Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS20010053539 A1
Publication typeApplication
Application numberUS 09/286,288
Publication dateDec 20, 2001
Filing dateApr 6, 1999
Priority dateJun 28, 1990
Also published asUS7253264
Publication number09286288, 286288, US 2001/0053539 A1, US 2001/053539 A1, US 20010053539 A1, US 20010053539A1, US 2001053539 A1, US 2001053539A1, US-A1-20010053539, US-A1-2001053539, US2001/0053539A1, US2001/053539A1, US20010053539 A1, US20010053539A1, US2001053539 A1, US2001053539A1
InventorsLeander Lauffer, Gerd Zettlmeibl, Patricia Oquendo, Brian Seed
Original AssigneeThe General Hospital Corporation
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Fusion proteins with immunoglobulin portions, the preparation and use thereof
US 20010053539 A1
The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are surprisingly retained in the fusion protein.
Previous page
Next page
Patent claims:
1. A soluble fusion protein composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of immunoglobulin molecules of all subclasses.
2. A fusion protein as claimed in
claim 1
, wherein the immunoglobulin portion is the constant part of the heavy chain of human IgG.
3. A fusion protein as claimed in
claim 2
, wherein the immunoglobulin portion is the constant part of the heavy chain of human IgG1 or a protein A-binding fragment thereof.
4. A fusion protein as claimed in
claim 2
claim 3
, wherein the fusion takes place at the hinge region.
5. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extra-cellular portion of a membrane protein or parts thereof.
6. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extracellular portion of thromboplastin or parts thereof.
7. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extracellular portion of CD28 or parts thereof.
8. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is the extracellular portion of a cytokine receptor or growth factor receptor or parts thereof.
9. A fusion protein as claimed in
claim 8
, wherein the protein fused to immunoglobulin is the extracellular portion of IL-4 receptor or parts thereof.
10. A fusion protein as claimed in
claim 8
, wherein the protein fused to immunoglobulin is the extracellular portion of IL-7 receptor or parts thereof.
11. A fusion protein as claimed in
claim 8
, wherein the protein fused to immunoglobulin is the extracellular portion of tumor necrosis factor receptor or parts thereof.
12. A fusion protein as claimed in
claim 8
, wherein the protein fused to immunoglobulin is the extracellular portion of G-CSF receptor or parts thereof.
13. A fusion protein as claimed in
claim 8
, wherein the protein fused to immunoglobulin is the extracellular portion of GM-CSF receptor or parts thereof.
14. A fusion protein as claimed in
claim 8
, wherein the protein fused to immunoglobulin is the extracellular portion of erythropoietin receptor or parts thereof.
15. A fusion protein as claimed in claims 1-4, wherein the protein fused to immunoglobulin is a non-membrane-bound soluble protein or parts thereof.
16. A fusion protein as claimed in
claim 15
, wherein the protein fused to immunoglobulin is a cytokine- or growth factor or parts thereof.
17. A fusion protein as claimed in
claim 16
, wherein the protein fused to immunoglobulin is erythropoietin or parts thereof.
18. A fusion protein as claimed in
claim 16
, wherein the protein fused to immunoglobulin is GM-CSF or G-CSF or parts thereof.
19. A fusion protein as claimed in
claim 16
, wherein the protein fused to immunoglobulin is interleukins IL-1 to IL-8 or parts thereof.
20. A process for preparing fusion proteins as claimed in any of claims 1-19, which comprises introducing the DNA coding for these constructs into a mammalian cell expression system and, after expression, purifying the produced fusion protein by affinity chromatography via the immunoglobulin portion.
21. The use of the fusion proteins as claimed in any of claims 1-19 for diagnosis.
22. The use of the fusion proteins as claimed in any of claims 1-19 for therapy.
  • [0001]
    The invention relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant region of immunoglobulin molecules. The functional properties of the two fusion partners are, surprisingly, retained in the fusion protein.
