CN1699424A - Heparinase I fusion protein and genes encoding same and expression method thereof - Google Patents
Heparinase I fusion protein and genes encoding same and expression method thereof Download PDFInfo
- Publication number
- CN1699424A CN1699424A CN 200410038098 CN200410038098A CN1699424A CN 1699424 A CN1699424 A CN 1699424A CN 200410038098 CN200410038098 CN 200410038098 CN 200410038098 A CN200410038098 A CN 200410038098A CN 1699424 A CN1699424 A CN 1699424A
- Authority
- CN
- China
- Prior art keywords
- heparinase
- seq
- fusion rotein
- sequence
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a heparinase I fusion protein and genes encoding same and expression method, wherein the protein of amino acid residue sequence SEQ ID No:2 in the sequence table, or SEQ ID No:2 derived protein by the substitution, deletion or addition of one or several amino acid residual radicals to the SEQ ID No. 2 amino acid residual radical sequence, and having the same activity with the SEQ ID No.2 amino acid residual radical sequence.
Description
Technical field
The present invention relates to a kind of Heparinase I fusion rotein and encoding gene and expression method in genetically engineered and the field of fermentation engineering.
Background technology
Heparinase (heparinase) is the polysaceharide lyase that a class acts on heparin, in many kinds of microorganisms, find, comprise excellent bacillus Corynebacterium sp. (high Ningguo etc., heparinase produces screening and the fermentation condition of bacterium, microorganism journal 1999 Vol.39:64-67), Sphingobacterium sp. Sphingobacterium sp. (high Ningguo etc., the generation of Sphingobacterium sp. heparinase, microorganism journal 2003 Vol.43:813-816), Bacillus subtillis Bacillus subtilis (Wang Zhongyan etc., heparinase produces the screening of bacterium and the research of thick enzymatic property thereof, Sichuan University's journal (natural science edition) 2002 Vol.39:777-779), Bacillus circulans Bacillus circulans (Yasutaka Tahara et al., Purification and characterization of heparinasethat degrades both heparin and heparin sulfate from Bacillus circulansBioSci.Biotechnol.Biochem.2002 Vol.66:1181-1184), Bacteroides heparinolyticus Prevotellaheparinolytica (Kazuyuki Sugahara et al., Characterization of heparinasefrom an oral bacterium Prevotella heparinolytica J.Biochem.1998Vol.123:283-288), Bacteroides stercoris Bacteroides stercoris HJ-15 (Dong Hyuu Kim etal., Purification and characterization of a novel heparinase from Bacteroidesstercoris HJ-15 J.Biochem.2000 Vol.128:323-328) and heparin Flavobacterium Flavabacteriumheparinum (Sasiekharan, R.1991 Ph.D.Thesis, Havard University).But the heparinase from the heparin Flavobacterium is business-like unique source.Heparinase from the heparin Flavobacterium mainly contains three kinds, difference called after Heparinase I (EC 4.2.2.7), II (NO EC code) and III (EC 4.2.2.8) (RobertJ.Linhardt et al., Purification and characterization of heparin lyases fromFlavobacterium heparinum JBC 1992 Vol.267:24347-24355).
The research of heparinase has crucial meaning (Sasiekharan, Ph.D.Thesis R.1991, HavardUniversity; Sasiekharan, R.et al., A comparative analysis of the primarysequences and characteristics of heparinase I, II, and III from Flavobacteriumheparinum Biochemical and Biophysical Research Communication 1996Vol.229:770-777): heparinase is a kind of of polysaceharide lyase, is used to study the mechanism of action that interaction between heparinase and the substrate polysaccharide heparin thereof helps to illustrate polysaceharide lyase; Heparinase can be used to resolve the structure and the biological function thereof of complicated mucopolysaccharides such as heparin; Heparinase can be used to resolve intravital blood coagulation of people and anticlotting mechanism; Heparinase can be used to prepare low molecular anticoagulation medicine Low molecular heparin; Heparinase can prevent postoperative hemorrhage as the removal of clinical blood heparinization; Heparinase is used for the processing of the preceding blood products of PCR reaction.
Normally purification obtains Heparinase I from heparin Flavobacterium fermented liquid, needs the chromatogram purification through multistep usually, and yield is lower.Heparin Flavobacterium rate of growth is slow, and the production stability of heparinase is poor, and producing heparinase need be expensive heparin-induced, has increased the cost of enzyme.Therefore, utilize the cost of Flavobacterium production heparinase high at present, limited the application development of heparinase.Ram Sasiekharan (1993) (Sasiekharan, R.et al., Cloning and expression of heparinase I gene fromFlavobacterium heparinum Proc.Natl. Acad.Sci.USA 1993 Vol.90:3660-3664) at first by amino acid sequencing, the design primer amplification has obtained the gene order of Heparinase I and has been binned in the expression (table 1) that has realized heparinase in the intestinal bacteria; But expression product can not correctly be folded to form activated albumen.RamSasiekharan (1996) (Sasiekharan, R.et al., Expression in Escherichia coli, Purification and characterization of heparinase I from Flavobacteriumheparinum Biochem.J.1996 Vol.315:589-597) utilize the pET expression system to improve expressing quantity (14.4mg/L fermented liquid) (table 1), but the reorganization Heparinase I still forms inclusion body, needs renaturation could form activated protein.Oded Shoseyov (1999) (Etai Shpigel, et al., Immobilizationof recombinant heparinase I fused to cellulose-binding domain Biotechnologyand Bioengineering 1999 Vol.65:17-23) utilize Mierocrystalline cellulose conjugated protein (CBD) and heparinase to merge, utilize fusion rotein to realize the amalgamation and expression of CBD-hep, hep-CBD, by the cellulose column affinity separations, and improved the expression amount (150mg/L fermented liquid) (table 1) of Heparinase I; Although but under low IPTG (0.5mM), to induce, this fusion rotein still forms inclusion body, needs renaturation just can be formed with active reorganization Heparinase I.
