Summary of the invention
The object of the present invention is to provide the method for the synthetic cDNA of a kind of efficient RNA reverse transcription.
For achieving the above object, the present invention can take following technical proposals:
The method of the synthetic cDNA of efficient RNA reverse transcription of the present invention, it is take positive chain RNA or mRNA as template, uses reverse transcriptase primer, carries out the synthetic of cDNA under the effect of reversed transcriptive enzyme; Wherein:
3 ' end of the target section of selected reverse transcription template is called Auele Specific Primer land R1, transcribed spacer S and segment template fragment district R2 successively;
Used reverse transcription multiplexed sequence primer forms by containing respectively two sections deoxynucleotide fragment combination of template minus strand sequence with positive chain-ordering: wherein the P1 district of 3 ' of reverse transcriptase primer end be one group with template specificity PBR R1 complementary specificity deoxynucleoside acid sequence mutually, 5 ' the P2 district of holding of reverse transcriptase primer is one group of specificity deoxynucleoside acid sequence identical with segment template fragment district R2 sequence.
Described and template specificity PBR R1 mutually the deoxynucleotide sequence length in the P1 district of 3 ' end of complementary reverse transcriptase primer are 15-24bp.
The deoxynucleotide sequence length in the P2 district of 5 ' end of the described reverse transcriptase primer identical with segment template fragment district R2 sequence is 12-18 bp.
The Auele Specific Primer land R1 of described reverse transcription template, the sequence length of the transcribed spacer S between the segment template fragment district R2 equate with the sequence length in reverse transcriptase primer P1 district or add/when subtracting 1bp, when being S length=P1 length or S length=P1 length ± 1bp, the resultant quantity of the synthetic cDNA of reverse transcription is higher.
The invention has the advantages that reverse transcription reaction is simple, efficient, has greatly improved the resultant quantity of cDNA, and then the amplification amount of follow-up PCR is improved greatly.
RNA among the present invention or mRNA comprise from cells such as microorganism (such as virus, bacterium, chlamydozoan and fungi etc.), people and animals and plants.
In the reverse transcription initial reaction of the present invention, the P1 section of reverse transcriptase primer and template ribonucleic acid combination, under the effect of reversed transcriptive enzyme, synthesize article one cDNA chain with the RNA complementation, because the sequence of the cDNA chain complementation that can newly synthesize with part is contained in the P2 district of reverse transcriptase primer, can hold at 5 ' of new cDNA chain at random to a certain extent and form a hairpin like fold, so that the primer P1 section institute calmodulin binding domain CaM on the template ribonucleic acid comes out again, new primer is again in conjunction with on it, and the cDNA that offers a new round is synthetic.Repeat like this, form a reverse transcription reaction that produces a plurality of cDNA copies in the RNA template.
Embodiment
The method of the synthetic cDNA of the efficient RNA reverse transcription of the present invention, it is take positive chain RNA or mRNA as template, uses the specificity reverse transcriptase primer of particular design, carries out the synthetic of cDNA under the effect of reversed transcriptive enzyme; Wherein
3 ' end of the target section of selected reverse transcription template is called Auele Specific Primer land R1, transcribed spacer S and segment template fragment district R2 successively;
The enzyme of leading cDNA building-up reactions is RNA reversed transcriptive enzyme (Reverse transcripatase), also can be that RNA is the archaeal dna polymerase of template.
The specificity reverse transcriptase primer of the present invention design is the multiplexed sequence primer that is formed by two sections deoxynucleotide fragment combination that contain respectively template ribonucleic acid minus strand sequence and positive chain-ordering: wherein the P1 district of 3 ' of this reverse transcriptase primer end be one group with the Auele Specific Primer land R1 of the template ribonucleic acid specificity deoxynucleoside acid sequence of complementation mutually, 5 ' the P2 district of holding of reverse transcriptase primer be one group with the identical specificity deoxynucleoside acid sequence of segment template RNA fragment district R2 sequence.
The reverse transcription reaction damping fluid comprises dNTPs, 250mM Tris-HCl pH8.3; 375mM KCl; 15mM MgCl2; 50mM DTT, etc.
Reverse transcription reaction reagent should sequentially add, and reaction should be carried out at 37-42 ℃, and building-up reactions should be finished in 30-60 minute.