  • [0002]
    EP-A 0 325 262 and EP-A 0 314 317 disclose corresponding fusion proteins composed of various domains of the CD4 membrane protein of human T cells and of human IgG1 portions. Some of these fusion proteins bind with the same affinity to the glycoprotein gp120 of human immunodeficiency virus as the cell-bound CD4 molecule. The CD4 molecule belongs to the immunoglobulin family and, consequently, has a very similar tertiary structure to that of immunoglobulin molecules. This also applies to the a chain of the T-cell antigen receptor, for which such fusions have also been described (Gascoigne et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 2937-2940). Hence, on the basis of the very similar domain structure, in this case retention of the biological activity of the two fusion partners in the fusion protein was to be expected.
  • [0003]
    The human proteins which are, according to the invention, preferably coupled to the amino terminus of the constant region of immunoglobulin do not belong to the immunoglobulin family and are to be assigned to the following classes: (i) membrane-bound proteins whose extracellular domain is wholly or partly incorporated in the fusion. These are, in particular, thromboplastin and cytokine receptors and growth factor receptors, such as the cellular receptors for interleukin-4, interleukin-7, tumor necrosis factor, GM-CSF, G-CSF, erythropoietin; (ii) non-membrane-bound soluble proteins which are wholly or partly incorporated in the fusion. These are, in particularly, proteins of therapeutic interest such as, for example, erythropoietin and other cytokines and growth factors.
  • [0004]
    The fusion proteins can be prepared in known pro- and eukaryotic expression systems, but preferably in mammalian cells (for example CHO, COS and BHK cells).
  • [0005]
    The fusion proteins according to the invention are, by reason of their immunoglobulin portion, easy to purify by affinity chromatography and have improved pharmacokinetic-properties in vivo.
  • [0006]
    The invention thus relates to genetically engineered soluble fusion proteins composed of human proteins not belonging to the immunoglobulin family, or of parts thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE). Preferred as immunoglobulin is the constant part of the heavy chain of human IgG, particularly preferably of human IgG1, where fusion takes place at the hinge region.
  • [0007]
    Furthermore, the invention relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for diagnosis and therapy.
  • [0008]
    Finally, the invention is explained in further examples.
  • EXAMPLE 1 Thromboplastin Fusion Proteins
  • [0009]
    Blood coagulation is a process of central importance in the human body. There is appropriately delicate regulation of the coagulation cascade, in which a large number of cellular factors and plasma proteins cooperate. These proteins (and their cofactors) in their entirety are called coagulation factors. The final products of the coagulation cascade are thrombin, which induces the aggregation of blood platelets, and fibrin which stabilizes the platelet thrombus. Thrombin catalyzes the formation of fibrin from fibrinogen and itself is formed by limited proteolysis of prothrombin. Activated factor X (factor Xa) is responsible for this step and, in the presence of factor Va and calcium ions, binds to platelet membranes and cleaves prothrombin.
  • [0010]
    Two ways exist for factor X to be activated, the extrinsic and the intrinsic pathway. In the intrinsic pathway a series of factors is activated by proteolysis in order for each of them to form active proteases. In the extrinsic pathway, there is increased synthesis of thromboplastin (tissue factor) by damaged cells, and it activates factor X, together with factor VIIa and calcium ions. It was formerly assumed that the activity of thromboplastin is confined to this reaction. However, the thromboplastin/VIIa complex also intervenes to activate the intrinsic pathway at the level of factor IX. Thus, a thromboplastin/VIIa complex is one of the most important physiological activators of blood coagulation.
  • [0011]
    It is therefore conceivable that thromboplastin, apart from its use as diagnostic aid (see below), can also be employed as constituent of therapeutic agents for treating inborn or acquired blood coagulation deficiencies. Examples of this are chronic hemophilias caused by a deficiency of factors VIII, IX or XI or else acute disturbances of blood coagulation as a consequence of, for example, liver or kidney disease. Use of such a therapeutic agent after surgicial intervention would also be conceivable.
