CN101228164A - Pyrrolopyridine-based inhibitors of dipeptidyl peptidase IV and methods - Google Patents

Abstract

Compounds are provided having the formula (I): wherein R, X, Y, Z, A and n are as defined herein, which are inhibitors of dipeptidyl peptidase IV and thus are useful in treating diabetes and related diseases.

Description

The Pyrrolopyridine inhibitor and the method for DPP IV

The application requires the interests of the right of priority of the U.S. Provisional Application No.60/682968 that submitted on May 20th, 2005, and whole disclosures of this provisional application add as a reference at this.

[technical field]

The present invention relates to the Pyrrolopyridine inhibitor of DPP IV (DPP-4) and by using separately this Pyrrolopyridine inhibitor, or be used in combination the method for the treatment of multiple disease or illness with the therapeutical agent of other types.

[background technology]

DPP IV (DPP-4) is for being positioned at film on multiple tissue (intestines, liver, lung, kidney) and the circulation T-lymphocyte in conjunction with the amino pepx (wherein this enzyme is called CD-26) of atypia Serine.It is responsible in vivo, and metabolic divides some interior living peptide (GLP-1 (7-36), glucagon) and has proved that it has the proteolytic activity of anti-multiple other peptides (GHRH, NPY, GLP-2, VIP) in vitro.

30 amino acid peptides that GLP-1 (7-36) is obtained for glucagon (proglucagon) before enteral by the back translation process.GLP-1 (7-36) has multiple action in vivo, comprises that stimulating insulin secretion, suppress glucagon secretes, promotes to be satiated with food and to slow down stomach emptying.Based on its physiology overview, the effect of expection GLP-1 (7-36) is of value to prevention and treatment type ii diabetes and potentiality obesity.For supporting this opinion, exophytic the giving of GLP-1 (7-36) proved effect in this patient colony to the diabetic subject.Lamentedly, GLP-1 (7-36) is degraded fast in vivo, and is presented at the transformation period (t1/2 ≈ 1.5 minutes) that in vivo has than short.Based on the research of genetic breeding DPP-4 KO mouse and in vivo/in vitro research of selective d PP-4 inhibitor, shown that DPP-4 is the in vivo primary degradation enzyme of GLP-1 (7-36).DPP-4 can make GLP-1 (7-36) effectively be degraded to GLP-1 (9-36), serves as the physiology antagonist of GLP-1 (7-36) through inferring GLP-1 (9-36).Therefore, the in vivo inhibition of DPP-4 should strengthen the interior living content of GLP-1 (7-36) and weaken the formation of its antagonist GLP-1 (9-36), thereby is used to improve the diabetes patient's condition.

[summary of the invention]

According to the present invention, provide the compound of formula (I):

Wherein:

Represent one or two pair key in these 5 yuan of rings, condition is an aromatic ring for these 6 yuan of rings;

N is 1 or 2;

R is the functional group that is selected from following group: hydrogen (H), halogen, CF ₃Cyano group (CN), amino, the amino that is substituted, alkyl, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, bicyclic alkyl (bicycloalkyl), bicyclic alkyl alkyl (bicycloalkylalkyl), alkylthio alkyl, the alkylthio-aryl alkyl, cycloalkenyl group, aryl, arylalkyl, heteroaryl, heteroarylalkyl, encircle mix alkyl and the assorted alkyl-alkyl of ring, wherein arbitrary this functional group is optional can be replaced through one to three substituting group (as if possibility) that is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl (polycycloalkyl), assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl;

X is identical with Z or different, and it is independently selected from CH ₂, CH, C=O, C=CR ₃R ₄, C=S, C=NR ₃And CR ₃R ₄, R wherein ₃With R ₄Be alkyl or aryl;

A is selected from the functional group of following group: hydrogen (H), alkyl, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, bicyclic alkyl, bicyclic alkyl alkyl, alkylthio alkyl, alkylthio-aryl alkyl, cycloalkenyl group, aryl, arylalkyl, heteroaryl, heteroarylalkyl, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, O-R ₁, cyano group, amino ,-C (O)-OH ,-C (O)-NR ₁R ₂,-C (O)-OR ₁, S (O) _m-R ₁,-S (O) ₂NR ₁R ₂,-NR ₁R ₂,-NR ₁-C (O) R ₂,-NR ₁-SO ₂R ₂, wherein arbitrary this functional group is optional can be replaced through one to three substituting group (if possibility) that is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carboxyl, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, the assorted alkyl amino-carbonyl of ring, the assorted alkyl-carbonyl of ring, assorted aromatic aminocarbonyl, assorted alkane (alkyl) aminocarboxyl of ring, cycloalkanes sulphonyl (alkyl) amino, halosulfonyl groups (alkyl) amino, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, dialkylamino carbonyl (wherein this alkyl is identical or different), the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl;

M is 0,1 or 2;

R ₁With R ₂Identical or different, and:

(i) each is independently for being selected from the functional group of following group: hydrogen (H), alkyl, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, bicyclic alkyl, the bicyclic alkyl alkyl, alkylthio alkyl, the alkylthio-aryl alkyl, cycloalkenyl group, aryl, arylalkyl, heteroaryl, heteroarylalkyl, encircle mix alkyl and the assorted alkyl-alkyl of ring, wherein arbitrary functional group is optional can be replaced through one to three substituting group (as if possibility) that is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl; Or

(ii) NR ₁R ₂In R ₁With R ₂Can together form 5 yuan or 6 yuan of saturated or undersaturated loop systems of part, it is selected from Heterocyclylalkyl, assorted bicyclic alkyl, heteroaryl and bicyclic heteroaryl, wherein this loop systems is optional can replace through one to three substituting group (if possibility) that is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl; And

Y is aryl or heteroaryl, and wherein this aryl or heteroaryl are optional can replace through one to five substituting group (if possibility) that is selected from following group: hydrogen; halogen; alkyl; multi-haloalkyl; alkoxyl group; halogenated alkoxy; many halogenated alkoxies; carbalkoxy; thiazolinyl; alkynyl; cycloalkyl; cycloalkylalkyl; multi-ring alkyl; assorted virtue is amino; virtue is amino; the assorted alkyl of ring; the assorted alkyl-alkyl of ring; hydroxyl; hydroxyalkyl; nitro; cyano group; amino; the amino that is substituted; alkylamino; dialkylamino; thiol group; alkylthio; alkyl carbonyl; acyl group; carbalkoxy; aminocarboxyl; the alkynes aminocarboxyl; alkyl amino-carbonyl; the enamino carbonyl; alkyl carbonyl oxy; alkyl oxycarbonyl amino; the aryl carbonyl amino; alkyl sulfonyl-amino; the alkylamino carbonyl amino; the alkoxyl group carbonyl amino; alkyl sulphonyl; amino-sulfonyl; alkyl sulphinyl; sulfonamido and alkylsulfonyl.

All pharmacy acceptable salts, steric isomer and the prodrug ester class that comprise formula I with the definition of following formula I.

The compound of formula I has in vivo the activity as the DPP-4 inhibitor, and is applicable to the capillary blood vessel and the great vessels complication of treatment diabetes and diabetes, such as retinopathy, neuropathy, ephrosis and wound healing.This disease and illness also are called " diabetic complication " sometimes.

The invention provides the compound that formula I is provided, the method for using the pharmaceutical composition of this compound and using this compound.Particularly, the invention provides comprise independent use or with the pharmaceutical composition of the compound of the formula I of the treatment significant quantity of pharmaceutically acceptable carrier combinations.

The present invention further provides a kind of treat or delay comprise that diabetic complication (comprises retinopathy, neuropathy, ephrosis and retardance wound healing (delayed wound healing)) diabetes, especially type ii diabetes, and relative disease is (such as insulin resistance (insulin resistance) (glucose homeostasis is impaired), hyperglycemia (hyperglycemia), hyperinsulinemia (hyperinsulinemia), the high blood content of lipid acid or glycerine (elevated blood levels of fatty acids or glycerol), obesity (obesity), the hyperlipidaemia (hyperlipidemia) that comprises hypertriglyceridemia (hypertriglyceridemia), X syndrome (Syndrome X), dyslipidemia (dyslipidemia), atherosclerosis (atherosclerosis) and hypertension (hypertension)) development or outbreak and the method that increases hdl concentration, the compound that wherein will treat the formula I of significant quantity gives to the Mammals of needs treatment, such as human patients.

Compound of the present invention can use separately, be used in combination with other compounds of the present invention or be used in combination with one or more other medicaments in the described therapeutic domain herein.

In addition, the invention provides a kind of method for the treatment of diabetes and the relative disease that reaches hereinafter as mentioned to be limited, the combination that wherein will treat the therapeutical agent (such as antidiabetic and/or lipid-lowering agent) of the compound of formula I of significant quantity and at least a other types gives the human patients for the treatment of to needs.

The weight ratio of the compound of employing formula usually, (I) and the therapeutical agent of antidiabetic or other types (deciding) on its insecticide-applying way about 0.01: 1 to about 500: 1, preferred about 0.1: 1 to about 100: 1, more preferably from about 0.2: 1 to about 10: 1 scope.

Particular of the present invention comprises the compound of the formula I with following structure:

Other embodiments of the present invention comprise the compound of the formula I with following structure:

In addition, according to the present invention, provide novel racemize or homochiral intermediate with following structure:

[embodiment]

The compound of formula of the present invention (I) can prepare shown in following reaction scheme and explanation thereof, also can use the program preparation of the spendable relevant open source literature of those skilled in the art.The exemplary agents of these reactions and program are shown in and hereinafter reach among the operation embodiment.

Scheme 1

The amino methyl pyrrolin that scheme 1 provides preparation formula (10) is the general routes outlined of [3,4-b] pyridine-5-ketone also.The chlorine ketone (obtaining from commercial source) that can make formula (1) and aldehyde (2) reaction to be forming conjugation ester (3), its with enamine (4) but the dihydropyridine of production (5) after reacting.The enamine of formula (4) can obtain maybe can prepare by making corresponding acetylacetic ester and ammonia react from commercial source.Can MnO ₂, HNO ₃Or additive method known in the art is oxidizing to pyridine (6) with dihydropyridine (5).Under heating or microwave heating condition, make the amine A-NH of chloromethylpyridine (6) and aniline or formula (7) ₂(wherein A is defined suc as formula I) reaction can produce also [3,4-b] pyridine-5-ketone (8) of pyrrolin.Use arbitrary method known in the art can make ester (8) be converted into primary alconol (9).For example, work as R ₂During=Me, can be such as LiBH ₄Suitable hydride reducer ester reduction (8).Work as R ₂=PhCH ₂The time, can make ester (8) hydrogenolysis become acid earlier, be converted into Acibenzolar, then with such as NaBH such as mixed anhydride ₄Reductive agent reduction.Then use such as CH ₃SO ₂Cl or SOCl ₂Reagent institute produced alcohol (9) be converted into muriate or mesylate.Then by making precursor muriate or mesylate and NH ₃/ MeOH reaction under heating or microwave heating condition can obtain required primary amine (10).

The pyrrolin that scheme 2 is described preparation formula (18) is the route of [3,4-b] pyridin-7-one also.

Scheme 2

The dialkyl oxalate condensation that can make the amine of the acrylate of formula (11) and formula (7) or aniline and formula (12) shown type is to produce two oxa-pyrrolidine carboxylic acid esters (13).(13) and aldehyde (2) in the presence of acid but the conjugation ketone of reaction production (14).Condensation reaction via formula (14) and enamine (4) can obtain dihydropyridine (15).Can MnO ₂, HNO ₃Or additive method known in the art makes dihydropyridine (15) be oxidized to pyridine (16).Follow with scheme 1 described order and similarly can finish the conversion of ester (16) in proper order to primary amine (18).

The pyrrolin of describing preparation formula (18) in the scheme 3 is the alternative method of [3,4-b] pyridin-7-one also.

Scheme 3

Follow with similar shown in the scheme 2 in proper order by acrylate (11), dialkyl oxalate (12) and amine P ₁-NH ₂(19) preparation primary amine (25).P ₁Can be 4-methoxy-benzyl, 4-p-methoxy-phenyl or any suitable protecting group that to remove from lactan (26).Can be such as the due care base (P of tertbutyloxycarbonyl ₂) protect primary amine to produce through the amino lactan (26) of difference protection is arranged.Make P ₁Group goes protection to produce lactan (27).Can make lactan (27) and boric acid (28) coupling to produce lactan (29), make P ₂Group goes to protect the back to produce primary amine (18).Perhaps, can use other couling process known in the art lactan (27) to be converted into the lactan (29) that is substituted.

Scheme 4 provides the route of pyrrolo-[3, the 4-b] pyridine of preparation formula (32).Can be pyrrolopyridine ester (30) with the lactan carbonyl on the ester (16) (lactam carbonyl) selective reduction.Suitably the example of reductive agent is DIBAL-H.Further reduction pyrrolopyridine (30) can produce alcohol (31), itself so that can functionalised as previously mentioned and be primary amine (32).

Scheme 4

Show 6 in the scheme 5, the general of 7-dihydro-5H-pyrrolo-[3,4-b] pyridines (34) synthesizes.

Scheme 5

Lactan-ester (16) can be reduced to 6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine alcohol (33) with reductive agent such as LAH.Can be further functionalized as previously mentioned to produce primary amine (34).

Scheme 6 is described 5 of preparation formula (35), and the 6-pyrrolin is the route of [3,4-b] pyridin-7-one also.

Scheme 6

Make the P in the lactan (27) ₁Group goes protection can produce lactan-amine (35).Work as P ₁When=4-p-methoxy-phenyl or 4-methoxy-benzyl, go protection in the presence of ceric ammonium nitrate, to carry out.

Scheme 7

Make lactan (27) deprotonation with alkali such as NaH; then to be handled such as alkylogen, aryl and alkyl sulfonyl chloride, aryl isocyanate and alkyl isocyanate and the halid suitable electrophilic reagent of alkoxycarbonyl methyl; can produce the lactan (29) that is substituted, it is gone can produce corresponding primary amines (18) after the protection.Perhaps, can carry out the functionalized of alkali mediation, then can use with order shown in the scheme 3 similarly to make it change into corresponding primary amines in proper order ester (23).

Scheme 8

The amino methyl pyrrolin that scheme 8 provides preparation formula (35) is the general routes outlined of [3,4-b] pyridine-5-ketone also.Chloromethylpyridine (6) and formula (30) (R wherein ₈With R ₉Can be C ₁-C ₆Alkyl, arylalkyl, heteroarylalkyl, cycloalkyl (3-6 unit) or F yl) react under heating or microwave heating condition through the amino acid ester of due care; can produce also [3,4-b] pyridine-5-ketone (31) and can it further being handled to obtain compound (33) of pyrrolin as scheme 1.Can use GPF (General Protection False-go guard method to obtain N-protected acid (34), this acid suitably can and then gone protection through N-, generation acid amides-amine (35) with primary amine or secondary amine coupling in the presence of the coupler.By separating acid amides-amine (35) that end product (35) or arbitrary intermediate (such as (6) or alcohol (32)) can obtain this pure enantiomerism form.

Scheme 9

As shown in scheme 9, perhaps follow the order shown in the scheme of being similar to 8 and can make acid amides-amine (35) by the alkylamine (36) that replaces through acid amides.By separating acid amides-amine (35) that end product (35) or arbitrary intermediate (such as (6) or alcohol (38)) can obtain this pure enantiomerism form.

Corresponding amino methyl pyrrolin is [3,4-b] pyridin-7-ones (36) also

Can by with scheme 8 and 9 in for the amino methyl pyrrolin and also [3,4-b] pyridine-described similar method of 5-ketone (35) (38)s obtained from diester (37) or amide-ester.

Operational version 7 can obtain diester (37) from the amino acid ester through due care.

Scheme 10

Perhaps but the order shown in the operational version 10 prepares the amine such as (10) or (35).Can prepare intermediate (42) with the similar mode of mode shown in the scheme 1, and then make its reduction to produce primary amine (10) or (35).

In addition, use methods known in the art, via the corresponding carboxylic acid of homologization (homologation) (for example 8 or 16, R wherein ₂=H) can prepare the Compound I of n=2.In addition, use Lawson (Lawesson) reagent can by suitable lactan intermediate (for example 8 or 16, R wherein ₂=alkyl, benzyl or due care base) and preparation corresponding thiocarbonyl group analogue (Compound I, X or Z are C=S) (referring to for example J.Org.Chem.1992,57 (14), 4000-4005; J.Org.Chem.1990,55 (9), 2694-2702).At POCl ₃Existing down by making corresponding lactan (wherein X or Z are C=O) and alkylamine or arylamine condensation can prepare 5-or 7-alkylamino or virtue amino-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) (Compound I, X or Z are C=NR to methylamine ₃) (referring to for example Ukrainskii Khimicheskii Zhurnal 1984,50 (11), 1198-1203).

Use methods known in the art all product amine that exist with the atropisomer form can be separated into independent enantiomer.For example, by the crystallization diastereomeric salt (tartrate or N-protected amino acid, referring to for example Eliel, Ernest L; Wilen, Samuel H.Doyle, Michael P.BasicOrganic Stereochemistry, Wiley, 2001), chirality preparation HPLC, chirality supercritical flow chromatography, use enzyme, use chirality derivating agent (derivatizing agent) are (referring to for example J.Org.Chem.1983,48 (15), 2520-2527) or preparation and chromatographic separation diastereomer derivative separate.Perhaps, can use this method to the arbitrary intermediate in synthetic these product amine.

Definition

Unless at specific examples qualification is arranged in addition, is applied to whole term as used in this specification to give a definition.

Except as otherwise noted, comprise having the side chain and the straight chain radical of saturated aliphatic alkyl of specifying carbonatoms separately or as other group employed terms of a part " alkyl " or " alk " herein.Particularly, except as otherwise noted, " alkyl " refer to preferably have 1 to 40 carbon atom, more preferably 1 to 10 carbon atom even the more preferably basic side chain of list or the non-branched-chain saturated hydrocarbon chain of 1 to 6 carbon atom, such as methyl, ethyl, n-propyl, sec.-propyl, normal-butyl, sec-butyl, the tertiary butyl, n-hexyl, n-octyl, positive decyl, dodecyl, 2-ethyl dodecyl, tetradecyl and similar group.Unless the definition of alkyl substituent has qualification in addition, this alkyl is optional can be replaced through one or more substituting groups that are selected from such as following each group: halogen; alkyl; alkoxyl group; aryl; aryloxy; aryl (aryl) or diaryl; arylalkyl; alkoxy aryl; thiazolinyl; cycloalkyl; cycloalkylalkyl; cycloalkyl alkoxy; amino; hydroxyl; hydroxyalkyl; acyl group; heteroaryl; heteroaryloxy; heteroarylalkyl; the heteroaryl alkoxyl group; aryloxy alkyl; alkylthio; alkylthio-aryl; the aryloxy aryl; alkyl amido; alkanoylamino; the aryl carbonyl amino; aryl sulfonyl; alkyl sulphonyl; the naphthene sulfamide base; nitro; cyano group; thiol group; haloalkyl; tri haloalkyl and/or alkylthio.

Except as otherwise noted, comprise separately or as other groups employed terms of a part " cycloalkyl " or " carbocyclic ring " herein and contain 1 to 3 ring filling or part unsaturated (containing 1 or 2 two key) cyclic hydrocarbon group, comprise that containing 3 to 20 altogether becomes ring carbon atom, preferred 3 to 10 monocycle alkyl that become ring carbon atom, bicyclic alkyl and tricyclic alkyl, and this cyclic hydrocarbon group can condense 1 or 2 as for the described aromatic ring of aryl, and this cyclic hydrocarbon group comprises for example cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, suberyl, the ring octyl group, ring decyl and cyclo-dodecyl, cyclohexenyl;

This group is optional arbitrarily can replace through one or more substituting groups (such as herein for the described substituting group of alkyl or aryl).

Herein separately or as other groups employed terms of a part " aryl " or " Ar " refer to have 5 to 20 carbon atoms, the unsaturated aromatic carbocyclic group of monocycle (for example phenyl) or multiple condensation (condensing) ring (for example naphthyl or anthryl).Representative example includes, but is not limited to aryl, such as phenyl, naphthyl, tetralyl, indane and xenyl.Unless the definition of aryl substituent is restricted in addition, this aryl is optional can be replaced through one or more substituting groups that are selected from following group: hydrogen; halogen; haloalkyl; alkyl; haloalkyl; alkoxyl group; halogenated alkoxy; thiazolinyl; trifluoromethyl; trifluoromethoxy; alkynyl; cycloalkyl-alkyl; the assorted alkyl of ring; the assorted alkyl-alkyl of ring; aryl; heteroaryl; arylalkyl; aryloxy; aryloxy alkyl; alkoxy aryl; arylthio; the arylazo base; heteroarylalkyl; the heteroaryl thiazolinyl; the heteroaryl heteroaryl; heteroaryloxy; hydroxyl; nitro; cyano group; amino; (wherein this amino comprises that (it is alkyl to 1 or 2 substituting group for any alkyl substituent as herein described or the amino that is substituted; mentioned any other aryl compounds in aryl or the definition)); thiol group; alkylthio; arylthio; heteroarylthio; virtue sulfane base; the alkoxy aromatic sulfenyl; alkyl carbonyl; aromatic carbonyl; alkyl-aminocarboxyl; aromatic aminocarbonyl; alkoxy carbonyl; aminocarboxyl; alkyl carbonyl oxy; aryl-carbonyl oxygen; alkyl oxycarbonyl amino; the aryl carbonyl amino; alkyl sulphonyl; the naphthene sulfamide base; aryl sulfonyl kia; the aryl sulfonyl kia alkyl; Arenesulfonyl amino or Arenesulfonyl amino carbonyl and/or any alkyl substituent cited herein.

Except as otherwise noted, refer to have 1 to 40 carbon atom and 1 to 10 ring filling or unsaturated group that heterocyclic atom, the monocycle of preferred 1 to 4 heterocyclic atom (being selected from nitrogen, sulphur, phosphorus and/or oxygen), multiple fused rings or many covalent manner connect separately or as the employed term of other group parts " the assorted alkyl of ring ", " heterocycle " or " heterocyclic radical " as this paper.Preferably, " heterocycle " or " heterocyclic radical " means and stablizes 5 to 7 yuan of monocycles or dicyclo or 7 to 10 yuan of bicyclic heterocycles, its can be saturated, part is unsaturated or aromatic heterocycle, and it comprises carbon atom and 1 to 4 heteroatoms that independently is selected from nitrogen, oxygen and sulphur, and wherein this nitrogen and sulfur heteroatom optional can through oxidation and this nitrogen heteroatom are optional can be through quaternized, and this group comprises any heterocycle defined above and phenyl ring condensed bicyclic radicals.Heterocyclic radical can be through replacing for the described substituting group of alkyl or aryl such as (but being not limited to), as long as the compound that is produced is stable on carbon or nitrogen, sulphur, phosphorus and/or oxygen heteroatom herein.For example:

Similar group.

Comprise the unsaturated heterocycle base separately or as other group parts employed " heteroaryl " herein.The example of heteroaryl comprises: unsaturated 3 to the 6 yuan of heteromonocyclic groups that contain 1 to 4 nitrogen-atoms, pyrryl, pyrrolinyl, imidazolyl, pyrazolyl, pyridyl, pyrimidyl, pyrazinyl, clatter piperazine base, triazolyl (4H-1 for example for example, 2,4-triazolyl, 1H-1,2,3-triazolyl, 2H-1,2,3-triazolyl etc.), tetrazyl (for example 1H-tetrazyl, 2H-tetrazyl etc.) etc.; The unsaturated annelated heterocycles base that contains 1 to 5 nitrogen-atoms, for example indyl, pseudoindoyl, indolizine base, benzimidazolyl-, quinolyl, isoquinolyl, indazolyl, benzotriazole base, tetrazolium clatter piperazine base (for example tetrazolium [1,5-b] clatter piperazine base etc.) etc.; Unsaturated 3 to 6 yuan of heteromonocyclic group groups of containing Sauerstoffatom, for example mutter base, furyl etc. of piperazine; Unsaturated 3 to 6 yuan of heteromonocyclic group groups of containing sulphur atom, for example thienyl etc.; Unsaturated 3 to 6 yuan of heteromonocyclic group groups of containing 1 to 2 Sauerstoffatom and 1 to 3 nitrogen-atoms, for example  azoles base, different  azoles base,  di azoly (for example 1,2,4- di azoly, 1,3,4- di azoly, 1,2,5- di azoly etc.) etc.; The unsaturated annelated heterocycles base (for example benzoxazol base, benzo  di azoly etc.) that contains 1 to 2 Sauerstoffatom and 1 to 3 nitrogen-atoms; Unsaturated 3 to 6 yuan of heteromonocyclic group groups of containing 1 to 2 sulphur atom and 1 to 3 nitrogen-atoms, for example thiazolyl, thiadiazolyl group (for example 1,2,4-thiadiazolyl group, 1,3,4-thiadiazolyl group, 1,2,5-thiadiazolyl group etc.) etc.; The unsaturated annelated heterocycles base (for example benzothiazolyl, diazosulfide base etc.) and the similar group that contain 1 to 2 sulphur atom and 1 to 3 nitrogen-atoms.In addition, the example of heteroaryl comprises following group:

And similar group.Unless the heteroaryl substituent definition is restricted in addition, this heteroaryl is optional can be replaced through one or more substituting groups (such as herein for described those substituting groups of alkyl or aryl).

Except as otherwise noted, make a comment or criticism separately or as other groups employed terms of a part " thiazolinyl " herein and have 2 to 20 carbon in the chain, preferred 2 to 12 carbon and more preferably 1 to 8 carbon, the straight or branched group that comprises 1 to 6 two key in the normal chain, such as vinyl, the 2-propenyl, the 3-butenyl, crotyl, the 4-pentenyl, the 3-pentenyl, the 2-hexenyl, the 3-hexenyl, the 2-heptenyl, the 3-heptenyl, the 4-heptenyl, the 3-octenyl, 3-nonene base, 4-decene base, 3-hendecene base, 4-laurylene base, 4,8,12-14 carbon trialkenyl and similar group.This thiazolinyl is optional can be replaced through one or more substituting groups (such as for disclosed those substituting groups of alkyl).

Except as otherwise noted, herein separately or as other groups employed terms of a part " alkynyl " make a comment or criticism have 2 to 20 carbon in the chain, preferred 2 to 12 carbon and more preferably comprise a triple-linked straight or branched group in 2 to 8 carbon, the normal chain, such as 2-propynyl, 3-butynyl, 2-butyne base, 4-pentynyl, 3-pentynyl, 2-hexin base, 3-hexin base, 2-heptyne base, 3-heptyne base, 4-heptyne base, 3-octyne base, 3-n-heptylacetylene base, 4-decynyl, 3-undecyne base, 4-dodecyne base and similar group.This alkynyl is optional can be replaced through one or more substituting groups (such as for disclosed those substituting groups of alkyl).

Herein separately or refer to contain the part unsaturated cyclic hydrocarbon of 3 to 12 carbon, preferred 5 to 10 carbon and 1 or 2 two key as other groups employed terms of a part " cycloalkenyl group ".The exemplary loop thiazolinyl comprises cyclobutene base, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctene base, cyclohexadienyl and cycloheptadiene base.This cycloalkenyl group is optional can be replaced through one or more substituting groups (such as for disclosed those substituting groups of alkyl).

Comprise the saturated bicyclic group separately or as other group employed terms of a part " bicyclic alkyl " herein, such as (being not limited to) [3.3.0] double-octane, [4.3.0] bicyclic nonane, [4.4.0] dicyclo decane (perhydronaphthalene), [2.2.2] double-octane etc.

Comprise two or more cycloalkyl ring systems as defined herein separately or as other group employed terms of a part " multi-ring alkyl " herein, wherein at least one carbon atom is the part of at least two independent certifiable loop systems.Multi-ring alkyl can comprise two bridgings between the carbon atom, and this multi-ring alkyl for example is dicyclo [1.1.0] butyl, dicyclo [3.2.1] octyl group, dicyclo [5.2.0] nonyl, three ring [2.2.1.0. ¹] heptyl, norcamphyl and pinane base (pinanyl).Multi-ring alkyl can contain one or more fused rings system, for example decahydro naphthyl (deriving from the group of perhydronaphthalene) and perhydro anthryl.Multi-ring alkyl can contain volution and connect (spiro union), and wherein single atom is the unique shared atom of two rings, and this multi-ring alkyl for example is spiral shell [3.4] octyl group, spiral shell [3.3] heptyl and spiral shell [4.5] decyl.

Refer to chlorine, bromine, fluorine and iodine and CF separately or as other group employed terms of a part " halogen " or " halo " herein ₃

Herein separately or refer to be attached to the alkyl as defined herein of parent molecule part as other groups employed terms of a part " alkoxyl group " via alkyl as defined herein.

Refer to further replace so that the alkoxyl group as herein defined of halogenated alkoxy to be provided separately or as other group employed terms of a part " halogenated alkoxy " herein through one or more halogen atoms (such as fluorine, chlorine or bromine).Example includes, but is not limited to fluoro methoxyl group, chloro methoxyl group, trifluoromethoxy, trifluoromethoxy, fluoro oxyethyl group and fluorine propoxy-.

Herein separately or as the employed term of other part " acyl group ", as defined herein, digital be connected to carbonyl (

) organic group; The acyl group example comprises the substituting group that is attached to carbonyl, such as alkyloyl, enoyl-, aroyl, aralkanoyl, 4-hetaroylpyrazol, cycloalkanes acyl group, the assorted alkyloyl of ring and similar group.

Refer to that as herein defined cycloalkyl, aryl, the assorted base of ring, bicyclic alkyl or heteroaryl are attached to the parent molecule part via alkyl as herein defined separately or as other groups part employed terms " cycloalkylalkyl ", " arylalkyl ", " the assorted alkyl of ring ", " bicyclic alkyl alkyl " or " heteroarylalkyl " herein.The representative example of arylalkyl includes, but is not limited to benzyl, 2-phenylethyl, 3-phenyl propyl and similar group.

Refer to be connected to (CH separately or as the employed term of other group parts " the assorted alkyl-alkyl of ring " herein via C atom or heteroatomic bond ₂) _rThe ring as defined herein of chain (wherein " r " can be 1 to the 10) alkyl of mixing.

Herein separately or as other groups employed terms of a part " multi-haloalkyl " refer to have 2 to 9, as defined above " alkyl " of preferred 2 to 5 halogenic substituents, such as CF ₃CH ₂, CF ₃Or CF ₃CF ₂CH ₂

As used herein term " many halogenated alkoxies " refer to have 2 to 9, as hereinbefore defined " alkoxyl group " of preferred 2 to 5 halogenic substituents, such as CF ₃CH ₂O-, CF ₃O-or CF ₃CF ₂CH ₂O-.

Herein separately or as other groups part employed terms " thiol group " or " sulfenyl ", refer to (S) or (S-).

Term " alkylthio " or " alkylthio-aryl " refer to be attached to the alkyl as defined herein of parent molecule part or/and arylalkyl via thiol group.

Term " alkylthio alkyl " or " alkylthio-aryl alkyl " refer to be connected to the alkylthio as herein defined of parent molecule part or/and alkylthio-aryl via alkyl.

Be separately or as other group employed terms of a part " hydroxyl " herein--the OH group.

Herein separately or refer to be attached to the hydroxyl as herein defined of parent molecule part as other groups employed terms of a part " hydroxyalkyl " via alkyl as defined herein.

Be separately or as other group employed terms of a part " cyano group " herein--the CN group.

Term " nitro " refers to as used herein--NO ₂Group.

No matter term " sulfinyl " uses separately or the use that links to each other with other terms, such as alkyl sulphinyl, represents divalent group respectively--S (O)--.

Herein separately or refer to be attached to the alkyl as herein defined of parent molecule part as other groups employed terms of a part " alkyl sulphinyl " via sulfinyl as defined herein.

Be SO separately or as other groups employed terms of a part " alkylsulfonyl " herein ₂Group.

Term " alkyl sulphonyl " or " amino-sulfonyl " refer to be attached to via alkylsulfonyl as defined herein the alkyl as defined herein or the amino of parent molecule part as used herein.

" amino " refers to-NH term as used herein ₃Group or amine key :-NR _a-, wherein Ra can be as following described in the definition of " amino that is substituted ".

Refer to through 1 or 2 amino that substituting group replaced separately or as other group employed terms of a part " amino that is substituted " herein.For example, NR _aR _b, R wherein _aWith R _bCan be identical or different, and for example be selected from hydrogen, alkyl, cycloalkyl, thiazolinyl, cycloalkenyl group, alkynyl, aryl, heteroaryl, heterocyclic radical, arylalkyl, heteroarylalkyl, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, cycloalkylalkyl, haloalkyl, hydroxyalkyl, alkoxyalkyl or alkylthio.This substituting group is optional can be further through replacing as above cited any alkyl substituent.In addition, the amino substituting group nitrogen-atoms that can be connected with them together forms optional 1-pyrrolidyl, piperidino, 1-azepines base, 4-morpholinyl, 4-thia morpholinyl, 1-piperazinyl, 4-alkyl-1-piperazinyl, 4-arylalkyl-1-piperazinyl, 4-alkyl diaryl-1-piperazinyl, 1-pyrrolidyl, piperidino or the 1-azepines base that replaces through alkyl, alkoxyl group, alkylthio, halogen, trifluoromethyl or hydroxyl.

Herein separately or refer to have the amino that is substituted of 2 alkyl substituents as other groups employed terms of a part " dialkylamino ".For example, NR _aR _b, R wherein _aWith R _bBe respectively alkyl as herein defined.

As used herein term " carbonyl " refers to-C (O)-group.

As used herein term " aminocarboxyl ", " alkyl-carbonyl ", " carbalkoxy ", " aromatic carbonyl ", " alkynes aminocarboxyl ", " alkyl amino-carbonyl " reach amino as herein defined, alkyl, alkoxyl group, aryl, alkynes amino, alkylamino or the enamino that " enamino carbonyl " refers to be attached to via carbonyl as herein defined the parent molecule part.

Term " heteroaryl amino ", " virtue amino ", " alkylamino ", " alkyl oxycarbonyl amino ", " aryl carbonyl amino ", " alkyl sulfonyl-amino ", " alkylamino carbonyl amino " or " alkoxyl group carbonyl amino " refer to via amino heteroaryl as herein defined, aryl, alkyl, alkyl carbonyl, aromatic carbonyl, alkyl sulphonyl, alkyl amino-carbonyl or the carbalkoxy that is attached to the parent molecule part as herein defined as used herein.

Term " sulfonamido " refers to--S (O) ₂--NR _aR _b, R wherein _aWith R _bDefine for " amino that is substituted " as mentioned.

Term " alkyl carbonyl oxy " refers to " alkyl-CO--O--" as used herein, and wherein alkyl as hereinbefore defined.

" choose wantonly " or " randomly " to be meant described subsequently incident or situation and can take place or can not take place, and mean this description and include, but is not limited to example that this incident or situation take place and the example that does not take place thereof.For example, the optional alkyl that is substituted mean alkyl can through or can be substituted group cited in the definition of alkyl without those and replacing.

" be substituted " as used herein; no matter express or hint; and no matter whether be preced with before " choosing wantonly "; all mean any one or a plurality of hydrogen on the specified atom (C, N etc.) by the group displacement shown in being selected from, condition is that the normal valency and this replacement that are no more than specified atom produce stable compound.For example, if CH ₂Through the ketone group substituting group (=when O) replacing, then 2 hydrogen atoms are replaced on this atom.Have only when the combination results stable compound, the combination of substituting group and/or variant is just allowed.In addition, an above position can be when being selected from the substituting group replacement of special groups in giving fixed structure, and this substituting group can be identical or different in each position.

Term " prodrug " is illustrated in when giving to the person under inspection and stands chemical conversion with the compound of production (I) and/or the compound of its salt and/or its solvate by metabolism or chemical process.For example, the compound that contains carboxyl can form the physiology hydrolyzable ester that serves as prodrug, and it is hydrolyzed in vivo, production (I) compound itself.Because hydrolysis mainly takes place under the influence of digestive ferment in many situations, so this prodrug preferred oral administration.If ester this as active, or betide in those situations of blood in hydrolysis, then can use non-through the enteral administration mode.The example of the physiology hydrolyzable ester of the compound of formula (I) is for example acetic ester, pivalate, methyl carbonic and benzoic ether, and comprises C _1-6Alkyl benzyl, 4-methoxy-benzyl, dihydro indenyl, phthaloyl base, methoxymethyl, C _1-6Alkanoyloxy-C _1-6Alkyl (for example acetyl-o-methyl, pivaloyl oxygen methyl or propionyl oxygen methyl), C _1-6Alkyl oxy carbonyl oxygen-C _1-6Alkyl (for example methoxy carbonyl oxy-methyl or ethoxy carbonyl oxy-methyl), glycyl oxygen ylmethyl, phenyl glycyl oxygen ylmethyl, (5-methyl-2-ketone group-1,3-two oxa-s amylene-4-yl)-methyl; And the employed physiology hydrolyzable ester that other are known in penicillin and the cynnematin technology for example.This ester can prepare by routine techniques known in the art.

The prodrug ester example comprises following group: (1-alkanoyloxy) alkyl, such as

Or

R wherein ^z, R ^tAnd R ^yBe H, alkyl, aryl or arylalkyl; Yet, R ^zO not can be HO.The example of this prodrug ester comprises

CH ₃CO ₂CH ₂-,

, t-C ₄H ₅CO ₂CH ₂-, or

Other examples of suitable prodrug ester comprise

R wherein ^zCan be H, alkyl (such as the methyl or the tertiary butyl), arylalkyl (such as benzyl) or aryl (such as phenyl); R ^vBe H, alkyl, halogen or alkoxyl group; R ^uBe alkyl, aryl, arylalkyl or alkoxyl group, and n ₁Be 0,1 or 2.

For other examples of prodrug derivant, referring to:

A) Design of Prodrugs, H.Bundgaard edit (Elsevier, 1985) and Methods inEnzymology, the 112nd volume, and the 309-396 page or leaf, people such as K.Widder edit (Academic Press, 1985);

B) A Textbook of Drug Design and Development, edited byKrosgaard-Larsen and H.Bundgaard edit, the 5th chapter, " Design and Application ofProdrugs; " (H.Bundgaard), 113-191 page or leaf (1991);

C) H.Bundgaard, Advanced Drug Delivery Reviews, the 8th volume, 1-38 page or leaf (1992); And

D) The Practice of Medicinal Chemistry, people such as Wermuth, the 31st chapter (AcademicPress 1996).

