and Na+ ion channels.

The number of K+ ions is greater inside a resting myocardial cell than outside. But the number of Na+ ions is greater outside. When a myocardial cell beats, sodium channels open allowing a rapid, transient in-rush of Na+ ions, then close within about two one-thousandth's (2/1000) of a second. This depolarizes the 5 membrane with the positive ions moving in. Then there is then a slower, but prolonged (1/2 second), release of potassium to the outside of the cell which repolarizes the cell membrane.
Although myocardial contraction is more complex and involves other ions and channels, the end result of this depolarization-repolarization is that the contractile filaments in the cell engage, and the cell contracts.
Nerve cells: Signal propagation through neuronal cells is also governed by ion influx/outflux through nerve cell membranes. In nerve cells, Na+, Ca++ and K+ channels participate in the generation and pr'opagation of a nerve signal.
Glandular tissue: Secretion of glandular factors, such as hormones is in some cases effected by the excitation of secreting cells or tissues. For example, in the pancreas, T-type calcium channels along with cell-to-cell gap junctions participate in secretion of insulin.
Since ion channels participate in numerous physiological processes, damage to cells and/or channels of excitable tissues can be a cause for numerous disorders.
For example, heart conditions, such as reentrant arrhythmia, are brought about by the damage or death of myocardial cells, which can no longer support normal electrophysiological function. Secretion of factors from glandular tissue, such as insulin is also effected by damage to excitable cells forming this tissue, while nerve cell changes, as for instance in disorders such as; epilepsy severely effects nerve signal function.
The present invention provides a novel approach for modifying the electrophysiological property and thus the electrophysiological function of excitable tissues.
This novel approach, which according to one embodiment of the present invention utilizes cellular implants, can be utilized for restoring normal electrophysiological function to damaged tissues such as heart, nerve or glandular tissues.

SUMMARY OF THE INVENTION
According to one aspect of the present invention there is provided a nucleic acid construct comprising: (a) a first polynucleotide region encoding at least one first polypeptide capable of forming a functional ion channel or transporter when expressed within a cell; and (b) a second polynucleotide region encoding at least one second polypeptide capable of forming a functional gap junction when expressed within the cell.
According to further features in preferred embodiments of the invention described below, the nucleic acid construct further comprising at least one promoter being for directing the transcription of the first polynucleotide and the second polynucleotide.
According to still further features in the described preferred embodiments the at least one promoter is functional in mammalian cells.
According to still further features in the described preferred embodiments the at least one promoter is selected from the group consisting of a constitutive promoter, a tissue specific promoter, an inducible promoter and a developmentally regulated promoter.
According to still further features in the described preferred embodiments the first polynucleotide region and the second polynucleotide region are transcriptionally fused via an IRES sequence.
According to still further features in the described preferred embodiments the at least one first polypeptide and the at least one second polypeptide are translationally fused via at least one protease recognition site.
According to still fiuther features in the described preferred embodiments the at least one promoter includes two promoters, a first promoter for directing the transcription of the first polynucleotide and a second promoter for directing the transcription of the second polynucleotide.

According to another aspect of the present invention there is provided a nucleic acid construct system comprising: (a) a first nucleic acid construct including a first polynucleotide region encoding at least one first polypeptide capable of forming a functional ion channel or transporter when expressed within a cell;
and (b) a second nucleic acid construct including a second polynucleotide region encoding at least one second polypeptide capable of forming a functional gap junction when expressed within the cell.
According to still further features in the described preferred embodiments the first nucleic acid construct further includes a first promoter being for directing the transcription of the first polynucleotide and further wherein the second nucleic acid construct further includes a second promoter being for directing the transcription of the second polynucleotide.
According to still further features in the described preferred embodiments each of the first and the second promoters is functional in mammalian cells.
According to still further features in the described preferred embodiments each of first and the second promoters is independently selected from the group consisting of a constitutive promoter, a tissue specific promoter, an inducible promoter and a developmentally regulated promoter.
According to still further features in the described preferred embodiments there is provided a cell, cell culture or tissue explant transformed with the nucleic acid constructs described above.
According to still fitrther features in the described preferred embodiments the cell is selected from the group consisting of a fibroblast, a myoblast, an astroglial cell and an endothelial cell.
According to still further features in the described preferred embodiments the tissue explant is an organ tissue explant.
According to still further features in the described preferred embodiments there is provided a pharmaceutical composition comprising, as an active ingredient, the nucleic acid constructs described above.

According to still further features in the described preferred embodiments the ion channel is selected from the group consisting of a sodium ion channel, a potassium ion channel, a calcium ion channel and a chloride ion channel.
According to still further features in the described preferred embodiments the at least one first polypeptide is selected from the group consisting of a K
channel polypeptide, a Na channel polypeptide, a Ca channel polypeptide, a Cl channel polypeptide, a Na/K transporter polypeptide, a Na/Ca transporter polypeptide, a Na/H transporter polypeptide and a Cl/ HCO3 transporter polypeptide.
According to still further features in the described preferred embodiments the at least one second polypeptide is selected from the group consisting of connexin43, connexin45 and connexin26.
According to still another aspect of the present invention there is provided a method of modifying the electrophysiological function of an excitable tissue region of an individual, the method comprising the step of implanting cells into the excitable tissue region, each implanted cell being: (a) capable of forming gap junctions with at least one cell of the excitable tissue region; and (b) capable of forming a functional ion channel or transporter; the functional ion channel or transporter being capable of modifying the electrophysiological function of the excitable tissue region.
According to still further features in the described preferred embodiments the ion channel is selected from the group consisting of a sodium ion channel, a potassium ion channel, a calcium ion channel and a chloride ion channel.
According to still further features in the described preferred embodiments each implanted cell is transfected, prior to, or following implantation, with an exogenous polynucleotide expressing at least one polypeptide capable of forming the functional ion channel or transporter.
According to still further features in the described preferred embodiments each implanted cell is transformed, prior to, or following implantation, with an exogenous polynucleotide expressing at least one polypeptide capable of forming the gap junctions.

According to still further features in the described preferred embodiments expression of the at least one polypeptide from the exogenous polynucleotide is regulatable by an endogenous or an exogenous factor.
According to still further features in the described preferred embodiments an ion permeability of the functional ion channels is regulatable by an endogenous or an exogenous factor.
According to still further features in the described preferred embodiments the method further comprising the step of regulating the permeability of the functional ion channels, or the activity of the transporter to thereby regulate the electrophysiological function of the excitable tissue region.
According to still further features in the described preferred embodiments the step of regulating the permeability is affected by providing the exogenous factor to the excitable tissue region.
According to still further features in the described preferred embodiments each implanted cell is capable of forming the functional ion channel or transporter following induction.
According to still further features in the described preferred embodiments the excitable tissue region forms a part of an organ selected from the group consisting of a heart, a pancreas, a kidney, a brain and a liver.
According to still further features in the described preferred embodiments the method is utilized for regulating cardiac arrhythmia.
According to still fu.rther features in the described preferred embodiments the metliod is utilized for regulating secretion of endogenous factors from an organ including the excitable tissue region of the individual.
According to still further features in the described preferred embodiments the method is utilized for regulating neuronal discharge.
According to an additional aspect of the present invention there is provided a method of modifying the electrophysiological function of an excitable tissue region of an individual, the method comprising the step of expressing an exogenous polypeptide in at least a portion of cells forming a part of, or being in contact with, the excitable tissue region, the exogenous polypeptide being capable of forming functional ion channels or transporters within the at least a portion of the cells to thereby modify the electrophysiological function of the excitable tissue region.
According to still further features in the described preferred embodiments the method further comprising the step of expressing a second exogenous polypeptide in 5 the at least a portion of the cells, the second exogenous polypeptide being capable of forming functional pap junctions within the at least a portion of the cells.
According to still an additional aspect of the present invention there is provided a population of cells suitable for treating a glucose regulation disorder in a subject, the population of cells comprising cells expressing at least one exogenous 10 polypeptide forming: (i) a connexin channel; (ii) a depolarizing ion channel; and/or (iii) a non selective ion channel.
According to a further aspect of the present invention there is provided a population of cells suitable for treating cardiac arrhythmia in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming: (i) a sodium channel; (ii) a calcium channel; (iii) a leak ion channel; and/or (iv) a non-selective ion channel.
According to yet a further aspect of the present invention there is provided a population of cells suitable for prolonging a refractory period of a cardiac tissue in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming: (i) a connexin channel; (ii) a sodium channel; (iii) a potassium channel; and/or (iv) a chloride channel.
According to still a further aspect of the present invention there is provided a population of cells suitable for modulating neural excitability in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming: (i) a connexin channel; and/or (ii) a depolarizing ion channel.
According to still a further aspect of the present invention there is provided a population of cells suitable for increasing neural excitability in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming: (i) a hyperpolarizing ion channel; and/or (ii) connexin36.
According to still a fiirther aspect of the present invention there is provided a population of cells suitable for increasing pyramidal or purkinje cell coupling in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming: (i) connexin47; and/or (ii) a depolarizing ion channel.
According to still further features in the described preferred embodiments the subject suffers from cerebrovascular accident.
According to still a further aspect of the present invention there is provided a population of cells suitable for decreasing pyramidal or purkinje cell coupling in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming: (i) connexin47; and/or (ii) a hyperpolarizing ion channel.
According to still further features in the described preferred embodiments the subject suffers from epilepsy and/or phantom pain.
According to still further features in the described preferred embodiments the hyperpolarizing ion channel is selected from the group consisting of a potassium channel and a chloride channel.
According to still a further aspect of the present invention there is provided a method of treating glucose regulation disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling with pancreatic j3-islets, thereby treating the glucose regulation disorder in the subject.
According to still further features in the described preferred embodiments the cells are selected from the group consisting of mesenchymal stem cells, fibroblasts and embryonic stem cells. ' According to still further features in the described preferred embodiments the cells express at least one exogenous polypeptide forming: (i) a connexin channel; (ii) a depolarizing ion channel; and/or (iii) a non-selective ion channel, thereby treating insulin-deficiency in a subject.
According to still a further aspect of the present invention there is provided a method of treating insulin-deficiency in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with pancreatic 0-cells, the at least one exogenous polypeptide forming: (i) a connexin channel; and/or (ii) a depolarizing ion channel, thereby treating the insulin-deficiency in the subject.

According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with pancreatic (3-cells is effected by systemic administration of at least one polynucleotide encoding the at least one exogenous polypeptide, the at least one exogenous polynucleotide being operably linked to a pancreatic functional promoter.
According to still further features in the described preferred embodiments ein expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with pancreatic 0-cells is effected by localized administration of at least one polynucleotide encoding the at least one exogenous polypeptide.
According to still further features in the described preferred embodiments the depolarizing ion channel is selected from the group consisting of a sodium channel and a calcium channel and a non-selective ion channel.
According to still further features in the described preferred embodiments the sodium channel is an SCN channel.
According to still further features in the described preferred embodiments the calcium channel is selected from the group consisting of an L-type calcium channel, a T-type calcium channel and an N-type calcium channel.
According to still further features in the described preferred embodiments the non-selective ion channel is an HCN channel.
According to still further features in the described preferred embodiments connexin channel is selected from the group consisting of connexin36, connexin4O, connexin43 and connexin 45.
According to still further features in the described preferred embodiments the subject suffers from type 2 diabetes mellitus.
According to still a further aspect of the present invention there is provided a method of treating cardiac arrhythmia in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling a cardiac tissue of the subject, thereby treating the cardiac arrhythmia in the subject.

According to still further features in the described preferred embodiments the cells are selected from the group consisting of mesenchymal stem cells, fibroblasts, myoblasts and embryonic stem cells.
According to still farther features in the described preferred embodiments' the cells express at least one exogenous polypeptide forming: (i) a sodium channel;
(ii) a calcium channel; (iii) a leak ion channel; and/or (iv) a non-selective ion channel.
According to still a further aspect of the present invention there is provided a method of treating cardiac arrhythmia in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with cardiac tissue, the at least one exogenous polypeptide forming: (i) a sodium channel; (ii) a calcium channel; (iii) a leak ion channel; and/or (iv) a non-selective ion channel, thereby treating cardiac arrhythmia in a subject.
According to still further features in the described preferred embodiments the subject suffers from bradycardia and/or atrial fibrillation.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the cardiac tissue is effected by systemic administration of at least one polynucleotide encoding the at least one exogenous polypeptide, the at least one exogenous polynucleotide being operably linked to a cardiac functional promoter.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the cardiac tissue is effected by localized administration of at least one polynucleotide encoding the at least one exogenous polypeptide.
According to still a further aspect of the present invention there is provided a method of treating a disease treatable by increasing the refractory period of a cardiac tissue in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling with a cardiac tissue of the subject, thereby treating the disease treatable by increasing the refractory period of a cardiac tissue in the subject.
According to still further features in the described preferred embodiments the cells are selected from the group consisting of myoblasts, fibroblasts, mesenchymal stem cells and embryonic stem cells.
According to still further features in the described preferred embodiments the cells express at least one exogenous polypeptide forming: (i) a connexin channel; (ii) a sodium channel; (iii) a potassium channel; and/or (iv) a chloride channel.
According to still further features in the described preferred embodiments administering to the subject is effected at a location selected from the group consisting of an AV node and an AV node area, AV nodal artery, specific coronary artery feeding an arrhythmogenic area, ventricles, atrias and anterior right atrial branch of right coronary artery.
According to still further features in the described preferred embodiments administration to the subject is effected by epicardial during surgery, trans-catheter injection to coronary artery using balloon catheter, or trans-catheter injection using injecting catheter.
According to still a further aspect of the present invention there is provided a method of treating a disease treatable by increasing the refractory period of a cardiac tissue in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with a cardiac tissue of the subject, the at least one exogenous polypeptide forming:
(i) a connexin channel; (ii) a sodium channel; (iii) a potassium channel; and/or (iv) a chloride channel, thereby treating the disease treatable by increasing the refractory period of the cardiac tissue in a subject.
According to still further features in the described preferred embodiments the disease is selected from the group consisting of atrial fibrillation, atrial flutter, atrial tachycardia and ventricular tachycardia.

According to still further features in the described preferred embodiments connexin channel is selected from the group consisting of connexin4O, connexin43 and connexin45.
According to still further features in the described preferred embodiments the 5 sodium channel is a mutated SCN5A channel.
According to still further features in the described preferred embodiments the SCN5A channel has a mutation selected from the group consisting of AKPQ, N1325S, R1644H, E1295K, D1790G and ins1795.
According to still further features in the described preferred embodiments the 10 potassium channel is a voltage gated potassium channel or an inward rectifier channel.
According to still further features in the described preferred embodiments the voltage gated potassium channel is a Kv1.3 or a mutant thereof.
According to still further features in the described preferred embodiments the 15 mutant of Kvl.3 is Kvl.3 H401 W.
According to still further features in the described preferred embodiments the inward rectifier channel is a KCNH channel.
According to still further features in the described preferred embodiments the KCNH channel is selected from the group consisting of Kir4.1, Kir7.1, Kirl.1, Kir2. 1, Kir5. 1, Kir6.1 and Kir8. 1.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the cardiac tissue is effected by systemic administration of at least one polynucleotide encoding the at least one exogenous polypeptide, the at least one exogenous polynucleotide being operably linked to a cardiac functional promoter.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the cardiac tissue is effected by localized administration of at least one polynucleotide encoding the at least one exogenous polypeptide.

According to still further features in the described preferred embodiments the administering is effected at a location selected from the group consisting of an AV
node and an AV node area, AV nodal artery, specific coronary artery feeding an arrhythmogenic area, ventriclesi atrias and anterior right atrial branch of right coronary artery.
According to still a further aspect of the present invention there is provided a method of treating a disease treatable by modulating neural excitability in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling with a neural tissue of the subject, thereby treating the disease treatable by modulating neural excitability in the subject.
According to still further features in the described preferred embodiments modulating neural excitability is decreasing neural excitability.
According to still further features in the described preferred embodiments the cells are selected from the group consisting of fibroblasts, microglia, oligodendrocytes, astroglia, mesenchymal stem cells and embryonic stem cells.
According to still further features in the described preferred embodiments the cells express at least one exogenous polypeptide forming: (i) a connexin channel;
and/or (ii) a depolarizing ion channel; and/or (iii) a hyperpolarizing ion channel.
According to still further features in the described preferred embodiments the site is selected from the group consisting of an external globus pallidum, striatum, subthalamic nucleus, internal globus pallidus, nigra reticulate and zona increta.
According to still further features in the described preferred embodiments administering is effected using a delivery route selected from the group consisting of direct injection during a neurosurgery procedure and trans-catheter through neural arteries.
According to still a further aspect of the present invention there is provided a method of treating a disease treatable by modulating neural excitability in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with a neural tissue of the subject, the at least one exogenous polypeptide forming: (i) a connexin channel;

and/or (ii) a depolarizing ion channel, ; and/or (iii) a hyperpolarizing ion channel, thereby treating the disease treatable by decreasing neural excitability in the subject According to still further features in the described preferred embodiments the connexin channel is selected from the group consisting of connexin32, connexin36, connexin43 and connexin47.
According to still further features in the described preferred embodiments the disease is Parkinson's disease and/or epilepsy.
According to still further features in the described preferred embodiments expressing is effected at a site capable of generating an epileptic stimulus.
According to still further features in the described preferred embodiments the site is selected from the group consisting of an external globus pallidum, striatum, subthalamic nucleus, internal globus pallidus, nigra reticulate and zona increta.
According to still further features in the described preferred einbodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the neural tissue is effected by systemic administration of at least one polynucleotide encoding the at least one exogenous polypeptide, the at least one exogenous polynucleotide being operably linked to a neural functional promoter.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the neural tissue is effected by localized administration of at least one polynucleotide encoding the at least one exogenous polypeptide.
According to still a further aspect of the present invention there is provided a method of treating a disease treatable by increasing neural excitability in a subject, the method comprising administering to the subject a therapeutically effective amount of cells expressing at least one exogenous polypeptide forming: (i) a hyperpolarizing ion channel; and/or (ii) connexin36, thereby treating the disease treatable by increasing neural excitability in the subject According to still further features in the described preferred embodiments the cells are selected from the group consisting of fibroblasts, microglia, oligodendrocytes, astroglia, mesenchymal stem cells, and embryonic stem cells.
According to still a further aspect of the present invention there is provided a method of treating a disease treatable by increasing neural excitability in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with a neural tissue of the subject, the at least one exogenous polypeptide forming: (i) a hyperpolarizing ion channel; and/or (ii) connexin36, thereby treating the disease treatable by increasing neural excitability in the subject According to still further features in the described preferred embodiments the disease is a neurodegenerative disorder.
According to still further features in the described preferred embodiments the neurodegenerative disorder is Alzheimer's disease.
According to still further features in the described preferred embodiments the hyperpolarizing ion channel is a potassium channel or a chloride channel.
According to still further features in the described preferred embodiments the potassium channel is a Kv channel, a Kir channel, an acetylcholine receptor channel and a HERG channel.
According to still further features in the described preferred embodiments the chloride channel is a CIC channel.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the neural tissue is effected by systemic administration of at least one polynucleotide encoding the at least one exogenous polypeptide, the at least one exogenous polynucleotide being operably linked to a neural functional promoter.
According to still further features in the described preferred embodiments expressing the at least one exogenous polypeptide in at least the subset of cells forming a part of, or being in contact with the neural tissue is effected by localized administration of at least one polynucleotide encoding the at least one exogenous polypeptide.
According to still further features in the described preferred embodiments expressing is effected at a site selected from the group consisting of subthalamic nucleous, internal globus pallidum, zona increta, nigra reticulate, external globus pzallidum and nuclei..
The present invention successfully addresses the shortcomings of the presently known configurations by providirig a novel approach for modifying the electrophysiological function of excitable tissues.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

In the drawings:
FIGs. la-f illustrate results from experiments performed on large random cortical networks cultured on substrate-embedded multi-electrode arrays (MEA).
Figure la-b - an image illustrating four out of sixty electrodes and the somata of numerous neurons growing on the surface (la) and a magnification of a region thereof (lb). In the magnified image (lb) the richness of the connective (axo-dendritic) network is evident. Scale bar: 30 ?m. Figure lc - exemplifies an action potential recorded from one electrode. The two parallel lines represent Jz8RMS
units for this particular electrode. Network response to focal stimulation.
Figures 1d-e illustrate a reverberating response of the network to focal stimuli. A
typical stimulus pulse lasts 420 ?Sec, and its amplitude is 50 ?A. The traces were recorded simultaneously from different electrodes. Note the reverberating response to a stimulus (enlarged in Figure 1 e) which lasts 100 milliseconds or more. Figure 1 f is a graph illustrating the connectivity in cultured networks. The average number (four 5 networks) of significantly occurring activity pairs formed between ten randomly chosen active (>0.2Hz of spontaneous activity) electrodes. This number, normalized to the maximal number of possible activity pairs, is depicted as ftaction connected, and shown to decrease as a function of within-pair time delay (o). Inset:
Given an A
-->B activity pair, the forecasting of B by A, which is the strength of the functional 10 connectivity between the two, is given in terms of a correlation coefficient. This correlation is calculated from the number of times that the given pair appears within 1 hour, divided by the number of occurrences of A OR B. The average (n=4) functional connectivity strength as a function of o is shown.
FIG. 2a illustrates epileptic activity recorded from MEA in a mature (3 weeks 15 in vitro) cultured cortical network. The network is prepared and recorded from as explained in Figure 1. The recorded spontaneously bursting synchronous activity throughout the network is a characteristic feature of epileptic-like activity in networks of neurons.
FIG. 2b illustrates an expanded time scale of the activity marked by the red 20 box (left side) revealing a complex structure of a single burst.
FIG. 3 illustrates the dose response to charybdotoxin of the Kvl.3 potassium channel.
FIG. 4a illustrates a diffused fibroblast seeding pattern on multi electrode array (fibroblasts.in red).
FIG. 4b illustrates a clustered fibroblast seeding pattern on multi electrode array.
FIG. 5 illustrates the CTX frequency response of cultured cardiomyocytes (square), cardiomyocytes co-cultured with fibroblasts NIH 3T3 (dot) and cardiomyocytes co-cultured with fibroblasts (NIH 3T3) transfected with voltage gated potassium channel Kvl.3 coding sequence (triangle). c-no. of cultures; n-no.

of measurements (without fibroblast - c=8; n=16, NIH 3T3 - c=6; n=47, Kv1.3 -c=6;
n=43, error bar - standard error).
FIG. 6a is a fluorescent image of a cardiomyocytes co-cultured with fibroblasts transfected with Kv1.3 channel coding sequences and labeled with Fast DiO (MAE cluster seeding pattern). The blue dot marks electrode 28 and the red dot marks electrode 53.
FIGs. 6b-c represent a two second recording of synchronous extracellular activity prior to seeding of the fibroblasts described in Figure 6a. Figure 6b-recording from electrode 28; Figure 6c- recording from electrode 53;
FIGs. 6d-e represent a two second recording of uncoupled extracellular activity following seeding of the fibroblasts described in Figure 6a and prior to treatment with CTX. Figure 6d- recording from electrode 28; Figure 6e-recording from electrode 53;
FIG. 6f-g represent a two second recording of extracellular activity following seeding of the fibroblasts described in Figure 6a and treatment with CTX 100 nM
which reverses uncoupling effect. Figure 6f- recording from electrode 28;
Figure 6g-recording from electrode 53;
FIG. 7a is a fluorescent image of cardiomyocytes co-cultured with fibroblasts transfected with Kv1.3 channel coding sequences and labeled with Fast DiO on a MEA (cluster seeding pattern).
FIG. 7b illustrates an activation map constructed prior to seeding of the fibroblasts described in Figure 7a.
FIG. 7c is an activation map constructed five days following seeding of the fibroblasts described in Figure 7a and prior to treatment with CTX
illustrating the appearance of a conduction block.
FIG. 7d is an activation map constructed five days following seeding of the fibroblasts described in Figure 7a and following treatment with CTX 10 nM
illustrating the reversal of the conduction block.
FIG. 8 illustrates the conduction velocity change throughout an experiment with seeded fibroblasts (in blue - myocytes with fibroblasts transfected with Kvl.3, in brown - myocytes with fibroblast without Transfection (control 1), in yellow -myocytes without fibroblast (control 2)) ; fibroblasts where seeded following measurements at day 1; Kvl.3 c=4, NIH 3T3 c=3, without fib c=1 error bar -standard error.
FIG. 9 illustrates the amplitude change throughout the experiment illustrated in Figure 8; fibroblasts where seeded following measurements at day 1; Kv1.3 c=3, NIH 3T3 c=3 error bar - standard error.
FIG. 10 illustrates the development of a conduction block in MEA seeded fibroblasts following measurement at day 0. A substantial increase in the conduction block factor was recorded from the culture including the fibroblast transfected with potassium channels (Kv1.3) (pink, n=5), while in the non-transfected fibroblast culture a decrease in the conduction block factor was recorded (blue, n=6).
FIG.11 illustrates the effects of Charybdotoxin (specific blocker of potassium channel Kvl.3) on conduction blocks. In co-cultures incluidng fibroblasts transfected with Kvl.3, application of Charybdotoxin substantialy decreased the conduction block factor (pink, n=10), while in co-cultures incluidng non-transfected fibroblasts, a minimal response was recorded (blue, n=9).
FIG. 12a is a fluorescent image of MEA cultured cardiomyocytes and fibroblasts labeled with Fast DiO (cluster seeding pattern).
FIG. 12b illustrates an activation map constructed prior to seeding of the fibroblasts described in Figure 12a.
FIG. 12c illustrates an activation map constructed five days following seeding of the fibroblasts described in Figure 12a and prior to treatment with CTX, no conduction block is apparent.
FIG. 12d illustrates an activation map constructed five days following seeding of the fibroblasts described in Figure 12a and following treatment with CTX
(10 nM); no appreciable change from the activation map of Figure 12c is evident.

