Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS20020037851 A1
Publication typeApplication
Application numberUS 09/836,077
Publication dateMar 28, 2002
Filing dateApr 16, 2001
Priority dateJul 9, 1997
Also published asCA2237158A1, CN1209436A, EP0892047A2, EP0892047A3, US7339030, US20060029998
Publication number09836077, 836077, US 2002/0037851 A1, US 2002/037851 A1, US 20020037851 A1, US 20020037851A1, US 2002037851 A1, US 2002037851A1, US-A1-20020037851, US-A1-2002037851, US2002/0037851A1, US2002/037851A1, US20020037851 A1, US20020037851A1, US2002037851 A1, US2002037851A1
InventorsBernhard Fleckenstein, Armin Ensser
Original AssigneeBernhard Fleckenstein, Armin Ensser
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Human semaphorin L (H-SemaL) and corresponding semaphorins in other species
US 20020037851 A1
Human semaphorin L (H-SemaL) and corresponding semaphorins in other species.
The invention relates to novel semaphorins which are distinguished by a particular domain structure and derivatives thereof, nucleic acids (DNA, RNA, cDNA) which code for these semaphorins, and derivatives thereof, and the use thereof.
The present invention relates to semaphorins which have a novel, as yet undisclosed and unexpected domain structure and which possess a biochemical function in the immune system (immunomodulating semaphorins). The novel semaphorins are referred to as type L semaphorins (SemaL). They comprise an N-terminal signal peptide, a characteristic Sema domain and, in the C-terminal region of the protein, an immunoglobulin-like domain and a hydrophobic domain which represents a potential transmembrane domain.
Previous page
Next page
1. An isolated semaphorin protein comprising an amino acid sequence having an N-terminal signal peptide, a Sema domain and, in a C-terminal region, an immunoglobulin-like domain and a transmembrane domain.
2. The isolated semaphorin protein as claimed in claim 1, wherein the amino acid sequence corresponds to SEQ ID NO.: 3, or a derivative of SEQ ID NO.: 3.
3. The isolated semaphorin protein as claimed in claim 1, wherein the amino acid sequence of the Sema domain of the semaphorin protein is at least about 40% homologous to the Sema domain of SEQ ID NO.: 3.
4. The isolated semaphorin protein as claimed in claim 1, wherein the amino acid sequence of the protein is at least about 15 to 20% homologous to SEQ ID NO.: 3.
5. The isolated semaphorin protein as claimed in claim 1, comprising an amino acid sequence corresponding to SEQ ID NO.: 4.
6. An isolated nucleic acid molecule encoding a semaphorin protein as claimed in claim 1.
7. The isolated nucleic acid molecule as claimed in claim 6, comprising a nucleic acid sequence corresponding to SEQ ID NO.: 41, or a derivative of SEQ ID NO.: 41.
8. The isolated nucleic acid molecule as claimed in claim 6 wherein the nucleic acid molecule is a cDNA sequence coding for the semaphorin protein.
9. The isolated nucleic acid molecule as claimed in claim 8, wherein the cDNA sequence corresponds to SEQ ID NO.: 1, or to a derivative of SEQ ID NO.: 1.
10. The isolated nucleic acid molecule as claimed in claim 8, wherein the cDNA sequence corresponds to SEQ ID NO.: 2, or to a derivative of SEQ ID NO.: 2.
11. The isolated semaphorin protein as claimed in claim 1, wherein the protein is phosphorylated, glycosylated or myristylated.
12. A plasmid comprising the nucleic acid sequence as claimed in claim 6.
13. A plasmid comprising a nucleic acid sequence corresponding to SEQ ID NO.: 41, or a derivative of SEQ ID NO.: 41.
14. A plasmid comprising the nucelic acid sequence as claimed in claim 8.
15. A vector comprising the nucleic acid sequence as claimed in claim 6.
16. A vector comprising the nucleic acid sequence as claimed in claim 8.
17. A process for preparing a semaphorin protein as claimed in claim 1, which comprises the steps of:
cloning a nucleic acid sequence as claimed in claim 6 into an expression vector to form a recombinant vector;
transforming a cell with the recombinant vector; and
expressing the protein from the transformed cell.
18. The process as claimed in claim 17, wherein the transformed cell is a eukcaryotic cell.
19. A process for preparing a nucleic acid molecule encoding a semaphorin protein as claimed in claim 1, comprising amplifying the nucleic acid sequence corresponding to SEQ ID NO.: 41, or a derivative thereof, by the polymerase chain reaction using specific primers.
20. A method for identifying immunomodulating agents, which comprises incubating a semaphorin protein as claimed in claim 1 under defined conditions with an agent to be investigated, carrying out a second batch in parallel without without the agent to be investigated but under conditions which are otherwise the same, and then determining the inhibiting or activating effect of the agent to be investigated.
21. A method for identifying immunomodulating agents, which comprises expressing a nucleic acid sequence as claimed in claim 6 under defined conditions and in the presence of an agent to be investigated, and determining the extent of the expression.
22. An isolated semaphorin antibody which recognizes an epitope corresponding to amino acids 179 to 378 of SEQ ID NO.: 3 or amino acids 480 to 666 of SEQ ID NO.: 3.
23. A process for preparing an antibody to the semaphorin protein as claimed in claim 1, which comprises the steps of:
preparing a recombinant plasmid with a fusion protein consisting of of a semaphorin epitope and an epitope tag;
transforming a suitable cell with the recombinant plasmid;
purifying the fusion protein from the cells via the epitope tag; and
using the purified fusion proteins for immunization.
24. A method for preventing or treating an immunological disorder which comprises administering to a host in need thereof a pharmaceutical product containing an isolated semaphorin protein or a derivative thereof, as claimed in claim 1.
25. A method for preventing or treating an immunological disorder which comprises administering to a host in need thereof a pharmaceutical product containing a nucleic acid sequence as claimed in claim 6 or a derivative thereof.
26. A method for preventing or treating an immunological disorder which comprises administering to a host in need thereof a pharamceutical product containing a nucleic acid sequence as claimed in claim 8.
27. The method according to claim 24 wherein the method is gene therapy.
28. The method according to claim 25 wherein the method is gene therapy.
29. A method for modulating an immune response or inhibiting inflammation which comprises introducing the nucleic acid sequence as claimed in claim 6 to a host cell.
  • [0001]
    This application claims priority to German Application Nos. 19729211.9 and 19805371.1, filed Jul. 9, 1997 and Feb. 11, 1998 respectively, each incorporated herein by reference.
  • [0002]
    1. Field of the Invention
  • [0003]
    The invention relates to novel semaphorins which are distinguished by a particular domain structure and derivatives thereof, nucleic acids (DNA, RNA, cDNA) which code for these semaphorins, and derivatives thereof, and the preparation and use thereof.
  • [0004]
    2. Description of the Related Art
  • [0005]
    The publications which are referenced in this application describe the state of the art to which this invention pertains. These references are incorporated herein by references.
  • [0006]
    Semaphorins were described for the first time by Kolodkin {Kolodkin et al. (1993) Cell 75:1389-1399} as members of a conserved gene family.
  • [0007]
    The genes or parts of the genes of other semaphorins have now been cloned and, in some cases, characterized. To date, a total of 5 human (H-Sema III, H-Sema V, H-Sema IV, H-SemaB and H-SemaE) {Kolodkin et al. (1993); Roche et al. (1996) Onkogene 12:1289-1297; Sekido et al. (1996) Proc. Natl. Acad. Sci. USA 93:41204125; Xiang et al. (1996) Genomics 32:39-48; Hall et al. (1996) Proc. Natl. Acad. Sci. USA 39:11780-11785; Yamada et al. (1997) (GenBank Accession No. AB000220)}, 8 murine (mouse genes; M-Sema A to M-Sema-H) {Püschel et al. (1995) Neuron 14:941-948; Messerschmidt et al. (1995) Neuron 14:949-959; Inigaki et al. (1995) FEBS Letters 370:269-272; Adams et al. (1996) Mech. Dev. 57:33-45; Christensen et al. (1996) (GenBank Accession No. Z80941, Z93948)}, 5 galline (chicken) (collapsin-1 to -5) {Luo et al. (1993); Luo et al. (1995) Neuron 14:1131-1140), and genes from rats (R-Sema-III) {Giger et al. (1996) J. Comp. Neurol. 375:378-392}, zebra fish, insects (fruit fly (Drosophila melanogaster: D-Sema I and D-Sema II), beetles (Tribolium confusum: T-Sema-I), grasshoppers (Schistocerca americana: G-Sema-I)) {Kolodkin et al. (1993)}, and nematodes (C.elegans: Ce-Sema) {Roy et al. (1994) (GenBank Accession No. U15667)} have been disclosed. In addition, two poxviruses (vaccinia (ORF-A39) and variola (ORFA39-homologous)) {Kolodkin et al. (1993)} and alcelaphine herpesvirus Type 1 (AHV-1) (AHV-Sema) {Ensser and Fleckenstein (1995) Gen. Virol. 76:1063-1067} have genes homologous to semaphorins.
  • [0008]
    Table 1 summarizes the semaphorins identified to date in various species. Table 1 indicates the names of the semaphorins (column 1), the synonyms used (column 2), the species from which the particular semaphorin has been isolated (column 3) and, where known, data on the domain structure of the encoded protein and on the chromosomal location (column 4 in Table 1), the accession number under which the sequence of the gene is stored in gene databanks (for example in an EST (expressed sequence tags) databank, EMBL (European Molecular Biology Laboratory, Heidelberg) or NCBI (National Center for Biotechnology Information, Maryland, USA), and the corresponding reference under which these data have been published (column 5 in Table 1).
  • [0009]
    All the gene products (encoded semaphorins) of the semaphorin genes disclosed to date have an N-terminal signal peptide which has at its C-terminal end a characteristic Sema domain with a length of about 450 to 500 amino acids. Highly conserved amino acid motifs and a number of highly conserved cysteine residues are located within the Sema domains. The gene products (semaphorins) differ in the C-terminal sequences which follow the Sema domains and are composed of one or more domains. They have, for example, in these C-terminal amino acid sequences transmembrane domains (TM), immunoglobulin-like domains (Ig) (constant part of the immunoglobulin), cytoplasmic sequences (CP), processing signals (P) (for example having the consensus sequence (RXR) where R is the amino acid arginine and X is any amino acid) and/or hydrophilic C termini (HPC). The semaphorins disclosed to date can be divided on the basis of the differences in the domain structure in the C terminus into 5 different subgroups (I to V):
  • [0010]
    I Secreted, without other domains (for example ORF-A49)
  • [0011]
    II Ig Secreted (without transmembrane domain) for example AHV-Sema)
  • [0012]
    III Ig, TM, CP Membrane-anchored with cytoplasmic sequence (for example CD100)
  • [0013]
    IV Ig, (P), HPC Secreted with hydrophilic C terminus (for example H-Sema III, M-SemaD, collapsin-1)
  • [0014]
    V Ig, TM, CP Membrane-anchored with C-terminal 7 thrombospondin motif (for example M-SemaF and G)
  • [0015]
    A receptor or extracellular ligand for semaphorins has not been described to date. Intracellular, heterotrimeric GTP-binding protein complexes have been described in connection with semaphorin-mediated effects. One component of these protein complexes which has been identified in chickens is called CRMP (collapsin response mediator protein) and is presumed to be a component of the semaphorin-induced intracellular signal cascade (Goshima et al. (1995) Nature 376: 509-514). CRMP62, for example, has homology with unc-33, a nematode protein which is essential for directed growth of axons. A human protein with 98% amino acid identity with CRMP62 is likewise known (Hamajima et al. (1996) Gene 180: 157-163). Several CRMP-related genes have likewise been described in rats (Wang et al. (1996) Neurosci. 16: 6197-6207).
  • [0016]
    The secreted or transmembrane semaphorins convey repulsive signals for growing nerve buds. They play a part in the development of the central nervous system (CNS) and are expressed in particular in muscle and nerve tissues (Kolodkin et al. (1993); Luo et al. (1993) Cell 75:217-227).
  • [0017]
    Pronounced expression of M-SemaG has been observed not only in the CNS but also in cells of the lymphatic and hematopoietic systems, in contrast to the closely related M-SemaF {Furuyima et al. (1996) J. Biol. Chem. 271: 33376-33381}.
  • [0018]
    Recently, two other human semaphorins have been identified, H-Sema IV and H-Sema V, specifically in a region on chromosome 3p21.3, whose deletion is associated with various types of bronchial carcinomas. H-Sema IV {Roche et al. (1996), Xiang et al. (1996), Sekido et al. (1996)} is about 50% identical at the amino acid level with M-SemaE, whereas H-Sema V {Sekido et al. (1996)} is the direct homolog of M-SemaA (86% amino acid identity). Since these genes (H-Sema IV and V) were found during DNA sequencing projects on the deleted 3p21.3 loci, the complex intron-exon structure of these two genes is known. Both genes are expressed in various neuronal and non-neuronal tissues.
  • [0019]
    Likewise only recently, the cellular surface molecule CD100 (human), expressed and induced on activated T cells, has been identified as a semaphorin (likewise listed in Table 1). It assists interaction with B cells via the CD40 receptor and the corresponding ligand CD40L. CD100 is a membrane-anchored glycoprotein dimer of 150 kd (kilodaltons). An association of the intracytoplasmic C-terminus of CD100 with an as yet unknown kinase has been described {Hall et al. (1996)}. This means that CD100 is the first and to date only semaphorin whose expression in cells of the immune system has been demonstrated.
  • [0020]
    In the “transforming genes of rhadinoviruses” project, the complete genome of alcelaphine herpesvirus Type 1 (AHV-1) has been cloned and sequenced {Ensser et al. (1995)}. AHV-1 is the causative agent of malignant catarrhal fever, a disease of various ruminants which is associated with a lymphoproliferative syndrome and is usually fatal. On analysis, an open reading frame was found, at one end of the viral genome, having remote but significant homology with a gene of vaccinia-virus (ORF-A39 corresponds to VAC-A39 in Ensser et al. (1995) J. Gen. Virol. 76:1063-1067) which has been assigned to the semaphorin gene family. Whereas the AHV-1 semaphorin (AHV-Sema) has a well-conserved semaphorin structure, the poxvirus genes (ORF-A39 and ORF-A39-homologous, see Table 1) have C-terminal truncations, i.e. the conserved Sema domain is present in them only incompletely.
  • [0021]
    Databank comparison of the found AHV-Sema with dbEST (EST (expressed sequence tags) databank (db)) provided in each case 2 EST sequences from 2 independent cDNA clones from human placenta (accession numbers H02902, H03806 (clone 151129), accession numbers R33439 and R33537 (clone 135941)). These display distinctly greater homology with AHV-1 semaphorin than with the neuronal semaphorins hitherto described.
  • [0022]
    The present invention relates to semaphorins which have a novel, as yet undisclosed and unexpected domain structure and which possess a biochemical function in the immune system (immunomodulating semaphorins). The novel semaphorins are referred to as type L semaphorins (SemaL). They comprise an N-terminal signal peptide, a characteristic Sema domain and, in the C-terminal region of the protein, an immunoglobulin-like domain and a hydrophobic domain which represents a potential transmembrane domain.