All above reference all are incorporated herein by reference.

Term " tautomer " refers to that the compound of formula (I) and salt thereof can its tautomeric form exist, and wherein therefore the chemical bond that is transferred between the atom of other parts of molecule and molecule of hydrogen atom is reset.Should be appreciated that all tautomeric forms (as long as it can exist) are included in the present invention.

Term pharmaceutically acceptable " salt " reaches " salt " and also comprises acid salt.It can be formed by following each acid: for example, strong inorganic acid, such as mineral acid, for example sulfuric acid, phosphoric acid or such as the haloid acid of HCl or HBr; Strong organic carboxyl acid, alkane carboxylic acid such as 1 to 4 carbon atom that is unsubstituted or replaces through halogen for example, acetate for example, such as saturated or unsaturated dicarboxylic acid, for example oxalic acid, propanedioic acid, succsinic acid, maleic acid, FUMARIC ACID TECH GRADE, phthalic acid or terephthalic acid, such as hydroxycarboxylic acid, for example xitix, oxyacetic acid, lactic acid, oxysuccinic acid, tartrate or citric acid, such as amino acid, for example aspartic acid or L-glutamic acid or from propylhomoserin or arginine; Or phenylformic acid; Or organic sulfonic acid, such as (the C that is unsubstituted or replaces through halogen for example ₁-C ₄) alkyl or aryl sulfonic acid, for example methylsulfonic acid or tosic acid.

All steric isomers of the The compounds of this invention of form of mixtures or respective pure form or substantially pure form all are covered by among the present invention.Compound of the present invention can locate to have center of asymmetry at arbitrary carbon atom (comprising arbitrary substituting group or R substituting group).Therefore, the compound of formula I can enantiomerism or diastereo-isomerism form or exist with its mixed form.The preparation method can utilize racemic modification, enantiomer or diastereomer as initial substance.When preparation diastereo-isomerism product or enantiomerism product, can for example chromatography or fractional crystallization separate it by ordinary method.

Compound of the present invention can become to dissociate or solvate (for example hydrate) form.

The patient's condition, disease and the morbid state that are referred to as " diabetic complication " comprise other known complication of retinopathy, neuropathy and ephrosis, erective dysfunction, retardance wound healing and diabetes.

Give therapeutical agent of the present invention and comprise the medicament of the present invention for the treatment of significant quantity.Term used herein " treatment significant quantity " refers to by giving combination treatment of the present invention or preventing the therapeutical agent consumption of the medicable patient's condition.The amount of this amount for being enough to show detectable treatment or prevention or improving effect.This effect can comprise, for example treatment of the cited herein patient's condition or prevention.The character of the patient's condition that the accurate and effective amount that is suitable for the person under inspection depends on person under inspection's size and health degree, treated and degree, treatment doctor's suggestion and for the combination of selected therapy of administration or therapy.Therefore, specify accurate and effective amount and inapplicable in advance.

Term " therapeutical agents of other types " includes, but is not limited to one or more antidiabetics (except that the DPP-IV of formula I), one or more antiobesity agents, one or more hypotensive agents, one or more anti-platelet agents, one or more antiatherosclerotics and/or one or more lipid-lowering agents (comprising antiatherosclerotic) as used herein.

Effectiveness and combination

A. effectiveness

Compound of the present invention has the activity as the inhibitor of the DPP IV of being found in mammiferous various tissues (such as intestines, liver, lung and kidney).Via in vivo suppressing DPP IV, compound of the present invention has the interior living content of enhancing GLP-1 (7-36) and weakens the ability that its antagonist GLP-1 (9-36) forms.

Therefore, compound of the present invention can be given to being preferably human Mammals so that treat the various patient's condition and illness, include, but is not limited to treatment or delay diabetes (preferred II type, glucose tolerance reduction (impaired glucose tolerance), insulin resistance reaches such as ephrosis, retinopathy, neuropathy and cataractous diabetic complication), hyperglycemia, hyperinsulinemia, unusual blood fat disease, hypercholesterolemia, the high blood content of free fatty acids or glycerine, hyperlipidaemia, hypertriglyceridemia, obesity, wound healing, the tissue local ischemic, atherosclerosis and hypertensive development or outbreak.Also can utilize compound of the present invention to increase the blood content of high-density lipoprotein (HDL) (HDL).

In addition, use compound of the present invention can treat the J.Clin.Endocrinol.Metab.82 as Johannsson, that is described in detail among the 727-34 (1997) is referred to as " X syndrome " or the syndromic patient's condition of metabolic, disease and morbid state.

B. combination

The present invention in its category, comprise comprise separately or with the pharmaceutical composition as the compound of at least a formula I of the treatment significant quantity of activeconstituents of medical supporting agent or thinner combination.Compound of the present invention optional can be separately, make up or be used in combination with other compounds of the present invention with one or more other treatment agent (for example antidiabetic or other medicinal activity materials).

Be fit to include, but is not limited to be applicable to the known treatment agent for the treatment of aforementioned illness that with compound combination of the present invention other " therapeutical agents " this therapeutical agent comprises: antidiabetic, antihyperglycemic agents, lipid-lowering agent, antiobesity agent, hypotensive agent and appetite-inhibiting agent.The other treatment agent that compound suitable and of the present invention makes up comprises medicament, the arthritis agent of the medicament for the treatment of Infertility, the medicament for the treatment of polycystic ovary syndrome, treatment growth illness and/or fragility (frailty), the medicament that prevents allograft rejection in the transplanting, the medicament for the treatment of autoimmune disorders, anti-AIDS medicament, treatment inflammatory bowel/syndromic medicament, treats the medicament and the ALENDRONATE FOSAMAX agent of anorexia nervosa.

The example that is suitable for the anti-diabetic medicament that is used in combination with compound of the present invention comprises biguanides (for example N1,N1-Dimethylbiguanide or phenformin), glucosidase inhibitor (for example acarbose (acarbose) or miglitol (miglitol)), Regular Insulin (comprising insulin secretagogue or insulin sensitizers), meglitinide (meglitinide) (for example repaglinide (repaglinide)), sulfonylurea (glimepiride (glimepiride) for example, Glyburide (glyburide), gliclazide (gliclazide), P-607 qualifying row pyrazines (glipizide)), biguanides/Glyburide composition (Glucovance for example ^), thiazolidinedione (troglitazone (troglitazone) for example, rosiglitazone (rosiglitazone) and pioglitazone (pioglitazone)), the PPAR-alfa agonists, the PPAR-gamma agonist, PPAR α/γ dual agonists, the PPAR-delta agonists, the triple agonists of PPAR α/gamma/delta, glycogen Starch phosphorylase (glycogen phosphorylase) inhibitor, the inhibitor of fatty acid binding protein (aP2), other agonists of glucagon-like peptide-1 (GLP-1) or GLP-1 acceptor, STLT2 inhibitor and other DPP IVs (DPP4) inhibitor.

Other suitable thiazolidinediones comprise that the MCC-555 of Mitsubishi (is disclosed in United States Patent (USP) the 5th, 594, No. 016), GL-262570, englitazone (the englitazone) (CP-68722 of Glaxo-Wellcome, Pfizer) or darglitazone (darglitazone) (CP-86325, Pfizer, Yi Shalita ketone (isaglitazone) (MIT/J﹠amp; J)), JTT-501 (JPNT/P﹠amp; U), L-895645 (Merck), R-119702 (Sankyo/WL), NN-23 44 (Dr.Reddy/NN) or YM-440 (Yamanouchi).

The PPAR-alfa agonists, the PPAR-gamma agonist, the example of PPAR-delta agonists and PPAR α/γ dual agonists comprises special (muraglitizar) in the wooden glug, flesh side Ge Lite (peliglitazar), AR-HO39242 (Astra/Zeneca), GW-409544 (Glaxo-Wellcome), GW-501516 (Glaxo-Wellcome), LY-919818 (Lilly/Ligand), KRP297 (KyorinMerck), and people such as Murakami, " A NovelInsulin Sensitizer Acts As a Coligand forPeroxisome Proliferation-Activated Receptor Alpha (PPAR alpha) and PPARgamma.Effect on PPAR alpha Activation on Abnormal Lipid Metabolism inLiver of Zucker Fatty Rats ", Diabetes 47,1841-1847 (1998), WO 01/21602 and United States Patent (USP) 6,653, disclosed those agonists in 314, the disclosure content is incorporated herein by reference, the using dosage of those agonists is as described in the disclosure content, and it is preferred for herein as preferred and specified compound.

Disclosed those inhibitor in suitable aP2 inhibitor comprises U. S. application the 09/391st, No. 053 (application on September 7th, 1999) and the U. S. application the 09/519th, No. 079 (application on March 6th, 2000), its using dosage as described herein.

Other suitable DPP4 inhibitor comprise Sa Kegeli booth (saxagliptin); Disclosed those inhibitor among WO99/38501, W099/46272, W099/67279 (PROBIODRUG), W099/67278 (PROBIODRUG), the W099/61431 (PROBIODRUG); As people such as Hughes, Biochemistry, 38 (36), 11597-11603, disclosed NVP-DPP728A in 1999 ((1-[[[2-[(5-cyanopyridine-2-yl) amino] ethyl] amino] ethanoyl]-2-cyano group-(S)-tetramethyleneimine)) (Novartis); TSL-225 (tryptophyl-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid) (people such as Yamada, Bioorg.﹠amp; Disclosed among Med.Chem.Lett.8 (1998) 1537-1540); 2-cyano group Pyrrolidine (2-cyanopyrrolidides) and 4-cyano group Pyrrolidine (as people such as Ashworth, Bioorg.﹠amp; Med.Chem.Lett. the 6th volume is the 22nd phase, disclosed in 1163-1166 page or leaf and the 2745-2748 page or leaf (1996)); Disclosed compound in No. the 6th, 395,767, No. the 10/899641st, U. S. application, WO 01/868603 and the United States Patent (USP) is described in using dosage such as the above reference.

Other suitable meglitinides comprise nateglinide (Novartis) or KAD1229 (PF/Kissei).

The example that is suitable for the antihyperglycemic agents that is used in combination with compound of the present invention comprises glucagon-like peptide-1 (GLP-1), such as GLP-1 (1-36) acid amides, GLP-1 (7-36) acid amides, GLP-1 (7-37) (as United States Patent (USP) the 5th, disclosed in 614, No. 492); And (Amylin/Lilly) according to gloomy Taide (exenatide); LY-315902 (Lilly); MK-0431 (Merck); Lira Ge Taide (liraglutide) (NovoNordisk); ZP-10 (Zealand Pharmaceuticals A/S); Disclosed compound among CJC-1131 (Conjuchem Inc) and the WO03/033671.

The example that is suitable for the lipid-lowering agent that is used in combination with compound of the present invention comprises one or more MTP inhibitor, HMG CoA reductase inhibitor, inhibitor for squalene synthetic enzyme, fiber acid derivative, ACAT inhibitor, lipoxidase inhibitor, cholesterol absorption inhibitor, ileum Na ⁺/ cholic acid is carried inhibitor (co-transporter inhibitor), the active adjusted agent of ldl receptor (up-regulator), cholic acid sequestering agent, cholesteryl ester transfer protein (for example CETP inhibitor, such as CP-529414 (Pfizer) and JTT-705 (Akros Pharma)), PPAR agonist (as indicated above) and/or niacin and derivative thereof altogether.

Spendable MTP inhibitor as indicated above comprises United States Patent (USP) the 5th, 595, No. 872, United States Patent (USP) the 5th, 739, No. 135, United States Patent (USP) the 5th, 712, No. 279, No. the 5th, 760,246, United States Patent (USP), United States Patent (USP) the 5th, 827, No. 875, No. the 5th, 885,983, United States Patent (USP) and United States Patent (USP) the 5th, disclosed those inhibitor in 962, No. 440.

The HMG CoA reductase inhibitor that can be used in combination with the compound of one or more formulas I comprises that mevastatin (mevastatin) reaches as United States Patent (USP) the 3rd, 983, disclosed related compound in No. 140, lovastatin (lovastatin) (nervinolin (mevinolin)) reaches as United States Patent (USP) the 4th, 231, No. 938 related compound, Pravastatin (pravastatin) reaches as United States Patent (USP) the 4th, 346, disclosed related compound in No. 227, simvastatin (simvastatin) reaches as United States Patent (USP) the 4th, 448, No. 784 and the 4th, 450, No. 171 disclosed related compounds.Other HMG CoA reductase inhibitors that can use in this article include, but is not limited to be disclosed in United States Patent (USP) the 5th, 354, the fluvastatin (fluvastatin) in No. 772; As United States Patent (USP) the 5th, 006, No. 530 and the 5th, 177, disclosed Cerivastatin (cerivastatin) in No. 080; As United States Patent (USP) the 4th, 681, No. 893, the 5th, 273, No. 995, the 5th, 385, No. 929 and the 5th, 686, disclosed atorvastatin (atorvastatin) in No. 104; As United States Patent (USP) the 5th, 011, disclosed Ah he cuts down his spit of fland (atavastatin) (Buddhist nun of Nissan/Sankyo cut down him spit of fland (nisvastatin) (NK-104)) in No. 930; As United States Patent (USP) the 5th, 260, disclosed Visa Si Tating (visastatin) (Shionogi-Astra/Zeneca (ZD-4522)) in No. 440; And disclosed relevant statin compound in No. the 5th, 753,675, the United States Patent (USP); As United States Patent (USP) the 4th, 613, the pyrazole analogs of disclosed mevalonolactone (mevalonolactone) derivative in No. 610; Indenes analogue as disclosed mevalonolactone derivative among the PCT application WO 86/03488; As United States Patent (USP) the 4th, 647, disclosed 6-[2-(pyrroles who is substituted-1-yl)-alkyl in No. 576] piperazine mutters-2-ketone and derivative thereof; The SC-45355 of Searle (glutaric acid derivatives that 3-replaces) dichloro acetic acid ester; Imidazoles analogue as disclosed mevalonolactone among the PCT application WO 86/07054; As French Patent the 2nd, 596, disclosed 3-carboxyl-2-hydroxyl-propane-phosphoric acid derivatives in No. 393; As disclosed 2 in No. the 0221025th, the european patent application, 3-disubstituted pyrroles, furans and thiophene derivant; As United States Patent (USP) the 4th, 686, the naphthyl analogue of disclosed mevalonolactone in No. 237; Such as United States Patent (USP) the 4th, 499, disclosed octahydro naphthalene in No. 289; Keto analog as disclosed nervinolin (lovastatin) in european patent application the 0142146th A2 number; And as United States Patent (USP) the 5th, 506, No. 219 and the 5th, 691, disclosed quinoline and pyridine derivate in No. 322.

Preferred lipid-lowering agent is that Pravastatin, lovastatin, simvastatin, atorvastatin, fluvastatin, Cerivastatin, Ah he cut down Ta Ting and ZD-4522.

In addition, be applicable to that the phosphinic acid compounds (such as disclosed those compounds among the GB 2205837) that suppresses HMG CoA reductase enzyme is fit to be used in combination with compound of the present invention.

Be applicable to that inhibitor for squalene synthetic enzyme herein includes, but is not limited to United States Patent (USP) the 5th, 712, disclosed α-phosphonate group-sulphonate in No. 396; People such as Biller, J.Med.Chem.1988, the 31st volume, the 10th phase, disclosed those inhibitor of 1869-1871 page or leaf comprise isoprenoid (phosphinyl-methyl) phosphonic acid ester; And other known inhibitor for squalene synthetic enzyme, for example as United States Patent (USP) the 4th, 871, No. 721 and the 4th, 924, No. 024 and Biller, S.A.Neuenschwander, K.Ponpipom, M.M. reach Poulter, CD.Current Pharmaceutical Design, 2, disclosed inhibitor for squalene synthetic enzyme among the 1-40 (1996).

In addition, be applicable to that other inhibitor for squalene synthetic enzyme herein comprise people such as P.Ortiz deMontellano, J.Med.Chem.1977,20, the disclosed terpenoid pyrophosphate of 243-249; Corey and Volante, J.Am.Chem.Soc, 1976,98, the disclosed bisphosphate method of 1291-1293 Buddhist nun ester (farnesyl diphosphate) analogue A and preceding squalene pyrophosphate (PSQ-PP) analogue; McClard, people such as R.W., J.A.C.S.1987,109, the 5544 phosphinyl phosphonic acid esters of being reported; And Capson, T.L, Ph D dissertation, in June, 1987, Dept.Med.Chem.U of Utah, summary, catalogue, the 16th, 17,40-43,48-51 page or leaf, the cyclopropanes of being reported in the general introduction.

The fiber acid derivative that can be used in combination with the compound of formula I comprises fenofibrate (fenofibrate), gemfibrozil (gemfibrozil), chlorine Bei Te (clofibrate), bezafibrate (bezafibrate), Win-35833 (ciprofibrate), S-8527 (clinofibrate) etc., probucol (probucol), reaches related compound, as the special example the 3rd of the U.S., 674, disclosed in No. 836, be preferably probucol and gemfibrozil; Cholic acid chelating agent is such as QUESTRAN (cholestyramine), colestipol (colestipol) and DEAE-Sephadex (Secholex ^, Policexide ^) and protect fat appropriate (lipostabil) (Rhone-Poulenc), Eisai E-5050 (ethanolamine derivant that N-replaces), imanixil (imanixil) (HOE-402), tetrahydrochysene lipstatin (tetrahydrolipstatin) (THL), stigmastane base phosphorylcholine (istigmastanylphos-phorylcholine) (SPC, Roche), amino cyclodextrin (TanabeSeiyoku), Ajinomoto AJ-814 (azulene derivatives), AC-233 (melinamide) (Sumitomo), Sandoz 58-035, U.S. Cyanamid CL-277,082 and CL-283,546 (dibasic urea derivativess), niacin, Olbetam (acipimox), Acifran (acifran), Xin Meisu (neomycin), para-aminosalicylic acid, acetylsalicylic acid (aspirin), such as United States Patent (USP) 4,759, disclosed poly-(diallyl methylamine) derivative in 923, such as United States Patent (USP) the 4th, poly-(diallyldimethylammonium chloride) and ionene class (ionenes) and other known serum cholesterol-lowering agents agent of disclosed quaternary amine in 027,009.

The ACAT inhibitor that can be used in combination with the compound of formula I comprises disclosed those inhibitor in following each document: Drugs of the Future 24, and 9-15 (1999), (Avasimibe); " The ACATinhibitor; C1-1011 is effective in the prevention and regression of aortic fattystreak area in hamsters ", people such as Nicolosi, Atherosclerosis (Shannon, Irel). (1998), 137 (1), 77-85; " The pharmacological profile of FCE 27677:a novel ACATinhibitor with potent hypolipidemic activity mediated by selective suppression ofthe hepatic secretion of ApoB100-containing lipoprotein ", Ghiselli, Giancarlo, Cardiovasc.Drug Rev. (1998), 16 (1), 16-30; " RP 73163:a bioavailablealkylsulfinyl-diphenylirmdazole ACAT inhibitor ", Smith, people such as C, Bioorg.Med.Chem.Lett. (1996), 6 (1), 47-50; " ACAT inhibitors:physiologic mechanisms forhypolipidemic and anti-atherosclerotic activities in experimental animals ", people such as Krause, editor: Ruffolo, Robert R.Jr.Hollinger, Mannfred A.Inflammation:Mediators Pathways (1995), 173-98, publisher: CRC, Boca Raton, Fla. " ACAT inhibitors:potential anti-atherosclerotic agents ", people such as Sliskovic, Curr.Med.Chem. (1994), 1 (3), 204-25; " Inhibitors of acyl-CoA:cholesterolO-acyl transferase (ACAT) as hypocholesterolemic agents.6. The firstwater-soluble ACAT inhibitor with lipid-regulating activity.Inhibitors ofacyl-CoA:cholesterol acyltransferase (ACAT) .7.Development of a series ofsubstituted N-phenyl-N '-[(1-phenylcyclopentyl) methyl] ureas with enhancedhypocholesterolemic activity ", people such as Stout, Chemtracts:Org.Chem. (1995), 8 (6), 359-62, or TS-962 (Taisho Pharmaceutical Co.Ltd).

Lipid-lowering agent can be the adjusted agent of LD2 receptor active, such as MD-700 (TaishoPharmaceutical Co.Ltd) and LY295427 (Eli Lilly).

Example suitable and the suitable cholesterol absorption inhibitor that compound of the present invention is used in combination comprises SCH48461 (Schering-Plough) and Atherosclerosis 115,45-63 (1995) and J.Med.Chem.41, disclosed those inhibitor in 973 (1998).

The suitable suitable ileum Na that is used in combination with compound of the present invention ⁺/ cholic acid carries the example of inhibitor to comprise the Future as Drugs of the, 24, disclosed compound among the 425-430 (1999) altogether.

The lipoxidase inhibitor that can be used in combination with the compound of formula I comprises: 15-lipoxygenase (15-LO) inhibitor, such as disclosed benzimidizole derivatives among the WO 97/12615; As disclosed 15-LO inhibitor among the WO97/12613; As disclosed isothiazolones among the WO 96/38144; Reach as disclosed 15-LO inhibitor in the following document: people such as Sendobry " Attenuation ofdiet-induced atherosclerosis in rabbits with a highly selective 15-lipoxygenaseinhibitor lacking significant antioxidant properties ", Brit.J.Pharmacology (1997) 120, people such as 1199-1206 and Comicelli, " 15-Lipoxygenase and its Inhibition:ANovel Therapeutic Target for Vascular Disease ", Current Pharmaceutical Design, 1999,5,11-20.

The example suitable and hypotensive agent that compound of the present invention is used in combination comprises Beta-3 adrenergic blocker, calcium channel blocker (L-type and T-type; Odizem (diltiazem) for example, verapamil (verapamil), nifedipine (nifedipine), amlodipine (amlodipine) and rice are than method (mybefradil)), diuretic(s) (chlorothiazide for example, hydrochlorothiazide, trifluoromethylthiazide, Hydroflumethiazide, Hydrex, Methyclothiazide, trichlormethiazide, many thiazines, benzthiazide, Ethacrynic Acid (ethacrynic acid) blows Ku Ruina fen (tricrynafen), chlorthalidone, Furosemide (furosemide), wood rope imines (musolimine), bumetanide (bumetanide), triamterene (triamtrenene), guanamprazine (amiloride), spironolactone), renin inhibitor, ACE inhibitor (captopril (captopril) for example, zofenopril (zofenopril), fosinopril (fosinopril), enalapril (enalapril), Puli (ceranopril) is drawn in match, silk draws Puli (cilazopril), delapril (delapril), pentopril (pentopril), quinapril (quinapril), Ramipril (ramipril), lisinopril (lisinopril)), AT-1 receptor antagonist (losartan (losartan) for example, Irb (irbesartan), valsartan (valsartan)), ET receptor antagonist (Sai Tashengtan (sitaxsentan) for example, Aunar is given birth to smooth (atrsentan) and United States Patent (USP) the 5th, 612, No. 359 and the 6th, disclosed compound in 043, No. 265), ET/AII dual antagonist (for example disclosed compound among the WO00/01389), neutral endopeptidase (NEP) inhibitor, vasopeptidase inhibitors (NEP-ACE double inhibitor) (for example omapatrilat (omapatrilat) and Ji Moqu draw (gemopatrilat)) and nitrate.

Example suitable and the suitable antiobesity agent that compound of the present invention is used in combination comprises: 'beta '3 adrenergic agonists, lipase inhibitor, thrombotonin (and Dopamine HCL (dopamine)) absorbs (reuptake) inhibitor again, thryoid receptor β medicine, 5HT2C agonist (such as ArenaAPD-356), MCHR1 antagonist (such as Synaptic SNAP-7941 and Takeda T-226926), melanochrome cortin acceptor (MC4R) agonist, MELANIN CONCENTRATING HORMONE acceptor (MCHR) antagonist (such as SynapticSNAP-7941 and Takeda T-226926), the galanin receptors inhibitor, orexin antagonists, the CCK agonist, NPY1 or NPY5 antagonist, NPY2 and NPY4 conditioning agent, the corticotropin releasing factor (CRF) agonist, Histamine Receptors-3 (H3) conditioning agent, 11-β-HSD-1 inhibitor, adiponectin (adinopectin) receptor modulators, monoamine reuptake inhibithors or releasing agent, (CNTF is such as the AXOKINE of Regeneron for the ciliary nerves cytotrophy factor ^), BDNF (Brain Derived Neurotrophic Factor), leptin and leptin receptor inhibitor, cannaboid-1 receptor antagonist (such as SR-141716 (Sanofi) or SLV-319 (Solvay)) and/or anoretic.

Optional can comprise AJ9677 (Takeda/Dainippon), L750355 (Merck) or CP331648 (Pfizer) with the 'beta '3 adrenergic agonists that compound of the present invention is used in combination or as United States Patent (USP) the 5th, 541, No. 204, the 5th, 770, No. 615, the 5th, 491, No. 134, the 5th, 776, No. 983 and the 5th, disclosed other known β 3 agonists in 488, No. 064.

The example of the optional lipase inhibitor that can be used in combination with compound of the present invention comprises orlistat (orlistat) or ATL-962 (Alizyme).

Choose wantonly and can be BVT-933 (Biovitrum), sibutramine (sibutramine), topiramate (topiramate) (Johnson﹠amp with thrombotonin (and Dopamine HCL) reuptake inhibithors (or serotonin receptor agonist) that compound of the present invention is used in combination; Johnson) or ciliary body neurotrophic factor (axokine) (Regeneron).

The example of the optional thryoid receptor beta compounds that can be used in combination with compound of the present invention comprises thryoid receptor ligands, such as disclosed those compounds among WO97/21993 (U.Cal SF), WO99/00353 (KaroBio) and the WO00/039077 (KaroBio).

Choose wantonly and can comprise S-768 (fenfluramine) with the monoamine reuptake inhibithors that compound of the present invention is used in combination, dexfenfluramine (dexfenfluramine), fluvoxamine (fluvoxamine), fluoxetine (fluoxetine), paroxetine (paroxetine), Sertraline (sertraline), chlorphentermine (chlorphentermine), cloforex (cloforex), clortermine (clortermine), picilorex (picilorex), sibutramine (sibutramine), dextroamphetamine (dexamphetamine), PHENTERMINE (phentermine), Phenylpropanolamine or Mazindol (mazindol).

Choose wantonly and can comprise topiramate (Johnson﹠amp with the anoretic that compound of the present invention is used in combination; Johnson), dextroamphetamine, PHENTERMINE, Phenylpropanolamine or Mazindol.

Above-mentioned patent and patent application are all to be incorporated herein by reference.

When above other treatment agent and compound of the present invention are used in combination, this therapeutical agent for example among the Physician ' s Desk Reference, use as those indicated amounts in the above cited patent, or the amount of determining with those skilled in the art is in addition used.

If compound of the present invention and one or more other treatment agent while or successive combination are used, then following combination ratio and dosage range are preferred.

If other antidiabetics are biguanides, then the compound of formula I can use with the weight ratio in about 0.01: 1 to about 100: 1, preferred about 0.1: 1 to about 5: 1 scope with biguanides.

The compound of formula I can use with the weight ratio in about 0.01: 1 to about 100: 1, preferred about 0.5: 1 to about 50: 1 scope with glucosidase inhibitor.

The compound of formula I can use with the weight ratio in about 0.01: 1 to about 100: 1, preferred about 0.2: 1 to about 10: 1 scope with sulfonylurea.

The compound of formula I can use with the weight ratio in about 0.01: 1 to about 100: 1, preferred about 0.2: 1 to about 10: 1 scope with thiazolidinedione.

If there is a thiazolidinedione antidiabetic, then its amount in can about 0.01 to 2000 milligram/daily range is used, and it can single dose or fractionated dose 1 to 4 administration every day.

Randomly, the amount that can be lower than about 150mg is incorporated sulfonylurea and thiazolidinedione into single tablet with the compound of formula I.

If there is a N1,N1-Dimethylbiguanide, then N1,N1-Dimethylbiguanide or its salt can be about 500 milligrams of/day amounts to about 2000 milligrams/daily range use, it can single dose or fractionated dose 1 to 4 administration every day.

If there is the GLP-1 peptide, then the GLP-1 peptide can contain the agent formulation form by nasal administration or non-through the administration of intestines mode, as United States Patent (USP) the 5th, 346 in the oral cavity, No. 701 (TheraTech), the 5th, 614, No. 492 and 5, described in 631,224, this patent all is incorporated herein by reference.

The compound of formula I with the weight ratio use in about 0.01: 1 to about 100: 1, preferred about 0.2: 1 to about 10: 1 scope of meglitinide, PPAR-gamma agonist, PPAR-α/γ dual agonists, PPAR-delta agonists, the triple agonists of PPAR-α/gamma/delta, aP2 inhibitor or other DPP4 inhibitor.

The compound of formula I of the present invention usually with the weight ratio use of lipid-lowering agent (existence) in about 500: 1 to about 1: 500, preferred about 100: 1 to about 1: 100 scopes.

For oral administration, with about 0.01mg/kg to about 500mg and preferably about 0.1mg extremely amount, every day 1 to 4 use MTP inhibitor in about 100mg scope can obtain satisfactory result.

Contain the 1mg that has an appointment to about 500mg, preferred about 2mg about 400mg extremely such as tablet or capsular preferred oral formulation, and the 5mg MTP inhibitor of about 250mg content extremely more preferably from about, 1 to 4 administration every day.

For oral administration, can obtain satisfactory result to the amount use HMG CoA reductase inhibitor in about 200mg scope with about 1mg to 2000mg and preferably about 4mg.

Contain the 0.1mg that has an appointment to about 100mg, preferred extremely about 80mg and the 10mg HMG CoA reductase inhibitor of about 40mg content extremely more preferably from about of about 5mg such as tablet or capsular preferred oral formulation.

Inhibitor for squalene synthetic enzyme can extremely about 2000mg and the extremely interior dosage use of about 200mg scope of preferably about 25mg of about 10mg.

Contain the 10mg that has an appointment to about 500mg, preferred about 25mg inhibitor for squalene synthetic enzyme of about 200mg content extremely such as tablet or capsular preferred oral formulation.

For described arbitrary purposes herein, the compound of formula I can contain the dosage unit preparations form of non-toxicity, pharmaceutically acceptable supporting agent or thinner by any suitable manner administration, per os for example is such as the form with tablet, capsule, granula or pulvis; Through the hypogloeeis; Contain clothes; Non-through intestines, such as by subcutaneous, intravenously, intramuscular or breastbone inner injection or infusion techniques (for example as the aseptic injection aqueous solution or non-aqueous solution or suspension); Intranasal comprises giving to the nose film, such as spraying by sucking; Through the part, such as form with newborn frost or ointment; Or per rectum, such as with suppository form.

Be used for the treatment of in the preferred method of the present invention of any disease disclosed herein (such as diabetes and relative disease) compound that contains one or more formulas I that use and pharmaceutical carriers or thinner are united, the pharmaceutical composition that has or do not have the therapeutical agent of other antidiabetics and/or hyperlipidemia agent and/or other types implementing.Use is suitable for the conventional solid of type of required administering mode or liquid carrier or thinner and medicated premix (such as pharmaceutically acceptable carrier, vehicle, tackiness agent etc.) can prepare this pharmaceutical composition.Can pass through the per os approach, for example this compound be given to the Mammals kind that comprises the mankind, monkey, dog etc. with tablet, capsule, pill, granula or powder form; Maybe can want by non-with the form of injectable formulation it being given through the intestines approach; Or in the intranasal or with the form of transdermal patch it is given.The typical solid preparation will contain the compound of 0.1mg to the formula I of about 500mg of having an appointment.Adult's dosage is preferably 1 milligram/day to 2,000 milligrams/day, and it can single dose or with form 1-4 administration every day of fractionated dose.

Can by under aseptic condition, be positioned over the compound of 250mg formula I in the bottle, lyophilize and the typical injectable formulation of sealing preparation under the aseptic condition.During use, inclusion is mixed with 2mL physiological saline, with the preparation injectable formulation.

Should be appreciated that the concrete dosage level and the administration frequency that are used for any particular subject can change and depend on following various factors, comprising: the activity of employed specific compound; The metabolic stability of this compound and action time length; Person under inspection's kind, age, body weight, general health situation, sex and diet; Administering mode and time; Excretion rate; The severity of drug regimen and particular condition.

By using the DPP-4 mediation cracking of measuring suitable substrate or counterfeit substrate to suppress the in vitro checking system of degree, the DPP-4 that can measure compound of the present invention suppresses active.The inhibition constant of DPP-4 inhibitor of the present invention (Ki value) can be measured by method described in the following experimental section.

Clone, expression and the purifying of human DPP-4

For producing human DPP-4, nucleotide sequence (preservation registration number M74777) based on the people clone, use two kinds of primer ACGCCGACGATGAAGACA and AGGTAAAGAGAAACATTGTT from the enterprising performing PCR of human cDNA of placenta (Clontech) (red mark (Red-tag) polysaccharase, Sigma).The PCR product cloning is gone into pcDN4/HisMax TOPO carrier (Invitrogene).For the stable transfection of CHO-DG44 cell, use primer GGTACCAGCGCAGAGGCTT and CTCGAGCTAAGGTAAAGAGAAACATTG again DPP4 to be carried out PCR, to produce KpnI and XhoI site.Use KpnI and XhoI site to extract the terminal His marker gene of N-.Thereby can be included by enteropeptidase cracking and the His mark that downcuts and to be used in addition purifying of the affine tubing string of TALON.Then this gene is inserted the KpnI of pD16 carrier and XhoI site so that stable transfection.Use electroporation to produce stable cell line by expression vector being transfected into Chinese hamster ovary (CHO-DG44) cell.Be supplemented with HT (glycine, xanthoglobulin and thymidine, Invitrogene), growth CHO-DG44 cell strain in the PFCHO substratum of glutamine and Recombulin (ICN).Then collect 1 * 10 ⁷Cells/ml is used electroporation transfection 60 μ g DNA under 300V, then it is transferred in the T75 flask.After the transfection the 3rd day, remove the HT fill-in, and (MTX, 10nM ICN) begin to select with the methylamine petrin.After spending 10 days again, cell is adorned plate in each hole of 96 orifice plates.Every 10 days, MTX concentration is increased by 2 or 3 times, until the highest 400nM.Based on being selected final stable cell line by the output of expressed proteins and activity.

Attempt using Talon resin purification reorganization DPP-4 poor effect, cause output few, most of DPP activity is passed through tubing string.Therefore, use conventional anionresin (Sepharose Q), gel-filtration (S-200) and high resolving power MonoQ tubing string that albumen is further purified.Final albumen produces the wall scroll band on the SDS-PAGE gel.Amino acid sequence analysis shows two DPP-4 groups in the sample.Part albumen has 27 amino acid that blocked from the N-end, and another part lacks terminal 37 amino acid of N-.Between this explanation separation period, remove by existing proteolytic enzyme in the Chinese hamster ovary celI in the whole film district (comprising the His mark) of striding.Use the Bradford staining to measure the albumen total concn, and measure the amount of active DPP-4 with this enzyme of inhibitor (Ki=0.4nM) titration of previous sign.Do not observe two phase characters during inhibition or the catalysis, illustrate that two albumen groups are identical on function.

The check of DPP-4 inhibition

Under steady state conditions, when cracking counterfeit substrate Gly-Pro-pNA by 405nm according to absorbancy increase measure active restraining effect to DPP-4.Use Thermomax plate reader in 96 orifice plates, to test.Usually, reaction contains the inhibitor of 100 μ l ATE buffer reagents (100mM Aces, 52mM Tris, 52mM thanomin, pH 7.4), 0.45nM enzyme, 120 μ M or 1000 μ M substrates (S＜Km and S＞Km, Km=180 μ M) and variable concentrations.For guaranteeing to be used for the steady state conditions of slow fixation inhibitor, before adding substrate, enzyme was cultivated 40 minutes in advance, to begin reaction with this compound.All serial inhibitor dilutions all in DMSO and final solvent strength be no more than 1%.

By suppressing data and combining the thermoisopleth match and evaluate inhibitor usefulness.

Wherein vi is the initial action speed under the different concns inhibitor I; V is the contrast speed under the situation that does not have inhibitor, and codomain is without speed that suppresses and the difference between the background; Background is the speed of substrate spontaneous hydrolysis under the situation that does not have enzyme; N is the Hill coefficient.

With as calculated IC under each concentration of substrate ₅₀Be converted into the Ki that presents competitive inhibition according to following formula:

$\mathrm{Ki}=\frac{I{C}_{50}}{(1+\frac{S}{\mathrm{Km}})}.---\left(2\right)$

As judging that by the extremely excellent consistence that reaches the Ki value that hanging down tests under the concentration of substrate obtains from height all inhibitor are emulative.IC under low concentration of substrate ₅₀In approaching to check in the situation of employed enzyme concn, with data fitting Morrison equation ¹, so that the loss of free inhibitor to be described:

$\frac{\mathrm{vi}}{v0}=1-\frac{(E+I+I{C}_{50})-\sqrt{{(E+I+I{C}_{50})}^2-4\mathrm{EI}}}{2E}---\left(3\right)$

Wherein vi and v0 are that existence is an enzyme concn with not having the steady state speed that is measured under the situation of inhibitor, E.

User's formula (2) is further with each IC ₅₀Actuarial (refine) becomes Ki, with the concentration of substrate in the explanation check.

¹Morrison，JF，Walsh，CT.Advances?in?Enzymology.61(1988)，201-206.