  • [0012]
    Thromboplastin is an integral membrane protein which does not belong to the immunoglobulin family. Thromboplastin cDNA sequences have been published by a total of four groups (Fisher et al., Thromb. Res., vol. 48 (1987), 89-99; Morrisey et al., Cell, vol. 50 (1987), 129-135; Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238; Spicer et al., Proc. Natl. Acad. Sci. USA, vol. 84 (1987), 5148-5152). Thromboplastin cDNA contains an open reading frame which codes for a polypeptide of 295 amino-acid residues, of which the 32 N-terminal amino acids act as signal peptide. Mature thromboplastin comprises 263 amino-acid residues and has a three-domain structure: i) amino-terminal extracellular domain (219 amino-acid residues); ii) transmembrane region (23 amino-acid residues); iii) cytoplasmic domain (carboxyl terminus; 21 amino-acid residues). In the extracellular domain there are three potential sites for N-glycosylation (Asn-X-Thr). Thromboplastin is normally glycosylated but glycosylation does not appear essential for the activity of the protein (Paborsky et al., Biochemistry, vol. 29 (1989), 8072-8077).
  • [0013]
    Thromboplastin is required as additive to plasma samples in diagnostic tests of coagulation. The coagulation status of the tested person can be found by the one-stage prothrombin clotting time determination (for example Quick's test). The thromboplastin required for diagnostic tests is currently obtained from human tissue, and the preparation process is difficult to standardize, the yield is low and considerable amounts of human starting material (placentae) must be supplied. On the other hand, it is to be expected that preparation of native, membrane-bound thromboplastin by genetic engineering will also be difficult owing to complex purification processes. These difficulties can be avoided by the fusion according to the invention to immunoglobulin portions.
  • [0014]
    The thromboplastin fusion proteins according to the invention are secreted by mammalian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have surprisingly high activity in the one-stage prothrombin clotting time determination.
  • [0015]
    Cloning of Thromboplastin cDNA
  • [0016]
    The sequence published by Scarpati et al., Biochemistry, vol. 26 (1987), 5234-5238, was used for cloning the thromboplastin cDNA. Two oligonucleotide probe molecules (see FIG. 1) were derived from this. These two probe molecules were used to screen a cDNA bank from human placenta (Grundmann et al., Proc. Natl. Acad. Sci. USA, vol. 83 (1986), 8024-8028).
  • [0017]
    cDNA clones of various lengths were obtained. One clone, 2b-Apr5, which is used for the subsequent procedure, codes for the same amino-acid sequence as the cDNA described in Scarpati et al. FIG. 2 depicts the total sequence of the clone 2b-Apr5 with the thromboplastin amino-acid sequence deduced therefrom.
  • [0018]
    Construction of a Hybrid Plasmid pTF1Fc Coding for Thromboplastin Fusion Protein
  • [0019]
    The plasmid pCD4E gamma 1 (EP 0 325 262 A2; deposited at the ATCC under the number No. 67610) is used for expression of a fusion protein composed of human CD4 receptor and human IgG1. The DNA sequence coding for the extracellular domain of CD4 is deleted from this plasmid using the restriction enzymes HindIII and BamHI. Only partial cleavage must be carried out with the enzyme HindIII in this case, in order to cut at only one of the two HindIII sites contained in pCD4E gamma 1 (position 2198). The result is an opened vector in which a eukaryotic transcription regulation sequence (promoter) is followed by the open HindIII site. The open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgG1. The reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid. DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences are attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5′-untranslated region (A: 5′ GATCGATTAAGCTTCGGAACCCGCTCGATCTCGCCGCC 3′) or coding region (B: 5′ GCATATCTGGATCCCCGTAGAATATTTCTCTGAATTCCCC 3′) of thromboplastin cDNA were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 3.
  • [0020]
    Thus, amplification results in a DNA fragment (827 bp) which contains (based on the coding strand) at the 5′ end before the start of the coding sequence a HindIII site, and at the 3′ end after the codon for the first three amino-acid residues of the transmembrane region a BamHI site. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the thromboplastin cDNA to the stop codon of the heavy chain of IgG1. The desired fragment was obtained and, after treatment with HindIII and BamHI, ligated into the vector pCD4E gamma 1, as described above, which had been cut with HindIII (partially) and BamHI. The resulting plasmid was called pTF1Fc (FIG. 4).