With template specificity PBR R1 mutually the deoxynucleotide sequence length in the P1 district of 3 ' end of complementary reverse transcriptase primer be 15-24bp.The deoxynucleotide sequence length in the P2 district of 5 ' end of the reverse transcriptase primer identical with segment template fragment district R2 sequence is 12-18 bp; The Auele Specific Primer land R1 of reverse transcription template, the sequence length of the transcribed spacer S between the segment template fragment district R2 equate or add/subtract 1bp with the sequence length in reverse transcriptase primer P1 district.
As shown in Figure 1, in reverse transcription reaction of the present invention, the P1 section of primer and template ribonucleic acid combination, article one cDNA chain of synthetic and RNA complementation, it comprised can with the respective segments of the complementary combination of primer P2 section.The random incorporation of the P2 complementary sequence section that contains by primer P2 district and new synthetic cDNA chain, 5 ' end at the cDNA chain can form hair pin type structure, cause the R1 district of template ribonucleic acid to return to the strand state, new primer P1 section is incorporated into the R1 district of same template ribonucleic acid again, under the effect of reversed transcriptive enzyme, start the synthetic of new cDNA chain.Namely under the condition identical with other reverse transcription reaction, use the reverse transcriptase primer of particular design of the present invention, can use same RNA template, repeat continuously synthetic a plurality of cDNA chains, make the cDNA resultant quantity improve several times, realized the reverse transcription reaction of efficient synthesizing single-stranded cDNA.
Embodiment 1:
As shown in Figure 2, adopt the HCV viral RNA to be used for the synthetic To Template RNA of cDNA, reverse transcription multiplexed sequence primer is: 5 '
ACTGCCTGATAGGGTGCACGGTCTACGAGACCTC, 3 ' end of Auele Specific Primer have and template ribonucleic acid complementary specificity deoxynucleoside acid sequence (P1) mutually, and 19bp can be incorporated into the R1 district of masterplate RNA.5 ' end of Auele Specific Primer has can the specificity deoxynucleoside acid sequence (P2) identical with masterplate RNA sequence R2 zone, 14bp.Show that in Fig. 2 the R1 of RNA template and the R2 interval S section length of being separated by is that the P1 sequence length adds 1bp, i.e. 20bp.
Use conventional reverse transcriptase primer 5 ' TGCACGGTCTACGAGACCTC to react as a comparison.
Reverse transcription reaction arranges:
The reverse transcription reaction mixture of reaction configuration comprises the HCV RNA template of 1 microgram, dNTPs(dATP, dCTP, dGTP and dTTP), 50 mM Tris-HCl (25 ° of C of pH 8.3 at), 75 mM KCl, 3 mM MgCl2, the reversed transcriptive enzyme of 10 mM DTT and 5 units.Reaction mixture is divided into two groups, and one group (A pipe) uses " conventional reverse transcriptase primer ", and another group (B pipe) is used " reverse transcription multiplexed sequence primer " of the present invention.
1.RNA/primer mixture reaction tubes: A pipe and B pipe
A pipe: HCV RNA 1 microgram
The conventional reverse transcriptase primer 1ul of 20 uM
The dNTP mixture 1ul of 10 mM
DEPC H2O to 10ul
B pipe: HCV RNA 1 microgram
20 uM reverse transcription multiplexed sequence primer 1ul
The dNTP mixture 1ul of 10 mM
DEPC H2O to 10ul
2. hatch A, B manages sample 65
o C 5 minutes, ice bath 1 minute.
3. in each reaction, add again:
5X reverse transcription solution 4ul,
Reversed transcriptive enzyme (5U/ul) 1ul,
DEPC H
2O 5 ul
25
o C 10 minutes, 42
oC 50 minutes, 70
o C
10 minutes.
According to above-mentioned steps, the synthetic reverse transcription reaction of cDNA is carried out in two group reactions simultaneously, and the reverse transcription cDNA product that obtains is put-20 ℃ of preservations.
After reverse transcription reaction was finished, the reverse transcription cDNA product of getting respectively equivalent was template, carries out the pcr amplification of parallel sample.Amplification is got 5ul PCR product after finishing, and adopts electrophoresis method to measure.Compare the difference of the amount of each reaction tubes product with the power of electrophoretic band.The results are shown in Figure 3, PCR product and should be 380bp.Sample 1,2,5, and the 6 PCR results for the reverse transcription cDNA template of using conventional reverse transcriptase primer.Sample 3,4,7, and the 8 PCR results for the reverse transcription cDNA template of using reverse transcription multiplexed sequence primer.Banding pattern on the running gel shows, in other reverse transcription situation identical with each condition of PCR reaction, uses reverse transcription multiplexed sequence primer of the present invention can improve the cDNA resultant quantity, and then pcr amplification is improved greatly.