Abbreviation

Use following abbreviation in the embodiment of this paper and the other places:

The Ph=phenyl

The Bn=benzyl

The i-Bu=isobutyl-

The Me=methyl

The Et=ethyl

The pr=propyl group

The Bu=butyl

Boc or BOC=tert-butoxycarbonyl

Cbz=benzene methoxycarbonyl or carbobenzoxy-(Cbz) or carbobenzoxy

HOAc or AcOH=acetate

DMF=N, dinethylformamide

The DMSO=methyl-sulphoxide

The EtOAc=ethyl acetate

The Hex=hexane

CHCl ₃=chloroform

CH ₂Cl ₂=methylene dichloride

The THF=tetrahydrofuran (THF)

The TFA=trifluoroacetic acid

Pd/C=carbon carries palladium

LiBFH ₄=lithium borohydride

NaBH ₄=sodium borohydride

The MsCl=methylsulfonyl chloride

The DIBAL-H=diisobutylaluminium hydride

The TEA=triethylamine

Min=minute

H or hr=hour

The L=liter

The mL=milliliter

μ L=microlitre

The g=gram

The mg=milligram

The mol=mole

The mmol=mmole

The meq=milliequivalent

The rt=room temperature

Sat or sat ' d=are saturated

The aq.=water-based

The TLC=thin-layer chromatography

R _t=the residence time

The mp=fusing point

The HPLC=high performance liquid chromatography

PrepHPLC=preparation property HPLC

Solvent orange 2 A (preparation property HPLC): 90%H ₂O/10%MeOH+0.1%TFA

Solvent B (preparation property HPLC): 90%MeOH/10%H ₂O+0.1%TFA

LC/MS=high performance liquid chromatography/mass spectrum

MS or Mass Spec=mass spectrum

The HRMS=high resolution mass spec

The NMR=nucleus magnetic resonance

The equiv=equivalent

Embodiment

Provide following examples so that describe the present invention in more detail.Illustrate these embodiment that are used to implement the current best mode of containing of the present invention, be intended to illustrate the present invention and unrestricted the present invention.

Generally speaking, preferred compound of the present invention, such as disclosed specific compound in following examples, determined that but inhibition concentration equals or significantly greater than 10 μ M, be preferably 5 μ M, the enzymatic activity of the DPP IV of 3 μ M more preferably, prove that thus compound of the present invention has the effectiveness as effective inhibitor of DPP IV.Can calculate usefulness and it is expressed as inhibition constant (Ki value) or IC ₅₀(inhibition concentration 50%) value, this usefulness refers to use the activity of describing that in vitro checking system measured herein.

Embodiment 1:

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-phenyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also

Embodiment 1A:2-(chloromethyl)-4-(2,4 dichloro benzene base)-5-(2-methoxyl group-2-ketone group ethyl)-6-methyl isophthalic acid, 4-dihydropyridine-3-carboxylic acid, ethyl ester

At ambient temperature with 2, the 4-dichlorobenzaldehyde (2.3g, 12.9mmol), 4-chloro-3-acetoacetic acid ethyl ester (2.2g, 12.9mmol), benzylamine (80.0mg, 0.8mmol) and acetate (55.0mg, 0.9mmol) stirring of the mixture in Virahol (15mL) 65h.(1.6g 14.4mmol) is added in the reaction mixture and continues to stir 24h at ambient temperature with 3-aminobutene acid methyl esters.With dense HCl (1mL) stopped reaction, and at ambient temperature mixture is stirred 2h.Follow concentrated reaction mixture in a vacuum,, filter and evaporation with the diethyl ether dilution.By flash chromatography (120g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates, obtain the embodiment 1A (4.2g, 79% productive rate) of yellow viscous oil shape. ¹H NMR (400 MHz, CDCl ₃) δ 1.22 (t, J=7.5Hz, 3H), 2.36 (s, 3H), 3.63 (s, 3H), 4.11 (q, J=7.2Hz, 2H), 4.86 and 4.97 (AB _q, J=14.0Hz, 2H), 5.40 (s, 1H), 6.40 (wide unimodal, 1H), 7.13 (dd, J=8.4,2.2Hz, 1H), 7.26-7.31 (m, 2H).[M+H] ⁺＝418.2。

Embodiment 1B:2-(chloromethyl)-4-(2,4 dichloro benzene base)-6-picoline-3,5-dicarboxylic acid 3-ethyl ester 5-methyl esters

(3.4g 8.1mmol) is dissolved in acetate (15mL) and the 70% nitric acid/water (15mL) with embodiment 1A.At ambient temperature reaction mixture is stirred 72h.By the embodiment 1B (1.9g, 57% productive rate) of flash chromatography (120g tubing string, 0-100%EtOAc/ hexane) purifying crude product (3.7g) to obtain faint yellow oily. ¹H NMR (400MHz, CDCl ₃) δ 1.02 (t, J=7.7Hz, 3H), 2.66 (s, 3H), 3.60 (s, 3H), 4.10 (q, J=7.0Hz, 2H), 4.80 and 4.93 (AB _q, J=11.0Hz, 2H), 7.13 (d, J=7.0Hz, 1H), 7.26-7.33 (m, 1H), 7.45 (s, 1H).[M+H] ⁺＝415.91。

Embodiment 1C:4-(2,4 dichloro benzene base)-2,7-dimethyl-5-ketone group-6-phenyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid methyl esters

Method 1: (241mg is 0.6mmol) with aniline (60mg, 0.6mmol) the mixture backflow 72h in ethanol (10mL) with embodiment 1B.In a vacuum mixture is concentrated.By flash chromatography (40g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates to obtain embodiment 1C (166mg, 67% productive rate).

Method 2: (671mg, 1.6mmol) (168mg, 1.8mmol) mixture heating up to 175 in ethanol (5mL) ℃ is lasted 45 minutes with aniline with embodiment 1B in microwave.By the embodiment 1C (485mg, 71% productive rate) of flash chromatography (120g tubing string, 0-100%EtOAc/ hexane) purification reaction to obtain filbert solid state. ¹H NMR (400MHz, CDCl ₃) δ 2.77 (s, 3H), 3.64 (s, 3H), 4.88 and 5.00 (AB _q, J=17.6Hz, 2H), 7.13-7.20 (m, 2H), 7.33 (dd, J=8.4,2.2 Hz, 1H), 7.36-7.44 (m, 2H), 7.53 (d, J=1.8Hz, 1H), 7.79 (d, J=7.9Hz, 2H).[M+H] ⁺＝472.99。

Embodiment 1D:4-(2,4 dichloro benzene base)-3-(methylol)-2,7-dimethyl-6-phenyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also

Program #1: (160mg 0.4mmol) adds 2 MLiBH in the solution of THF (10mL) to embodiment 1C ₄/ THF (0.4mL, 0.8mmol).Mixture is stirred at ambient temperature, and follow the tracks of reaction by HPLC and LC/MS.The extra 2 M LiBH that add ₄/ THF (0.8mL, 1.6mmol), and with mixture heating up to 50 ℃ and stir 18h.With saturated NaHCO ₃Aqueous solution stopped reaction is then diluted with EtOAc.With the EtOAc aqueous layer extracted.With salt water washing ECDC organic layer also, dry (Na ₂SO ₄), and evaporation in a vacuum.By the embodiment 1D (11.5mg, 8% productive rate) of flash chromatography (40g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates to obtain faint yellow oily. ¹H NMR (400MHz, CDCl ₃) δ 2.89 (s, 3H), 4.46 and 4.60 (AB _q, J=11.9 Hz, 2H), 4.85 and 4.90 (AB _q, J=17.2Hz, 2H), 7.16 (t, J=7.5Hz, IH), 7.21 (d, J=7.9Hz, 1H), 7.33-7.43 (m, 3H), 7.56 (d, J=1.8Hz, 1H), 7.77 (d, J=7.9Hz, 2H).[M+H] ⁺＝399.20。

Program #2: at ambient temperature with embodiment 1C (183mg, 0.43mmol) with lithium hydroxide (about 200mg) in THF/H ₂Mixture among the O (4mL) stirs 18h.Then reactant is heated 1h at 120 ℃ in microwave.With 1 N HCl stopped reaction, and it is extracted among the EtOAc.With salt water washing ECDC organic layer also, dry (Na ₂SO ₄) and evaporation, with the thick acid product (34mg, 19% productive rate) that obtains the faint yellow solid shape. ¹H NMR (400MHz, CDCl ₃) δ 2.80 (s, 3H), 4.85 and 4.95 (AB _q, J=17.6Hz, 2H), 7.15 (t, J=7.5Hz, 1H), 7.20 (d, J=7.9Hz, 1H), 7.30 (dd, J=8.9,1.8Hz, 1H), 7.37 (t, J=7.9Hz, 2H), 7.49 (d, J=2.2Hz, 1H), 7.76 (d, J=7.9Hz, 2H) .[M+H] ⁺=412.81.

To this acid (25mg, 0.06mmol) in the solution of THF, add Vinyl chloroformate (24 μ L, 0.25mmol), add afterwards triethylamine (50 μ L, 0.36mmol).See precipitation at once.At ambient temperature mixture is stirred 2h, and then filter and wash with THF (1mL * 2).With H ₂NaBH among the O (0.3mL) ₄(11mg 0.29mmol) dropwise is added in the filtrate.At ambient temperature mixture is stirred 18h, and with it with EtOAc/H ₂The O dilution.With salt water washing organic layer, dry (Na ₂SO ₄), and evaporation is to obtain the thick embodiment 1D (11.5mg) of colorless oil.

Embodiment 1E and 1F:3-(chloromethyl)-4-(2,4 dichloro benzene base)-2,7-dimethyl-6-phenyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also; With methylsulfonic acid (4-(2,4 dichloro benzene base)-2,7-dimethyl-5-ketone group-6-phenyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) methyl esters

Program #1: (10mg, (11.5mg, 0.03mmol) (15mg is 0.15mmol) in the solution of methylene dichloride (2mL) with triethylamine 0.09mmol) to be added into embodiment 1D with methylsulfonyl chloride.At ambient temperature mixture is stirred 1h.With solvent evaporation, and pass through flash chromatography (4g tubing string, 0 to 100%EtOAC/ hexane) purifying resistates to obtain the mixture of embodiment 1E (5mg, 42% productive rate) and 1F (4mg, 29% productive rate).

Embodiment 1E: ¹H NMR (400MHz, CDCl ₃) δ 2.89 (s, 3H), 4.31 and 4.56 (AB _q, J=11.9Hz, 2H), 4.87 and 4.93 (AB _q, J=17.6 Hz, 2H), 7.16 (t, J=7.5Hz, 1H), 7.29 (d, J=8.4Hz, 1H), 7.38 (t, J=7.9Hz, 2H), 7.42 (dd, J=8.1,2.0Hz, 1H), 7.57 (d, J=2.2Hz, 1H), 7.78 (d, J=7.9Hz, 2H).[M+H] ⁺＝417.18。

Embodiment 1F: ¹H NMR (400MHz, CDCl ₃) δ 2.89 (s, 3H), 2.90 (s, 3H), 4.89 and 4.95 (AB _q, J=17.6Hz, 2H), 4.99 and 5.21 (AB _q, J=11.0Hz, 2H), 7.18 (t, J=7.0Hz, 1H), 7.23 (d, J=8.4Hz, 1H), 7.34-7.45 (m, 3H), 7.58 (wide unimodal, 1H), 7.78 (d, J=8.8Hz, 2H).[M+H] ⁺＝477.24。

Program #2: (15 μ L, (11.5mg, 0.03mmol) (30 μ L are 0.22mmol) in the solution of methylene dichloride (2mL) with triethylamine 0.19mmol) to be added into embodiment 1D with methylsulfonyl chloride.At ambient temperature mixture is stirred 4h.Evaporating solvent, and by the embodiment 1E (4mg, 33%) of flash chromatography (4g tubing string, 0 to 100%EtOAC/ hexane) purifying resistates to obtain colorless oil.

Embodiment 1G:3-(repeatedly nitrogen ylmethyl)-4-(2,4 dichloro benzene base)-2,7-dimethyl-6-phenyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also

Sodium azide (each 5mg, 0.08mmol) is added into the embodiment 1E that contains in DMF (each 5mL), and (5mg, 0.01mmol) (4mg is in independent flask 0.01mmol) with 1F.At ambient temperature mixture is stirred 18h.With EtOAc and water diluting reaction.With salt water washing organic layer, dry (Na ₂SO ₄), and in a vacuum with its evaporation.Merge crude product and pass through the embodiment 1G (5mg, 58% productive rate) of flash chromatography (4 g tubing strings, 0 to 100%EtOAc/ hexane) purifying to obtain white solid. ¹H NMR (400MHz, CDCl ₃) δ 2.85 (s, 3H), 4.24 and 4.31 (AB _q, J=13.6 Hz, 2H), 4.88 and 4.93 (AB _q, J=17.6Hz, 2H), 7.17 (t, J=7.5Hz, 1H), 7.21 (d, J=7.9Hz, 1H), 7.38 (t, J=8.1Hz, 2H), 7.42 (dd, J=8.4,2.2Hz, 1H), 7.58 (d, J=2.2Hz, 1H), 7.78 (d, J=7.9Hz, 2H).[M+H] ⁺＝424.19。

Embodiment 1.3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-phenyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also, tfa salt

Program #1: (28mg, (5mg is 0.01mmol) in THF/H 0.08mmol) to be added into azide 1G in conjunction with triphenyl phosphine with polymkeric substance ₂In the mixture among the O (1.5mL).At ambient temperature mixture is stirred 18h, and then filter and evaporation.By preparation property HPLC (YMC ODS 20 * 100mm, the 10min gradient, 30 to 100%B/A, 20ml/min) purifying resistates is to obtain colorless oil embodiment 1 (1.5mg, 32% productive rate). ¹H NMR (400MHz, CDCl ₃+ CD ₃OD is as cosolvent) and δ 2.83 (s, 3H), 3.88 and 4.10 (AB _q, J=14.5Hz, 2H), 4.85 and 4.90 (AB _q, J=18.5Hz, 2H), 7.14 (t, J=7.0Hz, 1H), 7.24-7.27 (m, 1H), 7.34 (t, J=7.9Hz, 2H), 7.40 (dd, J=8.1,2.0Hz, 1H), 7.55 (d, J=1.8Hz, 1H), 7.70 (d, J=8.8Hz, 2H).HRMS: for C ₂₁H ₁₈Cl ₂N ₃O, calculated value: 398.0827, experimental value: 398.0812.[M+H] ⁺＝398.20。

Program #2: (4mg is 0.0096mmol) with 7 M NH with embodiment 1E ₃Mixture in MeOH (4mL) heats 15min under 100 ℃ in microwave.With solvent evaporation, and with EtOAc and saturated NaHCO ₃The aqueous solution is handled (take up) resistates.With salt water washing organic layer, be dried (Na ₂SO ₄), and evaporation.By preparation property HPLC (30 to 100%B/A for YMC ODS 20 * 100mm, 10min gradient) purifying resistates, be the embodiment 1 (5.8mg, quantitative) of tfa salt to obtain.

Embodiment 2

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(4-p-methoxy-phenyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also

Embodiment 2A:(Z)-the amino but-2-ene acid benzyl ester of 3-

At ambient temperature with benzyl acetoacetate (4.6g, 24mmol) and ammonium acetate (9.2g, 119.5mmol) mixture in methyl alcohol (30mL) stirs 72h.With solvent evaporation, and with CHCl ₃/ H ₂O handles resistates.With salt water washing ECDC organic layer also, be dried (Na ₂SO ₄), and evaporation, obtain golden yellow buttery embodiment 2A (4.3g, 90% productive rate). ¹H?NMR(400MHz，CDCl ₃)δ1.91(s，3H)，4.60(s，1H)，5.12(s，2H)，7.24-7.40(m，5H)。

Embodiment 2B:(Z)-2-(2, the 4-dichlorin benzylidene)-4-chloro-3-acetoacetic acid ethyl ester

At ambient temperature with 2,4-25 chlorobenzaldehydes (4.6g, 26.1mmol), 4-chloro-3-acetoacetic acid ethyl ester (4.5g, 27.4mmol), benzylamine (165mg, 1.5mmol) and acetate (118mg, 2.0mmol) the solution stirring 96h in Virahol (30mL).Mixture with isopropanol, is obtained the 50mL cumulative volume, and store as stock solution (0.52mmol/mL).

Embodiment 2C:6-(chloromethyl)-4-(2,4 dichloro benzene base)-2-methyl isophthalic acid, 4-dihydropyridine-3,5-dicarboxylic acid 3-benzyl ester 5-ethyl ester

At ambient temperature with stock solution 2B (25mL, 13mmol) and embodiment 2A (2.8g, 14.5mmol) mixture in Virahol (3mL) stirs 18h.With dense HCl (8mL) stopped reaction, and at ambient temperature mixture is stirred 2h.Follow concentration response in a vacuum, it is diluted with diethyl ether, filter and evaporation.By flash chromatography (120g tubing string, EtOAc/ hexane) purifying resistates, obtain the embodiment 2C (4.2g, 65% productive rate) of yellow viscous oil shape. ¹HNMR (400MHz, CDCl ₃) δ 1.19 (t, J=7.0Hz, 3H), 2.35 (s, 3H), 4.05-4.15 (m, 2H), 4.82 and 4.97 (AB _q, J=14.1Hz, 2H), 5.07 and 5.11 (AB _q, J=12.3Hz, 2H), 5.41 (s, 1H), 6.37 (wide unimodal, 1H), 7.07 (dd, J=8.4,2.2Hz, 1H), 7.1 6-7.32 (m, 5H), 7.35-7.38 (m, 2H).

Embodiment 2D:6-(chloromethyl)-4-(2,4 dichloro benzene base)-2-picoline-3,5-dicarboxylic acid 3-benzyl ester 5-ethyl ester (novel intermediate)

(4.1mg 8.2mmol) is dissolved in acetate (30mL) and the 70% nitric acid/water (25mL) with embodiment 2C.At ambient temperature reaction mixture is stirred 18h.By flash chromatography (120g tubing string, 0-100%EtOAc/ hexane) purifying crude product (4.2g), obtain the embodiment 2D (2.7g, 68% productive rate) of faint yellow oily. ¹H NMR (400MHz, CDCl ₃) δ 0.98 (t, J=7.3Hz, 3H), 2.65 (s, 3H), 4.05 (q, J=7.0Hz, 2H), 4.77 and 4.92 (AB _q, J=11.0Hz, 2H), 5.04 (s, 2H), 7.01 (d, J=8.35Hz, 1H), 7.07 (dd, J=8.4,2.2Hz, 1H), 7.10-7.14 (m, 2H), 7.21 (d, J=2.2Hz, 1H), 7.28-7.28 (m, 3H).[M+H] ⁺＝491.98。

Embodiment 2E:4-(2,4 dichloro benzene base)-6-(4-p-methoxy-phenyl)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

(199mg, 0.4mmol) (61mg, 0.5mmol) mixture in ethanol (3mL) heats 15min under 175 ℃ in microwave with the 4-anisidine with embodiment 2D.Evaporating solvent, and, obtain golden yellow buttery embodiment 2E (114.6mg, 53% productive rate) by flash chromatography (12g tubing string, EtOAc/ hexane) purifying resistates. ¹H NMR (400MHz, CDCl ₃) δ 2.76 (s, 3H), 3.79 (s, 3H), 4.81 and 4.90 (AB _q, J=17.6Hz, 2H), 5.05 and 5.11 (AB _q, J=11.9Hz, 2H), 6.89 (d, J=9.2Hz, 2H), 7.03 (d, J=8.4Hz, 1H), 7.08-7.16 (m, 3H), 7.28-7.38 (m, 4H), 7.66 (d, J=9.2Hz, 2H).[M+H] ⁺＝533.06。

Embodiment 2F:4-(2,4 dichloro benzene base)-6-(4-p-methoxy-phenyl)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

At H ₂(g) (114.6mg 0.2mmol) stirs 5h with the mixture of 10%Pd/C (44mg) in ethyl acetate (15mL) with embodiment 2E at ambient temperature under the air bag (balloon).Reactant is filtered, evaporate and continue on for next reaction and need not to be further purified.

Embodiment 2G:4-(2,4 dichloro benzene base)-3-(methylol)-6-(4-p-methoxy-phenyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also

To sour 2F (114mg, 0.3mmol) in the solution of THF (10mL), add Vinyl chloroformate (50 μ L, 0.5mmol), add afterwards triethylamine (150 μ L, 1.1mmol).At ambient temperature mixture is stirred 2h, and filter.With NaBH ₄(50mg 1.3mmol) is added in the filtrate, and at ambient temperature mixture is stirred 18h.With saturated NaHCO ₃Aqueous solution stopped reaction, and it is extracted among the EtOAc.With salt water washing ECDC organic layer also, dry (Na ₂SO ₄), and evaporation.By flash chromatography (12g tubing string, EtOAc/ hexane) purifying resistates, obtain the embodiment 2G (10.5mg, 10% productive rate) of white solid.[M+H] ⁺＝429.10。

Embodiment 2H:3-(chloromethyl)-4-(2,4 dichloro benzene base)-6-(4-p-methoxy-phenyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also

With triethylamine (25 μ L, 0.18mmol) and methylsulfonyl chloride (20 μ L, (10mg is 0.02mmol) in the solution of methylene dichloride (4mL) 0.26mmol) to be added into pure 2G.At ambient temperature mixture is stirred 18h and evaporation.By flash chromatography (4g tubing string, EtOAc/ hexane) purifying resistates, obtain the embodiment 2H (7mg, 67% productive rate) of colorless oil. ¹H NMR (400MHz, CDCl ₃) δ 2.89 (s, 3H), 3.80 (s, 3H), 4.31 and 4.56 (AB _q, J=11.9Hz, 2H), 4.82 and 4.89 (AB _q, J=17.1Hz, 2H), 6.87-6.94 (m, 2H), 7.29 (d, J=7.9Hz, 1H), 7.4 1 (dd, J=7.9,1.8Hz, 1H), 7.56 (d, J=1.8Hz, 1H), 7.63-7.70 (m, 2H).[M+H] ⁺＝446.90。

Embodiment 2:3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(4-p-methoxy-phenyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also, tfa salt

(7mg is 0.02mmol) with 7 M NH with muriate 2H ₃Mixture in MeOH (4mL) heats 15min under 100 ℃ in microwave.Remove in a vacuum and desolvate, and, obtain embodiment 2 (6.7mg, 79% product) into tfa salt by preparation property HPLC (30 to 100%B for Phenomenex, 10min gradient) purifying resistates. ¹H NMR (400MHz, CDCl ₃) δ 2.86 (s, 3H), 3.80 (s, 3H), 3.97 and 4.20 (AB _q, J=14.5Hz, 2H), 4.96 and 5.01 (AB _q, J=18.0Hz, 2H), 6.94-7.00 (m, 2H), 7.36 (d, J=8.4Hz, 1H), 7.54 (dd, J=8.4,2.2Hz, 1H), 7.59-7.65 (m, 2H), 7.72 (d, J=1.8Hz, 1H).HRMS: for C ₂₂H ₂₀Cl ₂N ₃O ₂, calculated value: 428.0933, experimental value: 428.0943.[M+H] ⁺＝428.10。

Embodiment 3

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-p-methoxy-phenyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also, tfa salt

Outside the 4-anisidine among the 2-anisidine replacement step 2E, use above embodiment 2 described same procedure to prepare embodiment 3. ¹H NMR (400MHz, CDCl ₃) δ 2.87 (s, 3H), 3.83 (s, 3H), 3.99 and 4.22 (AB _q, J=14.5Hz, 2H), 4.85-4.95 (m, 2H), 7.01 (Kuan Sanfeng, J=7.5Hz, 1H), 7.14 (wide bimodal, J=8.4Hz, 1H), 7.32 (dd, J=7.9,1.8Hz, 1H), 7.34-7.40 (m, 2H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.69 (d, J=2.2Hz, 1H).HRMS: for C ₂₂H ₂₀Cl ₂N ₃O ₂, calculated value: 428.0933, experimental value: 428.0937.[M+H] ⁺＝428.12。

At Chiralcel ^OJ, 20 μ use the degree gradients (isocratic gradient) such as heptane that contain 15%EtOH-MeOH (50%) to separate embodiment 3 on 5 * 50cm tubing string, obtain each enantiomer.

Embodiment 3-1 (enantiomer A; Move very fast): [α] _D ²⁵+ 8.2 °; Chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm; Contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] gained purity＞98%.

Embodiment 3-2 (enantiomer B; Move slower): [α] _D ²⁵-8.0 °; Chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm; Contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] gained purity＞98%.

Embodiment 4

3-(amino methyl)-6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also, tfa salt

Outside the 4-anisidine among the benzene methanamine replacement step 2E, use above embodiment 2 described same procedure to prepare embodiment 4. ¹H NMR (400MHz, CDCl ₃) δ 2.81 (s, 3H), 3.96 and 4.19 (AB _q, J=14.5Hz, 2H), 4.40 (s, 2H), 4.69 and 4.74 (AB _q, J=14.9Hz, 2H), 7.25-7.40 (m, 6H), 7.54 (dd, J=7.9,1.8Hz, 1H), 7.71 (d, J=2.2Hz, 1H).HRMS: for C ₂₂H ₂₀Cl ₂N ₃O, calculated value: 412.0983, experimental value: 412.0995.[M+H] ⁺＝412.13。

Embodiment 5

3-(amino methyl)-6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-5,6-pyrrolin be [3,4-b] pyridin-7-one also

Embodiment 5A:1-benzyl-4,5-diketo tetramethyleneimine-3-carboxylic acid, ethyl ester

At room temperature with benzylamine (3.63g, 33.0mmol), (3.6mL, 33.0mmol) mixture in EtOH (10mL) stirs 16h to ethyl acetate.Add oxalic acid diethyl ester (4.5mL, 33mmol) with freshly prepd EtOH in alcohol sodium solution ((39.0mmol) is prepared in 10mL EtOH by the 0.9g sodium Metal 99.5).With the mixture heating up 1h that refluxes, and make its curing.In a vacuum volatile matter is removed.With H ₂O (50mL) dilutes crude product, and by adding dense HCl the pH value of mixture is adjusted to 1.Mixture is filtered, obtain the embodiment 5A (7.7g, 88%) of white solid. ¹H?NMR(400MHz，CD ₃OD)δ1.26(t，J＝7.1Hz，3H)，3.89(s，3H)，4.22(q，J＝7.1Hz，2H)，4.65(s，2H)，7.20-7.40(m，5H)。[M+Na] ⁺＝284.23。

Embodiment 5B:(E)-and 4-(2, the 4-dichlorin benzylidene)-1-benzyl-pyrrole alkane-2, the 3-diketone

With embodiment 5A (1.3g, 4.9mmol), 2,4 dichloro benzene formaldehyde (0.86g, 4.9mmol) the mixture heating up backflow 4h in EtOH (20mL)/20%HCl aqueous solution (50mL).After being cooled to envrionment temperature, with water layer decant (decant).Collect the bit solid obtained, and in EtOAc further recrystallize, obtain the embodiment 5B (0.84g, 48%) of glassy yellow solid state. ¹H?NMR(400MHz，CDCl ₃)δ4.31(d，J＝2.2Hz，2H)，4.79(s，2H)，7.20-7.42(m，7H)，7.51(d，J＝2.2Hz，1H)，8.01(m，1H)。[M+H] ⁺＝345.97。

Embodiment 5C:6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-4,5,6,7-tetrahydro-1 H-pyrrolo be [3,4-b] pyridine-3-carboxylic acid ethyl ester also

With embodiment 5B (1.75g, 50mmol), (0.685g 53mmol) is heated to backflow through stirred mixture to ethyl in acetate (4mL), last 1.5h.Under reduced pressure volatile matter is removed.With EtOAc (20mL) washing crude reaction product, and, obtain the embodiment 5C (1.62g, 70%) of white solid with its filtration. ¹H NMR (400MHz, DMSO-d ₆) δ 0.87 (t, J=7.5Hz, 3H), 2.36 (s, 3H), 3.46 (d, J=18.9Hz, 1H), 3.70-3.85 (m, 3H), 4.35 and 4.59 (AB _q, J=15.2Hz, 2H), 5.30 (s, 1H), 7.10-7.32 (m, 6H), 7.37 (dd, J=8.3,1.8Hz, 1H), 7.49 (d, J=1.8Hz, 1H), 9.31 (s, 1H).[M+H] ⁺＝457.29。

Embodiment 5D:6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid ethyl ester

(1.55g 34mmol) is heated to backflow through stirred mixture in 1 N aqueous nitric acid (12.5mL), last 0.5h, and then be cooled to RT with embodiment 5C.With the water layer decant.The remaining solid resistates is dissolved in EtOAc (50mL).With organic layer with H ₂O (10mL), salt water washing are dried (MgSO ₄), filter, and under reduced pressure concentrate, obtain light brown solid state embodiment 5D (1.5g, 97%). ¹H NMR (400MHz, CDCl ₃) δ 0.94 (t, J=7.5Hz, 3H), 2.75 (s, 3H), 3.94 and 4.10 (AB _q, J=18.0Hz, 2H), 4.02 (q, J=7.1Hz, 2H), 4.61 and 4.89 (AB _q, J=15.0Hz, 2H), 7.07 (d, J=8.3Hz, 1H), 7.15-7.30 (m, 6H), 7.43 (d, J=1.8Hz, 1H).[M+H] ⁺＝455.29。

Embodiment 5E:6-benzyl-4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5,6-pyrrolin be [3,4-b] pyridin-7-one also

(0.75g 1.64mmol) adds LiBH in stirred solution in THF (15mL) to embodiment 5D ₄(the 2M solution in THF, 1.23mL, 2.46mmol).After at room temperature stirring 16h, add another part LiBH ₄(2 M solution in THF, 1.00mL, 2.0mmol).After at room temperature stirring 48h in addition, by adding saturated NaHCO ₃Solution (10mL) comes stopped reaction.The gained mixture is diluted with EtOAc (125mL), with H ₂The O washing also concentrates.(silica gel, EtOAc/ hexane=1: 1 are to EtOAc/MeOH=95: 5) come the purifying crude reaction product, obtain solid state embodiment 5E (0.23 g, 34%) by flash chromatography. ¹H NMR (400 MHz, CDCl ₃) δ 2.87 (s, 3H), 3.87 and 3.95 (AB _q, J=17.6Hz, 2H), 4.42 and 4.61 (AB _q, J=12.0Hz, 2H), 4.67 and 4.90 (AB _q, J=14.5Hz, 2H), 7.1-7.30 (m, 7H), 7.52 (d, J=2.2Hz, 1H).[M+H] ⁺＝413.27。

Embodiment 5:3-(amino methyl)-6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-5,6-pyrrolin be [3,4-b] pyridin-7-one .HCl salt also

(88mg is 0.21mmol) in CH to embodiment 5E ₂Cl ₂(1mL) in stirred solution, add MsCl (28 μ L, 0.36mmol) and Et ₃N (60 μ L, 0.43mmol).At ambient temperature reaction mixture is kept 2.5h and concentrated, obtain crude product, make crude product stand flash chromatography (silica gel, EtOAc/ hexane=1: 2 is to 100%EtOAc), obtain muriate intermediate (74mg, 80%).(72mg 0.17mmol) shines 15min with the mixture of 7 N ammonia in MeOH (7mL) under 50 ℃ in microwave reactor with the muriate in the sealed tube.After being cooled to envrionment temperature, in a vacuum volatile matter is removed.Come the purifying crude product so that pure products to be provided by anti-phase preparation HPLC.This product is dissolved in CH again ₂Cl ₂(3mL), and add 4 N HCl in the two  alkane (30 μ L).With the solvent evaporate to dryness, obtain 3-(amino methyl)-6-benzyl-4-(2,4 dichloro benzene the base)-2-methyl-5 of white solid, the 6-pyrrolin is [3,4-b] pyridin-7-one (embodiment 5) also, HCl salt (57mg, 2 steps, 60%). ¹H NMR (400 MHz, CD ₃OD) δ 2.83 (s, 3H), 3.98 and 4.19 (AB _q, J=14.5Hz, 2H), 4.03 and 4.12 (AB _q, J=18.5Hz, 2H), 4.75 and 4.81 (AB _q, J=14.7Hz, 2H), 7.24-7.34 (m, 5H), 7.37 (d, J=8.3Hz, 1H), 7.54 (dd, J=8.3,2.0Hz, 1H), 7.74 (d, J=2.0Hz, 1H).HPLC PhenomenexLUNA C-18 4.6 * 50mm, 0 to 100%B lasts 4 minutes, 1 minute hold-time, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA, R _t=3.27min, 99% uniformity index.LCMS: for C ₂₂H ₁₉Cl ₂N ₃O, calculated value: 411.09, experimental value: 411.95[M+H] ⁺HRMS: for C ₂₂H ₂₀Cl ₂N ₃O, calculated value: 412.0983, experimental value: 412.0998[M+H] ⁺

Embodiment 6

6-(4-methoxy-benzyl)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

Outside the benzylamine among the 4-methoxybenzylamine replacement step 5A, use above embodiment 5 described same procedure to prepare embodiment 6. ¹H NMR (400 MHz, CD ₃OD) δ 2.84 (s, 3H), 3.75 (s, 3H), 3.98 and 4.19 (AB _q, J=14.5Hz, 2H), 3.99 and 4.09 (AB _q, J=18.0Hz, 2H), 4.68 and 4.75 (AB _q, J=14.7Hz, 2H), 6.87 (d, J=8.8Hz, 2H), 7.21 (d, J=8.8Hz, 2H), 7.37 (d, J=8.3Hz, 1H), 7.56 (dd, J=8.3,1.8Hz, 1H), 7.76 (d, J=1.8Hz, 1H).Phenomenex LUNA C-18 4.6 * 50mm, 0 to 100%B lasts 4 minutes, 1 minute hold-time, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA, R _t=3.27min, 99% uniformity index.LCMS: for C ₂₃H ₂₁Cl ₂N ₃O ₂, calculated value: 441.10, experimental value: 442.17[M+H] ⁺HRMS: for C ₂₃H ₂₂Cl ₂N ₃O ₂, calculated value: 442.1089, experimental value: 442.1101[M+H] ⁺

Embodiment 7

(6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6H-pyrrolo-[3,4-b] pyridin-3-yl) methylamine

Embodiment 7A:6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid ethyl ester

(0.102g, (1.5mL, 1.5 M are in toluene, 1.0mmol) 0.223mmol) to add DIBAL-H solution in the solution of THF (10mL) to embodiment 5D.Under RT, mixture is stirred 1.5h, and with saturated NaHCO ₃The solution stopped reaction, it is molten that it is divided between water (5mL) and EtOAc (150mL).With organic phase drying (MgSO ₄) and concentrate in a vacuum.With resistates chromatography (SiO ₂EtOAc), obtain yellow foams shape required compound (55 mg; 63%). ¹H?NMR(400?MHz，CDCl ₃)δ0.91(t，J＝7.1Hz，3H)，2.62(s，3H)，4.01(q，J＝7.1Hz，2H)，5.23(s，2H)，6.64(d，J＝2.2Hz，1H)，7.01-7.30(m，8H)，7.44(d，J＝1.8Hz，1H)。[M+H] ⁺＝439.24。

Embodiment 7B:(6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6H-pyrrolo-[3,4-b] pyridin-3-yl) methyl alcohol

(55mg, (0.4mL, 1 M is in THF, 0.4mmol) 0.125mmol) to add LAH solution in the solution of THF (15mL) to embodiment 7A.Under RT, mixture is stirred 1.5h, and with saturated NaHCO ₃Solution (1.5mL) stopped reaction, afterwards with EtOAc (15mL) with its extraction.With organic phase drying (MgSO ₄) and in a vacuum it is concentrated.With resistates chromatography (SiO ₂EtOAc), obtain yellow solid shape required compound (32mg; 64%). ¹H NMR (400 MHz, CDCl ₃) δ 2.78 (s, 3H), 4.43 and 4.52 (AB _q, J=11.9Hz, 2H), 5.28 (s, 2H), 6.55 (d, J=2.2Hz, 1H), 7.06-7.38 (m, 2H), 7.20-7.38 (m, 6H), 7.53 (d, J=1.8Hz, 1H).[M+H] ⁺＝397.17。

Embodiment 7:(6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6H-pyrrolo-[3,4-b] pyridin-3-yl) methylamine .HCl salt

(32mg is 0.08mmol) in CH to embodiment 7B ₂Cl ₂(0.5mL) through stirring. mix add in the solution MsCl (12 μ L, 0.16mmol) and Et ₃N (32 μ L, 0.213mmol).At ambient temperature reactant is kept 0.5h and concentrated, obtain crude product,, obtain muriate intermediate (21mg) crude product flash chromatography (silica gel, EtOAc/ hexane=1: 1 is to 100%EtOAc).With the muriate of gained (21mg, 0.05mmol) with the mixture of 7 N ammonia in MeOH (4mL) in sealed tube in microwave reactor 100 ℃ of irradiation 5min down.After being cooled to envrionment temperature, in a vacuum volatile matter is removed.Come the purifying crude product by anti-phase preparation HPLC, obtain pure products.This product is dissolved in CH again ₂Cl ₂(1mL), and make an addition to 4 N HCl in the two  alkane (20 μ L).With the solvent evaporate to dryness, obtain (6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6H-pyrrolo-[3,4-b] pyridin-3-yl) methylamine (embodiment 3) .HCl salt (5.6mg, step, 15%) of yellow solid shape. ¹H NMR (400MHz, CD ₃OD) δ 2.78 (s, 3H), 4.05 and 4.27 (AB _q, J=13.9Hz, 2H), 5.54 (s, 2H), 7.30-7.38 (m, 5H), 7.53 (d, 8.3Hz, 1H), 7.58 (d, J=2.2Hz, 1H), 7.67 (dd, J=8.3,2.2Hz, 1H), 7.77 (d, J=2.2Hz, 1H), 7.85 (d, J=2.2Hz, 1H).HPLC Phenomenex LUNA C-18 4.6 * 50 mm, 0 to 100%B lasts 4 minutes, 1 minute hold-time, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA, R _t=2.75min, 99% uniformity index (homogeneityindex).LCMS: for C ₂₂H ₁₉Cl ₂N ₃, calculated value: 395.10, experimental value: 395.94[M+H] ⁺HRMS: for C ₂₂H ₂₀Cl ₂N ₃: calculated value: 396.1034, experimental value: 396.1022[M+H] ⁺

Embodiment 8

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-phenyl-5,6-pyrrolin be [3,4-b] pyridin-7-one .HCl salt also

Embodiment 8A:4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid ethyl ester (novel intermediate)

To embodiment 6D (100mg, 0.21mmol is to prepare with the similar mode of embodiment 5D)

Embodiment 6D

In CH ₃(0.232g is 0.42mmol) in H to add ceric ammonium nitrate in the solution of CN (3mL) ₂The aqueous solution among the O (1.5mL).Under 0 ℃, reaction mixture is stirred 20min, then dilute with EtOAc (30ml).With the saturated sodium sulfite aqueous solution (15mL) washing organic phase, dry (MgSO ₄), and concentrate in a vacuum, obtain thick resistates, with its chromatography (SiO ₂EtOAc to EtOAc/MeOH=95: 5), obtain solid state embodiment 8A (28mg, 38%). ¹H NMR (400MHz, CDCl ₃) δ 2.71 (s, 3H), 3.58 (s, 3H), 4.05 and 4.26 (AB _q, J=17.1Hz, 2H), 7.09 (d, J=8.3Hz, 1H), 7.25 (bs, 1H), 7.28 (d, J=2.2Hz, 1H), 7.39 (dd, J=8.3,2.2Hz, 1H), [M+H] ⁺=351.06.

