Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS20020037851 A1
Publication typeApplication
Application numberUS 09/836,077
Publication dateMar 28, 2002
Filing dateApr 16, 2001
Priority dateJul 9, 1997
Also published asCA2237158A1, CN1209436A, EP0892047A2, EP0892047A3, US7339030, US20060029998
Publication number09836077, 836077, US 2002/0037851 A1, US 2002/037851 A1, US 20020037851 A1, US 20020037851A1, US 2002037851 A1, US 2002037851A1, US-A1-20020037851, US-A1-2002037851, US2002/0037851A1, US2002/037851A1, US20020037851 A1, US20020037851A1, US2002037851 A1, US2002037851A1
InventorsBernhard Fleckenstein, Armin Ensser
Original AssigneeBernhard Fleckenstein, Armin Ensser
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Human semaphorin L (H-SemaL) and corresponding semaphorins in other species
US 20020037851 A1
Abstract
Human semaphorin L (H-SemaL) and corresponding semaphorins in other species.
The invention relates to novel semaphorins which are distinguished by a particular domain structure and derivatives thereof, nucleic acids (DNA, RNA, cDNA) which code for these semaphorins, and derivatives thereof, and the use thereof.
The present invention relates to semaphorins which have a novel, as yet undisclosed and unexpected domain structure and which possess a biochemical function in the immune system (immunomodulating semaphorins). The novel semaphorins are referred to as type L semaphorins (SemaL). They comprise an N-terminal signal peptide, a characteristic Sema domain and, in the C-terminal region of the protein, an immunoglobulin-like domain and a hydrophobic domain which represents a potential transmembrane domain.
Images(18)
Previous page
Next page
Claims(29)
1. An isolated semaphorin protein comprising an amino acid sequence having an N-terminal signal peptide, a Sema domain and, in a C-terminal region, an immunoglobulin-like domain and a transmembrane domain.
2. The isolated semaphorin protein as claimed in claim 1, wherein the amino acid sequence corresponds to SEQ ID NO.: 3, or a derivative of SEQ ID NO.: 3.
3. The isolated semaphorin protein as claimed in claim 1, wherein the amino acid sequence of the Sema domain of the semaphorin protein is at least about 40% homologous to the Sema domain of SEQ ID NO.: 3.
4. The isolated semaphorin protein as claimed in claim 1, wherein the amino acid sequence of the protein is at least about 15 to 20% homologous to SEQ ID NO.: 3.
5. The isolated semaphorin protein as claimed in claim 1, comprising an amino acid sequence corresponding to SEQ ID NO.: 4.
6. An isolated nucleic acid molecule encoding a semaphorin protein as claimed in claim 1.
7. The isolated nucleic acid molecule as claimed in claim 6, comprising a nucleic acid sequence corresponding to SEQ ID NO.: 41, or a derivative of SEQ ID NO.: 41.
8. The isolated nucleic acid molecule as claimed in claim 6 wherein the nucleic acid molecule is a cDNA sequence coding for the semaphorin protein.
9. The isolated nucleic acid molecule as claimed in claim 8, wherein the cDNA sequence corresponds to SEQ ID NO.: 1, or to a derivative of SEQ ID NO.: 1.
10. The isolated nucleic acid molecule as claimed in claim 8, wherein the cDNA sequence corresponds to SEQ ID NO.: 2, or to a derivative of SEQ ID NO.: 2.
11. The isolated semaphorin protein as claimed in claim 1, wherein the protein is phosphorylated, glycosylated or myristylated.
12. A plasmid comprising the nucleic acid sequence as claimed in claim 6.
13. A plasmid comprising a nucleic acid sequence corresponding to SEQ ID NO.: 41, or a derivative of SEQ ID NO.: 41.
14. A plasmid comprising the nucelic acid sequence as claimed in claim 8.
15. A vector comprising the nucleic acid sequence as claimed in claim 6.
16. A vector comprising the nucleic acid sequence as claimed in claim 8.
17. A process for preparing a semaphorin protein as claimed in claim 1, which comprises the steps of:
cloning a nucleic acid sequence as claimed in claim 6 into an expression vector to form a recombinant vector;
transforming a cell with the recombinant vector; and
expressing the protein from the transformed cell.
18. The process as claimed in claim 17, wherein the transformed cell is a eukcaryotic cell.
19. A process for preparing a nucleic acid molecule encoding a semaphorin protein as claimed in claim 1, comprising amplifying the nucleic acid sequence corresponding to SEQ ID NO.: 41, or a derivative thereof, by the polymerase chain reaction using specific primers.
20. A method for identifying immunomodulating agents, which comprises incubating a semaphorin protein as claimed in claim 1 under defined conditions with an agent to be investigated, carrying out a second batch in parallel without without the agent to be investigated but under conditions which are otherwise the same, and then determining the inhibiting or activating effect of the agent to be investigated.
21. A method for identifying immunomodulating agents, which comprises expressing a nucleic acid sequence as claimed in claim 6 under defined conditions and in the presence of an agent to be investigated, and determining the extent of the expression.
22. An isolated semaphorin antibody which recognizes an epitope corresponding to amino acids 179 to 378 of SEQ ID NO.: 3 or amino acids 480 to 666 of SEQ ID NO.: 3.
23. A process for preparing an antibody to the semaphorin protein as claimed in claim 1, which comprises the steps of:
preparing a recombinant plasmid with a fusion protein consisting of of a semaphorin epitope and an epitope tag;
transforming a suitable cell with the recombinant plasmid;
purifying the fusion protein from the cells via the epitope tag; and
using the purified fusion proteins for immunization.
24. A method for preventing or treating an immunological disorder which comprises administering to a host in need thereof a pharmaceutical product containing an isolated semaphorin protein or a derivative thereof, as claimed in claim 1.
25. A method for preventing or treating an immunological disorder which comprises administering to a host in need thereof a pharmaceutical product containing a nucleic acid sequence as claimed in claim 6 or a derivative thereof.
26. A method for preventing or treating an immunological disorder which comprises administering to a host in need thereof a pharamceutical product containing a nucleic acid sequence as claimed in claim 8.
27. The method according to claim 24 wherein the method is gene therapy.
28. The method according to claim 25 wherein the method is gene therapy.
29. A method for modulating an immune response or inhibiting inflammation which comprises introducing the nucleic acid sequence as claimed in claim 6 to a host cell.
Description
    RELATED APPLICATIONS
  • [0001]
    This application claims priority to German Application Nos. 19729211.9 and 19805371.1, filed Jul. 9, 1997 and Feb. 11, 1998 respectively, each incorporated herein by reference.
  • BACKGROUND OF THE INVENTION
  • [0002]
    1. Field of the Invention
  • [0003]
    The invention relates to novel semaphorins which are distinguished by a particular domain structure and derivatives thereof, nucleic acids (DNA, RNA, cDNA) which code for these semaphorins, and derivatives thereof, and the preparation and use thereof.
  • [0004]
    2. Description of the Related Art
  • [0005]
    The publications which are referenced in this application describe the state of the art to which this invention pertains. These references are incorporated herein by references.
  • [0006]
    Semaphorins were described for the first time by Kolodkin {Kolodkin et al. (1993) Cell 75:1389-1399} as members of a conserved gene family.
  • [0007]
    The genes or parts of the genes of other semaphorins have now been cloned and, in some cases, characterized. To date, a total of 5 human (H-Sema III, H-Sema V, H-Sema IV, H-SemaB and H-SemaE) {Kolodkin et al. (1993); Roche et al. (1996) Onkogene 12:1289-1297; Sekido et al. (1996) Proc. Natl. Acad. Sci. USA 93:41204125; Xiang et al. (1996) Genomics 32:39-48; Hall et al. (1996) Proc. Natl. Acad. Sci. USA 39:11780-11785; Yamada et al. (1997) (GenBank Accession No. AB000220)}, 8 murine (mouse genes; M-Sema A to M-Sema-H) {Püschel et al. (1995) Neuron 14:941-948; Messerschmidt et al. (1995) Neuron 14:949-959; Inigaki et al. (1995) FEBS Letters 370:269-272; Adams et al. (1996) Mech. Dev. 57:33-45; Christensen et al. (1996) (GenBank Accession No. Z80941, Z93948)}, 5 galline (chicken) (collapsin-1 to -5) {Luo et al. (1993); Luo et al. (1995) Neuron 14:1131-1140), and genes from rats (R-Sema-III) {Giger et al. (1996) J. Comp. Neurol. 375:378-392}, zebra fish, insects (fruit fly (Drosophila melanogaster: D-Sema I and D-Sema II), beetles (Tribolium confusum: T-Sema-I), grasshoppers (Schistocerca americana: G-Sema-I)) {Kolodkin et al. (1993)}, and nematodes (C.elegans: Ce-Sema) {Roy et al. (1994) (GenBank Accession No. U15667)} have been disclosed. In addition, two poxviruses (vaccinia (ORF-A39) and variola (ORFA39-homologous)) {Kolodkin et al. (1993)} and alcelaphine herpesvirus Type 1 (AHV-1) (AHV-Sema) {Ensser and Fleckenstein (1995) Gen. Virol. 76:1063-1067} have genes homologous to semaphorins.
  • [0008]
    Table 1 summarizes the semaphorins identified to date in various species. Table 1 indicates the names of the semaphorins (column 1), the synonyms used (column 2), the species from which the particular semaphorin has been isolated (column 3) and, where known, data on the domain structure of the encoded protein and on the chromosomal location (column 4 in Table 1), the accession number under which the sequence of the gene is stored in gene databanks (for example in an EST (expressed sequence tags) databank, EMBL (European Molecular Biology Laboratory, Heidelberg) or NCBI (National Center for Biotechnology Information, Maryland, USA), and the corresponding reference under which these data have been published (column 5 in Table 1).