The recombinant expressed present Research of table 1. Heparinase I
| Recombinant expressed research | Expression amount (mg/L fermented liquid) | Host, carrier | Whether solvable | Whether secrete | Whether be fusion rotein |
| ????Ram?Sasiekharan ????(1993) ????Ram?Sasiekharan ????(1996) ? | ??0.1 ? ??14.4 ? ? | ????E.coli?BL21(DE3) ????(pET3a-hepA) ????E.coli?BL21(DE3) ????(pET3a、pET12a、pET15b、 ????pET28a-hepA) | Small part is solvable not | Not | Not |
| ????Oded?Shoseyov ????(1999) ? | ??150 ? ? | ????E.coli?BL21(DE3) ????(pET3d?CBD-hepA， ????pET3d?hepA-CBD) | Not | Not | ??CBD?fusion ??protein ? |
From colibacillary natural maltose binding protein MBP can with the special absorption of maltose, participate in transhipment and the utilization of intestinal bacteria to maltose.MBP not only can combine with amylose, realizes affine separation, also can with yam starch in conjunction with realizing affine the separation that (biological chemistry and biophysics are made progress 1998 Vol.25:283-284 for Lian Dejun etc., a kind of improved fusion rotein affinity chromatographic purification process; Usha Srinivasan et al., Aconvenient method for affinity purification of maltose binding proteinfusions Journal of Biotechnology 1998 Vol.62:163-167), thus can reduce the cost of the separation and purification of enzyme greatly.
The innovation and creation content
The purpose of this invention is to provide a kind of Heparinase I fusion rotein and encoding gene thereof.
Heparinase I fusion rotein provided by the present invention, name is called MBP-HepA, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, or with SEQ ID №: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 2 amino acid residue sequence is identical active by SEQ ID №: 2 deutero-protein.
SEQ ID № in the sequence table: 2 are made up of 756 amino-acid residues.
Heparinase I fusion rotein encoding gene, name is called MBP-HepA, has one of following nucleotide sequences:
1) SEQ ID № in the sequence table: 1 dna sequence dna;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;
3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 95% above homology, and the identical function protein DNA sequence of encoding.
Dna sequence dna in the sequence 1 is by 2271 based compositions, and the open reading frame of this gene is from 5 ' end the 1st to the 2271st bit base.
Contain expression carrier of the present invention, clone and engineering bacteria, all belong to protection scope of the present invention as pMal-hepA and the intestinal bacteria E.coli TB1 (pMAL-hepA) that contains pMal-hepA.
Increase arbitrary segmental primer in this fusion rotein encoding gene to also within protection scope of the present invention.
Second purpose of the present invention provides a kind of method of expressing the Heparinase I fusion rotein.
The method of expression Heparinase I fusion rotein provided by the present invention is that the recombinant expression vector that will contain above-mentioned Heparinase I fusion rotein encoding gene imports the expressive host bacterium, expresses the Heparinase I fusion rotein.
Wherein, the recombinant expression vector of described Heparinase I fusion rotein encoding gene is pMal-hepA.
PMal-hepA inserts pMal p2x by BamHI and PstI with Heparinase I encoding gene complete sequence, the recombinant expression vector of the Heparinase I fusion rotein encoding gene that obtains in pMalc2x (physical map is bought as shown in Figure 7 from the NEB company) expression vector.Wherein, described Heparinase I encoding gene complete sequence is that the genome DNA with the heparin Flavobacterium is a template, with 5 ' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC 3 ' and 5 ' GCTTCTGCAGTCTGGCAGTTTCGCTGTAC 3 ' is primer, obtains according to conventional PCR method.
Described host bacterium can be intestinal bacteria, and described intestinal bacteria can be following bacterial strain: Bl21, JM109, DH5 α, TB1 etc.
The abduction delivering condition of Heparinase I fusion rotein can be 10-42 degree centigrade of 0.01-1mM IPTG and induced 16 hours; Yeast extract concentration in the substratum that is adopted can be 1g/L-20g/L, also can add 1%-5% ethanol and/or heat-shocked materials such as 0.05-2mg/L kantlex and/or 0.01-2.0mg/L paraxin in substratum.Wherein, this expression condition be preferably engineering bacteria 37 degrees centigrade cultivate 3 hours after, add 0.3mM IPTG and induced 16 hours for 15 degrees centigrade; The substratum that is adopted is preferably NaCl 10g/L, and yeast extract paste is 7.5g/L, peptone 10g/L, 1% (mass percent) ethanol, 0.6mg/L paraxin.
The present invention has made up the fusion expression vector that prevents that inclusion body from forming, and realizes an affine separation of step by the amylose resin.Realize first that by fusion rotein Heparinase I exists with the soluble protein form that activity is arranged, correctly fold more than 90% in intestinal bacteria; Intestinal bacteria E.coli TB1 (pMAL-hepA) adds 0.3mM IPTG 37 degrees centigrade of cultivations after 3 hours, 15 degrees centigrade of inducing temperatures, and yeast powder concentration 0.75% in the substratum, ethanol 1%, the heparinase enzyme work of production can reach 270U/L (108UL
-1OD
600 -1) fermented liquid, expression amount can reach the 150mg/L fermented liquid, and has realized the single step purification of this fusion rotein by affine separation.The present invention adds the IPTG time by changing IPTG concentration, inducing temperature, optimization and improvements such as substratum composition warm proteic output and heparinase live.The present invention will play a significant role in the production of Heparinase I.