Embodiment 8B:4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6-phenyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid methyl esters

To embodiment 8A (28mg, 0.079mmol) solution in methylene dichloride (1.5mL) add phenyl-boron dihydroxide (30mg, 0.25mmol), Cu (OAc) ₂(15.6mg, 0.08mmol), Et ₃N (33.2 μ L, O.238mmol), pyridine (25 μ L, 0.31mmol) and

Molecular sieve (50mg, predrying overnight) at 400 ℃.Bottle is sealed, and air is fed in the reaction mixture, under RT, it is stirred 1.5h.Remove volatile matter in a vacuum, and chromatography (SiO ₂1: 1 hexane: EtOAc to EtOAc) resistates obtains solid state embodiment 8B (24mg, 70%). ¹H NMR (400MHz, CDCl ₃) δ 2.74 (s, 3H), 3.60 (s, 3H), 4.45 and 4.64 (AB _q, J=17.0Hz, 2H), 7.14 (d, J=8.3Hz, 2H), 7.30-7.38 (m, 3H), 7.52 (d, J=2.2Hz, 1H), 7.76 (dd, J=8.3,2.2Hz, 2H).[M+H] ⁺＝427.08。

Embodiment 8C:4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-6-phenyl-5,6-pyrrolin be [3,4-b] pyridin-7-one also

(O.056mmol) 24mg adds LiBH in stirred solution in THF (1.5mL) to embodiment 8B ₄(O.03mL, the solution of 2 M in THF, 0.06mmol) and MeOH (15 μ L).After at room temperature stirring 15min, by adding saturated NaHCO ₃Solution (1mL) comes stopped reaction.Reaction mixture is diluted with EtOAc (10mL), with H ₂O washing and concentrated.By by Et ₂O grinds the purifying crude reaction product, obtains white solid embodiment 8C (17mg, 77%). ¹HNMR (400MHz, CDCl ₃) δ 2.84 (s, 3H), 4.39 and 4.46 (AB _q, J=16.7Hz, 2H), 4.40 (dd, J=11.8,6.6Hz, 1H), 4.57 (dd, J=11.8,4.8Hz, 1H), 7.11 (t, J=7.5Hz, 1H), 7.24 (d, J=8.3Hz, 1H), 7.32 (dd, J=8.3,7.5Hz, 2H), 7.38 (dd, J=8.3,2.2Hz, 1H), 7.55 (d, J=2.2H, 1H), 7.74 (d, J=7.5Hz, 2H), [M+H] ⁺=399.06.

Embodiment 8:3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-phenyl-5,6-pyrrolin be [3,4-b] pyridin-7-one .HCl salt also

(17mg is 0.043mmol) in CH to embodiment 8C ₂Cl ₂(1mL) in stirred solution, add MsCl (21 μ L, 0.26mmol) and Et ₃N (60 μ L, 0.32mmol).Make reaction keep 4h at ambient temperature, and concentrate, obtain crude product, it is washed with EtOAc (10mL) dilution and with the 0.1N HCl aqueous solution (2mL).With organic phase drying (MgSO ₄), and concentrate in a vacuum, obtain the muriate intermediate.Mixture in MeOH (3mL) shines 15min under 100 ℃ in microwave reactor in sealed tube with gained muriate and 7 N ammonia.After being cooled to envrionment temperature, in a vacuum volatile matter is removed.Come the purifying crude product so that pure products to be provided by anti-phase preparation HPLC.This product is dissolved in CH again ₂Cl ₂(2mL), and add 4 N HCl in the two  alkane (10 μ L).With the solvent evaporate to dryness, obtain 3-(amino methyl)-4-(2,4 dichloro benzene the base)-2-methyl-6-phenyl-5 of white solid, the 6-pyrrolin is [3,4-b] pyridin-7-one (embodiment 8) .HCl salt (5.1 mg, 2 steps, 28%) also. ¹H NMR (400 MHz, CD ₃OD) δ 2.87 (s, 3H), 4.04 and 4.24 (AB _q, J=14.5Hz, 2H), 4.63 and 4.78 (AB _q, J=17.0Hz, 2H), 7.22 (t, J=7.5Hz, 1H), 7.42 (dd, J=8.4,7.5Hz, 2H), 7.51 (d, J=8.4Hz, 1H), 7.63 (dd, J=8.3,2.2Hz, 1H), 7.81-7.85 (m, 3H).HPLCPhenomenex LUNA C-18 4.6 * 50mm, 0 to 100%B lasts 4 minutes, 1 minute hold-time, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA, R _t=3.30min, 99% uniformity index.LCMS: for C ₂₁H ₁₇Cl ₂N ₃O, calculated value: 397.08, experimental value: 398.06[M+H] ⁺HRMS: for C ₂₁H ₁₈Cl ₂N ₃O ₂, calculated value: 398.0827, experimental value: 398.0826[M+H] ⁺

Embodiment 9

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-p-methoxy-phenyl)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

Outside the phenyl-boron dihydroxide among the 2-anisole ylboronic acid replacement step 8B, use above embodiment 8 described same procedure to prepare embodiment 9. ¹H NMR (400 MHz, CD ₃OD) δ 2.89 (s, 3H), 3.80 (s, 3H), 4.04 and 4.26 (AB _q, J=14.5Hz, 2H), 4.51 and 4.61 (AB _q, J=18.0Hz, 2H), 7.00-7.17 (m, 2H), 7.35-7.43 (m, 2H), 7.50 (d, J=8.3Hz, 1H), 7.59 (dd, J=8.3,2.2Hz, 1H), 7.79 (d, J=2.2Hz, 1H).LCMS: for C ₂₂H ₁₉Cl ₂N ₃O ₂, calculated value: 427.09, experimental value: 427.94[M+H] ⁺HRMS: for C ₂₂H ₁₉Cl ₂N ₃O ₂, calculated value: 428.0933, experimental value: 428.0946[M+H] ⁺

At Chiralcel ^OJ, 20 μ use on 5 * 50cm tubing string to contain 15%EtOH-MeOH (50%) heptane of (containing 0.1% diethylamine) degree gradient separations embodiment 9 such as (containing 0.1% diethylamine), obtain each enantiomer.

Embodiment 9-1 (enantiomer A; Move very fast): [α] _D ²⁵-15.8 ° (c=0.2, MeOH); Chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm; Contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity: 88%ee.

Embodiment 9-2 (enantiomer B; Move very fast): [α] _D ²⁵+ 17.9 ° (c=0.2, MeOH); Chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm; Contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity of gained: 93%ee.

Embodiment 10

(6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) methylamine .HCl salt

Embodiment 10A:(6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) methyl alcohol

Under 0 ℃, (0.360g, (5mL, 1 M is in THF, 5mmol) 0.79mmol) to add LAH solution in the solution of THF (3.5mL) to embodiment 5D.Mixture is warmed to RT and stirs 1.5h under RT, between water (5mL) and EtOAc (150mL), divide it molten afterwards.With organic phase drying (MgSO ₄) and concentrate in a vacuum.With resistates chromatography (SiO ₂, the continuous gradient from 100% hexane to 100%EtOAc lasts 3min, and 100%EtOAc lasts 5min), obtain solid state embodiment 10A (0.151g; 48%). ¹H NMR (400MHz, CDCl ₃) δ 2.78 (s, 3H), 4.20-4.60 (m, 6H), 4.71 and 4.84 (AB _q, J=15.8Hz, 2H), 7.19 (d, J=7.9Hz, 1H), 7.47-7.53 (m, 6H), 7.78 (d, J=1.8Hz, 1H).[M+H] ⁺＝398.88。

Embodiment 10:(6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) methylamine .HCl salt

(50mg is 0.13mmol) in CH to embodiment 10A ₂Cl ₂(1.5mL) in stirred solution, add MsCl (28 μ L, 0.36mmol) and Et ₃N (53 μ L, 0.39mmol).Reactant is kept 2.5h and concentrated at ambient temperature, obtain crude product, crude product flash chromatography (silica gel, 100%EtOAc to EtOAc/MeOH=95: 5) obtain the muriate intermediate.Mixture in MeOH (3mL) shines 15min under 100 ℃ in microwave reactor in sealed tube with gained muriate and 7 N ammonia.After being cooled to room temperature, remove volatile matter in a vacuum.Come the purifying crude product so that pure products to be provided by anti-phase preparation HPLC.This product is dissolved in CH again ₂Cl ₂(3mL), and add 4 N HCl in the two  alkane (40 μ L).With the solvent evaporate to dryness, obtain (6-benzyl-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) methylamine (embodiment 10) .HCl salt (21.1mg, 2 steps, 35%) of white solid. ¹H NMR (400MHz, CD ₃OD) δ 2.75 (s, 3H), 3.89 and 4.15 (AB _q, J=14.5Hz, 2H), 4.43 and 4.56 (AB _q, J=14.5Hz, 2H), 4.63 (s, 2H), 4.75 (s, 2H), 7.43 (d, J=8.3Hz, 1H), 7.47-7.53 (m, 3H), 7.54-7.58 (m, 2H), 7.69 (dd, J=8.3,2.2Hz, 1H), 7.78 (d, J=2.2Hz, 1H).HPLC Phenomenex LUNA C-18 4.6 * 50mm, 0 to 100%B lasts 4 minutes, 1 minute hold-time, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA, R _t=2.10min, 99% uniformity index.LCMS: for C ₂₂H ₂₁Cl ₂N ₃, calculated value: 397.11, experimental value: 398.09[M+H] ⁺HRMS: for C ₂₂H ₂₂Cl ₂N ₃, calculated value: 398.1191, experimental value: 398.1175[M+H] ⁺

Embodiment 11

Embodiment 11A:(6-(4-methoxy-benzyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester (novel intermediate)

(2.41g 5.47mmol) adds saturated NaHCO in the mixture in THF (50mL) to embodiment 6 ₃The aqueous solution (15mL), H ₂O (5mL) and Boc ₂O (1.79g, 8.20mmol).Under RT, the stirring of gained mixture is spent the night, with EtOAc (100mL) dilution and the other 5min that stirs.With the organic layer separation and in a vacuum with its evaporation, obtain crude product, its recrystallize in the EtOAc/ hexane is obtained the embodiment 11A (2.33g, 79%) of white solid.

Embodiment 11B:(4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

(1.99g is 3.68mmol) in CH to embodiment 11A ₃Add in the mixture among the CN (80mL) ceric ammonium nitrate (5.76g, 10.51mmol).Under RT, the gained mixture is stirred 6h and then is positioned in the refrigerator it overnight.With solid filtering and with H ₂O (20mL) washing.Solid further is scattered among the EtOAc (80mL), ultrasonication, and filter, obtain the required product of light brown solid state (embodiment 11B).Filtrate is concentrated, handle, and filtration obtains second part of embodiment 11B (amounting to 1.44g, 93%) with EtOAc (30mL).

Embodiment 11C:(6-(4-chloro-phenyl-)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

Under 75 ℃ with embodiment 11B (29.8mg, 0.071mmol), the 4-chlorophenylboronic acid (45mg, 0.288mmol), Cu (OAc) ₂(24mg, 0.132mmol), Et ₃N (45 μ L, 0.324mmol), pyridine (60 μ L, 0.743mmol) and the mixture heating up 1.5h of ethylene dichloride (1mL).Vacuum concentration, flash chromatography (50% to 100%EtOAc/ hexane) obtains embodiment 11 C afterwards, by recrystallize in MeOH it is further purified and obtains 23mg (61%) solid.

Embodiment 11:3-(amino methyl)-6-(4-chloro-phenyl-)-4-(2,4 dichloro benzene base)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

(20mg is 0.038mmol) in CH to embodiment 11C ₂Cl ₂Add TFA (0.8mL) in the solution (1.2mL) and the gained mixture is stirred 3h.With the reaction mixture evaporate to dryness, be dissolved in CH again ₂Cl ₂(1mL), and add 4 N HCl/, two  alkane (40 μ L).With solvent evaporation and use the ether grinding residues, obtain embodiment 11 (10.0mg, 57%). ¹H NMR (400 MHz, CD ₃OD) δ 2.78 (s, 3H), 3.96 and 4.17 (AB _q, J=14.5Hz, 2H), 4.55 and 4.69 (AB _q, J=17.1 Hz, 2H), 7.30-7.35 (m, 2H), 7.40-7.45 (m, 1H), 7.55 (dd, J=8.3,1.8Hz, 1H), 7.74 (d, J=1.8Hz, 1H), 7.76-7.81 (m, 2H).LCMS: for C ₂₁H ₁₆Cl ₃N ₃O, calculated value: 431.04, experimental value: 431.98[M+H] ⁺HRMS: for C ₂₁H ₁₇Cl ₂N ₃O, calculated value: 432.0437, experimental value: 432.0435[M+H] ⁺

Embodiment 12

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5,6-pyrrolin be [3,4-6] pyridin-7-one .HCl salt also

(8.9mg is 0.021mmol) in CH to embodiment 11B ₂Cl ₂Add TFA (0.5mL) in the mixture (1mL) and under RT, the gained mixture is stirred 3h.Evaporation reaction mixture is dissolved in CH again with resistates in a vacuum ₂Cl ₂(1mL), and add 4 N HCl/, two  alkane (40 μ L).The solvent evaporate to dryness is obtained the embodiment 12 (7.24mg, 96%) of white solid. ¹H NMR (400MHz, CD ₃OD) δ 2.76 (s, 3H), 3.92 and 4.14 (AB _q, J=14.0Hz, 2H), 4.00 and 4.13 (AB _q, J=18.8Hz, 2H), 7.38 (d, J=8.3Hz, 1H), 7.51 (dd, J=8.3,2.2Hz, 1H), 7.70 (d, J=1.6Hz, 1H).LCMS: for C ₁₅H ₁₃Cl ₂N ₃O, calculated value: 321.04, experimental value: 322.02[M+H] ⁺HRMS: for C ₁₅H ₁₄Cl ₂N ₃O, calculated value: 322.0514, experimental value: 322.0524[M+H] ⁺

Embodiment 13:

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-p-methylphenyl-5,6-pyrrolin be [3,4-b] pyridin-7-one .HCl salt also

Outside the 4-chlorophenylboronic acid among the 4-aminomethyl phenyl boric acid replacement step 11C, use above embodiment 11 described same procedure to prepare embodiment 13. ¹HNMR (400MHz, CD ₃OD) δ 2.24 (s, 3H), 2.81 (s, 3H), 3.96 and 4.20 (AB _q, J=14.5Hz, 2H), 4.53 and 4.68 (AB _q, J=17.6Hz, 2H), 7.13-7.18 (m, 2H), 7.47-7.50 (m, 1H), 7.55 (dd, J=7.9,1.8Hz, 1H), 7.58-7.63 (m, 2H), 7.73 (d, J=1.8Hz, 1H).LCMS: for C ₂₂H ₁₉Cl ₂N ₃O, calculated value: 411.09, experimental value: 412.04[M+H] ⁺HRMS: for C ₂₂H ₂₀Cl ₂N ₃O, calculated value: 412.0983, experimental value: 412.0993[M+H] ⁺

Embodiment 14

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(4-p-methoxy-phenyl)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

Outside the 4-chlorophenylboronic acid among the 4-anisole ylboronic acid replacement step 11C, use above embodiment 11 described same procedure to prepare embodiment 14. ¹H NMR (400 MHz, CD ₃OD) δ 2.86 (s, 3H), 3.79 (s, 3H), 4.03 and 4.25 (AB _q, J=14.5Hz, 2H), 4.58 and 4.74 (AB _q, J=17.6Hz, 2H), 6.90-7.00 (m, 2H), 7.51 (d, J=8.3Hz, 1H), 7.63 (dd, J=8.3,2.2Hz, 1H), 7.68-7.71 (m, 2H), 7.81 (d, J=2.2Hz, 1H).LCMS: for C ₂₁H ₁₆Cl ₃N ₃O, calculated value: 427.09, experimental value: 428.05[M+H] ⁺HRMS: for C ₂₁H ₁₇Cl ₃N ₃O, calculated value: 428.0933, experimental value: 428.0941[M+H] ⁺

Embodiment 15

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(4-fluorophenyl)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

Outside the 4-chlorophenylboronic acid of 4-fluorophenyl boric acid replacement in step 11C, use above embodiment 11 described same procedure to prepare embodiment 15. ¹H NMR (400 MHz, CD ₃OD) δ 2.89 (s, 3H), 4.05 and 4.27 (AB _q, J=14.3Hz, 2H), 4.64 and 4.80 (AB _q, J=17.6Hz, 2H), 7.12-7.18 (m, 2H), 7.54 (d, J=8.3Hz, 1H), 7.63 (dd, J=8.3,2.2Hz, 1H), 7.82 (d, J=1.6Hz, 1H), 7.83-7.87 (m, 2H).LCMS: for C ₂₁H ₁₆Cl ₂N ₃OF, calculated value: 415.07, experimental value: 416.02[M+H] ⁺HRMS: for C ₂₁H ₁₇Cl ₂N ₃OF, calculated value: 416.0733, experimental value: 416.0743[M+H] ⁺

Embodiment 16

4-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) cyanobenzene .HCl salt

Outside the 4-chlorophenylboronic acid of 4-cyano-phenyl boric acid replacement in step 11C, use above embodiment 11 described same procedure to prepare embodiment 16. ¹H NMR (400 MHz, CD ₃OD) δ 2.87 (s, 3H), 4.04 and 4.24 (AB _q, J=14.2Hz, 2H), 4.69 and 4.82 (AB _q, J=17.1Hz, 2H), 7.50 (d, J=8.3Hz, 1H), 7.64 (dd, J=8.3,2.2Hz, 1H), 7.74-7.78 (m, 2H), 7.84 (d, J=2.2Hz, 1H), 8.10-8.15 (m, 2H).LCMS: for C ₂₂H ₁₆Cl ₂N ₄O, calculated value: 422.07, experimental value: 422.93[M+H] ⁺HRMS: for C ₂₂H ₁₇Cl ₂N ₄O, calculated value: 423.0779, experimental value: 423.0790[M+H] ⁺

Embodiment 17

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-o-tolyl-5,6-pyrrolin be [3,4-b] pyridin-7-one .HCl salt also

Outside the phenyl-boron dihydroxide of 2-aminomethyl phenyl boric acid replacement in step 8B, use above embodiment 8 described same procedure to prepare embodiment 17. ¹H NMR (400 MHz, CD ₃OD) δ 2.20 (s, 3H), 2.88 (s, 3H), 4.04 and 4.25 (AB _q, J=14.2Hz, 2H), 4.50 and 4.65 (AB _q, J=18.0Hz, 2H), 7.25-7.40 (m, 4H), 7.51 (d, J=8.3Hz, 1H), 7.60 (dd, J=8.3,2.2Hz, 1H), 7.79 (d, J=2.2Hz, 1H), 8.10-8.15 (m, 2H).LCMS: for C ₂₂H ₁₉Cl ₂N ₃O, the analytical calculation value: 411.09, experimental value: 412.04[M+H] ⁺HRMS: for C ₂₂H ₂₀Cl ₂N ₃O, calculated value: 412.0983, experimental value: 412.0982[M+H] ⁺

Embodiment 18

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(methylthio group) phenyl)-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

Outside the phenyl-boron dihydroxide of 2-methylthio phenyl ylboronic acid replacement in step 8B, use above embodiment 8 described same procedure to prepare embodiment 18. ¹H NMR (400 MHz, CD ₃OD) δ 2.43 (s, 3H), 2.88 (s, 3H), 4.03 and 4.25 (AB _q, J=14.5Hz, 2H), 4.52 and 4.58 (AB _q, J=17.6Hz, 2H), 7.24-7.35 (m, 2H), 7.42-7.46 (m, 2H), 7.48 (d, J=8.3Hz, 1H), 7.60 (dd, J=8.3,2.2Hz, 1H), 7.79 (d, J=2.2Hz, 1H).LCMS: for C ₂₂H ₁₉Cl ₂N ₃OS, calculated value: 443.06, experimental value: 444.01[M+H] ⁺HRMS: for C ₂₂H ₁₉Cl ₂N ₃OS, calculated value: 444.0704, experimental value: 444.0695[M+H] ⁺

Embodiment 19

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(3-p-methoxy-phenyl)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one .HCl salt also

Outside the 4-chlorophenylboronic acid of 3-anisole ylboronic acid replacement in step 11C, use above embodiment 11 described same procedure to prepare embodiment 19. ¹H NMR (400MHz, CD ₃OD) δ 2.86 (s, 3H), 3.80 (s, 3H), 4.03 and 4.24 (AB _q, J=14.5Hz, 2H), 4.62 and 4.76 (AB _q, J=17.5Hz, 2H), 6.80 (dt, J=7.0,2.2Hz, 1H), 7.26-7.35 (m, 2H), 7.50 (d, J=8.3Hz, 1H), 7.56-7.60 (m, 1H), 7.63 (dd, J=8.3,2.2Hz, 1H), 7.82 (d, J=2.2Hz, 1H).LCMS: for C ₂₂H ₁₉Cl ₂N ₃O ₂, calculated value: 427.09, experimental value: 428.04[M+H] ⁺HRMS: for C ₂₂H ₂₀Cl ₂N ₃O ₂, calculated value: 428.0933, experimental value: 428.0935[M+H] ⁺

Embodiment 20

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-pyrrolin be [3,4-b] pyridine-5-ketone also, tfa salt

Divided by 7 N NH among the MeOH ₃Outside the 4-anisidine of replacement in step 2E, use above embodiment 2 described same procedure to prepare embodiment 20. ¹H NMR (400 MHz, CDCl ₃) δ 2.84 (s, 3H), 3.95 and 4.19 (AB _q, J=14.9Hz, 2H), 4.49 (s, 2H), 7.33 (d, J=8.4Hz, 1H), 7.48-7.55 (m, 1H), 7.66-7.72 (m, 1H).HRMS: for C ₁₅H ₁₄Cl ₂N ₃O, calculated value: 322.0514, experimental value: 322.0512.[M+H] ⁺＝322.03。

Embodiment 21

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-methoxy ethyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also, tfa salt

Outside the 4-anisidine of 2-methoxyethyl amine replacement in step 2E, use above embodiment 2 described same procedure to prepare embodiment 21. ¹H NMR (400MHz, CDCl ₃) δ 2.83 (s, 3H), 3.34 (s, 3H), 3.58-3.63 (m, 2H), 3.65-3.78 (m, 2H), 3.95 and 4.18 (AB _q, J=14.5Hz, 2H), 4.62 (s, 2H), 7.33 (d, J=8.4 Hz, 1H), 7.52 (dd, J=8.1,2.0Hz, 1H), 7.70 (d, J=2.2Hz, 1H).HRMS: for C ₁₈H ₂₀Cl ₂N ₃O ₂, calculated value: 380.0933, experimental value: 380.0941.[M+H] ⁺＝379.91。

Embodiment 22

3-(amino methyl)-4-(2,4 dichloro benzene base)-2,6-dimethyl-5,6-pyrrolin be [3,4-b] pyridin-7-one .HCl salt also

Embodiment 22A:4-(2,4 dichloro benzene base)-2,6-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid methyl esters

(50mg, (6.2mg 0.26mmol) and at room temperature stirs 15min with the gained mixture 0.14mmol) to add 95%NaH in the mixture in DMF (0.8mL) to embodiment 8A.Reaction mixture is stirred 5h also then with NH ₄Cl aqueous solution stopped reaction.Mixture with EtOAc (* 2) extraction, and is evaporated organic layer in a vacuum and obtains crude mixture, be purified, obtain 37mg (71%) colorless oil embodiment 22A by flash chromatography (50 to 100%EtOAc/ hexane).

Embodiment 22:3-(amino methyl)-4-(2,4 dichloro benzene base)-2,6-dimethyl-5,6-pyrrolin be [3,4-b] pyridin-7-one also, tfa salt

Use is converted into embodiment 8 employed orders with embodiment 8B and similarly in proper order embodiment 22A is converted into embodiment 22. ¹H NMR (400 MHz, CDCl ₃) δ 2.80 (s, 3H), 3.14 (s, 3H), 3,98 and 4.16 (AB _q, J=14.4Hz, 2H), 4.13 and 4.24 (AB _q, J=18.0Hz, 2H), 7.41 (d, J=8.3Hz, 1H), 7.56 (dd, J=8.3,2.2Hz, 1H), 7.75 (d, J=2.2Hz, 1H).LCMS: for C ₁₆H ₁₅Cl ₂N ₃O, the analytical calculation value: 335.06, experimental value: 336.06[M+H] ⁺HRMS: for C ₁₆H ₁₅Cl ₂N ₃O, the analytical calculation value: 336.0670, experimental value: 336.0684[M+H] ⁺

Embodiment 23

2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate, tfa salt

Embodiment 23A:2-(3-((tertbutyloxycarbonyl) methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate

(50mg, (2.8mg 0.11mmol) and at room temperature stirs 10min with the gained mixture, and then with ultrasonication 30 seconds 0.12mmol) to add 95%NaH in the mixture in DMF (1mL) to embodiment 11B.(0.025mL 0.26mmol) and at room temperature stirs the mixture that is produced and spends the night then to add methyl bromoacetate.With 2 1NHCl stopped reaction mixtures, and evaporating mixture in a vacuum.With EtOAc (10mL) processing resistates and with H ₂O (2mL) washing.Separate organic layer and in a vacuum with its evaporation, obtain crude mixture, (100%EtOAc to 10%MeOH/EtOAc) is purified by flash chromatography, obtains the embodiment 23A (21mg, 36%) of colorless oil. ¹H NMR (400MHz, CDCl ₃) δ 2.84 (s, 3H), 3.73 (s, 3H), 4.02 and 4.25 (AB _q, J=14.5Hz, 2H), 4.25 and 4.34 (AB _q, J=17.6Hz, 2H), 4.39 and 4.45 (AB _q, J=18.0Hz, 2H), 7.45 (d, J=8.3Hz, 1H), 7.57 (dd, J=8.3,2.2Hz, 1H), 7.79 (d, J=2.2Hz, 1H).LCMS: for C ₁₈H ₁₇Cl ₂N ₃O ₃, the analytical calculation value: 393.06, experimental value: 394.06[M+H] ⁺

Embodiment 23:2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate, tfa salt

(21mg is 0.042mmol) in CH to embodiment 23A ₂Cl ₂Add TFA (0.3mL) in the solution (0.7mL) and the mixture that is produced is stirred 2h.Solvent is removed, and, obtained the embodiment 23 of white powder, tfa salt (16.8mg, 71%) by preparation property HPLC (30 to 100%B for Phenomenex, 10min gradient) purifying resistates. ¹H?NMR(400MHz，CDCl ₃)δ。HRMS: for C ₁₈H ₁₈Cl ₂N ₃O ₃, calculated value: 394.0725, experimental value: 394.0728[M+H] ⁺[M+H] ⁺=394.06.

Embodiment 24

3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) cyanobenzene .HCl salt

Except replace the 4-chlorophenylboronic acid in step 11C with 3-cyano-phenyl boric acid, use above embodiment 11 described same procedure to prepare embodiment 24. ¹H NMR (400 MHz, CD ₃OD) δ 2.88 (s, 3H), 4.04 and 4.26 (AB _q, J=14.5Hz, 2H), 4.70 and 4.84 (AB _q, J=17.1Hz, 2H), 7.53 (d, J=8.3Hz, 1H), 7.54-7.62 (m, 2H), 7.64 (dd, J=8.3,2.2Hz, 1H), 7.82 (d, J=2.2 Hz, 1H), 8.12 (dt, J=8.8,1.8Hz, 1H), 8.38-8.42 (m, 1H).LCMS: for C ₂₂H ₁₆Cl ₂N ₄O, the analytical calculation value: 422.07, experimental value: 423.04[M+H] ⁺HRMS: for C ₂₂H ₁₇Cl ₂N ₄O, analytical calculation value: TBD, experimental value: TBD[M+H] ⁺

Embodiment 25

2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) acetate, tfa salt

(50mg, (14mg is in 0.8mL H 0.10mmol) to add the LiOH aqueous solution in the solution of THF (1mL) to embodiment 23A ₂Among the O, 0.33mmol), and with the mixture stirring 2h that is produced.With the 1 NHCl aqueous solution mixture is acidified to pH=4.In a vacuum organic volatile is removed, and with EtOAc (5ml) aqueous phase extracted.Concentrate organic extract in a vacuum and obtain carboxylic acid.

To this carboxylic acid in CH ₂Cl ₂Add TFA (0.35mL) in the mixture (1mL), and the mixture that is produced is stirred 2h.Solvent is removed, and, obtained the embodiment 25 of white powder, tfa salt (9.1mg, 18%) by preparation property HPLC (15 to 100%B for Phenomenex, 10min gradient) purifying resistates. ¹H NMR (400 MHz, CD ₃OD) δ 2.84 (s, 3H), 4.00 and 4.22 (AB _q, J=14.5 Hz, 2H), 4.26 and 4.34 (AB _q, J=18.0Hz, 2H), 4.36 and 4.42 (AB _q, J=18.1Hz, 2H), 7.44 (d, J=8.3Hz, 1H), 7.60 (dd, J=8.3,2.2Hz, 1H), 7.80 (d, J=2.2Hz, 1H).LCMS: for C ₁₇H ₁₅Cl ₂N ₃O ₃, the analytical calculation value: 379.05, experimental value: 380.00[M+H] ⁺HRMS: for C ₁₇H ₁₆Cl ₂N ₃O ₃, analytical calculation value: TBD, experimental value: TBD[M+H] ⁺

Embodiment 26

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-hydroxyethyl)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one also, tfa salt

(172mg 0.15mmol) adds 2 MLiBH in the solution of THF (3.5mL) to embodiment 22A ₄/ THF (0.2mL, 0.4mmol).At room temperature mixture is stirred 2h, then with saturated NaHCO ₃The aqueous solution (0.5mL) is ended.With EtOAc (8mL) extractive reaction mixture.Concentrate organic extract in a vacuum.Chromatography (SiO ₂EtOAc) resistates obtains the required pure product part A (96mg of colourless foam body shape; 42%).

(35mg is 0.075mmol) in CH to this pure product ₂Cl ₂Add TFA (0.5mL) in the mixture (1mL), and the mixture that is produced is stirred 2h.Remove and desolvate, and, obtain the embodiment 26 of white powder, tfa salt (9.0mg, 25%) by preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates. ¹H NMR (400MHz, CD ₃OD) δ 2.83 (s, 3H), 3.69-3.73 (m, 2H), 3.74-3.79 (m, 2H), 4.01 and 4.23 (AB _q, J=14.8Hz, 2H), 4.28 and 4.37 (AB _q, J=18.1Hz, 2H), 7.45 (d, J=8.3Hz, 1H), 7.59 (dd, J=8.3,2.2Hz, 1H), 7.80 (d, J=2.2Hz, 1H).LCMS: for C ₁₇H ₁₇Cl ₂N ₃O ₂, the analytical calculation value: 365.07, experimental value: 366.05[M+H] ⁺HRMS: for C ₁₇H ₁₈Cl ₂N ₃O ₂, analytical calculation value: TBD, experimental value: TBD[M+H] ⁺

Embodiment 27

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-hydroxyethyl)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one also, tfa salt

At ambient temperature with embodiment 26 part A compounds (420mg, 0.875mmol), Ag ₂O (0.75g, 3.25mmol), (0.55mL is 8.74mmol) in CH for methyl iodide ₃Mixture among the CN (10ml) stirred 5 days.Via the solids removed by filtration resistates.Filtrate is concentrated and chromatography (SiO ₂EtOAc), obtain required methyl ether (methyl ether) product (103mg, 24%) of colourless foam body shape.

(103mg is 0.21mmol) in CH to this methyl ether product ₂Cl ₂Add TFA (0.6mL) in the mixture (1.4mL), and the mixture that is produced is stirred 2h.Solvent is removed, and, obtained the embodiment 27 of white powder, tfa salt (17.3mg, 16%) by preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates. ¹H NMR (400MHz, CD ₃OD) δ 2.83 (s, 3H), 3.30 (s, 3H), 3.61 (t, J=5.3Hz, 2H), 3.78 (t, J=5.3Hz, 2H), 4.02 and 4.25 (AB _q, J=14.5Hz, 2H), 4.24 and 4.34 (AB _q, J=18.3Hz, 2H), 7.46 (d, J=8.3Hz, 1H), 7.58 (dd, J=8.3,2.2Hz, 1H), 7.77 (d, J=2.2Hz, 1H).LCMS: for C ₁₈H ₁₉Cl ₂N ₃O ₂, the analytical calculation value: 379.09, experimental value: 380.11[M+H] ⁺HRMS: for C ₁₈H ₂₀Cl ₂N ₃O ₂, the analytical calculation value: 380.0933, experimental value: 380.0938[M+H] ⁺

Embodiment 28

2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate, tfa salt

Embodiment 28A:

Divided by 2-(3-(chloromethyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) methyl acetate replacement 3-(chloromethyl)-4-(2, the 4-dichlorophenyl)-2,7-dimethyl-6-phenyl-6, the 7-pyrrolin also outside [3,4-b] pyridine-5-ketone, uses the described same procedure of above embodiment 1G to prepare embodiment 28A. ¹H NMR (400 MHz, CDCl ₃): δ 2.82 (s, 3H), 3.74 (s, 3H), 4.25 and 4.42 (AB _q, J=17.6Hz, 2H), 4.24 and 4.31 (AB _q, J=13.6Hz, 2H), 4.56 and 4.61 (AB _q, J=17.6Hz, 2H), 7.19 (d, J=8.4Hz, 1H), 7.40 (dd, J=8.4,2.2Hz, 1H), 7.55 (d, J=2.2Hz, 1H).LCMS：420.03[M+H] ⁺。

Embodiment 28

At room temperature with embodiment 28A (15mg, 0.036mmol), Ph ₃P (23mg, 2.5mmol), THF (1mL) and H ₂O (0.5mL) stirs 4 h.Reaction mixture is filtered, with the MeOH washing, evaporation, and by preparation property HPLC (Phenomenex LUNA 5 μ C18 (2) 21.2 * 100mm; The 8min gradient; 20 to 100%B; 20mL/min) purifying resistates obtains embodiment 28 tfa salts (1.94mg, 10%) of colorless oil. ¹H NMR (400MHz, CD ₃OD) δ 2.85 (s, 3H), 3.75 (s, 3H), 3.97 and 4.20 (AB _q, J=14.4Hz, 2H), 4.33 and 4.41 (AB _q, J=17.9Hz, 2H), 4.62 (s, 2H), 7.33 (d, J=8.3Hz, 1H), 7.52 (dd, J=8.3,2.0Hz, 1H), 7.69 (d, J=2.0Hz, 1H).LCMS：394.01[M+H] ⁺。HRMS: for C ₁₈H ₁₈Cl ₂N ₃O ₃, calculated value: 394.0725, experimental value: 394.0727[M+H] ⁺

Embodiment 29

3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(3-methoxy-propyl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also, tfa salt

Outside the 4-anisidine of 3 methoxypropyl amine replacement in step 2E, use above embodiment 2 described same procedure to prepare embodiment 29. ¹H NMR (400 MHz, CD ₃OD) δ 1.85-1.95 (m, 2H), 2.83 (s, 3H), 3.27 (s, 3H), 3.41 (t, J=5.9Hz, 2H), 3.63 (t, J=7.0Hz, 2H), 3.94 and 4.13 (AB _q, J=14.4Hz, 2H), 4.53 and 4.58 (AB _q, J=18.5Hz, 2H), 7.33 (d, J=7.9Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.69 (d, J=2.2Hz, 1H).LCMS：394.10[M+H] ⁺。HRMS: for C ₁₉H ₂₂Cl ₂N ₃O ₂, the analytical calculation value: 394.1089, experimental value: 394.1099[M+H] ⁺

Embodiment 30

3-(amino methyl)-4-((S)-2,4 dichloro benzene base)-6-((S)-1-methoxy propyl-2-yl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also, tfa salt [isomer A]

Outside (the S)-1-methoxy propyl-4-anisidine of 2-amine replacement in step 2E, use above embodiment 2 described same procedure to prepare embodiment 30.Separate non-enantiomer mixture by preparation property HPLC (10 to 100%B for Phenomenex, 10min gradient), obtain the embodiment 30 of white powder, tfa salt and embodiment 31, tfa salt.Specify three-dimensional chemical configuration (stereochemical assignment tentative) by experiment.