  • [0009]
    All the gene products (encoded semaphorins) of the semaphorin genes disclosed to date have an N-terminal signal peptide which has at its C-terminal end a characteristic Sema domain with a length of about 450 to 500 amino acids. Highly conserved amino acid motifs and a number of highly conserved cysteine residues are located within the Sema domains. The gene products (semaphorins) differ in the C-terminal sequences which follow the Sema domains and are composed of one or more domains. They have, for example, in these C-terminal amino acid sequences transmembrane domains (TM), immunoglobulin-like domains (Ig) (constant part of the immunoglobulin), cytoplasmic sequences (CP), processing signals (P) (for example having the consensus sequence (RXR) where R is the amino acid arginine and X is any amino acid) and/or hydrophilic C termini (HPC). The semaphorins disclosed to date can be divided on the basis of the differences in the domain structure in the C terminus into 5 different subgroups (I to V):
  • [0010]
    I Secreted, without other domains (for example ORF-A49)
  • [0011]
    II Ig Secreted (without transmembrane domain) for example AHV-Sema)
  • [0012]
    III Ig, TM, CP Membrane-anchored with cytoplasmic sequence (for example CD100)
  • [0013]
    IV Ig, (P), HPC Secreted with hydrophilic C terminus (for example H-Sema III, M-SemaD, collapsin-1)
  • [0014]
    V Ig, TM, CP Membrane-anchored with C-terminal 7 thrombospondin motif (for example M-SemaF and G)
  • [0015]
    A receptor or extracellular ligand for semaphorins has not been described to date. Intracellular, heterotrimeric GTP-binding protein complexes have been described in connection with semaphorin-mediated effects. One component of these protein complexes which has been identified in chickens is called CRMP (collapsin response mediator protein) and is presumed to be a component of the semaphorin-induced intracellular signal cascade (Goshima et al. (1995) Nature 376: 509-514). CRMP62, for example, has homology with unc-33, a nematode protein which is essential for directed growth of axons. A human protein with 98% amino acid identity with CRMP62 is likewise known (Hamajima et al. (1996) Gene 180: 157-163). Several CRMP-related genes have likewise been described in rats (Wang et al. (1996) Neurosci. 16: 6197-6207).
  • [0016]
    The secreted or transmembrane semaphorins convey repulsive signals for growing nerve buds. They play a part in the development of the central nervous system (CNS) and are expressed in particular in muscle and nerve tissues (Kolodkin et al. (1993); Luo et al. (1993) Cell 75:217-227).
  • [0017]
    Pronounced expression of M-SemaG has been observed not only in the CNS but also in cells of the lymphatic and hematopoietic systems, in contrast to the closely related M-SemaF {Furuyima et al. (1996) J. Biol. Chem. 271: 33376-33381}.
  • [0018]
    Recently, two other human semaphorins have been identified, H-Sema IV and H-Sema V, specifically in a region on chromosome 3p21.3, whose deletion is associated with various types of bronchial carcinomas. H-Sema IV {Roche et al. (1996), Xiang et al. (1996), Sekido et al. (1996)} is about 50% identical at the amino acid level with M-SemaE, whereas H-Sema V {Sekido et al. (1996)} is the direct homolog of M-SemaA (86% amino acid identity). Since these genes (H-Sema IV and V) were found during DNA sequencing projects on the deleted 3p21.3 loci, the complex intron-exon structure of these two genes is known. Both genes are expressed in various neuronal and non-neuronal tissues.
  • [0019]
    Likewise only recently, the cellular surface molecule CD100 (human), expressed and induced on activated T cells, has been identified as a semaphorin (likewise listed in Table 1). It assists interaction with B cells via the CD40 receptor and the corresponding ligand CD40L. CD100 is a membrane-anchored glycoprotein dimer of 150 kd (kilodaltons). An association of the intracytoplasmic C-terminus of CD100 with an as yet unknown kinase has been described {Hall et al. (1996)}. This means that CD100 is the first and to date only semaphorin whose expression in cells of the immune system has been demonstrated.
  • [0020]
    In the “transforming genes of rhadinoviruses” project, the complete genome of alcelaphine herpesvirus Type 1 (AHV-1) has been cloned and sequenced {Ensser et al. (1995)}. AHV-1 is the causative agent of malignant catarrhal fever, a disease of various ruminants which is associated with a lymphoproliferative syndrome and is usually fatal. On analysis, an open reading frame was found, at one end of the viral genome, having remote but significant homology with a gene of vaccinia-virus (ORF-A39 corresponds to VAC-A39 in Ensser et al. (1995) J. Gen. Virol. 76:1063-1067) which has been assigned to the semaphorin gene family. Whereas the AHV-1 semaphorin (AHV-Sema) has a well-conserved semaphorin structure, the poxvirus genes (ORF-A39 and ORF-A39-homologous, see Table 1) have C-terminal truncations, i.e. the conserved Sema domain is present in them only incompletely.
  • [0021]
    Databank comparison of the found AHV-Sema with dbEST (EST (expressed sequence tags) databank (db)) provided in each case 2 EST sequences from 2 independent cDNA clones from human placenta (accession numbers H02902, H03806 (clone 151129), accession numbers R33439 and R33537 (clone 135941)). These display distinctly greater homology with AHV-1 semaphorin than with the neuronal semaphorins hitherto described.
  • SUMMARY OF THE INVENTION
  • [0022]
    The present invention relates to semaphorins which have a novel, as yet undisclosed and unexpected domain structure and which possess a biochemical function in the immune system (immunomodulating semaphorins). The novel semaphorins are referred to as type L semaphorins (SemaL). They comprise an N-terminal signal peptide, a characteristic Sema domain and, in the C-terminal region of the protein, an immunoglobulin-like domain and a hydrophobic domain which represents a potential transmembrane domain.
  • [0023]
    The amino acid sequence of the signal peptide may have fewer than 70, preferably fewer than 60 amino acids and more than 20, preferably more than 30 amino acids, and a particularly preferred length is of about 40 to 50 amino acids. In a specific embodiment of the invention, the signal peptide has a length of 44 amino acids, i.e. a cleavage site for a signal peptidase is located between amino acids 44 and 45.
  • [0024]
    The Sema domain may have a length of from 300 to 700 or more, preferably of about 400 to 600, amino acids. Preferred Sema domains have a length of 450 to 550 amino acids, preferably of about 500 amino acids. In a preferred embodiment of the invention, the Sema domain is joined to the signal peptide, in which case the Sema domain preferably extends up to amino acid 545.
  • [0025]
    The immunoglobulin-like domain may have a length of about 30 to 110 or more amino acids, and preferred lengths are between 50 and 90, particularly preferably about 70, amino acids.
  • [0026]
    The transmembrane domain may have a length of about 10 to 35, preferably of about 15 to 30, particularly preferably of about 20 to 25, amino acids.
  • [0027]
    The invention relates to type L semaphorins from various species, in particular from vertebrates, for example from birds and/or fishes, preferably from mammals, for example from primates, rat, rabbit, dog, cat, sheep, goat, cow, horse, pig, particularly preferably from human and mouse. The invention also relates to corresponding semaphorins from microorganisms, especially from pathogenic microorganisms, for example from bacteria, yeasts and/or viruses, for example from retroviruses, especially from human-pathogenic microorganisms.
  • BRIEF DECEPTION OF THE DRAWING
  • [0028]
    The invention will be described in greater detail with the aid of the following figures:
  • [0029]
    [0029]FIG. 1 is a Multiple tissue Northern blot for the tissue-specific expression of H-SemaL.
  • [0030]
    [0030]FIG. 2 is a diagrammic representation of the cloning of the H-SemaL cDNA and of the genomic organization of the H-SemaL encoding sequence.
  • [0031]
    [0031]FIG. 3 is a phylogenetic tree.
  • [0032]
    [0032]FIG. 4 is a FACS analysis of H-SEMAL expression in various cell lines.
  • [0033]
    [0033]FIG. 5 is a comparative analysis of CD 100 and H-SemaL expression.
  • [0034]
    [0034]FIG. 6 is the expression of secretable human SEMA-L (H-SemaL) in HiFive and SC3 cells.
  • [0035]
    [0035]FIG. 7 depicts the specificity of the antiserum.
  • [0036]
    [0036]FIG. 8 is a plasmid map of pMelBacA-H-SEMAL.
  • DETAILED DESCRIPTION OF THE INVENTION
  • [0037]
    One embodiment of the invention is a corresponding human semaphorin (H-SemaL) which has a signal peptide, a Sema domain, an immunoglobulin-like domain and a transmembrane domain. A specific embodiment is the semaphorin which is given by the amino acid sequence shown in Table 4.
  • [0038]
    Another embodiment of the invention comprises corresponding semaphorins in other species which have, in the region of the Sema domain, an amino acid identity greater than 40%, preferably greater than 50%, particularly preferably greater than 60%, in relation to the Sema domain of H-SemaL (amino acids 45 to 545 of the sequence in Table 4). The corresponding semaphorins from closely related species (for example primates, mouse) may perfectly well have amino acid identities of greater than 70%, preferably greater than 80%, particularly preferably greater than 90%. Percentage homologies can be determined or calculated for example using the GAP program (GCG program package, Genetic Computer Group (1991)).