Description of drawings
Fig. 1 is the building process synoptic diagram of expression vector pMal-hepA
Fig. 2 is the Heparinase I gene electrophoretogram that pcr amplification obtains from the heparin Flavobacterium
Fig. 3 is transformant bacterium colony PCR and double digestion checking electrophoretogram
Fig. 4 a is the protein electrophorese collection of illustrative plates of E.coli TB1 (pMAL-hepA) at 37 ℃ of different induction times
Fig. 4 b is the protein electrophorese collection of illustrative plates of E.coli TB1 (pMAL-hepA) at 21 ℃ of different induction times
Fig. 5 passes through the affine isolating SDS-PAGE electrophoretogram of amylose resin for fusion rotein MBP-HEPA
Fig. 6 is the physical map of pMal-hepA
Fig. 7 is pMal p2x, the physical map of pMal c2x
Embodiment
The expression of embodiment 1, Heparinase I fusion rotein MBP-HepA
1, the structure of expression vector pMal-hepA
The building process of expression vector pMal-hepA as shown in Figure 1, detailed process is as follows: amplification Heparinase I gene from the genome DNA of heparin Flavobacterium, used upstream and downstream primer is respectively 5 ' GCCT
GGATCCCAGCAAAAAAAATCCGGTAAC 3 ' (base of band underscore is the restriction enzyme site of BamHI), 5 ' GCTT
CTGCAGTCTGGCAGTTTCGCTGTAC 3 ' (base of band underscore is the PstI restriction enzyme site) introduces BamHI and PstI restriction enzyme site respectively, and the reaction system of amplification is: the 50ng template DNA, every kind of primer of 100pmol, 1 * amplification buffer, every kind of dNTP of 200 μ mol/L, the high Pfu enzyme of protecting of 1 unit; Amplification program is: 95 degrees centigrade of sex change 5 minutes, and 50-60 degree centigrade of primer annealing 45 seconds, 72 degrees centigrade of primer extensions 90 seconds, after 30 circulations, 72 degrees centigrade are extended and finished reaction in 5 minutes.This PCR result shows that amplification obtains the Heparinase I gene fragment of 1.1kb as shown in Figure 2.Among Fig. 2, it is 50,51,53,55,58 or 59 ℃ of amplifications that 1-6 is respectively the primer annealing temperature, and 7 is molecular weight marker 15kb, and arrow indication place is a 1.1kb target segment.
PMal-p2x and pMal-c2x carrier and PCR product are used BamHI and PstI double digestion respectively, use T
4Dna ligase connects, transform JM109, with 5 ' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC 3 ' and 5 ' GCTTCTGCAGTCTGGCAGTTTCGCTGTAC 3 ' is primer, and by bacterium colony PCR screening transformant, the upgrading grain is by BamHI and the checking of PstI double digestion again.Verify the result as shown in Figure 3, bacterium colony PCR result shows that about 55 ℃, the goal gene segment can access effective amplification.Transformed into escherichia coli TB1 obtains the recombinant plasmid vector bacterial strain that two strains contain correct connection, wherein a strain called after recombination bacillus coli TB1 (pMal-hepA).Among Fig. 3,1,8 is respectively 2k and λ/HindIII marker; 5-7 is the transformant of PCR checking, and 2-4 is 5-7 double digestion rear electrophoresis figure, and the arrow indication is a Heparinase I gene band; Wherein 6,7 is the correct pMal-hepA that connects.
2, the expression of Heparinase I fusion rotein MBP-HepA
Recombination bacillus coli TB1 (pMal-hepA) cultivated 3 hours for 37 ℃ at LB substratum (containing 100 μ g/ml Amp), added 1mM IPTG and carried out inducing culture at 37 ℃ and 21 ℃ respectively.Get bacterium liquid at regular intervals and do full cell SDS-PAGE electrophoresis, induce back bacterium liquid to get 40ml centrifugal 10min under 10000rpm, with 20mM Tris-HCl washed twice, (output rating is 300W to be resuspended in ultrasonication among the 4ml 20mMTris.HCl, each ultrasonic 3 seconds and intermittently 3 seconds processing 99 times), get supernatant liquor 50 μ l and be SDS-PAGE and analyze.The result is shown in Fig. 4 a and Fig. 4 b, and different inducing temperatures are to the obvious effect of protein-active.Induce at 37 ℃, target protein exists with the form of non-activity inclusion body, and 21 ℃ induced, and the amount of soluble protein obviously increases.Among Fig. 4 a, 1,9 is protein marker, and 2-4 is an induction time 0,6,16 hours full cell electrophoresis figure, and 5,6 is 3,4 cytoclasis postprecipitation, and 7,8 is 3,4 supernatant liquor, and arrow indication place is fusion rotein MBP-hepA (94KDa).Among Fig. 4 b, 1-6 is induction time t=0,2,3,4,9,21 full cell electrophoresis figure, and 7 is molecular weight maerker; 8,9 is 5,6 cytoclasis postprecipitation, and 10,11 is 8,9 supernatant liquor, and arrow indication place is fusion rotein MBP-hepA (94KDa).