FIG. 13 is a photomicrograph depicting PCR screening of Navl.5-expressing fibroblasts. Lanel: DNA .ladder. Lane 2: Negative control wherein the PCR
reaction mixture includes N-terminus primer with no DNA template. Lane 3 : Negative control the PCR reaction mixture includes only C-terminus primers with no DNA
template.

Lane 4: positive control N-terminus primers with pcDNA3/Navl.5 plasmid. Lane 5:
positive control C-terminus primers with pcDNA3/Nav1.5 plasmid. Lane 6:NIH/3T3 fibroblasts transfected with pcDNA3/Nav1.5 with N-terminus Nav1.5. Lane 7:
NIH/3T3 fibroblasts transfected with pcDNA3/Navl.5 with C-terminus Navl.5.
FIGs. 14a-b are graphs depicting voltage clamp recordings from transfected fibroblasts preformed in holding potential of -100mV (Figure 14a) and a corresponding I-V curve (Figure 14b).
FIG. 15 is a graph depicting plasma glucose concentration during IVGTT in genetically manipulated rats (squares and triangles) and in control treated rats (circles).
FIG. 16 is a bar graph depicting plasma insulin levels in 3 different time points during the IVGTT in genetically manipulated rats (gray) and in control treated rats (black).
FIG. 17 is a photomicrograph depicting genetically manipulated fibroblasts (red) in pancreatic tissue slice as detected by histological analysis.
FIGs. 18a-b are graphs depicting the effect of Kvl.3 overexpressing fibroblasts on the average spontaneous beating rate of the rat heart (Figure 18a) and reversion of this effect by the administration of an ion channel blocker (Figure 18b).
FIG. 19a is a representative ECG recording depicting changes in LV effective refractory period (ERP) of rats following grafting of fibroblasts transfected to express the voltage sensitive potassium channel Kvl.3 channel. Note the significant increase in the LV ERP at the site of cell transplantation (middle trace) when compared to the baseline recording (top). This change was reversed following application of the specific blocker of the Kvl.3 channel Margatoxin (bottom trace). Arrows indicate ERP interval.
FIG. 19b is a bar graph summarizing the measured effective refractory period (ERP) in rats grafted with naive fibroblasts (black), genetically manipulated fibroblasts (stripes_ and following treatment with an ion channel blocker . In black, the control group of animals transplanted with non transfected fibroblasts.
Note, ERP

increased in the study group from 84 8.08 ms to 154 13.04 ms (P<0.05) 7 days after transplantation and decreased to 117 7.70 ms after the administration of Margatoxin.

In the control group, no significant changes in ERP were observed.
FIGs 20a-b depict changes in LV ERP of pigs grafted with naive or fibroblasts transfected to express the voltage sensitive potassium channel Kv1.3 channel.
Figure 20a - note the middle trace, where the stimulus fails to activate the ventricle.
Following the administration of Margatoxin, the ERP decreased to a near baseline value. Figure 20b summarizes the changes in the ventricular ERP in the swine model.
Black bar - ERP 7 days after transplantation of Kvl.3 expressing cell. Note the significant increase in ERP in comparison to the control area and the decrease to near baseline values after the administration of Margatoxin.
FIGs. 21a-b are photomicrographs showing the presence of grafted cells within the rat myocardium, as detected by immunostaining. Figure 21 a shows immunostaining of the transplanted area in the rat myocardium. The grafted cells were labeled before transplantation with the fluorescent cell tracker CFDA (green).
Note the presence of the grafted cells (green stained cells) along the needle track. Host cardiomyocytes can be identified by the positive staining with anti-cardiac troponin I
antibodies (red cells). Cell nuclei were counterstained with ToPro3 (blue).
Figure.
21b shows immunostaining of connexin 43 (green punctuate staining) showing the development of gap junctions (arrows) between host cardiomyocytes (red cells, positively stained with anti-cardiac troponin I antibodies) and the grafted fibroblasts (which were labeled with DAPI before transplantation and can be identified by their blue labeled nuclei).
FIG. 22 is a one-dimensional passive electrical circuit model. Myo A-E are the myocytes and the fibroblast connects to myo C(ro - extracellular resistance, Cm -membrane capacitance, rmyo, rfib - longitudinal resistances, Rgapmm -resistance between myocytes, Rgapft - resistance between myocyte and fibroblast), le the over expressed ion current.
FIGs. 23a j depict computer simulation of voltage clamp from cells expressing (Figure 23a) Kvl.3 channels, (Fifure 23b) Kir2.l channels, (Figure 23c) SCN5A
AKPQ channels and (Figure 23d) Mut Kvl.3 H401 W Vs WT Kv1.3. Also shown is the refractory period in fibroblasts overexpressing (Figure 23e) Kvl.3 channels (ERP=425 25 ms), (Figure 23f) Kir2. i channels (ERP=475 25 ms), (Figure 23g) SCN5A ? KPQ sodium channels (ERP=425 zL 25 ms), (Figure 23h), in native fibroblasts (i.e., without transfection, ERP=375 25 ms), (Figure 23i) in the absence of fibroblasts (ERP=375 125 ms), and in fibroblasts overexpressing (Figure 23j) Mut Kvl.3 H401 W channels (ERP=500 25 ms). Blue - Myo E membrane potential, Red 5 - stimulus current.
FIGs. 24a-d are graphs depicting voltage recordations of Kvl.3 or mutant Kvl.3/H401 W expressing cells, as determined by patch clamp analysis. Figures 24a-b show voltage clamp recordations from WT Kvl.3 (Figure 24a) and mutant Kvl.3/H401 W(Figure 24b) transfected NIH/3T3 fibroblasts performed at holding 10 potential of -100mV. Figures 24c-d show tail current recorded from WT Kvl.3 (Figure 24c) and Mutant Kvl.3/H401W (Figure 24d).
FIGs. 25a-b are bar graphs depicting in vivo effective refractory period (ERP) of pigs transplanted with naive fibroblasts or Kvl.3, mutant Kvl.3/H401 W
potassium channel or Kir2.1. Figure 25a shows Cardiac ventricular electrophysiological 15 modulation in pigs: control area (Control), fibroblasts transfected with GFP (Fib-GFP), fibroblasts overexpressing Kvl.3 potassium channel (WT Kvl.3), Mut Kvl.3 (H401 W), and Kir2.1. Note, that the H401 W and the Kir2.1 groups are not significantly different from each other, however, they are both significantly longer then the control, the Fib-GFP, and the WT Kvl.3 groups (P<0.05). Figure 25b shows 20 computer simulation depicting Effective refractory Period without fibroblast, with fibroblast without transfection, with fibroblast over expressing WT Kvl.3, or Mut Kvl.3 H401 W, or Kir2.1.
FIG. 26a shows activation map of the right atria using the Carto system. Pink ball marks the bundle of His.

25 FIG. 26b shows the AV node effective refractory period was 240 10 ms at baseline, 265 +15 ms a week following transplantation that was reduces to 250 ms following application of Margatoxin (MTX - a specific blocker of Kvl.3 channel).
Two weeks following transplantation the ERP was 281.5 1.5 ms and was reduced to 225 40 ms following MTX administration (n=2).
FIGs. 27a-d are light (Figures 27b, d) and fluorescent (Figures 27a, c) microscope images depicting Cx36-GFP expression in NIH 3T3 fibroblasts. Figure 27a - shows an NIH/3T3:Cx36-GFP clone stained with anti-GFP. Figure 27b shows a DIC image of the field of Figure 27a. Figure 27c shows a naive NIH/3T3 cell stained with anti-GFP. Figure 27d shows a DIC image of the field of Figure 27c.
FIGs. 28a-e show dye coupling in Cx36-GFP modified fibroblasts (Figures 28b, d) and in naive fibroblasts (Figures 28a, c). Calcein AM is shown in green and DID is shown in red. Summary of the fluorescent intensity of acceptor fibroblasts in NIH/3T3 co cultures versus NIH/3T3:Cx36 co cultures is shown in Figure 28e.
Note, only acceptors located less than 5 m apart from the donor were used for the analysis.
FIGs. 29a-g are fluorescent and light microscope images showing the ability of Cx36-expressing fibroblasts to create gap junctions with neurons. Figure 29a shows imaging of cultured hippocampus neurons before seeding of donor fibroblasts.
Note, almost no fluorescent signal is oberved. Figure 29b shows an image of the same field as of Figure 29a immediately following Calcein-AM preloaded donor fibroblasts seeding. Note, the fibroblasts demonstrate clear fluorescent signal Figure 29c shows the same field (Figures 29a-b) 42 minutes following donor fibroblast were seeding.
Note, the initiation of branching. Figure 29d is an image of the same field (Figures 29a-c) 162 minutes following donor fibroblast seeding. Figure 29e is an image of a different field 4 hours following donor fibroblast seeding. The arrow head is showing a hippocampal neuron filled with Calcein AM. Figure 29f is an image of the DID
dye at the same field (Figure 29e). Figure 29g is a DIC image of the same field (Figures 29e-f).
FIGs. 30a-b are whole cell records (current Figure 30a; and voltage Figure 30b) from a NIH:CX36-GFP:Kvl.3:H401 W clone. The whole cell patch clamp technique was used to characterize currents presented by modified fibroblasts.
Currents were elicited by 200 ms pulses from holding potential of -80 mV to -90 mv and then to 110 mV in increments of 20 mV. Note, Kvl.3:H401W currents are characterized by fast inactivation kinetics as compared to the wild type Kvl.3 currents.
FIGs. 31a-b are bar graphs showing the ability of CX36:Kv1.3:H401W
expressing fibroblasts to modulate the electrical discharge of cultured neurons. Figure 31a shows electrophysiological records from cortical neurons culture prior to fibroblast seeding. Figure 31b shows electrophysiological records from cortical neuron culture 3 days following fibroblast seeding. Each column presents number of spikes in 8 minutes. Note, a significant decline in spikes is observed following fibroblast seeding.
FIG. 32 is a bar graph depicting in vivo modulation of glutamate levels by GFP expressing fibroblasts (GFP), and Cx36-GFP-Kir2.1 expressing fibroblasts (study) as well as in control samples (medium). Cells were implanted to the globus pallidum (GPe) of the rats. One week following cells implantation, glutamate levels were measured at the globus pallidum nucleus (GPi). Once achieving stable glutamate levels, a D2 receptor antagonist was administrated. Note, all animals at the study group showed significant elevation in glutamate levels. In contrast all control animals showed decline in glutamate levels.
FIGs. 33a-b are graphs depicting rotations sum during the 15 minute peak before and following cell implantation. Figure 33a shows the rotational behavior of rats treated with fibroblasts co-transfected with Cx36 and Kvl.3 H401W. Figure 33b shows the rotational behavior of non-transplanted rats. Note, two of the five treated rats rotated substantially less 10 days following cell implantation (CI-1) as compared to their baseline levels at 4 and 5-weeks post induction. At the same time none of the control group rats (Figure 33b) displayed a reduction in rotation levels.

DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is of nucleic acid constructs and cells, and of methods utilizing same for modifying the electrophysiological function of excitable tissues.
Specifically, the present invention can be used to restore normal electrophysiological function to cells or tissues of, for example, damaged myocardium, neurons and secretory glands.
The principles and operation of the present invention may be better understood with reference to the accompanying descriptions.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of the components set forth in the following description. The invention is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting.
Since electrophysiological function of excitable tissues is governed by the quantity and type of ion channels present in the membrane of cells forming the excitable tissue, as well as the presence of gap junctions networking these cells, the present inventors propose that the electrophysiological function of any excitable tissue region can be modified by either expressing ion channel/transporter polypeptide(s) and/or gap junction polypeptide(s) within cells forming a part of, or being in contact with, the excitable tissue region; and/or by implanting cells (transformed or non-transformed) which are capable of electrical coupling with the excitable tissue.
As is illustrated hereinbelow and in the Examples section which follows, the present inventors successfully showed that ion channel over-expressing cells may be used to locally modulate the electrophysiological properties of a cardiac tissue. Ion channels over-expressing fibroblasts (e.g., Kvl.3, Kvl.3 H401W, Kir2.1) were able to significantly prolong ERP of pigs hearts, substantiating their use as biological pace-makers (Examples 8-9). The present inventors further showed that ion-channel and/or gap junction (e.g., potassium channel, Cx36) over-expressing fibroblasts are capable of modulating neural network discharge both in vitro and in vivo.
Specifically, such modified fibroblasts were able to electrically couple with cultured cortical neurons and to reduce the number of electrically-fired spikes, in a reversible manner.
These results were in vivo substantiated, where genetically modified fibroblasts were able to modulate the neural output (as measured by glutamate levels) of the GPe. The therapeutic effect of cells of the present invention was shown in a Parkinson's disease (PD) animal model, in which implantation of such cells to rat GPi and SNr caused a significant reduction in the number of amorphine-induced contralateral rotations (see Example 11). These results indicate that cells of the present invention can modify the output of the basal ganglia and improve the motor symptoms seen in PD.
Finally, these results suggest the use of this broad treatment strategy for the treatment of other disorders involving excitable tissues.
As used herein, the phrase "excitable tissue" refers to tissue which is composed, at least in part, of cells which respond to, or propagate, an electrochemical change. Examples include muscle tissue, neuronal tissue and glandular tissue.
As used herein the phrase "cells capable of electrical coupling" refers to cells which are capable of causing voltage change in cells of the excitable tissues.
Electrical coupling is usually achieved by gap junctions or electrical synapses although other mechanisms are also envisaged (e.g., fusion of grafted cell with host cell, and ion concentration changes). Electrical coupling is typically tested by impaling both cells with microelectrodes, injecting a current into one, and looking for a change in potential in the other.
Examples of cells which are capable of electrical coupling with the excitable tissues include non-transformed cells such as those listed in Examples 7-9 of the Examples section and transformed cells which express ion channels (ligand, voltage or drug-gated ion channels), transporters and/or gap junctions as further described hereinbelow and in the Exarnples section which follows.
According to the present invention, the introduction of new channels or channel producing cells into an excitable tissue, as well as the regulation of channel formation or permeability via endogenous or exogenous factors, can be utilized to control the electrophysiological function of excitable tissue to thereby treat various disorders associated with such tissues.
Thus, according to one aspect of the present invention, there is provided a nucleic acid construct including a first polynucleotide region encoding at least one first polypeptide which is capable of forming a functional ion channel or transporter 5 when expressed within a cell, and a second polynucleotide region encoding at least one second polypeptide capable of forming a functional gap junction when expressed within the cell.
According to a preferred embodiment of the present invention, the first polynucleotide region encodes an ion channel forming polypeptide or polypeptides, 10 such as, but not limited to, a Ca, K, Na or Cl ion channel forming polypeptide(s).
For example, the first polynucleotide region can include the sequence set forth by nucleotides 179-6121 of Genbank Accession number AB027567, which when expressed within the cell produces a Na channel.
Additional examples of sequences which can be utilized by the present 15 invention for forming a functional ion channel, when expressed within the cell, are listed according to their GenBank accession numbers in Tables 1-3 of the Example section which follows and in Examples 7-9 of the Examples section which follows.
The first polynucleotide region can also encode any modified polypeptide (e.g. mutated, chimeric etc') which is capable of forming functional ion channel in 20 cells. Examples of mutated ion channel forming sequences are given in the Examples section which follows.
It will be appreciated that ion transporters such as Na/K, Na/Ca or Cl/HCO3 exchange systems (ATPases) can also be utilized by the present invention.
Since such transporters are typically slower than channels in transporting ions across cell 25 membranes, their use is limited to cases where rapid influx or outflux of ions is not required.
According to anotlier preferred embodiment of the present invention, the gap junction forming polypeptide encoded by the second polynucleotide region is Connexin43 or 45, other connexin types which can be utilized by the present 30 invention are described in the Examples section which follows.
The nucleic acid construct according to this aspect of the present invention also includes at least one promoter sequence for driving the transcription of the first and second polynucleotide regions. Preferably, the nucleic acid construct includes two promoters each driving transcription of a specific polynucleotide region.
Alternatively, a single promoter sequence can transcribe both polynucleotide regions as a polycistronic message. Such a polycistronic message can include an internal ribosome entry site (IRES) between the first and second polynucleotide regions so as to enable the translation of the downstream polynucleotide region.
Alternatively, the first and second polynucleotide regions of the polycistronic message can be translationally fused via a protease recognition site, such that a polypeptide translated from this message is cleaved into the first and second polypeptides described above.
It will be appreciated that although expressing both polynucleotide regions from a single construct is advantageous in some respects, each of the polynucleotide regions can alternatively be provided on a separate construct.
Thus, according to another aspect of the present invention there is provided a nucleic acid construct system which includes a first nucleic acid construct including a first polynucleotide region encoding at least one first polypeptide capable of forming a functional ion channel or transporter when expressed within a cell and a second nucleic acid construct including a second polynucleotide region encoding at least one second polypeptide capable of forming a functional gap junction when expressed within the cell.
The nucleic acid constructs of the present invention are utilized to transform cells, preferably mammalian cells, either in-vivo or ex-vivo.
As such the promoters utilized by these construct are mammalian functional promoters which are either constitutive, tissue specific, inducible or growth regulatable depending on the cell type and application.
The nucleic acid constructs described hereinabove are preferably constructed using commercially available matnmalian expression vectors or derivatives thereof.
Examples of suitable vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, which are available from Invitrogen, pCI which is available from Promega, pBK-RSV and pBK-CMV which are available from Stratagene, pTRES which is available from Clontech, and their derivatives and modificants.
Any of the promoter and/or regulatory sequences included in the mammalian expression vectors described above can be utilized to direct the transcription of the polynucleotide regions described above. However, since such vectors are readily amenable to sequence modifications via standard recombinant techniques, additional regulatory elements, promoter and/or selection markers can easily be incorporated therein if needed.
The nucleic acid constructs of the present invention can be introduced into a cell, population of cells, or tissue via any standard in-vivo or ex-vivo mammalian transformation method such as, biochemical methods, including but not limited to calcium-phosphate-mediated transformation, diethylaminoethyl (DEAE)-dextran-mediated transformation, cationic lipid-mediated (liposome) transformation, polybrene mediated transformation; physical methods such as, electroporation, direct micro-injection and biolistic particle delivery; and biological methods such as by using viruses (for further detail see, for example, "Methods in Enzymology"
Vol.
1-317, Academic Press).
The cells or constructs according to the present invention can be administered to the individual per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.
Thus, according to another preferred embodiment of the present invention, the nucleic acid constructs according to the teachings of the present invention are included in a pharmaceutical composition which also includes a pharmaceutically acceptable carrier which serves for stabilizing and/or enhancing the accessibility or targeting of the constructs to target tissues.
As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pliarmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term "active ingredient" refers to the preparation accountable for the biological effect, i.e. the nucleic acid constructs of the present invention.
Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" are interchangeably used to refer to a carrier, such as, for example, a liposome, a virus, a micelle, or a protein, or a dilutent which do not cause significant irritation to an organism and do not abrogate the biological activity and properties of the active ingredient. An adjuvant is included under these phrases.
Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients, include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
Techniques for formulation and administration of compositions may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.
Suitable routes of administration are preferably local rather than systemic, for example, via injection of the preparation directly into the excitable tissue region.
Systemic administration is typically limited to the constructs of the present invention and is preferably effected while using tissue specific promoters, as described hereinabove. Specific routes for local and systemic administration as well as transplantation techniques (e.g., CT guided) are listed in Examples 7-9 of the ' Examples section which follows.
For injection, the active ingredients of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.

Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically.
Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose.
Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer of the active ingredient. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
The dosage may vary depending upon the dosage form employed. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.1).
Direct administration of the nucleic acid constructs described hereinabove or of pharmaceutical compositions including such constructs into cells forming a part of, or being in contact with, the excitable tissue region is preferably used in cases where the cells of the excitable tissue to be transformed are viable and functional.
In cases where cell damage or death defines a disorder of excitable tissue, the preferred mode of treatment is implantation of transformed or non-transfonned cells having ion channels/transporters and gap junctions.
Thus, according to another aspect of the present invention there is provided a method of modifying the electrophysiological function of an excitable tissue region of an individual. The method is effected by implanting cells into the excitable tissue region, wherein the implanted cells are each characterized by the ability to form gap junctions with at least one cell of the excitable tissue region and by the ability to form functional ion channels or transporters of one or more channel or transporter types.
Implantation of such cells can be effected by, for example, a syringe and 5 needle adapted or fabricated for cell implanta.tion, by a catheter drug delivery system (see for example, U.S. Pat. No. 6,102,887) or by standard neurosurgical methods.
As mentioned above, the implanted cells can be cells expressing endogenous ion channel and/or gap junction polypeptides, or modified cells transformed with the nucleic acid constructs of the present invention. Preferably, the implanted cells are 10 mammalian cells, such as for example, muscle, or fibers cells (see the Examples section for further detail).
In any case, the cells and ion channel selectivity and gating-regulation types are selected according to the application. For example, in application where rapid channel gating is crucial, an ion channel of regulatable gating is selected.
Gating 15 Regulated channels, and factors utilizable for regulating gating are described in the examples section hereinbelow.
In addition, regulation of ion channel/transporter polypeptide expression through, for example, induced promoter activity or the like can also be effected as an alternative or additive regulatory mechanism for controlling ion influx or outflux.
20 Thus, the present invention provides a novel approach for modifying the electrophysiological function of excitable tissues. As is further detailed in the Examples section which follows, the present invention can be utilized to restore enhance or suppress electrophysiological function across a tissue region thereby treating diseases caused by dysfunction in, or damage to, excitable tissues.
25 As used herein the term "treating" refers to inhibiting or arresting the development of a disease, disorder or condition and/or causing the reduction, remission, or regression of a disease, disorder or condition in a subject suffering from, being predisposed to, or diagnosed with, the disease, disorder or condition.
Those of skill in the art will be aware of various methodologies and assays which can be used 30 to assess the development of a disease, disorder or condition, and similarly, various methodologies and assays which can be used to assess the reduction, remission or regression of a disease, disorder or condition.
Examples of diseases and conditions which can be treated using the constructs and/or cells of the present invention include, but are not limited to glucose regulation disorders (e.g., diabetes mellitus), cardiac arrythmia (e.g., bradycardia, atrial fibrillation) diseases which are treatable by modulating (i.e., increasing or decreasing) the refractory period of a cardiac tissue (e.g., atrial fibrillation, atrial flutter, atrial tachycardia and ventricular tachycardia), diseases which are treatable by modulating (i.e., increasing or decreasing) neural excitability (e.g., epilepsy, Parkinson's disease and Alzheimer's disease) and diseases and conditions which are treatable by modulating (i.e., increasing or decreasing) pyramidal or purkinje cell coupling (e.g., cerebrovascular accident, epilepsy and pain (e.g., phantom pain).
Cells and/or constructs of the present invention can be included in a diagnostic or therapeutic kit. For example, cells suitable for treating glucose regulation disorder in a subject, can be packaged in a container with appropriate buffers and preservatives and used for therapy.

Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

EXAMPLES
Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, cellular and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual"
Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III
Ausubel, R.
M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds);
methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531;
5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes i-III
Cellis, J. E., ed. (1994); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S.
J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S.
J., eds.

(1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols:
A Guide To Methods And Applications", Academic Press, San Diego, CA (1990);
all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

EXiMPLE 1 Cardiac applications Cardiac arrhythmias are rhythm disturbances that result from alteration of the electrophysiological substrate of the heart. These arrhythmias include bradyarrhythmias (slow heart rate) which result from abnormalities in impulse formation or conduction and tachyarrhythmias (high heart rate) which result from abnormalities in the electrophysiological substrate and which lead to the formation of tachycardia via abnormal foci firing at high rate or via formation of reentry circuits.
Cardiac arrhythmia often results from damage to the electrophysiological tissue substrate of the heart. By transplanting cells transfected with various ionic channels of specific and predetermined properties, the methods of the present invention enable one to modify the electrophysiological properties of heart tissue and thus repair such arrhythmias. Thus, the present invention can be used to either increase excitability to treat bradyarrhythmias or modify the electrophysiological substrate in order to suppress or prevent tachyarrhythmias.
Numerous cell types can be utilized to accomplish such a task, provided the cells posses functional gap junctions and functional ion channels.
Examples of suitable cell types include, but are not limited to, fibroblasts, skeletal myoblasts (satellite cells), endothelial cells and the like which can be of autogenic, allogenic, or xenogenic origin.
The cells transplanted generate specific structural and function interactions with the cardiomyocytes via the gap junction which can be either inherent to the transplanted cells or the product of overexpressed exogenes (listed in Table 1 below).