Embodiment 30: ¹H NMR (400MHz, CD ₃OD) δ 1.26 (d, J=7.0Hz, 3H), 2.83 (s, 3H), 3.32 (s, 3H), 3.49 (dd, J=10.1,4.4Hz, 1H), 3.59 (dd, J=12.1Hz, 7.9Hz, 1H), 3.95 and 4.18 (AB _q, J=14.5Hz, 2H), 4.52-4.54 (m, 1H), 4.50 and 4.55 (AB _q, J=18.9Hz, 2H), 7.32 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.4,1.8Hz, 1H), 7.70 (d, J=2.2Hz, 1H).LCMS：394.10[M+H] ⁺。HRMS: for C ₁₉H ₂₂Cl ₂N ₃O ₂, calculated value: 394.1089, experimental value: 394.1104[M+H] ⁺

Embodiment 31

3-(amino methyl)-4-((R)-2,4 dichloro benzene base)-6-((S)-1-methoxy propyl-2-yl)-2-methyl-6, the 7-pyrrolin is [3,4-b] pyridine-5-ketone also, tfa salt [isomer B]

¹H NMR (400MHz, CD ₃OD) δ 1.27 (d, J=7.0Hz, 3H), 2.83 (s, 3H), 3.31 (s, 3H), 3.49 (dd, J=10.1,4.4Hz, 1H), 3.59 (dd, J=10.1Hz, 7.9Hz, 1H), 3.94 and 4.18 (AB _q, J=14.5Hz, 2H), 4.46-4.55 (m, 1H), 4.48 and 4.57 (AB _q, J=18.5Hz, 2H), 7.33 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.70 (d, J=2.2Hz, 1H).LCMS:394.10[M+H] ⁺.HRMS: for C ₁₉H ₂₂Cl ₂N ₃O ₂, calculated value: 394.1089, experimental value: 394.1073[M+H] ⁺

Embodiment 32

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-carboxylic acid, ethyl ester, tfa salt

Embodiment 32A:(4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

Under RT with embodiment 20 (47mg, 0.096mmol), 1 M Boc ₂O/THF (0.18mL, 0.18mmol), NaHCO ₃(160mg 1.9mmol) stirs with the mixture of THF (5mL) and spends the night, and with EtOAc and water treatment, and it is transferred to separatory funnel.Water layer is extracted with EtOAc (* 2), with the salt water washing, dry (Na ₂SO ₄), filtering and evaporation obtains crude product 32A, it can be not purified and be used for next step.[M+H] ⁺＝422.15。

Embodiment 32B:3-((tert-butoxycarbonyl amino) methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-carboxylic acid, ethyl ester

To above crude product, embodiment 32A in CH ₂Cl ₂Add Et in the solution (5mL) ₃(0.1mL, 0.72mmol), (0.04mL's N 0.42mmol), and spends the night the mixture stirring under RT to add EtOCOCl afterwards.LC indication transformation efficiency is about 10%.Add DMAP (10mg), (0.1mL 1.05mmol), and spends the night the mixture stirring under RT to add EtOCOCl afterwards again.Evaporation and flash chromatography (40g silicon-dioxide, 0% to 100%EtOAc/ hexane), the embodiment 32B (2 steps, 39%) of generation 18.5mg colorless oil.[M+H] ⁺＝494.22。

Embodiment 32:3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-carboxylic acid, ethyl ester, tfa salt

(18mg is 0.046mmol) in CH to embodiment 32B ₂Cl ₂Dropwise add TFA (1mL) in the solution (1mL) and under RT, mixture is stirred 1h.With the mixture evaporation and by preparation property HPLC (Phenomenex LUNA 5 μ Cl8 (2) 21.2 * 100mm; The 8min gradient; 0% to 100%B; 20mL/min) purifying obtains 16.8mg (91%) white powder. ¹H NMR (400 MHz, CD ₃OD) δ 1.35 (t, J=7.3Hz, 3H), 2.86 (s, 3H), 3.97 and 4.19 (AB _qJ=14.5 Hz, 1H), 4.33 (q, J=7.0Hz, 2 H), 4.84-4.95 (m, 2H), 7.32 (d, J=7.9Hz, 1H), 7.54 (dd, J=8.4,2.2Hz, 1H), 7.72 (d, J=2.2Hz, 1H).HRMS: for C ₁₈H ₁₈Cl ₂N ₃O ₃, calculated value: 394.0725, experimental value: 394.0726[M+H] ⁺

Embodiment 33

(1R, 2S)-2-((S)-3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile, tfa salt and (1R, 2S)-2-((R)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile, tfa salt

Embodiment 33A:(1R, 2S)-2-((S)-4-(2, the 4-dichlorophenyl)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) cyclopentane formamide and (1R, 2S)-2-((R)-4-(2, the 4-dichlorophenyl)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) cyclopentane formamide

Follow similar order, be prepared as the embodiment 33A of non-enantiomer mixture with (±)-suitable-2-Aminocyclopentane methane amide from embodiment 2D (racemic modification) with embodiment 2G.[M+Na] ⁺＝456.2。

Embodiment 33B:(1R, 2S)-2-((R)-3-(chloromethyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile and (1R, 2S)-2-((S)-3-(chloromethyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ring valeronitrile

The mixture of embodiment 33A (0.22mmol) is carried out as the chlorination among the embodiment 2H, obtain muriatic diastereo-isomerism mixture (embodiment 33B), wherein primary amide is also dewatered and is formed nitrile.Diastereomer 1:[M+H] ⁺=434.12.Diastereomer 2:[M+H] ⁺=434.13.

Embodiment 33:(1R, 2S)-2-((S)-3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile, tfa salt and (1R, 2S)-2-((R)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile, tfa salt

Produce the diastereo-isomerism mixture (embodiment 33) of amine as the ammonolysis among the embodiment 33B. ¹HNMR (400 MHz, CD ₃OD) δ 1.66-1.84 (m, 1H), 1.97-2.27 (m, 5 H), 2.85 (s, 3H), 3.35-3.47 (m, J=6.6Hz, 1H), 3.94 and 4.21 (AB _q, J=14.5Hz, 1H), 4.64-4.78 (m, 4 H), 7.36 (d, J=8.4Hz, 1H), 7.54 (dd, J=8.4,1.8Hz, 1H), 7.71 (d, J=2.2Hz, 1H).HRMS: for C ₂₁H ₂₁Cl ₂N ₄O, calculated value: 415.1092, experimental value: 415.1085[M+H] ⁺

Embodiment 34

(1S, 2R)-2-((S)-3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile, tfa salt and (1S, 2R)-2-((R)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) ring valeronitrile, tfa salt

Come from the diastereomer 2 of embodiment 33B except that using, as above embodiment 33 preparation embodiment 34. ¹H NMR (400MHz, CD ₃OD) δ 1.66-1.80 (m, 1H), 1.99-2.26 (m, 5H), 2.84 (s, 3H), and 3.38-3.49 (m, J=6.6Hz, 1H), 3.98 and 4.17 (d, J=14.5Hz, 1H), 4.68 (d, J=18.0Hz, 1H), 4.75 (d, J=18.0Hz, 1H), 7.32 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.71 (d, J=1.8Hz, 1H).HRMS: for C ₂₁H ₂₁Cl ₂N ₄O, calculated value: 415.1092, experimental value: 415.1084[M+H] ⁺

Embodiment 35

(1R, 3S)-3-((S)-3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) cyclopentane carboxylic acid methyl, tfa salt and (1R, 3S)-3-((R)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) cyclopentane carboxylic acid methyl, tfa salt

Use the order similar order used with embodiment 2, by (1R, 3S)-3-Aminocyclopentane carboxylate methyl ester and racemize embodiment 2D be prepared as the embodiment 35 of non-enantiomer mixture. ¹H NMR (400MHz, CD ₃OD, racemic modification) δ 1.75-2.10 (m, 5H), 2.14-2.32 (m, 1H), 2.83 (s, 3H), 2.89-3.02 (m, 1H), 3.67/3.69 (s, 3H), 3.94 and 4.18 (AB _q, J=14.5Hz, 2H), 4.49-4.67 (m, 2H), 7.31 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.4,1.8Hz, 1H), 7.69 (d, J=2.2Hz, 1H).HRMS: for C ₂₂H ₂₄Cl ₂N ₃O ₃, calculated value: 448.1195, experimental value: 448.1203[M+H] ⁺

Embodiment 36

3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid, tfa salt

Embodiment 36A:6-(3-tert.-butoxy-3-ketone group propyl group)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid ethyl ester

With racemize embodiment 2D (308mg, 0.625mmol), 3-alanine tert-butyl ester hydrochloride (143mg, 0.79mmol), Et ₃(0.25mL, 1.8mmol) mixture with DMA (5mL) heats 30min to N under 100 ℃ in microwave reactor.Reaction mixture is diluted with EtOAc (30mL), with H ₂O (30mL * 2), salt solution (30mL) washing, dry (Na ₂SO ₄), filter and evaporation, obtain resistates, with this residue purified, obtain the embodiment 36A (226mg, 65%) of colorless oil by flash chromatography (40g silicon-dioxide, 0% to 100%EtOAc/ hexane).

Embodiment 36B:3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid tert-butyl ester

Follow and the similar order of embodiment 2 described orders, the thick embodiment 36A that is free alkali form certainly obtains embodiment 36B.

Embodiment 36:3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid, tfa salt

To thick embodiment 36B (0.17mmol) in CH ₂Cl ₂Dropwise add TFA (1mL) in the solution (5mL) and under RT, mixture is stirred 2h.With the mixture evaporation and by preparation property HPLC (Phenomenex LUNA 5 μ Cl8 (2) 21.2 * 100mm; The 8min gradient; 0% to 100%B; 20mL/min) purifying obtains the white powder of 60.5mg (last 2 steps, 70%). ¹H NMR (400MHz, CD ₃OD, racemic modification) δ 2.67 (t, J=6.8Hz, 2H), 2.83 (s, 3H), 3.73-3.85 (m, 2H), 3.94 and 4.18 (AB _q, J=14.5Hz, 2H), 4.62 (s, 2H), 7.32 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.1,2.0Hz, 1H), 7.70 (d, J=1.8Hz, 1H).HRMS: for C ₁₈H ₁₈Cl ₂N ₃O ₃, calculated value: 394.0725[M+H] ⁺, experimental value: 394.0735[M+H] ⁺

Embodiment 37

(S)-3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid, tfa salt

Embodiment 37A:(S)-and 6-(chloromethyl)-4-(2,4 dichloro benzene base)-2-picoline-3,5-dicarboxylic acid-3-benzyl ester 5-ethyl ester (novel intermediate)

Use supercritical flow chromatography (SFC) that embodiment 2D is separated into independent atropisomer.Condition: Whelk 0-1 SS, 500 * 20mm, 10 microns; 35 ℃; 5%IPA, 0.1%DEA is in SFC-CO ₂In; 100 crust; 60mL/min; 220nm.Move very fast isomer: embodiment 37A.[α] _d ²⁵+54.45°(c10.21mg/mL，CHCl ₃)。

Embodiment 37B:(R)-and 6-(chloromethyl)-4-(2,4 dichloro benzene base)-2-picoline-3,5-dicarboxylic acid-3-benzyl ester 5-ethyl ester (novel intermediate)

Available from the isolating isomer slowly that moves of above SFC.[α] _d ²⁵-52.87°(c?10.21mg/mL，CHCl ₃)。

Embodiment 37:(S)-3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid, tfa salt

Except that using embodiment 37A but not the racemize embodiment 2D, use embodiment 36 described orders to prepare embodiment 37.

Embodiment 38

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-methoxy ethyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Except that using embodiment 37A but not the racemize embodiment 2D, use embodiment 21 described orders to prepare embodiment 38.Chirality HPLC (Chiralpak AS 4.6 * 250mm contains the heptane (containing 0.1%DEA) of 5%EtOH-MeOH (1: 1)): Rt=14.3min,＞97%ee. ¹H NMR (400 MHz, CD ₃OD) δ 2.83 (s, 3H), 3.34 (s, 3H), 3.60 (t, J=5.3Hz, 2H), 3.65-3.80 (m, 2H), 3.95 and 4.18 (AB _q, J=14.5Hz, 2H), 4.62 (s, 2H), 7.33 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.1,2.0Hz, 1H), 7.69 (d, J=2.2Hz, 1H).HRMS: for C ₁₈H ₂₀Cl ₂N ₃O ₂, calculated value: 380.0933, experimental value: 380.0929[M+H] ⁺

Embodiment 39

(R)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-methoxy ethyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Except that using embodiment 37B but not the racemize embodiment 2D, use embodiment 21 described orders to prepare embodiment 39.Chirality HPLC (Chiralpak AS 4.6 * 250mm contains the heptane (containing 0.1%DEA) of 5%EtOH-MeOH (1: 1)): Rt=16.2min,＞97%ee. ¹H NMR (400MHz, CD ₃OD) δ 2.83 (s, 3H), 3.34 (s, 3H), 3.60 (t, J=5.1Hz, 2H), 3.65-3.80 (m, 2H), 3.95 and 4.19 (AB _q, J=14.5Hz, 2H), 4.62 (s, 2H), 7.33 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.69 (d, J=1.8Hz, 1H).HRMS: for C ₁₈H ₂₀Cl ₂N ₃O ₂, calculated value: 380.0933, experimental value: 380.0931[M+H] ⁺

Embodiment 40

N-(S)-1-(3-((S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionyl) tetramethyleneimine-3-yl) ethanamide, tfa salt

Embodiment 40A:(S)-3-(3-((tert.-butoxy carbonyl amino) methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid

To embodiment 37, and tfa salt (82mg, 0.16mmol), saturated NaHCO ₃Add Boc in the mixture of the aqueous solution (1mL) and THF (5mL) ₂(50mg's O 0.23mmol), and spends the night the mixture stirring that is produced under RT, dilutes with EtOAc (25mL) and 1 N HCl (25mL), and it is transferred to separatory funnel.With EtOAc (25mL * 2) aqueous layer extracted, with salt water washing organic layer, dry (Na ₂SO ₄), filter and evaporation, obtain the thick embodiment 40A of 93mg.[M+H] ⁺＝494.27。

Embodiment 40B:((S)-and 6-(3-((S)-3-kharophen tetramethyleneimine-1-yl)-3-ketone group propyl group)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

In the solution of THF (3mL), add PyBOP (54mg to thick embodiment 40A (about 0.05mmol), 0.104mmol), (0.05mL 0.287mmol), and spends the night the mixture stirring that is produced under RT to add (3S)-(-)-kharophen tetramethyleneimine and DIEA afterwards.Mixture is diluted with EtOAc, with 1 N HCl, salt water washing, dry (Na ₂SO ₄), filter, and evaporation obtains resistates, by preparation property HPLC (Phenomenex LUNA 5 μ Cl8 (2) 21.2 * 100mm; The 8min gradient; 40% to 100%B; 20mL/min) be purified, obtain 32mg (all being about 100%) water white oil for last 2 steps.

Embodiment 40:N-((S)-1-(3-((S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionyl) tetramethyleneimine-3-yl) ethanamide, tfa salt

(32mg is 0.053mmol) in CH to embodiment 40B ₂Cl ₂Dropwise add TFA (1mL) in the solution (3mL) and under RT, mixture stirred and spend the night.Evaporation is afterwards by preparation property HPLC (Phenomenex LUNA 5 μ C18 (2) 21.2 * 100mm; The 8min gradient; 0% to 100%B; 20mL/min) purifying obtains 19.1mg (58%) white powder. ¹H NMR (400MHz, CD ₃OD) rotational isomer, and δ 1.85 and 1.87 (two are unimodal, 3H), 1.90-2.23 (m, 1H), 2.63-2.75 (m, 2H), 3.34-3.46 (m, 1H), 3.5 1-3.62 (m, 1H), 3.65-3.82 (m, 1H), 3.85-3.98 (m, 2H), 4.17 and 4.1 8 (AB _qPart, J=14.5Hz, 1H), 4.25-4.36 (m, 1H), 4.56-4.72 (m, 1H), 7.319/7.322 (d, J=8.40Hz, 1H), 7.50-7.54 (m, 1H), 7.69-7.71 (m, 1H).HRMS: for C ₂₄H ₂₈Cl ₂N ₅O ₃, calculated value: 504.1569, experimental value: 504.1551[M+H] ⁺

Embodiment 41

(S)-3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N, N-diethyl propionic acid amide, tfa salt

Use with embodiment 40 described orders similar in proper order by embodiment 40A and Et ₂NH prepares embodiment 41. ¹H NMR (400MHz, CD ₃OD) δ 1.06 (t, J=7.0Hz, 3H), 1.14 (t, J=7.0Hz, 3H), 2.54-2.80 (m, 2H), 2.83 (s, 3H), 3.32-3.38 (m, 4H), 3.82 (t, J=6.8Hz, 2H), 3.94 and 4.18 (AB _q, J=14.5Hz, 2H), 4.60 and 4.65 (AB _q, J=18.9Hz, 2H), 7.32 (d, J=8.40Hz, 1H), 7.51 (dd, J=8.1,2.0Hz, 1H), 7.69 (d, J=1.8Hz, 1H).HRMS: for C ₂₂H ₂₇Cl ₂N ₄O ₂, calculated value: 449.1511, experimental value: 449.1506[M+H] ⁺

Embodiment 42

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-isopropoxy ethyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Use and the similar order of embodiment 38 described orders, prepare embodiment 42 by embodiment 36A and 2-isopropoxy ethamine. ¹H NMR (400 MHz, CD ₃OD) 1.11 (d, J=6.2Hz, 6H), 2.84 (s, 3H), 3.54-3.74 (m, 5H), 3.95 and 4.19 (AB _q, J=14.5Hz, 2H), 4.63 and 4.68 (AB _q, J=18.9Hz, 2H), 7.33 (d, J=7.90Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.69 (d, J=2.2 Hz, 1H).HRMS: for C ₂₀H ₂₄Cl ₂N ₃O ₂, calculated value: 408.1246, experimental value: 408.1237[M+H] ⁺

Embodiment 43

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(((R)-tetrahydrofuran (THF)-2-yl) methyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Use and the similar order of embodiment 38 described orders, reaching (R)-(tetrahydrofuran (THF)-2-yl) by embodiment 36A, methylamine prepares embodiment 43. ¹H NMR (400 MHz, CD ₃OD) δ 1.53-1.65 (m, 1H), 1.83-1.94 (m, 2H), 1.95-2.06 (m, 1H), 2.83 (s, 3H), 3.52 (dd, J=14.1hz, 7.9Hz, 1H), 3.66-3.76 (m, 2H), 3.82-3.90 (m, 1H), 3.95 and 4.18 (AB _q, J=14.5Hz, 2H), 4.06-4.15 (m, 1H), 4.60 and 4.71 (AB _q, J=18.9Hz, 2H), 7.33 (d, J=7.91Hz, 1H), 7.52 (dd, J=8.1,2.0Hz, 1H), 7.69 (d, J=1.8Hz, 1H).HRMS: for C ₂₀H ₂₂Cl ₂N ₃O ₂, calculated value: 406.1089, experimental value: 406.1085[M+H] ⁺.[α] _D ²⁵-15.08 ° (c1.9mg/mL, EtOH).

Embodiment 44

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(((S)-tetrahydrofuran (THF)-2-yl) methyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Use and the similar order of embodiment 38 described orders, reaching (S)-(tetrahydrofuran (THF)-2-yl) by embodiment 36A, methylamine prepares embodiment 44. ¹H NMR (400 MHz, CD ₃OD) δ 1.53-1.65 (m, 1H), 1.83-1.94 (m, 2H), 1.95-2.06 (m, 1H), 2.83 (s, 3H), 3.49 (dd, J=14.5Hz, 7.7 Hz, 1H), 3.66-3.76 (m, 2H), 3.82-3.90 (m, 1H), 3.95 and 4.19 (AB _q, J=14.5Hz, 2H), 4.06-4.15 (m, 1H), 4.63 and 4.71 (AB _q, J=18.9Hz, 2H), 7.34 (d, J=7.91Hz, 1H), 7.51 (dd, J=8.4,1.8Hz, 1H), 7.68 (d, J=2.2Hz, 1H).HRMS: for C ₂₀H ₂₂Cl ₂N ₃O ₂, calculated value: 406.1089, experimental value: 406.1092[M+H] ⁺.[α] _D ²⁵+ 10.27 ° (c2.2mg/mL, EtOH).

Embodiment 45

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(2,2, the 2-trifluoro ethoxy) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Use and the similar order of embodiment 38 described orders, prepare embodiment 45 by embodiment 36A and 2-(2,2, the 2-trifluoro ethoxy) ethamine. ¹H NMR (400MHz, CD ₃OD) δ 2.84 (s, 3H), 3.73-3.78 (m, 2H), 3.84 (t, J=3.84hz, 2H), 3.84 (t, J=5.1Hz, 2H), 3.91-4.00 (m, 2H), 4.19 (part of Abq, J=14.5Hz, 1H), 4.64 (s, 2H), 7.34 (d, J=8.4Hz, 1H), 7.51 (dd, J=8.4,2.2Hz, 1H), 7.68 (d, J=1.8Hz, 1H).HRMS: for C ₁₉H ₁₉Cl ₂F ₃N ₃O ₂, calculated value: 448.0806, experimental value: 448.0798[M+H] ⁺

Embodiment 46

(R)-2-((S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) propionic acid, tfa salt

Use and the similar order of embodiment 38 described orders, by embodiment 36A and (R)-the 2-alanine tert-butyl ester prepares embodiment 46, afterwards as described in example 40 above, the TFA-mediation cracking tert-butyl ester. ¹HNMR (400 MHz, CD ₃OD) possible rotational isomer; The data of main rotational isomer: δ 1.60 (d, J=7.5Hz, 3H), 2.85 (s, 3H), 3.95 and 4.21 (AB _q, J=14.5Hz, 2H), 4.56-4.68 (m, 2H), 4.90 (q, J=7.5Hz, 1H), 7.35 (d, J=8.4Hz, 1H), 7.51 (dd, J=8.4,2.2Hz, 1H), 7.68 (d, J=2.2Hz, 1H).[M+H] ⁺＝394.23。

Embodiment 47

(R)-2-((S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N, N-diethyl propionic acid amide, tfa salt

Use and similar 3 sequence of steps of embodiment 40 described orders, by embodiment 46 and Et ₂NH prepares embodiment 47. ¹H NMR (400MHz, CD ₃OD) possible rotational isomer; The data of main rotational isomer: δ 1.09 (t, J=7.3Hz, 3H), 1.20 (t, J=7.0Hz, 3H), 1.52 (d, J=7.0Hz, 3H), 2.84 (s, 3H), 3.18-3.28 (m, 4H), 3.93 and 4.20 (AB _q, J=14.5 Hz, 2H), 4.67 and 4.80 (AB _q, J=18.0Hz, 2H), 5.24 (q, J=7.0Hz, 1H), 7.33 (d, J=8.4Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.69 (d, J=2.2Hz, 1H).HRMS: for C ₂₂H ₂₇Cl ₂N ₄O ₂, calculated value: 449.1511, experimental value: 449.1524[M+H] ⁺

Embodiment 48

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-((1-methyl isophthalic acid H-pyrazole-3-yl) methyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Use and the similar order of embodiment 38 described orders, prepare embodiment 48 by embodiment 36A and (1-methyl isophthalic acid H-pyrazole-3-yl) methylamine. ¹H NMR (400 MHz, CD ₃OD) δ 2.82 (s, 3H), 3.34 (s, 2H), 3.85 (s, 3H), 3.95 and 4.19 (AB _q, J=14.1Hz, 2H), 4.66 and 4.72 (AB _q, J=15.2Hz, 2H), 6.18 (d, J=2.2Hz, 1H), 7.35 (d, J=8.4Hz, 1H), 7.48-7.57 (m, 1H), 7.70 (d, J=2.2Hz, 1H).HRMS: for C ₂₀H ₂₀Cl ₂N ₅O ₂, calculated value: 416.1045, experimental value: 416.1046[M+H] ⁺

Embodiment 49

(S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-((1-methyl isophthalic acid H-pyrazole-3-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Use and the similar order of embodiment 38 described orders, prepare embodiment 49 by embodiment 36A and 1-methyl isophthalic acid H-pyrazoles-3-amine. ¹H NMR (400 MHz, CD ₃OD) δ 2.86 (s, 3H), 3.86 (s, 3H), 3.97 and 4.20 (AB _q, J=14.5Hz, 2H), 4.98 (br s, 2H), 6.65 (d, J=2.2Hz, IH), 7.36 (d, J=8.4Hz, IH), 7.52 (d, J=2.6Hz, 1H), 7.55 (dd, J=8.4,2.2Hz, 1H), 7.73 (d, J=1.8Hz, 1H).HRMS: for C ₁₉H ₁₈Cl ₂N ₅O, calculated value: 402.0888, experimental value: 402.0891[M+H] ⁺

Embodiment 50

(S)-3-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N,N-dimethylacetamide, tfa salt

Program A:

Embodiment 50A:6-(2-tert.-butoxy-3-ketone group ethyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

With 6-(chloromethyl)-4-(2, the 4-dichlorophenyl)-2-picoline-3,5-dicarboxylic acid 3-benzyl ester 5-ethyl ester (10.59g, 21.43mmol), glycine tert-butyl hydrochloride (8.26g, 49.29mmol) and triethylamine (8.94mL, 64.29mmol) mixture heating up to 100 in N,N-dimethylacetamide (200mL) ℃ lasts 2h, and then be cooled to envrionment temperature.With the mixture branch that produced at EtOAc and H ₂Branch is molten between the O, and further with EtOAc (2X) aqueous layer extracted.Organic extract that will be through merging is with H ₂O and salt water washing, dry (Na ₂SO ₄), and vapourisation under reduced pressure.Obtain the embodiment 50A (9.34g, 77.2% productive rate) of glassy yellow solid state by flash chromatography (330g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates. ¹H NMR (500MHz, CDCl ₃) δ 1.44 (s, 9H), 2.74 (s, 3H), 4.13 and 4.29 (AB _q, J=17.6Hz, 2H), 4.56 (s, 2H), 5.05 and 5.07 (AB _q, J=11.8,2H), 7.00 (d, J=8.3Hz, 1H), 7.06-7.16 (m, 2H), 7.21-7.40 (m, 5 H).[M+H] ⁺＝541.2。

Embodiment 50B:6-(2-tert.-butoxy-3-ketone group ethyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

At ambient temperature in the presence of hydrogen (air bag) with embodiment 50A (9.33g, 17.23mmol) and 10% carbon carry the mixture of palladium (1.36g) in EtOAc (150mL) and stir 2h.Reaction mixture is filtered through Celite pad, and with MeOH and CH ₂Cl ₂Washing.With the filtrate vapourisation under reduced pressure, obtain the thick embodiment 50B (8.13g, 100% productive rate) of dark yellow solid state. ¹H NMR (400MHz, CD ₃OD) δ 1.45 (s, 9H), 2.75 (s, 3H), 4.23 and 4.28 (AB _q, J=18.0Hz, 2H), 4.63 and 4.58 (AB _q, J=18.0Hz, 2H), 7.27 (d, J=8.4Hz, 1H), 7.39 (dd, J=8.1,2.0Hz, 1H), 7.55 (d, J=2.2Hz, 1H).[M+H] ⁺＝451.2。

Embodiment 50C:2-(4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tert.-butyl acetate

At ambient temperature to embodiment 50B (1.18g, 2.5mmol) and the triphenylphosphine resin (5.07g is 7.5mmol) in CH ₂Cl ₂(80mL) in stirring the mixture, dropwise add Trichloroacetonitrile (0.75mL, 7.5mmol).At ambient temperature mixture is stirred 2.5h, and add in addition the triphenylphosphine resin (0.33g, 0.5mmol) with Trichloroacetonitrile (50 μ L, 0.5mmol).Behind the 30min, mixture is filtered, and in a vacuum filtrate is concentrated, obtain the 2-(3-(chloroformyl)-4-(2 of glassy yellow solid state, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) tert.-butyl acetate (1.12g), it can be directly used in subsequent reactions.

(0.93g 1.98mmol) dropwise adds three-tert.-butoxy lithium aluminum hydride in the solution of THF (30mL) to above chloride of acid during 5min under 0 ℃.Under 0 ℃, mixture is stirred 20min, with H ₂O (1.3mL) ends, and concentrates in a vacuum.Obtain white solid embodiment 50C (690.4mg, 2 steps, 80%) by flash chromatography (40g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates. ¹H NMR (500MHz, CD ₃OD) δ 1.45 (s, 9H), 2.84 (s, 3H), 4.20 and 4.26 (AB _q, J=17.6,2H), 4.32 and 4.58 (AB _q, J=12.1Hz, 2H), 4.56 (s, 2H), 7.32 (d, J=8.3Hz, 1H), 7.44 (d, J=8.3Hz, 1H), 7.59 (s, 1H).[M+H] ⁺＝437.2。

The isomer A of embodiment 50C and isomer B:(R)-(4-(2 for 2-, the 4-dichlorophenyl)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) tert.-butyl acetate and (S)-(4-(2 for 2-, the 4-dichlorophenyl)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tert.-butyl acetate

Isomer A isomer B

By supercritical flow chromatography (Chiralpak ^AD 250 * 4.6mm ID; 10 μ m; 35 ℃; Flow velocity: 2.0mL/min; Mobile phase: CO ₂/ IPA: 82/18; Volume injected: 5 μ L; The detector wavelength: 220nm) separate embodiment 50C (5.7g), obtain white solid isomer A (2.43g, RT=5.1min, 100%ee) with isomer B (2.55 g, RT=7.1min, 100%ee).

Embodiment 50D:(R)-2-(3-(chloromethyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tert.-butyl acetate

0 ℃ to embodiment 50C (isomer B, 763mg, 1.74mmol) and Et ₃(0.97mL is 6.98mmol) in CH for N ₂Cl ₂Dropwise add in the mixture (15mL) methylsulfonyl chloride (0.41mL, 5.24mmol).To keep through stirred mixture at ambient temperature overnight, and vapourisation under reduced pressure.With resistates at EtOAc and H ₂Branch is molten between the O, and further with EtOAc (2X) aqueous layer extracted.Organic extract that will be through merging is with the salt water washing, dry (Na ₂SO ₄), and in a vacuum it is concentrated.Crude product chromatography (40g tubing string, 0 to 100%EtOAc/ hexane) is obtained white solid embodiment 50D (785.7mg, 99%). ¹H NMR (500MHz, CDCl ₃) δ 1.45 (s, 9H), 2.86 (s, 3H), 4.14 and 4.29 (AB _q, J=17.6,2H), 4.31 (AB _qPart, J=7.1,1H), 4.52-4.60 (m, 3H), 7.27 (d, J=8.3,1H), 7.39 (dd, J=8.3,2.2 Hz, 1H), 7.54 (d, J=1.7,1H).[M+H] ⁺＝455.1。

Embodiment 50E:(S)-2-(3-((tert.-butoxy carbonyl amino) methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) acetate (novel intermediate)

Under 50 ℃ with 7 M NH among the MeOH (140mL) ₃In embodiment 50D (784mg, 1.72mmol) solution heating 50min, cooling and concentrated thick (S)-2-(3-(amino methyl)-4-(2 that obtains bright orange viscous solid shape, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tert.-butyl acetates (1.81g).

To in CH ₂Cl ₂Add TFA (5.0mL) in the above material (8.0mL), and at ambient temperature the mixture that is produced is stirred 3h, and vapourisation under reduced pressure.Make resistates and ethanol coevaporation for several times, obtain thick (S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) acetate of yellow solid shape.

Yellow solid is dissolved in THF (35mL) and saturated NaHCO ₃In the aqueous solution (20mL), add afterwards two-tertiary butyl, two carbonic ethers (1.28g, 5.85mmol).To keep 2.5h through stirring the mixture at ambient temperature, and follow with 1 N HCl pH regulator to 3.With EtOAc (2X) aqueous layer extracted.Organic extract that will be through merging is with the salt water washing, dry (Na ₂SO ₄), and vapourisation under reduced pressure obtains the thick embodiment 50E (1.375g) of glassy yellow solid state, it just can be used for next step without being further purified.[M+H] ⁺＝480.2。

Embodiment 50:(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N,N-dimethylacetamide, tfa salt

To embodiment 50E (100.9mg, 0.21mmol) in the solution of THF (5.0mL), add benzotriazole-1-base oxygen base tripyrrole Wan Ji Phosphonium hexafluorophosphate (163.9mg, 0.315mmol), N, the N-diisopropylethylamine (0.15mL, 0.84mmol) and 2 M NHMe ₂/ THF (0.157mL, 0.315mmol).At ambient temperature reaction mixture is stirred 2.5h and evaporation.With resistates at EtOAc and H ₂Branch is molten between the O, and further with EtOAc (2X) aqueous layer extracted.Organic extract that will be through merging is with H ₂O and salt water washing are with (Na ₂SO ₄) drying, and vapourisation under reduced pressure obtains (S)-(4-(2,4 dichloro benzene base)-6-(2-(dimethylamino)-2-ketone group ethyl)-2-methyl-5-ketone group-6 of bright orange solid state, 7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester (186.1mg).

Above crude product is dissolved in CH ₂Cl ₂(1.5mL), add TFA (0.8mL) afterwards.At ambient temperature reaction mixture is stirred 2.5h and concentrated in a vacuum.By preparation property HPLC (YMC S5ODS 30 * 100mm, the 12min gradient, 0 to 80% solvent B, 40mL/min) purifying resistates obtains the embodiment 50 of white powder, tfa salt (2 step productive rates are 70% for 78.9mg, 98.2%ee). ¹H NMR (500MHz, CD ₃OD) δ 2.83 (s, 3H), 2.94 (s, 3H), 3.07 (s, 3H), 3.95 and 4.19 (AB _q, J=14.3Hz, 2H), 4.39 and 4.51 (AB _q, J=17.0Hz, 2H), 7.33 (d, J=8.3Hz, 1H), 7.51 (d, J=8.3Hz, 1H), 7.69 (s, 1H).HRMS: for C ₁₉H ₂₁Cl ₂N ₄O ₂, calculated value: 407.1042, experimental value: 407.1046[M+H] ⁺

Program B:, can use embodiment 77 described programs to prepare embodiment 50 as selection.

Program C: also can be by Berger SFC at Chirapak ^AD-H, 5 μ, 30 * 250mm tubing string uses the 25%EtOH/75%CO that contains 0.1% diethylamine ₂Racemic modification such as gradient separations such as degree such as grade obtain each enantiomer, obtain embodiment 50.