Recombination bacillus coli TB1 (pMal-hepA) cultivated 3 hours for 37 ℃ at LB substratum (containing 100 μ g/ml Amp), added 1mM IPTG respectively at 37 ℃, and 21 ℃ and 15 ℃ were carried out inducing culture 16 hours.After cell centrifugation separation, Tris buffer pH7.0 washed twice, be resuspended among the 4ml Tris buffer, carry out cytoclasis.With broken liquid centrifugal after, the heparinase of surveying in the supernatant liquor is lived.Reddish black A (Azure A) method is adopted in the analysis that enzyme is lived, 30 ℃ of needed protein contents of 1mg substrate heparin of per hour degrading of definition that the enzyme of 1U is lived.The result shows that resulting heparinase work is respectively under the different inducing temperatures: 37 ℃, and 14U/L fermented liquid (2.9UL
-1OD
600 -1); 21 ℃, 89U/L fermented liquid (18.5UL
-1OD
600 -1), 15 ℃, 270U/L fermented liquid (108UL
-1OD
600 -1).
Embodiment 2, by amylose starch column purification Heparinase I fusion rotein MBP-HepA
The fusion partners that utilizes among the present invention (fusion partner) maltose binding protein MBP can separate with affine one step of absorption realization of amylose starch.Concrete affine separating step is as follows: with 16 hours thalline 100ml of 0.3mM IPTG abduction delivering, the centrifugal 5min of 10000rpm; Establish the not thalline contrast of abduction delivering simultaneously.Then operate respectively by following two schemes:
Scheme one: with column equilibration liquid Column buffer (pH 7.4 for 20mM TrisHCl, 200mM NaCl) washed twice, be resuspended among the 5ml column buffer, carry out ultrasonic (output rating is 300W, each ultrasonic 3 seconds and intermittently 3 seconds processing 99 times).
Scheme two: osmotic pressure impacts.Thalline is resuspended in (20-40% sucrose, 30mMTrisHCl, 1mMEDTA) 15min, stirring among the 100ml osmotic shock buffer I.Centrifugal 10000rpm 10min is resuspended in the equal-volume 0.5mM sal epsom ice bath 10-15min, centrifugal 10000rpm10min.
Centrifugal back supernatant is with the amylose starch affine separator column of 0.5ml/min by the 2ml pre-equilibration, by 10mM0.5ml/min maltose wash-out and collection.
Each step gets 50 μ l and is SDS-PAGE, after target protein process amylose starch (amylose) resin absorption, and can be under 1 column volume with 10mM maltose with the target protein wash-out.The result shows through target protein behind the amylose resin single step purification and can account for more than 95% as shown in Figure 5.Among Fig. 5,1 is the full cell electrophoresis of 0.3mM IPTG inductive E.coli TB1 (pMAL-hepA), 2 are the full cell electrophoresis of inductive E.coli TB1 (pMAL-hepA) not, 3 is molecular weight marker, and 4 is solvable target protein MBP-HEPA, and 5 is soluble target protein, 6-8 is through 1 of the maltose wash-out collection of amylose resin absorption back, 2,3 pipes (every pipe 1.5ml), the arrow indication is a target protein.
Sequence table
<160>2
<210>1
<211>2271
<212>DNA
＜213〉artificial sequence
<400>1
atgaaaatcg?aagaaggtaa?actggtaatc?tggattaacg?gcgataaagg?ctataacggt?????60
ctcgctgaag?tcggtaagaa?attcgagaaa?gataccggaa?ttaaagtcac?cgttgagcat????120
ccggataaac?tggaagagaa?attcccacag?gttgcggcaa?ctggcgatgg?ccctgacatt????180
atcttctggg?cacacgaccg?ctttggtggc?tacgctcaat?ctggcctgtt?ggctgaaatc????240
accccggaca?aagcgttcca?ggacaagctg?tatccgttta?cctgggatgc?cgtacgttac????300
aacggcaagc?tgattgctta?cccgatcgct?gttgaagcgt?tatcgctgat?ttataacaaa????360
gatctgctgc?cgaacccgcc?aaaaacctgg?gaagagatcc?cggcgctgga?taaagaactg????420
aaagcgaaag?gtaagagcgc?gctgatgttc?aacctgcaag?aaccgtactt?cacctggccg????480
ctgattgctg?ctgacggggg?ttatgcgttc?aagtatgaaa?acggcaagta?cgacattaaa????540
gacgtgggcg?tggataacgc?tggcgcgaaa?gcgggtctga?ccttcctggt?tgacctgatt????600
aaaaacaaac?acatgaatgc?agacaccgat?tactccatcg?cagaagctgc?ctttaataaa????660