Table 1- Sequences encoding polypeptide constituents of various ion channels Ion Channel type GenBank Accession numbers Potential application K Kvl.3 H18261 Reentrant arrhythmia, Atrial fibrillation, Ventricular and atrial tachycardia or heart failure K inward rectifier potassium S65566 Atrial fibrillation or channel TWIK-1 - human heart failure K Delayed rectifier potassium L28168 L33815 M26685 Atrial fibrilation or channel - human heart failure K Cardiac inward rectifier 138727 Atrial fibrilation or otassium channel - human heart failure K VOLTAGE-GATED M55514 AI631014 AI701825 Atrial fibrilation or POTASSIUM CHANNEL A1694934 AI793138 heart failure PROTEIN KV 1.4 K 'voltage-gated potassium JC5275 Atrial fibrilation or channel protein - human' heart failure K OKCNQ2"; potassium channel AF033348 Atrial fibrilation or heart failure K 'inwardly rectifying potassium 138521 Reentrant channel, hippocampal arrhythmia, Atrial fibrillation, Ventricular and atrial tachycardia or heart failure K VOLTAGE-GATED Atrial fibrilation or POTASSIUM CHANNEL AF033347 AF071491 heart failure -LIKE 3.KCNQ3. AA019129 AA001392 H86059 Na Sodium channel AB027567 A-V block, Atrial fibrillation, Sick sinus syndrome Na Voltage gated "SCN11A" AF188679 A-V block, Atrial fibrillation, Sick sinus s drome Na 'AMILORIDE-SENSITIVE U57352 U50352 H12215 A-V biock, Atrial BRAIN SODIUM CHANNEL Z45660 R35720 R15377 fibrillation, Sick BNAC1' AA457638 AI473139 H12216 sinus syndrome Na hBNaC2"; product: "sodium U78181 AL035862 AA442069 A-V block, Atrial channel2 A1017398 A1620655 A1762424 fibrillation, Sick Z40887 A1700050 sinus syndrome Ca T-type AF134986 Heart failure Ca 'VOLTAGE-DEPENDENT M94172 U76666 AA776162 Heart failure CHANNEL' Ca "L-type calcium channel M92269 AA927640 AA443875 Heart failure (HFCC)"; Human' AA173146 Ca "CACNG4"; product: AF142625 Heart failure "calcium channel' Ca 'VOLTAGE-DEPENDENT L- AJ224874 AJ006216 Heart failure TYPE CALCIUM
CHANNEL,' Ca "voltage-dependent calcium M92301 W07059 T28094 Heart failure channel' Ca L-type M76558 AF055575 H29339 Heart failure Cl 'probable chloride channel S68428 CIC-6 - human' Cl "CLCN3"; product: "chloride AF029346 channel p rotein' Cl "C1C-2"; product: "cliloride AF026004 channel' Cl "clc4"; product: "chloride AB019432 channel' Table 1 (Cont.) The coupling between the transplanted and host cells forms a single functional unit. Such functional coupling of the transplanted cells with the myocytic 5 tissue allows modification of the various action potential phases of the myocytes.
Listed below are some of the action potential modifications, which can be effected using the methods of the present invention.
(i) Transplantation of fibroblasts having potassium channels (KV1-3,E) can be utilized to reduce automaticity; the effect may be reversed by specific 10 antagonist (e.g., Charybdotoxin) (ii) Transplantation of fibroblasts having potassium channels (KVl-3,E) can also be utilized for the creation of block which can be reversed with CTX.
(iii) Transplantation of fibroblasts having sodium channels can be utilized for the creation of rate dependent conduction block. Na channels will be inactivated 15 at fast (abnormal) rates but permit conduction at slower (physiological) rates.

(iv) Transplantation of cells having various channels (for example the human ether-a-go-go-related gene, HERG) can be used to repress abnormal focal activity (due to triggered activity and unstable repolarization).
(v) Transplantation of cells having KV channels can be utilized to regulate A-V node conduction (e.g., prolong refractoriness, or decrease conduction velocity):
(vi) Transplantation of cells having Na-channels or Na and K channels can be utilized to increase A-V node conduction.
(vii) Transplantation of cells having Na-channels can be utilized to increase excitability by increasing spontaneous rate and conduction within the SA node (pacemaker).
Transplantation patterns The ability to transplant the cellular grafts of the present invention at predetermined myocardial sites may be of unique advantage since the location of the transplantation site can be selected and optimized according to the specific mechanism of the arrhythmia treated.
For example, a local effect may decrease side effects which result from a nlore generalized effect, as occurs for example, during pharmacological treatments.
A focal transplantation pattern may be used to treat focal arrhythniia or change excitability at predetermined sites. Linear lesion transplantation may be utilized to generate conduction blocks for the treatment of specific reentrant arrhythmia while diffuse transplantation patterns may be utilized to modify the excitable properties of entire regions.

Methods of transplantation Several transplantation approaches can be utilized by the present invention.
For example, an epicardial transplantation can be effected via surgical procedures, while an endocardial transplantation can be effected via catheters that are employed percutaneously and may be used to inject the cells endocardially.
Alternatively, the cells may be injected into the coronary circulation.

Specific applications Atrial fibrillation (AF): In atrial fibrillation, the normal rhythmical contractions of the cardiac atria are replaced by rapid irregular twitchings of the muscular wall; the ventricles respond in an irregular and rapid manner to the dysrhythmic bombardment from the atria. The pathological. properties of AF can be modified using the teachings of the present invention via one of several possible approaches:
Cells transfected with specific ionic channel coding sequences, for example the voltage gated potassium channels (Kvl.3), can be transplanted into the A-V
node. The modulating effect on the A-V node will slow the ventricular rate.
This effect may be further modulated by dose-related changes resulting from the application of a blocking factor such as, for example, charybdotoxin.
The present invention also enables to treat AF by creating multiple line blocks (similar to the surgical maze procedure or the equivalent ablation procedure) in both atria. These blocks can be created by transplanting cells having K channels or rate dependent Na channels in the desired predetermined pattern.
The methods of the present invention cells may also be utilized to suppress pulmonary vein foci which often trigger AF, or to prevent their propagation to the atria by creating conduction blocks. By modifying the electrophysiological substrate of the atria the methods of the present invention can be used to increase cellular coupling and to increase and homogenize repolarization.
Atrial flutter and other Macroreentrant atrial arrhythmia: These arrhythmias result from macroreentrant wavefronts which can be treated by transplanting the cells to create a block at a critical area (for example the tricuspid-IVC isthmus in typical flutter).
Atrial tachycardia: Paroxysmal tachycardia originating in an ectopic focus in the atrium can be treated by cells transplanted at the area of the ectopic foci which suppress the abnormal activity.
Ventricular and reentrant tachycardia: The methods of the present invention can also be utilized to treat paroxysmal tachycardia originating in an ectopic focus in the ventricle by transplanting cells at the area of the ectopic foci. In addition, reentrant tachycardia originating from a scar tissue, following myocardial infarction is also treatable via the methods of the present invention. In this case, cellular grafts can be used to modify (increase or decrease) the conduction properties of slow conduction pathways within the scar which are critical for initiation and sustainment of the reentrant arrhythmia.
A-V block: An impairment of the normal conduction between atria and ventricles can be treated by cellular graft which improve the excitability properties of the A-V node thus reversing the conduction block.
Sick-sinus syndrome: An abnormal function of the SA node (normal pace maker) which results in a slow heart rate or alternating slow-fast rates can be treated by cells transplanted in the SA Node area in order to increase the excitability of the SA Node, or by creating an alternative pacemaker by transplanting cells with pace maker properties (combination of Na and K channels).
Heart failure: despite considerable advances in the diagnosis and treatment, congestive heart failure is the only major cardiovascular disorder which is increasing in incidence. Ventricular arrhythmias account for approximately 50 % of the moralities associated with congestive heart failure. Ventricular arrhythmias typically arise from prolongation of the action potential duration (APD) which results in unstable repolarization and thus generation of arrhythmias. Treatment in these cases can be effected by shortening the action potential or by synchronizing repolarization.
This can be achieved by transplanting cells having potassium channels (e.g.
delayed rectifier or ether-go-go) which would function in shortening the cardiomyocytic APD.
Heart failure can also be treated by transplantation of cells having L-type or T-type calcium channels into the ventricles in a diffuse or a predetermined pattern in order to increase the excitability of the ventricles and to modulate calcium ion kinetics in the host myocardial tissue. Such transplantation would improve the contractility and relaxation pattern of the ventricles and thus change the systolic and diastolic properties of the ventricle.
Long OT syndrome: patients with genetic or acquired abnormalities in repolarization which display prolonged QT intervals may suffer from life-threatening malignant arrhythmias such as polymorphic VT. Such patients may be treated with the cellular grafts of the present invention having ion channels, such as potassium channels, which are selected capable of shortening and homogenizing repolarization.

Pancreas Diabetes Mellitus is a metabolic disease in which carbohydrate utilization is reduced while utilization of lipid and protein enhanced. Diabetes Mellitus is caused by relative deficiency of insulin, and is characterized, in more severe cases, by chronic hyperglycemia, glycosuria, water and electrolyte loss, and various organ damage causing significant morbidity and mortality.
Gap junctions and junction-mediated cell-to-cell communications are obligatory features of gland cells, regardless of their secretory products.
Studies on pancreatic islets and acinar cells indicate that cell-to-cell communication via gap junction channels is required for proper biosynthesis, storage and release of both insulin and amylase. However, the endocrine and exocrine portions of the pancreas show opposite connexin (Cx) and coupling changes in relation to the activation and inhibition of their secretory functions. These differences may be accounted for by the expression of connexin43 (Cx43) in pancreatic islets and of Cx26 and Cx32 in pancreatic acini. This alternative expression of connexin isoforms is also found in several other endocrine and exocrine glands. These observations indicate that connexin-made channels play a central role in the control of secretory events (Meda, 1996, Clinical & Experimental Pharmacology & Physiology, Dec;23(12):1053-7).
The function of T-type voltage-gated calcium channels in insulin-secreting cells has been previously described (Bhattacharjee et al, 1997 Endocrinology, Sep.138(9):3735-40). Whole-cell voltage and current recordings, capacitance measurements, and RIA techniques were used to determine the contribution of T-type calcium channels in modulation of electrical activity and in stimulus-secretion coupling in a rat insulin secreting cell line, INS-1. Studies employing double pulse protocols in the current-clamp mode, uncovered that activation of T-type calcium channels provided a low threshold depolarizing potential that decreased the latency of onset of action potentials and increased the frequency of action potentials, both of which are abolished by administration of nickel chloride (NiC12), a selective T-type calcium channel blocker (Bhattacharjee et al, 1997 Endocrinology, Sep. 13 8(9):3735-40).
5 Currently, treatment of non insulin dependent diabetes mellitus (NIDDM) includes, in more severe cases, drug therapy and insulin injections. The sulfonylureas family acts as ATP-sensitive potassium channels blockers, thus causing depolarization of the pancreatic b cells, calcium influx and insulin secretion.

Cellular grafts capable of forming gap junction (e.g. expressing Cx43) with 10 pancreatic beta cells can be used by the present invention to treat NIDDM.
These cells which can be of autogeneic, allogeneic or xenogeneic origin can be, for example, transfected ex-vivo with nucleic acid construct encoding a specific ion channel polypeptide(s), such as, for example, CACNAIG (encoded by GenBank Accession number AF134986) which forms a T-type voltage gated calcium channel 15 (see Table 2 below for additional examples). The cells will be transplanted in the pancreas in a diffuse or a predetermined pattern via invasive or minimally invasive techniques. For example, minimally invasive percutaneous procedures using image guiding (CT, US etc.) can be used for transplantation of the cellular grafts.
Upon gap junction establishment, the cellular grafts will form a single 20 compartment with the surrounding tissue and will increase the sensitivity of the pancreatic b cells to glucose levels by increasing the depolarization process and the sensitivity of insulin secretion to depolarization. For example, by using cells transfected with the T-type voltage gated calcium channels one may increase the ca influx following depolarization of the pancreatic cells thereby increasing insulin 25 secretion.
Pharmacological blockage of these channels at a fine tuned dosage will prevent spontaneous action potentials thus preventing hypoglycemic states.
This approach is advantageous since it allows to monitor insulin secretion regardless of the time of drug administration.
30 Several approaches can be utilized for regulating pancreatic beta cells excitability and insulin secretion. For example, transplantation of cells transfected with sodium or calcium channels can be utilized to increase depolarization of the beta cells or transplantation of cells transfected with calcium channels can be utilized to increase calcium influx thereby increasing beta cell sensitivity to depolarization. In addition these and other approaches can be utilized to increase and prolong the firing rate of such pancreatic cells.
Table 2 Ion Channel type GenBank Accession numbers Na Sodium channel AB027567 Na Voltage gated "SCN11A" AF188679 Na hBNaC2"; product: "sodium U78181 AL035862 AA442069 A1017398 channel2 AI620655 AI762424 Z40887 AI700050 Ca T-type AF134986 Ca 'VOLTAGE-DEPENDENT N- M94172 U76666 AA776162 T12610 TYPE CALCIUM CHANNEL' Ca "L-type calcium channel M92269 AA927640 AA443875 AA173146 (BFCC)"; Human' Ca "CACNG4"; product: "calcium AF142625 channel' Ca 'VOLTAGE-DEPENDENT L- AJ224874 AJ006216 TYPE CALCIUM CHANNEL,' Ca "voltage-dependent calcium M92301 W07059 T28094 channel' Ca L-type M76558 AF055575 H29339 R25307 T27949 EXiMPLE 3 CNS
Epilepsy Epilepsy is a chronic disorder usually associated with some alteration of consciousness and characterized by paroxysmal brain dysfunction due to excessive neuronal discharge.
Astroglial cells contribute to neuronal maintenance and function in the normal and diseased brain. Gap junctions, formed predominantly by connexin43 between astroglias, provide important pathways which coordinate astroglial responses (Reuss et al, 2000, Glia May;30(3):231-41). Neuronal-glial interactions play an important role in information processing in the CNS. Previous studies have indicated that electro-tonic coupling between locus ceruleus (LC) neurons is involved in synchronizing the spontaneous activity. Moreover, Spontaneous oscillations in the membrane potential were observed in a subset of glial cells.
These oscillations were synchronous with the firing of neurons, insensitive to transmitter receptor antagonists and disrupted by carbenoxolone, a gap junction blocker. Finally, immunoelectron microscopy studies established that connexins, the proteins that form gap junctions, were present on portions of the plasmalemma, bridging the cytoplasm of neurons and glia in LC (Alvarez et al, 2000, J
Neurosci.
Jun 1;20(11):4091-8).
Treatment of epilepsy can be effected by the present invention by transplantation of astroglial cells, fibroblasts or other cells transfected ex-vivo with a restraining force channel coding sequence exemplified in Table 3 below.

Table 3 Ion Channel type GenBank Accession numbers K Kvl.3 H18261 K inward rectifier potassium channel S65566 TWIK-1 - human K Delayed rectifier potassium channel - L28168 L33815 M26685 human K Cardiac inward rectifier potassium 138727 channel - human CHANNEL PROTEIN KV 1.4 AI793138 K 'voltage-gated potassium channel protein JC5275 - human' K OKCN 2' ; potassium channel AF033348 K 'inwardly rectifying potassium channel, 138521 hi ocam al K VOLTAGE-GATED POTASSIUM

3.KCNQ3. AW135705 The transfected cells will be transplanted to the pathologic foci using standard neuro-surgical methods. Upon establishment of gap junction with the surrounding tissue, the cellular grafts form a single compartment which enables the repression of pathological tissue regions via controlled activation of the channels.

EX"PLE 4 Neuronal networks Neuronal cells were cultured on multi electrode arrays in efforts to determine electrophysiological function of these cultured cells under various conditions.

Culture techniques Cortical neurons were obtained from newborn rats within 24 hours from birth, following standard harvesting procedures (Culturing nerve cells, 2"d edition, Gary Ranker and Kimberly Goslin, 1998). The cortex tissue was digested enzymatically and mechanically dissociated and the neurons were plated directly onto substrate-i5 integrated multi-electrode array (MEA) dishes prepared as described below.
The cultures were bathed in MEM which was supplemented with heat-inactivated horse serum (5%), Glutamine (0.5 mM), Glucose (20 mM), and Gentamycin (10 ?g/ml), and maintained in a tissue culture incubator at 37 C, 5 % CO2 and 95 % during the recording phases. Half of the medium was exchanged twice a week and the experiments were performed during the third week following plating, thus allowing complete maturation of the neurons (Figures 1 a-b).
It is a well known fact that electrical activity in a cultured neuronal network is dependent upon synaptic transmission. As shown by various published studies, this electrical activity can be blocked by perfusion with the N-Methyl-D-aspartate (NMDA), receptor antagonist D-2-amino-5-phosphonovalerate (APV), and non-NMDA receptor antagonist 6-cyano-7-nitroquinoxaline-2,3-dion (CNQX).
To determine the sensitivity and accuracy of the multi electrode array and detecting system of the present invention, prior art electrical activity studies in cultured neuronal networks were repeated as part of the present study using intracellular recordings as well as MEA recordings.

Electrophysiological methods Arrays of 60 Ti/Au/TiN electrodes, 30?m in diameter, spaced 200?m from each other (MultiChannelSystems (MCS), Reutlingen, Germany) were utilized in the present study. The insulation layer (silicon nitride), was pretreated with poly-L-lysine forming a good surface for network development. A commercial 60-channel amplifier (B-MEA-1060, MCS, Reutlingen, Germany) with frequency limit range of 10-3000 Hz and a gain of x1024 was utilized for signal amplification. The amplifier was connected to MCPPIus filter amplifiers (Alpha Omega, Nazareth, Israel) for further amplification (xlO to x20). Stimulation through the MEA was performed using a dedicated 8-channel stimulus generator (MCS, Reutlingen, Germany).
In addition, the micro-incubation environment was arranged to support long-term recordings from MEA dishes. This was achieved by streaming a filtered, heated and humidified air/CO2 (95/5%) gas mixture, and by electrically heating the MEA platform to 37 C. Data is digitized using two 5200a/526 A/D boards (Microstar Laboratories, WA, USA).
Experiments were first conducted in efforts to determine the functionality of the multi electrode array and the detecting system described above. The response of the cultured neuronal network to electrical stimuli is illustrated in Figures 1 c-f.
Following electrical fiuictionality determination, the neuronal network cultures were incubated with various electrical conduction blockers.
The addition of 5 M bicuculin, 10 M DNQX or 20 M APV to the cultured neuronal network completely abolished spiking activity therein.
Epilepsy Epileptic activity of the cultured neuronal network described above was measured from the MEA described above. Figures 2a-b illustrate epileptic activity recorded from MEA in a mature (3 weeks in vitro) cultured cortical network.
This recorded spontaneously bursting synchronous activity throughout the network is a characteristic feature of epileptic-like activity in networks of neurons.

EX"PLE 5 Although electrical coupling between fibroblasts and myocytes has been previously reported by Rook et al. (1992), the experiments conducted as a part of that study were designed in efforts to elucidate the validity of modulating excitable 5 tissue by cellular graft. Thus, Rook et al. did not describe nor did they suggest the use of cells transfected with ion channel coding sequences. for the purpose of modifying the electrophysiological function of excitable tissues.
While reducing the present invention to practice, the present inventors utilized a cell culture model system which included fibroblasts which were 10 transfected with ion channel coding sequences and co-cultured with cardiomyocytes.

These co-cultures enabled to test the effects of the ion channel expressing fibroblast on the electrophysiological function of the myocardial cells and to test the effects of various molecules which regulate channel permeability.

Materials and Methods 15 Preparation of cultured cardiomyocytes Monolayer cultures of neonatal rat ventricular cardiomyocytes (NRVM) were prepared as previously described (Rubin et al, 1995), with some modifications.
The cultures were maintained in a humidified incubator under a controlled environment of 5 % CO2 + 95 % air at 37 C; fresh medium was replaced on alternating days.

20 Preparation offibroblast cultures transfected with gv1.3 Fibroblasts from the NIH 3T3 cell line were transfected with an expression cassette which included a mutant voltage gated potassium channel (Kvl.3) coding sequence (GeneBank Accession number H18261) placed under the transcription control of a constitutive promoter using standard procedures. Fibroblast cultures not 25 transfected with the channel coding sequence were produced from the NIH 3T3 cell-line.
Preparation of co-cultures Once well synchronous spontaneous activity was established in the cardiomyocyte -cultures, fibroblasts transfected with the Kvl.3 channel coding 30 sequence or non-transfected fibroblasts were added to the cultures. Two different methods where used to seed the fibroblasts. In the first method, the fibroblast were suspended in trypsin for 5 minutes following which they were seeded in a diffuse pattern in the cardiomyocytic cultures (Figure 4a). In the second method, the fibroblasts where pipetted up and down through a 5 ml pipette for 2 minutes and seeded in the cardiomyocytic cultures thus were forming clusters of fibroblasts (Figure 4b).
Immunohistochemistr,y The fibroblasts were labeled with Fast DiO [3,3'-dilinoleyloxacarbocyanine perchlorate (FAST DiOTM solid, Cat #-3898; Molecular Probes, USA) in order to track the fibroblasts in the co-cultures.
The data acquisition system and electrical activity recording Extracellular recordings from cultured cardiomyocytes were performed on a PC-based Microelectrode Data Acquisition System (Multi Channel Systems, Reutlingen, Germany), consisting of Multi-Electrode Array (MEA), pre- and filter-amplifiers, data acquisition board, and software. The MEA consists of a 50? 50 mm glass substrate, in the center of which is an embedded 0.7? 0.7 or 1.4? 1.4 mm matrix of 60 Titanium-nitride, gold contacts 10 or 30 ?m diameter electrodes insulated with silicone nitride, with inter-electrode distance of 100 or 200 ? m(there are no electrodes in the corners of the matrix). Data were recorded at 10-25 KHz with bit precision. During the recording sessions, the MEA (removed from the regular incubator) was constantly perfused with a gas mixture consisting of 5% COZ +
95%
air. Temperature was kept at 37 ? 0.10 C.

Construction of activation maps Recorded data was filtered using cutoff frequency of 2 KHz (Fast et al, 1993).
The filtered signal was then differentiated digitally to determine the Local Activation Time (LAT) at each electrode, corresponding to dF/dtmin (where F is the filtered signal) (Dolber and Spach, 1986). Color-coded activation maps were constructed by interpolating the LAT values for the sites between the electrodes, and by extrapolating the LAT values for the 4 corners of the MEA matrix.
Activation maps were plotted by means of Matlab standard 2-d. plotting function (pcolor) (Matlab 5.3 Mathworks Incorporated ). Conduction velocity was calculated by standard methods (Bayly et al, 1988).

Conduction block Conduction block quantification is central to evaluating conduction block development in the cell cultures, and to evaluating reversibility of the conduction block following CTX application. A conduction block was determined using the following algorithm:
the local activation time (LAT) of each electrode was compared to the LAT of the four nearest electrodes, where LATx is the local activation time at electrode x and LATy is the local activation time at one of the four nearest electrodes to electrode x.
Thus, If LATx - LATy > 0.25 X [LATmax(last local activation time in the array )-LATmin(first local activation time in the array)], then the electrode was assigned a value of 1, else the electrode was assigned a value of 0. Each of the four electrodes was tested and if one or more satisfied this condition, then electrode x was set to a value - 1, a sum of all the electrode values represented the block value.

Recording protocol Electrical activity of the cultures was recorded on day one immediately prior to seeding of the fibroblasts and then daily until the cultures died or no spontaneous activity was detected. During the daily measurements the cultures where subjected to increasing concentrations (0.1, 1, 10, 100 nM) of CTX.