  • [0039]
    Such an embodiment of the invention is a corresponding mouse semaphorin (murine semaphorin (M-SemaL)). This contains, for example, the partial amino acid sequence shown in Table 5 (murine semaphorin (M-SemaL)).
  • [0040]
    The invention also relates to corresponding semaphorins which have an amino acid identity (considered over the entire length of the amino acid sequence of the protein) of only about 15 to 20% in the case of less related species (very remote from one another phylogenetically), preferably 25 to 30%, particularly preferably 35 to 40%, or a higher identity in relation to the complete amino acid sequence of H-SemaL shown in Table 4.
  • [0041]
    The genes which code for type L semaphorins have a complex exon-intron structure. These genes may have, for example, between 10 and 20 exons, preferably about 11 to 18, particularly preferably 12 to 16, exons and a corresponding number of introns. However, they may also have the same number of exons and introns as does the gene of H-SemaL (13 or 15 exons, preferably 14 exons). A particular embodiment of the invention relates to the gene of H-SemaL. This gene preferably has a length of 8888 to 10,000 or more nucleotides. The human semaphorin gene preferably contains the nucleotide sequence given in Table 14 or the nucleotide sequence which has been deposited at the GenBank® databank under accession number AF030697. These nucleotide sequences contain at least 13 introns. In addition, the human semaphorin gene has at the 5′ end an additional sequence region. This region contains, where appropriate, further coding and uncoding sequences, for example one or two further introns or exons.
  • [0042]
    Attempts to locate the human type L semaphorin on the chromosome revealed that the corresponding gene is located at position 15q22.3-23. The gene for M-SemaL has correspondingly been located at position 9A3.3-B.
  • [0043]
    As a consequence of the complex intron-exon structure, the splicing of the primary transcript of the semaphorin mRNA may vary, resulting in different splicing variants of the semaphorins. The proteins translated from these splicing variants are derivatives of the semaphorins according to the invention. They correspond in their amino acid sequence and also substantially in their domain structure to the described type L semaphorins according to the invention, but are truncated by comparison with the latter where appropriate. For example, splicing variants wholly or partly lacking the transmembrane domain may be formed. A semaphorin derivative which contains an incomplete, or no, transmembrane domain, but contains a signal peptide, may be secreted and in this way have effects outside the cell, locally or else over relatively large distances, for example on other cells. Another splicing variant may, for example, no longer contain a sequence which codes for a signal peptide and, where appropriate, also no sequence which codes for a hydrophobic amino acid sequence representing a potential transmembrane domain. One consequence would be that this semaphorin derivative is neither incorporated into the membrane nor secreted (unless through secretory vesicles). Such a semaphorin derivative may be involved in intracellular processes, for example in signal transduction processes. It is possible in this way for a wide variety of intra- and extracellular processes to be controlled and/or harmonized with the same basic molecule (type L semaphorins) and the derivatives derived therefrom (for example splicing variants).
  • [0044]
    A particular embodiment of the invention relates to semaphorin derivatives which are derived from the type L semaphorins according to the invention but which contain an incomplete, or no, transmembrane domain.
  • [0045]
    Another embodiment of the invention relates to semaphorin derivatives which are derived from the type L semaphorins according to the invention but which contain no signal peptide.
  • [0046]
    The signal peptide may also undergo post-translational elimination. This forms a membrane-bound (with TM domain) or a secreted (splicing variant without TM domain) semaphorin derivative with truncated domain structure. A semaphorin derivative which has undergone post-translational processing in this way now contains only Sema domain, Ig domain and, where appropriate, transmembrane domain. A signal peptide cleavage site can be located, for example, right at the end of the signal peptide, but it may, for example, be located 40 to 50 amino acids or more away from the amino terminus.
  • [0047]
    A “truncated” (i.e. containing fewer domains) semaphorin L derivative can be distinguished from other semaphorins which are not derived from type L semaphorins in that there is a very great (>90%) amino acid identity or an identical amino acid sequence with the type L semaphorins in the domains which are present.
  • [0048]
    The semaphorins according to the invention may also have undergone post-translational modification in other ways. For example, they may be glycosylated (N- and/or O-glycosylated) once, twice, three, four, five, six, seven, eight, nine, ten or more times. The amino acid sequences of the semaphorins may then have an equal number of or more consensus sequences for potential glycosylation sites, preferably five such sites. One embodiment of the invention relates to semaphorins in which the glycosylation sites are located at positions which correspond to positions 105, 157, 258, 330 and 602 of the H-SemaL amino acid sequence (Table 4).
  • [0049]
    In addition, the semaphorins may be in the form of their phosphorylated derivatives. Semaphorins may be the substrates of various kinases, for example the amino acid sequences may have consensus sequences for protein kinase C, tyrosine kinase and/or creatine kinases. In addition, the amino acid sequences of the semaphorins may have consensus sequences for potential myristylation sites. Corresponding semaphorin derivatives may be esterified with myristic acid at these sites.
  • [0050]
    The type L semaphorins according to the invention and their derivatives may be in the form of monomers, dimers and/or multimers, for example two or more semaphorins or their derivatives can be linked together by intermolecular disulfide bridges. It is also possible for intramolecular disulfide bridges to be formed.
  • [0051]
    Further derivatives of the semaphorins according to the invention are fusion proteins. A fusion protein of this type contains, on the one hand, a type L semaphorin or parts thereof and, in addition, another peptide or protein or a part thereof. Peptides or proteins or parts thereof may be, for example, epitope tags (for example His tag (6×histidine), Myc tag, flu tag) which can be used, for example, for purifying the fusion proteins, or those which can be used for labeling the fusion proteins, for example GFP (green fluorescent protein). Examples of derivatives of the type L semaphorins are given for example by the constructs described in the examples. The sequences of these constructs can be found in Tables 7 to 15, where appropriate taking account of the annotations relating to the plasmids.
  • [0052]
    The invention further relates to nucleic acid sequences, preferably DNA and RNA sequences, which code for the type L semaphorins according to the invention and/or their derivatives, for example the corresponding genes, the various splicing variants of the mRNA, the cDNAs corresponding thereto, and derivatives thereof, for example salts of the DNA or RNA. Derivatives for the purpose of the inventions are sequences or parts thereof which have been modified, for example, by methods of molecular biology and adapted to the particular requirements, for example truncated genes or parts of genes (for example promoter sequences, terminator sequences), cDNAs or chimeras thereof, constructs for expression and cloning and salts thereof.
  • [0053]
    One embodiment relates to the genomic sequences (genes) of the type L semaphorins. The invention relates to the intron and exon sequences and gene-regulatory sequences, for example promoter, enhancer and silencer sequences.
  • [0054]
    This embodiment relates on the one hand to the gene of H-SemaL or its derivatives. The invention relates on the one hand to a gene which comprises the nucleotide sequence given in Table 14. The invention further relates to the gene which comprises the nucleotide sequence which is deposited in the GenBank® databank under accession number AF030697.
  • [0055]
    This embodiment further relates to the gene of M-SemaL and its derivatives.
  • [0056]
    The invention further relates to the cDNA of H-SemaL or its derivatives (for example parts of the cDNA). A particular embodiment is the cDNA of H-SemaL according to the nucleotide sequence in Table 2. The invention further relates to the cDNA of H-SemaL which is deposited in the GenBank® databank under accession number AF030698. The invention also relates to the mRNAs corresponding to these cDNAs, or parts thereof.
  • [0057]
    The invention further relates to the cDNA of M-SemaL or its derivatives (for example parts of the cDNA). A particular embodiment is the partial cDNA sequence of M-SemaL shown in Table 3, and cDNA sequences which comprise this partial cDNA sequence. Another embodiment of the invention relates to the cDNA of M-SemaL which is deposited in the GenBank databank under accession number AF030699. The invention also relates to the mRNAs corresponding to these cDNAs, or parts thereof.
  • [0058]
    The invention also comprises alleles and/or individual expression forms of the genes/mRNAs/cDNAs which differ only slightly from the semaphorin sequences described herein and code for an identical or only slightly modified protein (difference in the amino acid sequence less than or equal to 10%) (further example of derivatives). Further examples of the derivatives are given by the constructs indicated in the examples. The sequences of these constructs are depicted in Tables 7 to 14 and can be interpreted taking account of the annotation for plasmids.
  • [0059]
    The invention further relates to plasmids which comprise DNA which codes for the type L semaphorins or derivatives thereof. Plasmids of this type may be, for example, plasmids with high replication rates suitable for amplification of the DNA, for example in E. coli.
  • [0060]
    A specific embodiment comprises expression plasmids with which the semaphorins or parts thereof or their derivatives can be expressed in prokaryotic and/or eukaryotic expression systems. Both constitutive expression plasmids and those containing inducible promoters are suitable.
  • [0061]
    The invention also relates to processes for preparing nucleic acids which code for type L semaphorins or derivatives thereof.
  • [0062]
    These nucleic acids, for example DNA or RNA, can be synthesized, for example, by chemical means. In particular, it is possible for these nucleic acids, for example the corresponding genes or cDNAs or parts thereof, to be amplified by PCR using specific primers and suitable starting material as template. (For example cDNA from a suitable tissue or genomic DNA).
  • [0063]
    A specific process for preparing semaphorin L cDNA and the H-SemaL gene is described in the examples.