Embodiment 50:(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N,N-dimethylacetamide, tfa salt

Embodiment 50 (enantiomer B; Move slower): analyze [Chiralpak by chiral analysis HPLC:Berger SFC ^AD 4.6 * 250 mm; The 25%EtOH/75%CO that contains 0.1%DEA ₂] purity of gained:＞99%ee.LCMS: for C ₁₉H ₂₀Cl ₂N ₄O ₂, the analytical calculation value: 406.08, experimental value: 407.55[M+H] ⁺

Use above embodiment 50 described program A, prepare following compound (embodiment 51 to 65):

Embodiment 51

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(4-morpholinyl piperidines-1-yl)-2-ketone group ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.53-1.69 (m, 1H), 1.71-1.83 (m, 1H), 2.10-2.31 (m, 2H), 2.71 (t, J=12.6Hz, 1H), 2.85 (s, 3H), 3.10-3.26 (m, 3H), 3.44-3.56 (m, 3H), 3.71-3.88 (m, 2H), 3.96 and 4.21 (AB _q, J=14.3Hz, 2H), 4.02-4.17 (m, 3H), 4.35-4.69 (m, 5H), 7.36 (d, J=8.3Hz, 1H), 7.51 (d, J=8.3Hz, 1H), 7.68 (s, 1H).HRMS: for C ₂₆H ₃₂Cl ₂N ₅O ₃, calculated value: 532.1882, experimental value: 532.1869[M+H] ⁺

Embodiment 52

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-morpholinyl-2-ketone group ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 2.75 (s, 3H), 3.45 (wide unimodal, 4 H), 3.57 (wide bimodal, dd, J=18.2,4.4Hz, 4 H), 3.86 and 4.11 (AB _q, J=14.6Hz, 2H), 4.33-4.42 (AB _q, J=16.8Hz, 2H), 4.50 (s, 2H), 7.24 (dd, J=8.2,3.3Hz, 1H), 7.42 (dd, J=8.2,2.2Hz, 1H), 7.59 (s, 1H).HRMS: for C ₂₁H ₂₃Cl ₂N ₄O ₃, calculated value: 449.1147, experimental value: 449.1135[M+H] ⁺

Embodiment 53

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-ketone group-2-(4-(2-(tetramethyleneimine-1-yl) ethyl) piperazine-1-yl) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 2.02 (wide unimodal, 4H), 2.75 (s, 3H), 2.78-3.58 (m, 12H), 3.69 (wide unimodal, 4H), 3.87 and 4.11 (AB _q, J=14.3Hz, 2H), 4.38 and 4.45 (AB _q, J=16.9Hz, 2H), 4.50 (s, 2H), 7.26 (d, J=8.3Hz, 1H), 7.42 (d, J=8.3Hz, 1H), 7.59 (s, 1H).HRMS: for C ₂₇H ₃₅Cl ₂N ₆O ₂, calculated value: 545.2199, experimental value: 545.2201[M+H] ⁺

Embodiment 54

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(4-(4-methylpiperazine-1-yl) piperidines-1-yl)-2-ketone group ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.42-1.58 (m, 1H), 1.59-1.72 (m, 1H), 1.90-2.11 (m, 2H), 2.62 (t, J=12.9Hz, 1H), 2.75 (s, 3H), 2.85 (s, 3H), 3.08 (t, J=12.9Hz, 1H), 3.23-3.57 (m, 9 H), 3.87 and 4.11 (AB _q, J=14.3Hz, 2H), 3.98 (d, J=14.3Hz, 1H), 4.27-4.58 (m, 5H), 7.26 (d, J=8.3Hz, 1H), 7.41 (d, J=8.3Hz, 1H), 7.59 (s, 1H).HRMS: for C ₂₇H ₃₅Cl ₂N ₆O ₂, calculated value: 545.2199, experimental value: 545.2199[M+H] ⁺

Embodiment 55

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-ethyl-N-N,N-DIMETHYLACETAMIDE, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.10 and 1.23 (t, J=7.15,3H, rotational isomer), 2.84 (s, 3H), 2.92 and 3.05 (s, 3H, rotational isomers), 3.35-3.49 (m, 2H), 3.96 and 4.20 (AB _q, J=14.6Hz, 2H), 4.34-4.64 (m, 4H), 7.34 (d, J=8.3Hz, 1H), 7.51 (dd, J=8.3,2.2Hz, 1H), 7.68 (d, J=1.7Hz, 1H).HRMS: for C ₂₀H ₂₃Cl ₂N ₄O ₂, calculated value: 421.1198, experimental value: 421.1200[M+H] ⁺

Embodiment 56

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-methyl-N-propyl acetamide, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 0.88 and 0.96 (t, J=7.3Hz, 3H, rotational isomer), 1.56 and 1.68 (q, J=7.2Hz, 2H, rotational isomers), 2.84 (s, 3H), 2.92 and 3.06 (s, 3H, rotational isomers), 3.26-3.41 (m, 2H), 3.96 and 4.20 (AB _q, J=14.3Hz, 2H), 4.33-4.61 (m, 4H), 7.34 (d, J=7.7Hz, 1H), 7.51 (d, J=8.3Hz, 1H), 7.68 (s, 1H).HRMS: for C ₂₁H ₂₅Cl ₂N ₄O ₂, calculated value: 435.1355, experimental value: 435.1368[M+H] ⁺

Embodiment 57

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N, N-diethyl acetamide, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.12 (t, J=7.2Hz, 3H), 1.24 (t, J=7.2Hz, 3H), 2.84 (s, 3H), 3.34-3.48 (m, 4 H), 3.96 and 4.20 (AB _q, J=14.3Hz, 2H), 4.40 and 4.52 (AB _q, J=16.7Hz, 2H), 4.61 (s, 2H), 7.34 (d, J=8.3Hz, 1H), 7.51 (d, J=8.3 Hz, 1H), 7.69 (s, 1H).HRMS: for C ₂₁H ₂₅Cl ₂N ₄O ₂, calculated value: 435.1355, experimental value: 435.1366[M+H] ⁺

Embodiment 58

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-ketone group-2-(tetramethyleneimine-1-yl) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.83-1.95 (m, 2H), 1.96-2.09 (m, 2H), 2.84 (s, 3H), 3.43 (t, J=6.9Hz, 2H), 3.52 (t, J=6.9Hz, 2H), 3.96 and 4.20 (AB _q, J=14.3Hz, 2H), 4.33 and 4.44 (AB _q, J=17.1Hz, 2H), 4.62 (s, 2H), 7.34 (d, J=8.3Hz, 1H), 7.51 (d, J=8.3Hz, 1H), 7.69 (s, 1H).HRMS: for C ₂₁H ₂₃Cl ₂N ₄O ₂, calculated value: 433.1198, experimental value: 433.1194[M+H] ⁺

Embodiment 59

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-ketone group-2-(piperidines-1-yl) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.55 (m, 2H), 1.65 (m, J=24.2,3.9Hz, 4H), 2.84 (s, 3H), 3.47 (t, J=5.3,2H), 3.52 (t, J=5.0,2H), 3.96 and 4.20 (AB _q, J=14.6Hz, 2H), 4.41 and 4.50 (AB _q, J=16.8Hz, 2H), 4.59 (s, 2H), 7.34 (dd, J=8.3,2.2Hz, 1H), 7.51 (dd, J=8.3,1.7Hz, 1H), 7.68 (s, 1H).HRMS: for C ₂₂H ₂₅Cl ₂N ₄O ₂, calculated value: 447.1355, experimental value: 447.1362[M+H] ⁺

Embodiment 60

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-sec.-propyl-N-methylacetamide, tfa salt

¹H NMR (400MHz, solvent) δ 1.11,1.13 and 1.24 (rotational isomer, d, J equal 3.5,3.5 and 6.6Hz respectively, amount to 6 H), 2.79 and 2.91 (s, 3H, rotational isomers), 2.84 (s, 3H), 3.96 and 4.20 (AB _q, J=14.50Hz, 2H), 4.13 and 4.73 (m, 1H, rotational isomers), 4.33 and 4.55 (m, 2H) .4.50 (s, 2H), 7.34 (d, J=7.91Hz, 1H), 7.52 (dd, J=8.4,2.2Hz, 1H), 7.69 (d, J=2.2Hz, 1H).HRMS: for C ₂₁H ₂₅Cl ₂N ₄O ₂, calculated value: 435.1355, experimental value: 435.1365[M+H] ⁺

Embodiment 61

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-sec.-propyl-N-(1,3-dimethyl-1H-pyrazoles-5-yl) ethanamide, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 2.19 (s, 3H), 2.85 (s, 3H), 3.67 (s, 3H), 3.97 and 4.21 (AB _q, J=14.6Hz, 2H), 4.41 and 4.52 (AB _q, J=17.0Hz, 2H), 4.67 (s, 2H), 6.14 (s, 1H), 7.35 (d, J=8.3Hz, 1H), 7.51 (d, J=8.3Hz, 1H), 7.69 (s, 1H).HRMS: for C ₂₂H ₂₃Cl ₂N ₆O ₂, calculated value: 473.1260, experimental value: 473.1269[M+H] ⁺

Embodiment 62

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-(1-ethyl-1H-pyrazoles-5-yl) ethanamide, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.34 (t, J=7.2Hz, 3H), 2.85 (s, 3H), 3.97 and 4.20 (AB _q, J=14.8Hz, 2H), 4.05 (q, J=7.2Hz, 2H), 4.43 and 4.53 (AB _q, J=17.1Hz, 2H), 4.68 (s, 2H), 6.24 (s, 1H), 7.34 (d, J=8.3Hz, 1H), 7.42 (s, 1H), 7.52 (d, J=8.3Hz, 1H), 7.70 (s, 1H).HRMS: for C ₂₂H ₂₃Cl ₂N ₆O ₂, calculated value: 473.1260, experimental value: 473.1276[M+H] ⁺

Embodiment 63

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-(1-methyl isophthalic acid H-pyrazoles-5-yl) ethanamide, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 2.85 (s, 3H), 3.72 (s, 3H), 3.96 and 4.20 (AB _q, J=14.3Hz, 2H), 4.44 and 4.53 (AB _q, J=17.3 Hz, 2H), 4.68 (s, 2H), 6.25 (s, 1H), 7.35 (d, J=8.2Hz, 1H), 7.39 (s, 1H), 7.51 (dd, J=8.2,2.20Hz, 1H), 7.70 (d, J=2.2Hz, 1H).HRMS: for C ₂₁H ₂₁Cl ₂N ₆O ₂, calculated value: 459.1103, experimental value: 459.1105[M+H] ⁺

Embodiment 64

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group 5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-(1-methyl isophthalic acid H-pyrazole-3-yl) ethanamide, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 2.85 (s, 3H), 3.77 (s, 3H), 3.96 and 4.20 (AB _q, J=14.3Hz, 2H), 4.35 and 4.47 (AB _q, J=17.1Hz, 2H), 4.66 (s, 2H), 6.44 (wide unimodal, 1H), 7.35 (d, J=8.3Hz, 1H), 7.44 (wide unimodal, 1H), 7.50 (d, J=8.3Hz, 1H), 7.67 (s, 1H).HRMS: for C ₂₁H ₂₁Cl ₂N ₆O ₂, calculated value: 459.1103, experimental value: 459.1118[M+H] ⁺

Embodiment 65

(S)-and 2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H-yl)-N-(1-methyl isophthalic acid H-pyrazole-3-yl) methyl) ethanamide, tfa salt

¹H NMR (400MHz, CD ₃OD) δ 2.74 (s, 3H), 3.73 (s, 3H), 3.86 and 4.10 (AB _q, J=14.5Hz, 2H), 4.11 and 4.23 (AB _q, J=16.7Hz, 2H), 4.26 (s, 2H), 4.52 (s, 2H), 6.10 (d, J=2.20Hz, 1H), 7.24 (d, J=8.4Hz, 1H), 7.37-7.46 (m, 2H), 7.59 (d, J=1.8Hz, 1H).HRMS: for C ₂₂H ₂₃Cl ₂N ₆O ₂, calculated value: 473.1260, experimental value: 473.1248[M+H] ⁺

Embodiment 66

2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) acetate, tfa salt

With 7 M NH among the MeOH (1.25mL) ₃In embodiment 50D (racemic modification, 31.3mg, solution 0.068mmol) be 100 ℃ of following heating 15min in microwave, cooling and vapourisation under reduced pressure.Resistates is dissolved in CH ₂Cl ₂(0.5mL), add TFA (0.13mL) afterwards, and the mixture that is produced is stirred 2.5h and concentrated in a vacuum at ambient temperature.By preparation property HPLC (Phenomenex Luna 5 μ C18,21.2 * 100mm, the 18min gradient, 0 to 80% solvent B 40mL/min) with the crude product purifying, obtains the embodiment XX of white solid, tfa salt (17.2mg, 51.2% productive rate). ¹H NMR (400MHz, CD ₃OD) δ 2.75 (s, 3H), 3.86 and 4.10 (AB _q, J=14.5Hz, 2H), 4.19 and 4.27 (AB _q, J=18.0Hz, 2H), 4.53 (s, 2H), 7.24 (d, J=8.4Hz, 1H), 7.42 (dd, J=8.4,2.2Hz, 1H), 7.60 (d, J=2.2Hz, 1H).[M+H] ⁺＝380.12。

Embodiment 67 and 68

(R)-2-(3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) acetate, tfa salt reaches (S)-2-(3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) acetate, tfa salt

Embodiment 67 embodiment 68

Embodiment 67A and 68A:(R)-2-(3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) tert.-butyl acetate and (S)-2-(3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tert.-butyl acetate

Embodiment 67A embodiment 68A

With 7 M NH among the MeOH (10mL) ₃In embodiment 50D (racemic modification, 393.4mg, solution 0.863mmol) be 100 ℃ of following heating 20min in microwave, cooling and under reduced pressure concentrating.By chirality tubing string (Chiralpak, 5cm * 50cm, 20 μ) with 12 to 25% solvent B (solvent orange 2 A=heptane+0.1%DEA, solvent B=IPA+0.1%DEA) wash-out separates resistates, obtain embodiment 2A, the isomer A (84.7mg of colorless solid shape, 98%ee) and isomer B (97.8mg, 98%ee).

Embodiment 67 and 68:(R)-2-(3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) acetate, tfa salt reaches (S)-2-(3-(amino methyl)-4-(2, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) acetate, tfa salt

Embodiment 67 embodiment 68

Embodiment 67: at ambient temperature with embodiment 67A (28 mg, 0.06mmol) with TFA (0.26mL) in CH ₂Cl ₂Mixture (1mL) stirs 3h, and vapourisation under reduced pressure.By preparation property HPLC (Phenomenex Luna 5 μ, C18,21.2 * 100mm, the 18min gradient, 0 to 80% solvent B, 40mL/min) purifying resistates obtains embodiment 67, the isomer A tfa salt (21.8mg, 72% productive rate) of white solid. ¹H NMR (500MHz, CD ₃OD) δ 2.75 (s, 3H), 3.86 and 4.10 (AB _q, J=14.6Hz, 2H), 4.18-4.26 (AB _q, J=18.2Hz, 2H), 4.53 (s, 2H), 7.24 (d, J=8.3Hz, 1H), 7.42 (d, J=8.3 Hz, 1H), 7.60 (s, 1H).[M+H] ⁺＝380.2。

Embodiment 68: at ambient temperature with embodiment 68A (27mg, 0.06mmol) with TFA (0.4mL) in CH ₂Cl ₂Mixture (2mL) stirs 2.5h, and vapourisation under reduced pressure.By preparation property HPLC (Phenomenex Luna 5 μ, C18,21.2 * 100mm, the 18min gradient, 0 to 80% solvent B, 40mL/min) purifying resistates obtains embodiment 68, the isomer B tfa salt (21.3mg, 71.8% productive rate) of white solid. ¹H NMR (500 MHz, CD ₃OD) δ 2.75 (s, 3H), 3.86 and 4.10 (AB _q, J=14.30Hz, 2H), 4.19-4.26 (AB _q, J=18.0 Hz, 2H), 4.53 (s, 2H), 7.24 (d, J=8.3 Hz, 1H), 7.42 (d, J=8.3Hz, 1H), 7.60 (s, 1H).HRMS: for C ₁₇H ₁₆Cl ₂N ₃O ₃, calculated value: 380.0569, experimental value: 380.0558[M+H] ⁺

Embodiment 69

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(5-(methylsulfonyl) indoline-1-yl)-2-ketone group ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

At ambient temperature with embodiment 50E (31.4mg; 0.065mmol), EDCI (49.8mg, 0.26mmol), HOAT (13.3mg, 0.097mmol) with 5-(methylsulfonyl) indoline (16.7mg; 0.084mmol) mixture stir 1h and vapourisation under reduced pressure.With resistates at EtOAc and H ₂Branch is molten between the O, and further with the EtOAc aqueous layer extracted.Organic layer that will be through merging is with the salt water washing, dry (Na ₂SO ₄), and in a vacuum it is concentrated.Then resistates is dissolved in CH ₂Cl ₂(1.0mL), add TFA (0.5mL) afterwards.At ambient temperature reaction mixture is stirred 3h and concentrated in a vacuum.By preparation property HPLC (Phenomenex Luna 5 μ, C18,21.2 * 250mm, the 15min gradient, 30 to 90% solvent B, 40mL/min) purifying crude product obtains the embodiment 69 of white powder, tfa salt (3.5mg, productive rate is 8% in 2 steps). ¹H NMR (500MHz, CD ₃OD) δ 2.77 (s, 3H), 2.99 (s, 3H), 3.25 (t, J=8.5Hz, 2H), 3.88 and 4.12 (AB _q, J=14.3 Hz, 2H), 4.18 (t, J=8.5Hz, 2H), 4.44 and 4.55 (AB _q, J=16.0Hz, 2H), 4.58 (s, 2H), 7.26 (d, J=8.3Hz, 1H), 7.43 (d, J=8.3Hz, 1H), 7.60 (s, 1H), 7.66 (d, J=8.3Hz, 1H), 7.71 (s, 1H), 8.13 (d, J=8.8Hz, 1H).HRMS: for C ₂₆H ₂₅Cl ₂N ₄O ₄S, calculated value: 559.0974, experimental value: 559.0985[M+H] ⁺

Use the program described in the embodiment 69, prepare following compound (embodiment 70 to 75):

Embodiment 70

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-(4-sec.-propyl piperazine-1-yl)-2-ketone group ethyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.37 (d, J=6.6Hz, 6 H), 2.84 (s, 3H), 2.98-3.15 (m, 2H), 3.19-3.35 (m, 1H), 3.39-3.63 (m, 4 H), 3.96 and 4.20 (AB _q, J=14.6Hz, 2H), 4.14-4.25 (m, 1H), 4.37-4.73 (m, 5H), 7.35 (d, J=8.3Hz, 1H), 7.51 (d, J=8.3Hz, 1H), 7.68 (s, 1H).HRMS: for C ₂₄H ₃₀Cl ₂N ₅O ₂, calculated value: 490.1777, experimental value: 490.1759[M+H] ⁺

Embodiment 71

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-ketone group-2-(4-(pyrimidine-2-base) piperazine-1-yl) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500 MHz, CD ₃OD) δ 2.75 (s, 3H), 3.48-3.61 (m, 4 H), 3.74 (t, J=5.0Hz, 2H), 3.81 (t, J=4.4Hz, 2H), 3.87 and 4.11 (AB _q, J=14.8Hz, 2H), 4.39 and 4.49 (AB _q, J=17.0Hz, 2H), 4.52 (s, 2H), 6.57 (t, J=5.0Hz, 1H), 7.25 (d, J=8.3Hz, 1H), 7.42 (d, J=8.3Hz, 1H), 7.60 (s, 1H), 8.27 (d, J=5.0Hz, 2H).HRMS: for C ₂₅H ₂₆Cl ₂N ₇O ₂, calculated value: 526.1525, experimental value: 526.1512[M+H] ⁺

Embodiment 72

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N, N-Valpromide, tfa salt

¹H NMR (400MHz, CD ₃OD) δ 0.78 (t, J=7.5Hz, 3H), 0.87 (t, J=7.5Hz, 3H), 1.39-1.52 (m, 2H), 1.53-1.67 (m, 2H), 2.74 (s, 3H), 3.15-13.25 (m, 4 H), 3.86 and 4.10 (AB _q, J=14.5Hz, 2H), 4.31 and 4.44 (AB _q, J=16.7Hz, 2H), 4.51 (s, 2H), 7.24 (d, J=7.9Hz, 1H), 7.42 (dd, J=8.1,1.10Hz, 1H), 7.59 (d, J=1.3Hz, 1H).HRMS: for C ₂₃H ₂₉Cl ₂N ₄O ₂, calculated value: 463.1668, experimental value: 463.1672[M+H] ⁺

Embodiment 73

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl) ethanamide, tfa salt

¹H?NMR(400MHz，CD ₃OD)δ1.32-1.50(m，2H)，1.65-1.81(m，2H)，2.74(s，3H)，3.36(t，J＝11.4Hz，2H)，3.71-3.93(m，4H)，4.00-4.30(m，3H)，4.52(s，2H)，7.24(d，J＝7.9Hz，1H)，7.42(dd，J＝8.1，2.0Hz，1H)，7.60(d，J＝2.2，1H)。HRMS: for C ₂₂H ₂₅Cl ₂N ₄O ₃, calculated value: 463.1304, experimental value: 463.1306[M+H] ⁺

Embodiment 74

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-(4,4-dimethyl  azoles alkane-3-yl)-2-ketone group ethyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 1.35 (d, J=5.5Hz, 6 H), 2.75 (s, 3H), 3.67 (s, 2H), 3.87 and 4.11 (AB _q, J=14.5Hz, 2H), 4.08 and 4.20 (AB _q, J=16.8Hz, 2H), 4.51 (s, 2H), 4.97 (s, 2H), 7.25 (d, J=8.3Hz, 1H), 7.42 (dd, J=8.3,1.6Hz, 1H), 7.59 (d, J=1.6Hz, 1H).HRMS: for C ₂₂H ₂₅Cl ₂N ₄O ₃, calculated value: 463.1304, experimental value: 463.1390[M+H] ⁺

Embodiment 75

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-methylacetamide, tfa salt

¹H NMR (400MHz, CD ₃OD) δ 2.63 (s, 3H), 2.74 (s, 3H), 3.86 and 4.11 (AB _q, J=14.5Hz, 2H), 4.08 and 4.20 (AB _q, J=16.8Hz, 2H), 4.50 (s, 2H), 7.25 (d, J=8.3Hz, 1H), 7.42 (dd, J=8.3,1.6Hz, 1H), 7.59 (d, J=1.6Hz, 1H).HRMS: for C ₁₈H ₁₉Cl ₂N ₄O ₂, calculated value: 393.0885, experimental value: 393.0894[M+H] ⁺

Embodiment 76

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N, N-di-isopropyl ethanamide, tfa salt

At ambient temperature to embodiment 50E (173.4mg, 0.152mmol) and the triphenylphosphine resin (0.31g is 0.458mmol) in CH ₂Cl ₂(4mL) in stirring the mixture, dropwise add Trichloroacetonitrile (45.9 μ L, 0.458mmol).To keep 2.5h through stirred mixture at ambient temperature, and then be cooled to 0 ℃, add afterwards Diisopropylamine (64.2 μ L, 0.458mmol) and Et ₃N (63.8 μ L, 0.458mmol).Under 0 ℃, will keep 35min, and keep 30min in addition under the envrionment temperature, and filter through stirred mixture.Follow concentrating filtrate in a vacuum, and resistates is dissolved in CH ₂Cl ₂(2.0mL), add TFA (0.7mL) afterwards.At ambient temperature reaction mixture is stirred 2.5h and concentrated in a vacuum.By preparation property HPLC (Phenomenex Luna 5 μ, 21.2 * 250mm, the 14min gradient, 10 to 90% solvent B, 40mL/min) purifying crude product obtains the embodiment 4 of white powder, tfa salt (12.4mg, 14% productive rate). ¹H NMR (500MHz, CD ₃OD) δ 1.11-1.21 (m, 6H), 1.27 (q, J=6.6Hz, 6 H), 2.75 (s, 3H), 3.42-3.52 (m, 1H), 3.86 and 4.10 (AB _q, J=14.6Hz, 2H), 3.89-3.98 (m, 1H), 4.26 and 4.38 (AB _q, J=16.8Hz, 2H), 4.49 (s, 2H), 7.25 (d, J=8.3Hz, 1H), 7.42 (d, J=8.3Hz, 1H), 7.59 (s, 1H).HRMS: for C ₂₃H ₂₉Cl ₂N ₄O ₂, calculated value: 463.1668, experimental value: 463.1656[M+H] ⁺

Embodiment 77

(S)-2-(((S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H-yl) methyl) tetramethyleneimine-1-carboxylic acid tert-butyl ester, tfa salt

Embodiment 77A:(R)-and 6-(((S)-1-(tertbutyloxycarbonyl) tetramethyleneimine-2-yl) methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-benzyl ester

With (S)-6-(chloromethyl)-4-(2, the 4-dichlorophenyl)-2-picoline-3,5-dicarboxylic acid 3-benzyl ester 5-ethyl ester (248mg, 0.503mmol), (S)-2-(amino methyl) tetramethyleneimine-1-carboxylic acid tert-butyl ester (231.7mg, 1.157mmol) and triethylamine (161 μ L, 1.157mml) mixture heating up to 100 in N,N-dimethylacetamide (10mL) ℃ lasts 3h, and then be cooled to envrionment temperature.With the mixture that produced at EtOAc and H ₂Branch is molten between the O, and further with EtOAc (2X) aqueous layer extracted.Organic extract that will be through merging is with H ₂O and salt water washing, dry (Na ₂SO ₄), and vapourisation under reduced pressure.By flash chromatography (40g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates, obtain the embodiment 77A (240.4mg, 78% productive rate) of glassy yellow solid state.[M+H-Boc] ⁺＝510.2。

Embodiment 77B:(R)-and 6-(((S)-1-(tertbutyloxycarbonyl) tetramethyleneimine-2-yl) methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

At ambient temperature under hydrogen (air bag) with embodiment 77A (235.9mg, 0.386mmol) and 10% carbon carry palladium (47mg) and in EtOAc (8mL), keep 3h through stirred mixture.Reaction mixture is filtered through Celite pad, with MeOH and CH ₂Cl ₂With its washing.Under reduced pressure, obtain the thick embodiment 77B (200.7mg, 100% productive rate) of glassy yellow solid state with the filtrate evaporation.[M+H-Boc] ⁺＝420.1。

Embodiment 77C:(S)-2-(((S)-4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl) tetramethyleneimine-1-carboxylic acid tert-butyl ester

At ambient temperature to embodiment 77B (200mg, 0.384mmol) and the triphenylphosphine resin (1.04g is 1.536mmol) in CH ₂Cl ₂(10mL) in stirred mixture, dropwise add Trichloroacetonitrile (0.15mL, 1.536mmol).To keep 1.5h and filtration through stirred mixture at ambient temperature.Concentrating filtrate obtains slightly (S)-2-(((R)-3-(chloroformyl)-4-(2 in a vacuum, the 4-dichlorophenyl)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H)-yl) methyl) tetramethyleneimine-1-carboxylic acid tert-butyl ester, it can be directly used in subsequent reactions.

Under 0 ℃, to above chloride of acid in the solution of THF (7mL), dropwise add three-tert.-butoxy lithium aluminum hydride (1.15mL, 1.15mmol).Under 0 ℃, mixture is stirred 45min, with H ₂O (0.2mL) ends, and concentrates in a vacuum.Can obtain bright orange solid state embodiment 77C (137.2mg is 70% in 2 steps) by flash chromatography (12g tubing string, 0 to 100%EtOAc/ hexane) purifying resistates.[M+H-Boc] ⁺＝406.2。

Embodiment 77D:(S)-2-(((R)-3-(chloromethyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl) tetramethyleneimine-1-carboxylic acid tert-butyl ester

Under 0 ℃ to embodiment 77C (40mg, 0.079mmol) and Et ₃(44 μ L are 0.316mmol) in CH for N ₂Cl ₂Dropwise add in the mixture (1.5mL) methylsulfonyl chloride (18.3 μ l, 0.237mmol).To keep through stirred mixture at ambient temperature overnight, and under reduced pressure with its evaporation.With resistates at EtOAc and H ₂Branch is molten between the O, and further with EtOAc (2X) aqueous layer extracted.Organic extract that will be through merging is with the salt water washing, dry (Na ₂SO ₄), and concentrate in a vacuum.Crude product chromatography (4g tubing string, 0 to 100%EtOAc/ hexane) is obtained colorless solid shape embodiment 77D (41.2mg, 99.4%).[M+H-Boc] ⁺＝424.1。

Embodiment 77:(S)-2-(((S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridine-6 (7H-yl) methyl) tetramethyleneimine-1-carboxylic acid tert-butyl ester, tfa salt

With 7 M NH among the MeOH (4mL) ₃In embodiment 77D (40mg, solution 0.076mmol) be 100 ℃ of following heating 15min in microwave, cooling and concentrating in a vacuum.By preparation property HPLC (Luna5 μ C18,30 * 100mm, the 10min gradient, 0 to 100% solvent B, 40mL/min) purifying resistates obtains the embodiment 77 of white powder, tfa salt (36.5mg, 77.5% productive rate). ¹H NMR (400MHz, CD ₃OD) δ 1.38 (s, 9H), 1.69-1.98 (m, 4H), 2.84 (s, 3H), 3.25-3.39 (m, 2H), 3.52-3.68 (m, 2H), 3.95 (AB _qPart, J=14.5Hz, 1H), 4.10-4.26 (m, 2H), 4.46-4.77 (m, 2H), 7.26-7.42 (m, 1H), 7.52 (dd, J=8.1,2.0Hz, 1H), 7.69 (d, J=1.8Hz, 1H).HRMS: for C ₂₅H ₃₁Cl ₂N ₄O ₃, calculated value: 505.1773, experimental value: 505.1783[M+H] ⁺

Program described in the use embodiment 77 prepares embodiment 50 and 78:

Embodiment 50

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N,N-dimethylacetamide, tfa salt

Embodiment 78

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-( azoles-2-ylmethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

¹H NMR (500MHz, CD ₃OD) δ 2.74 (s, 3H), 3.86 and 4.10 (AB _q, J=14.3Hz, 2H), 4.53 and 4.57 (AB _q, J=19.0Hz, 2H), 4.75 and 4.83 (AB _q, J=16.5Hz, 2H), 7.03 (s, 1H), 7.25 (d, J=8.3Hz, 1H), 7.41 (dd, J=8.3,2.20Hz, 1H), 7.59 (d, J=1.7Hz, 1H), 7.79 (s, 1H).HRMS: for C ₁₉H ₁₇Cl ₂N ₄O ₂, calculated value: 403.0729, experimental value: 403.0715[M+H] ⁺

Embodiment 79

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(S)-tetramethyleneimine-2-ylmethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

At ambient temperature with embodiment 77 (28mg, 0.055mmol) with TFA (0.7mL) in CH ₂Cl ₂(mixture in 1.0 stirs 1h, and under reduced pressure with its evaporation.By preparation property HPLC (Luna 5 μ C18 (2), 30 * 100mm, the 10min gradient, 0 to 60% solvent B, 40mL/min) purifying resistates obtains the embodiment 6 of white solid, tfa salt (15.9mg, 45.7% productive rate). ¹HNMR (400MHz, CD ₃OD) δ 1.59-1.75 (m, 1H), 1.83-2.05 (m, 2H), 2.07-2.18 (m, 1H), 2.75 (s, 3H), 3.10-3.30 (m, 2H), 3.64-3.98 (m, 4 H), 4.12 (AB _qPart, J=14.1Hz, 1H), 4.50 and 4.61 (AB _q, J=18.0Hz, 2H), 7.26 (d, J=8.4Hz, 1H), 7.42 (dd, J=8.1,2.0Hz, 1H), 7.60 (d, J=2.20Hz, 1H).HRMS: for C ₂₀H ₂₃Cl ₂N ₄O, calculated value: 405.1249, experimental value: 405.1256[M+H] ⁺

Embodiment 80

(S)-and 3-(amino methyl)-6-(((S)-1-(encircling third alkylsulfonyl) tetramethyleneimine-2-yl) methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Embodiment 80A:(S)-and 4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-6-((S)-tetramethyleneimine-2-ylmethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

At ambient temperature with embodiment 77C (84mg, 0.166mmol) with TFA (0.7mL) in CH ₂Cl ₂(mixture in 1.5 stirs 3h, and under reduced pressure with its evaporation.With resistates and ethanol (3X) coevaporation, obtain orange buttery embodiment 80A (123.7mg), its not purified next step that just can be used for.[M+H] ⁺＝406.2。

Embodiment 80B:(R)-and 3-(chloromethyl)-6-(((S)-1-(encircling third alkylsulfonyl) tetramethyleneimine-2-yl) methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone

Under 0 ℃ to embodiment 80A (123mg, 0.166mmol) and Et ₃(230.9 μ L are 1.66mmol) in CH for N ₂Cl ₂Add CH in the solution (2.5mL) ₂Cl ₂Ring third SULPHURYL CHLORIDE (0.5mL) (23.3mg, 0.166mmol).To keep 2.5h through stirred mixture at ambient temperature, add afterwards methylsulfonyl chloride (32 μ L, 0.415mmol).At ambient temperature the mixture that is produced is kept overnight, and under reduced pressure with its evaporation.Resistates is dissolved among the EtOAc, with the salt water washing, dry (Na ₂SO ₄), and in a vacuum it is concentrated.Crude product chromatography (12g tubing string, 0 to 100%EtOAc/ hexane) is obtained the embodiment 80B (55.2mg, 62.9%) of colorless solid shape.[M+H] ⁺＝528.1。

Embodiment 80:(S)-and 3-(amino methyl)-6-(((S)-1-(encircling third alkylsulfonyl) tetramethyleneimine-2-yl) methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

With 7 M NH among the MeOH (5mL) ₃In embodiment 80B (55mg, solution 0.104mmol) be 100 ℃ of following heating 15min in microwave, cooling and concentrating in a vacuum.By preparation property HPLC (Luna5 μ C18 (2), 30 * 100mm, the 12min gradient, 0 to 80% solvent B, 40mL/min) purifying resistates obtains the embodiment 80 of white powder, tfa salt (44.9mg, 69.2% productive rate). ¹H NMR (500MHz, CD ₃OD) δ 0.81-0.97 (m, 4H), 1.65-1.74 (m, 1H), 1.81-1.93 (m, 2H), 1.91-2.03 (m, 1H), 2.33-2.50 (m, 1H), 2.73 (s, 3H), 3.24-3.31 (m, 1H), 3.34-3.61 (m, 3H), 3.85 (AB _qPart, J=14.3Hz, 1H), 4.06-4.18 (m, 2H), 4.50-4.66 (m, 2H), 7.24 (d, J=8.3Hz, 1H), 7.42 (d, J=8.3Hz, 1H), 7.59 (s, 1H).HRMS: for C ₂₃H ₂₇Cl ₂N ₄O ₃S, calculated value: 509.1181, experimental value: 509.1190[M+H] ⁺

Embodiment 81

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate, tfa salt

At Chiralcel ^OJ, 20 μ use on 5 * 50cm tubing string to contain 15%EtOH-MeOH (50%) heptane of (containing 0.1% diethylamine) degree gradient separations such as (containing 0.1% diethylamine) and go out racemize embodiment 23, obtain each enantiomer.

Embodiment 81 (enantiomer A; Move slower): by chiral analysis HPLC[Chiralcel ^OJ4.6 * 250mm; Contained 20%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity of gained: RT=18.22min;＞97%ee.

Embodiment 82

(R)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate, tfa salt

Embodiment 82 (enantiomer B; Move very fast): by chiral analysis HPLC[Chiralcel ^OJ4.6 * 250mm; Contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity of gained: RT=15.8min;＞97%ee.

Embodiment 83

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7G)-yl)-acetate, tfa salt

(20mg, (4.5mg is in 0.5mL H 0.05mmol) to add the LiOH aqueous solution in the solution of THF (0.7mL) to embodiment 81 ₂Among the O, 0.107mmol), and with the mixture stirring 2h that is produced.With the 1N HCl aqueous solution mixture is acidified to pH=4.In a vacuum organic volatile is removed, and with EtOAc (5mL) aqueous phase extracted.Organic extract is concentrated in a vacuum, obtain crude product, be purified, obtain the embodiment 83 of white powder, tfa salt (7.1mg, 28%) by preparation property HPLC (15 to 100%B for Phenomenex, 10min gradient).Phenomenex LUNA C-18 4.6 * 50mm, 0-100% lasts 10min, A=90% water, 10% acetonitrile, 0.1%TFA, B=10% water, 90% acetonitrile, 0.1%TFA). ¹H NMR (400MHz, CD ₃OD) δ 2.75 (s, 3H), 3.91 and 4.12 (AB _q, J=14.5Hz, 2H), 4.16 and 4.23 (AB _q, J=16.3Hz, 2H), 4.26 and 4.32 (AB _q, J=16.0Hz, 2H), 7.34 (d, J=8.3Hz, 1H), 7.51 (dd, J=8.3,2.2Hz, 1H), 7.71 (d, J=2.2Hz, 1H).[α] _D ²⁵+ 5.84 ° (c=0.1, MeOH); LCMS: for C ₁₇H ₁₅Cl ₂N ₄O ₂, the analytical calculation value: 379.05, experimental value: 380.18[M+H] ⁺

Embodiment 84

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-ethanamide, tfa salt

Embodiment 84A:(S)-2-(3-((tert.-butoxy carbonyl amino) methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) methyl acetate

(37mg 0.094mmol) adds saturated NaHCO in the mixture in THF (3mL) to embodiment 81 ₃The aqueous solution (2mL) and Boc ₂O (50mg, 0.23mmol).Under RT, the mixture that is produced is stirred 2h, with EtOAc (8mL) and H ₂O (2mL) dilution.Mixture is stirred 5min in addition.Organic layer is separated and evaporation in a vacuum, obtain embodiment 84A.

Embodiment 84B:(S)-(6-(2-amino-2-ketone group ethyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

(30mg 0.06mmol) shines 10min with the solution of 7N ammonia in MeOH (1mL) under 100 ℃ in microwave reactor with the embodiment 84A in the sealed tube.After being cooled to envrionment temperature, volatile matter being removed obtained the crude amide product in a vacuum.In sealed tube, this product is mixed in MeOH (2mL) with 7 N ammonia, then 100 ℃ of other down irradiation 10min in microwave reactor.After being cooled to envrionment temperature, volatile matter being removed obtained embodiment 84B in a vacuum.

Embodiment 84:(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethanamide, tfa salt

To embodiment 84B product in CH ₂Cl ₂Solution (1mL) adds TFA (0.5mL), and the mixture that is produced is stirred 1h.Solvent is removed, and, obtained the embodiment 84 of white powder, tfa salt (12mg, 39%) by preparation property HPLC (15 to 100%B for Phenomenex, 10min gradient) purifying resistates.Phenomenex LUNA C-18 4.6 * 50mm, 0-100% lasts 10min, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA).[α] _D ²⁵+ 6.3 ° (c=0.1, MeOH); By chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity of gained:＞98%ee. ¹H NMR (400MHz, CD ₃OD) δ 2.84 (s, 3H), 4.02 and 4.24 (AB _q, J=14.1Hz, 2H), 4.24 and 4.33 (AB _q, J=18.5Hz, 2H), 4.28 and 4.35 (AB _q, J=17.0Hz, 2H), 7.45 (d, J=8.3Hz, 1H), 7.59 (dd, J=8.3,2.2Hz, 1H), 7.78 (d, J=2.2Hz, 1H).LCMS: for C ₁₇H ₁₆Cl ₂N ₄O ₂, the analytical calculation value: 378.07, experimental value: 379.12[M+H] ⁺HRMS: for C ₁₇H ₁₈Cl ₂N ₄O ₂, the analytical calculation value: 379.0729, experimental value: 379.0732[M+H] ⁺

Embodiment 85

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-methylacetamide, tfa salt

Embodiment 85A:(S)-(4-(2,4 dichloro benzene base)-2-methyl-6-(2-(methylamino-)-2-ketone group ethyl)-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

With the embodiment 84A in the sealed tube (16mg, 0.032mmol), (0.4mL, 40 weight % are in H for methylamine ₂In the O water) with the mixture of MeOH (0.6mL) 100 ℃ of irradiation 20min down in microwave reactor.After being cooled to envrionment temperature, volatile matter being removed obtained the crude amide product in a vacuum.

Embodiment 85:(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-methylacetamide, tfa salt

To embodiment 85A product in CH ₂Cl ₂Add TFA (0.5mL) in the solution (1mL), and the mixture that is produced is stirred 1h.Solvent is removed, and, obtained the embodiment 85 of white powder, tfa salt (11mg, 66%) by preparation property HPLC (15 to 100%B for Phenomenex, 10min gradient) purifying resistates.Phenomenex LUNA C-18 4.6 * 50mm, 0-100% lasts 10min, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA). ¹H NMR (400MHz, CD ₃OD) δ 2.72 (s, 3H), 2.84 (s, 3H), 4.01 and 4.27 (AB _q, J=14.5Hz, 2H), 4.23 and 4.33 (AB _q, J=18.1Hz, 2H), 4.27 and 4.31 (AB _q, J=16.0Hz, 2H), 7.45 (d, J=8.3Hz, 1H), 7.58 (dd, J=8.3,2.2Hz, 1H), 7.78 (d, J=2.2Hz, 1H).[α] _D ²⁵+ 23.8 ° of (c=0.1, MeOH) .LCMS: for C ₁₈H ₁₈Cl ₂N ₄O ₂, the analytical calculation value: 392.08, experimental value: 393.16[M+H] ⁺HRMS: for C ₁₈H ₂₀Cl ₂N ₄O ₂, the analytical calculation value: 393.0885, experimental value: 393.0882[M+H] ⁺By chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm, the 20%EtOH-MeOH in the heptane (containing 0.1%DEA) (1: 1; Contain 0.1%DEA)] purity of gained: RT=12.16min;＞97%ee.

Embodiment 86

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N,N-dimethylacetamide, tfa salt

Embodiment 86A:(S)-2-(3-((tert.-butoxy carbonyl amino) methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) acetate

(130mg, (19mg is in 2mL H 0.26mmol) to add the LiOH aqueous solution in the solution of THF (3mL) to embodiment 84A ₂Among the O, 0.45mmol), and with the mixture stirring 2h that is produced.With the 1 NHCl aqueous solution mixture is acidified to pH=4.In a vacuum organic volatile is removed, and with EtOAc (20ml) aqueous phase extracted.In a vacuum organic extract is concentrated, obtain embodiment 86A (125mg, 99%).