  • [0023]
    The amino acid sequence of the signal peptide may have fewer than 70, preferably fewer than 60 amino acids and more than 20, preferably more than 30 amino acids, and a particularly preferred length is of about 40 to 50 amino acids. In a specific embodiment of the invention, the signal peptide has a length of 44 amino acids, i.e. a cleavage site for a signal peptidase is located between amino acids 44 and 45.
  • [0024]
    The Sema domain may have a length of from 300 to 700 or more, preferably of about 400 to 600, amino acids. Preferred Sema domains have a length of 450 to 550 amino acids, preferably of about 500 amino acids. In a preferred embodiment of the invention, the Sema domain is joined to the signal peptide, in which case the Sema domain preferably extends up to amino acid 545.
  • [0025]
    The immunoglobulin-like domain may have a length of about 30 to 110 or more amino acids, and preferred lengths are between 50 and 90, particularly preferably about 70, amino acids.
  • [0026]
    The transmembrane domain may have a length of about 10 to 35, preferably of about 15 to 30, particularly preferably of about 20 to 25, amino acids.
  • [0027]
    The invention relates to type L semaphorins from various species, in particular from vertebrates, for example from birds and/or fishes, preferably from mammals, for example from primates, rat, rabbit, dog, cat, sheep, goat, cow, horse, pig, particularly preferably from human and mouse. The invention also relates to corresponding semaphorins from microorganisms, especially from pathogenic microorganisms, for example from bacteria, yeasts and/or viruses, for example from retroviruses, especially from human-pathogenic microorganisms.
  • [0028]
    The invention will be described in greater detail with the aid of the following figures:
  • [0029]
    [0029]FIG. 1 is a Multiple tissue Northern blot for the tissue-specific expression of H-SemaL.
  • [0030]
    [0030]FIG. 2 is a diagrammic representation of the cloning of the H-SemaL cDNA and of the genomic organization of the H-SemaL encoding sequence.
  • [0031]
    [0031]FIG. 3 is a phylogenetic tree.
  • [0032]
    [0032]FIG. 4 is a FACS analysis of H-SEMAL expression in various cell lines.
  • [0033]
    [0033]FIG. 5 is a comparative analysis of CD 100 and H-SemaL expression.
  • [0034]
    [0034]FIG. 6 is the expression of secretable human SEMA-L (H-SemaL) in HiFive and SC3 cells.
  • [0035]
    [0035]FIG. 7 depicts the specificity of the antiserum.
  • [0036]
    [0036]FIG. 8 is a plasmid map of pMelBacA-H-SEMAL.
  • [0037]
    One embodiment of the invention is a corresponding human semaphorin (H-SemaL) which has a signal peptide, a Sema domain, an immunoglobulin-like domain and a transmembrane domain. A specific embodiment is the semaphorin which is given by the amino acid sequence shown in Table 4.
  • [0038]
    Another embodiment of the invention comprises corresponding semaphorins in other species which have, in the region of the Sema domain, an amino acid identity greater than 40%, preferably greater than 50%, particularly preferably greater than 60%, in relation to the Sema domain of H-SemaL (amino acids 45 to 545 of the sequence in Table 4). The corresponding semaphorins from closely related species (for example primates, mouse) may perfectly well have amino acid identities of greater than 70%, preferably greater than 80%, particularly preferably greater than 90%. Percentage homologies can be determined or calculated for example using the GAP program (GCG program package, Genetic Computer Group (1991)).
  • [0039]
    Such an embodiment of the invention is a corresponding mouse semaphorin (murine semaphorin (M-SemaL)). This contains, for example, the partial amino acid sequence shown in Table 5 (murine semaphorin (M-SemaL)).
  • [0040]
    The invention also relates to corresponding semaphorins which have an amino acid identity (considered over the entire length of the amino acid sequence of the protein) of only about 15 to 20% in the case of less related species (very remote from one another phylogenetically), preferably 25 to 30%, particularly preferably 35 to 40%, or a higher identity in relation to the complete amino acid sequence of H-SemaL shown in Table 4.
  • [0041]
    The genes which code for type L semaphorins have a complex exon-intron structure. These genes may have, for example, between 10 and 20 exons, preferably about 11 to 18, particularly preferably 12 to 16, exons and a corresponding number of introns. However, they may also have the same number of exons and introns as does the gene of H-SemaL (13 or 15 exons, preferably 14 exons). A particular embodiment of the invention relates to the gene of H-SemaL. This gene preferably has a length of 8888 to 10,000 or more nucleotides. The human semaphorin gene preferably contains the nucleotide sequence given in Table 14 or the nucleotide sequence which has been deposited at the GenBank® databank under accession number AF030697. These nucleotide sequences contain at least 13 introns. In addition, the human semaphorin gene has at the 5′ end an additional sequence region. This region contains, where appropriate, further coding and uncoding sequences, for example one or two further introns or exons.
  • [0042]
    Attempts to locate the human type L semaphorin on the chromosome revealed that the corresponding gene is located at position 15q22.3-23. The gene for M-SemaL has correspondingly been located at position 9A3.3-B.
  • [0043]
    As a consequence of the complex intron-exon structure, the splicing of the primary transcript of the semaphorin mRNA may vary, resulting in different splicing variants of the semaphorins. The proteins translated from these splicing variants are derivatives of the semaphorins according to the invention. They correspond in their amino acid sequence and also substantially in their domain structure to the described type L semaphorins according to the invention, but are truncated by comparison with the latter where appropriate. For example, splicing variants wholly or partly lacking the transmembrane domain may be formed. A semaphorin derivative which contains an incomplete, or no, transmembrane domain, but contains a signal peptide, may be secreted and in this way have effects outside the cell, locally or else over relatively large distances, for example on other cells. Another splicing variant may, for example, no longer contain a sequence which codes for a signal peptide and, where appropriate, also no sequence which codes for a hydrophobic amino acid sequence representing a potential transmembrane domain. One consequence would be that this semaphorin derivative is neither incorporated into the membrane nor secreted (unless through secretory vesicles). Such a semaphorin derivative may be involved in intracellular processes, for example in signal transduction processes. It is possible in this way for a wide variety of intra- and extracellular processes to be controlled and/or harmonized with the same basic molecule (type L semaphorins) and the derivatives derived therefrom (for example splicing variants).
  • [0044]
    A particular embodiment of the invention relates to semaphorin derivatives which are derived from the type L semaphorins according to the invention but which contain an incomplete, or no, transmembrane domain.
  • [0045]
    Another embodiment of the invention relates to semaphorin derivatives which are derived from the type L semaphorins according to the invention but which contain no signal peptide.
  • [0046]
    The signal peptide may also undergo post-translational elimination. This forms a membrane-bound (with TM domain) or a secreted (splicing variant without TM domain) semaphorin derivative with truncated domain structure. A semaphorin derivative which has undergone post-translational processing in this way now contains only Sema domain, Ig domain and, where appropriate, transmembrane domain. A signal peptide cleavage site can be located, for example, right at the end of the signal peptide, but it may, for example, be located 40 to 50 amino acids or more away from the amino terminus.
  • [0047]
    A “truncated” (i.e. containing fewer domains) semaphorin L derivative can be distinguished from other semaphorins which are not derived from type L semaphorins in that there is a very great (>90%) amino acid identity or an identical amino acid sequence with the type L semaphorins in the domains which are present.
  • [0048]
    The semaphorins according to the invention may also have undergone post-translational modification in other ways. For example, they may be glycosylated (N- and/or O-glycosylated) once, twice, three, four, five, six, seven, eight, nine, ten or more times. The amino acid sequences of the semaphorins may then have an equal number of or more consensus sequences for potential glycosylation sites, preferably five such sites. One embodiment of the invention relates to semaphorins in which the glycosylation sites are located at positions which correspond to positions 105, 157, 258, 330 and 602 of the H-SemaL amino acid sequence (Table 4).
  • [0049]
    In addition, the semaphorins may be in the form of their phosphorylated derivatives. Semaphorins may be the substrates of various kinases, for example the amino acid sequences may have consensus sequences for protein kinase C, tyrosine kinase and/or creatine kinases. In addition, the amino acid sequences of the semaphorins may have consensus sequences for potential myristylation sites. Corresponding semaphorin derivatives may be esterified with myristic acid at these sites.
  • [0050]
    The type L semaphorins according to the invention and their derivatives may be in the form of monomers, dimers and/or multimers, for example two or more semaphorins or their derivatives can be linked together by intermolecular disulfide bridges. It is also possible for intramolecular disulfide bridges to be formed.
  • [0051]
    Further derivatives of the semaphorins according to the invention are fusion proteins. A fusion protein of this type contains, on the one hand, a type L semaphorin or parts thereof and, in addition, another peptide or protein or a part thereof. Peptides or proteins or parts thereof may be, for example, epitope tags (for example His tag (6×histidine), Myc tag, flu tag) which can be used, for example, for purifying the fusion proteins, or those which can be used for labeling the fusion proteins, for example GFP (green fluorescent protein). Examples of derivatives of the type L semaphorins are given for example by the constructs described in the examples. The sequences of these constructs can be found in Tables 7 to 15, where appropriate taking account of the annotations relating to the plasmids.
  • [0052]
    The invention further relates to nucleic acid sequences, preferably DNA and RNA sequences, which code for the type L semaphorins according to the invention and/or their derivatives, for example the corresponding genes, the various splicing variants of the mRNA, the cDNAs corresponding thereto, and derivatives thereof, for example salts of the DNA or RNA. Derivatives for the purpose of the inventions are sequences or parts thereof which have been modified, for example, by methods of molecular biology and adapted to the particular requirements, for example truncated genes or parts of genes (for example promoter sequences, terminator sequences), cDNAs or chimeras thereof, constructs for expression and cloning and salts thereof.
  • [0053]
    One embodiment relates to the genomic sequences (genes) of the type L semaphorins. The invention relates to the intron and exon sequences and gene-regulatory sequences, for example promoter, enhancer and silencer sequences.
  • [0054]
    This embodiment relates on the one hand to the gene of H-SemaL or its derivatives. The invention relates on the one hand to a gene which comprises the nucleotide sequence given in Table 14. The invention further relates to the gene which comprises the nucleotide sequence which is deposited in the GenBank® databank under accession number AF030697.
  • [0055]
    This embodiment further relates to the gene of M-SemaL and its derivatives.
  • [0056]
    The invention further relates to the cDNA of H-SemaL or its derivatives (for example parts of the cDNA). A particular embodiment is the cDNA of H-SemaL according to the nucleotide sequence in Table 2. The invention further relates to the cDNA of H-SemaL which is deposited in the GenBank® databank under accession number AF030698. The invention also relates to the mRNAs corresponding to these cDNAs, or parts thereof.
  • [0057]
    The invention further relates to the cDNA of M-SemaL or its derivatives (for example parts of the cDNA). A particular embodiment is the partial cDNA sequence of M-SemaL shown in Table 3, and cDNA sequences which comprise this partial cDNA sequence. Another embodiment of the invention relates to the cDNA of M-SemaL which is deposited in the GenBank databank under accession number AF030699. The invention also relates to the mRNAs corresponding to these cDNAs, or parts thereof.
  • [0058]
    The invention also comprises alleles and/or individual expression forms of the genes/mRNAs/cDNAs which differ only slightly from the semaphorin sequences described herein and code for an identical or only slightly modified protein (difference in the amino acid sequence less than or equal to 10%) (further example of derivatives). Further examples of the derivatives are given by the constructs indicated in the examples. The sequences of these constructs are depicted in Tables 7 to 14 and can be interpreted taking account of the annotation for plasmids.
  • [0059]
    The invention further relates to plasmids which comprise DNA which codes for the type L semaphorins or derivatives thereof. Plasmids of this type may be, for example, plasmids with high replication rates suitable for amplification of the DNA, for example in E. coli.
  • [0060]
    A specific embodiment comprises expression plasmids with which the semaphorins or parts thereof or their derivatives can be expressed in prokaryotic and/or eukaryotic expression systems. Both constitutive expression plasmids and those containing inducible promoters are suitable.
  • [0061]
    The invention also relates to processes for preparing nucleic acids which code for type L semaphorins or derivatives thereof.
  • [0062]
    These nucleic acids, for example DNA or RNA, can be synthesized, for example, by chemical means. In particular, it is possible for these nucleic acids, for example the corresponding genes or cDNAs or parts thereof, to be amplified by PCR using specific primers and suitable starting material as template. (For example cDNA from a suitable tissue or genomic DNA).
  • [0063]
    A specific process for preparing semaphorin L cDNA and the H-SemaL gene is described in the examples.
  • [0064]
    The invention also relates to processes for preparing type L semaphorins. For example, a semaphorin L or a derivative thereof can be prepared by cloning a corresponding nucleic acid sequence which codes for a type L semaphorin or a derivative thereof into an expression vector and using the latter recombinant vector to transform a suitable cell. It is possible to use, for example, prokaryotic or eukaryotic cells. The type L semaphorins or derivatives thereof may also, where appropriate, be prepared by chemical means.
  • [0065]
    In addition, the type L semaphorins and derivatives thereof can be expressed as fusion proteins, for example with proteins or peptides which permit detection of the expressed fusion protein, for example as fusion protein with GFP (green fluorescent protein). The semaphorins may also be expressed as fusion proteins with one, two, three or more epitope tags, for example with Myc and/or His (6×histidine) and/or flu tags. It is correspondingly possible to use or prepare plasmids which comprise DNA sequences which code for these fusion proteins. For example, semaphorin-encoding sequences can be cloned into plasmids which contain DNA sequences which code for GFP and/or epitope tags, for example Myc tag, His tag, flu tag. Specific examples thereof are given by the examples and the sequences listed in the tables, where appropriate with the assistance of the annotation relating to the plasmids.
  • [0066]
    The invention further relates to antibodies which specifically bind or recognize the type L semaphorins, derivatives thereof or parts thereof. Possible examples thereof are polyclonal or monoclonal antibodies which can be produced, for example, in mouse, rabbit, goat, sheep, chicken etc.
  • [0067]
    A particular embodiment of this subject-matter of the invention comprises antibodies directed against the epitopes which correspond to the amino acid sequences from position 179 to 378 or 480 to 666 of the H-SemaL sequence shown in Table 4. The invention also relates to a process for preparing specific anti-semaphorin L antibodies, using for the preparation antigens comprising said epitopes.
  • [0068]
    The invention also relates to processes for preparing the antibodies, preferably using for this purpose a fusion protein consisting of a characteristic semaphorin epitope and an epitope tag which can be used for the subsequent purification of the recombinant fusion protein. The purified fusion protein can subsequently be used for the immunization. To prepare the recombinant fusion protein, a corresponding recombinant expression vector is prepared and used to transform a suitable cell. The recombinant fusion protein can be isolated from this cell. The procedure can be, for example, like that described in Example 8.