  • [0064]
    The invention also relates to processes for preparing type L semaphorins. For example, a semaphorin L or a derivative thereof can be prepared by cloning a corresponding nucleic acid sequence which codes for a type L semaphorin or a derivative thereof into an expression vector and using the latter recombinant vector to transform a suitable cell. It is possible to use, for example, prokaryotic or eukaryotic cells. The type L semaphorins or derivatives thereof may also, where appropriate, be prepared by chemical means.
  • [0065]
    In addition, the type L semaphorins and derivatives thereof can be expressed as fusion proteins, for example with proteins or peptides which permit detection of the expressed fusion protein, for example as fusion protein with GFP (green fluorescent protein). The semaphorins may also be expressed as fusion proteins with one, two, three or more epitope tags, for example with Myc and/or His (6×histidine) and/or flu tags. It is correspondingly possible to use or prepare plasmids which comprise DNA sequences which code for these fusion proteins. For example, semaphorin-encoding sequences can be cloned into plasmids which contain DNA sequences which code for GFP and/or epitope tags, for example Myc tag, His tag, flu tag. Specific examples thereof are given by the examples and the sequences listed in the tables, where appropriate with the assistance of the annotation relating to the plasmids.
  • [0066]
    The invention further relates to antibodies which specifically bind or recognize the type L semaphorins, derivatives thereof or parts thereof. Possible examples thereof are polyclonal or monoclonal antibodies which can be produced, for example, in mouse, rabbit, goat, sheep, chicken etc.
  • [0067]
    A particular embodiment of this subject-matter of the invention comprises antibodies directed against the epitopes which correspond to the amino acid sequences from position 179 to 378 or 480 to 666 of the H-SemaL sequence shown in Table 4. The invention also relates to a process for preparing specific anti-semaphorin L antibodies, using for the preparation antigens comprising said epitopes.
  • [0068]
    The invention also relates to processes for preparing the antibodies, preferably using for this purpose a fusion protein consisting of a characteristic semaphorin epitope and an epitope tag which can be used for the subsequent purification of the recombinant fusion protein. The purified fusion protein can subsequently be used for the immunization. To prepare the recombinant fusion protein, a corresponding recombinant expression vector is prepared and used to transform a suitable cell. The recombinant fusion protein can be isolated from this cell. The procedure can be, for example, like that described in Example 8.
  • [0069]
    These antibodies can be used, for example, for purifying the corresponding semaphorins, for example H-SemaL and its derivatives, for example on affinity columns, or for the immunological detection of the proteins, for example in an ELISA, in a Western blot and/or in immunohistochemistry. The antibodies can also be used to analyze the expression of H-SemaL, for example in various cell types or cell lines.
  • [0070]
    The cDNA of H-SemaL has a length of 2636 nucleotides (Table 2). The gene product of the H-SemaL cDNA has a length of about 666 amino acids (Table 4) and displays the typical domain structure of a type L semaphorin. The gene product has an N-terminal signal peptide (amino acids 1 to 44), Sema domain (amino acid 45 to approximately amino acid 545), and Ig (immunoglobulin) domain (approximately amino acids 550 to 620) and, at the C-terminal end, a hydrophobic amino acid sequence which represents a potential transmembrane domain. This domain structure has never previously been described for semaphorins. It relates to a membrane-associated glycoprotein which is probably located on the cell surface and belongs to a new subgroup. On the basis of this previously unknown domain structure, the semaphorins can now be divided into VI subgroups:
  • [0071]
    I Secreted, without other domains (for example ORF-A49)
  • [0072]
    II Ig Secreted (without transmembrane domain) (for example AHV-Sema)
  • [0073]
    III Ig, TM, CP Membrane-anchored with cytoplasmic sequence (for example CD100)
  • [0074]
    IV Ig, (P), HPC Secreted with hydrophilic C terminus (for example H-Sema-III, M-SemaD, collapsin-1)
  • [0075]
    V Ig, TM, CP Membrane-anchored with C-terminal 7 thrombospondin motif (for example M-SemaF and G)
  • [0076]
    VI Ig, TM Membrane-anchored (for example H-SemaL, M-SemaL)
  • [0077]
    The unglycosylated, unprocessed form of H-SemaL has a calculated molecular weight of about 74.8 kd (74823 dalton) (calculated using Peptide-Sort, GCG program package). The isoelectric point is calculated to be pH=7.56.
  • [0078]
    A possible signal peptide cleavage site is located between amino acids 44 and 45 (Table 3; calculated with SignalP (http.//www.cbs.dtu.dk/services/Signal P), a program based on neural networks for analyzing signal sequences {Nielsen H. et. al. (1997) Protein Engineering 10:1-6}). This gives for the processed protein (without signal peptide) a molecular weight (MW) of 70.3 kd (70323 dalton) and an isoelectric point of pH=7.01.
  • [0079]
    The genomic structure is likewise substantially elucidated. The H-SemaL gene has 13 or 15 or more exons, preferably 14 exons, and 12 or 14 introns, preferably 13 introns. Because of this complex exon-intron structure, various splicing variants are possible. The mRNA of the transcribed H-SemaL gene is found in the Northern blot particularly in placenta, gonads, thymus and spleen. No mRNA has been detected in neuronal tissue or in muscle tissue. There is evidence of specifically regulated expression in endothelial cells.
  • [0080]
    Alternative splicing may also result in forms of H-SemaL with intracytoplasmic sequences which are involved in intracellular signal transduction, similar to, for example, CD100. It would likewise be possible for alternative splicing to result in secreted forms of H-SemaL, analogous to viral AHV-Sema.
  • [0081]
    Nucleotide and amino acid sequence analyses were performed with the aid of the GCG program package (Genetics Computer Group (1991) Program manual for the GCG package, Version 7, 575 Science Drive, Wisconsin, USA 53711), FASTA (Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85, 2444-2448) and BLAST program (Gish and States (1993) Nat. Genet.3, 266-272; Altschul et al. (1990) J. Mol. Biol. 215, 403410). These programs were also used for sequence comparisons with GenBank (Version 102.0) and Swiss Prot (Version 34.0).
  • [0082]
    Post-translational modifications such as glycosylation and myristylation of H-SemaL are likewise possible. Consensus sequences for N-glycosylation sites were found with the aid of the Prosite program (GCG program package) at positions 105, 157, 258, 330 and 602 of the amino acid sequence of H-SemaL (shown in Table 4), and those for myristylation were found at positions 114, 139, 271, 498, 499, 502 and 654 (consensus sequence: G˜(E, D, R, K, H, P, F, Y, W)×(S, T, A, G, C, N)˜(P)). In addition, the amino acid sequence of H-SemaL contains several consensus sequences for potential phosphorylation sites for various kinases. It can therefore be assumed that H-SemaL can be the substrate of various kinases, for example phosphorylation sites for creatine kinase 2, protein kinase C and tyrosine kinase.
  • [0083]
    Predicted creatine kinase 2 phosphorylation sites (consensus sequence Ck2: (S,T)×2(D,E)) (Prosite, GCG) at positions 119, 131, 173, 338, 419 and 481 of the amino acid sequence.
  • [0084]
    Predicted protein kinase C phosphorylation sites (consensus sequence PkC: (S,T)×(R,K)) (Prosite, GCG) at positions 107, 115, 190, 296, 350, 431, 524 and 576 of the amino acid sequence.
  • [0085]
    Predicted tyrosine kinase phosphorylation site (consensus sequence: (R,K)×{2,3}(D,E)×{2,3}Y) (Prosite, GCG) at position 205 of the amino acid sequence.
  • [0086]
    The consensus sequences are indicated in the single letter code for amino acids.
  • [0087]
    An “RGD” motif (arginine-glycine-aspartic acid) characteristic of integrins is located at position 267.
  • [0088]
    The glycosylation sites are highly conserved between viral AHV-Sema, H-SemaL and (as far as is known) M-SemaL.
  • [0089]
    Di- or multimerization of H-SemaL is possible and has been described for other semaphorins such as CD100 {Hall et al. (1996)}. The CD100 molecule is likewise a membrane-anchored glycoprotein dimer of 150 kd. However, CD100 is not closely related to the human semaphorin (H-SemaL) according to the invention.
  • [0090]
    The partial cDNA sequence of M-SemaL has a length of 1195 nucleotides. This sequence codes for a protein having 394 amino acids. These 394 amino acids correspond to amino acids 1 to 396 of H-SemaL. The signal peptide in M-SemaL extends over amino acids 1 to 44 (exactly as in H-SemaL). The Sema domain starts at amino acid 45 and extends up to the end or probably beyond the end of the sequence shown in Table 4.
  • [0091]
    Multiple alignments were carried out using the Clustal W program (Thompson et al. (1994)). These alignments were processed further manually using SEAVIEW (Galtier et al. (1996) Comput. Appl. Biosci 12, 543-548). The phylogenetic distances were determined using Clustal W (Thompson et al. (1994)).
  • [0092]
    Comparison of the protein sequences of the known and of the novel semaphorins and phylogenetic analysis of these sequences shows that the genes can be categorized according to their phylogenetic relationship. The C-terminal domain structure of the corresponding semaphorin subtypes is, of course, involved in this as a factor deciding why semaphorins in the same subgroups are, as a rule, also more closely related phylogenetically than are semaphorins in different subgroups. The species from which the semaphorin was isolated also has an influence, i.e. whether the corresponding species are phylogenetically closely related to one another or not.