  • [0021]
    Transfection of pTF1Fc into Mammalian Cells
  • [0022]
    The fusion protein encoded by the plasmid pTF1Fc is called pTF1Fc hereinafter. pTF1Fc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pTF1Fc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investigations revealed that the proportion of transfected cells was about 25%. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
  • [0023]
    Purification of pTF1Fc Fusion Protein from Cell Culture Supernatants
  • [0024]
    170 ml of supernatant from transiently transfected COS cells were collected overnight in a batch process in a column containing 0.8 ml of protein A-Sepharose at 4° C., washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml fractions with eluting buffer (93:7 100 mM citric acid: 100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM EDTA). The pTF1Fc obtained in this way is pure by SDS-PAGE electrophoresis (U. K. Lämmli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 165 KDa).
  • [0025]
    Biological Activity of Purified TF1Fc in the Prothrombin Clotting Time Determination
  • [0026]
    TF1Fc fusion protein is active in low concentrations (>50 ng/ml) in the one-stage prothrombin clotting time determination (Vinazzer, H. Gerinnungsphysiologie und Methoden im Blutgerinnungslabor (1979), Fisher Verlag Stuttgart). The clotting times achieved are comparable with the clotting times obtained with thromboplastin isolated from human placenta.
  • EXAMPLE 2 Interleukin-4 Receptor Fusion Proteins
  • [0027]
    Interleukin-4 (IL-4) is synthesized by T cells and was originally called B-cell growth factor because it is able to stimulate B-cell proliferation. It exerts a large number of effects on these cells. One in particular is the stimulation of synthesis of molecules of immunoglobulin subclasses IgG1 and IgE in activated B cells (Coffmann et al., Immunol. Rev., vol. 102 (1988) 5). In addition, IL-4 also regulates the proliferation and differentiation of T cells and other hemopoietic cells. It thus contributes to the regulation of allergic and other immunological reactions. IL-4 binds with high affinity to a specific receptor. The cDNA which codes for the human IL-4 receptor has been isolated (Idzerda et al., J. Exp. Med., vol. 171 (1990) 861-873. It is evident from analysis of the amino-acid sequence deduced from the cDNA sequence that the IL-4 receptor is composed of a total of 825 amino acids, with the 25 N-terminal amino acids acting as signal peptide. Mature human IL-4 receptor is composed of 800 amino acids and, like thromboplastin, has a three-domain structure: i) amino-terminal extracellular domain (207 amino acids); ii) transmembrane region (24 amino acids) and iii) cytoplasmic domain (569 amino acids). In the extracellular domain there are six potential sites for N-glycosylation (Asn-X-Thr/Ser). IL-4 receptor has homologies with human Il-6 [sic] receptor, with the β-subunit of human IL-2 receptor, with mouse erythropoietin receptor and with rat prolactin receptor (Idzerda et al., loc. cit.). Thus, like thromboplastin, it is not a member of the immunoglobulin family but is assigned together with the homologous proteins mentioned to the new family of hematopoietin receptors. Members of this family have four cysteine residues and a conserved sequence (Trp-Ser-X-Trp-Ser) in the extracellular domain located near the transmembrane region in common.
  • [0028]
    On the basis of the described function of the IL-4/IL-4 receptor system, there is a possible therapeutic use of a recombinant form of the IL-4 receptor for suppressing IL-4-mediated immune reactions (for example transplant rejection reaction, autoimmune diseases, allergic reactions).
  • [0029]
    The amount of substance required for therapy make [sic] it necessary to prepare such molecules by genetic engineering. Because of the straightforward purification by affinity chromatography and improved pharmacokinetic properties, according to the invention the synthesis of soluble forms of the IL-4 receptor as immunoglobulin fusion protein is particularly advantageous.
  • [0030]
    The IL-4 receptor fusion proteins are secreted by mammalian cells (for example CHO, BHK, COS cells) into the culture medium, purified by affinity chromatography on protein A-Sepharose and have, surprisingly, identical functional properties to the extracellular domain of the intact membrane-bound IL-4 receptor molecule.