  • [0069]
    These antibodies can be used, for example, for purifying the corresponding semaphorins, for example H-SemaL and its derivatives, for example on affinity columns, or for the immunological detection of the proteins, for example in an ELISA, in a Western blot and/or in immunohistochemistry. The antibodies can also be used to analyze the expression of H-SemaL, for example in various cell types or cell lines.
  • [0070]
    The cDNA of H-SemaL has a length of 2636 nucleotides (Table 2). The gene product of the H-SemaL cDNA has a length of about 666 amino acids (Table 4) and displays the typical domain structure of a type L semaphorin. The gene product has an N-terminal signal peptide (amino acids 1 to 44), Sema domain (amino acid 45 to approximately amino acid 545), and Ig (immunoglobulin) domain (approximately amino acids 550 to 620) and, at the C-terminal end, a hydrophobic amino acid sequence which represents a potential transmembrane domain. This domain structure has never previously been described for semaphorins. It relates to a membrane-associated glycoprotein which is probably located on the cell surface and belongs to a new subgroup. On the basis of this previously unknown domain structure, the semaphorins can now be divided into VI subgroups:
  • [0071]
    I Secreted, without other domains (for example ORF-A49)
  • [0072]
    II Ig Secreted (without transmembrane domain) (for example AHV-Sema)
  • [0073]
    III Ig, TM, CP Membrane-anchored with cytoplasmic sequence (for example CD100)
  • [0074]
    IV Ig, (P), HPC Secreted with hydrophilic C terminus (for example H-Sema-III, M-SemaD, collapsin-1)
  • [0075]
    V Ig, TM, CP Membrane-anchored with C-terminal 7 thrombospondin motif (for example M-SemaF and G)
  • [0076]
    VI Ig, TM Membrane-anchored (for example H-SemaL, M-SemaL)
  • [0077]
    The unglycosylated, unprocessed form of H-SemaL has a calculated molecular weight of about 74.8 kd (74823 dalton) (calculated using Peptide-Sort, GCG program package). The isoelectric point is calculated to be pH=7.56.
  • [0078]
    A possible signal peptide cleavage site is located between amino acids 44 and 45 (Table 3; calculated with SignalP (http.// P), a program based on neural networks for analyzing signal sequences {Nielsen H. et. al. (1997) Protein Engineering 10:1-6}). This gives for the processed protein (without signal peptide) a molecular weight (MW) of 70.3 kd (70323 dalton) and an isoelectric point of pH=7.01.
  • [0079]
    The genomic structure is likewise substantially elucidated. The H-SemaL gene has 13 or 15 or more exons, preferably 14 exons, and 12 or 14 introns, preferably 13 introns. Because of this complex exon-intron structure, various splicing variants are possible. The mRNA of the transcribed H-SemaL gene is found in the Northern blot particularly in placenta, gonads, thymus and spleen. No mRNA has been detected in neuronal tissue or in muscle tissue. There is evidence of specifically regulated expression in endothelial cells.
  • [0080]
    Alternative splicing may also result in forms of H-SemaL with intracytoplasmic sequences which are involved in intracellular signal transduction, similar to, for example, CD100. It would likewise be possible for alternative splicing to result in secreted forms of H-SemaL, analogous to viral AHV-Sema.
  • [0081]
    Nucleotide and amino acid sequence analyses were performed with the aid of the GCG program package (Genetics Computer Group (1991) Program manual for the GCG package, Version 7, 575 Science Drive, Wisconsin, USA 53711), FASTA (Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85, 2444-2448) and BLAST program (Gish and States (1993) Nat. Genet.3, 266-272; Altschul et al. (1990) J. Mol. Biol. 215, 403410). These programs were also used for sequence comparisons with GenBank (Version 102.0) and Swiss Prot (Version 34.0).
  • [0082]
    Post-translational modifications such as glycosylation and myristylation of H-SemaL are likewise possible. Consensus sequences for N-glycosylation sites were found with the aid of the Prosite program (GCG program package) at positions 105, 157, 258, 330 and 602 of the amino acid sequence of H-SemaL (shown in Table 4), and those for myristylation were found at positions 114, 139, 271, 498, 499, 502 and 654 (consensus sequence: G˜(E, D, R, K, H, P, F, Y, W)×(S, T, A, G, C, N)˜(P)). In addition, the amino acid sequence of H-SemaL contains several consensus sequences for potential phosphorylation sites for various kinases. It can therefore be assumed that H-SemaL can be the substrate of various kinases, for example phosphorylation sites for creatine kinase 2, protein kinase C and tyrosine kinase.
  • [0083]
    Predicted creatine kinase 2 phosphorylation sites (consensus sequence Ck2: (S,T)×2(D,E)) (Prosite, GCG) at positions 119, 131, 173, 338, 419 and 481 of the amino acid sequence.
  • [0084]
    Predicted protein kinase C phosphorylation sites (consensus sequence PkC: (S,T)×(R,K)) (Prosite, GCG) at positions 107, 115, 190, 296, 350, 431, 524 and 576 of the amino acid sequence.
  • [0085]
    Predicted tyrosine kinase phosphorylation site (consensus sequence: (R,K)×{2,3}(D,E)×{2,3}Y) (Prosite, GCG) at position 205 of the amino acid sequence.
  • [0086]
    The consensus sequences are indicated in the single letter code for amino acids.
  • [0087]
    An “RGD” motif (arginine-glycine-aspartic acid) characteristic of integrins is located at position 267.
  • [0088]
    The glycosylation sites are highly conserved between viral AHV-Sema, H-SemaL and (as far as is known) M-SemaL.
  • [0089]
    Di- or multimerization of H-SemaL is possible and has been described for other semaphorins such as CD100 {Hall et al. (1996)}. The CD100 molecule is likewise a membrane-anchored glycoprotein dimer of 150 kd. However, CD100 is not closely related to the human semaphorin (H-SemaL) according to the invention.
  • [0090]
    The partial cDNA sequence of M-SemaL has a length of 1195 nucleotides. This sequence codes for a protein having 394 amino acids. These 394 amino acids correspond to amino acids 1 to 396 of H-SemaL. The signal peptide in M-SemaL extends over amino acids 1 to 44 (exactly as in H-SemaL). The Sema domain starts at amino acid 45 and extends up to the end or probably beyond the end of the sequence shown in Table 4.
  • [0091]
    Multiple alignments were carried out using the Clustal W program (Thompson et al. (1994)). These alignments were processed further manually using SEAVIEW (Galtier et al. (1996) Comput. Appl. Biosci 12, 543-548). The phylogenetic distances were determined using Clustal W (Thompson et al. (1994)).
  • [0092]
    Comparison of the protein sequences of the known and of the novel semaphorins and phylogenetic analysis of these sequences shows that the genes can be categorized according to their phylogenetic relationship. The C-terminal domain structure of the corresponding semaphorin subtypes is, of course, involved in this as a factor deciding why semaphorins in the same subgroups are, as a rule, also more closely related phylogenetically than are semaphorins in different subgroups. The species from which the semaphorin was isolated also has an influence, i.e. whether the corresponding species are phylogenetically closely related to one another or not.
  • [0093]
    A phylogenetic analysis (compare FIG. 3) of the known semaphorin amino acid sequences (complete sequences and/or part-sequences, using the amino acid sequences for H-SemaL and M-SemaL shown in Tables 4 and 5 and for all other sequences the sequences stored under the accession numbers or the encoded amino acid sequences derived from these sequences) using the CLUSTAL W program {Thompson J. D. et al. (1994) Nucleic Acids Res. 22:4673-4680} shows that the amino acid sequences of H-SemaL and M-SemaL are phylogenetically closely related to one another and form a separate phylogenetic group. H-SemaL and M-SemaL in turn are phylogenetically most closely related to AHV-Sema and Vac-A39. The are distinctly more closely related to one another than to any other previously disclosed semaphorin. The analysis also shows that other semaphorins are also phylogenetically closely related to one another and form separate groups within the semaphorins. For example, the semaphorins which are secreted, for example H-Sema III, -IV, -V and -E belong in one phylogenetic group. Their homologs in other species also belong to this subfamily, whereas the human (transmembrane) CD100 belongs in one phylogenetic group together with the corresponding mouse homolog (M-SemaG2) and with Collapsin-4.
  • [0094]
    In relation to the complete amino acid sequences, the observed homologies within the phylogenetic groups are between about 90% and 80% amino acid identity in relation to very closely related genes such as, for example, H- and M-SemaE or -III/D and somewhat less than 40% in the case of less related genes of the semaphorins. Within the Sema domain, the observed amino acid identity is a few percent higher, and, owing to its great contribution to the total protein (50-80% of the protein belong to the Sema domain) of the amino acid sequence, this considerably influences the overall identity.
  • [0095]
    H-SemaL is, calculated for the complete protein, 46% identical with AHV-Sema, but if the Sema domain is considered on its own, then the amino acid identity is 53%. This is higher than, for example, between the related M-Sema-B and -C (37% identity in relation to the complete protein, 43% identity in relation to the Sema domain), similar to M-SemaA and -E (43% complete protein, 53% Sema domain). The amino acid identity between the partial M-SemaL sequence (Table 6) and H-SemaL (Table 5) in the region of the Sema domain is 93% so that it can be assumed that the correspondingly homologous mouse gene is involved.
  • [0096]
    Semaphorins corresponding to H-SemaL and M-SemaL in other species may have an amino acid identity within the Sema domain of more than 40% in relation to H-SemaL. In closely related vertebrates (mammals, birds) amino acid identities above 70% may even be found.
  • [0097]
    The semaphorins belong to a new subfamily with greater amino acid identity to the viral AHV-Sema than to the previously disclosed human and murine semaphorins, and with a C-terminal structure not previously disclosed for human semaphorins. These novel semaphorins (members of the subfamily) are distinguished by belonging, because of their domain structure, to subgroup IV and/or to the same phylogenetic group as H-SemaL and M-SemaL and/or have, in relation to the complete amino acid sequence, an amino acid identity of at least 30 to 40%, preferably 50 to 60%, particularly preferably 70 to 80%, or a greater identity, to H-SemaL and/or have, in relation to the Sema domain, an amino acid identity of at least 70%, preferably greater than 80%, particularly preferably greater than 90%, to H-SemaL.
  • [0098]
    The type L semaphorins also have a different type of biochemical function. One novel function of these semaphorins is modulation of the immune system.
  • [0099]
    The closest relative of H-SemaL is the viral AHV semaphorin (AHV-Sema). The latter has a similar size but, in contrast to H-SemaL, has no transmembrane domain. AHV-Sema is presumably secreted by virus-infected cells in order to block the H-SemaL equivalent receptor (type L semaphorin in the blue wildebeest) in the natural host (blue wildebeest) and thus elude the attack of the immune system. It is also conceivable that there is a function as repulsive agent (chemorepellant) for cells of the immune system.
  • [0100]
    The biochemical function of the novel type L semaphorins and derivatives thereof is to be regarded as generally immunomodulating and/or inflammation-modulating. They are able on the one hand
  • [0101]
    A) as molecules inhibiting the immune response to display their effect as chemorepellant and/or immunosuppressant either locally, for example as transmembrane protein on the surface of cells, or else over larger distances, for example if they are secreted due to processing (for example proteases) or alternative splicing, for example by diffusion in the tissue.
  • [0102]
     For example, expression of these novel type L semaphorins for example on the surface of the cells of the vascular endothelium can prevent leukocyte attachment and migration thereof through the vessel wall. The novel semaphorins may play a part in maintenance of barrier effects, for example to prevent infections in particularly “important” or exposed organs, for example to maintain the blood-brain barrier, the placental circulation and/or other immunologically privileged locations (for example pancreatic islets) and/or in prevention of autoimmune diseases. In addition, the novel semaphorins and/or their derivatives may also be involved in repulsive signals in various tissues, for example for cells of the immune system (for example leukocytes) to prevent inadvertent activation of defense mechanisms.
  • [0103]
    B) In addition, the novel semaphorins and/or derivatives thereof may have functions as accessory molecules. Expressed on the cell surface, they may, for example, be involved in the interaction with cells of the immune system as part of the activation of defense mechanisms, for example in cases of virus infection.
  • [0104]
    This reveals several possible uses of the novel type L semaphorins and derivatives thereof, and the nucleic acids coding for these proteins.
  • [0105]
    Function A): This comprises an immunosuppressant and/or anti-inflammatory principle: there are numerous potential possibilities of use in the areas of organ transplantation, therapy of inflammations, immunotherapy and gene therapy.
  • [0106]
    For example, nonhuman, transgenic animals can be produced with the aid of the semaphorin-encoding DNA or derivatives thereof.
  • [0107]
    One possible use of these animals is in the inhibition of transplant rejection in transgenic models of organ transplantations. For example, transgenic animal organs protected against rejection can be produced for xenotransplantations. This ought to be possible for example also together with other transgenes (for example complement regulators such as DAF or CD59). Another use is in the production of nonhuman knock-out animals, for example knock-out mice (“Laboratory Protocols for Gene-Targeting”, Torres and Kühn (1997) Oxford University Press, ISBN 0-19-963677-X): It is possible by knocking out the mouse M-SemaL gene for example to find other functions of the gene. They also represent potential model systems for inflammatory diseases if the mice can survive without semaphorin gene. If M-SemaL is important for immunomodulation, a plurality of such mice is to be expected. In addition, nonhuman knock-in animals, for example mice, can be produced. This entails, for example, replacing M-SemaL by normal/modified H-SemaL or modified M-SemaL (for example integration of the novel semaphorin subtypes under the control of constitutive and/or inducible promoters). Animals of this type can be used, for example, for looking for further functions of the novel semaphorins, for example functions of the human gene or derivatives of these genes, or be used for identifying and characterizing immunomodulating agents.
  • [0108]
    Use of, for example, nucleic acids which code for type L semaphorins or derivatives thereof for producing, for example, recombinant immunosuppressants, other soluble proteins or peptides derived from the amino acid sequence of type L semaphorins, for example from H-SemaL or the corresponding nucleic acids, for example genes. It is also possible in a similar way to produce agonists with structural similarity. These immunosuppressant agents or agonists may be used for autoimmune diseases and inflammatory disorders and/or organ transplantations too.
  • [0109]
    Gene therapy with type L semaphorins, for example with nucleic acids which code for H-SemaL or derivatives thereof, for example using viral or nonviral methods. Use in autoimmune diseases and inflammatory disorders, the transduction of organs and before/during/after transplantations to prevent transplant rejection.
  • [0110]
    It is particularly possible to employ the novel semaphorins and/or the nucleic acids coding for these semaphorins, and derivatives thereof, in particular H-SemaL, DNA coding for H-SemaL, and derivatives thereof, in a method for screening for agents, in particular for identifying and characterizing immunomodulating agents.
  • [0111]
    Function B): H-SemaL is an accessory molecule which is expressed on the cell surface and is involved in the interaction with cells, for example of the immune system, for example as accessory molecule in the activation of signal pathways. A viral gene or the gene product of a viral or other pathogenic gene, for example of microbiological origin, might act, for example, as competitive inhibitor of this accessory molecule. One use of the novel semaphorins with this function is likewise in the area of organ transplantation, therapy of inflammation, immunotherapy and/or gene therapy.