Embodiment 2:
Adopting HAV RNA is the synthetic To Template RNA of cDNA, uses specificity reverse transcription composite primer of the present invention and conventional reverse transcriptase primer at first to carry out reverse transcription reaction, synthetic target cDNA.Adopt the real-time fluorescence PCR technology to carry out pcr amplification, the reverse transcription effect of two kinds of primers of contrast.As shown in Figure 4, reverse transcription multiplexed sequence primer is: RT-1 5 ' aggaggtttggattctCCatttcaagagtccacaca, 3 ' end of Auele Specific Primer has and template ribonucleic acid complementary specificity deoxynucleoside acid sequence (P1) mutually, and 20bp can be incorporated into the R1 district of masterplate RNA.5 ' end of Auele Specific Primer has can the specificity deoxynucleoside acid sequence (P2) identical with masterplate RNA sequence R2 zone, 16bp.Show that in Fig. 4 the R1 of RNA template and the R2 interval S section length of being separated by is 19bp.
Use conventional reverse transcriptase primer RT-2 5 ' CCatttcaagagtccacaca to react as a comparison.
Reverse transcription reaction arranges: (with embodiment 1).
The reverse transcription reaction mixture of reaction configuration comprises the HAV RNA template of 1 microgram, dNTPs(dATP, dCTP, dGTP and dTTP), 50 mM Tris-HCl (25 ° of C of pH 8.3 at), 75 mM KCl, 3 mM MgCl2, the reversed transcriptive enzyme of 10 mM DTT and 5 units.Reaction mixture is divided into two groups, and one group (A pipe) uses " conventional reverse transcriptase primer ", and another group (B pipe) is used " reverse transcription multiplexed sequence primer " of the present invention.Reverse transcription reaction arranges as follows:
1.RNA/primer mixture reaction tubes: A and B pipe
A pipe: HAV RNA 1 microgram
The conventional reverse transcriptase primer 1ul of 20 uM
The dNTP mixture 1ul of 10 mM
DEPC H
2O to 10ul
B pipe: HAV RNA 1 microgram
20 uM reverse transcription multiplexed sequence primer 1ul
The dNTP mixture 1ul of 10 mM
DEPC H2O to 10ul
2. hatch A, B manages sample 65
o C 5 minutes, ice bath 1 minute.
3. in each reaction, add again:
5X reverse transcription solution 4ul,
Reversed transcriptive enzyme (5U/ul) 1ul,
DEPC H
2O 5 ul
25
o C 10 minutes, 42
oC 50 minutes, 70
o C
10 minutes.
According to above-mentioned steps, the synthetic reverse transcription reaction of cDNA is carried out in two group reactions simultaneously.The reverse transcription cDNA product that obtains is put-20 ℃ of preservations.After reverse transcription reaction was finished, the reverse transcription cDNA product of getting respectively equivalent was template, used Bio-Rad SYBR Green Supermix (2X) real-time fluorescence reaction reagent to carry out pcr amplification.
The pcr amplification reaction primer is:
HAV-F 5’acagattctacatttggattggt
HAV-R 5’ aacttcattatttcatgctcct
The real-time fluorescence reaction arranges: (reaction is two-tube be arrangeding in parallel)
A pipe: the conventional reverse transcriptase primer cDNA of HAV 1 ul
HAV-F 0.5 ul
HAV-R 0.5 ul
DEPC H
2O to 13 ul
2X Bio-Rad SYBR Green Supermix 15 ul
B pipe: compound reverse transcriptase primer cDNA 1 ul of HAV
HAV-F 0.5 ul
HAV-R 0.5 ul
DEPC H
2O to 13 ul
2X Bio-Rad SYBR Green Supermix 15 ul
The pcr amplification program is: 94 ℃ 2 minutes, 94 ℃ 30 seconds, 54 ℃ 30 seconds, 72 ℃ of 30 seconds X40
Circulation." typical curve " uses known HAV cDNA to be diluted to 7 extent of dilution as reacting with reference to product with 10 times.
Result such as Fig. 5-shown in Figure 7: the cDNA that uses conventional reverse transcriptase primer is 27 as the Ct value of the real-time fluorescence PCR reaction of template.The cDNA that uses compound reverse transcriptase primer is 23 as the Ct value of the real-time fluorescence PCR reaction of template.The result shows, in other reverse transcription situation identical with each condition of PCR reaction, uses reverse transcription multiplexed sequence primer can improve the cDNA resultant quantity, and then pcr amplification is improved greatly.