  • [0031]
    Construction of a Hybrid Plasmid pIL-4RFc Coding for IL-4 Receptor Fusion Protein
  • [0032]
    Cutting of the plasmid pCD4EGamma1 with XhoI and BamHI results in an opened vector in which the open XhoI site is located downstream from the promoter sequence. The open BamHI site is located at the start of the coding regions for a pentapeptide linker, followed by the hinge and the CH2 and CH3 domains of human IgG1. The reading frame in the BamHI recognition sequence GGATCC is such that GAT is translated as aspartic acid. DNA amplification with thermostable DNA polymerase makes it possible to modify a given sequence in such a way that any desired sequences can be attached at one or both ends. Two oligonucleotides able to hybridize with sequences in the 5′-untranslated region (A: 5′ GATCCAGTACTCGAGAGAGAAGCCGGGCGTGGTGGCTCATGC 3′) or coding region (B: 5′ CTATGACATGGATCCTGCTCGAAGGGCTCCCTGTAGGAGTTGTG 3′) of the IL-4 receptor cDNA which is cloned in the vector pDC302/T22-8 (Idzerda et al., loc. cit.) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 5. Amplification using thermostable DNA polymerase results in a DNA fragment (836 bp) which, based on the coding strand, contains at the 5′ end before the start of the coding sequence an XhoI site, and at the 3′ end before the last codon of the extracellular domain a BamHI site. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of the IL-4 receptor cDNA to the stop codon of the heavy chain of IgG1. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into the vector pCD4E gamma 1, described above, which had been cut with XhoI/BamHI. The resulting plasmid was called pIL4RFc (FIG. 6).
  • [0033]
    Transfection of pIL4RFc into Mammalian Cells
  • [0034]
    The fusion protein encoded by the plasmid pIL4RFc is called pIL4RFc hereinafter. pIL4RFc was transiently expressed in COS cells. For this purpose, COS cells were transfected with pIL4RFc with the aid of DEAE-dextran (EP A 0 325 262). Indirect immunofluorescence investigations revealed that the proportion of transfected cells was about 25%. 24 h after transfection, the cells were transferred into serum-free medium. This cell supernatant was harvested after a further three days.
  • [0035]
    Purification of IL4RFc Fusion Protein from Cell Culture Supernatants
  • [0036]
    500 ml of supernatant from transiently transfected COS cells were collected overnight in a batch process in a column containing 1.6 ml of protein A-Sepharose at 4° C., washed with 10 volumes of washing buffer (50 mM tris buffer pH 8.6, 150 mM NaCl) and eluted in 0.5 ml fractions with eluting buffer (93:7 100 mM citric acid: 100 mM sodium citrate). The first 9 fractions were immediately neutralized with 0.1 ml of 2M tris buffer pH 8.6 in each case and then combined, and the resulting protein was transferred by three concentration/dilution cycles in an Amicon microconcentrator (Centricon 30) into TNE buffer (50 mM tris buffer pH 7.4, 50 mM NaCl, 1 mM EDTA). The IL4RFc obtained in this way is pure by SDS-PAGE electrophoresis (U. K. Lämmli, Nature 227 (1970) 680-685). In the absence of reducing agents it behaves in the SDS-PAGE like a dimer (about 150 KDa).
  • [0037]
    Biological Activity of Purified IL4RFc
  • [0038]
    IL4RFc proteins binds 125I-radiolabeled IL-4 with the same affinity (KD=0.5 nM) [sic] as membrane-bound intact IL-4 receptor. It inhibits the proliferation of IL-4-dependent cell line CTLLHuIL-4RI clone D (Idzerda et al., loc. cit.) in concentrations of 10-1000 ng/ml. In addition, it is outstandingly suitable for developing IL-4 binding assays because it can be bound via its Fc part to microtiter plates previously coated with, for example, rabbit anti-human IgG, and in this form likewise binds its ligands with high affinity.
  • EXAMPLE 3 Erythropoietin Fusion Proteins
  • [0039]
    Mature erythropoietin (EPO) is a glycoprotein which is composed of 166 amino acids and is essential for the development of erythrocytes. It stimulates the maturation and the terminal differentiation of erythroid precursor cells. The cDNA for human EPO has been cloned (EP-A-0 267 678) and codes for the 166 amino acids of mature EPO and a signal peptide of 22 amino acids which is essential for secretion. The cDNA can be used to prepare recombinant functional EPO in genetically manipulated mammalian cells and the EPO can be employed clinically for the therapy of anemic manifestations of various etiologies (for example associated with acute renal failure).