  • [0112]
    For example, the novel semaphorins can be used in a method for screening for antagonistic agents or inhibitors. Agents identified in this way can then be employed, for example, for blocking the semaphorin receptor. Soluble and/or secreted H-SemaL antagonists or inhibitors may be, for example, chemical substances or the novel semaphorins or derivatives thereof themselves (for example parts/truncated forms thereof, for example without membrane domain or as Ig fusion proteins or peptides derived from the latter, which are suitable for blocking the corresponding receptor). Specific antagonists and/or inhibitors identified in this way may, for example, have competitive effects and be employed for inhibiting rejection, for example in transgenic models of organ transplantations and for autoimmune diseases, inflammatory disorders and organ transplantations. Nucleic acids, for example DNA, which code for the novel semaphorins, or derivatives thereof produced with the aid of methods of molecular biology, may be used, for example, for producing nonhuman transgenic animals. Overexpression of H-SemaL in these transgenic animals may lead to increased susceptibility to autoimmune diseases and/or inflammatory disorders. Such transgenic animals are thus suitable for screening for novel specific immunomodulating agents.
  • [0113]
    Such nucleic acids can likewise be used to produce nonhuman knock-out animals, for example knock-out mice in which the mouse M-SemaL gene is switched off. Such knock-out animals can be employed to search for further biochemical functions of the gene. They also represent potential model systems for inflammatory disorders if the mice are able to survive without the M-SemaL gene.
  • [0114]
    This DNA can likewise be used to produce nonhuman knock-in animals, for example mice. This entails the M-SemaL gene being replaced by a modified M-SemaL gene/cDNA or an optionally modified, for example mutated, type L semaphorin gene/cDNA of another species, for example H-SemaL. Such transgenic animals can be used to look for further functions of the semaphorins according to the invention.
  • [0115]
    The invention also relates to the use of the type L semaphorins and derivatives thereof, and of the nucleic acids coding for these proteins, for example genes/cDNAs and derivatives thereof and/or agents identified with the aid of these semaphorins for producing pharmaceuticals. It is possible, for example, to produce pharmaceuticals which can be used in gene therapy and which comprise agonists and/or antagonists of the expression of the type L semaphorins, for example of H-SemaL. It is possible to use for this purpose, for example, viral and/or nonviral methods. These pharmaceuticals can be employed, for example, for autoimmune diseases and inflammatory disorders, organ transplantations before and/or during and/or after the transplantation to prevent rejection.
  • [0116]
    The nucleic acids coding for the novel semaphorins, for example genes, cDNAs and derivatives thereof, can also be employed as aids in molecular biology.
  • [0117]
    In addition, the novel semaphorins, especially H-SemaL and nucleic acids, for example genes/cDNAs thereof can be employed in methods for screening for novel agents. Modified proteins and/or peptides derived, for example, from H-SemaL and/or M-SemaL can be used to look for the corresponding receptor and/or its antagonists or agonist in functional assays, for example using expression constructs of H-SemaL and homologs.
  • [0118]
    The invention also relates to the use of a type L semaphorin or a nucleic acid sequence which codes for a type L semaphorin in a method for identifying pharmacological agents, especially immunomodulating agents.
  • [0119]
    The invention also relates to methods for identifying agents employing a type L semaphorin or a derivative thereof or a nucleic acid sequence which codes for a type L semaphorin, or a derivative thereof, in order to identify pharmacological agents, for example immunomodulating agents. The invention relates, for example, to a method in which a type L semaphorin is incubated under defined conditions with an agent to be investigated and, in parallel, a second batch is carried out without the agent to be investigated but under conditions which are otherwise the same, and then the inhibiting or activating effect of the agent to be investigated is determined.
  • [0120]
    The invention also relates, for example, to methods for identifying agents where a nucleic acid sequence which codes for a type L semaphorin or a derivative thereof is expressed under defined conditions in the presence of an agent to be investigated, and the extent of the expression is determined. It is also possible, where appropriate, in such a method to carry out two or more batches in parallel under the same conditions but with the batches containing different amounts of the agent to be investigated.
  • [0121]
    For example, the agent to be investigated may inhibit or activate transcription and/or translation.
  • [0122]
    The type L semaphorin can, like its viral homologs, bind to the newly described receptor molecule VESPR (Comeau et al, (1998) Immunity, Vol. 8, 473-482) and in monocytes can presumably cause induction of cell adhesion molecules such as ICAM-1 and cytokines such as interleukin-6 and interleukin-8. This may lead to activation thereof and to cell aggregation. The expression pattern of the VESPR receptor shows some interesting parallels with H-SemaL, for example strong expression in placenta and pronounced expression in spleen tissue. Interactions with other as yet unknown receptors of the plexin family or other receptors are possible. It may also interact with itself or other semaphorin-like molecules. Interaction of the type L semaphorins may take place in particular via a conserved domain in the C-terminal region of the Sema domain.
  • [0123]
    Concerning the Annotation on Plasmids:
  • [0124]
    pMelBacA-H-SemaL (6622 bp) in pMelBacA (Invitrogen, De Schelp, NL) (SEQ ID NO.42). Nucleotide 96-98 ATG—start codon, nucleotide 96-168 mellitin signal sequence, nucleotide 168-173 BamHI cleavage site (PCR/cloning), nucleotide 171-1998 reading frame SEMA-L amino acids 42-649 (without own signal sequence and without transmembrane sequence), nucleotide 1993-1998 EcoRI cleavage site (PCR/cloning) and nucleotide 1992-1994 stop codon.
  • [0125]
    Plasmid pCDNA3.1-H-SemaL-MychisA (7475 bp) (SEQ ID NO. 35): nucleotide 954-959 BamHI cleavage site (cloning), nucleotide 968-970 ATG SEMAL, nucleotide 968-2965 reading frame SEMAL, nucleotide 2963-2968 Pml I cleavage site, nucleotide 2969-2974 HindIII cleavage site, nucleotide 2981-3013 Myc tag, nucleotide 3026-3033 6×His tag, nucleotide 3034-3036 stop codon,
  • [0126]
    Plasmid pCDNA3.1-H-SemaL-EGFP-MychisA (8192 bp):(SEQ ID NO. 36): nucleotide 954-959 BamHI cleavage site (cloning), nucleotide 968-970 ATG SEMA-L, nucleotide 968-2965 reading frame SEMA-L, nucleotide 2963-2965 half Pml I cleavage site, nucleotide 2966-3682 reading frame EGFP (cloned in Pml I), nucleotide 3683-3685 half Pml I cleavage site, nucleotide 3685-3691 HindIII, nucleotide 3698-3730 Myc tag, nucleotide 3743-3760 6×His tag, and nucleotide 3761-3763 stop codon.
  • [0127]
    Plasmid pIND-H-SemaL-EA (7108 bp) in vector pIND (Invitrogen, De Schelp, NL) (SEQ ID No. 38): nucleotide 533-538 BamHI cleavage site (cloning), nucleotide 546-548 ATG SEMA-L, nucleotide 546—reading frame SEMA-L, nucleotide 2542-2547 Pml I cleavage site, nucleotide 2548-2553 HindIII cleavage site and nucleotide 2563-2565 stop codon.
  • [0128]
    Plasmid pIND-H-SemaL-EE (total length 7102 bp) in vector pIND (Invitrogen, De Schelp, NL) (SEQ ID No. 37): nucleotide 533-538 BamHI cleavage site (cloning), nucleotide 546-548 ATG SEMA-L, nucleotide 546-reading frame SEMA-L, nucleotide 2542-2547 Pml I cleavage site, nucleotide 2548-2553 HindIII cleavage site, nucleotide 2560-2592 Myc tag, nucleotide 2605-2622 6×His tag and nucleotide 2623-2625 stop codon.
  • [0129]
    Plasmid pQE30-H-SemaL-179-378.seq (4019 bp) in vector pQE30 (Qiagen, Hilden) corresponds to pQE30-H-SemaLBH (SEQ ID No. 39): nucleotide 115-117 ATG, nucleotide 127-144 6×His tag, nucleotide 145-750 BamHI-HindIII PCR fragment SEMA-L amino acids (aa) 179-378 and nucleotide 758-760 stop codon.
  • [0130]
    Plasmid pQE31-H-SemaL-(SH (3999 bp) in vector pQE31 (Qiagen, Hilden) (SEQ ID No. 40): nucleotide 115-117 ATG, nucleotide 127-144 6×His tag, nucleotide (147-152 BamHI), nucleotide 159-729 Saci-HindIII fragment SEMA-L (C-terminal) aa480-666 and nucleotide 734-736 stop codon.
  • [0131]
    Experimental Conditions used in the Examples:
    PCR programs used:
    Taq52-60 (with Ampli-TaqR polymerase, Perkin Elmer,
    Weil der Stadt, Germany)
    96° C./60s  1 cycle
    96° C./15s-52° C./20s-70° C./60s 40 cycles
    70° C./60s  1 cycle
    96° C./60s  1 cycle
    96° C./15s-60° C./20s-70° C./30s 35 cycles
    70° C./60s  1 cycle
    96° C./60s  1 cycle
    96° C./15s-60° C./20s-70° C./60s 35 cycles
    70° C./60s  1 cycle
    96° C./60s  1 cycle
    96° C./15s-62° C./20s-70° C./40s 35 cycles
    70° C./60s  1 cycle
  • [0132]
    Reaction Conditions used for PCR with Taq Polymerase:
  • [0133]
    50μl reaction mixtures with 100-200 ng of template, 200 μM dNTP, 0.2-0.4 μM each primer, 2.5 U of Ampli-TaqR, 5 μl of the 10× reaction buffer supplied
  • [0134]
    Programs used for:
    XL62-6 (with expand-long template PCR SystemR,
    Boehringer Mannheim, Germany)
    94° C./60s  1 cycle
    94° C./15s-62° C./30s-68° C./6 min 10 cycles
    94° C./15s-62° C./30s-68° C./(6 min + 15s/cycle) 25 cycles
    68° C./7 min  1 cycle
    XL62-12 (with expand-long template PCR System
    Boehringer Mannheim, Germany)
    94° C./60s  1 cycle
    94° C./15s-62° C./30s-68° C./12 min 10 cycles
    94° C./15s-62° C./30s-68° C./(12 min + 15s/cycle) 25 cycles
    68° C./7 min  1 cycle
  • [0135]
    Reaction Conditions for PCR with Expand-long Template PCR System
  • [0136]
    50 μl reaction mixtures with 100-200 ng of template, 500 μM dNTP, 0.2-0.4 μM each primer, 0.75 μl of enzyme mix, 5 μl of the 10× reaction buffer No. 2 supplied.
  • Example 1
  • [0137]
    Starting from AHV-Sema sequences (Ensser & Fleckenstein (1995), J. General Virol. 76: 1063-1067), PCRs and RACE-PCRs were carried out. The starting material used for this was human cDNA from placental tissue onto which adaptors had been ligated for the RACE amplification (Marathon™-cDNA Amplification Kit, Clontech Laboratories GmbH, Tullastraβe 4, 69126 Heidelberg, Germany). Firstly specific primers (No.121234+No. 121236, Table 6) were used to amplify a PCR fragment with a length of about 800 bp (base pairs) (PCR program: (Taq60-60)). This was cloned and sequenced (Taq dye-deoxy terminator sequencing kit, Applied Biosystems, Foster City, Calif., USA/Brunnenweg 13, Weil der Stadt). Sequencing of the PCR product revealed a sequence which has a high degree of homology with the DNA sequence of AHV-Sema, identical to the sequence of the two ESTs.
  • [0138]
    A PCR fragment of 600 bp was identified using the primer pair (No. 121237+No. 121239, Table 6). It emerged that they were clones with DNA sequences from the same gene.
  • Example 2
  • [0139]
    The 800 bp PCR fragment from Example 1 was radiolabeled (random priming by the method of {Feinberg (1983) Anal. Biochem. 132:6-13}, with 32P-α-dCTP) and used as probe for a multitissue Northern blot (Human Multiple Tissue Northern Blot II, Clontech, Heidelberg, Germany) which contains mRNA samples from the tissues spleen, thymus, prostate, testes, ovaries, small intestine, large intestine and leukocytes (PBL). This clearly showed expression of an mRNA with a length of about 3.3 kb in spleen and gonads (testes, ovaries), and less strongly in the thymus and intestine. Hybridization of a master blot (dot-blot with RNA from numerous tissues (Human RNA Master Blot™, Clontech)) confirmed this result and also showed strong expression in placental tissue.
  • [0140]
    Hybridization was carried out under stringent conditions (5×SSC, 50 mM Na phosphate pH 6.8, 50% formamide, 100 μg/ml yeast RNA) at 42° C. for 16 hours. The blots were washed stringently (65° C., 0.2×SSC, 0.1% SDS) and exposed to a Fuji BAS2000 Phosphoimager™.
  • Example 3
  • [0141]
    A cDNA library from human spleen, cloned in the bacteriophage Lambda gt10 (Human Spleen 5′ STRETCH PLUS cDNA, Clontech), was screened with this probe, and a lambda clone was identified. The cDNA with a length of 1.6 kb inserted in this clone was amplified by PCR (Expand™ Long Template PCR System, Boehringer Mannheim GmbH, Sandhofer Straβge 116, 68305 Mannheim) using the vector-specific primers No. 207608+No. 207609 (Table 6) (flanking the EcoRI cloning site), and the resulting PCR fragment was sequenced. This clone contained the 5′ end of the cDNA and also extended the known cDNA sequence in the 3′ direction. Starting from the new part-sequences of the cDNA, new primers for the RACE-PCR were developed (No. 232643, No. 232644, No. 233084, Table 6). Together with an improved thermocycler technique (PTC-200 from MJ-Research, Biozym Diagnostik GmbH, 31833 Hess. Oldendort) with distinctly better performance data (heating and cooling rates), a 3′ RACE-PCR product was amplified using the primers No. 232644 and No. 232643 and AP1, and was cloned into the vector pCR2.1 (Invitrogen, De Schelp 12, 9351 NV Leek, The Netherlands). The 3′ RACE-PCR product was sequenced and the 3′ end of the cDNA was identified in this way. A RACE amplification in the 5′ direction (primers No. 131990 and No. 233084 and AP1) extended the 5′ end of the cDNA by a few nucleotides and confirmed the amino terminus of H-SemaL found in the identified lambda clone.
  • Example 4
  • [0142]
    Starting from a short murine EST (Accession No. AA260340) and a primer derived therefrom, No. 260813 (Table 6) and the H-SemaL specific primer No. 121234 (Table 6), PCR (conditions: Taq52-60) was used to amplify a DNA fragment with a length of about 840 bp of murine cDNA, followed by cloning into the vector pCR2.1. The gene containing this DNA fragment was called M-SemaL. The resulting M-SemaL DNA fragment was used to investigate a cDNA bank from mouse spleen (Mouse Spleen 5′ STRETCH cDNA, Clontech), identification of several clones being possible.