  • [0093]
    A phylogenetic analysis (compare FIG. 3) of the known semaphorin amino acid sequences (complete sequences and/or part-sequences, using the amino acid sequences for H-SemaL and M-SemaL shown in Tables 4 and 5 and for all other sequences the sequences stored under the accession numbers or the encoded amino acid sequences derived from these sequences) using the CLUSTAL W program {Thompson J. D. et al. (1994) Nucleic Acids Res. 22:4673-4680} shows that the amino acid sequences of H-SemaL and M-SemaL are phylogenetically closely related to one another and form a separate phylogenetic group. H-SemaL and M-SemaL in turn are phylogenetically most closely related to AHV-Sema and Vac-A39. The are distinctly more closely related to one another than to any other previously disclosed semaphorin. The analysis also shows that other semaphorins are also phylogenetically closely related to one another and form separate groups within the semaphorins. For example, the semaphorins which are secreted, for example H-Sema III, -IV, -V and -E belong in one phylogenetic group. Their homologs in other species also belong to this subfamily, whereas the human (transmembrane) CD100 belongs in one phylogenetic group together with the corresponding mouse homolog (M-SemaG2) and with Collapsin-4.
  • [0094]
    In relation to the complete amino acid sequences, the observed homologies within the phylogenetic groups are between about 90% and 80% amino acid identity in relation to very closely related genes such as, for example, H- and M-SemaE or -III/D and somewhat less than 40% in the case of less related genes of the semaphorins. Within the Sema domain, the observed amino acid identity is a few percent higher, and, owing to its great contribution to the total protein (50-80% of the protein belong to the Sema domain) of the amino acid sequence, this considerably influences the overall identity.
  • [0095]
    H-SemaL is, calculated for the complete protein, 46% identical with AHV-Sema, but if the Sema domain is considered on its own, then the amino acid identity is 53%. This is higher than, for example, between the related M-Sema-B and -C (37% identity in relation to the complete protein, 43% identity in relation to the Sema domain), similar to M-SemaA and -E (43% complete protein, 53% Sema domain). The amino acid identity between the partial M-SemaL sequence (Table 6) and H-SemaL (Table 5) in the region of the Sema domain is 93% so that it can be assumed that the correspondingly homologous mouse gene is involved.
  • [0096]
    Semaphorins corresponding to H-SemaL and M-SemaL in other species may have an amino acid identity within the Sema domain of more than 40% in relation to H-SemaL. In closely related vertebrates (mammals, birds) amino acid identities above 70% may even be found.
  • [0097]
    The semaphorins belong to a new subfamily with greater amino acid identity to the viral AHV-Sema than to the previously disclosed human and murine semaphorins, and with a C-terminal structure not previously disclosed for human semaphorins. These novel semaphorins (members of the subfamily) are distinguished by belonging, because of their domain structure, to subgroup IV and/or to the same phylogenetic group as H-SemaL and M-SemaL and/or have, in relation to the complete amino acid sequence, an amino acid identity of at least 30 to 40%, preferably 50 to 60%, particularly preferably 70 to 80%, or a greater identity, to H-SemaL and/or have, in relation to the Sema domain, an amino acid identity of at least 70%, preferably greater than 80%, particularly preferably greater than 90%, to H-SemaL.
  • [0098]
    The type L semaphorins also have a different type of biochemical function. One novel function of these semaphorins is modulation of the immune system.
  • [0099]
    The closest relative of H-SemaL is the viral AHV semaphorin (AHV-Sema). The latter has a similar size but, in contrast to H-SemaL, has no transmembrane domain. AHV-Sema is presumably secreted by virus-infected cells in order to block the H-SemaL equivalent receptor (type L semaphorin in the blue wildebeest) in the natural host (blue wildebeest) and thus elude the attack of the immune system. It is also conceivable that there is a function as repulsive agent (chemorepellant) for cells of the immune system.
  • [0100]
    The biochemical function of the novel type L semaphorins and derivatives thereof is to be regarded as generally immunomodulating and/or inflammation-modulating. They are able on the one hand
  • [0101]
    A) as molecules inhibiting the immune response to display their effect as chemorepellant and/or immunosuppressant either locally, for example as transmembrane protein on the surface of cells, or else over larger distances, for example if they are secreted due to processing (for example proteases) or alternative splicing, for example by diffusion in the tissue.
  • [0102]
     For example, expression of these novel type L semaphorins for example on the surface of the cells of the vascular endothelium can prevent leukocyte attachment and migration thereof through the vessel wall. The novel semaphorins may play a part in maintenance of barrier effects, for example to prevent infections in particularly “important” or exposed organs, for example to maintain the blood-brain barrier, the placental circulation and/or other immunologically privileged locations (for example pancreatic islets) and/or in prevention of autoimmune diseases. In addition, the novel semaphorins and/or their derivatives may also be involved in repulsive signals in various tissues, for example for cells of the immune system (for example leukocytes) to prevent inadvertent activation of defense mechanisms.
  • [0103]
    B) In addition, the novel semaphorins and/or derivatives thereof may have functions as accessory molecules. Expressed on the cell surface, they may, for example, be involved in the interaction with cells of the immune system as part of the activation of defense mechanisms, for example in cases of virus infection.
  • [0104]
    This reveals several possible uses of the novel type L semaphorins and derivatives thereof, and the nucleic acids coding for these proteins.
  • [0105]
    Function A): This comprises an immunosuppressant and/or anti-inflammatory principle: there are numerous potential possibilities of use in the areas of organ transplantation, therapy of inflammations, immunotherapy and gene therapy.
  • [0106]
    For example, nonhuman, transgenic animals can be produced with the aid of the semaphorin-encoding DNA or derivatives thereof.
  • [0107]
    One possible use of these animals is in the inhibition of transplant rejection in transgenic models of organ transplantations. For example, transgenic animal organs protected against rejection can be produced for xenotransplantations. This ought to be possible for example also together with other transgenes (for example complement regulators such as DAF or CD59). Another use is in the production of nonhuman knock-out animals, for example knock-out mice (“Laboratory Protocols for Gene-Targeting”, Torres and Kühn (1997) Oxford University Press, ISBN 0-19-963677-X): It is possible by knocking out the mouse M-SemaL gene for example to find other functions of the gene. They also represent potential model systems for inflammatory diseases if the mice can survive without semaphorin gene. If M-SemaL is important for immunomodulation, a plurality of such mice is to be expected. In addition, nonhuman knock-in animals, for example mice, can be produced. This entails, for example, replacing M-SemaL by normal/modified H-SemaL or modified M-SemaL (for example integration of the novel semaphorin subtypes under the control of constitutive and/or inducible promoters). Animals of this type can be used, for example, for looking for further functions of the novel semaphorins, for example functions of the human gene or derivatives of these genes, or be used for identifying and characterizing immunomodulating agents.
  • [0108]
    Use of, for example, nucleic acids which code for type L semaphorins or derivatives thereof for producing, for example, recombinant immunosuppressants, other soluble proteins or peptides derived from the amino acid sequence of type L semaphorins, for example from H-SemaL or the corresponding nucleic acids, for example genes. It is also possible in a similar way to produce agonists with structural similarity. These immunosuppressant agents or agonists may be used for autoimmune diseases and inflammatory disorders and/or organ transplantations too.
  • [0109]
    Gene therapy with type L semaphorins, for example with nucleic acids which code for H-SemaL or derivatives thereof, for example using viral or nonviral methods. Use in autoimmune diseases and inflammatory disorders, the transduction of organs and before/during/after transplantations to prevent transplant rejection.
  • [0110]
    It is particularly possible to employ the novel semaphorins and/or the nucleic acids coding for these semaphorins, and derivatives thereof, in particular H-SemaL, DNA coding for H-SemaL, and derivatives thereof, in a method for screening for agents, in particular for identifying and characterizing immunomodulating agents.
  • [0111]
    Function B): H-SemaL is an accessory molecule which is expressed on the cell surface and is involved in the interaction with cells, for example of the immune system, for example as accessory molecule in the activation of signal pathways. A viral gene or the gene product of a viral or other pathogenic gene, for example of microbiological origin, might act, for example, as competitive inhibitor of this accessory molecule. One use of the novel semaphorins with this function is likewise in the area of organ transplantation, therapy of inflammation, immunotherapy and/or gene therapy.
  • [0112]
    For example, the novel semaphorins can be used in a method for screening for antagonistic agents or inhibitors. Agents identified in this way can then be employed, for example, for blocking the semaphorin receptor. Soluble and/or secreted H-SemaL antagonists or inhibitors may be, for example, chemical substances or the novel semaphorins or derivatives thereof themselves (for example parts/truncated forms thereof, for example without membrane domain or as Ig fusion proteins or peptides derived from the latter, which are suitable for blocking the corresponding receptor). Specific antagonists and/or inhibitors identified in this way may, for example, have competitive effects and be employed for inhibiting rejection, for example in transgenic models of organ transplantations and for autoimmune diseases, inflammatory disorders and organ transplantations. Nucleic acids, for example DNA, which code for the novel semaphorins, or derivatives thereof produced with the aid of methods of molecular biology, may be used, for example, for producing nonhuman transgenic animals. Overexpression of H-SemaL in these transgenic animals may lead to increased susceptibility to autoimmune diseases and/or inflammatory disorders. Such transgenic animals are thus suitable for screening for novel specific immunomodulating agents.
  • [0113]
    Such nucleic acids can likewise be used to produce nonhuman knock-out animals, for example knock-out mice in which the mouse M-SemaL gene is switched off. Such knock-out animals can be employed to search for further biochemical functions of the gene. They also represent potential model systems for inflammatory disorders if the mice are able to survive without the M-SemaL gene.