  • [0040]
    Because of the straightforward purification and the improved pharmacokinetic properties, according to the invention synthesis of EPO as immunoglobulin fusion protein is particularly advantageous.
  • [0041]
    Construction of a Hybrid Plasmid pEPOFc Coding for Erythropoietin Fusion Protein
  • [0042]
    This construction was carried out in analogy to that described in Example 2 (section: “Construction of a hybrid plasmid pIL-4RFc coding for IL-4 receptor fusion protein”). Two oligonucleotides able to hybridize with sequences in the vicinity of the initiation codon (A: 5′GATCGATCTCGAGATGGGGGTGCACGAATGTCCTGCCTGGCTGTGG 3′) and of the stop codon (B: 5′ CTGGAATCGGATCCCCTGTCCTGCAGGCCTCCCCTGTGTACAGC 3′) of the EPO cDNA cloned in the vector pCES (EP A 0 267 678) were synthesized. Of these, oligonucleotide A is partially homologous with the sequence of the coding strand, and oligonucleotide B is partially homologous with the non-coding strand; cf. FIG. 7. After amplification there is present with thermostable DNA polymerase a DNA fragment (598 bp) which, based on the coding strand, contains at the 5′ end in front of the initiation codon an XhoI site and in which at the 3′ end the codon for the penultimate C-terminal amino acid residue of the EPO (Asp) is present in a BamHI recognition sequence. The reading frame in the BamHI cleavage site is such that ligation with the BamHI site in pCD4E gamma 1 results in a gene fusion with a reading frame continuous from the initiation codon of EPO cDNA to the stop codon of the heavy chain of IgG1. The desired fragment was obtained and, after treatment with XhoI and BamHI, ligated into the vector pCD4E gamma 1, described above, which had been cut with XhoI/BamHI. The resulting plasmid was called pEPOFc (FIG. 8).
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6838260Dec 4, 2001Jan 4, 2005Emd Lexigen Research Center Corp.Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US7067110Jul 21, 2000Jun 27, 2006Emd Lexigen Research Center Corp.Fc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US7141651Jun 24, 2003Nov 28, 2006Emd Lexigen Research Center Corp.Multiple cytokine protein complexes
US7148321Mar 7, 2002Dec 12, 2006Emd Lexigen Research Center Corp.Expression technology for proteins containing a hybrid isotype antibody moiety
US7229962Jul 26, 2002Jun 12, 2007Medexgen Co., Ltd.Tetravalent etanercept
US7323549Dec 30, 2004Jan 29, 2008Emd Lexigen Research Center Corp.IL-7 fusion proteins
US7465447Dec 30, 2004Dec 16, 2008Merck Patent GmbhFc-erythropoietin fusion protein with improved pharmacokinetics
US7582288Nov 20, 2006Sep 1, 2009Merck Patent GmbhMethods of targeting multiple cytokines
US7589179Dec 8, 2005Sep 15, 2009Merck Patent GmbhIL-7 variants with reduced immunogenicity
US7670595Jun 27, 2005Mar 2, 2010Merck Patent GmbhFc-interferon-beta fusion proteins
US7670602Apr 24, 2007Mar 2, 2010Medexgen Co., LtdConcatameric immunoadhesion molecule
US7696320Jan 11, 2006Apr 13, 2010Domantis LimitedLigands that have binding specificity for VEGF and/or EGFR and methods of use therefor
US7736653Nov 13, 2004Jun 15, 2010Hanmi Pharm. Co., LtdPharmaceutical composition comprising an immunoglobulin Fc region as a carrier
US7737260Nov 13, 2004Jun 15, 2010Hanmi Pharm. Co., LtdProtein complex using an immunoglobulin fragment and method for the preparation thereof