Results Spontaneous activity Measurement were performed during spontaneous activity from three groups of cardiomyocyte cultures: cultures without fibroblasts, cultures with NIH 3T3 fibroblasts (seeded diffusely) and cultures with transfected NIH 3T3 fibroblasts (expressing the mutant voltage gated potassium channel coding sequence).
The cultures where subjected to an increasing concentration of CTX from 0.1 to 100 nM. CTX caused a significant increase in the spontaneous activity rate in the co-cultures which included the transfected fibroblasts. The activity rate increased by 20 and 55% following administration of CTX concentrations of 10 and 100 nM
respectively.
In contrast, administration of CTX to cardiomyocyte cultures or to cardiomyocytes co-cultured with untransfected fibroblasts did not increase the activity rate at 10 nM and caused a modest increase of up to 15% at a 100 nM
(Figure 5).
There are three possible explanations for these results:
(i) Kv1.3 channel opening in transfected fibroblasts during action potential propagation causes hyperpolarization and therefore elongation of phase 4 at neighboring cardiomyocytes resulting in a slower activity rate; therefore, blocking of Kvl.3 channels with CTX reverses this effect. (ii) CTX treatment increases electrical activity in areas that are blocked due to the presence of fibroblasts.
(iii) CTX enables propagation through otherwise blocked conduction tracts thus enabling propagation of action potentials. Since the area of the electrode array is a lxl mm2 and since the area of the plate in which the array is embedded is about 2 cm2, most of the culture activity is not recorded because propagation of electrical signal from cells positioned outside the array may be blocked prior to entering the array. Application of CTX opens conduction blocks and thus enables activation of the myocytes at the electrode area.
The weak response observed in the control cultures treated with a high concentration of CTX is probably due to a minor blockage of potassium channels in the myocytes.
Synchronous activity and conduction block The two control culture types (with or without untransfected fibroblasts) exhibited a well-coupled synchronous activity throughout the experiment. Four of the co-cultures with transfected fibroblasts demonstrated an uncoupling effect following the fibroblasts seeding due to a conduction block generated by the Kvl.3 channels formed in the fibroblasts. Uncoupling effect was reversed following treatment with CTX (Figures 6f-g). Almost all of the cultures which included transfected fibroblasts demonstrated conduction blocks which developed following fibroblasts seeding (Figure 10). Such conduction blocks were reversed following treatment with CTX (Figure 7d and Figure 11).
Cultures including non-transfected fibroblasts did not demonstrate conduction blocks or reversibility of blocks following application of CTX (Figures 12a d). An immediate decrease in conduction velocity following transfected fibroblast seeding was also observed. Such an effect was not observed in co-cultures that included non-transfected fibroblasts (Figure 8).

Amplitude change In comparison to cultures seeded with non-transfected fibroblasts, the amplitude of the extracellular signals decreased significantly following seeding with transfected fibroblasts (Figure 9). This result may indicate a general decrease in culture excitability, implicating a reduced mass of action potential generating cardiomyocytes or the presence of slow conduction.

Summary andfuture directions The above described results demonstrate for the first time that transplantation of fibroblasts transfected with a Kvl.3 channel coding sequence into cardiomyocytic cultures causes a significant change in the electrophysiological function of this excitable tissue.
Specifically, reduced spontaneous rate of the co-culture's excitability, lower amplitude of extracellular potentials, reduced conduction velocity and generations of local conduction blocks, were generated. These changes where partially or fully reversed following administration of a specific Kvl.3 channel blocker, CTX.
These results indicate the presence of tight structural and functional coupling between the fibroblasts and the myocytes, activation of the Kvl.3 channels and significant modulation of the electrical properties of the cultures.
Thus, the present invention provides a novel method which can be utilized to modulate the electrophysiological function of an excitable tissue region, which method can be utilized to treat various cardiac disorders.
The ability to modulate the electrophysiological properties of cardiac tissue may have significant clinical applications. Transplantation of cellular grafts having a predetermined electrical phenotype may be used, in the future, to alter the electrophysiological properties of cardiac tissue and together with pharmacological administration serve as a procedure for treating selected pathologies in the heart.

Furthermore, the method of the present invention is advantageous in that it effects a local tissue region rather then the heart as a whole, thus not affecting non-pathological tissue regions. This mode of treatment may be applied to treat a variety of cardiac arrhythmias.
For examples, transplantation of cellular grafts of the present invention to the AV node may be used for AV nodal modification, where the inherent properties of the cellular graft (the frequency response with or without specific pharmacology) 5' can be used to modify the ventricular response during different atrial arrhythmias thus replacing the need for pharmacological treatment.
Local transplantation of the cellular grafts of the present invention may also be used to repress arrhythmogenic foci arising due to abnormal automaticity or to repress triggered activity by modulating the action potential in selected tissue 10 regions.
In addition, reentrant arrhythmia may also benefit from the teachings of the present invention. Cellular grafts may be used to create a local conduction block in a critical area of the circuit thus treating the arrhythmia. Alternatively, predetermined seeding patterns may be used to create barriers or lines of conduction blocks for the 15 treatment of more complex reentrant arrhythmias such as atrial fibrillation or flutter.
In the later two cases, specific cell types can be used to allow normal conduction during slow (normal) rhythms, while creating local conduction blocks during fast (pathological) rhythms.

The teachings of the present invention may also be applied to modify the electrophysiologoical functionality of excitable tissues such as, for example, nervous tissue and glandular tissue. For examples, cells transfected with selected ion channel proteins may be used to modulate focal pathological areas in the CNS, thus enabling 25 treatment of disorders such as Parkinson's disease. Parkinson's disease is a neurological disorder which typically results from deficiency of the neurotransmitter dopamine as the consequence of degenerative, vascular, or inflaminatory changes in the basal ganglia. Parkinson's disease is characterized by rhythmical muscular tremors, rigidity of movement, festination, droopy posture, and masklike facies.
30 Astroglial cells contribute to neuronal maintenance and function in the normal and diseased brain. Gap junctions formed between astroglial cells, predominantly by connexin43, provide the pathways which coordinate astroglial responses (Reuss et al, 2000, Glia May;30(3):231-41). Neuronal-glial interactions play an important role in information processing in the CNS. Previous studies have indicated that electrotonic coupling between locus ceruleus (LC) neurons lays a role in synchronizing the spontaneous activity. Moreover, spontaneous oscillations in the membrane potential were observed in a subset of glia. These oscillations were synchronous with the firing of neurons, insensitive to transmitter receptor antagonists and disrupted by carbenoxolone, a gap junction blocker. Finally, immunoelectron microscopy studies established that connexins, the proteins that form gap junctions, were present within the plasmalemma, bridging the cytoplasm of neurons and glia in LC (Alvarez et al, 2000, J Neurosci. Jun 1;20(11):4091-8).
Methodology Astroglial cells transfected to express selected ion channel and optionally gap junction proteins will be transplanted within the pathologic foci (e.g., Substantia nigra) using standard neuro-surgical methods.
Gap junction formation between the cellular graft and cells of the pathological region and activation of expressed ion channels (e.g., sodium channels) will substantially increase the excitability of the diseased tissue. In the case of compromised number of dopaminergic cells, the transplanted cells may increase synchronicity, thus effectively increasing timed release of dopamine or any other relevant neuromodulator.

EXA1tIPLE 7 Enhancement of insulin secretion from fl-Cells Background Diabetes mellitus is a metabolic disease in which carbohydrate utilization is reduced and that of lipid and protein enhanced; it is caused by an absolute or relative deficiency of insulin. Abnormalities in insulin secretion precede the onset of type-2 diabetes and may be present even when subjects show normal glucose tolerance (IJK
Prospective Diabetes). By the time of diagnosis, insulin secretion is significantly reduced and it contiriues to diminish inexorably throughout the course of the disease (UK Prospective Diabetes). The disease is characterized, in more severe cases, by chronic hyperglycemia, glycosuria, water and electrolyte loss, ketoacidosis, and coma;
long-term complications include development of neuropathy, retinopathy, nephropathy, generalized degenerative changes in large and small blood vessels, and increased susceptibility to infection [see also Example 2, above; Kahn SE. The relative contributions of insulin resistance and beta-cell dysfunction to the pathophysiology of Type 2 diabetes. Diabetologia. 2003; 46(l):3-19.].
(3-Cells within the pancreatic islets are responsible for insulin secretion.
Insulin secretion is the product of a chain reaction response to low glucose level.
This chain reaction begins with the closure of ATP-dependent potassium channels which leads to depolarization in (3 Cell's membrane potential, opening of Calcium channel (voltage dependent) and calcium entrance to the cell's cytoplasm. Calcium in the cytoplasm causes fusion of vesicles (containing insulin) with the 0 Cell membrane and secretion of insulin to the blood stream.
Electrical activity plays a critical role in the regulation of insulin secretion [Ashcroft, F.M. and Rorsman, P. (1989) Electrophysiology of the pancreatic 0 -cell.
Prog. Biophys. Mol. Biol., 54, 87-143]. No insulin is secreted in the absence of 0 -cell electrical activity, and there is a direct correlation between the extent of (3 -cell electrical activity, once initiated, and the amount of insulin secretion [Henquin, J.C.

and Meissner, H.P. (1984) Significance of ionic fluxes and changes in membrane potential for stimulus-secretion coupling in pancreatic [3-cells. Experientia, 40, 1043-1052]. Thus changes in electrical activity are immediately mirrored by changes in insulin secretion.
The stimulatory actions of almost all insulin secretagogues, including glucose, neurotransmitters and hormones, converge at the level of electrical activity, which serves to integrate the effects of all these agents. Although most secretagogues have additional downstream effects on insulin secretion [Henquin, J.C. (2000) Triggering and amplifying pathways of regulation of insulin secretion by glucose.
Diabetes, 49, 1751-1760., Rorsman, P. and Renstrom, E. (2003) Insulin granule dynamics in pancreatic 0 cells. Diabetologia, 46, 1029-1045], none are effective in the absence of electrica.l activity: Thus, (3-cell electrical activity is an essential step in insulin release [Ashcroft, F.M. and Rorsman, P. (2004) Human Molecular Genetics, 1 R21-R31].
The (3 -cells are electrically coupled to one another, such that the islet functions as an electrical syncytium [Meissner, H.P. (1976) Electrophysiological evidence for coupling between b cells of pancreatic islets. Nature, 262, 502-504., Eddlestone, G.T., Goncalves, A., Bangham, J.A. and Rojas, E. (1984) Electrical coupling between cells in islets of Langerhans from mouse. J. Membr. Biol., 77, 1-14., Santos, R.M., Rosario, L.M., Nadal, A., Garcia-Sancho, J., Soria, B. and Valdeolmillos, M. (1991) Widespread synchronous [ica2b]i oscillations due to bursting electrical activity in single pancreatic islets. Pflugers Arch., 418, 417-422].
This serves to coordinate electrical activity and insulin secretion across the islet and accounts for the fact that glucose-stimulated insulin secretion from a single islet is pulsatile and mirrors the slow waves of electrical activity [Bergsten, P.
(1995) Slow and fast oscillations of cytoplasmic Ca2p in pancreatic islets correspond to pulsatile insulin release. Am. J. Physiol., 268, E282-E287]. (3 Cells connect through connexin36 (Diabetes 49:727-734, 2000) which does not connect with other connexin type proteins (Nat Rev Neurosci. 2001 Jun;2(6):425-33).
Enhancements of insulin secretion - Insulin secretion may be enhanced by two basic mechanisms: first, increasing coupling between (3 Cells; and second, Increasing (3 Cell excitability (e.g., increasing bursting rate, increasing bursting duration, reducing silent duration, increasing bursting amplitude). Increased coupling may be achieved by transplanting cell (autologous, allogenic or xenogenic) capable of electrical coupling with pancreatic J3 cells. Examples of cells capable of forming electrical coupling with foreign tissue are Mesenchymal stem cells [Valiunas V. et al.
J Physiol. (2004) 555(Pt 3):617-26], pancreatic cells, embryonic stem cells or fibroblasts [Gaudesius G. et al. Circ Res. (2003)93(5):421-8. Epub 2003 Ju131].
Increased coupling may also be achieved by transplantation of cell grafts overexpressing connexin channels (e.g. connexin36, connexin40, connexin43, connexin45), depolarizing ion channels (e.g. sodium channels, calcium channels) and/or non-selective ion channels. Examples for sodium channels: (a) SCN5A, (b) Mutant SCN5A (AKPQ, N1325S, R1644H, E1295K, D1790G, ins1795) (these mutations cause LQTS and/or Brugada syndrome, and are characterized by long activation, and/or persistent current), (c) SCN1A, (d) SCN2A, (e) SCN3A, (f) SCN4A, (g) SCN8A, (h) SCN9A, (i) SCN10A, (j) SCN11A, (k) HCN channel family (e.g. hHCN2, hHCN4, mHCN1, mHCN2).
Examples of calcium channels include: (a) L-type, and (b) T-type calcium channels. Other examples of calcium channels are described in Example 2, above Examples of non-selective ion channels include channels of the HCN family.
In -vivo gene transfer into pancreatic (3-cells can be effected by injection of naked DNA of viral DNA vector including the polynucleotides of interest (i.e., ion channel encoding polynucleotide and/or gap junction encoding polynucleotide) to an artery feeding the pancreas. Injection may be localized such as by CT guided injection, ERCP, laparoscopy or laparotomy. Alternatively, when a(3-cell specific promoter is used injection may be systemic such as intravenous injection.
Cells for ex vivo gene transfer are selected capable of forming electrical coupling with 0 cells. To improve efficacy, cells preferably. over express either of the above-described polynucleotides. Cell delivery into the pancreas can be effected by direct CT guided injection, injection through ERCP, laparoscopy, or laparotomy, or injection of cells to an artery feeding the pancreas.
The following describes treatment of type 2 Diabetes mellitus by modifying the electrical activity of 0-cells using cellular grafts. To this end genetically modified fibroblasts overexpressing a specific ion channel were used and transplanted into rat's pancreas.
Materials and Experimental Procedures DNA constructs - Two different constructs were used including pcDNA3/Nav 1.5 [hH1A, GenBank Accession No. XM 427864, Zhang Y, Hartmann HA, Satin J. J
Membr Biol. 1999 Oct 1;171(3):195-207] and pRC/CMV/KV1.3 [GenBank Accession No. H18261, Feld et al. Circulation. 2002;105:522-529.

Generation of cell grafts Transfections - NIH/3T3 fibroblasts (ATCC: CRL 1658) were transfected using Lipofectin Reagent (Invitrogen) according to manufacturer instructions.

hours following transfection 500gg/ml of G-418 (GIBCO, LANGLEY, OK, USA) was added to the growth medium (DMEM - GIBCO, LANGLEY, OK, USA) supplemented with 10% FCS (Biological industries, Beit Haemek, Israel), gentamycin sulphate 50 ? g/ml (Biological industries, Beit Haemek, Israel), penicillin 100 U/ml (Biological industries, Beit Haemek, Israel), and streptomycin 100 ? g/ml (Biological industries, Beit Haemek, Israel) for selection of cells expressing the neomycin 5 resistance gene. Clones were isolated using cloning rings.
Molecular and electrophysiological screening - PCR analysis was effected to all NAV1.5 clones in order to confirm presence of the desirable gene. PCR was done using a PCR ReddyMixTM (ABgene). Reaction mixture included Thermoprime Plus DNA Polymerase, Tris-HCL (pH=8.8 at 25 C, (NH4)2SO4, MgC12, TweenTM20 and 10 dNTPs. Genomic DNA for PCR screening was generated by High pure PCR
template preparation kit (Roche Diagnostic). Two pairs of primers were used to detect the Nav1.5 gene: Primers for C terminus of the genes (amplifying 547 bp) - hH1A-ATG
sense: atggcaaacttcctattacct (SEQ ID NO: 1); hH1A-547 anti sense:
ggcagaagcctcgagccagaat (SEQ ID NO: 2).. Primers for N terminus of the genes 15 (amplifying 659 bp) - hH1A-5369 sense: tcgatatgttctatgagatctg (SEQ ID NO:
3);
hH1A-6052 anti sense: ctcacacgatggactcacg (SEQ ID NO: 4).
Whole-cell recordings were conducted on a KV 1.3 clone. The recordings were conducted at room temperature using Axopatch 200 (Axon Instruments). Data was collected using a Quadra 800 (Apple computers) with PULSE software (HEKA
20 Electronic), low-pass filtered at 5 to 10 kHz and sampled at 20 kHz.
Electrodes for voltage-clamp experiments were made from borosilicate glass, with a resistance of 2 to 4 MQ. The pipette solution contained KCl 140 [mmol//L], Na2ATP 10 [mmol/L], EGTA 10 [mmol/L], HEPES 5[mmol/L], CaCl2 1[mmol/L], and MgC12 1 [mmol/L]
(pH 7.3). The bath solution contained NaCI 140 [mmol/L], KCl 3[mmol/L], HEPES
25 10 [mmol/L], glucose 10 [mmol/L], MgC12 2[mmo1/L], and CaC12 2[mmol/L].
One week prior to transplantation the selected clone was expanded in order to obtain suitable amount of cells for transplantation (4 x 106 cells for each animal). On the day of transplantation, cells were trypsinated for 5 minutes, counted, centrifuged and re-suspended in 200 1 serum-free DMEM (GIBCO, Langley, OK, USA). The 30 cells were loaded into a syringe, and transported to the transplantation theater on ice.
Cell transplantation - Seven Sprague-Dawely rats were divided randomly to three different experimental conditions as detailed in Table 4, below.

Table 4 Number of Experimental condition animals 3 Control: Pancreas was injected with 200 1 of saline.
3 Navl.5: Pancreas was injected with 4 x 106 fibroblasts over expressing the Na ion channel Navl.5.
Kvl.3: Pancreas was injected 4 x 106 fibroblasts over expressing the W ion 1 channel Kvl.3.

Rats were anaesthetized with an intraperitoneal injection of Xylasine (0.5 mg/kg) and Ketamine (0.5 mg/kg). Animals were kept wann on a heat mat heated to 38 C throughout the anesthesia to prevent hypothermia. The rats were operated ventrally by a median cut (4 cm long) exposing the pancreas. Genetically modified fibroblasts were injected to the head of the pancreas on 10 different sites.
The animals were sutured, and got single dose of antibiotics. Animals were treated with CyclosporinA (CsA) 5 mg/Kg/Day in order to prevent graft rejection. Antibiotic treatment was initiated one day prior to the first surgical procedure, and continued during the whole experiment.
Intravenous glucose tolerance test - One week following graft transplantation, an Intravenous Glucose Tolerance Test (IVGTT) was conducted.
Rats were anaesthetized as previously described. Rats were shaved at the front nape of the neck. The trachea was isolated and a plastic tube was inserted to assist with breathing during the experiment. The right jugular vein was isolated and tied off in its upper part. Then an incision was made in order to insert the cannula. The cannula was washed with heparinized saline (35LTIml) to maintain patency. 30 minuntes following the induction of anaesthesia, two sequential fasting blood samples were retrieved.
The IVGTT was commenced with a glucose load of 0.7 g/kg 50% glucose (w/v) as a single pulse over 30 seconds. Blood samples (200 L) for glucose and insulin analyses were collected to eppendorf tubes (without any heparine/EDTA) at 0, 2, 4, 6, 10, 20, 30, and 45 minutes following the glucose load. Plasma glucose levels were analyzed using Glucometer (Glucometer EliteXL, Bayer Ltd). Plasma insulin concentration was analyzed using radioimmunoassay kit (Linco, St Louis, MO, USA).
Fibroblast labeling - In order to track the transplanted cells, fibroblasts were labeled with fluorescent cell tracker CM-Dil (molecular probes).

Results PCR analysis of the clones - PCR analysis was effected to select the best expressing clone for cell transplantation. Figure 13 shows PCR screening of the transplanted Nav 1. 5 clone.
Voltage clamp analysis of transfectedfibroblasts - Voltage clamp analysis (Figure 14a) and the corresponding current-voltage (I-V) curve (Figure 14b) demonstrated the presence of high magnitude outward potassium current with rapid activation kinetics in the transfected fibroblasts. Previous studies have already demonstrated that no significant transmembrane currents are present in naive NIH/3T3 (Feld et al. 2002). A similar voltage clamp study is presently conducted on fibroblasts expressing the ion channel Navl.5.
Intravenous glucose tolerance test - Changes over time in plasma glucose concentrations after intravenous glucose load are shown in Figure 15. Changes over time in plasma insulin concentrations after intravenous glucose load are shown in Figure 16. Unexpectedly in the Nav1.5 group, insulin levels were reduced after the glucose load. The control group presents more typical response to IVGTT with maximum plasma insulin level concentrations reaching 10 minutes following the glucose load.
At the end of the experiment the animals were sacrificed and the pancreas of one rat was extracted for histological studying. Figure 17 demonstrates fibroblasts labeled with CM-Dil in the pancreas at the end of the experiment.
Thus, the present study demonstrates the ability to inject genetically modified cells to rat pancreas to thereby change the plasma insulin and glucose levels in diabetic rats. Specifically, all the animals survived the operation and were vital during whole experimental period. The implanted cells survived at the rat pancreas for a week as was demonstrated by immunohistochimestry. The Navl.5 expressing animals exhibited lower glucose levels 45 minutes following glucose load, as comparde to control animals. The basal insulin levels were the highest for the Navl.5 animals and the lowest for the Kv1.3 animal (not shown). The overall insulin secretion over time was higher for the Nav1.5 animals in comparison to control animals.

EXiD<IPLE 8 Biological pacemakers and prolonging the refractory period of the cardiac tissue Biological pacemakers can be produced by increasing excitability at a specific location or diffusely in a large area. Increasing excitability can be achieved by the following:
Transplantation of cell grafts (autologous, allogenic or xenogenic) capable of forming electrical coupling with host tissue. Examples are Mesenchymal stem cells [Valiunas V. et al. J Physiol. (2004) 555(Pt 3):617-26] or fibroblasts [Gaudesius G. et al. Circ Res. (2003) 93(5):421-8. Epub 2003 Jul 31] or myoblasts or embryonic or embryonic derived stem cells (e.g., cardiomyocytrs, myocytes, fibroblasts, Mesenchymal cells, etc.). The cells are ex vivo genetically modified to over-express sodium channels: for example (a) SCN5A, (b) Mutant SCN5A (?KPQ, N1325S, R1644H, E1295K, D1790G, ins1795) (these mutations cause LQTS and/or Brugada syndrome, and are characterized by long activation, and/or persistent current), (c) SCN1A, (d) SCN2A, (e) SCN3A, (f) SCN4A, (g) SCN8A, (h) SCN9A, (i) SCNlOA, (j) SCNl lA and/or calcium channels, Examples for calcium channels are: (a) L-type, and (b) T-type, and (c) N-type calcium channels, and/or non selective HCN
channel family (e.g. hHCN2, hHCN4, mHCNl, mHCN2), and/or leak ion channel (e.g. KCN-K family channel [Goldstein S. et al. Nature review neuroscience (2001): 2,(3) 184].
This method can be further enhanced by transplantation of cells overexpressing also connexin channel (e.g. connexin4O, connexin43, connexin45). An alternative approach can be the introduction of these sodium or calcium or non-selective or leak channels directly (without a cell as a vehicle as naked DNA
sequence or with viral vectors). The cells/DNA sequence can be transplanted in the atrial tissue at a predetermine pattern or diffusely (e.g. through coronary artery or surgery), the cells/DNA sequence can be transplanted to the area and/or surroundings of the AV
node (e.g. by catheterization through coronary arteries (AV nodal artery), or surgery, or directly by endocardial injection catheter) or to specific area in the cardiac ventricles (e.g. by catheterization through coronary arteries, or surgery, or directly by endocardial injection catheter). These approaches can be used for the treatment of bradycardias from all causes (e.g. AV _block, sick sinus syndrome), this approach can also be utilized for the treatment of atrial fibrillation combined with AV
nodal ablation (ablate and pace procedure).
Prolongation of cardiac tissue refractory period can be achieved by the following procedures: Transplantation of cell grafts (autologous, allogenic or xenogenic) capable of forming electrical coupling with host tissue. Examples are Mesenchymal stem cells [Valiunas V. et al. J Physiol. (2004) 555(Pt 3):617-26]
or fibroblasts [Gaudesius G. et al. Circ Res. (2003) 93(5):421-8], embryonic stem cells or derivatives thereof or myoblasts. The cells serve as a current sink, and therefore increase the amount of ionic current that is needed for generation of an action potential. This method can be further enhanced by transplantation of cells overexpressing connexin channel (e.g. connexin40, connexin43, connexin45) and/or overexpressing sodium channels [e.g. Mutant SCN5A (? KPQ or N1325S or R1644H
or E1295K or D1790G or ins1795, these mutations cause LQTS and/or Brugada syndrome, and are characterized by long activation, and/or persistent current]
and/or overexpressing potassium channels [e.g. voltage gated potassium channel (e.g.
Kvl.l, Kvl.2, Kvl.3, mutant Kvl.3 H401W)], Kir family: (e.g. Kir2.l) and/or overexpressing chloride channels (e.g. C1C family)). An alternative approach can be the introduction of these ion channels directly (without a cell as a vehicle as naked DNA sequence or with viral vectors). The cells/DNA sequence can be transplanted in the atrial tissue at a predetermine pattern or diffusely (e.g. through coronary artery or surgery), the cells/DNA sequence can be transplanted to the area and/or surroundings of the AV node (e.g. by catheterization through coronary arteries (AV nodal artery), or surgery, or directly by endocardial injection catheter) or to specific area in the cardiac ventricles (e.g. by catheterization through coronary arteries, or surgery, or directly by endocardial injection catheter). These approaches can be used for the treatment of atrial fibrillation, atrial flutter, atrial tachycardia, and ventricular tachycardia.