  • [0143]
    PCR (Taq60-30) with the primers No. 260812 and No. 260813 from murine endothelial cDNA provided a PCR fragment with a length of 244 base pairs. The PCR results showed that there is distinct baseline expression in murine endothelial cells which declines after stimulation with the cytokine interferon-γ and lipopolysaccharides.
  • Example 5
  • [0144]
    Investigations on the location in the chromosome were carried out by fluorescence in situ hybridization (FISH). For this purpose, human and murine metaphase chromosomes were prepared starting from a human blood sample and the mouse cell line BINE 4.8 (Keyna et al. (1995) J. Immunol. 155, 5536-5542), respectively (Kraus et al. (1994) Genomics 23, 272-274). The slides were treated with RNase and pepsin (Liehr et al. (1995) Appl. Cytogenetics 21, 185-188). For the hybridization, 120 mg of human nick-translated semaphorin sample and 200 mg of a corresponding mouse sample were used. The hybridization was in each case carried out in the presence of 4.0 μg of COT1-DNA and 20 μg of STD at 37° C. (3 days) in a moistened chamber.
  • [0145]
    The slides were washed with 50% formamide/2×SSC (3 times for 5 min each time at 45° C.) and then with 2×SSC (3 times for 5 min each time at 37° C.), and the biotinylated sample was detected using the FITC-avidin system (Liehr et al. (1995)). The slides were evaluated using a fluorescence microscope. 25 metaphases/sample were evaluated, carrying out each experiment in duplicate. It emerged that H-SemaL is located on chromosome 15q23. Located adjacent in the chromosome is the locus for Bardet-Biedls syndrome and Tay-Sachs disease (hexosaminidase A).
  • Example 6
  • [0146]
    The genomic intron-exon structure of the H-SemaL gene is for the most part elucidated.
  • [0147]
    Genomic DNA fragments were amplified starting from 250 mg of human genomic DNA which had been isolated from PHA-stimulated peripheral lymphocytes (blood). Shorter fragments were amplified using Ampli TaqR (Perkin Elmer), and longer fragments were amplified using the expanded long template PCR SystemR (Boehringer Mannheim).
  • [0148]
    It has been possible by PCR amplification to date to clone and characterize almost the complete genomic locus of H-SemaL. It has already been possible in total to determine more than 8888 bp of the genomic sequence and thus substantially to elucidate the intron-exon structure of the gene.
  • Example 7
  • [0149]
    Expression Clonings:
  • [0150]
    Since no complete clone of the semaphorin gene could be isolated from the lambda-gt10 cDNA bank, and no complete clone was obtainable by PCR either, the coding region of the cDNA was amplified in 2 overlapping subfragments by PCR (XL62-6) using the primers No. 240655 and No. 121339 for the N-terminal DNA fragment, and the primers No. 240656 (contains HindIII and Pmel cleavage sites) and No. 121234 for the C-terminal DNA fragment. The resulting DNA fragments (subfragments) were cloned into the vector pCR21. The two subfragments were completely sequenced and finally the complete H-SemaL cDNA was prepared by inserting a 0.6 kb C-terminal SstI-HindIII restriction fragment into the plasmid which contained the N-terminal DNA fragment and had been cut with the restriction enzymes SstI and HindIII. From this plasmid pCR2.1-H-SemaL (sequence shown in Table 7, SEQ ID NO. 34), the complete gene was cut out using the EcoRI cleavage site (in pCR2.1) and HindIII cleavage site (in primer No. 240656, Table 6) and ligated into a correspondingly cut constitutive expression vector pCDNA3.1 (−)MycHisA (Invitrogen). The EcoRI-ApaI fragment (without Myc-His tag) was cut out of the resulting recombinant plasmid pCDNA3.1(−)H-SemaL-MycHisA (sequence shown in Table 8) and ligated into the inducible vector pIND (Ecdysone-Inducible Mammalian Expression System, Invitrogen) which had previously likewise been cut with EcoRI-ApaI. The recombinant plasmid was called pIND-H-SemaLEA (sequence shown in Table 11). An EcoRI-Pmel fragment (with Myc-His tag) from pCDNA3.1(−)H-SemaL-Myc-HisA (sequence shown in Table 9) was inserted into an EcoRI-EcoRV-cut vector pIND. The recombinant plasmid was called pIND-H-SemaL-EE (sequence shown in Table 10).
  • [0151]
    A fusion gene of H-SemaL with enhanced green fluorescent protein (EGFP) was prepared by ligating the PCR-amplified EGFP reading frame (from the vector pEGFP-C1 (Clontech), using the primers No. 243068+No. 243069, Taq52-60) into the Pmel cleavage site of the plasmid pCDNA3.1(−)H-SemaL-MycHisA, resulting in the plasmid pCDNA3.1 (−)H-SemaL-EGFP-MycHisA (sequence shown in Table 9).
  • [0152]
    Small letters in Tables 7 to 13 and Table 15 denote the sequence of H-SemaL, parts or derivatives thereof, and large letters denote the sequence of the plasmid.
  • Example 8
  • [0153]
    To prepare H-SemaL-specific antibodies, cDNA fragments of H-SemaL were integrated into prokaryotic expression vectors and expressed in E. coli, and the semaphorin derivatives were purified. The semaphorin derivatives were expressed as fusion proteins with a His tag. Accordingly, vectors containing the sequence for a His tag and permitting integration of the semaphorin cDNA fragment into the reading frame were used. An N-terminal 6×histidine tag makes it possible, for example, to purify by nickel chelate affinity chromatography (Qiagen GmbH, Max-Volmer Straβe 4, 40724 Hilden):
  • [0154]
    1. The part of the H-SemaL cDNA coding for amino acids 179-378 was amplified by PCR using the primers No. 150788 and No. 150789, and this DNA fragment was ligated into the vector pQE30 (Qiagen) which had previously been cut with the restriction enzymes BamHI and HindIII (construct pQE30-H-SemaL-BH (sequence shown in Table 12)).
  • [0155]
    2. The section of the H-SemaL cDNA coding for the C-terminal amino acids 480-666 was cut with the restriction enzymes SstI and HindIII out of the plasmid pCR 2.1 and ligated into the vector pQE31 (Qiagen) which had previously been cut with SstI and HindIII (construct pQE31-H-SemaL-SH (sequence shown in Table 13)).
  • [0156]
    Correct integration of the sequences in the correct reading frame was checked by DNA sequencing. The fusion proteins consisting of an N-terminal 6×histidine tag and a part of the semaphorin H-SemaL were purified by Ni2+ affinity chromatography. The purified fusion proteins were used to immunize various animals (rabbit, chicken, mouse).
  • Example 9
  • [0157]
    FACS Analysis of Various Cell Types (FIGS. 4 and 5)
  • [0158]
    The cells (about 0.2-0.5×106) were washed with FACS buffer (phosphate-buffered saline (PBS) with 5% fetal calf serum (FCS) and 0.1% Na azide) and then incubated with the antisera (on ice) for 1 hour in each case.
  • [0159]
    The primary antibodies used for the control (overlay chicken preimmune serum (1:50)) and for the specific detection (specific staining) comprised an H-SemaL-specific chicken antiserum (1:50). The specific antiserum with antibodies against amino acids (Aa) 179-378 (with N-terminal His tag) of H-SemaL was generated by immunizing chickens with the protein purified by Ni chelate affinity chromatography (as described in Example 8). The second antibody used was an FITC-labeled anti-chicken F(ab′) antibody from rabbits (Dianova Jackson Laboratories, Order No. 303-095-006, Hamburg, Germany) (1 mg/ml). A rabbit anti-mouse IgG, FITC-labeled, was used for the CD100 staining. The second antibody was employed in each case in 1:50 dilution in FACS buffer.
  • [0160]
    The cells were then washed, resuspended in PBS and analyzed in the FACS. The FACS analysis was carried out using a FACS-track instrument (Becton-Dickinson). Principle: a single cell suspension is passed through a measuring channel where the cells are irradiated with laser light of 488 nm and thus fluorescent dyes (FITC) are excited. The measurements are of the light scattered forward (forward scatter, FSC: correlates with the cell size), and to the side (sideward scatter, SSC: correlates with the granular content: different in different cell types) and fluorescence in channel 1 (FL 1) (for wavelengths in the FITC emission range, max. at 530 nm). 10,000 events (cells) were measured in this way each time.
  • [0161]
    The dot plot (FIGS. 4a-k) (figure on the left in each case): FSC against SSC (size against granular content/scatter) with, inside the boundary, the (uniform) cell population of similar size and granular content analyzed in the right-hand window (relevant right-hand figure in each case). The right-hand window shows the intensity of FL 1 (X axis) against the number of events (Y axis), that is to say a frequency distribution.
  • [0162]
    In each of these, the result with the control serum (unfilled curve) is superimposed on the result of the specific staining (filled curve). A shift of the curve for the specific staining to the right compared with the control corresponds to an expression of H-SemaL in the corresponding cells. A larger shift means stronger expression.
  • [0163]
    Cell lines used for FACS analysis:
  • [0164]
    a) U937 cell line
  • [0165]
    American Type Culture Collection ATCC; ATCC number: CRL-1593
  • [0166]
    Name: U-937
  • [0167]
    Tissue: lymphoma; histiocytic; monocyte-like
  • [0168]
    Species: human;
  • [0169]
    Depositor: H. Koren
  • [0170]
    b) THP-1 cell line
  • [0171]
    ATCC number: TIB-202
  • [0172]
    Tissue: monocyte; acute monocytic leukemia
  • [0173]
    Species: human
  • [0174]
    Depositor: S. Tsuchiya
  • [0175]
    c) K-562 cell line
  • [0176]
    ATCC number: CCL-243
  • [0177]
    Tissue: chronic myelogenous leukemia
  • [0178]
    Species: human;
  • [0179]
    Depositor: H. T. Holden
  • [0180]
    d) L-428 cell line
  • [0181]
    DSMZ-Deutsche Sammiung von Mikroorganismen und Zelikulturen GmbH,
  • [0182]
    DSMZ No: ACC 197
  • [0183]
    Cell type: human Hodgkin's lymphoma
  • [0184]
    e) Jurkat cell line
  • [0185]
    DSMZ-Deutsche Sammiung von Mikroorganismen und zellkulturen GmH,
  • [0186]
    DSMZ No: ACC 282
  • [0187]
    Cell type: human T cell leukemia
  • [0188]
    f) Daudi cell line
  • [0189]
    ATCC number: CCL-213
  • [0190]
    Tissue: Burkitt's lymphoma; B lymphoblast; B cells
  • [0191]
    Species: human
  • [0192]
    Depositor: G. Klein
  • [0193]
    g) LCL cell line
  • [0194]
    EBV-transformed lymphoblastoid B-cell line.
  • [0195]
    h) Jiyoye (P-2003) cell line
  • [0196]
    ATCC number: CCL-87
  • [0197]
    Tissue: Burkitt's lymphoma; B cells, B lymphocyte
  • [0198]
    Species: human
  • [0199]
    Depositor: W. Henle
  • [0200]
    i) CBL-Mix57
  • [0201]
    Human T-cell line (isolated from blood) transformed with recombinant H. Saimiri (wild-type without deletion)
  • [0202]
    j) CBL-Mix59
  • [0203]
    Human T-cell line (isolated from blood) transformed with H. Saimiri (deletion of ORF71).
  • Example 10
  • [0204]
    Protein Gel and Western Blot
  • [0205]
    Secretable human SEMA-L (amino acids 42-649 in Table 4 (without signal peptide and without transmembrane domain)) was cloned into the plasmid pMelBac-A (Invitrogen, De Schelp, Leck, The Netherlands, Cv 1950-20) and, in this way, the plasmid pMelBacA-H-SemaL (length 6622 bp) was generated (FIG. 8). The H-SemaL derivative was expressed in the baculovirus system (Bac-N-Blue, Invitrogen). Expression was carried out in the cell lines derived TM from insect egg cells Sf9 (from Spodoptera frugiperda) and High Five™ (from Trichoplusia ni, U.S. Pat. No. 5,300,435, purchased from Invitrogen) by infection with the recombinant, plaque-purified baculoviruses.
  • [0206]
    The expression was carried out in accordance with the manufacturer's instructions.
  • [0207]
    The proteins were then fractionated in a gel, and the H-SemaL derivative was detected in a Western blot. Detection was carried out with H-SemaL-specific chicken antiserum (compare Example 8 and FIG. 7) (dilution 1:100). The specific chicken antibody was detected using anti-IgY-HRP conjugate (dilution: 1:3000, from donkey; Dianova Jackson Laboratories) in accordance with the manufacturer's instructions.
  • Example 11
  • [0208]
    Preparation of pMelBacA-H-SEMAL
  • [0209]
    The recombinant vector (pMelBacA-H-SEMAL, 6622 bp) was prepared by cloning an appropriate DNA fragment which codes for amino acids 42-649 of H-SemaL into the vector pMelBacA (4.8 kb Invitrogen) (compare annotation for pMelBacA-H-SEMAL). The cloning took place via BamHI and EcoRI in frame behind the signal sequence present in the vector (“honeybee melittin signal sequence”). A corresponding H-SemaL DNA fragment was amplified using the primer pair h-sema-1 baculo 5′ and h-sema-1 baculo 3′.
  • [0210]
    Primers for amplification (TaKaRa Ex Ta9 polymerase) and cloning: “h-sema-1 baculo 5′” for amplification without signal sequence and for introducing a BamHI cleavage site 5′-CCGGATCCGCCCAGGGCCACCTAAGGAGCGG-3′ (SEQ ID NO: 43) “h-sema-1 baculo 3′” for amplification without transmembrane domain and for introducing an EcoRI cleavage site 5′-CTGMTTCAGGAGCCAGGGCACAGGCATG-3′ (SEQ ID NO: 44).
  • [0211]
    [0211]FIG. 1:
  • [0212]
    Tissue-specific expression of H-Sema-L
  • [0213]
    A) Multiple tissue Northern blot (Clontech, Heidelberg, Germany). Loadings from left to right: 2 μg in each lane of Poly-A-RNA from spleen, thymus, prostate, testes, ovaries, small intestine, large intestinal mucosa, peripheral (blood) leukocytes. Size standards are marked.
  • [0214]
    The blots were hybridized under stringent conditions with an H-SemaL probe 800 base-pairs long.
  • [0215]
    [0215]FIG. 2:
  • [0216]
    Diagrammatic representation of the cloning of the H-SemaL cDNA and of the genomic organization of the H-SemaL encoding sequences (H-SemaL gene)
  • [0217]
    Top: Location of the EST sequences (accession numbers; location of the EST sequences is shown relative to the AHV-Sema sequence).
  • [0218]
    Below: Amplified PCR and RACE products and the position of the cDNA clones in relation to the location in the complete H-SemaL cDNA and the open reading frame (ORF) for the encoded protein.
  • [0219]
    Bottom: Relative position of the exons in the H-SemaL gene in relation to the genomic sequence. The position of the oligonucleotide primer used is indicated by arrows.