US7754855 *Jul 13, 2000Jul 13, 2010Bolder Biotechnology, Inc.Immunoglobulin fusion proteins
US7767405Nov 15, 2006Aug 3, 2010Merck Patent GmbhImmunocytokine sequences and uses thereof
US7790415Jan 27, 2009Sep 7, 2010Merck Patent GmbhEnhancing the circulating half-life of antibody-based fusion proteins
US7803618Aug 29, 2008Sep 28, 2010Merck Patent GmbhRecombinant tumor specific antibody and use thereof
US7879319Jul 7, 2009Feb 1, 2011Merk Patent GmbhHeterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US7888071Dec 1, 2008Feb 15, 2011Merck Patent GmbhDNA encoding IL-2 fusion proteins with modulated selectivity
US7955590Mar 24, 2005Jun 7, 2011Merck Patent GmbhFc fusion proteins for enhancing the immunogenicity of protein and peptide antigens
US7960514Dec 4, 2007Jun 14, 2011Merck Patent GmbhIL-7 fusion proteins
US7968316Aug 16, 2006Jun 28, 2011Hanmi Holdings Co., Ltd.Method for the mass production of immunoglobulin Fc region deleted initial methionine residues
US7973150Sep 1, 2009Jul 5, 2011Merck Patent GmbhReducing the immunogenicity of fusion proteins
US7993643Apr 26, 2007Aug 9, 2011Amgen Fremont, Inc.Uses of human monoclonal antibodies against oxidized LDL receptor
US8029789Nov 13, 2004Oct 4, 2011Hanmi Holdings Co., Ltd.Method for the mass production of immunoglobulin constant region
US8043608Mar 25, 2009Oct 25, 2011Merck Patent GmbhMethods of using Fc-cytokine fusion proteins
US8066994Jul 19, 2006Nov 29, 2011Merck Patent GmbhProteins comprising an IgG2 domain
US8110665Apr 14, 2010Feb 7, 2012Hanmi Holdings Co., Ltd.Pharmaceutical composition comprising an immunoglobulin FC region as a carrier
US8338575May 18, 2011Dec 25, 2012Merck Patent GmbhIL-7 fusion proteins
US8372961Jan 22, 2010Feb 12, 2013Medexgen Co., Ltd.Polynucleotides encoding concatameric immunoadhesion molecules
US8377448Jan 14, 2010Feb 19, 2013The Board Of Trustees Of The Leland Standford Junior UniversityCD47 related compositions and methods for treating immunological diseases and disorders
US8420087Jan 5, 2005Apr 16, 2013Antisoma Research LimitedInterleukin-12 targeted to oncofoetal fibronectin
US8470991Apr 27, 2010Jun 25, 2013Merck Patent GmbhImmunocytokine sequences and uses thereof
US8557232Feb 27, 2009Oct 15, 2013Merck Patent GmbhStabilization of Fc-interferon-beta fusion proteins
US8822650Apr 15, 2011Sep 2, 2014Hanmi Science Co., LtdMethod for the mass production of immunoglobulin constant region
US8846874Nov 13, 2004Sep 30, 2014Hanmi Science Co., LtdIgG Fc fragment for a drug carrier and method for the preparation thereof
US8877186Jun 3, 2008Nov 4, 2014Domantis LimitedPolypeptides, antibody variable domains and antagonists
US8907066Apr 20, 2010Dec 9, 2014Merck Patent GmbhAntibody fusion proteins with a modified FcRn binding site
US8926973May 26, 2011Jan 6, 2015Merck Patent GmbhReducing the immunogenicity of fusion proteins
US9493531 *Dec 22, 2015Nov 15, 2016Jyant Technologies, Inc.Chemokine-immunoglobulin fusion polypeptides, compositions, method of making and use thereof
US20020147311 *Feb 9, 2001Oct 10, 2002Gillies Stephen D.Enhancing the circulating half-life of antibody-based fusion proteins
US20020193570 *Dec 4, 2001Dec 19, 2002Gillies Stephen D.Heterodimeric fusion proteins useful for targeted immune therapy and general immune stimulation
US20030143226 *Mar 2, 2001Jul 31, 2003Yuko KobayashiHuman monoclonal antibodies against oxidized ldl receptor and medicinal use thereof