ggcgaaacag?cgatgaccat?caacggcccg?tgggcatggt?ccaacatcga?caccagcaaa????720
gtgaattatg?gtgtaacggt?actgccgacc?ttcaagggtc?aaccatccaa?accgttcgtt????780
ggcgtgctga?gcgcaggtat?taacgccgcc?agtccgaaca?aagagctggc?aaaagagttc????840
ctcgaaaact?atctgctgac?tgatgaaggt?ctggaagcgg?ttaataaaga?caaaccgctg????900
ggtgccgtag?cgctgaagtc?ttacgaggaa?gagttggcga?aagatccacg?tattgccgcc?????960
actatggaaa?acgcccagaa?aggtgaaatc?atgccgaaca?tcccgcagat?gtccgctttc????1020
tggtatgccg?tgcgtactgc?ggtgatcaac?gccgccagcg?gtcgtcagac?tgtcgatgaa????1080
gccctgaaag?acgcgcagac?taattcgagc?tcgaacaaca?acaacaataa?caataacaac????1140
aacctcggga?tcgagggaag?gatttcagaa?ttcggatccc?agcaaaaaaa?atccggtaac????1200
atcccttacc?gggtaaatgt?gcaggccgac?agtgctaagc?agaaggcgat?tattgacaac????1260
aaatgggtgg?cagtaggcat?caataaacct?tatgcattac?aatatgacga?taaactgcgc????1320
tttaatggaa?aaccatccta?tcgctttgag?cttaaagccg?aagacaattc?gcttgaaggt????1380
tatgctgcag?gagaaacaaa?gggccgtaca?gaattgtcgt?acagctatgc?aaccaccaat????1440
gattttaaga?aatttccccc?aagcgtatac?caaaatgcgc?aaaagctaaa?aaccgtttat????1500
cattacggca?aagggatttg?tgaacagggg?agctcccgca?gctatacctt?ttcagtgtac????1560
ataccctcct?ccttccccga?caatgcgact?actatttttg?cccaatggca?tggtgcaccc????1620
agcagaacgc?ttgtagctac?accagaggga?gaaattaaaa?cactgagcat?agaagagttt????1680
ttggccttat?acgaccgcat?gatcttcaaa?aaaaatatcg?cccatgataa?agttgaaaaa????1740
aaagataagg?acggaaaaat?tacttatgta?gccggaaagc?caaatggctg?gaaggtagaa????1800
caaggtggtt?atcccacgct?ggcctttggt?ttttctaaag?ggtattttta?catcaaggca????1860
aactccgacc?ggcagtggct?taccgacaaa?gccgaccgta?acaatgccaa?tcccgagaat????1920
agtgaagtaa?tgaagcccta?ttcctcggaa?tacaaaactt?caaccattgc?ctataaaatg????1980
ccctttgccc?agttccctaa?agattgctgg?attacttttg?atgtcgccat?agactggacg????2040
aaatatggaa?aagaggccaa?tacaattttg?aaacccggta?agctggatgt?gatgatgact????2100
tataccaaga?ataagaaacc?acaaaaagcg?catatcgtaa?accagcagga?aatcctgatc????2160
ggacgtaacg?atgacgatgg?ctattacttc?aaatttggaa?tttacagggt?cggtaacagc????2220
acggtcccgg?ttacttataa?cctgagcggg?tacagcgaaa?ctgccagatg?a?????????????2271
<210>2
<211>756
<212>PRT
＜213〉artificial sequence
<400>2
Met?Lys?Ile?Glu?Glu?Gly?Lys?Leu?Val?Ile?Trp?Ile?Asn?Gly?Asp?Lys
1???????????????5???????????????????10??????????????????15
Gly?Tyr?Asn?Gly?Leu?Ala?Glu?Val?Gly?Lys?Lys?Phe?Glu?Lys?Asp?Thr
20??????????????????25??????????????????30
Gly?Ile?Lys?Val?Thr?Val?Glu?His?Pro?Asp?Lys?Leu?Glu?Glu?Lys?Phe
35??????????????????40??????????????????45
Pro?Gln?Val?Ala?Ala?Thr?Gly?Asp?Gly?Pro?Asp?Ile?Ile?Phe?Trp?Ala
50??????????????????55??????????????????60
His?Asp?Arg?Phe?Gly?Gly?Tyr?Ala?Gln?Ser?Gly?Leu?Leu?Ala?Glu?Ile
65??????????????????70??????????????????75??????????????????80
Thr?Pro?Asp?Lys?Ala?Phe?Gln?Asp?Lys?Leu?Tyr?Pro?Phe?Thr?Trp?Asp
85??????????????????90??????????????????95
Ala?Val?Arg?Tyr?Asn?Gly?Lys?Leu?Ile?Ala?Tyr?Pro?Ile?Ala?Val?Glu
100?????????????????105?????????????????110
Ala?Leu?Ser?Leu?Ile?Tyr?Asn?Lys?Asp?Leu?Leu?Pro?Asn?Pro?Pro?Lys
115?????????????????120?????????????????125
Thr?Trp?Glu?Glu?Ile?Pro?Ala?Leu?Asp?Lys?Glu?Leu?Lys?Ala?Lys?Gly
130?????????????????135?????????????????140
Lys?Ser?Ala?Leu?Met?Phe?Asn?Leu?Gln?Glu?Pro?Tyr?Phe?Thr?Trp?Pro
145?????????????????150?????????????????155?????????????????160
Leu?Ile?Ala?Ala?Asp?Gly?Gly?Tyr?Ala?Phe?Lys?Tyr?Glu?Asn?Gly?Lys
165?????????????????170?????????????????175
Tyr?Asp?Ile?Lys?Asp?Val?Gly?Val?Asp?Asn?Ala?Gly?Ala?Lys?Ala?Gly
180?????????????????185?????????????????190
Leu?Thr?Phe?Leu?Val?Asp?Leu?Ile?Lys?Asn?Lys?His?Met?Asn?Ala?Asp
195?????????????????200?????????????????205
Thr?Asp?Tyr?Ser?Ile?Ala?Glu?Ala?Ala?Phe?Asn?Lys?Gly?Glu?Thr?Ala
210?????????????????215?????????????????220
Met?Thr?Ile?Asn?Gly?Pro?Trp?Ala?Trp?Ser?Asn?Ile?Asp?Thr?Ser?Lys
225?????????????????230?????????????????235?????????????????240
Val?Asn?Tyr?Gly?Val?Thr?Val?Leu?Pro?Thr?Phe?Lys?Gly?Gln?Pro?Ser