Materials and Experimental Procedures Expression system and electrophysiological recordings - NIH 3T3 fibroblast cells (ATCC: CRL 1658) were stably transfected to express the voltage gated 5 potassium channel Kvl.3 as previously described [Feld Y. et al. Circulation.
(2002);
105:522-529]. Briefly, stable transfection of pRC/CMV/Kv1.3 in fibroblasts was achieved using electroporation with a single pulse of 200 V, 960 gF followed by antibiotic selection of NeoR clones with 400 g/mL of G-418 (GIBCO, Langley, OK, USA). Alternatively, NIH/3T3 cells were stably transfected using Lipofectin 10 reagent (Invetrogen - life technology; Cat. No: 18292-011); and standard transfection protocol as recommended by the manufacturer. Colonies were picked and tested for channel expression using whole-cell patch clamp recordings. The recordings were conducted at room temperature using Axopatch 200 (Axon Instruments). Kvl.3 expressing fibroblast were generated as previously described [Feld Y. et al.
15 Circulation. (2002);105:522-9].
Wild type rat KV1.3 was received as a generous gift from Prof. Steve Golstein (Institute of Molecular Pediatric Science, University of Chicago).
The tryptophane to histidine exchange at position 401 was achieved by cloning the wild type rat KV 1.3 into the pGEM cloning vector, containing the endogenous 20 Accl restriction site and the designed BamHl restriction site on both sides of the desired mutation location (position 401).
Primers used creating the mutation:
rKv3(41-3) s Accl:
5' TTC ATT GGG GTC ATC CTT TTC TCC AGT GCA GTC TAC TTT
25 GCT GAG 3' (SEQ ID NO: 5).
rKv3(41-3) asl BamHl:
5' AAG GGA TCC CAC AAT CTT GCC TCC TAT GGT CAC TGG CCA
CAT ATC ACC ATA 3' (SEQ ID NO: 6).
The mutated 174 base-pair fragment was obtained and ligated into a PCR

30 cloning kit (Qiagen ; Cat. No:231122). Positive E-coli colonies were mini prepped and sequenced. The wild-type fragment was then exchanged with the mutated fragment using the Acci and BamHl restriction sites. Positive colonies were again sequenced. The exchanged Kv l.3 gene (referred to as H401 W-1) was amplified with the following primers, each containing the designed restriction sites:

rKv3 (41-3) s + Bgl2:
5' CAT AGA TCT GAA TCG GAG TGA GTG CCG 3' (SEQ ID NO: 7) rKv3 (41-3) as + EcoRl :
5' ATG AAT TCC ACA CAA TAC TGG GCA CAG A 3' (SEQ ID NO: 8) Finally, the 1.7 kb mutated fragment was cloned into pIRES2:GFP vector (clontech PT3267-5).
Cell co-culturing - Primary monolayer cultures of neonatal rat (Sprague Dawley) ventricular myocytes were generated as previously described [Nuss HB, Marban E, Johns DC. Overexpression of a human potassium channel suppresses cardiac hyperexcitability in rabbit ventricular myocytes. JClin Invest. 1999;
103:889-96]. Briefly, following excision, the ventricles were minced and treated with RDB
(IIBR, Ness-Ziona, Israel). Following centrifugation, dispersed cells were suspended in culture medium (Ham's F10), 5 lo fetal calf serum, 5 % horse serum, 100 U/ml penicillin, 100 mg/mi streptomycin (all from Biological industries, Beit Haemek, Israel), 1 mM CaC12 and 50 mg/100 ml bromodeoxyuridine (BrdU, Sigina). The cells were then cultured on gelatin coated (0.1 %) microelectrode culture plates at a density of 1.5x106 cells/ml.
Once a well synchronous spontaneous activity was established in the cardiomyocyte cultures, fibroblasts (naive, or Kv1.3 expressing fibroblasts) were seeded in a diffuse manner into the cardiomyocytic cultures. Two groups were studied: The cultures were studied daily, and the electrophysiological properties, essentially the spontaneous beating rate of the culture, was assessed at baseline and following application of the specific Kvl.3 blocker, Charybdotoxin (CTx), at increasing dosages (1, 10, 100 nM). The electrophysiological properties of the cultures were studied using a microelectrode array (MEA) mapping technique [Feld Y. et al. Circulation. (2002);105:522-9].
Animals - Animal studies were approved by the Animal Board and Safety Committee of the Technion's Faculty of Medicine. Two animal models (rats and pigs) were used in this study. The swine model allowed electrophysiological studying using a range of cycle-lengths (CLs) between 350 and 500 ms for the basic (S1) stimulation drive, whereas the rat model allowed the use of a more rapid stimulation protocol with CL of 200 ms at the basic S 1 train stimuli.
Rat model - Male Sprague-Dawley rats weighing 200-250 gr were anesthetized using A Xylasine (0.5 mg/kg) and Ketamine (0.5 mg/kg) preparation [see Example 7]. The animals were then intubated and ventilated using a Harvard small-animal mechanical respirator. The chest wall was opened using a left thoracotomy and the heart was exposed. After removal of the pericardium, a total of 6 x 106 cells (either fibroblasts without transfections in the control group or fibroblast overexpressing the KV 1.3 channel in the study group) were transplanted into the anterior aspect of the left ventricular wall using a 28 g needle. In order to prevent graft rejection, all animals were treated with a daily dose of cyclosporin (10 mg/kg) and methyprednisolone (2 mg/kg). The animals underwent a detailed electrophysiological study (see below) immediately before cell grafting and 7 days post-transplantation.
Swine model - Three domestic pigs (20-30) kg were studied. Anesthesia was induced with 5-10 ml of intravenous sodium pentothal 2.5% solution and maintained with inhaled isoflurane (2 %) in oxygen. Following a right thoracotomy, each heart was exposed and a total of 6 x 106 cells were transplanted at a total of 7 different locations in the anterior free wall of the right ventricle. Cells were delivered using a g needle using an injection volume of 250 l. The sites of cell transplantation were marked with a suture. To prevent graft rejection, the animals were treated with an immunosuppressive regimen (cyclosporine, 10 mg/kg/d and methylprednisolone, 3 25 mg/kg/d). 7 days following cell transplantation, a second thoracotomy and a detailed epicardial electrophysiological study were performed.
Cell labeling - transplanted fibroblasts were labeled prior to cell grafting with the nuclear fluorescent marker DAPI (Sigma) or with the fluorescent tracer,CFDA
(Molecular probes, Eugene, OR, USA).
In vivo electrophysiological studies - The electrophysiological study in rats included a standard ventricular pacing protocol to determine the local myocardial effective refractory period (ERP). The ERP was evaluated by applying a train of 20 stimuli at a fixed cycle-length of 200 ms (Si), followed by a single premature stimulus (S2). The S1-S2 coupling interval was gradually shortened. The ERP
was determined as the shortest S 1-S2 coupling interval still capable of eliciting a ventricular response. Stimuli were generated using a computer controlled STG

stimulus generator with the matching MC-Stim software (both from Multi Channel Systems, Reutlingen, Germany).
The ERP was measured at the site of cell transplantation and at remote sites, both prior to cell transplantation and seven days following cell grafting. In order to dissect the role of the overexpressed channel in altering the local myocardial electrophysiological properties, the ERP was measured also at each site following application of 9 g/kg of Margatoxin (Alomone Labs, Jerusalem, Israel), a specific Kv 1.3 channel blocker as an intraperitoneal bolus.
The ERP in the pigs was measured in a similar manner to that in the rats but using slower basic stimulation intervals (CLs of 350, 400 and 500 ms). The ERP
was measured at the site of cell transplantation as well as in remote sites and also following local intramyocardial injection of Margatoxin at the examined sites.
Immunostaining - At the end of the experiments the hearts were harvested and frozen in liquid nitrogen and cryo-sectioned (8 micron slices). Sections were first permeabilized using 1% triton and later blocked with 3 % NGS and 0.1 % triton for 1 hour at 37 C. Immunostaining was then performed using mouse anti-cardiac troponin I(cTnI) antibodies at a dilution of 1:3000 and rabbit anti-connexin 43 antibodies at a dilution of 1:100 (both antibodies were from Chemicon, Temicula, Ca) in blocking buffer for 24 hours at 4 C. Preparations where then incubated with Rhodamine-conjugated anti-mouse and FITC-conjugated anti-rabbit secondary antibodies at a dilution of 1:100 for 1 hour at room temperature. The preparations were then analyzed using an upright fluorescent microscope (Axioscop 2, Zeiss).
Computer sinzulation - A one-dimensional numeric mathematical model was used to provide mechanistic insights into the possible electrophysiological effects generated by the engineered cell grafts. This model simulates action potential propagation along a chain of five cardiomyocytes connected to an engineered fibroblast, overexpressing the Kv1.3 channel. The computer simulation was programmed using Matlab 6.5 software. The Lue and Rudy model17 was followed [Luo CH, Rudy Y. A model of the ventricular cardiac action potential.
Depolarization, repolarization, and their interaction. Circ Res. 1991;68:1501-26] for the action potential simulation in each cell and the cable theory for intercellular conduction simulation.
The gap junction resistance between two myocytes was set to 10 Kncm. The gap junction resistance between myocyte-fibroblast was set to 0.1/4S KS2cm (where S
is the fibroblast surface area). Myocyte surface area was set to 1 cm2 and the time step (dt) was set to 0.01 msec. The kinetic parameters of the voltage sensitive potassium channel Kvl.3 in the engineered fibroblast were taken from previous studies characterizing its biophysical properties [Marom S, Levitan IB. State-dependent inactivation of the Kv3 potassium channel. Biophys J. 1994;67:579-89]. The maximum potassium current amplitude was derived from previous patch-clamp studies characterizing the transfected fibroblasts [Feld (2002) Supra] and was set to 125 nA/(mV - cm2).
Electrophysiological measurement of the refractory period was simulated by applying two 10 nA/(mV = cm2) stimuli to myocyte A (Figure 22). The time between two stimuli was gradually shortened. The effective refractory period (ERP) was defined as the minimum time interval between the two stimuli allowing the generation of an action potential in myocyte E (Figure 22).
The refractory period generated by cell over expressing Kir channel, SCN5A
? KPQ sodium channel, and mutant Kvl.3 H401 W was also simulated (Figures 23a j).
Statistics - All results are expressed as mean + SEM. For the in-vivo experiments, data was compared using either paired or unpaired t-test. Data from the MEA experiment was compared using two ways ANOVA with repetition. Results were considered significant if P<0.05.

Results In vitro studies - To determine the ability of the transfected fibroblasts to affect the excitable properties of cardiomyocytes, changes in the spontaneous beating rate of the hybrid cultures following cell grafting were followed. The electrophysiological properties of the transfected fibroblasts, overexpressing the voltage sensitive potassium current Kvl.3 channel, used in the current study, were previously evaluated in depth [Feld Y. et al. Circulation. (2002) 105:522-9].
These voltage-clamp studies demonstrated the presence of robust expression of the Kvl.3 5 channel with a high-magnitude outward potassium current of up to 4 nA
recorded in the transfected fibroblasts. As expected, no significant currents were detected in non transfected fibroblasts that were used in the control co-cultures [Feld Y. et al.
Circulation. (2002);105:522-9].
The average spontaneous beating rate of both the control group (in which 10 naive fibroblasts were seeded) and the study (in which the transfected fibroblasts were used) co-culture group were assessed daily (Figure 18a). While the spontaneous beating frequency did not differ between the two groups at baseline (prior to cell grafting, Figure 18a - day 0), a significant reduction in the spontaneous beating frequency of the study co-culture group was detected from day 2. This negative 15 chronotropic effect, induced by the transfected fibroblasts was maintained during the entire experiment (Figure 18a). Interestingly, in some of these co-cultures, cell grafting even resulted, in complete cessation of spontaneous beating. In contrast, grafting of naive fibroblasts did not have a significant effect on beating frequency in the control group.
20 To dissect the possible contribution of the potassium current in the transfected fibroblasts to the generated electrophysiological effect in the co-cultures, the reversibility of this effect was addressed following administration of a Kv1.3 channel specific blocker, CTx. Administration of CTx had a dose-related effect in the study group (Figure 18b) with full reversibility of the negative chronotropic effect induced 25 by the transfected fibroblast when given at a dose of 100 nM. In contrast, CTx application did not significantly alter the beating frequency in the control group.
In vivo effects of cell grafting - To evaluate the ability of the engineered cell graft to modify the local myocardial electrophysiological properties also in vivo, possible changes in the local ventricular refractory period were followed after 30 transplantation in rats. Figure 19a depicts the changes in the local effective refractory period (ERP) prior to- and a week following cell grafting at a site in the left ventricular myocardium in one of the animals. Note that the ventricular ERP
(measured at a basic CL of 200 ms) was 60 ms prior to cell transplantation (Figure 19a, top panel) and increased to 170 ms at the site of cell grafting (Figure 19a, middle panel) seven days later. Interestingly, the increase in the local ERP at the site of cell grafting was partially reversed by the application of the specific Kvl.3 channel blocker, Margatoxin (MTx), with the ventricular ERP decreasing to 100 ms (Figure 19a, bottom panel).
The increase in the local ventricular ERP at the site of cell grafting was observed in all animals studied (n=10). This was manifested by an increase of the local ERP from a baseline value of 84 8 ms prior to cell grafting to a value of 154 13 ms (P<0.05) seven days later (Figure 19b). The Kv1.3 potassium channel is highly sensitive to MTx, at concentrations that do not affect any of the cardiac channels.
This allowed to examine whether the increase in the ERP was due to the presence of the transplanted fibroblasts in the native myocardium or due to the presence of the overexpressed potassium channels within the cells. Upon the administration of MTx, a significant decrease (P<0.05) was detected in the local ventricular ERP at the site of cell transplantation in all animals studied to a value of 117-1:8 ms (Figure 19b).
In contrast to the above results, the local ventricular ERP at remote ventricular sites (at least l Omms away from the site of cell transplantation) in the study group did not change seven days following the initial operation (8617 ms). Similarly, in the control group, which consisted of animals (n=8) that were grafted with the same number of naive fibroblasts (lacking transfection) only a very mild increase in the local ERP was detected at the site of cell grafting from a baseline value of 73 5 ms to a value of 88 4 ms (Figure 19b). This value did not change significantly following administration of Mtx (Figure 19b).
Due to the relatively fast spontaneous beating rate of the rat heart, the effects of cell grafting on the local ventricular refractoriness could only be detected at rapid ventricular stimulation rates (CL-200 ms). To assess whether the grafted cells could increase refractoriness also at more clinically relevant, slower ventricular rates (longer CLs), a swine model was used. Figure 20 displays the electrophysiological changes observed seven days following grafting of the transfected cells in the right ventricular free wall of a pig. Noteworthy is that the ventricular ERP at the site of cell transplantation (Figure 20a, middle panel) significantly increased to 310 ms (at a basic CL drive of 400 ms) when compared to control myocardial sites in which the measured ERP was 210 ms (Figure 20a, top panel). The increase in the ventricular ERP, observed at the site of cell grafting, was reversible upon the local application of MTx with the local ERP value decreasing to 220 ms.
The lower ventricular rate in the swine model allowed assessing of the electrophysiological effects of cell grafting using three different basic CL
drives: 350, 400, and 500 ms. As is shown in Figure 20b, transplantation of the transfected fibroblasts resulted in a significant increase (p<0.05) in the local ventricular ERP at all three CLs when compared to non-transplanted areas. The increase in the local ventricular ERP was reversible in all cases with the ventricular ERP
decreasing to values not different from the control sites following local application of MTx (Figure 20b).
After harvesting the hearts, the presence of the grafted cells at the site of cell transplantation was validated. The grafted cells were labeled prior to transplantation either by the fluorescent tracer CFDA (Figure 21 a) or with the nuclear fluorescent marker DAPI (Figure 21b). As can be seen in the immunostaining confocal image, the grafted fibroblasts could be easily detected (green labeled cells in Figure 21a, and DAPI labeled cells in Figure 21b) within the rat's myocardium along the needle's track. Interestingly, gap junctions could be recognized at the interphase between the grafted fibroblasts and host cardiomyocytes as identified by the positive punctuate staining for connexin 43 (green staining, arrows in the Figure 21b).
Modeling results - In order to achieve further insights into the possible mechanisms by which the transfected fibroblast could modulate the excitable properties of host cardiac tissue, computer simulation was employed. This simulation utilizes simplified one-dimensional numeric mathematical model that simulates action potential propagation along a chain of five cardiomyocytes connected to an engineered fibroblast (Figure 22e). The computer simulation was run for four different alternative strategies: (a) for a chain of cardiomyocytes without a connecting fibroblast, (b) with a connected naive fibroblast (without any currents), (c) with a connected fibroblast overexpressing the voltage-gated potassium channels Kv1.3, and (d) the same as (c) but without the unique inactivation properties of the Kv1.3 channel.
The results of the above-mentioned four simulations are depicted in Figures 22a-d. The effective refractory period (ERP) was defined as the minimum time deference between two stimuli applied to myocyte A that were conducted to all five myocytes (including myocytes C which is linked to the fibroblast). In the setup of five myocytes without a connecting fibroblast, the measured ERP was 375 ms (Figure 22a) in this case. When a fibroblast without transfection was connected to myocytes C, the ERP did not change and remained 375 ms (Figure 21b). In contrast, when the myocyte was connected to a fibroblast overexpressing the Kvl.3 channel, the same coupling interval (375 ms) resulted in the inability to induce action potential in myocytes C and consequentially in failure in conduction to myocytes D (Figure 22c).
Only longer CLs enabled impulse conduction through myocytes C. The changes in the ERP induced by the connecting fibroblats dependent on several factors.
Figure 22D, for example, shows that the ERP increased significantly with relation to the fibroblast surface area (Figure 21d). Hence, by increasing the surface area of the connecting fibroblasts a larger sink is generated and results in a significant prolongation of the myocytes refractory period.
When the inactivation property of the Kvl.3 channel was removed, the ERP
was shorter than the refractory period measured without a fibroblast connected. The last result suggest that the reason that fibroblast transfected with Kvl.3 channel lengthened the refractory period is that during phase 4 of the action potential Kvl.3 channels are in the state of inactivation and are moving to the close state through the open state. The inactivation time constants for the Kv 1.3 channel are very long -inactivation to open - Kio 1/10 Sec"1, and open to inactivation- Koi 1/0.7 Sec 1. The result is the generation of a relatively long tail current following repolarization [Marom (1994) Supra]. The tail current serves as a current sink to myocyte C, limiting the possibility for action potential generation long after repolarization occurs.
As mentioned hereinabove, traditional pharinacotherapy for the different cardiac tachyarrhythmias is limited by relatively low efficacy and significant side effects due to global cardiac action and systemic effects. The above-described shows a new approach for the modification of the myocardial electrophysiological properties by using genetically engineered cell grafts, transfected ex vivo to express specific ionic currents. Using fibroblasts engineered to express the voltage gated potassium current Kv1.3, the validity of this concept was demonstrated by showing the ability of the cells to reduce local excitability and prolong the local refractory period in ex vivo, in vivo, and computer simulation studies.
The ability of the transfected fibroblasts to modulate the local ventricular electrophysiological substrate as shown in the in vivo studies indicates the ability of the engrafted cells to survive following cell transplantation, their ability to integrate with host tissue, and their ability to modulate local excitability by the generation of electrotonic currents with neighboring cardiomyocytes. In order for the transfected channel to exhibit its effect on the surrounding native myocardium, the fibroblasts carrying the channel must be electrically coupled to the neighboring myocytes.
The possibility of such an electrical connectivity between cardiomyocytes and fibroblasts was previously demonstrated in the work of Rook et al [Rook MB, Jongsma HJ, de Jonge B. Single channel currents of homo- and heterologous gap junctions between cardiac fibroblasts and myocytes. Pflugers Arch. 1989;414:95-8] who demonstrated morphological connectivity in cardiomyocytes - fibroblast pairs in the appearance of connexin 43 gap junction protein, by Fast at al [Fast VG, Darrow BJ, Saffitz JE, Kleber AG. Anisotropic activation spread in heart cell monolayers assessed by high-resolution optical mapping. Role of tissue discontinuities. Circ Res.
1996;79:115-27]
who reported on electrical interactions in cultured cardiomyocytes harboring fibroblasts within them, and by a recent report by the present inventors showing the ability of transfected fibroblast to create local conduction blocks in co-culture experiments. More recently, Gaudesius et al. [Gaudesius G, Miragoli M, Thomas SP, Rohr S. Coupling of cardiac electrical activity over extended distances by fibroblasts of cardiac origin. Circ Res. 2003;93:421-8] have managed to show the ability of fibroblasts to propagate electrical signals over extended distances of up to microns in co-cultures.
In order for the long-term in vivo effects observed herein to occur, the transplanted cells must survive the procedure for at least seven days and generate electrical connections with host cells that result in a large enough electrotonic currents to generate a measurable effect. Interestingly, albeit several in vitro demonstrations of electrotonic currents appearing between fibroblasts and cardiomyocytes, the present inventors have previously shown [Feld Y, Melamed-Frank M, Kehat I, Tal D, Marom 5 S, Gepstein L. Electrophysiological modulation of cardiomyocytic tissue ' by transfected fibroblasts expressing potassium channels: a novel strategy to manipulate excitability. Circulation. 2002;105:522-9] that non transfected fibroblasts do not induce significant changes in activation patterns of cultured cardiomyocytes.
The results presented herein demonstrate that the electrophysiological effect created by the 10 implantation of the cells can be directly related to the activity of the transfected channels, as reflected from the lack of an effect in the control group, in which animals were treated with non transfected cells, and furthermore, by the reversibility of the effect seen in the animals receiving channel expressing fibroblasts upon the administration of the specific Kv1.3 blocker Margatoxin.
15 The mutated potassium channel used in this work, Kv1.3, was comprehensively studied and described by Marom et al [Marom S, Levitan IB.
State-dependent inactivation of the Kv3 potassium channel. Biophys J. 1994;67:579-89;
Marom S. Slow changes in the availability of voltage-gated ion channels:
effects on the dynamics of excitable membranes. J Membr Biol. 1998;161:105-13]. Several 20 properties made it suitable for the purpose of iinposing changes on the action potential morphology of neighboring cardiomyocytes. First, the robust potassium current and the readiness of its achievement allow a significant outward restraining current.
Second, the slow kinetics for transition from open to closed states allows a possible effect in late stages of the action potential. And last, the fact that the channel is not 25 expressed in the native myocardium and its sensitivity to the specific blocker Margatoxin provides the possibility to exclusively control the behavior of the channel when expressed by the fibroblasts and integrated into the myocardium.
Several important conclusion can be drawn from the results presented herein [Scheinman MM. NASPE Survey on Catheter Ablation. Pacing Clin Electrophysiol.
30 1995;18:1474-8]: Transplantation of fibroblasts genetically reprogrammed to express a voltage gated potassium channel altered the local effective refractory period (ERP) in a localized manner [Kusumoto FM, Goldschlager N. Cardiac pacing. NEngl JMed.
1996;334:89-97]. Transplantation of non transfected fibroblasts did not result in alteration of the ERP [Moss AJ, Zareba W, Hall WJ, Klein H, Wilber DJ, Cannom DS, Daubert JP, Higgins SL, Brown MW, Andrews ML. Prophylactic implantation of a defibrillator in patients with myocardial infarction and reduced ejection fraction. N
Engl J Med. 2002;346:877-83]. The activity of the introduced channel could be reversed in vivo by a systemic administration of a specific blocker, allowing a significant reduction in the effect [Echt DS, Liebson PR, Mitchell LB, Peters RW, Obias-Manno D, Barker AH, Arensberg D, Baker A, Friedman L, Greene HL, et al.
Mortality and morbidity in patients receiving encainide, flecainide, or placebo. The Cardiac Arrhythmia Suppression Trial. N Engl J Med. 1991;324:781-8].
Fibroblasts survived in the heart at least 7 days after transplantation.
Figure 21 provides an example for a section from a rat heart 7 days after the transplantation of fibroblasts. In this section, blue DAPI labeled nuclei of fibroblasts are aligned aside to the native heart cells, seen in red. Gap junction channels are depicted in green. The border zone between the graft and the cardiomyocytes is characterized by the appearance of a vast uniform appearance of gap junctions.
A
subset of animals was kept alive for a period of 28 days. When the hearts were excised and histological evaluation was effected, the fibroblasts could be readily visualized at the site of transplantation, with no apparent reduction in number. For an in-depth evaluation of the electrophysiological alteration elicited in the present study, a computer simulation was designed, allowing the prediction of the effect. Using this model, componential analysis of the electrical effect that resulted in the simulation was conducted. When the simulation was programmed to disregard the inactivation properties of the channel, no significant increase in the ERP could be detected. When the inactivation component was added, the significant, cell surface related increase in the ERP was revealed. This surprising fmding helped to address the riddle of the mechanism underlying the observed electrophysiological effect of an increase in the ERP. 'A possible explanation may be provided by the inactivation properties of the KV 1.3 channels. When a myocyte is activated and depolarized, a voltage difference is created between it and the neighboring transplanted fibroblast. This voltage difference results in an electrotonic current, flowing from the myocyte to the fibroblast via gap junction channels. The resulting rise in the fibroblast's membrane potential may lead to the opening of the voltage gated potassium channels and the generation of an outward potassium current from the fibroblasts as a result. This current, sustained throughout the action potential period, influences directly on the myocyte's action potential morphology. These changes include: (1) phase 0 of the action potential decreases, as was previously observed [Feld (2002) Supra] to create conduction velocity delays in vitro, (2) the amplitude of the action potential is decreased, and (3) the action potential duration is shortened.
The ability to increase the refractory period is imparted by the inactivation property of the KV 1.3 potassium channel. Shortly after the activation and the opening of the channel, the channel shifts to its inactive state. From this state the channel can not return to a closed state, but rather has to go through the open state in order to close. It is during the time of transition from an inactivated to close states, through the open state, that the important current results. This tail current is present during the late phases of the action potential and continues through the diastolic phase of the action potential. As long as this tail current occurs, it serves as a restraining current resisting an electrical activation. The fibroblast if so, serves as a current sink during this time, leading to the prolongation of the effective refractory period.
This novel exciting treatment modality is based on the utilization of cell grafts that can be genetically manipulated ex vivo to display specific electrophysiological characteristics and then be grafted to the in vivo heart. This approach is featured by a number of theoretical advantages over direct gene therapy. These advantages may be related to a better efficiency and control of the transfection process ex vivo.
Additionally, several ion channels and other electrically related components may be combined together in one cell, allowing a variety of electrophysiological effects that could be specifically designed in a manner that would generate electrophysiological behaviors that are absent in the native context. Another advantage is the ability to screen the phenotypic properties of the cells prior to transplantation, and the possible achievement of long-tenn effect since cardiac cell grafts were demonstrated to survive for prolonged periods following transplantation [Muller-Ehmsen J, Peterson KL, Kedes L, Whittaker P, Dow JS, Long TI, Laird PW, Kloner R.A. Rebuilding a damaged heart: long-term survival of transplanted neonatal rat cardiomyocytes after myocardial infarction and effect on cardiac function. Circulation. 2002;
105:1720-6].
Thus, the present approach approach can be applied as a tool for terminating arrhythmogenic conduction circuits. Generation of different ion channel compositions within an engineered cell, serving as a transplantable electrical modulating agent, may offer an innovative, pathology oriented tool for modifying the electrophysiological properties of the cardiac tissue for the treatment of cardiac arrhythmia.
Results presented herein were further substantiated in further clinical evaluations comprising larger samples of animal subjects (see Example 9, below).