US20050042729 *Sep 29, 2004Feb 24, 2005Emd Lexigen Research Center Corp.Expression and export of interferon-alpha proteins as Fc fusion proteins
US20050069521 *Aug 27, 2004Mar 31, 2005Emd Lexigen Research Center Corp.Enhancing the circulating half-life of interleukin-2 proteins
US20050112685 *Nov 26, 2003May 26, 2005Amiss Terry J.Compositions and methods for measuring analyte concentrations
US20060073141 *Apr 4, 2005Apr 6, 2006Domantis LimitedCompositions and methods for treating inflammatory disorders
US20060141581 *Dec 8, 2005Jun 29, 2006Merck Patent GmbhIL-7 variants with reduced immunogenicity
US20060228332 *Jun 27, 2005Oct 12, 2006Merck Patent GmbhAssembly and folding of Fc-interferon-beta fusion proteins
US20060269553 *Nov 13, 2004Nov 30, 2006Hanmi Pharm. Ind. Co., Ltd.Protein complex using an immunoglobulin fragment and method for the preparation thereof
US20060275254 *Nov 13, 2004Dec 7, 2006Hanmi Pharm. Ind. Co., Ltd.Pharmaceutical composition comprising an immunoglobulin fc region as a carrier
US20060276633 *Nov 13, 2004Dec 7, 2006Jung Sung YMethod for the mass production of immunoglobulin constant region
US20070041967 *Nov 13, 2004Feb 22, 2007Jung Sung YIgg fc fragment for a drug carrier and method for the preparation thereof
US20070134234 *Sep 29, 2006Jun 14, 2007Viral Logic Systems Technology Corp.Immunomodulatory compositions and uses therefor
US20070202103 *Jan 5, 2005Aug 30, 2007Emd Lexigen Research Center Corp.Compounds For Targeting
US20080032312 *Jun 8, 2007Feb 7, 2008Amiss Terry JCompositions and methods for measuring analyte concentrations
US20080131431 *May 15, 2007Jun 5, 2008Viral Logic Systems Technology Corp.CD47 related compositions and methods for treating immunological diseases and disorders
US20080241134 *Apr 26, 2007Oct 2, 2008Abgenix, Inc.Uses of human monoclonal antibodies against oxidized ldl receptor
US20080293106 *Aug 16, 2006Nov 27, 2008Jung Sung YoubMethod For the Mass Production of Immunoglobulin Fc Region Deleted Initial Methionine Residues
US20090249503 *Dec 6, 2005Oct 1, 2009Bolder Biotechnology, Inc.Enzyme conjugates for use as detoxifying agents
US20100239579 *Jan 14, 2010Sep 23, 2010Viral Logic Systems Technology Corp.CD47 Related Compositions and Methods for Treating Immunological Diseases and Disorders
US20100255014 *Apr 9, 2010Oct 7, 2010Hanmi Pharm, Co., Ltd.Protein Complex Using An Immunoglobulin Fragment and Method For The Preparation Thereof
US20100278827 *Jan 22, 2010Nov 4, 2010Medexgen Co., Ltd.Concatameric immunoadhesion molecule
US20100285014 *May 10, 2010Nov 11, 2010Bolder Biotechnology, Inc.Immunoglobulin fusion proteins
EP2275816A2Mar 22, 2007Jan 19, 2011Viral Logic Systems Technology Corp.Methods for identifying polypeptide targets and uses thereof for treating immunological diseases
EP2322931A2Mar 22, 2007May 18, 2011Viral Logic Systems Technology Corp.Methods for identifying polypeptide targets and uses thereof for treating immunological diseases
WO2007021129A1Aug 16, 2006Feb 22, 2007Hanmi Pharmaceutical Co., Ltd.A method for the mass production of immunoglobulin fc region deleted initial methionine residues
U.S. Classification435/69.7, 435/69.1, 530/350
International ClassificationC12P21/04, C07K16/00, C07K14/745, C07K14/715, A61K38/00, C07K14/505
Cooperative ClassificationC07K14/7155, C07K14/745, A61K38/00, C07K16/00, C07K2319/00, C07K14/505
European ClassificationC07K14/745, C07K14/505, C07K14/715F, C07K16/00