  • [0114]
    This DNA can likewise be used to produce nonhuman knock-in animals, for example mice. This entails the M-SemaL gene being replaced by a modified M-SemaL gene/cDNA or an optionally modified, for example mutated, type L semaphorin gene/cDNA of another species, for example H-SemaL. Such transgenic animals can be used to look for further functions of the semaphorins according to the invention.
  • [0115]
    The invention also relates to the use of the type L semaphorins and derivatives thereof, and of the nucleic acids coding for these proteins, for example genes/cDNAs and derivatives thereof and/or agents identified with the aid of these semaphorins for producing pharmaceuticals. It is possible, for example, to produce pharmaceuticals which can be used in gene therapy and which comprise agonists and/or antagonists of the expression of the type L semaphorins, for example of H-SemaL. It is possible to use for this purpose, for example, viral and/or nonviral methods. These pharmaceuticals can be employed, for example, for autoimmune diseases and inflammatory disorders, organ transplantations before and/or during and/or after the transplantation to prevent rejection.
  • [0116]
    The nucleic acids coding for the novel semaphorins, for example genes, cDNAs and derivatives thereof, can also be employed as aids in molecular biology.
  • [0117]
    In addition, the novel semaphorins, especially H-SemaL and nucleic acids, for example genes/cDNAs thereof can be employed in methods for screening for novel agents. Modified proteins and/or peptides derived, for example, from H-SemaL and/or M-SemaL can be used to look for the corresponding receptor and/or its antagonists or agonist in functional assays, for example using expression constructs of H-SemaL and homologs.
  • [0118]
    The invention also relates to the use of a type L semaphorin or a nucleic acid sequence which codes for a type L semaphorin in a method for identifying pharmacological agents, especially immunomodulating agents.
  • [0119]
    The invention also relates to methods for identifying agents employing a type L semaphorin or a derivative thereof or a nucleic acid sequence which codes for a type L semaphorin, or a derivative thereof, in order to identify pharmacological agents, for example immunomodulating agents. The invention relates, for example, to a method in which a type L semaphorin is incubated under defined conditions with an agent to be investigated and, in parallel, a second batch is carried out without the agent to be investigated but under conditions which are otherwise the same, and then the inhibiting or activating effect of the agent to be investigated is determined.
  • [0120]
    The invention also relates, for example, to methods for identifying agents where a nucleic acid sequence which codes for a type L semaphorin or a derivative thereof is expressed under defined conditions in the presence of an agent to be investigated, and the extent of the expression is determined. It is also possible, where appropriate, in such a method to carry out two or more batches in parallel under the same conditions but with the batches containing different amounts of the agent to be investigated.
  • [0121]
    For example, the agent to be investigated may inhibit or activate transcription and/or translation.
  • [0122]
    The type L semaphorin can, like its viral homologs, bind to the newly described receptor molecule VESPR (Comeau et al, (1998) Immunity, Vol. 8, 473-482) and in monocytes can presumably cause induction of cell adhesion molecules such as ICAM-1 and cytokines such as interleukin-6 and interleukin-8. This may lead to activation thereof and to cell aggregation. The expression pattern of the VESPR receptor shows some interesting parallels with H-SemaL, for example strong expression in placenta and pronounced expression in spleen tissue. Interactions with other as yet unknown receptors of the plexin family or other receptors are possible. It may also interact with itself or other semaphorin-like molecules. Interaction of the type L semaphorins may take place in particular via a conserved domain in the C-terminal region of the Sema domain.
  • [0123]
    Concerning the Annotation on Plasmids:
  • [0124]
    pMelBacA-H-SemaL (6622 bp) in pMelBacA (Invitrogen, De Schelp, NL) (SEQ ID NO.42). Nucleotide 96-98 ATG—start codon, nucleotide 96-168 mellitin signal sequence, nucleotide 168-173 BamHI cleavage site (PCR/cloning), nucleotide 171-1998 reading frame SEMA-L amino acids 42-649 (without own signal sequence and without transmembrane sequence), nucleotide 1993-1998 EcoRI cleavage site (PCR/cloning) and nucleotide 1992-1994 stop codon.
  • [0125]
    Plasmid pCDNA3.1-H-SemaL-MychisA (7475 bp) (SEQ ID NO. 35): nucleotide 954-959 BamHI cleavage site (cloning), nucleotide 968-970 ATG SEMAL, nucleotide 968-2965 reading frame SEMAL, nucleotide 2963-2968 Pml I cleavage site, nucleotide 2969-2974 HindIII cleavage site, nucleotide 2981-3013 Myc tag, nucleotide 3026-3033 6×His tag, nucleotide 3034-3036 stop codon,
  • [0126]
    Plasmid pCDNA3.1-H-SemaL-EGFP-MychisA (8192 bp):(SEQ ID NO. 36): nucleotide 954-959 BamHI cleavage site (cloning), nucleotide 968-970 ATG SEMA-L, nucleotide 968-2965 reading frame SEMA-L, nucleotide 2963-2965 half Pml I cleavage site, nucleotide 2966-3682 reading frame EGFP (cloned in Pml I), nucleotide 3683-3685 half Pml I cleavage site, nucleotide 3685-3691 HindIII, nucleotide 3698-3730 Myc tag, nucleotide 3743-3760 6×His tag, and nucleotide 3761-3763 stop codon.
  • [0127]
    Plasmid pIND-H-SemaL-EA (7108 bp) in vector pIND (Invitrogen, De Schelp, NL) (SEQ ID No. 38): nucleotide 533-538 BamHI cleavage site (cloning), nucleotide 546-548 ATG SEMA-L, nucleotide 546—reading frame SEMA-L, nucleotide 2542-2547 Pml I cleavage site, nucleotide 2548-2553 HindIII cleavage site and nucleotide 2563-2565 stop codon.
  • [0128]
    Plasmid pIND-H-SemaL-EE (total length 7102 bp) in vector pIND (Invitrogen, De Schelp, NL) (SEQ ID No. 37): nucleotide 533-538 BamHI cleavage site (cloning), nucleotide 546-548 ATG SEMA-L, nucleotide 546-reading frame SEMA-L, nucleotide 2542-2547 Pml I cleavage site, nucleotide 2548-2553 HindIII cleavage site, nucleotide 2560-2592 Myc tag, nucleotide 2605-2622 6×His tag and nucleotide 2623-2625 stop codon.
  • [0129]
    Plasmid pQE30-H-SemaL-179-378.seq (4019 bp) in vector pQE30 (Qiagen, Hilden) corresponds to pQE30-H-SemaLBH (SEQ ID No. 39): nucleotide 115-117 ATG, nucleotide 127-144 6×His tag, nucleotide 145-750 BamHI-HindIII PCR fragment SEMA-L amino acids (aa) 179-378 and nucleotide 758-760 stop codon.
  • [0130]
    Plasmid pQE31-H-SemaL-(SH (3999 bp) in vector pQE31 (Qiagen, Hilden) (SEQ ID No. 40): nucleotide 115-117 ATG, nucleotide 127-144 6×His tag, nucleotide (147-152 BamHI), nucleotide 159-729 Saci-HindIII fragment SEMA-L (C-terminal) aa480-666 and nucleotide 734-736 stop codon.
  • EXAMPLES
  • [0131]
    Experimental Conditions used in the Examples:
    PCR programs used:
    Taq52-60 (with Ampli-TaqR polymerase, Perkin Elmer,
    Weil der Stadt, Germany)
    96° C./60s  1 cycle
    96° C./15s-52° C./20s-70° C./60s 40 cycles
    70° C./60s  1 cycle
    Taq60-30
    96° C./60s  1 cycle
    96° C./15s-60° C./20s-70° C./30s 35 cycles
    70° C./60s  1 cycle
    Taq60-60
    96° C./60s  1 cycle
    96° C./15s-60° C./20s-70° C./60s 35 cycles
    70° C./60s  1 cycle
    Taq62-40
    96° C./60s  1 cycle
    96° C./15s-62° C./20s-70° C./40s 35 cycles
    70° C./60s  1 cycle
  • [0132]
    Reaction Conditions used for PCR with Taq Polymerase:
  • [0133]
    50μl reaction mixtures with 100-200 ng of template, 200 μM dNTP, 0.2-0.4 μM each primer, 2.5 U of Ampli-TaqR, 5 μl of the 10× reaction buffer supplied
  • [0134]
    Programs used for:
    XL62-6 (with expand-long template PCR SystemR,
    Boehringer Mannheim, Germany)
    94° C./60s  1 cycle
    94° C./15s-62° C./30s-68° C./6 min 10 cycles
    94° C./15s-62° C./30s-68° C./(6 min + 15s/cycle) 25 cycles
    68° C./7 min  1 cycle
    XL62-12 (with expand-long template PCR System
    Boehringer Mannheim, Germany)
    94° C./60s  1 cycle
    94° C./15s-62° C./30s-68° C./12 min 10 cycles
    94° C./15s-62° C./30s-68° C./(12 min + 15s/cycle) 25 cycles
    68° C./7 min  1 cycle
  • [0135]
    Reaction Conditions for PCR with Expand-long Template PCR System
  • [0136]
    50 μl reaction mixtures with 100-200 ng of template, 500 μM dNTP, 0.2-0.4 μM each primer, 0.75 μl of enzyme mix, 5 μl of the 10× reaction buffer No. 2 supplied.