Embodiment 86B:(S)-(4-(2,4 dichloro benzene base)-6-(2-(dimethylamino)-2-ketone group ethyl)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

To embodiment 86A (21mg, 0.044mmol), PyBOP (34mg, 0.065mmol), add in the mixture of dimethylamine (0.1mL, 2 M are in THF) in THF diisopropyl ethyl amine (0.03mL, 0.17mmol).At ambient temperature mixture is stirred and spend the night.Remove and desolvate, and, obtain the embodiment 86B (17.4mg, 78%) of white solid by preparation property HPLC (15 to 100%B for Phenomenex, 10min gradient) purifying resistates.Phenomenex LUNA C-18 4.6 * 50mm, 0-100% lasts 10min, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA).Experimental value: 507.29[M+H] ⁺

Embodiment 86:(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N,N-dimethylacetamide, tfa salt

To embodiment 86B in CH ₂Cl ₂Add TFA (0.3mL) in the solution (1mL), and the mixture that is produced is stirred 2h.Solvent is removed, and, obtained the embodiment 86 of white powder, tfa salt (10.4mg, 58%) by preparation property HPLC (15 to 100%B for Phenomenex, 10min gradient) purifying resistates.Phenomenex LUNA C-184.6 * 50mm, 0-100% lasts 10min, A=90% water, 10% methyl alcohol, 0.1%TFA, B=10% water, 90% methyl alcohol, 0.1%TFA). ¹H NMR (400MHz, CD ₃OD) δ 2.84 (s, 3H), 2.93 (s, 3H), 3.09 (s, 3H), 4.02 and 4.27 (AB _q, J=14.0Hz, 2H), 4.23 and 4.30 (AB _q, J=18.0Hz, 2H), 4.48 and 4.56 (AB _q, J=17.0Hz, 2H), 7.45 (d, J=8.3 Hz, 1H), 7.58 (dd, J=8.3,2.2 Hz, 1H), 7.78 (d, J=2.2Hz, 1H).[α] _D ²⁵+12.0°(c＝0.1，MeOH)。LCMS: for C ₁₉H ₂₀Cl ₂N ₄O ₂, the analytical calculation value: 406.10, experimental value: 407.19[M+H] ⁺HRMS: for C ₁₉H ₂₁Cl ₂N ₄O ₂, the analytical calculation value: 407.1042, experimental value: 407.1031[M+H] ⁺

Embodiment 87

(S)-and 6-(2-(4-ethanoyl piperazine-1-yl)-2-ketone group ethyl)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5, the 6-pyrrolin is [3,4-b] pyridin-7-one also, tfa salt

Outside the dimethylamine of 1-ethanoyl piperazine replacement in step 86B, use above embodiment 86 described identical methods to prepare embodiment 87. ¹H NMR (400 MHz, CD ₃OD) δ 2.12 (s, 1.5H), 2.13 (s, 1.5H), 2.84 (m, 3H), 3.50-3.72 (m, 8H), 4.02 and 4.27 (AB _q, J=14.0Hz, 2H), 4.23 and 4.33 (AB _q, J=18.0Hz, 2H), 4.52 and 4.63 (AB _q, J=17.0Hz, 2H), 7.45 (d, J=8.3Hz, 1H), 7.58 (dd, J=8.3,2.2Hz, 1H), 7.78 (d, J=2.2Hz, 1H) .[α] _D ²⁵+ 16.5 ° (c=0.1, MeOH).LCMS: for C ₂₃H ₂₅Cl ₂N ₅O ₃, the analytical calculation value: 489.13, experimental value: 490.31[M+H] ⁺HRMS: for C ₂₃H ₂₆Cl ₂N ₅O ₃, the analytical calculation value: 490.1413, experimental value: 490.1416[M+H] ⁺

Embodiment 88

(S)-1-(2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethanoyl) piperidines-4-methane amide, tfa salt

Outside the piperidines-dimethylamine of 4-methane amide replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 88. ¹H?NMR(400?MHz，CD ₃OD)δ1.45-1.95(m，4H)，2.40-2.55(m，2H)，2.86(s，3H)，3.10-3.22(m，1H)，3.90-4.65(m，8H)，7.45(d，J＝8.3Hz，1H)，7.59(dd，J＝8.3，2.2Hz，1H)，7.78(d，J＝2.2Hz，1H)。[α] _D ²⁵+15.1°(c＝0.1，MeOH)。LCMS: for C ₂₃H ₂₅Cl ₂N ₄O ₃, the analytical calculation value: 489.13, experimental value: 490.30[M+H] ⁺HRMS: for C ₂₃H ₂₆Cl ₂N ₅O ₃, the analytical calculation value: 490.1413, experimental value: 490.1405[M+H] ⁺

Embodiment 89

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(4-(methylsulfonyl) piperazine-1-yl)-2-ketone group ethyl)-5, the 6-pyrrolin is [3,4-b] pyridin-7-one also, tfa salt

Outside the dimethylamine of 1-(methylsulfonyl) piperazine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 89. ¹H NMR (400MHz, acetone-d ₆) δ 2.72 (s, 3H), 2.81 (s, 3H), 3.10-3.18 (m, 2H), 3.22-3.30 (m, 2H), 3.55-3.62 (m, 2H), 3.65-3.73 (m, 2H), 4.16 (S, 2H), 4.44 and 4.55 (AB _q, J=16.7Hz, 2H), 4.68 and 5.13 (AB _q, J=15.8Hz, 2H), 7.55 (dd, J=8.3,2.0Hz, 1H), 7.74 (d, J=2.0Hz, 1H), 7.77 (d, J=8.3Hz, 1H).[α] _D ²⁵+16.3°(c＝0.1，MeOH)。LCMS: for C ₂₂H ₂₅Cl ₂N ₅O ₃S, the analytical calculation value: 525.10, experimental value: 526.22[M+H] ⁺HRMS: for C ₂₂H ₂₆Cl ₂N ₅O ₃S, the analytical calculation value: 526.1069, experimental value: 526.1093[M+H] ⁺

Embodiment 90

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N, N-diethyl acetamide, tfa salt

Outside the dimethylamine of diethylamine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 90. ¹HNMR (400MHz, CD ₃OD) δ 1.10 (t, J=7.0Hz, 3H), 1.26 (t, J=7.0Hz, 3H), 2.84 (s, 3H), 3.38 (q, J=7.0Hz, 2H), 3.43 (q, J=7.0Hz, 2H), 4.06 and 4.26 (AB _q, J=14.5Hz, 2H), 4.24 and 4.31 (AB _q, J=18.0Hz, 2H), 4.47 and 4.58 (AB _q, J=17.0Hz, 2H), 7.45 (dd, J=8.3,2.0Hz, 1H), 7.59 (d, J=2.0Hz, 1H), 7.79 (d, J=8.3Hz, 1H).[α] _D ²⁵+19.4°(c＝0.1，MeOH)。LCMS: for C ₂₁H ₂₅Cl ₂N ₄O ₂, the analytical calculation value: 434.13, experimental value: 435.25[M+H] ⁺HRMS: for C ₂₁H ₂₅Cl ₂N ₄O ₂, the analytical calculation value: 435.1355, experimental value: 435.1341[M+H] ⁺

Embodiment 91

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-(1-methyl isophthalic acid H-pyrazoles-5-yl) ethanamide, tfa salt

Divided by using above embodiment 86 described same procedure to prepare embodiment 91 outside the dimethylamine of 3-amino-2-methyl pyrazoles replacement in step 86B. ¹H NMR (400 MHz, CD ₃OD) δ 2.85 (s, 3H), 3.76 (s, 3H), 4.06 and 4.26 (AB _q, J=14.5Hz, 2H), 4.28 and 4.40 (AB _q, J=18.0Hz, 2H), 4.42 and 4.51 (AB _q, J=17.1Hz, 2H), 6.39 (d, J=2.2Hz, 1H), 7.41 (d, J=2.2Hz, 1H), 7.46 (dd, J=8.3,2.0Hz, 1H), 7.56 (d, J=2.0Hz, 1H), 7.76 (d, J=8.3Hz, 1H).[α] _D ²⁵+31.9°(c＝0.1，MeOH)。LCMS: for C ₂₁H ₁₆Cl ₂N ₆O ₂, the analytical calculation value: 458.10, experimental value: 459.25[M+H] ⁺HRMS: for C ₂₁H ₁₇Cl ₂N ₆O ₂, the analytical calculation value: 459.1103, experimental value: 459.1113[M+H] ⁺

Embodiment 92

(S)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-ketone group-2-(tetramethyleneimine-1-yl) ethyl)-5H-pyrrolo-[3,4-b] pyridine-(6H)-ketone, tfa salt

Outside the dimethylamine of tetramethyleneimine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 92. ¹H NMR (400 MHz, CD ₃OD) δ 1.80-2.05 (m, 4H), 2.84 (s, 3H), 3.35-3.58 (m, 4H), 4.01 and 4.24 (AB _q, J=14.5Hz, 2H), 4.28 and 4.34 (AB _q, J=17.5Hz, 2H), 4.40 and 4.49 (AB _q, J=17.0Hz, 2H), 7.45 (d, J=2.2Hz, 1H), 7.58 (dd, J=8.3,2.0Hz, 1H), 7.78 (d, J=8.3Hz, 1H).[α] _D ²⁵+24.1°(c＝0.1，MeOH)。LCMS: for C ₂₁H ₂₃Cl ₂N ₄O ₂, the analytical calculation value: 432.11, experimental value: 433.22[M+H] ⁺HRMS: for C ₂₁H ₂₄Cl ₂N ₄O ₂, the analytical calculation value: 433.1198, experimental value: 433.1204[M+H] ⁺

Embodiment 93

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-morpholinyl-2-ketone group ethyl)-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Outside the dimethylamine of morpholine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 93. ¹H NMR (400MHz, CD ₃OD) δ 2.84 (s, 3H), 3.50-3.73 (m, 8H), 4.01 and 4.24 (AB _q, J=14.5Hz, 2H), 4.22 and 4.30 (AB _q, J=17.6Hz, 2H), 4.50 and 4.58 (AB _q, J=17.2Hz, 2H), 7.44 (d, J=2.2Hz, 1H), 7.60 (dd, J=8.3,2.0Hz, 1H), 7.79 (d, J=8.3Hz, 1H).[α] _D ²⁵+24.3°(c＝0.1，MeOH)。LCMS: for C ₂₁H ₂₃Cl ₂N ₄O ₂, the analytical calculation value: 448.11, experimental value: 449.23[M+H] ⁺HRMS: for C ₂₁H ₂₃Cl ₂N ₄O ₂, the analytical calculation value: 449.1147, experimental value: 449.1144[M+H] ⁺

Embodiment 94

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-(pyridin-3-yl methyl) ethanamide, tfa salt

Outside the dimethylamine of 3-(amino methyl) pyridine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 94. ¹H NMR (400 MHz, CD ₃OD) δ 2.84 (s, 3H), 4.01 and 4.23 (AB _q, J=14.5Hz, 2H), 4.27 and 4.37 (AB _q, J=18.0Hz, 2H), 4.36 and 4.40 (AB _q, J=17.0Hz, 2H), 4.55 (m, 2H), 7.44 (d, J=2.2 Hz, 1H), 7.61 (dd, J=8.3,2.0Hz, 1H), 7.79 (d, J=8.3Hz, 1H), 7.86 (dd, J=7.9,5.8 Hz, 1H), 8.30-8.37 (m, 1H), 8.64-8.68 (m, 1H), 8.70-8.73 (m, 1H).[α] _D ²⁵+16.3°(c＝0.1，MeOH)。LCMS: for C ₂₃H ₂₁Cl ₂N ₅O ₂, the analytical calculation value: 469.11, experimental value: 470.26[M+H] ⁺

Embodiment 95

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(4-methylpiperazine-1-yl)-2-ketone group ethyl)-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Outside the dimethylamine of 1-methylpiperazine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 95. ¹H NMR (400 MHz, acetone-d ₆) δ 2.78 (s, 3H), 2.96 (s, 3H), 3.02-3.90 (m, 8H), 4.10-4.80 (m, 4H) 4.82 and 5.24 (AB _q, J=15.8Hz, 2H), 7.59 (dd, J=8.3,2.2Hz, 1H), 7.70 (d, J=8.3Hz, 1H), 7.76 (d, J=2.2Hz, 1H).LCMS: for C ₂₃H ₂₅Cl ₂N ₄O ₂, the analytical calculation value: 461.14, experimental value: 462.24[M+H] ⁺

Embodiment 96

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(2-(4-ethyl piperazidine-1-yl)-2-ketone group ethyl)-2-methyl-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Outside the dimethylamine of 1-ethyl piperazidine replacement in step 86B, use above embodiment 86 described same procedure to prepare embodiment 96. ¹H NMR (400MHz, CD ₃OD) δ 1.36 (t, J=7.1Hz, 3H), 2.85 (s, 3H), 3.24 (q, J=7.1Hz, 2H), 3.00-3.55 (m, 8H), 4.02 and 4.23 (AB _q, J=14.5 Hz, 2H), 4.21 and 4.30 (AB _q, J=18.0Hz, 2H), 4.40-4.75 (m, 2H), 7.45 (d, J=8.3Hz, 1H), 7.59 (dd, J=8.3,2.0Hz, 1H), 7.79 (d, J=2.0Hz, 1H).LCMS: for C ₂₃H ₂₇Cl ₂N ₅O ₂, the analytical calculation value: 475.15, experimental value: 476.27[M+H] ⁺

Embodiment 97

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-7-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-N-methyl-N-(1-methyl piperidine-4-yl) ethanamide, tfa salt

Except that in step 97B, replacing the dimethylamine, use above embodiment 86 described same procedure to prepare embodiment 97 with 1-methyl-4-(methylamino-) piperidines. ¹H?NMR(400?MHz，CD ₃OD)δ1.70-2.20(m，3H)，2.75-3.00(m，9H)，3.05-3.20(m，2H)，3.50-3.70(m，2H)，3.90-4.70(m，8H)，7.45(d，J＝8.3Hz，1H)，7.59(dd，J＝8.3，2.0Hz，1H)，7.79(d，J＝2.0Hz，1H)，[α] _D ²⁵+16.3°(c＝0.1，MeOH)。LCMS: for C ₂₄H ₂₉Cl ₂N ₅O ₂, the analytical calculation value: 489.17, experimental value: 490.29[M+H] ⁺

Embodiment 98

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(4-methoxy-benzyl)-2-methyl-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Embodiment 98A:(R)-and 4-(2,4 dichloro benzene base)-6-(4-methoxy-benzyl)-2-methyl-7-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid ethyl ester

Separate (HPLC:Chiralpack by chirality SFC ^AD 4.6 * 250mm; 20%IPA/80%CO ₂) obtain.Embodiment 98A is the enantiomer of very fast wash-out.

Embodiment 98:(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-(4-methoxy-benzyl)-2-methyl-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Use with the similar program of program that is used for embodiment 5 and prepare embodiment 98 by embodiment 98A.[α] _d ²⁵+ 6.64 ° (c=0.1, MeOH); By chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm; 20%EtOH-MeOH in heptane (1: 1)] purity of gained: 91%ee.LCMS: for C ₂₃H ₂₁Cl ₂N ₃O ₂, the analytical calculation value: 441.10, experimental value: 442.34[M+H] ⁺

Embodiment 99

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(((S)-tetrahydrofuran (THF)-2-yl) methyl)-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Except that in step 5A, using (S)-(+)-tetrahydrofurfuryl amine but not the benzylamine, use embodiment 5 described same procedure to prepare embodiment 99.At Chiralcel ^OJ, 20 μ, the non-enantiomer mixture that uses the heptane degree gradient separations such as (containing 0.1% diethylamine) contain 5% to 15%EtOH-MeOH (50%) to be obtained on 5 * 50cm tubing string obtains each diastereomer.

Embodiment 99 (diastereomer A; Move very fast): [α] _D ²⁵+ 17.8 ° (c=0.085, MeOH); By chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250mm; Contain 1 5%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity of gained: 90%ee. ¹H?NMR(400MHz，CD ₃OD)δ?1.55-170(m，1H)，1.80-1.93(m，2H)，1.98-2.10(m，1H)，2.83(s，3H)，3.50-3.85(m，4H)，3.95-4.50(m，5H)，7.41-7.49(m，1H)，7.56-7.63(m，1H)，7.77-7.80(m，1H)。LCMS: for C ₂₀H ₂₁Cl ₂N ₃O ₂, the analytical calculation value: 405.10, experimental value: 406.13[M+H] ⁺HRMS: for C ₂₁H ₂₁Cl ₂N ₃O ₂, the analytical calculation value: 405.1010, experimental value: 406.1094[M+H] ⁺

Embodiment 100

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(((S)-tetrahydrofuran (THF)-2-yl) methyl)-5H-pyrrolo-[3,4-b] pyridines-7 (6H)-ketone, tfa salt

Embodiment 100 (enantiomer B; Move slower): [α] _D ²⁵+ 24.75 ° (c=0.0985, MeOH); By chiral analysis HPLC[Chiralcel ^OJ 4.6 * 250 mm; Contained 15%EtOH-MeOH (1: 1; Contain 0.1%DEA) heptane (containing 0.1%DEA)] purity of gained: 94%ee. ¹H NMR (400MHz, CD ₃OD) δ 1.55-1.68 (m, 1H), 1.85-1.95 (m, 2H), 2.00-2.10 (m, 1H), 2.84 (s, 3H), 3.50-3.85 (m, 4H), 4.02 and 4.24 (AB _q, J=14.5Hz, 2H), 4.08-4.18 (m, 1H), 4.32 (s, 2H), 7.45 (d, J=8.3Hz, 1H) .7.59 (dd, J=8.3,2.0Hz, 1H), 7.79 (d, J=2.0Hz, 1H).LCMS: for C ₂₀H ₂₁Cl ₂N ₃O ₂, the analytical calculation value: 405.10, experimental value: 406.11[M+H] ⁺HRMS: for C ₂₁H ₂₁Cl ₂N ₃O ₂, the analytical calculation value: 405.1010, experimental value: 406.1081[M+H] ⁺

Embodiment 101

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-((the different  azoles of 5-methyl-3-yl) methyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Except that using (the different  azoles of 5-methyl-3-base) methylamine but not the 3-alanine tert-butyl ester, use with above embodiment 37 described same procedure to prepare embodiment 101. ¹H NMR (400 MHz, CD ₃OD) δ 2.38 (s, 3H), 2.82 (s, 3H), 3.94 and 4.18 (AB _q, J=14.5Hz, 2H), 4.57 (s, 2H), 4.72 and 4.78 (AB _q, J=15.8Hz, 2H), 6.08 (s, 1H), 7.32 (d, J=8.3Hz, 1H), 7.53 (dd, J=8.3,2.0Hz, 1H), 7.71 (d, J=2.0Hz, 1H).LCMS: for C ₂₀H ₁₈Cl ₂N ₄O ₂, the analytical calculation value: 416.08, experimental value: 417.15[M+H] ⁺HRMS: for C ₂₀H ₁₈Cl ₂N ₄O ₂, the analytical calculation value: 416.0807, experimental value: 417.0869[M+H] ⁺

Embodiment 102

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-((1,5-dimethyl-1H-pyrazole-3-yl) methyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Remove to use 1,5-dimethyl-1H-pyrazole-3-yl methylamine but not outside the 3-alanine tert-butyl ester, use with above embodiment 37 described same procedure to prepare embodiment 102. ¹H NMR (400 MHz, CD ₃OD) δ 2.23 (s, 3H), 2.81 (s, 3H), 3.72 (s, 3H), 3.93 and 4.17 (AB _q, J=14.5Hz, 2H), 4.45 (s, 2H), 4.58 and 4.64 (AB _q, J=15.0Hz, 2H), 5.97 (s, 1H), 7.33 (d, J=8.3Hz, 1H), 7.51 (dd, J=8.3,2.0Hz, 1H), 7.68 (d, J=2.0Hz, 1H).LCMS: for C ₂₁H ₂₁Cl ₂N ₅O, the analytical calculation value: 429.11, experimental value: 430.21[M+H] ⁺HRMS: for C ₂₁H ₂₁Cl ₂N ₅O, analytical calculation: 429.1123, experimental value: 430.1220[M+H] ⁺

Embodiment 103

(S)-and 3-(amino methyl)-4-(2,4 dichloro benzene base)-6-((1-ethyl-1H-pyrazoles-5-yl) methyl)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Except that using (1-ethyl-1H-pyrazoles-5-yl) methylamine but not the 3-alanine tert-butyl ester, use with above embodiment 37 described same procedure to prepare embodiment 103. ¹H NMR (400MHz, CD ₃OD) δ 1.22 (t, J=8.3Hz, 3H), 2.81 (s, 3H), 3.95 and 4.18 (AB _q, J=14.5Hz, 2H), 4.16 (q, J=8.3Hz, 2H), 4.42 and 4.48 (AB _q, J=15.0Hz, 2H), 4.78 and 4.88 (AB _qJ=15.8Hz, 2H), 6.33 (d, J=1.7Hz, 1H), 7.32 (d, J=8.3Hz, 1H), 7.45 (d, J=1.7Hz, 1H), 7.53 (dd, J=8.3,2.0Hz, 1H), 7.71 (d, J=2.0Hz, 1H).LCMS: for C ₂₁H ₂₁Cl ₂N ₅O, the analytical calculation value: 429.11, experimental value: 430.12[M+H] ⁺HRMS: for C ₂₁H ₂₁Cl ₂N ₅O, analytical calculation: 429.1123, experimental value: 430.1212[M+H] ⁺

Embodiment 104

(S)-(6-(2-amino-2-ketone group ethyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridin-3-yl) the methyl carbamic acid tert-butyl ester

To embodiment 50E (70mg, 0.146mmol), HOBT.H ₂O (29.6mg, 0.218mmol), ammonium chloride (15.6mg, 0.292mmol) add in the mixture in DMF (0.5mL) EDCI (42mg, 0.218mmol), diisopropylethylamine (0.101mL, 0.58mmol).At ambient temperature mixture is stirred and spend the night, then with EtOAc (10mL) and H ₂O (2.5mL) dilution.Organic layer is separated and evaporation in a vacuum, obtain the thick embodiment 104 of product.

Embodiment 105

(S)-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl)-ethanamide, tfa salt

To embodiment 104 products in CH ₂Cl ₂Add TFA (0.5mL) in the solution (1mL), and the mixture that is produced is stirred 3h.Solvent is removed, and, obtained the embodiment 105 of white powder, tfa salt (8.6mg, 12%) by preparation property HPLC (0 to 100%B for Phenomenex Axia, 8min gradient) purifying resistates. ¹H NMR (400MHz, CD ₃OD) δ 2.76 (s, 3H), 3.88 and 4.12 (AB _q, J=15.0Hz, 2H), 4.13 and 4.24 (AB _q, J=17.2Hz, 2H), 4.54 (s, 2H), 7.26 (d, J=8.3Hz, 1H), 7.45 (dd, J=8.3,2.2Hz, 1H), 7.62 (d, J=2.2Hz, 1H).LCMS: for C ₁₇H ₁₆Cl ₂N ₄O ₂, the analytical calculation value: 378.06, experimental value: 379.00[M+H] ⁺, HRMS: for C ₁₇H ₁₆Cl ₂N ₄O ₂, the analytical calculation value: 378.0650, experimental value: 379.0739[M+H] ⁺

Embodiment 106

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

Embodiment 106A:4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

To embodiment 2D (0.38g, 0.76mmol) in the solution of 10mL dehydrated alcohol, add the amino tetrahydrochysene piperazine of 4-mutter (0.18g, 1.8mmol).In microwave under 150 ℃ with reactant at sealed vial internal heating 30min.Reactant is diluted with ethyl acetate, with 1 N HCl, saturated NaHCO ₃The aqueous solution and salt water washing, dry (MgSO ₄) and be condensed into foams.By flash chromatography (with 2: 1 EtOAc/ hexane wash-outs) purifying resistates, obtain 230mg (60%) white solid embodiment 106A.LRMS(ESI)：511.2/513.2[M+H] ⁺。

Embodiment 106B:4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone

At ambient temperature, at H ₂(230mg 0.45mmol) stirs 8h with the mixture of 10%Pd/C (100mg) in the 20mL ethyl acetate with embodiment 106A under (1 normal atmosphere is kept by air bag).Mixture is filtered and concentrates via Celite pad, obtain the carboxylic acid that can directly use.To this acid (130mg, 0.31mmol) in the solution of 6mL THF, add Vinyl chloroformate (45 μ L, 0.47mmol) and triethylamine (110 μ L 0.77mmol), and stir 1h with mixture at ambient temperature.Mixture is filtered removing insolubles, and then make an addition to sodium borohydride in the minimal amount of water (18mg, 0.47mmol).At ambient temperature mixture is stirred 18h.With 1 N HCl stopped reaction, with ethyl acetate extraction, and with organism with the salt water washing, dry (MgSO ₄) and concentrate.By flash chromatography (with the 10%MeOH/EtOAc wash-out) purifying resistates, obtain 40mg (32%) oily embodiment 106B.LRMS(ESI)：407.2/409.2[M+H] ⁺。

Embodiment 106:3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

(33mg is 0.08mmol) in 2mL CH to embodiment 106B ₂Cl ₂Solution in add triethylamine (33 μ L, 0.24mmol) with methylsulfonyl chloride (19 μ L, 0.24mmol).At ambient temperature mixture is stirred 18h.Mixture at sealed vial internal heating 2h, is proceeded to chloride phase so that react completely.Mixture is diluted with ethyl acetate, with 1 N HCl and salt water washing, dry (MgSO ₄) and concentrate, obtain the muriate that can directly use.This muriate in 2mL methyl alcohol (25mg, 0.06mmol) middle ammonia (the 2 M NH in the 6mL methyl alcohol that add ₃, 12mmol), and with mixture 100 ℃ of following heating 15min in microwave.With saturated NaHCO ₃Aqueous solution diluted mixture thing, and with CH ₂Cl ₂With its extracting twice.With organism drying (Na ₂SO ₄) and concentrate.Handle resistates with ethanol/ether, and then add HCl (the 4 N HCls of 33 μ L in two  alkane, 0.14mmol).The slurries that produced are concentrated into dried, and with ether with twice of solid abrasive (triturate) and be dried in a vacuum.Solid is handled with distilled water, filtered, and freeze-drying overnight, obtain the embodiment 106 of 10mg (50%) white powder. ¹H NMR (DMSO-D ₆): δ 8.31 (wide unimodal, 3H), 7.79 (d, 1H, J=1.7Hz), 7.56 (dd, 1H, J=8.2,2.2Hz), 7.47 (d, 1H, J=8.2Hz), 4.54 (AB _q, 2H), 4.15-4.05 (m, 2H), 3.95-3.88 (m, 2H), 3.62-3.55 (m, 1H), 3.40-3.30 (m, 2H), 2.79 (s, 3H), 1.82-1.72 (m, 2H), 1.65-1.57 (m, 2H).LRMS(ESI)：406.2/408.2[M+H] ⁺。

Embodiment 107

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Embodiment 107A:2-(chloromethyl)-5-cyano group-4-(2,4 dichloro benzene base)-6-methyl niacin ethyl ester (novel intermediate)

To 2,4 dichloro benzene formaldehyde (3.1g, 17.8mmol) in the solution of 30mL Virahol, add the 4-chloroacetyl acetacetic ester (3.22g, 19.6mmol), benzylamine (100 μ L, 0.89mmol) and acetate (76 μ L, 1.36mmol).At ambient temperature mixture was stirred 2 days.(1.61g 19.6mmol), and stirs 24h with mixture at ambient temperature then to add the amino propenyl cyanide of 3-.Mixture becomes thick slurries.In addition with 15mL isopropanol mixture, and then add 10mL 12 N HCl.At ambient temperature reactant is stirred 3h, even until mixture.With reactant with H ₂The O dilution, and with ethyl acetate extraction.With organism with saturated NaHCO ₃The aqueous solution and salt water washing, dry (MgSO ₄), filter through silicagel pad, and concentrate, obtain the dihydropyridine that can directly use.(6.5g 17.8mmol), and then adds 25mL 70%HNO to handle resistates with the 60mL glacial acetic acid ₃At ambient temperature mixture is stirred 4h.Carefully pour mixture into H ₂Among the O, and with twice of ethyl acetate extraction.With organism with saturated NaHCO ₃The aqueous solution and salt water washing, dry (MgSO ₄) and concentrate.By flash chromatography (with 6: 1 hexane/EtOAc wash-outs) purifying resistates, obtain oily embodiment 107A (2.2g, 32%), it can slowly solidify through leaving standstill.LRMS(ESI)：383.1/385.1[M+H] ⁺。

Embodiment 107B:4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-nitrile

To embodiment 107A (290mg, 0.76mmol) in the solution of 8mL dehydrated alcohol, add the amino tetrahydrochysene piperazine of 4-mutter (168mg, 1.66mmol).In microwave under 150 ℃ with reactant at sealed vial internal heating 30min.Reactant is diluted with ethyl acetate, with 1 N HCl, saturated NaHCO ₃The aqueous solution and salt water washing, dry (MgSO ₄), filter through silicagel pad, and concentrate so that 270mg (88%) to be provided the embodiment 107B of white solid, its enough pure can be not purified and use.LRMS(ESI)：402.2/404.2[M+H] ⁺。

Embodiment 107C: with 4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-nitrile chiral separation becomes independent atropisomer

Separate the sample of 0.40g racemize embodiment 107B so that two kinds of independent atropisomers to be provided by chirality HPLC (5 * 50cm tubing string is with 30%i-PrOH/ heptane wash-out for Chiralcel AD tubing string, 20 μ).

Embodiment 107C-1 (atropisomer 1; Move very fast): 165mg, by chiral analysis HPLC[Chiralcel AD 4.6 * 250mm; The 30%i-PrOH/ heptane; Residence time 6.8min] purity of gained:＞99%ee.

Embodiment 107C-2 (atropisomer 2; Move slower): 160mg, by chiral analysis HPLC[Chiralcel AD 4.6 * 250mm; The 30%i-PrOH/ heptane; Residence time 14.8min] purity of gained:＞99%ee.

Embodiment 107:3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Embodiment 107C-1 in the invisible spectro 10mL THF of the heavy wall of being furnished with screw-cap (100mg adds wet RaNi (about 300mg, 2400 grades (Yu Shuizhong), humidification) in solution 0.25mmol), add afterwards hydrazine (117 μ L, 3.7mmol).Test tube is tightly covered.Observing gas generates.At ambient temperature mixture is stirred 4h.Mixture is filtered and concentrates in a vacuum through Celite pad.By anti-phase preparation HPLC (with solvent gradient 0%MeOH/H ₂O+0.1%TFA to 100%MeOH+0.1%TFA wash-out) purifying resistates.Merge washing and take off fraction, with saturated NaHCO ₃Free alkalization (free-base), and with CH ₂Cl ₂Extracting twice.Will be through the organism drying (Na of merging ₂SO ₄) and concentrate.With 8: 1 Et ₂O/EtOH handles resistates, and then adds 4 NHCl in the two  alkane (50 μ L).The white depositions that is produced is filtered, with ether washing and dry in a vacuum.Solid is dissolved in the 1mL water, filters, and freeze-drying, obtain the title compound (25mg, 23%) of the embodiment 107 of white solid. ¹H NMR (DMSO-D ₆): δ 8.35 (wide unimodal, 3H), 7.78 (d, 1H, J=1.7Hz), 7.56 (dd, 1H, J=8.2,2.2Hz), 7.49 (d, 1H, J=8.2Hz), 4.54 (AB _q, 2H), 4.1 5-4.05 (m, 2H), 3.95-3.88 (m, 2H), 3.60-3.54 (m, 1H), 3.40-3.30 (m, 2H), 2.79 (s, 3H), 1.82-1.72 (m, 2H), 1.65-1.57 (m, 2H).LRMS(ESI)：406.2/408.2[M+H] ⁺。

Embodiment 108

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Follow program described in the embodiment 107, (atropisomer 2,68mg 0.17mmol) are converted into the title compound (30mg, 40%) of the embodiment 108 of white solid with embodiment 107C-2. ¹HNMR (DMSO-D ₆): δ 8.31 (wide unimodal, 3H), 7.79 (d, 1H, J=1.7Hz), 7.56 (dd, 1H, J=8.2,2.2Hz), 7.49 (d, 1H, J=8.2Hz), 4.54 (AB _q, 2H), 4.1 5-4.05 (m, 2H), 3.95-3.88 (m, 2H), 3.60-3.54 (m, 1H), 3.40-3.30 (m, 2H), 2.79 (s, 3H), 1.82-1.72 (m, 2H), 1.65-1.57 (m, 2H).LRMS(ESI)：406.2/408.2[M+H] ⁺。

Embodiment 109

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-1,1-diketo-2H-sulphur piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Embodiment 109A:4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6-(tetrahydrochysene-2H-sulphur piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

To embodiment 2D (0.63g, 1.28mmol) in the solution of 10mL dehydrated alcohol, add the amino tetrahydrochysene sulphur of 4-piperazine mutter (0.5g, 4.3mmol).In microwave under 150 ℃ with reactant at sealed vial internal heating 30min.Reactant is diluted with ethyl acetate, with 1 N HCl, saturated NaHCO ₃The aqueous solution and salt water washing, dry (MgSO ₄) and be condensed into foams.By flash chromatography (with 2: 1 EtOAc/ hexane wash-outs) purifying resistates, obtain 375mg (56%) white solid embodiment 109A.LRMS(ESI)：527.2/529.2[M+H] ⁺。

Embodiment 109B:4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6-(tetrahydrochysene-1,1-diketo-2H-piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

(0.20g 0.38mmol) adds metachloroperbenzoic acid (m-CPBA that 206mg about 70% is pure, about 0.83mmol) in the solution of 10mL methylene dichloride to embodiment 109A.At ambient temperature reactant is stirred 2h.Reactant is diluted with EtOAc, with saturated NaHCO ₃The aqueous solution and salt water washing, dry (MgSO ₄), filter through silicagel pad, and concentrate in a vacuum so that the embodiment 109B of 210mg (98%) to be provided, its enough pure can be not purified and use.LRMS(ESI)：559.2/561.2[M+H] ⁺。

Embodiment 109:3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(tetrahydrochysene-1,1-diketo-2H-sulphur piperazine is muttered-the 4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Follow program described in the embodiment 106, (210mg 0.38mmol) is converted into the title compound of the embodiment 109 of white solid with embodiment 109B. ¹H NMR (DMSO-D ₆): δ 8.28 (wide unimodal, 3H), 7.79 (d, 1H, J=2.2Hz), 7.56 (dd, 1H, J=8.2,1.7Hz), 7.46 (d, 1H, J=8.3Hz), 4.58 (AB _q, 2H), 4.3 1-4.23 (m, 1H), 4.12-4.05 (m, 1H), 3.60-3.54 (m, 1H), 3.40-3.30 (m, 2H), 3.12-3.07 (m, 2H), 2.78 (s, 3H), 2.30-2.20 (m, 2H), 2.05-1.96 (m, 2H).LRMS(ESI)：454.2/456.2[M+H] ⁺。

Embodiment 110

6-(2-amino-ethyl)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Embodiment 110A:6-(2-tert.-butoxy carbonyl amino) ethyl)-and 4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

With embodiment 2D (2.56g, 5.21mmol), the tertiary butyl-N-(2-amino-ethyl) carbamate (0.92g, 5.73mmol) and triethylamine (1.08mL, 7.82mmol) mixture in acetonitrile (150mL) in sealed vial at 110 ℃ of following heating 3h.With solvent evaporation, and, obtain 2.45g (83%) white solid embodiment 110A by flash chromatography (with 0 to 100%EtOAc/ hexane wash-out) purifying resistates. ¹H?NMR(400MHz，CDCl ₃)：δ1.34(s，9H)，2.73(s，3H)，3.36(m?2H)，3.65(m?2H)，4.51(AB _q，2H)，5.09(AB _q，2H)，6.98(d，1H)，7.11(m，3H)，7.28(m，4H)。LRMS(ESI)：470.2(M+H-BOC) ⁺。

Embodiment 110B:6-(2-tert.-butoxy carbonyl amino) ethyl)-and 4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

At ambient temperature, at H ₂(2.45g 4.30mmol) stirs 2h with the mixture of 10%Pd/C (122mg) in 120mL methyl alcohol with embodiment 110A under (1atm keeps by air bag).Mixture is filtered and concentrates through Celite pad, obtain the embodiment 110B of 2.08g (100%) solid state, it is not purified just to can be used for next reaction. ¹H?NMR(400MHz，CDCl ₃)：δ1.34(s，9H)，2.74(s，3H)，3.36(m?2H)，3.65(m?2H)，4.50(AB _q，2H)，7.14(d，1H，J＝8.0Hz)，7.28(m，1H)，7.48(s，1H)。LRMS(ESI)：480.2[M+H] ⁺。

Embodiment 110C:2-(4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl carbamic acid tert-butyl ester

(2.04g is 4.13mmol) in 60mL CH to embodiment 110B ₂Cl ₂Solution in add DMF (5) (2M be in CH with oxalyl chloride ₂Cl ₂In, 4.13mL, 8.26mmol).At ambient temperature mixture is stirred 1h.With solvent evaporation, and resistates is dissolved among the THF (60mL), the solution that is produced is cooled to-78 ℃, and add LAH (1 M in THF, 4.1mL, 4.1mmol).Stir 15min.To react with the 0.1 N HCl aqueous solution and end and it is extracted among the EtOAc.Will be through the organic layer Yi Shui and the salt water washing of merging, dry (MgSO ₄) and evaporation, by flash chromatography (with 0-100%EtOAc/ hexane wash-out) purifying resistates, obtain the embodiment 110C of 2.45g (83%) solid state. ¹H?NMR(400MHz，CDCl ₃)：δ1.36(s，9H)，2.86(s，3H)，3.39(m?2H)，3.67(m?2H)，4.46-4.58(m，4H)，7.19(d，1H，J＝8.0Hz)，7.28(dd，1H，J＝8.0，1.4Hz)，7.54(s，1H)。LRMS(ESI)：466.3[M+H] ⁺。

Embodiment 110D:2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl carbamic acid tert-butyl ester

To embodiment 110C (30mg, 0.065mmol) in the solution of 1.5mL methylene dichloride, add triethylamine (26 μ L, 0.19mmol) and methylsulfonyl chloride (15 μ L, 0.19mmol).With the mixture 1h that refluxes.Evaporating solvent, and, obtain the muriate intermediate by flash chromatography (with 0-100%EtOAc/ hexane wash-out) purifying resistates.Mixture in MeOH (1mL) shines 20min under 120 ℃ in microwave reactor in sealed tube with gained muriate and 7 N ammonia.With solvent evaporation, and pass through flash chromatography (with 0-10%MeOH/CH ₂Cl ₂Wash-out) purifying resistates obtains 12mg (2 steps, 59%) oily embodiment 110D.LRMS(ESI)：365.2(M+H-BOC) ⁺。

Embodiment 110:6-(2-amino-ethyl)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone, tfa salt

At ambient temperature with 1ml in CH ₂Cl ₂In 40%TFA in embodiment 110D (10mg 0.02mmol) stirs 60min.With solvent evaporation, and, obtain 4.9mg (38%) and be the embodiment 110 of tfa salt by preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates and freeze-drying overnight.LRMS(ESI)：365.2[M+H] ⁺。

Embodiment 111

2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl carbamic acid ethyl ester, tfa salt

Embodiment 111A and 111B: (4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl carbamic acid tert-butyl ester chiral separation is independent atropisomer with 2-

Embodiment 111A embodiment 111B

Sample by chirality HPLC (5 * 50cm tubing string is with 0-10%i-PrOH/ heptane wash-out for Chiralcel OD tubing string, 20 μ) separation 1.95g racemize embodiment 110C obtains two kinds of independent atropisomers.