245?????????????????250?????????????????255
Lys?Pro?Phe?Val?Gly?Val?Leu?Ser?Ala?Gly?Ile?Asn?Ala?Ala?Ser?Pro
260?????????????????265?????????????????270
Asn?Lys?Glu?Leu?Ala?Lys?Glu?Phe?Leu?Glu?Asn?Tyr?Leu?Leu?Thr?Asp
275?????????????????280?????????????????285
Glu?Gly?Leu?Glu?Ala?Val?Asn?Lys?Asp?Lys?Pro?Leu?Gly?Ala?Val?Ala
290?????????????????295?????????????????300
Leu?Lys?Ser?Tyr?Glu?Glu?Glu?Leu?Ala?Lys?Asp?Pro?Arg?Ile?Ala?Ala
305?????????????????310?????????????????315?????????????????320
Thr?Met?Glu?Asn?Ala?Gln?Lys?Gly?Glu?Ile?Met?Pro?Asn?Ile?Pro?Gln
325?????????????????330?????????????????335
Met?Ser?Ala?Phe?Trp?Tyr?Ala?Val?Arg?Thr?Ala?Val?Ile?Asn?Ala?Ala
340?????????????????345?????????????????350
Ser?Gly?Arg?Gln?Thr?Val?Asp?Glu?Ala?Leu?Lys?Asp?Ala?Gln?Thr?Asn
355?????????????????360?????????????????365
Ser?Ser?Ser?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Leu?Gly?Ile
370?????????????????375?????????????????380
Glu?Gly?Arg?Ile?Ser?Glu?Phe?Gly?Ser?Gln?Gln?Lys?Lys?Ser?Gly?Asn
385?????????????????390?????????????????395?????????????????400
Ile?Pro?Tyr?Arg?Val.Asn?Val?Gln?Ala?Asp?Ser?Ala?Lys?Gln?Lys?Ala
405?????????????????410?????????????????415
Ile?Ile?Asp?Asn?Lys?Trp?Val?Ala?Val?Gly?Ile?Asn?Lys?Pro?Tyr?Ala
420?????????????????425?????????????????430
Leu?Gln?Tyr?Asp?Asp?Lys?Leu?Arg?Phe?Asn?Gly?Lys?Pro?Ser?Tyr?Arg
435?????????????????440?????????????????445
Phe?Glu?Leu?Lys?Ala?Glu?Asp?Asn?Ser?Leu?Glu?Gly?Tyr?Ala?Ala?Gly
450?????????????????455?????????????????460
Glu?Thr?Lys?Gly?Arg?Thr?Glu?Leu?Ser?Tyr?Ser?Tyr?Ala?Thr?Thr?Asn
465?????????????????470?????????????????475?????????????????480
Asp?Phe?Lys?Lys?Phe?Pro?Pro?Ser?Val?Tyr?Gln?Asn?Ala?Gln?Lys?Leu
485?????????????????490?????????????????495
Lys?Thr?Val?Tyr?His?Tyr?Gly?Lys?Gly?Ile?Cys?Glu?Gln?Gly?Ser?Ser
500?????????????????505?????????????????510
Arg?Ser?Tyr?Thr?Phe?Ser?Val?Tyr?Ile?Pro?Ser?Ser?Phe?Pro?Asp?Asn
515?????????????????520?????????????????525
Ala?Thr?Thr?Ile?Phe?Ala?Gln?Trp?His?Gly?Ala?Pro?Ser?Arg?Thr?Leu
530?????????????????535?????????????????540
Val?Ala?Thr?Pro?Glu?Gly?Glu?Ile?Lys?Thr?Leu?Ser?Ile?Glu?Glu?Phe
545?????????????????550?????????????????555?????????????????560
Leu?Ala?Leu?Tyr?Asp?Arg?Met?Ile?Phe?Lys?Lys?Asn?Ile?Ala?His?Asp
565?????????????????570?????????????????575
Lys?Val?Glu?Lys?Lys?Asp?Lys?Asp?Gly?Lys?Ile?Thr?Tyr?Val?Ala?Gly
580?????????????????585?????????????????590
Lys?Pro?Asn?Gly?Trp?Lys?Val?Glu?Gln?Gly?Gly?Tyr?Pro?Thr?Leu?Ala
595?????????????????600?????????????????605
Phe?Gly?Phe?Ser?Lys?Gly?Tyr?Phe?Tyr?Ile?Lys?Ala?Asn?Ser?Asp?Arg
610?????????????????615?????????????????620
Gln?Trp?Leu?Thr?Asp?Lys?Ala?Asp?Arg?Asn?Asn?Ala?Asn?Pro?Glu?Asn
625?????????????????630?????????????????635?????????????????640
Ser?Glu?Val?Met?Lys?Pro?Tyr?Ser?Ser?Glu?Tyr?Lys?Thr?Ser?Thr?Ile
645?????????????????650?????????????????655
Ala?Tyr?Lys?Met?Pro?Phe?Ala?Gln?Phe?Pro?Lys?Asp?Cys?Trp?Ile?Thr
660?????????????????665?????????????????670
Phe?Asp?Val?Ala?Ile?Asp?Trp?Thr?Lys?Tyr?Gly?Lys?Glu?Ala?Asn?Thr
675?????????????????680?????????????????685
Ile?Leu?Lys?Pro?Gly?Lys?Leu?Asp?Val?Met?Met?Thr?Tyr?Thr?Lys?Asn
690?????????????????695?????????????????700
Lys?Lys?Pro?Gln?Lys?Ala?His?Ile?Val?Asn?Gln?Gln?Glu?Ile?Leu?Ile
705?????????????????710?????????????????715?????????????????720
Gly?Arg?Asn?Asp?Asp?Asp?Gly?Tyr?Tyr?Phe?Lys?Phe?Gly?Ile?Tyr?Arg
725?????????????????730?????????????????735
Val?Gly?Asn?Ser?Thr?Val?Pro?Val?Thr?Tyr?Asn?Leu?Ser?Gly?Tyr?Ser
740?????????????????745?????????????????750
Glu?Thr?Ala?Arg
755
Claims (10)
1, a kind of Heparinase I fusion rotein, be to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences, or with SEQ ID №: 2 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 2 amino acid residue sequence is identical active by SEQ ID №: 2 deutero-protein.