Refractory Period Prolongation by Fibroblasts Overexpressing ion channels in Pig Hearts The Kvl.3 channel expresses a long tail current causing it to be attractive as a potential modulator of the cardiac effective refractory period (ERP) when overexpressed by cardiomyocytes or other cells electrically coupled with cardiomyocytes. As shown above, Kvl.3 channel in which the histidine at position 401 was replaced by tryptophan (Kvl.3 H401 W) introduced a rapid inactivation property to the channel. Preliminary analysis suggested that the effect of the mutation is caused by slowing. down of the recovery rate from inactivation. In this channel recovery from inactivation involved passing through the open state. It was therefore expected that the mutant channel will have a significantly long tail current.
The following shows the prolongation of the refractory period of pig hearts at specific loci by transplantation of fibroblasts overexpressing GFP, the wild type (WT) Kv1.3 channel, and the Kv1.3 H401W as was evaluated by computer simulation and in vivo experiments.

Materials and Experimental Procedures Expression system and electrophysiological recordings - see Example 8 above.

In vivo animal study Right ventricle - Seven domestic pigs (each of 20-30 kg) were studied.
Anesthesia was induced with 5-10 ml of intravenous sodium pentothal 2.5 %
solution and maintained with inhaled isoflurane 2 % in oxygen. Following a right thoracotomy, the heart was exposed and a total of 6 x 106 cells were transplanted at six different locations in the anterior free wall of the right ventricle. The sites of cell transplantation were marked with a suture. To prevent graft rejection, the animals were immunosuppressed (cyclosporine lOmg/kg/d, methylprednisolone 3mg/kg/d, and azathioprime 50mg/d). Seven days following cell transplantation, a detailed electrophysiological study was performed.
Electrophysiological analysis - The electrophysiological analysis included a standard ventricular pacing protocol to determine the local myocardial effective refractory period (ERP). The ERP was evaluated by applying a train of 20 stimuli at a fixed cycle-length of 350 ms (Sl), followed by a single premature stimulus (S2). The S1-S2 coupling interval was gradually shortened. The ERP was determined as the shortest S1-S2 coupling interval still capable of eliciting a ventricular response.
Stimuli were generated using a computer controlled STG 1004 stimulus generator with the matching MC-Stim software (Multi Chamiel Systems, Reutlingen, Germany).
The ERP was measured at the site of cell transplantation and at remote sites, seven days following cell grafting. In order to dissect the role of the overexpressed channel in altering the local myocardial electrophysiological properties, the ERP was measured also at each site following an intravenous application of 9 g/kg of Margatoxin (Alomone Labs, Jerusalem, Israel), a specific Kv 1.3 channel blocker.

AV node - Two domestic pigs (each of 20-30 kg) were studied. Anesthesia was induced with 5-10 ml of intravenous sodium pentothal 2.5 % solution and maintained with inhaled isoflurane 2% in oxygen. The pigs were catheterized, and baseline electrophysiological study was recorded, then an activation map of the atria was recorded (NOGA Biosense). Once the His bundle was identified, 8 x 107 cells were injected using the NOGA Star catheter (Biosense). One and 2 weeks following cell transplantation the pigs were anesthetized and an electrophysiological study was performed.
5 Electrophysiological analysis - The electrophysiological study included a standard atrial pacing protocol to determine the AV node effective refractory period (ERP). The ERP was evaluated by applying a train of 20 stim., uli at a fixed cycle-length of 350 ms (S1), followed by a single premature stimulus (S2). The S1-S2 coupling interval was gradually shortened. The ERP was determined as the shortest 1o Sl-S2 coupling interval still capable of eliciting a ventricular response.
Stimuli were generated using a computer controlled STG 1004 stimulus generator with the matching MC-Stim software (Multi Channel Systems, Reutlingen, Germany) connected to the Carto system (Biosense).

Results 15 Patch clamp recording NIH 3T3 fibroblasts were transfected with wild-type Kv1.3 potassium channel or mut Kvl.3 H401 W and their activation pattern and as well as tail currents were compared. As can be seen, patch clamp analysis of isolated fibroblast revealed a rapid inactivation in the mut Kvl.3 H401W channel compared to the WT Kvl.3 (Figures 20 24a-b) and significantly long tail current in the Kvl.3 H401 W compared with the WT
Kv l .3 (Figures 24c-d).
Electrophysiological studies In vivo ERP in pigs transplanted with the above fibroblasts was analyzed in 6 different locations. As shown in Figure 25a, in vivo ERP at control areas was 25 ms (n=21), in areas transplanted with fibroblasts transfected with GFP, ERP
was 223 +9 ms (n=11), in areas transplanted with fibroblasts transfected with WT Kvl.3 the ERP was 227 11 ms (n=3), and the ERP at areas transplanted with the Kv1.3 was 259 9 ms (n=7) (P<0.05 compared with control, and Fib-GFP), and ERP at areas transplanted with the Kir2.1 was 260 7 ms (n=7, P<0.05 compared with control, and 3o Fib-GFP).

Computer simulation Computer simulation revealed that ERP without fibroblasts (control) and with non-transfected fibroblasts (unmodified) was 375 25 ms, while the ERP value for fibroblasts overexpressing WT Kvl.3 was 425 zk25, and 500 25 ms in the case of mutant Kvl.3 H401 W(Figure 25b).
AV node modification Two domestic pigs were studied. The AV node effective refractory period was 240 10 ms at baseline, 275 15 ms 1 week following transplantation that was reduced to 250 ms following application of Margatoxin (MTX - a specific blocker of Kvl.3 channel). Two weeks following transplantation the ERP was 281.5 }1.5 ms and was reduced to 225 40 ms following MTX administration. MTX had no effect on the ERP of the AV node in non-transplanted pigs (see Figure 26b).

Conclusions The foregoing suggests that ion cliannel overexpressing cells may be used to locally modulate the electrophysiological properties of cardiac tissues.
Fibroblasts transfected with the Kvl.3 H441 W were more potent in prolonging ERP of transfected pigs than fibroblasts transfected with GFP and even more effective compared to WT Kvl.3 (p=0.054) expressing cells, probably due to its biophysical properties of low transition rate form inactivation state to open state manifested by long tail current following activation. Transplantation of fibroblasts overexpressing the Kir2.1 potassium channel is also associated with significant local prolongation of the refractory period.

EXAMI'LE 10 Modulation of neuronal discharge by the present invention Background Neurological disorders are a major cause of morbidity and mortality. There are more than one million Americans that suffer from Parkinson's disease [N Engl J
Med 1998 Oct 8; 339(15):1044-53]. According to the National Society for Epilepsy -Epilepsy appears in 1 in 200 people.
Neurological disorders are associated with increase or decrease of neuronal discharge at specific loci and/or distributed loci in the central nervous system (CNS) or peripheral nervous system (PNS).
Modulation of the neural activity in specific areas may result in improvement of neurological disorders. Examples are focal ablation of epileptic foci, and deep brain stimulation for the treatment of Parkinson's disease (N Engl J Med 2001;345:956-63).
One available evidence indicates that only connexin32, connexin36, connexin43 and connexin47 are expressed in neurons [Nat Rev Neurosci. 2001 Jun;2(6):425-33]. Using freeze-fracture and immunogold labeling, it has been shown that only connexin36 is present at gap junctions between neurons, whereas connexin32 and connexin43 are present at glial gap junctions [Proc Natl Acad Sci U S
A. 2000 Jun 20;97(13):7573-8]. Connexin47 is a neuron-specific connexin with a wide distribution in the CNS [J Neurosci. 2001 Feb 15;21(4):1117-26].
Connexin36 is expressed specifically in parvalbumin-expressing GABA intemeurons [Brain Res.
2000 May 19;865(1):121-38].
Modulation of neuronal discharge can be achieved by two major strategies, first, increasing or decreasing efficacy of electrical and/or chemical synaptic coupling between neurons; second, increasing or decreasing intrinsic neuronal excitability properties (e.g. increase/decrease bursting rate, bursting duration, silent duration, and bursting amplitude). Both strategies may be realized by transplanting cells capable of forming gap junction. Examples are microglia or oligodendrocytes or astroglia or Mesenchymal stem cells [J Physiol. 2004 Mar 16;555(Pt 3):617-26] or fibroblasts [Circ Res. 2003 Sep 5;93(5):421-8. Epub 2003 Jul 31]. Such cells, by virtue of their intrinsic electrical properties (passive, e.g. capacity, and/or active elements, e.g. ionic channels), coupled electrically to the neuronal cells, will exert their said modulatory effects.
Modulation of neuronal discharge may also be achieved by transplantation of cell grafts overexpressing connexin channels (e.g. connexin32, connexin36, connexin43, connexin47) and/or overexpressing voltage-gated and/or ligand-gated ion channels (e.g. sodium channels, calcium channels, Acetyl-Cholin receptor channels, leak channels, potassium channels). Examples for sodium channels: (a) SCN5A, (b) Mutant SCN5A (AKPQ, N1325S, R1644H, E1295K, D1790G, ins1795) (these mutations cause LQTS and/or Brugada syndrome, and are characterized by long activation, and/or persistent current), (c) SCN1A, (d) SCN2A, (e) SCN3A, (f) SCN4A, (g) SCN8A, (h) SCN9A, (i) SCNlOA, (j) SCN11A. Examples for calcium channels are: (a) L-type, (b) T-type, and (c) N-type calcium channels.
Examples for non-selective depolarizing ion channels (HCN channel family: e.g. hHCN2, hHCN4, mHCNI, mHCN2). Examples for ACh receptor channels are Kir3.1, Kir3.2, Kir3.3 and Kir3.4). Examples for LEAK channels are of the KCN-K family channel).
Examples for potassium channels are voltage gated family e.g. Kv1.1, Kvl.2, Kvl.3 mutant Kvl.3 H401 W or inward rectifier family e.g. Kir2.1.
Another alternative is overexpression of depolarizing (e.g. sodium channels, calcium channels, non-selective ion channels) or hyperpolarizing (e.g.
potassium or chloride ion channels) ion channels by neurons. or microglia or oligodendrocytes or astroglia (with or without the use of grafted cells).
The inhibitory network is of a particular interest. These neurons form an electrically coupled sub-network that controls the activity of surrounding excitable neurons. Most importantly the coupling between these inhibitory neurons is via connexin36. Cells expressing or overexpressing connexin36 may serve as an attractive vehicle to modulate the inhibitory networks function at specific areas in the CNS. These cells may increase inhibitory interneuron coupling, and therefore increase the inhibitory system function at a specific location. Increasing the inhibitory networks function will result in a decrease of the overall function at the specific area.
This effect on the inhibitory networks can be further enhanced by using cells that overexpress depolarizing ion channels. This approach can serve as a novel treatment modality for depressing epileptic foci and/or pain release. Furthermore, modulating the activity of the subthalamic nucleous and/or the internal globus pallidum and/or the zona, increta and/or the nigra reticulata can serve for the treatment of Parkinson's disease [Lang EA. Et al. N Eng17 Med. 1998 Oct 15;339(16):1130-43. Review]. It is also possible to decrease the inhibitory network function by using cells expressing and/or overexpressing connexin36 and hyperpolarizing ion channels (e.g.
potassium channels (Potassium channels: Kv family, Kir family, HERG, Delayed rectifier, and chloride channels: CIC family: C1C1, CIC2, C1CN3, CIC4, CIC6). Decreasing the inhibitory system will result in increase excitability of specific areas in the CNS. This approach may be utilized for the treatment of Alzheimer's disease, and other neurodegenerative disorders.
Another alternative approach is the use of cells expressing and/or overexpressing connexin47 in order to increase pyramidal or purkinje cell coupling.
Furthermore, pyramidal or purkinje cells coupling may be enhanced by cells expressing or overexpressing connexin47 and depolarizing ion channels.
Increasing pyramidal or purkinje cells coupling and/or excitability may be used for regaining functionality in brain areas after lesion due to CVA or other brain damages.
Moreover, pyramidal or purkinje cell excitability can be decreased by utilizing cells expressing or overexpressing connexin47 and hyperpolarizing ion channels. This strategy can be used for the treatment of epilepsy or phantom pain.
Overexpression of ion channels or connexin by neurons or microglia or oligodendrocytes or astroglia can be effected by in-vivo gene therapy invlolving direct stereotaxis guided injection of naked DNA or virus vector carrying the DNA
sequence. Alternatively, injection of the naked DNA or virus vector carrying the DNA sequence to an artery feeding the specific area in the CNS. Systemic administration of DNA may be effected by intravenous injection using a promoter specific to neuron or microglia or oligodendrocytes or astroglia.
Ex vivo gene transfer may involve the use of autologous, allogenic, or ~ xenogenic cells. The cells must be capable of forming electrical coupling with host cells in a specific area in the CNS either by the expression of an endogenous protein or by overexpressing a protein capable of creating electrical coupling.
The cells can be transplanted in the CNS following expansion and/or genetic manipulation by one or more of the following procedure: direct stereotaxis guided injection of the cells [Kakishita K et al. Experimental Neurology 165, 27-34 (2000)];
or injection of the cells to an artery feeding the specific area in the CNS.

Modulation of the inhibitory output of the basal ganglia using Cx36 e.xpressing fibroblasts The inhibitory neural network (composed of inhibitory inter neurons) was the 5 focus of following study. These neurons form an electrically coupled sub-network that controls the activity of surrounding excitable neurons. The inhibitory neurons exclusively express the gap junction protein Connexin36 (Belluardo et al.
2000; Sohl et al, 2005), which allows coupling between these inhibitory neurons.
Inhibitory neurons exclusively express the gap junction protein Connexin36, 10 suggesting the use of genetically modified fibroblasts, which overexpress this protein, to specifically and exclusively modulate the activity of the inhibitory sub network.
Parkinson's disease (PD) was chosen as a candidate disease for treatment with modified fibroblasts expressing Connexin36. Parkinson's disease is a degenerative neurological disorder characterized by selective loss of dopaminergic neurons in the 15 substantia nigra pars compacta (SNc). This loss leads to marked depletion of dopamine from the primary projection region, the striatum. As a result, the subthalamic nucleus (STN), an excitatory nucleus, is dis-inhibited and in turn overactivates the major inhibitory-output nuclei of the basal ganglia, namely, the substantia nigra pars reticulate (SNr) and the internal segment of the globus pallidus 20 (GPi). This leads to over-inhibition of the thalamus by the basal ganglia, ultimately resulting in the bodily motor symptoms associated with PD.
Alleviation of PD-associated inotor symptoms was demonstrated by STN
ablation (Gill and heywood, 1997; Alvarez et al. 2001), by STN silencing through local lidocaine or muscimol infusion (Levy et al. 2001), as well as by electrical 25 inhibition with high-frequency stimulation both of the STN and of the GPi (Limousin 11995; Peppe et al. 2004; Anderson et al. 2005).
The following describes a novel cell therapy approach, aimed at modulating the inhibitory output of the basal ganglia using modified fibroblasts.

Material and methods:
In vitro experiments:
Preparation of cultured hippocampal neurons - Primary cultures of dissociated rat hippocampal cells were prepared as previously described (Ryan et al, 1993). To that end, hippocampal CA1-CA3 regions were dissected from 1-2 day old Sprague-Dawley rats, dissociated by trypsin treatment followed by triturization with a siliconized Pasteur pipette and then plated onto coverslips coated with Poly-D-Lysine (Sigma, USA) inside 8 mm diameter glass cylinders (Belico Glass, NJ, USA) microwells.
Culture media consisted of minimal essential media (Gibco BRL, MD, USA), 0.6 % glucose, 0.1 g/l bovine transferrin (Calbiochem CA, USA), 0.25 g/l insulin (Sigma), 0.3 g/l glutamine, 5-10 % FCS (Sigma), 2 % B-27 supplement (Gibco) and 8 M cytosine b-D-arabinofuranoside (Sigma). Cultures were maintained at 37 C in a 95 % air, 5 % C02 humidified incubator, and culture media was replaced every 7 days.
Preparation of cultured cortical neurons - Primary cultures of rat cortical neurons were prepared as described previously (Eytan et al. 2003; Marom and Shahaf 2002; Shahaf and Marom 2001). Briefly, cortical neurons were obtained from newborn rats within 24 h of birth. The cortex tissue was enzymatically digested and mechanically dissociated, and the neurons were plated directly onto substrate-integrated multi-electrode array (MEA) dishes (Gross 1979; Stenger and McKenna 1994). Cultures were grown in MEM supplemented with heat-inactivated horse-serum (5%), glutamine (0.5 mM), glucose (20 mM), and gentamycin (10 g/ml), and maintained in an atmosphere of 37 C, 5% C02-95% air, in a tissue culture incubator and during the recording phases. Experiments were performed during the third week after plating, following the period of functional and structural network maturation.
Electrophysiological analyses - Commercially available arrays of 60 Ti/Au/TiN electrodes, 30 m diam, spaced 200 m from each other (MCS, Reutlingen, Germany) were used. The insulation layer (silicon nitride) was pretreated with poly-L-lysine. The arrays were connected to a 60-channel amplifier (B-MEA-1060, MCS), with frequency limits of 1-5,000 Hz and a gain of x 1,024, which was further amplified using MCPPIus variable gain filter amplifiers (Alpha-Omega, Nazareth, Israel). Data was digitized, using two parallel 5200a/526 A/D boards (Microstar Laboratories). Each channel was sampled at a frequency of 24 ksample/s and output was prepared for analysis using the A1phaMap interface (Alpha Omegal).
Thresholds (x 8 RMS units-typically in the range of 10-20 V) were defined separately for each recording channel prior to the beginning of the experiment. All data presented in this manuscript was obtained from threshold crossing events.
Analysis of sample experiments revealed that the results were not qualitatively affected by passing the data through a spike-sorting procedure (principal component methodology; A1phaSort software, Alpha Omega).
Several records were performed under the application of a Kvl.3 channel blocker (rCarybdotoxin; Alomone aboratories). The blocker was applied to the array, using a standard perfusion system, to a final concentration of 1nM.
DNA constructs - pEGFP-C 1 was purchased from Clontech (clontech Cat. No.
PT3028-5), rat connexin36-EGFP was received as a generous gift from Dr. Zoidl G.
(Zoidl G et al. J Neurosci Res. 2002 Aug 15;69(4):448-65), and hKir2.1 was purchased from Genecopoeia (EX-A0606-M01).
Mutatgenesis of wild type Kvl.3 channel (rKvl.3:H401 W) was done as described above.
Cell lines - All cell lines were created using the same method: NIH/3T3 fibroblasts were transfected with the selected DNA plasmid using Lipofectin Reagent (Invitrogen) and standard transfection protocol as recommended by the manufacturer.
72 hours after transfection, 500 g/ml of G-418 (GIBCO) was added to the growth medium for selection of cells expressing the neomycin resistance gene. Clones were isolated using standard cloning rings (Corning). Cells were grown in DMEM, supplemented with 10 % FCS, Gentamycin (50 ?g/ml) and Penicillin (100 units/ml) -Streptomycin (100 ? g/ml). Medium was replaced every 3 days.
Dye coupling - To monitor the diffusion of fluorescent molecules through gap junctions (dye coupling) the method described by Tomasetto et al. (1993) and Goldberg et al. (1995) was used. Briefly, cells were preloaded with 2 different dyes:

the gap junction permeant dye Calcein-AM (using the acetoxymethyl ester derivative of the dye), and the membranal dye DiD (Molecular probes). The loaded cells are then sown over a monolayer of unloaded cells. Within a short time, fluorescent gap junction permeant dye will be observed to pass from "donor" to "acceptor"
cells.