  • Example 1
  • [0137]
    Starting from AHV-Sema sequences (Ensser & Fleckenstein (1995), J. General Virol. 76: 1063-1067), PCRs and RACE-PCRs were carried out. The starting material used for this was human cDNA from placental tissue onto which adaptors had been ligated for the RACE amplification (Marathon™-cDNA Amplification Kit, Clontech Laboratories GmbH, Tullastraβe 4, 69126 Heidelberg, Germany). Firstly specific primers (No.121234+No. 121236, Table 6) were used to amplify a PCR fragment with a length of about 800 bp (base pairs) (PCR program: (Taq60-60)). This was cloned and sequenced (Taq dye-deoxy terminator sequencing kit, Applied Biosystems, Foster City, Calif., USA/Brunnenweg 13, Weil der Stadt). Sequencing of the PCR product revealed a sequence which has a high degree of homology with the DNA sequence of AHV-Sema, identical to the sequence of the two ESTs.
  • [0138]
    A PCR fragment of 600 bp was identified using the primer pair (No. 121237+No. 121239, Table 6). It emerged that they were clones with DNA sequences from the same gene.
  • Example 2
  • [0139]
    The 800 bp PCR fragment from Example 1 was radiolabeled (random priming by the method of {Feinberg (1983) Anal. Biochem. 132:6-13}, with 32P-α-dCTP) and used as probe for a multitissue Northern blot (Human Multiple Tissue Northern Blot II, Clontech, Heidelberg, Germany) which contains mRNA samples from the tissues spleen, thymus, prostate, testes, ovaries, small intestine, large intestine and leukocytes (PBL). This clearly showed expression of an mRNA with a length of about 3.3 kb in spleen and gonads (testes, ovaries), and less strongly in the thymus and intestine. Hybridization of a master blot (dot-blot with RNA from numerous tissues (Human RNA Master Blot™, Clontech)) confirmed this result and also showed strong expression in placental tissue.
  • [0140]
    Hybridization was carried out under stringent conditions (5×SSC, 50 mM Na phosphate pH 6.8, 50% formamide, 100 μg/ml yeast RNA) at 42° C. for 16 hours. The blots were washed stringently (65° C., 0.2×SSC, 0.1% SDS) and exposed to a Fuji BAS2000 Phosphoimager™.
  • Example 3
  • [0141]
    A cDNA library from human spleen, cloned in the bacteriophage Lambda gt10 (Human Spleen 5′ STRETCH PLUS cDNA, Clontech), was screened with this probe, and a lambda clone was identified. The cDNA with a length of 1.6 kb inserted in this clone was amplified by PCR (Expand™ Long Template PCR System, Boehringer Mannheim GmbH, Sandhofer Straβge 116, 68305 Mannheim) using the vector-specific primers No. 207608+No. 207609 (Table 6) (flanking the EcoRI cloning site), and the resulting PCR fragment was sequenced. This clone contained the 5′ end of the cDNA and also extended the known cDNA sequence in the 3′ direction. Starting from the new part-sequences of the cDNA, new primers for the RACE-PCR were developed (No. 232643, No. 232644, No. 233084, Table 6). Together with an improved thermocycler technique (PTC-200 from MJ-Research, Biozym Diagnostik GmbH, 31833 Hess. Oldendort) with distinctly better performance data (heating and cooling rates), a 3′ RACE-PCR product was amplified using the primers No. 232644 and No. 232643 and AP1, and was cloned into the vector pCR2.1 (Invitrogen, De Schelp 12, 9351 NV Leek, The Netherlands). The 3′ RACE-PCR product was sequenced and the 3′ end of the cDNA was identified in this way. A RACE amplification in the 5′ direction (primers No. 131990 and No. 233084 and AP1) extended the 5′ end of the cDNA by a few nucleotides and confirmed the amino terminus of H-SemaL found in the identified lambda clone.
  • Example 4
  • [0142]
    Starting from a short murine EST (Accession No. AA260340) and a primer derived therefrom, No. 260813 (Table 6) and the H-SemaL specific primer No. 121234 (Table 6), PCR (conditions: Taq52-60) was used to amplify a DNA fragment with a length of about 840 bp of murine cDNA, followed by cloning into the vector pCR2.1. The gene containing this DNA fragment was called M-SemaL. The resulting M-SemaL DNA fragment was used to investigate a cDNA bank from mouse spleen (Mouse Spleen 5′ STRETCH cDNA, Clontech), identification of several clones being possible.
  • [0143]
    PCR (Taq60-30) with the primers No. 260812 and No. 260813 from murine endothelial cDNA provided a PCR fragment with a length of 244 base pairs. The PCR results showed that there is distinct baseline expression in murine endothelial cells which declines after stimulation with the cytokine interferon-γ and lipopolysaccharides.
  • Example 5
  • [0144]
    Investigations on the location in the chromosome were carried out by fluorescence in situ hybridization (FISH). For this purpose, human and murine metaphase chromosomes were prepared starting from a human blood sample and the mouse cell line BINE 4.8 (Keyna et al. (1995) J. Immunol. 155, 5536-5542), respectively (Kraus et al. (1994) Genomics 23, 272-274). The slides were treated with RNase and pepsin (Liehr et al. (1995) Appl. Cytogenetics 21, 185-188). For the hybridization, 120 mg of human nick-translated semaphorin sample and 200 mg of a corresponding mouse sample were used. The hybridization was in each case carried out in the presence of 4.0 μg of COT1-DNA and 20 μg of STD at 37° C. (3 days) in a moistened chamber.
  • [0145]
    The slides were washed with 50% formamide/2×SSC (3 times for 5 min each time at 45° C.) and then with 2×SSC (3 times for 5 min each time at 37° C.), and the biotinylated sample was detected using the FITC-avidin system (Liehr et al. (1995)). The slides were evaluated using a fluorescence microscope. 25 metaphases/sample were evaluated, carrying out each experiment in duplicate. It emerged that H-SemaL is located on chromosome 15q23. Located adjacent in the chromosome is the locus for Bardet-Biedls syndrome and Tay-Sachs disease (hexosaminidase A).
  • Example 6
  • [0146]
    The genomic intron-exon structure of the H-SemaL gene is for the most part elucidated.
  • [0147]
    Genomic DNA fragments were amplified starting from 250 mg of human genomic DNA which had been isolated from PHA-stimulated peripheral lymphocytes (blood). Shorter fragments were amplified using Ampli TaqR (Perkin Elmer), and longer fragments were amplified using the expanded long template PCR SystemR (Boehringer Mannheim).
  • [0148]
    It has been possible by PCR amplification to date to clone and characterize almost the complete genomic locus of H-SemaL. It has already been possible in total to determine more than 8888 bp of the genomic sequence and thus substantially to elucidate the intron-exon structure of the gene.
  • Example 7
  • [0149]
    Expression Clonings:
  • [0150]
    Since no complete clone of the semaphorin gene could be isolated from the lambda-gt10 cDNA bank, and no complete clone was obtainable by PCR either, the coding region of the cDNA was amplified in 2 overlapping subfragments by PCR (XL62-6) using the primers No. 240655 and No. 121339 for the N-terminal DNA fragment, and the primers No. 240656 (contains HindIII and Pmel cleavage sites) and No. 121234 for the C-terminal DNA fragment. The resulting DNA fragments (subfragments) were cloned into the vector pCR21. The two subfragments were completely sequenced and finally the complete H-SemaL cDNA was prepared by inserting a 0.6 kb C-terminal SstI-HindIII restriction fragment into the plasmid which contained the N-terminal DNA fragment and had been cut with the restriction enzymes SstI and HindIII. From this plasmid pCR2.1-H-SemaL (sequence shown in Table 7, SEQ ID NO. 34), the complete gene was cut out using the EcoRI cleavage site (in pCR2.1) and HindIII cleavage site (in primer No. 240656, Table 6) and ligated into a correspondingly cut constitutive expression vector pCDNA3.1 (−)MycHisA (Invitrogen). The EcoRI-ApaI fragment (without Myc-His tag) was cut out of the resulting recombinant plasmid pCDNA3.1(−)H-SemaL-MycHisA (sequence shown in Table 8) and ligated into the inducible vector pIND (Ecdysone-Inducible Mammalian Expression System, Invitrogen) which had previously likewise been cut with EcoRI-ApaI. The recombinant plasmid was called pIND-H-SemaLEA (sequence shown in Table 11). An EcoRI-Pmel fragment (with Myc-His tag) from pCDNA3.1(−)H-SemaL-Myc-HisA (sequence shown in Table 9) was inserted into an EcoRI-EcoRV-cut vector pIND. The recombinant plasmid was called pIND-H-SemaL-EE (sequence shown in Table 10).
  • [0151]
    A fusion gene of H-SemaL with enhanced green fluorescent protein (EGFP) was prepared by ligating the PCR-amplified EGFP reading frame (from the vector pEGFP-C1 (Clontech), using the primers No. 243068+No. 243069, Taq52-60) into the Pmel cleavage site of the plasmid pCDNA3.1(−)H-SemaL-MycHisA, resulting in the plasmid pCDNA3.1 (−)H-SemaL-EGFP-MycHisA (sequence shown in Table 9).
  • [0152]
    Small letters in Tables 7 to 13 and Table 15 denote the sequence of H-SemaL, parts or derivatives thereof, and large letters denote the sequence of the plasmid.