2, protein according to claim 1 is characterized in that: described Heparinase I fusion rotein is to have SEQ ID № in the sequence table: the protein of 2 amino acid residue sequences.
3, Heparinase I fusion rotein encoding gene has one of following nucleotide sequences:
1) dna sequence dna of SEQ ID No:1 in the sequence table;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;
3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 95% above homology, and the identical function protein DNA sequence of encoding.
4, gene according to claim 3 is characterized in that: described Heparinase I fusion rotein encoding gene is the SEQ ID № in the sequence table: 1.
5, contain claim 3 or 4 described expression carrier, clone and engineering bacteria.
6, expression vector according to claim 5 and clone is characterized in that: described expression vector is pMAL-hepA.
7, expression vector according to claim 5 and clone is characterized in that: described engineering bacteria is the intestinal bacteria that contain described Heparinase I fusion rotein encoding gene.
8, a kind of method of expressing the Heparinase I fusion rotein is that the recombinant expression vector that will contain Heparinase I fusion rotein encoding gene imports the expressive host bacterium, expresses obtaining expressing the Heparinase I fusion rotein; Described Heparinase I fusion rotein encoding gene has one of following nucleotide sequences:
1) SEQ ID № in the sequence table: 1 dna sequence dna;
2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;
3) with sequence table in SEQ ID №: 1 dna sequence dna that limits has 95% above homology, and the identical function protein DNA sequence of encoding.
9, method according to claim 8 is characterized in that: the recombinant expression vector of described Heparinase I fusion rotein encoding gene is pMAL-hepA; Described host bacterium is intestinal bacteria.
10, according to Claim 8 or 9 described methods, it is characterized in that: the abduction delivering condition of described Heparinase I fusion rotein is 0.01-1mM IPTG, 10-42 degree centigrade and induced 16 hours; Yeast extract concentration in the substratum that is adopted is 1g/L-20g/L; Also add 1%-5% ethanol and/or 0.05-2mg/L kantlex and/or 0.01-2.0mg/L paraxin in the described substratum; Described expression condition is preferably engineering bacteria and, adds 0.3mM IPTG and induced 16 hours at 15 degrees centigrade after 3 hours 37 degrees centigrade of cultivations; The substratum that is adopted is preferably NaCl 10g/L, and yeast extract paste is 7.5g/L, peptone 10g/L, 1% ethanol, 0.6mg/L paraxin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100380986A CN1312183C (en) | 2004-05-19 | 2004-05-19 | Heparinase I fusion protein and genes encoding same and expression method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100380986A CN1312183C (en) | 2004-05-19 | 2004-05-19 | Heparinase I fusion protein and genes encoding same and expression method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1699424A true CN1699424A (en) | 2005-11-23 |
| CN1312183C CN1312183C (en) | 2007-04-25 |
Family
ID=35475687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100380986A Active CN1312183C (en) | 2004-05-19 | 2004-05-19 | Heparinase I fusion protein and genes encoding same and expression method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1312183C (en) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7691613B2 (en) | 2006-11-03 | 2010-04-06 | Momenta Pharmaceuticals, Inc. | Glycosaminoglycan lyase IV and uses thereof |
| US7691612B2 (en) | 2005-11-03 | 2010-04-06 | Momenta Pharmaceuticals, Inc. | Heparan sulfate glycosaminoglycan lyase and uses thereof |
| US7767420B2 (en) | 2005-11-03 | 2010-08-03 | Momenta Pharmaceuticals, Inc. | Heparan sulfate glycosaminoglycan lyase and uses thereof |
| CN101942025A (en) * | 2010-08-20 | 2011-01-12 | 清华大学 | Heparanase III fusion protein and coding gene and expression method thereof |
| CN101942024A (en) * | 2010-08-20 | 2011-01-12 | 清华大学 | Heparanase II fusion protein and coding gene and expression method thereof |
| WO2011011906A1 (en) * | 2009-07-29 | 2011-02-03 | 清华大学 | A fusion heparinase, its coding gene and use |
| CN101608180B (en) * | 2009-07-29 | 2011-08-10 | 清华大学 | Fusion heparinase and coding gene thereof |
| CN101294177B (en) * | 2008-05-26 | 2012-07-18 | 清华大学 | Method for preparing low molecular weight heparin |
| CN104073480A (en) * | 2014-07-04 | 2014-10-01 | 深圳市海普瑞药业股份有限公司 | High-immobilization-tendency heparinase I coding gene and protein thereof |
| CN105753945A (en) * | 2014-12-15 | 2016-07-13 | 清华大学无锡应用技术研究院 | Connecting peptide and application thereof |
| US10900028B2 (en) | 2016-12-22 | 2021-01-26 | Shenzhen Hepalink Pharmaceutical Group Co., Ltd. | Heparinase-producing Pseudomonas stutzeri strain and heparinase derived therefrom |
| CN114181927A (en) * | 2021-08-18 | 2022-03-15 | 刘颖 | Heparinase I |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1552846A3 (en) * | 1995-09-29 | 2008-05-07 | BioMarin Pharmaceutical Inc | Use of heparinases to decrease inflammatory responses |
-
2004
- 2004-05-19 CN CNB2004100380986A patent/CN1312183C/en active Active