Loading procedure: 5 M calcein-AM (Fluka17783) and 2.5 M DID
(Molecular probes) were added to the medium.
Cells were incubated with the dyes at 37 C for 30 minutes. Excess unincorporated dye was removed by three consecutive washes in PBS + 2 mM Ca +
and 2 mM Mg2 Labeled cells were harvested using standard trypsinization methods and centrifuge for 3 minutes in 2000rpm. Cell pellet was resuspended in serum-containing medium. A small number (-8 x103) of the calcein and DiD-loaded cells (donor cells) was added to the monolayer of cultured fibroblasts or cultured neurons (acceptor cells). After four hours incubation the co-culture was inspected by microscope for fluorescent intensity in acceptor cells.
Immunohistochemistry - Cultures and Co-cultures were grown on cover slips, followed by retrospective immunocytochemistry analysis. Co-cultures were fixed by flooding the chamber with a fixative solution comprising 4 %
formaldehyde and 120 mM sucrose in phosphate buffered saline (PBS) . The cells were permeabilized for 10 min in fixative solution to which 0.25 % Triton X-(Sigma) was added. Cells were washed 3 times in PBS, incubated in 10 % bovine serum albumin (BSA) for 1 hour at 37 C, and incubated overnight at 4 C with primary antibodies in PBS and 1 % BSA. C ells were then rinsed 3 times for 10 minutes with PBS, and incubated for 1 hour at room temperature with secondary antibodies in PBS and 1% BSA. Finally, cells were rinsed with PBS and imaged immediately. Primary antibodies used in this study: anti-GFP (Santa Cruz Cat.
No.

sc8334) anti-glutamic acid decarboxylased (GAD)(Chemicon Cat. No. MAB351R).
Western blot analysis - Confluent 10 cm plates were washed with D-PBS
(Dulbecco's Phosphate Buffered. Saline, Biological industries Beit Haemek, cat number 02-023-1A) and cell lysate was obtained using 300 l of cold RIPA
buffer (RIPA lyses buffer Santa Cruz Biotechnology, cat number sc-24948). The lysate was centrifuged at 13000 g for 10 minutes at 4 C and sample buffer (Bio-rad Cat.
No.
161-0737; {beta}-mercaptoethanol was added) was added to supernatant. Sample was incubated for 5 minutes at 95 C, loaded onto a 10% SDS-PAGE (Novex; Cat. No.
EC6078BOX) and immobilized to a nitrocellulose filter. The filter was incubated in PBS with 1% casein (Bio-rad Cat. No. 161-0783) for 30 minutes at RT, then probed with anti-Kvl.3 polyclonal antibodies (Chemicon; Cat. No. AB5178) or anti-Cx36 (Zymed; Cat. No. 51-6200) overnight at 4 C, followed by goat anti-rabbit horseradish peroxidase labeling (Sigma; Cat. No. A6154). After extensive washing in PBS, bands were visualized by chemiluminescent reaction (Dab, Sigma).
Whole cell patch clamp recordings - Voltage-clamp recordings were performed using the whole-cell patch clamp technique, all measurements were done at room temperature. Patch pipettes (2-4 MO) were prepared from glass capillary tubes (Jencons Cat. No. 687-055) using a double-stage puller (Narishige pp-830).
Currents were recorded with an Axon Instruments amplifier (Axopatch 200), digitized by DigiData 1322A digitizer (Axon instruments). Data was analyzed using pCLAMP
software (version 8.0). Bath solution for the whole-cell recordings contained (in mM):
140 NaCI, 3 KCI, 2 CaCl2, 2 MgCl2, 10 Glucose and 10 HEPES (pH 7.4). Pipette solution for the whole-cell recordings (in mM): 140 KCI, 10 Na2 ATP, 1 CaC12, MgC12, 10 EGTA and 5 HEPES (pH 7.4).
In- vivo experiments Animals - Adult male Wistar rats (Harlaan, Israel) weighing 200-250 g were housed in groups of four in a temperature controlled environment under 12/12 hours light-dark cycle.
6-OHDA lesioning - Desipramine HCI (10 mg/Kg, s.c.) was administrated 30 minutes prior to the stereotaxic injection of 8 g/4 l 6-OHDA (in saline containing 0.1 % ascorbic acid) into the right medial forebrain bundle (MFB). Injection coordinates, relative to the bregma, were: (AP): -4.4; (LR): 1.3; (DV): -7.7 (from dura) or -8.1 (from skull).
Perfusion rate was 1 l /min for 4 minutes. At the end of each injection the needle (30G with round-blunted tip) was left in situ for an additional 5 minutes and then slowly retracted.
Cell implantation - 2.5 x 105 cells (in phosphate buffered saline supplemented with 1 mg/ml glucose) were streotaxicaly injected to the GPi. The same amount of cells was stereotaxically injected to the SNr. Coordinates used (relative to bregma adn skull):
medial globus pallidum (MGp) - (AP): -2.8, (LR): +2.9, (DV): -7.7.
substantia nigra reticulum (SNr) - (AP): -5.5, (LR): +2.3, (DV): -8Ø
5 At each site, cells were injected over a period of 5 minutes at a rate of 1 l/min. At the end of the 5 minutes injection period, the needle was left, in situ, for additional 5 minutes before being slowly retracted.
Behavioral test - Initially, 20 rats were lesioned with 6-ODHA. 5-6 weeks after 6-OHDA lesion each animal was prescreened for apomorphine-induced 10 rotational asymmetry.
Rats were placed in a cylindrical cage and injected with 0.25mg/Kg apomorphine (sigma, Cat. No. a-4393) after a five-minute acclimatization period.
Numbers of rotations, both ipsilateral and contralateral, were recorded at five-minute intervals using an automatic rotometer (Rota-Count-8; Columbus Instruments) over a 15 1.5 h period. 12 rats were classified as Parkinsonism after meeting the threshold criteria of seven or more full contra-lateral rotations/minute.
Microdialysis - A hole was drilled through the skull at the following coordinates: A: -2.56, and L: 2.6 relative to Bregma., A guide cannula (CMA/11, Cat.
No. 8309018) was inserted through this hole to a depth of 7.7 mm relative to skull, 20 corresponding to the internal globus pallidum, and anchored in place using dental cement. Microdialysis measurements were carried out using an individual free running cave system connected to sample collector. CSF buffer was perfused via a probe, inseted through the guide cannula, at a rate of 1.5 l/min for 20 minutes.
Glutamate levels were analyzed by CMA 600 microdialysis analyzer. When glutamate levels in 25 the samples showed stable vali,ues, 3 mg/Kg haloperidol, or the specific D2 receptor antagonist Raclopride (3mg/kg) were administrated s.c. Twenty minutes later a second microdialysis measurement was taken.
Results Connexin36 (Cx36) expressed in NIH3T3 is functional 30 GABAergic inter neurons in the brain, more specifically parvalbumin-contianing neurons, express the gap junction protein Cx36 (Belluardo et al.
2000).

Thus, in order to modulate the inhibitory GABAergic neural network using cell therapy, cells of the present invention should express the Cx36 protein. This protein will enable the fibroblasts to create gap junctions specifically with the GABAergic inhibitory neurons. For this reason, a NIH/3T3 clone, overexpressing the gap junction protein Cx36 in-frame fused to GFP (NIH/3T3:Cx36GFP), was generated using standard transfection and cloning methods. Protein expression was confirmed using western blot (data not presented) and immunocytochemistry analysis (Figures 27a-d).
The dye coupling method was used to determine the functionality of the exogenous protein. To that end, the amount of dye transferred between donor and acceptor cells (quantified as fluorescent intensity in acceptor cells) was measured in two different sets of co-cultures: (a).In the control co-culture, donor cells were naive NIH/3T3 which were seeded on unlabeled acceptor-monolayers of naive NIHI3T3, (b). In the study culture, donor cells were modified fibroblasts (NIH/3T3:Cx36GFP) seeded on unlabeled acceptor-monolayer of modified fibroblasts (NIH/3T3:Cx36GFP).
It is important to note that naive NIH/3T3 endogenously express gap junction proteins as Cx43 (but do not express Cx36). So, naive fibroblasts should also be able to tiransfer dye, but in smaller amounts compared to modify fibroblasts over-expressing the exogenous Cx36 gene.
As sliown in Figures 27a-e, the amount of dye transferred in the modified fibroblasts co-culture was significantly higher as compared to dye transferred between naive fibroblast co-cultures. The averaged fluorescent intensity of acceptor fibroblasts in naive co-culture was less then <200 (fluorescent arbitrary units); while the averaged fluorescent intensity of acceptor fibroblasts in co-culture of NIH/3T3:Cx36GFP
was greater than 300 (fluorescent arbitrary units) as seen in Figure 28e.
These results indicate that Cx36 modified fibroblasts of the present invention possess more functional gap junctions in comparison to naive fibroblasts, demonstrating that the exogenous protein is functional.
Fibroblasts expressing Cx36 can create gap junctions witla neurons - After establishing that NIH:Cx36GFP fibroblasts express functional Cx36, the ability of these modified cells to create gap junctions with neurons in hippocampal cultures was tested.
The ability of NIH:Cx36GFP to create gap junctions with neurons was assessed using the dye coupling technique, in which dye transfer between donor fibroblasts and acceptor neurons is indicative of the creation of effective gap junctions. NIH:Cx36GFP fibroblasts were loaded with calcein AM and membranal dye (DiD) and then seeded on mature hippocampal neuron monolayers. Four hours following fibroblasts seeding a clear fluorescent signal appeared in number of neurons in the culture (Figures 29a-g). This result suggests that modified fibroblasts, expressing the protein x36 are able to create gap junctions with neurons in culture.

Modified fibroblasts can modulate the electrical discliarge of cultured neurons - After demonstrating the ability of NIH:Cx36GFP fibroblasts to create gap junctions with hippocampal neurons, their ability to modify neural network discharge was examined. To this end, a new fibroblast clone, expressing both the gap junction protein CX36 and the mutated Kvl.3 ion channel Kvl.3:H401 W was created. Cells were tested for the expression of these proteins using both western blot (data are not presented) and patch clamp analysis (Figures 30a-b, 31a-b).
Primary cortical neurons, cultured on multi electrode arrays (MEA) were used for these experiments. Basal activity of three week old cultures was recorded, after which 5 x 104 fibroblasts were seeded onto the cortical cultures. Study cultures were seeded with fibroblasts expressing both Cx36 and a mutated potassium channel, Kvl.3:H401 W(NIH:CX36GFP:Kvl.3:H401 W fibroblasts). Control cultures were seeded with NIH fibroblasts expressing GFP.
The mutated Kvl.3 channel was used in the study group due to the long tail current following activation. The tail current produces a large current sink that prevent a second activation. As demonstrated above, fibroblasts overexpressing the mutant Kvl.3 are effective in prolonging the local refractory period in pig's hearts (Shabtay et al. Molecular Therapy. 2005 May; Abstract). In this manner, fibroblasts expressing the mutated Kv1.3 channel can prolong the refractory period of the neuron aind generally reduce its excitability.
After seeding, cultures were returned to the incubator allowing fibroblasts to settle. After 72 hours incubation a second set of electrophysiology recordings was performed and the influence of fibroblasts on the neural network discharge was assessed. Immediately after, a third set of electrophysiological recordings was performed under the application of rCharybdotoxin, a specific Kvl.3 channel blocker.
Both NIH:GFP fibroblasts and the NIH:CX36GFP:Kv1.3:H401 W fibroblasts caused aii initial decline in the neural network activity. This decline was stable over a period of three days. Upon addition of the specific channel blocker, the network activity was recovered in co-cultures of neurons with NIH:CX36GFP:Kvl.3:H401W
fibroblasts, but not those seeded with NIH:GFP.
The decline in network electrical discharges, observed after seeding the cultures with both types of fibroblasts is most likely the non-specific effect of 5 x 104 cells, probably still dividing. The recovery of electrical activity, obtained solely in the NIH:CX36GFP:Kvl.3 seeded cultures during blocker application is possibly the result of abrupt changes in the electrical properties of the fibroblasts caused by blocker application. The change ,in fibroblasts electrical properties caused a change in the electrical discharge of the neural network, suggesting that fibroblasts are electrically coupled to the neural network.
These results indicate that fibroblasts can modulate the neural network discharge and that this modulation depends on the fibroblasts electrical properties.
Modified fibroblasts can modulate glutamate levels in-vivo After demonstrating the ability of modified fibroblasts to modulate neural network discharge in vitro, the possibility of modifying the GABAergic inhibitory system in vivo was tested.
To that end, fibroblasts expressing the gap junction protein Cx36 and the potassium channels Kir2.l (NIH:Cx36GFP:Kir2.1) were implanted in the external globus pallidum nucleus (GPi) of rats. One week following cell implantation, glutamate levels in the internal globus pallidum (GPe) of the same rat were sampled by microdialysis. As soon as sample glutamate levels were stabilized, the dopamine receptor antagonist haloperidol, or the specific D2 receptor antagonist Raclopride were administrated. Twenty minutes later another measurement was taken.
Control groups included rats implanted with either fibroblasts expressing GFP or administered with medium. Table 5 summarizes the experimental design.

As shown in Figure 32, rats which were implanted with NIH:Cx36GFP:Kir2.l showed significant increase in glutamate levels after administration of the blocker (eitller raclopride or haloperidol). In contrast, rats implanted with NIH:GFP, showed significant decrease in glutamate levels following the injection of raclopride. The rat injected with DMEM, showed the same tendency as that of GFP-expressing cells.
Base line levels of glutamate were similar among all examined rats (with the exception of rat2). Thus, the present results indicate that implantation of NIH:3T3:Cx36GFP:Kir2.1 to the external globus pallidum results in a differential response to the D2 receptor antagonist in comparison to NIH:GFP or medium implanted rats. Based on these first indications, subsequent behavioral experiments on hemiparkinsonian rats were designed as further described.

Table 5- Im lantation conditions or microdialysis experiments Rat No. Type offibroblasts implanted Number offibroblasts implanted 1 NIH:3T3:GFP 2.5 x 105 2 NIH:3T3:GFP 2.5 x 105 3 NIH:3T3:Cx36GFP:Kir2.1 2.5 x 105 4 NIH:3T3:Cx36GFP:Kir2.1 2.5 x 105 5 NIH:3T3:Cx36GFP:Kir2.1 8.5 x 105 6 Medium --------Modified fibroblasts can improve asymmetric rotation behavior of hemiparkinsonian rats - The pathophysiology of Parkinson's disease (PD), includes over-inhibition of the thalamus by the main inhibitory nuclei of the basal ganglia.
Therefore, if can the excitability of these nuclei can be reduced, using the modified fibroblasts, this may alleviate motor symptoms of PD.
In order to test this hypothesis, twelve 6-OHDA lesioned rats, previously classified as parkinsonian using the apomorphine-induced rotation test, were randomly sorted to two groups. The study group included 5 rats, implanted with NIH:CX36GFP:Kv1.3:H401 W fibroblasts. Fibroblasts were implanted into the main inhibitory nuclei of the basal ganglia - the internal globus pallidum (GPi) and sabstantia nigra pars reticulate (SNr).
NIH:CX36GFP:Kvl.3:H401W fibroblasts express the gap junction protein Cx36 which enables them to create .gap junctions with Cx36-expressing neurons;
they also express a mutated voltage dependent potassium channel Kvl.3:H401 W.
5 The control group included 7 rats that did not receive any treatment.
The sum of rotations during the 15 minute peak is summarized in Table 6, below. Data refers to 4 and 5 weeks after PD induction, together with two rotation tests at 10 and 18 days, following cell implantation (CI), respectively. Two of the five treated rats (Figure 33a, red squares), but none of the control group rats (Figure 33b), 10 rotated substantially less 10 days after cell implantation, compared to their baseline levels at 4 and 5-weeks post induction. However, 18 days after cell-implantation treatment, only one rat (R04 - closed red squares) maintained substantially lowered rotation rates whereas R14 (open red squares) partially returned to high rotation rates.
15 Table 6- Sum of rotations during the 15 minute peak Sum 15-min max rotation peak Rat 4wks Swks CI-1 CI-2 Study R05 116 130 155 147 group Control R08 123 149 171 145 group Thus, the foregoing shows the ability of modified cells to modulate neural network discharge both in vitro and in vivo. It was demonstrated that modified 20 fibroblasts expressing Cx36 (gap junction protein presented in GABAergic neurons) and a potassium channel, were able to electrically couple with culture cortical neurons and to reduce the number of electrically-fired spikes. This effect was reversible, following administration of a specific blocker for the potassium channel expressed by the fibroblast. It is important to note, that the same potassium channel (Kvl.3) is endogenously expresses by cortical neuron. However, the blocker concentration that was used in these experiments did not alter the cortical culture activity, in the absent of fibroblasts, or in the presence of control fibroblasts expressing GFP only.

Fibroblasts expressing only GFP do cause a reduction in the number of spikes, but this effect was not reversible and most likely due to a change in the metabolic environment of the neurons cause by the physical addition of fibroblasts to the culture.
These experiments suggest that fibroblasts can modulate the neural network discharge in vitro, and that this modulation depends on the electrical properties of the fibroblasts electrically coupled to neurons.
Following the in vitro experiments, in vivo experiments were conducted using both neurochemical and behavioral methods. The results obtained for these experiments support the idea that modified fibroblasts can modulate neural network in vivo: Microdialysis technique was used to evaluate changes in glutamate levels after cells implantation. Rats implanted with NIH:Cx36GFP:Kir2.1 fibroblasts to the GPe showed significant increase in glutamate levels measured in the GPi after administration of the dopamine blocker. In contrast, glutamate levels were significantly decreased, after dopamine blocker administration, in rats implanted with NIH:GFP (control) fibroblasts to the same location. These results indicate that the implanted, modified fibroblasts do modulate the neural output of the GPe.
The 6-ODHA hemiparkinsonian rat model, a widely used model for PD
(Schwarting and Huston, 1996), was then used to demonstrate the therapeutic effect of the cells. Hemiparkinsonian rats were implanted with modified fibroblasts to the GPi and the SNr. Two out of 5 rats demonstrated a reduction in the number of apomorhine-induced contralateral rotations. In contrast, none of the control group rats demonstrated a similar response.
Reduction in the number of apomorhine-induced contralateral rotations is correlated with the successful therapeutic effect of the treatment. These results indicate that cells of the present invention can modify the output of the basal ganglia and can improve the motor symptoms seen in PD.
It is important to note that this is a broad treatment strategy which is also applicable towards the treatment of other neurological disorders.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims. All publications, patents, patent applications and sequences disclosed therein and/or identified by a GeneBank accession number mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent, patent application or sequence was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention.

REFERENCES
(Additional references are cited in the text) 1. Bayly P.V, Bruce H.Ken Knight, Jack M. Rogers, Russel E. Hillsley, Raymond E. Ideker, William M. Smith. Estimation of conduction velocity vector fields from epicardial mapping data. IEEE transactions on biomedical engineering. 1988. 45 : 5 63 -5 71.
2. Fast VG, Kleber AG. Microscopic conduction in cultured strands of neonatal rat heart cells measured with voltage-sensitive dyes. Circ Res. 1993. 73: 914-925.
3. Gussoni, E., Pavlath, G. K., Lanctot, A. M., Sharma, K. R., Miller, R. G., Steinman, L. and Blau, H. M. Normal dystrophin transcripts detected in duchenne muscular dystrophy patients after myoblast transplantation. Nature.
1992. 356: 435-438.
4. Marom s, Goldstein SA, Kupper J, Levitan IB. Mechanism and modulation of inactivation of the Kv3 potassium channel. Receptor and Channels. 1993.
1:81-88.
5. Rook MB, Van Ginneken ACG, De Jonge B, Aoumari AE, Gros D, and Jongsma HJ. Differences in gap junction channels between cardiac myocytes, fibroblasts, and heterologous pairs. Am J Physiol. 1992. 263: C959-C977.

6. Rubin Y, Kessler-Icekson G, Navon G. The effect of furosemide on calcium ion concentration in myocardial cells. Cell Calcium. 1995 Aug; 18(2):135-9.
7. Spach MS, Dolber PC. Relating extracellular potentials and their derivatives to anisotropic propagation at a microscopic level in human cardiac muscle.
Evidence for electrical uncoupling of side-to-side fiber connections with increasing age. Circ Res. 1986 Mar;58(3):356-71.
8. Tompson, L. Fetal transplants show promise. Science. 1992. 257: 868-870.
9. Waldo AL, Camm AJ, deRuyter H, Friedman PL, MacNeil DJ, Pauls JF, Pitt B, Pratt CM, Schwartz PJ, Veltri EP. Effect of d-sotalol on mortality in patients with left ventricular dysfunction after recent and remote myocardial infarction. The SWORD Investigators. Survival With Oral d-Sotalol. Lancet.
1996;348:7-12.

10. Hoppe UC, Johns DC, Marban E, O'Rourke B. Manipulation of cellular excitability by cell fusion: effects of rapid introduction of transient outward K+
current on the guinea pig action potential. Circ Res. 1999;84:964-72.
11. Johns DC, Nuss HB, Chiamvimonvat N, Ramza BM, Marban E, Lawrence JH.
Adenovirus-mediated expression of a voltage-gated potassium channel in vitro (rat cardiac myocytes) and in vivo (rat liver). A novel strategy for modifying excitability. J Clin Invest. 1995;96:1152-8.
12. Nuss HB, Johns DC, Kaab S, Tomaselli GF, Kass D, Lawrence JH, Marban E.
Reversal of potassium channel deficiency in cells from failing hearts by adenoviral gene transfer: a prototype for gene therapy for disorders of cardiac excitability and contractility. Gene Ther. 1996;3:900-12.
13. Nuss HB, Marban E, Johns DC. Overexpression of a human potassium channel suppresses cardiac hyperexcitability in rabbit ventricular myocytes. J
Clin Invest. 1999;103 : 8 89-96.
14. Johns DC, Marban E, Nuss HB. Virus-mediated modification of cellular excitability. Ann N YAcad Sci. 1999;868:418-22.
15. Mazhari R, Nuss HB, Armoundas AA, Winslow RL, Marban E. Ectopic expression of KCNE3 accelerates cardiac repolarization and abbreviates the QT interval. J Clin Invest. 2002;109:1083-90.
16. Donahue JK, Heldman AW, Fraser H, McDonald AD, Miller JM, Rade JJ, Eschenhagen T, Marban E. Focal modification of electrical conduction in the heart by viral gene transfer. Nat Med. 2000;6:1395-8.
17. Edelberg JM, Aird WC, Rosenberg RD. Enhancement of murine cardiac chronotropy by the molecular transfer of the human beta2 adrenergic receptor cDNA. J Clin Invest. 1998;101:337-43.
18. Miake J, Marban E, Nuss HB. Biological pacemaker created by gene transfer.
Nature. 2002;419:13 2-3 .
19. Qu J, Plotnikov AN, Danilo P, Jr., Shlapakova I, Cohen IS, Robinson RB, Rosen MR. Expression and function of a biological pacemaker in canine heart.
Circulation. 2003;107:1106-9.
20. Feld Y, Melamed-Frank M, Kehat I, Tal D, Marom S, Gepstein L.

Electrophysiological modulation of cardiomyocytic tissue by transfected fibroblasts expressing potassium channels: a novel strategy to manipulate excitability. Circulation. 2002;105:522-9.
21. Luo CH, Rudy Y. A model of the ventricular cardiac action potential.
Depolarization, repolarization, and their interaction. Circ Res. 1991;68:1501-26.
22. Alvarez L, Macias R, Guridi J, Lopez G, Alvarez E, Maragoto C, Teijeiro J, Torres A, Pavon N, Rodriguez-Oroz MC, Ochoa L, Hetherington H, Juncos J, DeLong MR, Obeso JA.. (2001). Dorsal subthalamotomy for Parkinson's disease. Mov Disord. 16(1):72-8.

23. Anderson VC, Burchiel KJ, Hogarth P, Favre J, Hammerstad JP. (2005).
Pallidal vs subthalamic nucleus deep brain stimulation in Parkinson disease.
Arch Neurol. 62(4):554-60.

24. Belluardo N., Trovato-Salinaro A, Mudo' G., Hurd Y.L., and Condorelli D.F.
(1999).
Structure, Chromosomal Localization, and Brain Expression of Human Cx36 Gene.
Journal of Neuroscience Research 57:740-752.

25. Belluardo N, marko G, Trovato-Salinaro A, Le Gurun S, Charollais A, Serre-Beinier V, Amato G, Haefliger JA, Meda P, Condorelli DF. (2000).
Expression of connexin36 in the adult and developing rat brain. Brain Res.
19;865(1):121-38.

26. Eytan D, Brenner N, Marom S. (2003). Selective adaptation in networks of cortical neurons. J Neurosci. 15;23(28):9349-56.

27. Gill SS, Heywood P. (1997). Bilateral dorsolateral subthalamotomy for advanced Parkinson's disease. Lancet. 25;350(9086):1224.

28. Goldberg GS, Bechberger JF, Naus CC. (1995). A pre-loading method of evaluating gap junctional communication by fluorescent dye transfer.
Biotechniques. 18(3):490-7.

29. Levy R, Lang AE, Dostrovsky JO, Pahapill P, Romas J, Saint-Cyr J, Hutchison WD, Lozano AM. (2001). Lidocaine and muscimol microinjections in subthalamic nucleus reverse Parkinsonian symptoms. Brain. 124(Pt 10):2105-18.

30. Limousin P, Pollak P, Benazzouz A, Hoffmann D, Le Bas JF, Broussolle E, Perret JE, Benabid AL. (1995). Effect of parkinsonian signs and symptoms of bilateral subthalamic nucleus stimulation. Lancet. 14;345(8942):91-5.

31. Limousin P, Krack P, Pollak P, et al. (1998). Electrical stimulation of the subthalamic nucleus in advanced Parkinson's disease. N Engl J
Mea'.;339:1105-11.

32. Marom S, Shahaf G. (2002). Development, learning and memory in large random networks of cortical neurons: lessons beyond anatomy. Q Rev Biophys. 35(l):63-87.

33. Peppe A, Pierantozzi M, Bassi A, Altibrandi MG, Brusa L, Stefani A, Stanzione P, Mazzone P. (2004). Stimulation of the subthalamic nucleus compared with the globus pallidus internus in patients with Parkinson disease.
J Neurosurg. 101(2):195-200.

34. Ryan, T.A., Reuter, H., Wendland, B., Schweizer, F.E., Tsien, R.W., and Smith, S.J (1993). The kinetics of synaptic vesicle recycling measured at single presynaptic boutons. Neuron. 11: 713-724.

35. Schwarting R.K.W and Huston J.P. (1996). The unilateral6-hydroxydopamine lesion model in behavioral brain research analysis of functional deficit, recovery and treatments. Progress in Neurobiology.50;275 -331.

36. Shahaf G, Marom S. (2001). Learning in networks of cortical neurons. J
Neurosci. 15;21(22):8782-8.

37. Sohl G, Maxeiner S, Willecke K. (2005). Expression and functions of neuronal gap junctions. Nat Rev Neurosci. 6(3):191-200.

38. The Deep-Brain Stimulation for Parkinson's Disease Study Group. (2001) Deep-brain stimulation of the subthalamic nucleus or the pars interna of the globus pallidus in Parkinson's disease. NEngl JMed.;345:956-63.

39. Tomasetto C, Neveu J, Daley J, Horan P.K , Sager R. (1993). Specificity of Gap Junction Communication Among Human Mammary Cells and Connexin Transfectants in Culture. The Journal of Cell Biology, 122 (1), 157-167.