Embodiment 111A (atropisomer 1; Move very fast): 740mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 12%i-PrOH/ heptane; Residence time 6.5min] purity of gained:＞99%ee.

Embodiment 111B (atropisomer 2; Move slower): 662mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 12%i-PrOH/ heptane; Residence time 11.0min] purity of gained:＞99%ee.

Embodiment 111:2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl carbamic acid ethyl ester tfa salt

With 1, (58mg 0.12mmol) stirs 15min to the embodiment 111B among the 1mL 4 M HCl in the 4-two  alkane at ambient temperature.In a vacuum mixture is concentrated.Resistates is dissolved in 2ml CH ₂Cl ₂In, and with Et ₃N (25 μ L, 0.18mmol) and Vinyl chloroformate (13 μ L 0.13mmol) are added in the solution.At ambient temperature the mixture that is produced is stirred 15min.With mixture through SiO ₂Rubber cushion filters.With solvent evaporation, and with 3mL CH ₂Cl ₂In MsCl (19 μ L, 0.24mmol) and Et ₃(50mL 0.36mmol) handles resistates to N.Under 50 ℃, reactant is stirred 1h and concentrated, obtain crude product, crude product flash chromatography (silica gel, 0-15%EtOAc/CH ₂Cl ₂) obtain the muriate intermediate.Mixture in MeOH (2mL) shines 16min under 100 ℃ in microwave reactor in sealed tube with gained muriate and 2N ammonia.In a vacuum volatile matter is removed, and, obtained 12mg (3 step 18%) and be the embodiment 111 of tfa salt by preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates and freeze-drying overnight. ¹H?NMR(400MHz，DMSO-D ₆)：δ1.08(m，3H)，2.76(s，3H)，3.19(m?2H)，3.48(m?2H)，3.88(m，4H)，4.55(Ab _q，2H)，7.18(s，1H).7.39(d，1H，J＝4.0Hz)，7.57(d，1H，J＝4.0Hz)，7.80(s，1H)，8.12(s，2H)。LRMS(ESI)：437.2[M+H] ⁺。

Embodiment 112

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl) ethanamide tfa salt

Replace outside the Vinyl chloroformate divided by Acetyl Chloride 98Min., use above embodiment 111 described same procedure to prepare embodiment 112.LRMS(ESI)：407.2[M+H] ⁺。

Embodiment 112-1

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl) ethanamide tfa salt

Replace Vinyl chloroformate and, use above embodiment 112 described same procedure to prepare embodiment 112-1 divided by Acetyl Chloride 98Min. with outside the embodiment 111A alternative embodiment 111B.LRMS(ESI)：407.2[M+H] ⁺。

Embodiment 113

3-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl)  azoles alkane-2-keto hydrochloride

With 1, (78mg 0.17mmol) stirs 15min to the embodiment 111B among the 1mL 4 M HCl in the 4-two  alkane at ambient temperature.In a vacuum mixture is concentrated.Resistates is dissolved in the 2ml methyl alcohol, with K ₂CO ₃(230mg, 1.7mmol) and chloroformic acid 2-bromine methyl esters (46mg 0.25mmol) is added in the solution.At ambient temperature the mixture that is produced is stirred 15min.With mixture through SiO ₂Rubber cushion filters.With solvent evaporation, and with 3mL CH ₂Cl ₂In MsCl (0.13mL, 1.70mmol) and Et ₃(0.23mL 1.70mmol) handles resistates to N.At ambient temperature reactant is kept 12h and concentrated, obtained crude product, (silica gel 100%EtOAc) obtains the muriate intermediate with the crude product flash chromatography.Mixture in MeOH (3mL) shines 20min under 100 ℃ in microwave reactor in sealed tube with gained muriate and 2N ammonia.In a vacuum volatile matter is removed.Crude product is passed through flash chromatography (with 0-10%MeOH/CH ₂Cl ₂Wash-out) purifying is handled with 2 N HCl among the MeOH, and evaporation, obtains the embodiment 113 of 10.1mg (4 steps, 13%) solid state. ¹H?NMR(400MHz，CDCl ₃)：δ?2.82(s，3H)，3.51-3.76(m?8H)，4.22(m?2H)，4.50(m，2H)，7.14(d，1H，J＝8.3Hz)，7.35(dd，1H，J＝8.3，1.7Hz)，7.54(d，2H，J＝1.3Hz)。LRMS(ESI)：435.1[M+H] ⁺。

Embodiment 114

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(2-Ketopyrroles alkane-1-yl) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone tfa salt

Replace outside the chloroformic acid 2-bromine methyl esters divided by the 4-bromobutanoylchloride, use above embodiment 113 described same procedure to prepare embodiment 114.LRMS(ESI)：433.2[M+H] ⁺。

Embodiment 115

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl) cyclopropyl-sulfonylamide hydrochloride

With 1, (70mg 0.15mmol) stirs 15min to the embodiment 111B among the 1mL 4 M HCl in the 4-two  alkane at ambient temperature.In a vacuum mixture is concentrated.Resistates is dissolved in 2ml CH ₂Cl ₂In, and with Et ₃N (0.2mL, 1.5mmol) and encircle third SULPHURYL CHLORIDE (25mg 0.18mmol) is added in the solution.At ambient temperature the mixture that is produced is stirred 6h.Interpolation MsCl (92 μ L, 1.2mmol).At ambient temperature reactant is kept 1h and concentrated, obtained crude product, (silica gel 100%EtOAc) obtains the muriate intermediate with the crude product flash chromatography.Mixture in MeOH (2mL) shines 30min under 140 ℃ in microwave reactor in sealed tube with gained muriate and 2 N ammonia.In a vacuum volatile matter is removed.Crude product is passed through flash chromatography (with 0-10%MeOH/CH ₂Cl ₂Wash-out) purifying is handled with 2 N HCl among the MeOH, and evaporation, obtains the embodiment 115 of 18mg (4 steps, 24%) solid state. ¹H NMR (400MHz, CDCl ₃): δ 0.92 (m, 2H), 1.11 (d, 2H, J=2.7Hz), 2.35 (m 1H), 2.84 (s, 3H), 3.44 (wide unimodal, 2H), 3.66-3.78 (m, 4H), 4.51 (s, and 2H) 7.16 (d, IH, J=8.2Hz), 7.35 (dd, 1H, J=8.3,1.6Hz), 7.54 (d, 2H, J=1.6Hz).LRMS(ESI)：469.1[M+H] ⁺。

Embodiment 116

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl) benzsulfamide hydrochloride

Replace outside ring third SULPHURYL CHLORIDE divided by benzene sulfonyl chloride, use above embodiment 115 described same procedure to prepare embodiment 116. ¹H?NMR(400?MHz，CDCl ₃)：δ?2.84(s，3H)，3.24(m，2H)，3.66(m，3H)，3.76(d，1H，J＝13.8Hz)，4.34(AB _q，2H)，7.15(d，1H，J＝8.3Hz)，7.40(m，3H)，7.54(m，2H)，7.79(d，2H，J＝7.1Hz)。LRMS(ESI)：505.1[M+H] ⁺。

Embodiment 117

With 1, (85mg 0.18mmol) stirs 15min to the embodiment 111B among the 1mL 4 M HCl in the 4-two  alkane at ambient temperature.In a vacuum mixture is concentrated.Resistates is dissolved among the 2ml THF, with t-BuONa (86mg, 0.9mmol) and 3-encircle third SULPHURYL CHLORIDE (39mg 0.22mmol) be added in the solution.At ambient temperature the mixture that is produced is stirred 1h.With mixture through SiO ₂Rubber cushion filters.With solvent evaporation, and with 5mL CH ₂Cl ₂In MsCl (0.08mL, 1.0mmol) and Et ₃(0.14mL 1.0mmol) handles resistates to N.At ambient temperature reactant is kept 3 h and concentrated, obtained crude product, (silica gel 100%EtOAc) obtains muriate intermediate (43 mg, 48%) with the crude product flash chromatography.Mixture in MeOH (3mL) shines 20min under 120 ℃ in microwave reactor in sealed tube with gained muriate and 2 N ammonia.In a vacuum volatile matter is removed.Crude product is passed through flash chromatography (with 0-10%MeOH/CH ₂Cl ₂Wash-out) purifying is handled with 2 N HCl among the MeOH, and evaporation, obtains the embodiment 117 of 12 mg (30%) solid state. ¹H?NMR(400?MHz，CDCl ₃)：δ?2.27(m，2H)，2.83(s，3H)，3.02(m，2H)，3.27(m，2H)，3.35(m，2H)，3.61-3.78(m，4H)，4.53(AB _q，2H)，7.14(d，1H，J＝8.3Hz)，7.36(dd，1H，J＝7.7，1.6Hz)，7.53(d，1H，J＝1.7Hz)。LRMS(ESI)：469.1[M+H] ⁺。

Embodiment 118

2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl) (methyl) t-butyl carbamate

Embodiment 118A:6-(2-tertbutyloxycarbonyl (methyl) amino) ethyl)-and 4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

Replace outside the 2-aminoethylamino t-butyl formate divided by 2-amino-ethyl (methyl) t-butyl carbamate, use the described same procedure of above embodiment 110A to prepare embodiment 118A.LRMS(ESI)：584.3[M+H] ⁺。

Embodiment 118B:6-(2-tertbutyloxycarbonyl (methyl) amino) ethyl)-and 4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

Outside embodiment 118A alternative embodiment 110A, use the described same procedure of above embodiment 110B to prepare embodiment 118B.LRMS(ESI)：394.2(M+H-BOC) ⁺。

Embodiment 118C:2-(4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyls (methyl) t-butyl carbamate

Outside embodiment 118B alternative embodiment 110B, use the described same procedure of above embodiment 110C to prepare embodiment 118 C.LRMS(ESI)：380.2/480.2(M+H-BOC/M+H) ⁺。

Embodiment 118D and 118E: (4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyls (methyl) t-butyl carbamate chiral separation is independent atropisomer with 2-

Embodiment 118D embodiment 118E

Sample by chirality HPLC (5 * 50cm tubing string is with 0-10%i-PrOH/ heptane wash-out for Chiralcel OD tubing string, 20 μ) separation 875mg racemize embodiment 118C obtains two kinds of independent atropisomers.

Embodiment 118D (atropisomer 1; Move very fast): 248mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 12%i-PrOH/ heptane; Residence time 11.5min] purity of gained:＞99%ee.

Embodiment 111E (atropisomer 2; Move slower): 240mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 12%i-PrOH/ heptane; Residence time 17.5min] purity of gained:＞99%ee. ¹H NMR (400 MHz, CDCl ₃): δ 1.35 (s, 9H), 2.85 (m, 6H), 3.54 (m, 2H), 3.69 (wide unimodal, 2H), 4.45-4.50 (m, 4H), 7.17 (d, 1H, J=8.3Hz), 7.36 (dd, 1H, J=8.3,1.7Hz), 7.53 (d, 1H, J=1.7Hz).LRMS(ESI)：380.2/480.2[M+H] ⁺。

Embodiment 118:2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyls (methyl) t-butyl carbamate

Outside embodiment 118E alternative embodiment 110C, use the described same procedure of above embodiment 110D to prepare embodiment 118. ¹H?NMR(400MHz，CDCl ₃)：δ?1.35(s，9H)，2.83(s，3H)，2.86(s，3H)，3.45(m，1H)，3.691-3.77(m，3H)，4.48(m，2H)，7.12(d，1H，J＝8.3Hz)，7.36(dd，1H，J＝8.3，2.2Hz)，7.53(d，1H，J＝2.2Hz)。LRMS(ESI)：379.2/479.2[M+H] ⁺。

Embodiment 119

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(methylamino-) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

With 1, (15.8mg 0.03mmol) stirs 15min to the embodiment 118 among the 1mL 4 M HCl in the 4-two  alkane at ambient temperature.With the mixture concentration and evaporation, obtain the embodiment 119 of 13.2mg (98%) yellow solid shape in a vacuum.NMR(400MHz，DMSO-D ₆)：δ?2.81(s，3H)，3.15(d，2H，J＝5.5Hz)，3.56(m，1H)，3.70(m，1H)，3.79(m，1H)，4.07(m，1H)，4.61(m，5H)，7.56(s，2H)，7.77(s，1H)，8.58(s，2H)，9.05(m，1H)。LRMS(ESI)：379.2[M+H] ⁺。

Embodiment 120

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl)-N-methyl ethyl sulfonamide hydrochloride

Embodiment 120A:3-(chloromethyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(2-(methylamino-) ethyl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

(240mg is 0.50mmol) in 5mL CH to embodiment 118E ₂Cl ₂Solution in add Et ₃N (0.7mL, 5mmol) with methylsulfonyl chloride (0.39mL, 5mmol).At ambient temperature the mixture that is produced is stirred and spend the night.In a vacuum mixture is concentrated.With resistates flash chromatography (silica gel, 100%EtOAc), obtain solid, at ambient temperature with its at 10ml in 1, stir 30min among 4 N-HCl in the 4-two  alkane, reaction mixture is concentrated, obtains the embodiment 120A of 186mg (86%) solid state, its enough pure can be not purified and use.LRMS(ESI)：398.1/400.1[M+H] ⁺。

(40mg is 0.09mmol) in 2mL CH to embodiment 120A ₂Cl ₂Solution in add Et ₃N (0.13mL, 0.93mmol) with ethyl sulfonyl chloride (100mg, 0.93mmol).At ambient temperature the mixture that is produced is stirred and spend the night.Reactant is concentrated, obtain crude product, (silica gel 100%EtOAc) obtains the muriate intermediate with its flash chromatography.Mixture in MeOH (2mL) shines 15min under 120 ℃ in microwave reactor in sealed tube with gained muriate and 2 N ammonia.In a vacuum volatile matter is removed.Crude product is passed through flash chromatography (with 0-10%MeOH/CH ₂Cl ₂Wash-out) purifying is handled with 2 N HCl among the MeOH, and evaporation, obtains the embodiment 120 of 11mg (2 steps, 24%) solid state. ¹H?NMR(400MHz，CDCl ₃)：δ?1.25(m，3H)，2.83(s，3H)，2.90(s，3H)，2.94(m，2H)，3.61-3.80(m，4H)，4.52(s，3H)，7.14(d，1H，J＝8.3Hz)，7.36(dd，1H，J＝2.2，8.2Hz)，7.53(d，1H，J＝1.6Hz)，LRMS(ESI)：471.1[M+H] ⁺。

Embodiment 121

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl)-N-methyl Toluidrin tfa salt

Replace outside the ethyl sulfonyl chloride divided by methylsulfonyl chloride, use above embodiment 120 described same procedure to prepare embodiment 121, and obtain tfa salt but not HCl salt. ¹H?NMR(400?MHz，DMSO-D ₆)：δ2.73(s，3H)，2.76(s，3H)，2.82(s，3H)，3.28(m，2H)，3.63(m，3H)，4.08(m，1H)，4.55(s，2H)，7.40(d，1H，J＝2.2Hz)，7.55(dd，1H，J＝1.7，8.3Hz)，7.79(d，1H，J＝2.0Hz)，8.2(s，2H)。LRMS(ESI)：457.2[M+H] ⁺。

Embodiment 122

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl)-N-methyl cyclopropane sulfonamide hydrochloride

Replace outside the ethyl sulfonyl chloride divided by the cyclopropane SULPHURYL CHLORIDE, use above embodiment 120 described same procedure to prepare embodiment 122. ¹H?NMR(400MHz，CDCl ₃)：δ?0.93-1.26(m，4H)，2.22(m，1H)，2.83(s，3H)，2.90(s，3H)，3.48(m，2H)，3.61-3.78(，4H)，4.52(s，2H)，7.15(d，1H，J＝8.3Hz)，7.35(dd，1H，J＝8.3，1.6Hz)，7.53(d，1H，J＝1.7Hz)，LRMS(ESI)：483.1[M+H] ⁺。

Embodiment 123

N-2-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) ethyl)-1,1,1-three fluoro-N-methyl Toluidrin hydrochlorides

Replace outside the ethyl sulfonyl chloride divided by trifluoroacetic anhydride, use above embodiment 120 described same procedure to prepare embodiment 123.LRMS(ESI)：511.1[M+H] ⁺。

Embodiment 124

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(piperidin-4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone tfa salt

Embodiment 124A:6-(1-(tertbutyloxycarbonyl) piperidin-4-yl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

With embodiment 2D (1.60g, 3.26mmol), 4-amino-1-N-BOC-piperidines (716mg, 3.58mmol) and triethylamine (0.68mL, 4.89mmol) mixture in acetonitrile (100mL) in sealed vial at 110 ℃ of following heating 3h.With solvent evaporation, and, obtain 1.32g (66%) solid state embodiment 124A by flash chromatography (with 0-100%EtOAc/ hexane wash-out) purifying resistates. ¹H?NMR(400MHz，CDCl ₃)：δ1.46(s，9H)，1.60-1.88(m，5H)，2.73(s，3H)，2.75(m，2H)，4.20-4.42(m，4H)，5.10(m，2H)，7.00-7.11(m，4H)，7.30(m，4H)，LRMS(ESI)：554.2(M+H-t-Bu) ⁺。

Embodiment 124B:6-(1-(tertbutyloxycarbonyl) piperidin-4-yl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

At ambient temperature, at H ₂(1.32g 2.17mmol) stirs 2h with the mixture of 10%Pd/C (66mg) in 90mL methyl alcohol with embodiment 124A under (1atm keeps by air bag).Mixture is filtered and concentrates through Celite pad, obtain the embodiment 124B of 1.10g (98%) solid state, it is enough pure, can be not purified and use. ¹H?NMR(400MHz，CDCl ₃)：δ?1.46(s，9H)，1.63-1.81(m，4H)，2.75(m，4H)，3.46(s，2H)，4.20-4.43(m，4H)，7.16(d，1H)，7.27(d，1H)，7.46(s，1H)。LRMS(ESI)：464.1(M+H-t-Bu) ⁺。

Embodiment 124C:4-(4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) piperidines-1-carboxylic acid tert-butyl ester

(1.38g is 2.66mmol) in 80mL CH to embodiment 124B ₂Cl ₂Solution in add DMF (3) (2 M be in CH with oxalyl chloride ₂Cl ₂In, 1.4mL, 2.80mmol).At ambient temperature mixture is stirred 1h.The interpolation triethylamine (0.74mL, 5.32mmol).With solvent evaporation, and with residue purified, obtain solid by flash chromatography (with 0-100%EtOAc/ hexane wash-out), this solid is dissolved among the THF (100mL), the solution that is produced is cooled to-78 ℃, and (1 M is in THF to add LAH, 2.7mL, 2.7mmol).Stir 30min.With reaction soln through SiO ₂Rubber cushion filters.In a vacuum volatile matter is removed, obtained the thick embodiment 124C of 1.38g buttery.LRMS(ESI)：450.2(M+H-t-Bu) ⁺。

Embodiment 124D and 124E: (4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) piperidines-1-carboxylic acid tert-butyl ester chiral separation becomes independent atropisomer with 4-

Embodiment 124D embodiment 124E

Sample by the thick racemize embodiment 124C of chirality HPLC (5 * 50cm tubing string is with 0-20%i-PrOH/ heptane wash-out for Chiralcel OD tubing string, 20 μ) separation 1.38g obtains two kinds of independent atropisomers.

Embodiment 124D (atropisomer 1; Move very fast): 313mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 20%i-PrOH/ heptane; Residence time 7.7min] purity of gained:＞99%ee.

Embodiment 124E (atropisomer 2; Move slower): 292mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 20%i-PrOH/ heptane; Residence time 11.6min] purity of gained:＞99%ee.

Embodiment 124:3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(piperidin-4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone tfa salt

(50mg is 0.10mmol) in 2mL CH to embodiment 124E ₂Cl ₂Solution in add Et ₃N (43 μ L, 0.3mmol) with methylsulfonyl chloride (23 μ L, 0.3mmol).With the mixture backflow 1h that is produced.Reactant is concentrated, obtain crude product, (silica gel 100%EtOAc) obtains the muriate intermediate with the crude product flash chromatography.Mixture in MeOH (2mL) shines 15min down at 100 ℃ in microwave reactor in sealed tube with gained muriate and 2 N ammonia.In a vacuum volatile matter is removed.With resistates at 2ml TFA/CH ₂Cl ₂Stir 15min in (1: 1).Mixture is concentrated, and, obtain 22 mg (40%) and be the embodiment 124 of tfa salt by preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates and with its freeze-drying overnight. ¹H NMR (400MHz, DMSO-D ₆): δ 1.79 (m, 2H), 1.91 (m, 2H), 2.7 (3,3H), 2.95 (wide unimodal, 2H), 3.32 (d, 2H), 3.59 (d, 1H), 4.12 (m, 2H), 4.45 (m, 2H), 7.38 (d, 1H), 7.49 (d, 1H), 7.72 (s, 1H) .LRMS (ESI): 405.2[M+H] ⁺

Embodiment 125

3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6-(1-(methylsulfonyl) piperidin-4-yl)-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone tfa salt

At ambient temperature with 2ml TFA/CH ₂Cl ₂(50mg 0.10mmol) stirs 30min to embodiment 124E in (1: 1).In a vacuum mixture is concentrated.Resistates is dissolved in 2ml CH ₂Cl ₂, Et ₃N (43 μ L, 0.3mmol) and methylsulfonyl chloride (23 μ L, 0.3mmol).With the mixture backflow 1h that is produced.Reactant is concentrated, obtain crude product, (silica gel 100%EtOAc) obtains the muriate intermediate with the crude product flash chromatography.Mixture in MeOH (2mL) shines 15min down at 100 ℃ in microwave reactor in sealed tube with gained muriate and 2 N ammonia.In a vacuum volatile matter is removed.By preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates and with its freeze-drying overnight, obtaining 8mg (3 steps, 13%) is the embodiment 125 of tfa salt.LRMS(ESI)：483.2[M+H] ⁺。

Embodiment 126

6-(1-ethanoyl piperidin-4-yl)-3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-ketone tfa salt

At ambient temperature with 2ml TFA/CH ₂Cl ₂(50mg 0.10mmol) stirs 30min to embodiment 124E in (1: 1).In a vacuum mixture is concentrated.Resistates is dissolved in 2ml CH ₂Cl ₂, Et ₃N (27 μ L, 0.2mmol) and Acetyl Chloride 98Min. (8 μ L, 0.1mmol) in.With the mixture backflow 30min that is produced.Reactant concentrated obtain crude product, (silica gel 100%EtOAc) obtains intermediate, and this intermediate is dissolved in 2ml CH with this crude product flash chromatography ₂Cl ₂In, add Et ₃N (43 μ L, 0.3mmol) and methylsulfonyl chloride (23 μ L, 0.3mmol).With the mixture backflow 1h that is produced.Reactant is concentrated, obtain crude product, (silica gel 100%EtOAc) obtains the muriate intermediate with this crude product flash chromatography.Mixture in MeOH (2mL) shines 15min down at 100 ℃ in microwave reactor in sealed tube with gained muriate and 2N ammonia.In a vacuum volatile matter is removed.By preparation property HPLC (20 to 100%B for Phenomenex, 10min gradient) purifying resistates and with its freeze-drying overnight, obtaining 4mg (4 steps, 7%) is the embodiment 126 of tfa salt.LRMS(ESI)：447.2[M+H] ⁺。

Embodiment 127

4-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) piperidines-1-carboxylic acid, ethyl ester tfa salt

Replace outside the Acetyl Chloride 98Min. divided by Vinyl chloroformate, use above embodiment 126 described same procedure to prepare embodiment 127.LRMS(ESI)：477.2[M+H] ⁺。

Embodiment 128

3-(amino methyl)-6-((S)-1-(cyclopropyl alkylsulfonyl) tetramethyleneimine-3-yl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Embodiment 128A:6-((S)-1-(tertbutyloxycarbonyl) tetramethyleneimine-3-yl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid benzyl ester

Replace outside 4-amino-1-N-BOC-piperidines divided by (S)-(-)-1-BOC-3-amino-pyrrolidine, use above embodiment 124 described same procedure to prepare embodiment 128A.LRMS(ESI)：540.2(M+H-t-Bu) ⁺。

Embodiment 128B:6-((S)-1-(tertbutyloxycarbonyl) tetramethyleneimine-3-yl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-3-carboxylic acid

Outside embodiment 128A alternative embodiment 124A, use the described same procedure of above embodiment 124B to prepare embodiment 128B.LRMS(ESI)：406.1/450.1(M+H-BOC/M+H-t-Bu) ⁺。

Embodiment 128C:4-(3-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tetramethyleneimine-1-carboxylic acid tert-butyl ester

Outside embodiment 128B alternative embodiment 124B, use the program that is similar to embodiment 124C to prepare embodiment 128C.

Embodiment 128D and 128E:3-((S)-4-(2,4 dichloro benzene base)-3-(methylol)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tetramethyleneimine-1-carboxylic acid tert-butyl ester

Outside embodiment 128C alternative embodiment 124C, use the described same procedure of above embodiment 124C to prepare embodiment 128D and 128E.(silica gel 0-100%EtOAc) produces two kinds of independent atropisomers to flash chromatography.

Embodiment 128D (atropisomer 1; Move very fast): 158mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 15%i-PrOH/ heptane; Residence time 11.5min] purity of gained:＞99%ee. ¹H NMR (400 MHz, CDCl ₃): δ 1.45 (s, 9H), 1.47 (m, 2H), 2.10 (wide unimodal, 1H), 2.23 (wide unimodal, 1H), 2.86 (s, 3H), 3.42 (m, 2H), 3.61 (m, 2H), 4.47 (m, 3H), 4.58 (d, 1H), 4.86 (m, 1H), 7.17 (d, 1H, J=8.0), 7.36 (m, 1H), 7.54 (s, 1H).LRMS(ESI)：436.1[M+H] ⁺。

Embodiment 128E (atropisomer 2; Move slower): 170mg, by chiral analysis HPLC[Chiralcel OD 4.6 * 250mm; The 15%i-PrOH/ heptane; Residence time 16.3min] purity of gained:

Embodiment 128:3-(amino methyl)-6-((S)-1-(cyclopropyl alkylsulfonyl) tetramethyleneimine-3-yl)-4-(2,4 dichloro benzene base)-2-methyl-6,7-dihydro-5H-pyrrolo-[3,4-b] pyridine-5-keto hydrochloride

Outside embodiment 128D alternative embodiment 111B, use above embodiment 115 described same procedure to prepare embodiment 128. ¹H?NMR(400MHz，CDCl ₃)：δ?1.00(m，2H)，1.20(m，2H)，2.17(s，1H)，2.35(m，2H)，2.83(s，3H)，3.47(m，2H)，3.63-3.78(m，4H)，4.51(AB _q，2H)，4.96(m，IH)，7.15(d，1H，J＝8.3)，7.36(dd，H，J＝8.2，2.2Hz)，7.54(d，1H，J＝1.7Hz)。LRMS(ESI)：495.0[M+H] ⁺。

Embodiment 129

3-((S)-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tetramethyleneimine-1-base alkylsulfonyl) cyanobenzene hydrochloride

Replace outside the cyclopropane SULPHURYL CHLORIDE divided by embodiment 128D alternative embodiment 111B and with 4-cyano group benzene sulfonyl chloride, use above embodiment 115 described same procedure to prepare embodiment 129. ¹H?NMR(400MHz，CDCl ₃)：δ2.02-2.20(m，2H)，2.84(s，3H)，3.20(m，1H)，3.45(m，2H)，3.63(m，2H)，3.74(m，1H)，4.31(d，2H，J＝4.9Hz)，4.75(m，1H)，7.10(d，1H，J＝7.7Hz)，7.35(dd，H，J＝7.7，1.7Hz)，7.55(d，1H，J＝1.4Hz)，7.82(d，2H，J＝8.2Hz)，7.93(d，2H，J＝8.2Hz)，LRMS(ESI)：556.0/558.0[M+H] ⁺。

Embodiment 130

3-((S)-(3-(amino methyl)-4-(2,4 dichloro benzene base)-2-methyl-5-ketone group-5H-pyrrolo-[3,4-b] pyridines-6 (7H)-yl) tetramethyleneimine-1-carboxylic acid, ethyl ester hydrochloride

Replace outside the cyclopropane SULPHURYL CHLORIDE divided by embodiment 128D alternative embodiment 111B and with Vinyl chloroformate, use above embodiment 115 described same procedure to prepare embodiment 130.LRMS(ESI)：463.0[M+H] ⁺。

Claims (25)

1. the compound of a formula (I):

Or its pharmacy acceptable salt and prodrug ester class and all steric isomers thereof, wherein:

One or two pair key in 5 yuan of rings of expression I, and 6 yuan of rings of I are aromatic ring;

N is 1 or 2;

R is the functional group that is selected from following group: hydrogen (H), halogen, CF ₃Cyano group (CN), amino, the amino that is substituted, alkyl, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, bicyclic alkyl, the bicyclic alkyl alkyl, alkylthio alkyl, the alkylthio-aryl alkyl, cycloalkenyl group, aryl, arylalkyl, heteroaryl, heteroarylalkyl, encircle mix alkyl and the assorted alkyl-alkyl of ring, wherein arbitrary this functional group is optional can be replaced through one to three substituting group (as if possibility) that is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl;

X is identical with Z or different, and is independently selected from CH ₂, CH, C=O, C=CR ₃R ₄, C=S, C=NR ₃And CR ₃R ₄, R wherein ₃With R ₄Be alkyl or aryl;

A is the functional group that is selected from following group: hydrogen (H), alkyl, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, bicyclic alkyl, bicyclic alkyl alkyl, alkylthio alkyl, alkylthio-aryl alkyl, cycloalkenyl group, aryl, arylalkyl, heteroaryl, heteroarylalkyl, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, O-R ₁, cyano group, amino ,-C (O)-OH ,-C (O)-NR ₁R ₂,-C (O)-OR ₁, S (O) _m-R ₁,-S (O) ₂NR ₁R ₂,-NR ₁R ₂,-NR ₁-C (O) R ₂,-NR ₁-SO ₂R ₂, wherein arbitrary this functional group is optional can be replaced through one to three substituting group (if possibility) that independently is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carboxyl, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, the assorted alkyl amino-carbonyl of ring, the assorted alkyl-carbonyl of ring, assorted aromatic aminocarbonyl, assorted alkyl (alkyl) aminocarboxyl of ring, naphthene sulfamide base (alkyl) amino, halosulfonyl groups (alkyl) amino, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, dialkylamino carbonyl (wherein this alkyl is identical or different), the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl;

M is 0,1 or 2;

R ₁With R ₂Identical or different, and:

(i) each is independently for being selected from the functional group of following group: hydrogen (H), alkyl, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, bicyclic alkyl, the bicyclic alkyl alkyl, alkylthio alkyl, the alkylthio-aryl alkyl, cycloalkenyl group, aryl, arylalkyl, heteroaryl, heteroarylalkyl, encircle mix alkyl and the assorted alkyl-alkyl of ring, wherein arbitrary functional group is optional can be replaced through one to three substituting group (as if possibility) that independently is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl; Or

(ii) NR ₁R ₂In R ₁With R ₂Can together form 5 yuan or 6 yuan of saturated or undersaturated loop systems of part, it is selected from Heterocyclylalkyl, assorted bicyclic alkyl, heteroaryl and bicyclic heteroaryl, wherein this loop systems is optional can replace through one to three substituting group (if possibility) that independently is selected from following group: hydrogen, halogen, alkyl, multi-haloalkyl, alkoxyl group, halogenated alkoxy, many halogenated alkoxies, carbalkoxy, thiazolinyl, alkynyl, cycloalkyl, cycloalkylalkyl, multi-ring alkyl, assorted virtue is amino, virtue is amino, the assorted alkyl of ring, the assorted alkyl-alkyl of ring, hydroxyl, hydroxyalkyl, nitro, cyano group, amino, the amino that is substituted, alkylamino, dialkylamino, thiol group, alkylthio, alkyl carbonyl, acyl group, carbalkoxy, aminocarboxyl, the alkynes aminocarboxyl, alkyl amino-carbonyl, the enamino carbonyl, alkyl carbonyl oxy, alkyl oxycarbonyl amino, the aryl carbonyl amino, alkyl sulfonyl-amino, the alkylamino carbonyl amino, the alkoxyl group carbonyl amino, alkyl sulphonyl, amino-sulfonyl, alkyl sulphinyl, sulfonamido and alkylsulfonyl; And

Y is aryl or heteroaryl, and wherein this aryl or heteroaryl are optional can replace through 1-5 substituting group that independently is selected from following group: hydrogen; halogen; alkyl; multi-haloalkyl; alkoxyl group; halogenated alkoxy; many halogenated alkoxies; carbalkoxy; thiazolinyl; alkynyl; cycloalkyl; cycloalkylalkyl; multi-ring alkyl; assorted virtue is amino; virtue is amino; the assorted alkyl of ring; the assorted alkyl-alkyl of ring; hydroxyl; hydroxyalkyl; nitro; cyano group; amino; the amino that is substituted; alkylamino; dialkylamino; thiol group; alkylthio; alkyl carbonyl; acyl group; carbalkoxy; aminocarboxyl; the alkynes aminocarboxyl; alkyl amino-carbonyl; the enamino carbonyl; alkyl carbonyl oxy; alkyl oxycarbonyl amino; the aryl carbonyl amino; alkyl sulfonyl-amino; the alkylamino carbonyl amino; the alkoxyl group carbonyl amino; alkyl sulphonyl; amino-sulfonyl; alkyl sulphinyl; sulfonamido and alkylsulfonyl.

2. compound as claimed in claim 1, it has following structure:

3. compound as claimed in claim 1, it has following structure:

4. compound as claimed in claim 1, it has following structure:

5. compound as claimed in claim 1, it has following structure:

6. compound as claimed in claim 1, it is selected from

7. pharmaceutical composition that comprises compound as claimed in claim 1 and pharmaceutically acceptable carrier thereof.

8. pharmaceutical composition that comprises compound as claimed in claim 1 and pharmacy acceptable salt thereof.

9. pharmaceutical composition that comprises compound as claimed in claim 1 and pharmaceutically acceptable prodrug thereof.

10. pharmaceutical composition, it comprises compound or its pharmacy acceptable salt or its prodrug that is the claim 1 of racemize or homochiral form as free alkali.

11. racemize or homochiral intermediate, it comprises:

12. a pharmaceutical composition, it comprises compound and at least a therapeutical agent that is selected from antidiabetic, antiobesity agent, hypotensive agent, antiatherosclerotic and lipid-lowering agent of formula I as claimed in claim 1.

13. pharmaceutical composition as claimed in claim 8, wherein this therapeutical agent is an antidiabetic.

14. combination as claimed in claim 9, wherein this antidiabetic is at least a following medicament that is selected from: biguanides, sulfonylurea, glucosidase inhibitor, PPAR gamma agonist, PPAR α/γ dual agonists, aP2 inhibitor, SGLT2 inhibitor, insulin sensitizers, glucagon-like peptide-1 (GLP-1), Regular Insulin and meglitinide.

15. as the combination of claim 10, wherein this antidiabetic is at least a following medicament that is selected from: N1,N1-Dimethylbiguanide, Glyburide, glimepiride, lattice row pyrrole spy (glipyride), Glipizide, P-607, gliclazide, acarbose, miglitol, pioglitazone, troglitazone, rosiglitazone, Regular Insulin, Yi Shalita ketone, repaglinide and nateglinide.

16. combination as claimed in claim 9, wherein the weight ratio of the compound of this formula I and this antidiabetic is about 0.01 to about 300: 1.

17. combination as claimed in claim 8, wherein this antiobesity agent is at least a following medicament that is selected from: 'beta '3 adrenergic agonists, lipase inhibitor, thrombotonin (and Dopamine HCL) reuptake inhibithors, thryoid receptor beta compounds, PPAR agonist and anoretic.

18. as the combination of claim 13, wherein this antiobesity agent is at least a following medicament that is selected from: orlistat, sibutramine, topiramate, ciliary body neurotrophic factor, dextroamphetamine, PHENTERMINE, Phenylpropanolamine and Mazindol.

19. combination as claimed in claim 8, wherein this lipid-lowering agent is at least a following medicament that is selected from: MTP inhibitor, cholesteryl ester transfer protein, HMG CoA reductase inhibitor, inhibitor for squalene synthetic enzyme, fiber acid derivative, the active adjusted agent of ldl receptor, PPAR agonist, lipoxidase inhibitor and ACAT inhibitor.

20. as the combination of claim 15, wherein this lipid-lowering agent is at least a following medicament that is selected from: Pravastatin, lovastatin, simvastatin, atorvastatin, Cerivastatin, fluvastatin, Buddhist nun cut down his spit of fland, Visa Si Tating, fenofibrate, gemfibrozil, chlorine Bei Te and avasimibe.

21. combination as claimed in claim 8, wherein the weight ratio of the compound of this formula I and this lipid-lowering agent is about 0.01 to about 100: 1.

22. a treatment or the method that delays following each illness development or show effect: high blood content, dyslipidemia, hyperlipidaemia, obesity, hypertriglyceridemia, atherosclerosis or the hypertension of diabetes, diabetic retinopathy, diabetic neuropathy, diabetic nephropathy, wound healing, insulin resistance, hyperglycemia, hyperinsulinemia, X syndrome, diabetic complication, free fatty acids or glycerine, this method comprise that the compound as claimed in claim 1 that will treat significant quantity gives to the Mammals of needs treatment.

23. method as claim 18, it also comprises simultaneously or treats successively at least a other treatment agent of significant quantity, and this at least a other treatment agent is selected from antidiabetic, antiobesity agent, hypotensive agent, antiatherosclerotic, is used for suppressing to transplant the medicament and the lipid-lowering agent of allograft rejection.

24. a pharmaceutical composition that suppresses DPP-IV, it contains compound as claimed in claim 1.

25. a method that suppresses DPP-IV comprises the pharmaceutical composition that comprises compound as claimed in claim 1.