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8198050B2 (en) | 2005-11-03 | 2012-06-12 | Momenta Pharmaceuticals, Inc. | Heparan sulfate glycosaminoglycan lyase and uses thereof |
| US7691612B2 (en) | 2005-11-03 | 2010-04-06 | Momenta Pharmaceuticals, Inc. | Heparan sulfate glycosaminoglycan lyase and uses thereof |
| US7767420B2 (en) | 2005-11-03 | 2010-08-03 | Momenta Pharmaceuticals, Inc. | Heparan sulfate glycosaminoglycan lyase and uses thereof |
| US7888072B2 (en) | 2005-11-03 | 2011-02-15 | Momenta Pharmaceuticals, Inc. | Heparan sulfate glycosaminoglycan lyase and uses thereof |
| US7691613B2 (en) | 2006-11-03 | 2010-04-06 | Momenta Pharmaceuticals, Inc. | Glycosaminoglycan lyase IV and uses thereof |
| CN101294177B (en) * | 2008-05-26 | 2012-07-18 | 清华大学 | Method for preparing low molecular weight heparin |
| WO2011011906A1 (en) * | 2009-07-29 | 2011-02-03 | 清华大学 | A fusion heparinase, its coding gene and use |
| CN101608180B (en) * | 2009-07-29 | 2011-08-10 | 清华大学 | Fusion heparinase and coding gene thereof |
| CN101942024A (en) * | 2010-08-20 | 2011-01-12 | 清华大学 | Heparanase II fusion protein and coding gene and expression method thereof |
| CN101942025B (en) * | 2010-08-20 | 2012-07-04 | 清华大学 | Heparanase III fusion protein and coding gene and expression method thereof |
| CN101942024B (en) * | 2010-08-20 | 2012-07-04 | 清华大学 | Heparanase II fusion protein and coding gene and expression method thereof |
| CN101942025A (en) * | 2010-08-20 | 2011-01-12 | 清华大学 | Heparanase III fusion protein and coding gene and expression method thereof |
| CN104073480A (en) * | 2014-07-04 | 2014-10-01 | 深圳市海普瑞药业股份有限公司 | High-immobilization-tendency heparinase I coding gene and protein thereof |
| CN105753945A (en) * | 2014-12-15 | 2016-07-13 | 清华大学无锡应用技术研究院 | Connecting peptide and application thereof |
| CN105753945B (en) * | 2014-12-15 | 2019-04-09 | 清华大学无锡应用技术研究院 | A kind of link peptide and its application |
| US10900028B2 (en) | 2016-12-22 | 2021-01-26 | Shenzhen Hepalink Pharmaceutical Group Co., Ltd. | Heparinase-producing Pseudomonas stutzeri strain and heparinase derived therefrom |
| CN114181927A (en) * | 2021-08-18 | 2022-03-15 | 刘颖 | Heparinase I |
| CN114181927B (en) * | 2021-08-18 | 2023-08-18 | 刘颖 | Heparinase I |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1312183C (en) | 2007-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1900290A (en) | Method for E, coli to express lysostaphin in high efficiency via external secretion | |
| CN1699424A (en) | Heparinase I fusion protein and genes encoding same and expression method thereof | |
| CN100344769C (en) | Production of low-molecular heparin | |
| CN1511849A (en) | Novel alpha interferon mutant and its preparing process | |
| CN1834236A (en) | Lipase A variant of wild Bacillus subtilis and application thereof | |
| CN1495257A (en) | New recombinant xylanase capable of deriving self-anaerobic mycetes, its related sequence, expression vector and host | |
| CN1156575C (en) | Escherichia coli strain secreting human granulocyte colony stimulating factor (G-CSF) | |
| CN1757739A (en) | Method of expressing heparinase and its special expression carrier | |
| CN1191359C (en) | Nucleic acid sequence of high-molecuale glutanin 14 sub-unit gene of wheat and its application | |
| CN101063113A (en) | Clone and expression for novel phytase | |
| CN1834237A (en) | Beta-mannase, its expression and special engineering bacterium | |
| CN1814746A (en) | Nattokinase and its coding gene and clone and expressing method | |
| CN1834250A (en) | Fusion gene of beta-glucanase and xylanase, constitution method and application | |
| CN100347294C (en) | Thermostabilized trehasynthetase, coding gene and use thereof | |
| CN1046559A (en) | The method for preparing hyperglycemic-glycogenolytic factor | |
| CN1834251A (en) | Fusion gene of beta-glucanase and xylanase, constitution method and application | |
| CN100340656C (en) | High-efficiency expression in Pichia yeast, fermentation and purification of human gamma-interferon | |
| CN1313608C (en) | Basic alpha-diastase, and its coding gene and production method | |
| CN1183246C (en) | Extracellent expression of cellulose binding domains (CBD) using bacillus | |
| CN100351378C (en) | Aldehyde-alcohol dehydrogenase gene | |
| CN1834249A (en) | Fusion gene of beta-glucanase and xylanase, constitution method and application | |
| CN101058818A (en) | Hydantoinase gene, coded amino acid and application thereof | |
| CN1234726C (en) | Nucleic acid, expression carrier and application of steady wheat high molecular gluten Dtx1, 5 subunit coding gene | |
| CN101058805A (en) | Method of producing mutation procarboxypeptidase B and mutation carboxypeptidase B | |
| CN1800401A (en) | Ester hydrolase and its gene and recombinant enzyme |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20051123 Assignee: Beijing Bicheng Biotechnology Co., Ltd. Assignor: Tsinghua University Contract record no.: 2015990000925 Denomination of invention: Heparinase I fusion protein and genes encoding same and expression method thereof Granted publication date: 20070425 License type: Common License Record date: 20151109 |
|
| LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model |