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims (171)

1. WHAT IS CLAIMED IS:
   
   I. A nucleic acid construct comprising:
   
   (a) a first polynucleotide region encoding at least one first polypeptide capable of forming a functional ion channel or transporter when expressed within a cell; and (b) a second polynucleotide region encoding at least one second polypeptide capable of forming a functional gap junction when expressed within said cell.
2. 2. A cell, cell culture or tissue explant transformed with the nucleic acid construct of claim 1.
3. 3. The cell, cell culture or tissue explant of claim 2, wherein the cell is selected from the group consisting of a fibroblast, a myoblast, an astroglial cell and an endothelial cell.
4. 4. The cell, cell culture or tissue explant of claim 2, wherein the tissue explant is an organ tissue explant.
5. 5. A pharmaceutical composition comprising, as an active ingredient, the nucleic acid construct of claim 1 and a pharmaceutically acceptable carrier.
6. 6. The nucleic acid construct of claim 1, wherein said ion channel is selected from the group consisting of a sodium ion channel, a potassium ion channel, a calcium ion channel and a chloride ion channel.
7. 7. The nucleic acid construct of claim 1, wherein said at least one first polypeptide is selected from the group consisting of a K channel polypeptide, a Na channel polypeptide, a Ca channel polypeptide, a CI channel polypeptide, a Na/K
   
   transporter polypeptide, a Na/Ca transporter polypeptide, a Na/H transporter polypeptide and a Cl/HCO3 transporter polypeptide.
8. 8. The nucleic acid construct of claim 1, wherein said at least one second polypeptide is selected from the group consisting of connexin43, connexin45 and connexin26.
9. 9. The nucleic acid construct of claim 1, further comprising at least one promoter being for directing the transcription of said first polynucleotide and said second polynucleotide.
10. 10. The nucleic acid construct of claim 9, wherein said at least one promoter is functional in mammalian cells.
11. 11. The nucleic acid construct of claim 9, wherein said at least one promoter is selected from the group consisting of a constitutive promoter, a tissue specific promoter, an inducible promoter and a developmentally regulated promoter.
12. 12. The nucleic acid construct of claim 1, wherein said first polynucleotide region and said second polynucleotide region are transcriptionally fused via an IRES sequence.
13. 13. The nucleic acid construct of claim 1, wherein said at least one first polypeptide and said at least one second polypeptide are translationally fused via at least one protease recognition site.
14. 14. The nucleic acid construct of claim 9, wherein said at least one promoter includes two promoters, a first promoter for directing the transcription of said first polynucleotide and a second promoter for directing the transcription of said second polynucleotide.
15. 15. A nucleic acid construct system comprising:
    
    (a) a first nucleic acid construct including a first polynucleotide region encoding at least one first polypeptide capable of forming a functional ion channel or transporter when expressed within a cell; and (b) a second nucleic acid construct including a second polynucleotide region encoding at least one second polypeptide capable of forming a functional gap junction when expressed within said cell.
16. 16. A cell, cell culture or tissue explant transformed with the nucleic acid construct of claim 15.
17. 17. A pharmaceutical composition comprising, as an active ingredient, the nucleic acid construct of claim 15 and a pharmaceutically acceptable carrier.
18. 18. The nucleic acid construct system of claim 15, wherein said first nucleic acid construct further includes a first promoter being for directing the transcription of said first polynucleotide and further wherein said second nucleic acid construct further includes a second promoter being for directing the transcription of said second polynucleotide.
19. 19. The nucleic acid construct system of claim 18, wherein each of said first and said second promoters is functional in mammalian cells.
20. 20. The nucleic acid construct system of claim 18, wherein each of first and said second promoters is independently selected from the group consisting of a constitutive promoter, a tissue specific promoter, an inducible promoter and a developmentally regulated promoter.
21. 21. The nucleic acid construct system of claim 15, wherein said at least one first polypeptide is selected from the group consisting of a K channel polypeptide, a Na channel polypeptide, a Ca channel polypeptide, a Cl channel polypeptide, a Na/K transporter polypeptide, a Na/Ca transporter polypeptide, a Na/H transporter polypeptide and a Cl/ HCO3 transporter polypeptide.
22. 22. The nucleic acid construct system of claim 15, wherein said at least one second polypeptide is selected from the group consisting of connexin43, connexin45 and connexin 26.
23. 23. A population of cells suitable for treating glucose regulation disorder in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    
    (i) a connexin channel;
    
    (ii) a depolarizing ion channel; and/or (iii) a non selective ion channel.
24. 24. The population of cells of claim 23, wherein said cells are selected from the group consisting of mesenchymal stem cells, pancreatic cells and fibroblasts.
25. 25. The population of cells of claim 23, wherein said depolarizing ion channel is selected from the group consisting of a sodium channel and a calcium channel.
26. 26. The population of cells of claim 25, wherein said sodium channel is an SCN channel.
27. 27. The population of cells of claim 25, wherein said calcium channel is selected from the group consisting of an L-type calcium channel, a T-type calcium channel and N-Type cacium channel.
28. 28. The population of cells of claim 23, wherein said connexin channel is selected from the group consisting of connexin36, connexin40, connexin43 and connexin 45.
29. 29. The population of cells of claim 23, wherein said non-selective ion channel is an HCN channel.
30. 30. The population of cells of claim 23, wherein the subject suffers from type 2 diabetes mellitus.
31. 31. A population of cells suitable for treating cardiac arrhythmia in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    
    (i) a sodium channel;
    (ii) a calcium channel;
    
    (iii) a leak ion channel; and/or (iv) a non-selective ion channel.
32. 32. The population of cells of claim 31, wherein said sodium channel is an SCN channel.
33. 33. The population of cells of claim 31, wherein said calcium channel is selected from the group consisting of an L-type calcium channel, an N-type calcium channel and a T-type calcium channel.
34. 34. The population of cells of claim 31, wherein said non-selective ion channel is an HCN channel.
35. 35. The population of cells of claim 31, wherein said cells further express an additional exogenous polypeptide forming a connexin channel.
36. 36. The population of cells of claim 35, wherein said connexin channel is selected from the group consisting of connexin4O, connexin43 and connexin45.
37. 37. The population of cells of claim 31, wherein the subject suffers from bradycardia and/or atrial fibrillation.
38. 38. The population of cells of claim 31, wherein said cells are selected from the group consisting of mesenchymal stem cells, fibroblasts, myoblasts and embryonic stem cells.
39. 39. A population of cells suitable for prolonging a refractory period of a cardiac tissue in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    (i) a connexin channel;
    (ii) a sodium channel;
    
    (iii) a potassium channel; and/or (iv) a chloride channel.
40. 40. The population of cells of claim 39, wherein the subject suffers from atrial fibrillation, atrial flutter, atrial tachycardia and/or ventricular tachycardia.
41. 41. The population of cells of claim 39, wherein said connexin channel is selected from the group consisting of connexin40, connexin43 and connexin45.
42. 42. The population of cells of claim 39, wherein said sodium channel is a mutated SCN5A channel.
43. 43. The population of cells of claim 42, wherein said SCN5A channel has a mutation selected from the group consisting of .DELTA.KPQ, N1325S, R1644H, E1295K, D1790G and ins1795.
44. 44. The population of cells of claim 39, wherein said potassium channel is a voltage gated potassium channel or an inward rectifier channel.
45. 45. The population of cells of claim 44, wherein said voltage gated potassium channel is a Kv1.3 or a mutant thereof.
46. 46. The population of cells of claim 45, wherein said mutant of Kv1.3 is Kv1.3 H401W.
47. 47. The population of cells of claim 44, wherein said inward rectifier channel is a KCNH channel.
48. 48. The population of cells of claim 47, wherein said KCNH channel is selected from the group consisting of Kir4.1, Kir7.1, Kir1.1, Kir2.1, Kir5.1, Kir6.1 and Kir8.1.
49. 49. The population of cells of claim 39, wherein said chloride channel is a CIC channel.
50. 50. The population of cells of claim 39, wherein said cells are selected from the group consisting of myoblasts, fibroblasts, mesenchymal stem cells and embryonic stem cells.
51. 51. A population of cells suitable for modulating neural excitability in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    (i) a connexin channel; and/or (ii) a depolarizing ion channel.
52. 52. The population of cells of claim 51, wherein modulating neural excitability is increasing neural excitability.
53. 53. The population of cells of claim 51, wherein modulating neural excitability is increasing neural excitability.
54. 54. The population of cells of claim 51, wherein said connexin channel is selected from the group consisting of connexin32, connexin36, connexin43 and connexin47.
55. 55. The population of cells of claim 51, wherein said depolarizing ion channel is selected from the group consisting of a sodium channel, a calcium channel and a non-selective depolarizing ion channel.
56. 56. The population of cells of claim 51, wherein said cells are selected from the group consisting of fibroblasts, microglia, oligodendrocytes, astroglia, embryonic stem cells and mesenchymal stem cells.
57. 57. The population of cells of claim 51, wherein said subject suffers from Parkinson's disease and/or epilepsy.
58. 58. A population of cells suitable for increasing neural excitability in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    
    (i) a hyperpolarizing ion channel; and/or (ii) connexin36.
59. 59. The population of cells of claim 58, wherein the subject suffers from a neurodegenerative disorder.
60. 60. The population of cells of claim 58, wherein said neurodegenerative disorder is Alzheimer's disease.
61. 61. The population of cells of claim 58, wherein said hyperpolarizing ion channel is a potassium channel or a chloride channel.
62. 62. The population of cells of claim 61, wherein said potassium channel is a Kv channel, a Kir channel, an Ach receptor channel and a HERG channel.
63. 63. The population of cells of claim 61, wherein said chloride channel is a CIC channel.
64. 64. The population of cells of claim 61, wherein said cells are selected from the group consisting of fibroblasts, microglia, oligodendrocytes, astroglia, embryonic stem cells and mesenchymal stem cells.
65. 65. A population of cells suitable for increasing pyramidal or purkinje cell coupling in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    
    (i) connexin47; and/or (ii) a depolarizing ion channel.
66. 66. The population of cells of claim 65, wherein the subject suffers from cerebrovascular accident.
67. 67. A population of cells suitable for decreasing pyramidal or purkinje cell coupling in a subject, the population of cells comprising cells expressing at least one exogenous polypeptide forming:
    
    (i) connexin47; and/or (ii) a hyperpolarizing ion channel.
68. 68. The population of cells of claim 67, wherein the subject suffers from epilepsy and/or phantom pain.
69. 69. The population of cells of claim 67, wherein said hyperpolarizing ion channel is selected from the group consisting of a potassium channel and a chloride channel.
70. 70. A method of treating glucose regulation disorder in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling with pancreatic .beta.-islets, thereby treating the glucose regulation disorder in the subject.
71. 71. The method of claim 70, wherein said cells are selected from the group consisting of mesenchymal stem cells, fibroblasts and embryonic stem cells.
72. 72. The method of claim 70, wherein said cells express at least one exogenous polypeptide forming:
    (i) a connexin channel;
    
    (ii) a depolarizing ion channel; and/or (iii) a non-selective ion channel, thereby treating insulin-deficiency in a subject.
73. 73. The method of claim 72, wherein said depolarizing ion channel is selected from the group consisting of a sodium channel and a calcium channel.
74. 74. The method of claim 73, wherein said sodium channel is an SCN
    channel.
75. 75. The method of claim 73, wherein said non-selective ion channel is an HCN channel.
76. 76. The method of claim 73, wherein said calcium channel is selected from the group consisting of an L-type calcium channel, a T-type calcium channel and an N-type calcium channel.
77. 77. The method of claim 72, wherein said connexin channel is selected from the group consisting of connexin36, connexin40, connexin43 and connexin45.
78. 78. The method of claim 70, wherein the subject suffers from type 2 diabetes mellitus.
79. 79. A method of treating insulin-deficiency in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with pancreatic .beta.-cells, said at least one exogenous polypeptide forming:
    (i) a connexin channel; and/or (ii) a depolarizing ion channel, thereby treating the insulin-deficiency in the subject.
80. 80. The method of claim 79, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with pancreatic .beta.-cells is effected by systemic administration of at least one polynucleotide encoding said at least one exogenous polypeptide, said at least one exogenous polynucleotide being operably linked to a pancreatic functional promoter.
81. 81. The method of claim 79, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with pancreatic .beta.-cells is effected by localized administration of at least one polynucleotide encoding said at least one exogenous polypeptide.
82. 82. The method of claim 79, wherein said depolarizing ion channel is selected from the group consisting of a sodium channel and a calcium channel and a non-selective ion channel.
83. 83. The method of claim 82, wherein said sodium channel is an SCN
    channel.
84. 84. The method of claim 82, wherein said calcium channel is selected from the group consisting of an L-type calcium channel, a T-type calcium channel and an N-type calcium channel.
85. 85. The method of claim 82, wherein said non-selective ion channel is an HCN channel.
86. 86. The method of claim 79, wherein said connexin channel is selected from the group consisting of connexin36, connexin40, connexin43 and connexin 45.
87. 87. The method of claim 79, wherein the subject suffers from type 2 diabetes mellitus.
88. 88. A method of treating cardiac arrhythmia in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling a cardiac tissue of the subject, thereby treating the cardiac arrhythmia in the subject.
89. 89. The method of claim 88, wherein said cells are selected from the group consisting of mesenchymal stem cells, fibroblasts, myoblasts and embryonic stem cells.
90. 90. The method of claim 88, wherein said cells express at least one exogenous polypeptide forming:
    (i) a sodium channel;
    (ii) a calcium channel;
    (iii) a leak ion channel; and/or (iv) a non-selective ion channel.
91. 91. The method of claim 90, wherein said sodium channel is an SCN
    channel.
92. 92. The method of claim 90, wherein said calcium channel is selected from the group consisting of an L-type calcium channel, an N-type calcium channel and a T-type calcium channel.
93. 93. The method of claim 90, wherein said non-selective ion channel is an HCN channel.
94. 94. The method of claim 90, wherein said cells further express an additional exogenous polypeptide forming a connexin channel.
95. 95. The method of claim 94, wherein said connexin channel is selected from the group consisting of connexin40, connexin43 and connexin45.
96. 96. The method of claim 88, wherein the subject suffers from bradycardia and/or atrial fibrillation.
97. 97. A method of treating cardiac arrhythmia in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being hi contact with cardiac tissue, said at least one exogenous polypeptide forming:
    
    (i) a sodium channel;
    (ii) a calcium channel;
    (iii) a leak ion channel; and/or (iv) a non-selective ion channel, thereby treating cardiac arrhythmia in a subject.
98. 98. The method of claim 97, wherein said sodium channel is an SCN
    channel.
99. 99. The method of claim 97, wherein said calcium channel is selected from the group consisting of an L-type calcium channel, an N-type calcium channel and a T-type calcium channel.
100. 100. The method of claim 97, wherein said non-selective ion channel is an HCN channel.
101. 101. The method of claim 97, wherein said cells further express an additional exogenous polypeptide forming a connexin channel.
102. 102. The method of claim 101, wherein said connexin channel is selected from the group consisting of connexin40, connexin43 and connexin45.
103. 103. The method of claim 97, wherein the subject suffers from bradycardia and/or atrial fibrillation.
104. 104. The method of claim 97, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said cardiac tissue is effected by systemic administration of at least one polynucleotide encoding said at least one exogenous polypeptide, said at least one exogenous polynucleotide being operably linked to a cardiac functional promoter.
105. 105. The method of claim 97, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said cardiac tissue is effected by localized administration of at least one polynucleotide encoding said at least one exogenous polypeptide.
106. 106. A method of treating a disease treatable by increasing the refractory period of a cardiac tissue in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling with a cardiac tissue of the subject, thereby treating the disease treatable by increasing the refractory period of a cardiac tissue in the subject.
107. 107. The method of claim 106, wherein said cells are selected from the group consisting of myoblasts, fibroblasts, mesenchymal stem cells and embryonic stem cells.
108. 108. The method of claim 106, wherein said cells express at least one exogenous polypeptide forming:
     
     (i) a connexin channel;
     (ii) a sodium channel;
     
     (iii) a potassium channel; and/or (iv) a chloride channel.
109. 109. The method of claim 107, wherein said disease is selected from the group consisting of atrial fibrillation, atrial flutter, atrial tachycardia and ventricular tachycardia.
110. 110. The method of claim 108, wherein said connexin channel is selected from the group consisting of connexin40, connexin43 and connexin45.
111. 111. The method of claim 108, wherein said sodium channel is a mutated SCN5A channel.
112. 112. The method of claim 111, wherein said SCN5A channel has a mutation selected from the group consisting of AKPQ, N1325S, R1644H, E1295K, D 1790G and ins 1795.
113. 113. The method of claim 108, wherein said potassium channel is a voltage gated potassium channel or an inward rectifier channel.
114. 114. The method of claim 113, wherein said voltage gated potassium channel is a Kv1.3 or a mutant thereof.
115. 115. The method of claim 114, wherein said mutant of Kv1.3 is Kv1.3 H401 W.
116. 116. The method of claim 113, wherein said inward rectifier channel is a KCNH channel.
117. 117. The method of claim 116, wherein said KCNH channel is selected from the group consisting of Kir4.1, Kir7.1, Kir1.1, Kir2.1, Kir5.1, Kir6.1 and Kir8. 1.
118. 118. The method of claim 108, wherein said chloride channel is a CIC
     channel.
119. 119. The method of claim 108, wherein said administering to the subject is effected at a location selected from the group consisting of an AV node and an AV
     node area, AV nodal artery, specific coronary artery feeding an arrhythmogenic area, ventricles, atrias and anterior right atrial branch of right coronary artery.
120. 120. The method of claim 108, wherein said administration to the subject is effected by epicardial during surgery, trans-catheter injection to coronary artery using balloon catheter, or trans-catheter injection using injecting catheter.
121. 121. A method of treating a disease treatable by increasing the refractory period of a cardiac tissue in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with a cardiac tissue of the subject, said at least one exogenous polypeptide forming:
     (i) a connexin channel;
     (ii) a sodium channel;
     (iii) a potassium channel; and/or (iv) a chloride channel, thereby treating the disease treatable by increasing the refractory period of the cardiac tissue in a subject.
122. 122. The method of claim 121, wherein said disease is selected from the group consisting of atrial fibrillation, atrial flutter, atrial tachycardia and ventricular tachycardia.
123. 123. The method of claim 121, wherein said connexin channel is selected from the group consisting of connexin40, connexin43 and connexin45.
124. 124. The method of claim 121, wherein said sodium channel is a mutated SCN5A channel.
125. 125. The method of claim 124, wherein said SCN5A channel has a mutation selected from the group consisting of AKPQ, N1325S, R1644H, E1295K, D1790G and ins1795.
126. 126. The method of claim 121, wherein said potassium channel is a voltage gated potassium channel or an inward rectifier channel.
127. 127. The method of claim 126, wherein said voltage gated potassium channel is a Kv1.3 or a mutant thereof.
128. 128. The method of claim 127, wherein said mutant of Kv1.3 is Kv1.3 H401 W.
129. 129. The method of claim 126, wherein said inward rectifier channel is a KCNH channel.
130. 130. The method of claim 129, wherein said KCNH channel is selected from the group consisting of Kir4.1, Kir7.1, Kir1.1, Kir2.1, Kir5.1, Kir6.1 and Kir8. 1.
131. 131. The method of claim 121, wherein said chloride channel is a CIC
     channel.
132. 132. The method of claim 121, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said cardiac tissue is effected by systemic administration of at least one polynucleotide encoding said at least one exogenous polypeptide, said at least one exogenous polynucleotide being operably linked to a cardiac functional promoter.
133. 133. The method of claim 121, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said cardiac tissue is effected by localized administration of at least one polynucleotide encoding said at least one exogenous polypeptide.
134. 134. The method of claim 121, wherein said administering is effected at a location selected from the group consisting of an AV node and an AV node area, AV
     nodal artery, specific coronary artery feeding an arrhythmogenic area, ventricles, atrias and anterior right atrial branch of right coronary artery.
135. 135. A method of treating a disease treatable by modulating neural excitability in a subject, the method comprising administering to the subject a therapeutically effective amount of cells capable of electrical coupling with a neural tissue of the subject, thereby treating the disease treatable by modulating neural excitability in the subject.
136. 136. The method of claim 135, wherein modulating neural excitability is decreasing neural excitability.
137. 137. The method of claim 135, wherein said cells are selected from the group consisting of fibroblasts, microglia, oligodendrocytes, astroglia, mesenchymal stem cells and embryonic stem cells.
138. 138. The method of claim 135, wherein said cells express at least one exogenous polypeptide forming:
     
     (i) a connexin channel; and/or (ii) a depolarizing ion channel; and/or (iii) a hyperpolarizing ion channel.
139. 139. The method of claim 138, wherein said connexin channel is selected from the group consisting of connexin32, connexin36, connexin43 and connexin47.
140. 140. The method of claim 138, wherein said depolarizing ion channel is selected from the group consisting of a sodium channel, a calcium channel and a non-selective ion channel.
141. 141. The method of claim 138, wherein said hyperpolarizing ion channel is selected from the group consisting of a potassium channel and a chloride channel.
142. 142. The method of claim 135, wherein the disease is Parkinson's disease and/or epilepsy.
143. 143. The method of claim 135, wherein administering is effected at a site capable of generating an epileptic stimulus.
144. 144. The method of claim 143, wherein said site is selected from the group consisting of an external globus pallidum, striatum, subthalamic nucleus, internal globus pallidus, nigra reticulate and zona increta.
145. 145. The method of claim 135, wherein said administering is effected using a delivery route selected from the group consisting of direct injection during a neurosurgery procedure and trans-catheter through neural arteries.
146. 146. A method of treating a disease treatable by modulating neural excitability in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with a neural tissue of the subject, said at least one exogenous polypeptide forming:
     
     (i) a connexin channel; and/or (ii) a depolarizing ion channel, ; and/or (iii) a hyperpolarizing ion channel, thereby treating the disease treatable by decreasing neural excitability in the subject.
147. 147. The method of claim 146, wherein said connexin channel is selected from the group consisting of connexin32, connexin36, connexin43 and connexin47.
148. 148. The method of claim 146, wherein said depolarizing ion channel is selected from the group consisting of a sodium channel, a calcium channel and a non-selective ion channel.
149. 149. The method of claim 146, wherein said hyperpolarizing ion channel is selected from the group consisting of a potassium channel and a chloride channel.
150. 150. The method of claim 146, wherein the disease is Parkinson's disease and/or epilepsy.
151. 151. The method of claim 146, wherein expressing is effected at a site capable of generating an epileptic stimulus.
152. 152. The method of claim 151, wherein said site is selected from the group consisting of an external globus pallidum, striatum, subthalamic nucleus, internal globus pallidus, nigra reticulate and zona increta.
153. 153. The method of claim 146, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said neural tissue is effected by systemic administration of at least one polynucleotide encoding said at least one exogenous polypeptide, said at least one exogenous polynucleotide being operably linked to a neural functional promoter.
154. 154. The method of claim 146, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said neural tissue is effected by localized administration of at least one polynucleotide encoding said at least one exogenous polypeptide.
155. 155. A method of treating a disease treatable by increasing neural excitability in a subject, the method comprising administering to the subject a therapeutically effective amount of cells expressing at least one exogenous polypeptide forming:
     (i) a hyperpolarizing ion channel; and/or (ii) connexin36, thereby treating the disease treatable by increasing neural excitability in the subject.
156. 156. The method of claim 155, wherein the disease is a neurodegenerative disorder.
157. 157. The method of claim 155, wherein said neurodegenerative disorder is Alzheimer's disease and/or Parkinson's disease.
158. 158. The method of claim 155, wherein said hyperpolarizing ion channel is a potassium channel or a chloride channel.
159. 159. The method of claim 158, wherein said potassium channel is a Kv channel, a Kir channel, an acetylcholine receptor channel and a HERG channel.
160. 160. The method of claim 158, wherein said chloride channel is a CIC
     channel.
161. 161. The method of claim 158, wherein said cells are selected from the group consisting of fibroblasts, microglia, oligodendrocytes, astroglia, mesenchymal stem cells, and embryonic stem cells.
162. 162. The method of claim 155, wherein administering is effected at a site selected from the group consisting of subthalamic nucleous, internal globus pallidum, zona increta, nigra reticulate, external globus pzallidum and nuclei.
163. 163. A method of treating a disease treatable by increasing neural excitability in a subject, the method comprising expressing at least one exogenous polypeptide in at least a subset of cells forming a part of, or being in contact with a neural tissue of the subject, said at least one exogenous polypeptide forming:
     (i) a hyperpolarizing ion channel; and/or (ii) connexin36, thereby treating the disease treatable by increasing neural excitability in the subject.
164. 164. The method of claim 163, wherein the disease is a neurodegenerative disorder.
165. 165. The method of claim 163, wherein said neurodegenerative disorder is Alzheimer's disease.
166. 166. The method of claim 163, wherein said hyperpolarizing ion channel is a potassium channel or a chloride channel.
167. 167. The method of claim 166, wherein said potassium channel is a Kv channel, a Kir channel, an acetylcholine receptor channel and a HERG channel.
168. 168. The method of claim 166, wherein said chloride channel is a CIC
     channel.
169. 169. The method of claim 163, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said neural tissue is effected by systemic administration of at least one polynucleotide encoding said at least one exogenous polypeptide, said at least one exogenous polynucleotide being operably linked to a neural functional promoter.
170. 170. The method of claim 163, wherein expressing said at least one exogenous polypeptide in at least said subset of cells forming a part of, or being in contact with said neural tissue is effected by localized administration of at least one polynucleotide encoding said at least one exogenous polypeptide.
171. 171. The method of claim 163, wherein expressing is effected at a site selected from the group consisting of subthalamic nucleous, internal globus pallidum, zona increta, nigra reticulate, external globus pzallidum and nuclei.