  • [0220]
    [0220]FIG. 3:
  • [0221]
    Phylogenetic tree: Obtained by multiple alignment of the listed semaphorin sequences. The phylogenetic relationship of the semaphorins can be deduced from their grouping in the phylogenetic tree.
  • [0222]
    [0222]FIG. 4:
  • [0223]
    FACS analysis of H-SemaL expression in various cell lines and various cell types (compare Example 8).
  • [0224]
    [0224]FIG. 5:
  • [0225]
    Comparative analysis of CD100 and H-SemaL expression (compare Example 9).
  • [0226]
    [0226]FIG. 6:
  • [0227]
    Expression of secretable human SEMA-L (H-SemaL) in HiFive and Sf3 cells (compare Example 10).
  • [0228]
    Aa 42-649 in pMelBac-A (Invitrogen) in the baculovirus system (Bac-N-Blue, Invitrogen)
  • [0229]
    Detection with specific chicken antiserum (1:100) and anti-IgY-HRP conjugate (1:3000, from rabbits, Jackson Lab.)
  • [0230]
    1,4,6 uninfected HiFive cells (serum-free)
  • [0231]
    2,3,5,7,8 HiFive cells infected with recombinant baculovirus (serum-free)
  • [0232]
    M Rainbow molecular weight marker (Amersham RPN756)
  • [0233]
    9,10 infected Sf9 cells (serum-containing medium).
  • [0234]
    [0234]FIG. 7: Specificity of the antiserum
  • [0235]
    Lanes 1-3: chicken 1; lanes 4-6: chicken 2
  • [0236]
    Lanes 1 and 4: Preimmune serum
  • [0237]
    Lanes 2 and 5: 60th day of immunization
  • [0238]
    Lanes 4 and 6: 105th day of immunization
  • [0239]
    Immunization was carried out with amino acids 179-378 of H-SemaL (with amino-terminal His tag) (compare Example 8, Section 1.)
  • [0240]
    [0240]FIG. 8: Depiction of the plasmid map of pMelBacA-H-SEMAL.
  • [0241]
    The recombinant plasmid was prepared as described in Example 11.
  • [0242]
    TABLE 1
    Various subtypes of semaphorins from various species
    Name Synonym Species Reference
    H-Sema III (H-SemaD) Human Sec. (Kolodkin et al. 1993)
    CD-100 Human TM, IC; CD45 associated, expressed in T cells (Hall et al. 1996)
    H-Sema V (H-SemaA) Human Sec.; Locus 3p21.3 (Sekido et al. 1996; Roche et al. 1996)
    H-Sema IV (H-Sema3F) Human Sec.; Locus 3p21.3 (Xiang et al. 1996; Sekido et al. 1996)
    H-SemaE Human Sec.; divergent from M-Sema-E at the 3′ end AB000220 (Yamada 1997 unpublished)
    (alignment of reading frame improved)
    H-SemaK KIAA0331 Human Sec.; (Nagase et al. 1997)
    H-SemaL SEMAL Human TM, no IC This application
    M-SemaA Mouse Sec. (Püchel et al. 1995)
    M-SemaB Mouse TM, IC (Püchel et al. 1995)
    M-SemaC Mouse TM, IC (Püchel et al. 1995)
    M-SemaD M-Sema III Mouse Sec. (Messersmith et al. 1995; Püchel et al. 1995)
    M-SemaE Mouse Sec.; 5′ partial sequence (Püchel et al. 1995)
    M-SemaF1 M-SemaF Mouse TM, IC (Inagaki et al. 1996)
    M-SemaG2 M-SemaG Mouse TM, IC; expressed in lymphoid cells, mouse (Furuyama et al. 1996)
    homolog of CD100
    M-SemaF2 M-SemaF Mouse TM, IC; Thrombospondin motif (Adams et al. 1996)
    M-SemaG1 M-SemaG Mouse TM, IC; Thrombospondin motif (Adams et al. 1996)
    M-SemaH Mouse Sec. (Christensen 1996 unpub) Z80941
    M-Sema Via Mouse TM, IC (Zhou et al. 1997)
    M-SemaL Semal Mouse Partial sequence This application
    Collapsin-1 Chicken Sec. (Luo et al. 1993)
    Collapsin-2 Chicken Sec. (Luo et al. 1995)
    Collapsin-3 Chicken Sec. (Luo et al. 1995)
    Collapsin-4 Chicken Partial sequence (Luo et al. 1995)
    Collapsin-5 Chicken Sec. (Luo et al. 1995)
    R-Sema III Rat Sec. (Giger et al. 1996)
    T-Sema I Tribolium TM, IC (Kolodkin et al. 1993)
    Ce-Semal C. elegans TM, IC U15667 (Roy 1994 unpublished)
    G-Sema I Fasciclin-IV Grasshopper TM, IC (Kolodkin et al. 1992)
    D-Sema I Drosophila TM, IC (Kolodkin et al. 1993)
    D-Sema II Drosophila Sec. (Kolodkin et al. 1993)
    AHV-Sema AHV-1 Sec. (Ensser and Fleckenstein, 1995)
    ORF-A39 Vaccinia Sec. (Kolodkin et al. 1993)
    ORF-A39 Variola Sec.; (Kolodkin et al. 1993)
  • [0243]
    TABLE 2
    cDNA sequence of H-SemaL (2636 nucleotides) (SEQ ID NO.: 1)
    1 cggggccacg ggatgacgcc tcctccgccc ggacgtgccg cccccagcgc
    51 accgcgcgcc cgcgtccctg gcccgccggc tcggttgggg cttccgctgc
    101 ggctgcggct gctgctgctg ctctgggcgg ccgccgcctc cgcccagggc
    151 cacctaagga gcggaccccg catcttcgcc gtctggaaag gccatgtagg
    201 gcaggaccgg gtggactttg gccagactga gccgcacacg gtgcttttcc
    251 acgagccagg cagctcctct gtgtgggtgg gaggacgtgg caaggtctac
    301 ctctttgact tccccgaggg caagaacgca tctgtgcgca cggtgaatat
    351 cggctccaca aaggggtcct gtctggataa gcgggactgc gagaactaca
    401 tcactctcct ggagaggcgg agtgaggggc tgctggcctg tggcaccaac
    451 gcccggcacc ccagctgctg gaacctggtg aatggcactg tggtgccact
    501 tggcgagatg agaggctacg cccccttcag cccggacgag aactccctgg
    551 ttctgtttga aggggacgag gtgtattcca ccatccggaa gcaggaatac
    601 aatgggaaga tccctcggtt ccgccgcatc cggggcgaga gtgagctgta
    651 caccagtgat actgtcatgc agaacccaca gttcatcaaa gccaccatcg
    701 tgcaccaaga ccaggcttac gatgacaaga tctactactt cttccgagag
    751 gacaatcctg acaagaatcc tgaggctcct ctcaatgtgt cccgtgtggc
    801 ccagttgtgc aggggggacc agggtgggga aagttcactg tcagtctcca
    851 agtggaacac ttttctgaaa gccatgctgg tatgcagtga tgctgccacc
    901 aacaagaact tcaacaggct gcaagacgtc ttcctgctcc ctgaccccag
    951 cggccagtgg agggacacca gggtctatgg tgttttctcc aacccctgga
    1001 actactcagc cgtctgtgtg tattccctcg gtgacattga caaggtcttc
    1051 cgtacctcct cactcaaggg ctaccactca agccttccca acccgcggcc
    1101 tggcaagtgc ctcccagacc agcagccgat acccacagag accttccagg
    1151 tggctgaccg tcacccagag gtggcgcaga gggtggagcc catggggcct
    1201 ctgaagacgc cattgttcca ctctaaatac cactaccaga aagtggccgt
    1251 tcaccgcatg caagccagcc acggggagac ctttcatgtg ctttacctaa
    1301 ctacagacag gggcactatc cacaaggtgg tggaaccggg ggagcaggag
    1351 cacagcttcg ccttcaacat catggagatc cagcccttcc gccgcgcggc
    1401 tgccatccag accatgtcgc tggatgctga gcggaggaag ctgtatgtga
    1451 gctcccagtg ggaggtgagc caggtgcccc tggacctgtg tgaggtctat
    1501 ggcgggggct gccacggttg cctcatgtcc cgagacccct actgcggctg
    1551 ggaccagggc cgctgcatct ccatctacag ctccgaacgg tcagtgctgc
    1601 aatccattaa tccagccgag ccacacaagg agtgtcccaa ccccaaacca
    1651 gacaaggccC cactgcagaa ggtttccctg gccccaaact ctcgctacta
    1701 cctgagctgc cccatggaat cccgccacgc cacctactca tggcgccaca
    1751 aggagaacgt ggagcagagc tgcgaacctg gtcaccagag ccccaactgc
    1801 atcctgttca tcgagaacct cacggcgcag cagtacggcc actacttctg
    1851 cgaggcccag gagggctcct acttccgcga ggctcagcac tggcagctgc
    1901 tgcccgagga cggcatcatg gccgagcacc tgctgggtca tgcctgtgcc
    1951 ctggctgcct ccctctggct gggggtgctg cccacactca ctcttggctt
    2001 gctggtccac tagggcctcc cgaggctggg catgcctcag gcttctgcag
    2051 cccagggcac tagaacgtct cacactcaga gccggctggc ccgggagctc
    2101 cttgcctgcc acttcttcca ggggacagaa taacccagtg gaggatgcca
    2151 ggcctggaga cgtccagccg caggcggctg ctgggcccca ggtggcgcac
    2201 ggatggtgag gggctgagaa tgagggcacc gactgtgaag ctggggcatc
    2251 gatgacccaa gactttatct tctggaaaat atttttcaga ctcctcaaac
    2301 ttgactaaat gcagcgatgc tcccagccca agagcccatg ggtcggggag
    2351 tgggtttgga taggagagct gggactccat ctcgaccctg gggctgaggc
    2401 ctgagtcctt ctggactctt ggtacccaca ttgcctcctt cccctccctc
    2451 tctcatggct gggtggctgg tgttcctgaa gacccagggc taccctctgt
    2501 ccagccctgt cctctgcagc tccctctctg gtcctgggtc ccacaggaca
    2551 gccgccttgc atgtttattg aaggatgttt gctttccgga cggaaggacg
    2601 gaaaaagctc tgaaaaaaaa aaaaaaaaaa aaaaaa
  • [0244]
    TABLE 3
    Nucleotide sequence of the cDNA of M-SemaL
    (partial, 1195 nucleotides) (SEQ ID NO.: 2)
    1 cggggctgcg ggatgacgcc tcctcctccc ggacgtgccg cccccagcgc
    51 accgcgcgcc cgcgtcctca gcctgccggc tcggttcggg ctcccgctgc
    101 ggctgcggct tctgctggtg ttctgggtgg ccgccgcctc cgcccaaggc
    151 cactcgagga gcggaccccg catctccgcc gtctggaaag ggcaggacca
    201 tgtggacttt agccagcctg agccacacac cgtgcttttc catgagccgg
    251 gcagcttctc tgtctgggtg ggtggacgtg gcaaggtcta ccacttcaac
    301 ttccccgagg gcaagaatgc ctctgtgcgc acggtgaaca tcggctccac
    351 aaaggggtcc tgtcaggaca aacaggactg tgggaattac atcactcttc
    401 tagaaaggcg gggtaatggg ctgctggtct gtggcaccaa tgcccggaag
    451 cccagctgct ggaacttggt gaatgacagt gtggtgatgt cacttggtga
    501 gatgaaaggc tatgccccct tcagcccgga tgagaactcc ctggttctgt
    551 ttgaaggaga tgaagtgtac tctaccatcc ggaagcagga atacaacggg
    601 aagatccctc ggtttcgacg cattcggggc gagagtgaac tgtacacaag
    651 tgatacagtc atgcagaacc cacagttcat caaggccacc attgtgcacc
    701 aagaccaagc ctatgatgat aagatctact acttcttccg agaagacaac
    751 cctgacaaga accccgaggc tcctctcaat gtgtcccgag tagcccagtt
    801 gtgcaggggg gaccagggtg gtgagagttc gttgtctgtc tccaagtgga
    851 acaccttcct gaaagccatg ttggtctgca gcgatgcagc caccaacagg
    901 aacttcaatc ggctgcaaga tgtcttcctg ctccctgacc ccagtggcca
    951 gtggagagat accagggtct atggcgtttt ctccaacccc tggaactact
    1001 cagctgtctg cgtgtattcg cttggtgaca ttgacagagt cttccgtacc
    1051 tcatcgctca aaggctacca catgggcctt tccaaccctc gacctggcat
    1101 gtgcctccca aaaaagcagc ccatacccac agaaaccttc caggtagctg
    1151 atagtcaccc agaggtggct cagagggtgg aacctatggg gcccc
  • [0245]
    TABLE 4
    Amino acid sequence of H-SemaL (666 amino acids)
    (SEQ ID NO.: 3)
  • [0246]
    TABLE 5
    (Partial) amino acid sequence of M-SemaL (394 amino acids,
    corresponding to position 1-396 of H-SemaL)
    (SEQ ID NO.: 4)
  • [0247]
    TABLE 6
    Synthetic oligonucleotides (Eurogentec, Seraing, Belgium)
    Number of the
    primer/name Nucleotide sequence of the primer (of the synthetic oligonucleotides)
    91506/AP2 actcactatagggctcgagcggc (SEQ ID NO.: 5)
    121234 agccgcacacggtgcttttc (SEQ ID NO.: 6)
    121235/Est 2 gcacagatgcgttcttgccc (SEQ ID NO.: 7)
    121236/Est 3 accatagaccctggtgtccc (SEQ ID NO.: 8)
    121237/Est 4 gcagtgatgctgccaccaac (SEQ ID NO.: 9)
    121238 ccagaccatgtcgctggatg (SEQ ID NO.: 10)
    121239/Est 6 acatgaggcaaccgtggcag (SEQ ID NO.: 11)
    131989/AP1 ccatcctaatacgactcactatagggc (SEQ ID NO.: 12)
    131990/Est 7 aggtagaccttgccacgtcc (SEQ ID NO.: 13)
    131991 gaacttcaacaggctgcaagacg (SEQ ID NO.: 14)
    131992 atgctgagcggaggaagctg (SEQ ID NO.: 15)
    131993 ccgccatacacctcacacag (SEQ ID NO.: 16)
    150788 ctggaagctttctgtgggtatcggctgc (SEQ ID NO.: 17)
    150789 tttggatccctggttctgtttgaag (SEQ ID NO.: 18)
    167579/cDNA ttctagaattcagcggccgcttttttttttttttttttttttttttttttvn (SEQ ID NO.: 19)
    Synthesis primer
    168421 ggggaaagttcactgtcagtctccaag (SEQ ID NO.: 20)
    168422 gggaatacacacagacggctgagtag (SEQ ID NO.: 21)
    207608/ agcaagttcagcctggttaagt (SEQ ID NO.: 22)
    Amplification of
    γgt10 insert
    207609/ ttatgagtatttcttccaggg (SEQ ID NO.: 23)
    Amplification of
    γgt10 insert
    232643/Est 13 ccattaatccagccgagccacacaag (SEQ ID NO.: 24)
    232644/Est 14 catctacagctccgaacggtcagtg (SEQ ID NO.: 25)
    233084 cagcggaagccccaaccgag (SEQ ID NO.: 26)
    240655/hs 5 gggatgacgcCtcctCcgCCcgg (SEQ ID NO.: 27)
    240656/hs 3 aagcttcacgtggaccagcaagccaagagtg (SEQ ID NO.: 28)
    240857/hs 3c aagctttttccgtccttccgtccgg (SEQ ID NO.: 29)
    243068 atggtgagcaagggcgaggagctg (SEQ ID NO.: 30)
    243069 cttgtacagctcgtccatgccgag (SEQ ID NO.: 31)
  • [0248]
    TABLE 7
    Nucleotide sequence of the recombinant plasmid pCR2.1-H-
    SemaL (SEQ ID NO.: 34)
     251 gcaagccaag agtgagtgtg ggcagcaccc ccagccagag ggaggcagcc
     301 agggcacagg catgacccag caggtgctcg gccatgatgc cgtcctcggg
     351 cagcagctgc cagtgctgag cctcgcggaa gtaggagccc tcctgggcct
     401 cgcagaagta gtggccgtac tgctgcgccg tgaggttctc gatgaacagg
     451 atgcagttgg ggctctggtg accaggttcg cagctctgct ccacgttctc
     501 cttgtggcgc catgagtagg tggcgtggcg ggattccatg gggcagctca
     551 ggtagtagcg agagtttggg gccagggaaa ccttctgcag tggggccttg
     601 tctggtttgg ggttgggaca ctccttgtgt ggctcggctg gattaatgga
     651 ttgcagcact gaccgttcgg agctgtagat ggagatgcag cggccctggt
     701 cccagccgca gtaggggtct cgggacatga ggcaaccgtg gcagcccccg
     751 ccatagacct cacacaggtc caggggcacc tggctcacct cccactggga
     801 gctcacatac agcttcctcc gctcagcatc cagcgacatg gtctggatgg
     851 cagccgcgcg gcggaagggc tggatctcca tgatgttgaa ggcgaagctg
     901 tgctcctgct cccccggttc caccaccttg tggatagtgc ccctgtctgt
     951 agttaggtaa agcacatgaa aggtctcccc gtggctggct tgcatgcggt
    1001 gaacggccac tttctggtag tggtatttag agtggaacaa tggcgtcttc
    1051 agaggcccca tgggctccac cctctgcgcc acctctgggt gacggtcagc
    1101 cacctggaag gtctctgtgg gtatcggctg ctggtctggg aggcacttgc
    1151 caggccgcgg gttgggaagg cttgagtggt agcccttgag tgaggaggta
    1201 cggaagacct tgtcaatgtc accgagggaa tacacacaga cggctgagta
    1251 gttccagggg ttggagaaaa caccatagac cctggtgtcc ctccactggc
    1301 cgctggggtc agggagcagg aagacgtctt gcagcctgtt gaagttcttg
    1351 ttggtggcag catcactgca taccagcatg gctttcagaa aagtgttcca
    1401 cttggagact gacagtgaac tttccccacc ctggtccccc ctgcacaact
    1451 gggccacacg ggacacattg agaggagcct caggattctt gtcaggattg
    1501 tcctctcgga agaagtagta gatcttgtca tcgtaagcct ggtcttggtg
    1551 cacgatggtg gctttgatga actgtgggtt ctgcatgaca gtatcactgg
    1601 tgtacagctc actctcgccc cggatgcggc ggaaccgagg gatcttccca
    1651 ttgtattcct gcttccggat ggtggaatac acctcgtccc cttcaaacag
    1701 aaccagggag ttctcgtccg ggctgaaggg ggcgtagcct ctcatctcgc
    1751 caagtggcac cacagtgcca ttcaccaggt tccagcagct ggggtgccgg
    1801 gcgttggtgc cacaggccag cagcccctca ctccgcctct ccaggagagt
    1851 gatgtagttc tcgcagtccc gcttatccag acaggacccc tttgtggagc
    1901 cgatattcac cgtgcgcaca gatgcgttct tgccctcggg gaagtcaaag
    1951 aggtagacct tgccacgtcc tcccacccac acagaggagc tgcctggctc
    2001 gtggaaaagc accgtgtgcg gctcagtctg gccaaagtcc acccggtcct
    2051 gccctacatg gcctttccag acggcgaaga tgcggggtcc gctccttagg
    2101 tggccctggg cggaggcggc ggccgcccag agcagcagca gcagccgcag
    2151 ccgcagcgga agccccaacc gagccggcgg gccagggacg cgggcgcgcg
    2201 gtgcgctggg ggcggcacgt ccgggcggag gaggcgtcat cccaagccga
    5851 CGGAAG
  • [0249]
    TABLE 8
    Nucleotide sequence of the recombinant expression plasmid
    pCDNA3.1(-)H-SemaL-MycHisA (SEQ ID NO.: 35)
     951 GcAgaattcg gcttgggatg acgcctcctc cgcccggacg tgccgccccc
    1001 agcgcaccgc gcgcccgcgt ccctggcccg ccggctcggt tggggcttcc
    1051 gctgcggctg cggctgctgc tgctgctctg ggcggccgcc gcctccgccc
    1101 agggccacct aaggagcgga ccccgcatct tcgccgtctg gaaaggccat
    1151 gtagggcagg accgggtgga ctttggccag actgagccgc acacggtgct
    1201 tttccacgag ccaggcagct cctctgtgtg ggtgggagga cgtggcaagg
    1251 tctacctctt tgacttcccc gagggcaaga acgcatctgt gcgcacggtg
    1301 aatatcggct ccacaaaggg gtcctgtctg gataagcggg actgcgagaa
    1351 ctacatcact ctcctggaga ggcggagtga ggggctgctg gcctgtggca
    1401 ccaacgcccg gcaccccagc tgctggaacc tggtgaatgg cactgtggtg
    1451 ccacttggcg agatgagagg ctacgccccc ttcagcccgg acgagaactc
    1501 cctggttctg tttgaagggg acgaggtgta ttccaccatc cggaagcagg
    1551 aatacaatgg gaagatccct cggttccgcc gcatccgggg cgagagtgag
    1601 ctgtacacca gtgatactgt catgcagaac ccacagttca tcaaagccac
    1651 catcgtgcac caagaccagg cttacgatga caagatctac tacttcttcc
    1701 gagaggacaa tcctgacaag aatcctgagg ctcctctcaa tgtgtcccgt
    1751 gtggcccagt tgtgcagggg ggaccagggt ggggaaagtt cactgtcagt
    1801 ctccaagtgg aacacttttc tgaaagccat gctggtatgc agtgatgctg
    1851 ccaccaacaa gaacttcaac aggctgcaag acgtcttcct gctccctgac
    1901 cccagcggcc agtggaggga caccagggtc tatggtgttt tctccaaccc
    1951 ctggaactac tcagccgtct gtgtgtattc cctcggtgac attgacaagg
    2001 tcttccgtac ctcctcactc aagggctacc actcaagcct tcccaacccg
    2051 cggcctggca agtgcctccc agaccagcag ccgataccca cagagacctt
    2101 ccaggtggct gaccgtcacc cagaggtggc gcagagggtg gagcccatgg
    2151 ggcctctgaa gacgccattg ttccactcta aataccacta ccagaaagtg
    2201 gccgttcacc gcatgcaagc cagccacggg gagacctttc atgtgcttta
    2251 cctaactaca gacaggggca ctatccacaa ggtggtggaa ccgggggagc
    2301 aggagcacag cttcgccttc aacatcatgg agatccagcc cttccgccgc
    2351 gcggctgcca tccagaccat gtcgctggat gctgagcgga ggaagctgta
    2401 tgtgagctcc cagtgggagg tgagccaggt gcccctggac ctgtgtgagg
    2451 tctatggcgg gggctgccac ggttgcctca tgtcccgaga cccctactgc
    2501 ggctgggacc agggccgctg catctccatc tacagctccg aacggtcagt
    2551 gctgcaatcc attaatccag ccgagccaca caaggagtgt cccaacccca
    2601 aaccagacaa ggccccactg cagaaggttt ccctggcccc aaactctcgc
    2651 tactacctga gctgccccat ggaatcccgc cacgccacct actcatggcg
    2701 ccacaaggag aacgtggagc agagctgcga acctggtcac cagagcccca
    2751 actgcatcct gttcatcgag aacctcacgg cgcagcagta cggccactac
    2801 ttctgcgagg cccaggaggg ctcctacttc cgcgaggctc agcactggca
    2851 gctgctgccc gaggacggca tcatggccga gcacctgctg ggtcatgcct
    2901 gtgccctggc tgcctccctc tggctggggg tgctgcccac actcactctt
    2951 ggcttgctgg tccacgtgaa gcttGGGCCC GAACAAAAAC TCATCTCAGA
  • [0250]
    TABLE 9
    Nucleotide sequence of the recombinant plasmid pcDNA3.1-H-
    SemaL-EGFP-MychisA (SEQ ID NO.: 36)
     951 GCAgaattcg gcttgggatg acgcctcctc cgcccggacg tgccgccccc
    1001 agcgcaccgc gcgcccgcgt ccctggcccg ccggctcggt tggggcttcc
    1051 gctgcggctg cggctgctgc tgctgctctg ggcggccgcc gcctccgccc
    1101 agggccacct aaggagcgga ccccgcatct tcgccgtctg gaaaggccat
    1151 gtagggcagg accgggtgga ctttggccag actgagccgc acacggtgct
    1201 tttccacgag ccaggcagct cctctgtgtg ggtgggagga cgtggcaagg
    1251 tctacctctt tgacttcccc gagggcaaga acgcatctgt gcgcacggtg
    1301 aatatcggct ccacaaaggg gtcctgtctg gataagcggg actgcgagaa
    1351 ctacatcact ctcctggaga ggcggagtga ggggctgctg gcctgtggca
    1401 ccaacgcccg gcaccccagc tgctggaacc tggtgaatgg cactgtggtg
    1451 ccacttggcg agatgagagg ctacgccccc ttcagcccgg acgagaactc
    1501 cctggttctg tttgaagggg acgaggtgta ttccaccatc cggaagcagg
    1551 aatacaatgg gaagatccct cggttccgcc gcatccgggg cgagagtgag
    1601 ctgtacacca gtgatactgt catgcagaac ccacagttca tcaaagccac
    1651 catcgtgcac caagaccagg cttacgatga caagatctac tacttcttcc
    1701 gagaggacaa tcctgacaag aatcctgagg ctcctctcaa tgtgtcccgt
    1751 gtggcccagt tgtgcagggg ggaccagggt ggggaaagtt cactgtcagt
    1801 ctccaagtgg aacacttttc tgaaagccat gctggtatgc agtgatgctg
    1851 ccaccaacaa gaacttcaac aggctgcaag acgtcttcct gctccctgac
    1901 cccagcggcc agtggaggga caccagggtc tatggtgttt tctccaaccc
    1951 ctggaactac tcagccgtct gtgtgtattc cctcggtgac attgacaagg
    2001 tcttccgtac ctcctcactc aagggctacc actcaagcct tcccaacccg
    2051 cggcctggca agtgcctccc agaccagcag ccgataccca cagagacctt
    2101 ccaggtggct gaccgtcacc cagaggtggc gcagagggtg gagcccatgg
    2151 ggcctctgaa gacgccattg ttccactcta aataccacta ccagaaagtg
    2201 gccgttcacc gcatgcaagc cagccacggg gagacctttc atgtgcttta
    2251 cctaactaca gacaggggca ctatccacaa ggtggtggaa ccgggggagc
    2301 aggagcacag cttcgccttc aacatcatgg agatccagcc cttccgccgc
    2351 gcggctgcca tccagaccat gtcgctggat gctgagcgga ggaagctgta
    2401 tgtgagctcc cagtgggagg tgagccaggt gcccctggac ctgtgtgagg
    2451 tctatggcgg gggctgccac ggttgcctca tgtcccgaga cccctactgc
    2501 ggctgggacc agggccgctg catctccatc tacagctccg aacggtcagt
    2551 gctgcaatcc attaatccag ccgagccaca caaggagtgt cccaacccca
    2601 aaccagacaa ggccccactg cagaaggttt ccctggcccc aaactctcgc
    2651 tactacctga gctgccccat ggaatcccgc cacgccacct actcatggcg
    2701 ccacaaggag aacgtggagc agagctgcga acctggtcac cagagcccca
    2751 actgcatcct gttcatcgag aacctcacgg cgcagcagta cggccactac
    2801 ttctgcgagg cccaggaggg ctcctacttc cgcgaggctc agcactggca
    2851 gctgctgccc gaggacggca tcatggccga gcacctgctg ggtcatgcct
    2901 gtgccctggc tgcctccctc tggctggggg tgctgcccac actcactctt
  • [0251]
    TABLE 10
    Nucleotide sequence of the recombinant plasmid pIND-H-
    SemaL-EE (SEQ ID NO.:37)
     551 cgcctcctcc gcccggacgt gccgccccca gcgcaccgcg cgcccgcgtc
     601 cctggcccgc cggctcggtt ggggcttccg ctgcggctgc ggctgctgct
     651 gctgctctgg gcggccgccg cctccgccca gggccaccta aggagcggac
     701 cccgcatctt cgccgtctgg aaaggccatg tagggcagga ccgggtggac
     751 tttggccaga ctgagccgca cacggtgctt ttccacgagc caggcagctc
     801 ctctgtgtgg gtgggaggac gtggcaaggt ctacctcttt gacttccccg
     851 agggcaagaa cgcatctgtg cgcacggtga atatcggctc cacaaagggg
     901 tcctgtctgg ataagcggga ctgcgagaac tacatcactc tcctggagag
     951 gcggagtgag gggctgctgg cctgtggcac caacgcccgg caccccagct
    1001 gctggaacct ggtgaatggc actgtggtgc cacttggcga gatgagaggc
    1051 tacgccccct tcagcccgga cgagaactcc ctggttctgt ttgaagggga
    1101 cgaggtgtat tccaccatcc ggaagcagga atacaatggg aagatccctc
    1151 ggttccgccg catccggggc gagagtgagc tgtacaccag tgatactgtc
    1201 atgcagaacc cacagttcat caaagccacc atcgtgcacc aagaccaggc
    1251 ttacgatgac aagatctact acttcttccg agaggacaat cctgacaaga
    1301 atcctgaggc tcctctcaat gtgtcccgtg tggcccagtt gtgcaggggg
    1351 gaccagggtg gggaaagttc actgtcagtc tccaagtgga acacttttct
    1401 gaaagccatg ctggtatgca gtgatgctgc caccaacaag aacttcaaca
    1451 ggctgcaaga cgtcttcctg ctccctgacc ccagcggcca gtggagggac
    1501 accagggtct atggtgtttt ctccaacccc tggaactact cagccgtctg
    1551 tgtgtattcc ctcggtgaca ttgacaaggt cttccgtacc tcctcactca
    1601 agggctacca ctcaagcctt cccaacccgc ggcctggcaa gtgcctccca
    1651 gaccagcagc cgatacccac agagaccttc caggtggctg accgtcaccc
    1701 agaggtggcg cagagggtgg agcccatggg gcctctgaag acgccattgt
    1751 tccactctaa ataccactac cagaaagtgg ccgttcaccg catgcaagcc
    1801 agccacgggg agacctttca tgtgctttac ctaactacag acaggggcac
    1851 tatccacaag gtggtggaac cgggggagca ggagcacagc ttcgccttca
    1901 acatcatgga gatccagccc ttccgccgcg cggctgccat ccagaccatg
    1951 tcgctggatg ctgagcggag gaagctgtat gtgagctccc agtgggaggt
    2001 gagccaggtg cccctggacc tgtgtgaggt ctatggcggg ggctgccacg
    2051 gttgcctcat gtcccgagac ccctactgcg gctgggacca gggccgctgc
    2101 atctccatct acagctccga acggtcagtg ctgcaatcca ttaatccagc
    2151 cgagccacac aaggagtgtc ccaaccccaa accagacaag gccccactgc
    2201 agaaggtttc cctggcccca aactctcgct actacctgag ctgccccatg
    2251 gaatcccgcc acgccaccta ctcatggcgc cacaaggaga acgtggagca
    2301 gagctgcgaa cctggtcacc agagccccaa ctgcatcctg ttcatcgaga
    2351 acctcacggc gcagcagtac ggccactact tctgcgaggc ccaggagggc
    2401 tcctacttcc gcgaggctca gcactggcag ctgctgcccg aggacggcat
    2451 catggccgag cacctgctgg gtcatgcctg tgccctggct gcctccctct
    2501 ggctgggggt gctgcccaca ctcactcttg gcttgctggt ccacgtgaag
  • [0252]
    TABLE 1
    Nucleotide sequence of the recombinant plasmid pIN D-H-
    SemaL-EA (SEQ ID NO.:38)
     551 cgcctcctcc gcccggacgt gccgccccca gcgcaccgcg cgcccgcgtc
     601 cctggcccgc cggctcggtt ggggcttccg ctgcggctgc ggctgctgct
     651 gctgctctgg gcggccgccg cctccgccca gggccaccta aggagcggac
     701 cccgcatctt cgccgtctgg aaaggccatg tagggcagga ccgggtggac
     751 tttggccaga ctgagccgca cacggtgctt ttccacgagc caggcagctc
     801 ctctgtgtgg gtgggaggac gtggcaaggt ctacctcttt gacttccccg
     851 agggcaagaa cgcatctgtg cgcacggtga atatcggctc cacaaagggg
     901 tcctgtctgg ataagcggga ctgcgagaac tacatcactc tcctggagag
     951 gcggagtgag gggctgctgg cctgtggcac caacgcccgg caccccagct
    1001 gctggaacct ggtgaatggc actgtggtgc cacttggcga gatgagaggc
    1051 tacgccccct tcagcccgga cgagaactcc ctggttctgt ttgaagggga
    1101 cgaggtgtat tccaccatcc ggaagcagga atacaatggg aagatccctc
    1151 ggttccgccg catccggggc gagagtgagc tgtacaccag tgatactgtc
    1201 atgcagaacc cacagttcat caaagccacc atcgtgcacc aagaccaggc
    1251 ttacgatgac aagatctact acttcttccg agaggacaat cctgacaaga
    1301 atcctgaggc tcctctcaat gtgtcccgtg tggcccagtt gtgcaggggg
    1351 gaccagggtg gggaaagttc actgtcagtc tccaagtgga acacttttct
    1401 gaaagccatg ctggtatgca gtgatgctgc caccaacaag aacttcaaca
    1451 ggctgcaaga cgtcttcctg ctccctgacc ccagcggcca gtggagggac
    1501 accagggtct atggtgtttt ctccaacccc tggaactact cagccgtctg
    1551 tgtgtattcc ctcggtgaca ttgacaaggt cttccgtacc tcctcactca
    1601 agggctacca ctcaagcctt cccaacccgc ggcctggcaa gtgcctccca
    1651 gaccagcagc cgatacccac agagaccttc caggtggctg accgtcaccc
    1701 agaggtggcg cagagggtgg agcccatggg gcctctgaag acgccattgt
    1751 tccactctaa ataccactac cagaaagtgg ccgttcaccg catgcaagcc
    1801 agccacgggg agacctttca tgtgctttac ctaactacag acaggggcac
    1851 tatccacaag gtggtggaac cgggggagca ggagcacagc ttcgccttca
    1901 acatcatgga gatccagccc ttccgccgcg cggctgccat ccagaccatg
    1951 tcgctggatg ctgagcggag gaagctgtat gtgagctccc agtgggaggt
    2001 gagccaggtg cccctggacc tgtgtgaggt ctatggcggg ggctgccacg
    2051 gttgcctcat gtcccgagac ccctactgcg gctgggacca gggccgctgc
    2101 atctccatct acagctccga acggtcagtg ctgcaatcca ttaatccagc
    2151 cgagccacac aaggagtgtc ccaaccccaa accagacaag gccccactgc
    2201 agaaggtttc cctggcccca aactctcgct actacctgag ctgccccatg
    2251 gaatcccgcc acgccaccta ctcatggcgc cacaaggaga acgtggagca
    2301 gagctgcgaa cctggtcacc agagccccaa ctgcatcctg ttcatcgaga
    2351 acctcacggc gcagcagtac ggccactact tctgcgaggc ccaggagggc
    2401 tcctacttcc gcgaggctca gcactggcag ctgctgcccg aggacggcat
    2451 catggccgag cacctgctgg gtcatgcctg tgccctggct gcctccctct
    2501 ggctgggggt gctgcccaca ctcactcttg gcttgctggt ccacgtgaag
    7101 GGATCGGG
  • [0253]
    TABLE 12
    Sequence of the recombinant plasmid pQE30-H-SemaL-BH
    (SEQ ID NO.:39)
     151 ctggttctgt ttgaagggga cgaggtgtat tccaccatcc ggaagcagga
     201 atacaatggg aagatccctc ggttccgccg catccggggc gagagtgagc
     251 tgtacaccag tgatactgtc atgcagaacc cacagttcat caaagccacc
     301 atcgtgcacc aagaccaggc ttacgatgac aagatctact acttcttccg
     351 agaggacaat cctgacaaga atcctgaggc tcctctcaat gtgtcccgtg
     401 tggcccagtt gtgcaggggg gaccagggtg gggaaagttc actgtcagtc
     451 tccaagtgga acacttttct gaaagccatg ctggtatgca gtgatgctgc
     501 caccaacaag aacttcaaca ggctgcaaga cgtcttcctg ctccctgacc
     551 ccagcggcca gtggagggac accagggtct atggtgtttt ctccaacccc
     601 tggaactact cagccgtctg tgtgtattcc ctcggtgaca ttgacaaggt
     651 cttccgtacc tcctcactca agggctacca ctcaagcctt cccaacccgc
     701 ggcctggcaa gtgcctccca gaccagcagc cgatacccac agaAAGCTTA
  • [0254]
    TABLE 13
    Sequence of the recombinant plasmid pQE3I-H-SemaL-SH
    (SEQ ID NO.:40)
     151 CCGCATGCga gctcccagtg ggaggtgagc caggtgcccc tggacctgtg
     201 tgaggtctat ggcgggggct gccacggttg cctcatgtcc cgagacccct
     251 actgcggctg ggaccagggc cgctgcatct ccatctaoag ctccgaacgg
     301 tcagtgctgc aatccattaa tccagccgag ccacacaagg agtgtcccaa
     351 ccccaaacca gacaaggccc cactgcagaa ggtttccctg gccccaaact
     401 ctcgctacta cctgagctgc cccatggaat cccgccacgc cacctactca
     451 tggcgccaca aggagaacgt ggagcagagc tgcgaacctg gtcaccagag
     501 ccccaactgc atcctgttca tcgagaacct cacggcgcag cagtacggcc
     551 actacttctg cgaggcccag gagggctcct acttccgcga ggctcagcac
     601 tggcagctgc tgcccgagga cggcatcatg gccgagcacc tgctgggtca
     651 tgcctgtgcc ctggctgcct ccctctggct gggggtgctg cccacactca
     701 ctcttggctt gctggtccac gtgaagcttA ATTAGCTGAG CTTGGACTCC
  • [0255]
    TABLE 14
    (Partial) nucleotide sequence of the human semaphorin L gene.
    (8888 nucleotides) (SEQ ID NO.:41):
  • [0256]
    TABLE 15
    Nucleotide sequence of pMeIBacA-H-SEMAL (6622bp)
    (SEQ ID NO:42)
                       gga tccgcccagg gccacctaag gagcggaccc
     201 cgcatcttcg ccgtctggaa aggccatgta gggcaggacc gggtggactt
     251 tggccagact gagccgcaca cggtgctttt ccacgagcca ggcagctcct
     301 ctgtgtgggt gggaggacgt ggcaaggtct acctctttga cttccccgag
     351 ggcaagaacg catctgtgcg cacggtgaat atcggctcca caaaggggtc
     401 ctgtctggat aagcgggact gcgagaacta catcactctc ctggagaggc
     451 ggagtgaggg gctgctggcc tgtggcacca acgcccggca ccccagctgc
     501 tggaacctgg tgaatggcac tgtggtgcca cttggcgaga tgagaggcta
     551 tgcccccttc agccGggaCg agaactccct ggttctgttt gaaggggacg
     601 aggtgtattc caccatccgg aagcaggaat acaatgggaa gatccctcgg
     651 ttccgccgca tccggggcga gagtgagctg tacaccagtg atactgtcat
     701 gcagaaccca cagttcatca aagccaccat cgtgcaccaa gaccaggctt
     751 acgatgacaa gatctactac ttcttccgag aggacaatcc tgacaagaat
     801 cctgaggctc ctctcaatgt gtcccgtgtg gcccagttgt gcagggggga
     851 ccagggtggg gaaagttcac tgtcagtctc caagtggaac acttttctga
     901 aagccatgct ggtatgcagt gatgctgcca ccaacaagaa cttcaacagg
     951 ctgcaagacg tcttcctgct ccctgacccc agcggccagt ggagggacac
    1001 cagggtctat ggtgttttct ccaacccctg gaactactca gccgtctgtg
    1051 tgtattccct cggtgacatt gacaaggtct tccgtacctc ctcactcaag
    1101 ggctaccact caagccttcc caacccgcgg cctggcaagt gcctcccaga
    1151 ccagcagccg atacccacag agaccttcca ggtggctgac cgtcacccag
    1201 aggtggcgca gagggtggag cccatggggc ctctgaagac gccattgttc
    1251 cactctaaat accactacca gaaagtggcc gttcaccgca tgcaagccag
    1301 ccacggggag acctttcatg tgctttacct aactacagac aggggcacta
    1351 tccacaaggt ggtggaaccg ggggagcagg agcacagctt cgccttcaac
    1401 atcatggaga tccagccctt ccgccgcgcg gctgccatcc agaccatgtc
    1451 gctggatgct gagcggagga agctgtatgt gagctcccag tgggaggtga
    1501 gccaggtgcc cctggacctg tgtgaggtct atggcggggg ctgccacggt
    1551 tgcctcatgt cccgagaccc ctactgcggc tgggaccagg gccgctgcat
    1601 ctccatctac agctccgaac ggtcagtgct gcaatccatt aatccagccg
    1651 agccacacaa ggagtgtccc aaccccaaac cagacaaggc cccactgcag
    1701 aaggtttccc tggccccaaa ctctcgctac tacctgagct gccccatgga
    1751 atcccgccac gccacctact catggcgcca caaggagaac gtggagcaga
    1801 gctgcgaacc tggtcaccag agccccaact gcatcctgtt catcgagaaG
    1851 ctcacggcgc agcagtacgg ccactacttc tgcgaggccc aggagggctc
    1901 ctacttccgc gaggctcagc actggcagct gctgcccgag gacggcatca
    1951 tggccgagca cctgctgggt catgcctgtg ccctggctgc ctgaattc
  • [0257]
    The above description of the invention is intended to be illustrative and not limiting. Various changes or modifications in the embodiments described may occur to those skilled in the art. These can be made without departing from the spirit or scope of the invention. Accordingly, it is intended that the invention be limited only to the extent required by the claims and the applicable rules of law.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US7232899Jan 14, 2000Jun 19, 2007The Scripps Research InstituteAdenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
US7498407Nov 12, 2002Mar 3, 2009Georgetown UniversityVascular endothelial cell growth inhibitor, VEGI-192a
US7750133Dec 6, 2007Jul 6, 2010Georgetown UniversityVascular endothelial cell growth inhibitor, VEGI-192a
US9090709Mar 14, 2013Jul 28, 2015Vaccinex, Inc.Anti-SEMA4D antibodies and epitopes
US9243068Jun 20, 2014Jan 26, 2016Vaccinex, Inc.Combination of SEMA-4D inhibitors and immunomodulators to inhibit tumors and metastases
US9249227Jun 29, 2015Feb 2, 2016Vaccinex, Inc.Use of semaphorin-4D binding molecules for treating neurodegenerative disorders
US9512224Oct 10, 2014Dec 6, 2016Vaccinex, Inc.Use of semaphorin-4D binding molecules for treatment of atherosclerosis
US9598495Oct 21, 2014Mar 21, 2017Vaccinex, Inc.Use of semaphorin-4D binding molecules for treating neurodegenerative disorders
US9605055Mar 12, 2013Mar 28, 2017Vaccinex, Inc.Anti-CD100 antibodies and methods of using the same
US9676840Mar 13, 2013Jun 13, 2017Vaccinex, Inc.Anti-CD100 neutralizing antibodies and methods of using the same
US20030170242 *Nov 12, 2002Sep 11, 2003Luyuan LiNovel isoforms of vascular endothelial cell growth inhibitor
US20050196201 *Dec 15, 2004Sep 8, 2005Canon Kabushiki KaishaImage forming apparatus
CN104168956A *Oct 11, 2012Nov 26, 2014瓦西尼斯公司Use of semaphorin-4D binding molecules for modulation of blood brain barrier permeability
WO2013055922A1 *Oct 11, 2012Apr 18, 2013Vaccinex, Inc.Use of semaphorin-4d binding molecules for modulation of blood brain barrier permeability
U.S. Classification435/69.1, 530/350, 435/325, 536/23.5, 514/19.1, 514/19.6
International ClassificationC12N15/85, C12Q1/68, C07K14/725, G01N33/68, A61K38/00, C12R1/91, C12P21/02, C07K16/28, A61K48/00, C12N15/11, C12N15/62, C12N15/12, C12N5/10, C12N15/09, C07K14/47
Cooperative ClassificationC07K2319/02, A61K48/00, C07K14/4703
European ClassificationC07K14/47A1A
Legal Events
Jan 4, 2006ASAssignment
Effective date: 20050901