  • Example 8
  • [0153]
    To prepare H-SemaL-specific antibodies, cDNA fragments of H-SemaL were integrated into prokaryotic expression vectors and expressed in E. coli, and the semaphorin derivatives were purified. The semaphorin derivatives were expressed as fusion proteins with a His tag. Accordingly, vectors containing the sequence for a His tag and permitting integration of the semaphorin cDNA fragment into the reading frame were used. An N-terminal 6×histidine tag makes it possible, for example, to purify by nickel chelate affinity chromatography (Qiagen GmbH, Max-Volmer Straβe 4, 40724 Hilden):
  • [0154]
    1. The part of the H-SemaL cDNA coding for amino acids 179-378 was amplified by PCR using the primers No. 150788 and No. 150789, and this DNA fragment was ligated into the vector pQE30 (Qiagen) which had previously been cut with the restriction enzymes BamHI and HindIII (construct pQE30-H-SemaL-BH (sequence shown in Table 12)).
  • [0155]
    2. The section of the H-SemaL cDNA coding for the C-terminal amino acids 480-666 was cut with the restriction enzymes SstI and HindIII out of the plasmid pCR 2.1 and ligated into the vector pQE31 (Qiagen) which had previously been cut with SstI and HindIII (construct pQE31-H-SemaL-SH (sequence shown in Table 13)).
  • [0156]
    Correct integration of the sequences in the correct reading frame was checked by DNA sequencing. The fusion proteins consisting of an N-terminal 6×histidine tag and a part of the semaphorin H-SemaL were purified by Ni2+ affinity chromatography. The purified fusion proteins were used to immunize various animals (rabbit, chicken, mouse).
  • Example 9
  • [0157]
    FACS Analysis of Various Cell Types (FIGS. 4 and 5)
  • [0158]
    The cells (about 0.2-0.5×106) were washed with FACS buffer (phosphate-buffered saline (PBS) with 5% fetal calf serum (FCS) and 0.1% Na azide) and then incubated with the antisera (on ice) for 1 hour in each case.
  • [0159]
    The primary antibodies used for the control (overlay chicken preimmune serum (1:50)) and for the specific detection (specific staining) comprised an H-SemaL-specific chicken antiserum (1:50). The specific antiserum with antibodies against amino acids (Aa) 179-378 (with N-terminal His tag) of H-SemaL was generated by immunizing chickens with the protein purified by Ni chelate affinity chromatography (as described in Example 8). The second antibody used was an FITC-labeled anti-chicken F(ab′) antibody from rabbits (Dianova Jackson Laboratories, Order No. 303-095-006, Hamburg, Germany) (1 mg/ml). A rabbit anti-mouse IgG, FITC-labeled, was used for the CD100 staining. The second antibody was employed in each case in 1:50 dilution in FACS buffer.
  • [0160]
    The cells were then washed, resuspended in PBS and analyzed in the FACS. The FACS analysis was carried out using a FACS-track instrument (Becton-Dickinson). Principle: a single cell suspension is passed through a measuring channel where the cells are irradiated with laser light of 488 nm and thus fluorescent dyes (FITC) are excited. The measurements are of the light scattered forward (forward scatter, FSC: correlates with the cell size), and to the side (sideward scatter, SSC: correlates with the granular content: different in different cell types) and fluorescence in channel 1 (FL 1) (for wavelengths in the FITC emission range, max. at 530 nm). 10,000 events (cells) were measured in this way each time.
  • [0161]
    The dot plot (FIGS. 4a-k) (figure on the left in each case): FSC against SSC (size against granular content/scatter) with, inside the boundary, the (uniform) cell population of similar size and granular content analyzed in the right-hand window (relevant right-hand figure in each case). The right-hand window shows the intensity of FL 1 (X axis) against the number of events (Y axis), that is to say a frequency distribution.
  • [0162]
    In each of these, the result with the control serum (unfilled curve) is superimposed on the result of the specific staining (filled curve). A shift of the curve for the specific staining to the right compared with the control corresponds to an expression of H-SemaL in the corresponding cells. A larger shift means stronger expression.
  • [0163]
    Cell lines used for FACS analysis:
  • [0164]
    a) U937 cell line
  • [0165]
    American Type Culture Collection ATCC; ATCC number: CRL-1593
  • [0166]
    Name: U-937
  • [0167]
    Tissue: lymphoma; histiocytic; monocyte-like
  • [0168]
    Species: human;
  • [0169]
    Depositor: H. Koren
  • [0170]
    b) THP-1 cell line
  • [0171]
    ATCC number: TIB-202
  • [0172]
    Tissue: monocyte; acute monocytic leukemia
  • [0173]
    Species: human
  • [0174]
    Depositor: S. Tsuchiya
  • [0175]
    c) K-562 cell line
  • [0176]
    ATCC number: CCL-243
  • [0177]
    Tissue: chronic myelogenous leukemia
  • [0178]
    Species: human;
  • [0179]
    Depositor: H. T. Holden
  • [0180]
    d) L-428 cell line
  • [0181]
    DSMZ-Deutsche Sammiung von Mikroorganismen und Zelikulturen GmbH,
  • [0182]
    DSMZ No: ACC 197
  • [0183]
    Cell type: human Hodgkin's lymphoma
  • [0184]
    e) Jurkat cell line
  • [0185]
    DSMZ-Deutsche Sammiung von Mikroorganismen und zellkulturen GmH,
  • [0186]
    DSMZ No: ACC 282
  • [0187]
    Cell type: human T cell leukemia
  • [0188]
    f) Daudi cell line
  • [0189]
    ATCC number: CCL-213
  • [0190]
    Tissue: Burkitt's lymphoma; B lymphoblast; B cells
  • [0191]
    Species: human
  • [0192]
    Depositor: G. Klein
  • [0193]
    g) LCL cell line
  • [0194]
    EBV-transformed lymphoblastoid B-cell line.
  • [0195]
    h) Jiyoye (P-2003) cell line
  • [0196]
    ATCC number: CCL-87
  • [0197]
    Tissue: Burkitt's lymphoma; B cells, B lymphocyte
  • [0198]
    Species: human
  • [0199]
    Depositor: W. Henle
  • [0200]
    i) CBL-Mix57
  • [0201]
    Human T-cell line (isolated from blood) transformed with recombinant H. Saimiri (wild-type without deletion)
  • [0202]
    j) CBL-Mix59
  • [0203]
    Human T-cell line (isolated from blood) transformed with H. Saimiri (deletion of ORF71).
  • Example 10
  • [0204]
    Protein Gel and Western Blot
  • [0205]
    Secretable human SEMA-L (amino acids 42-649 in Table 4 (without signal peptide and without transmembrane domain)) was cloned into the plasmid pMelBac-A (Invitrogen, De Schelp, Leck, The Netherlands, Cv 1950-20) and, in this way, the plasmid pMelBacA-H-SemaL (length 6622 bp) was generated (FIG. 8). The H-SemaL derivative was expressed in the baculovirus system (Bac-N-Blue, Invitrogen). Expression was carried out in the cell lines derived TM from insect egg cells Sf9 (from Spodoptera frugiperda) and High Five™ (from Trichoplusia ni, U.S. Pat. No. 5,300,435, purchased from Invitrogen) by infection with the recombinant, plaque-purified baculoviruses.
  • [0206]
    The expression was carried out in accordance with the manufacturer's instructions.
  • [0207]
    The proteins were then fractionated in a gel, and the H-SemaL derivative was detected in a Western blot. Detection was carried out with H-SemaL-specific chicken antiserum (compare Example 8 and FIG. 7) (dilution 1:100). The specific chicken antibody was detected using anti-IgY-HRP conjugate (dilution: 1:3000, from donkey; Dianova Jackson Laboratories) in accordance with the manufacturer's instructions.
  • Example 11
  • [0208]
    Preparation of pMelBacA-H-SEMAL
  • [0209]
    The recombinant vector (pMelBacA-H-SEMAL, 6622 bp) was prepared by cloning an appropriate DNA fragment which codes for amino acids 42-649 of H-SemaL into the vector pMelBacA (4.8 kb Invitrogen) (compare annotation for pMelBacA-H-SEMAL). The cloning took place via BamHI and EcoRI in frame behind the signal sequence present in the vector (“honeybee melittin signal sequence”). A corresponding H-SemaL DNA fragment was amplified using the primer pair h-sema-1 baculo 5′ and h-sema-1 baculo 3′.
  • [0210]
    Primers for amplification (TaKaRa Ex Ta9 polymerase) and cloning: “h-sema-1 baculo 5′” for amplification without signal sequence and for introducing a BamHI cleavage site 5′-CCGGATCCGCCCAGGGCCACCTAAGGAGCGG-3′ (SEQ ID NO: 43) “h-sema-1 baculo 3′” for amplification without transmembrane domain and for introducing an EcoRI cleavage site 5′-CTGMTTCAGGAGCCAGGGCACAGGCATG-3′ (SEQ ID NO: 44).
  • DETAILED DESCRIPTION OF THE DRAWINGS
  • [0211]
    [0211]FIG. 1:
  • [0212]
    Tissue-specific expression of H-Sema-L
  • [0213]
    A) Multiple tissue Northern blot (Clontech, Heidelberg, Germany). Loadings from left to right: 2 μg in each lane of Poly-A-RNA from spleen, thymus, prostate, testes, ovaries, small intestine, large intestinal mucosa, peripheral (blood) leukocytes. Size standards are marked.
  • [0214]
    The blots were hybridized under stringent conditions with an H-SemaL probe 800 base-pairs long.
  • [0215]
    [0215]FIG. 2:
  • [0216]
    Diagrammatic representation of the cloning of the H-SemaL cDNA and of the genomic organization of the H-SemaL encoding sequences (H-SemaL gene)
  • [0217]
    Top: Location of the EST sequences (accession numbers; location of the EST sequences is shown relative to the AHV-Sema sequence).
  • [0218]
    Below: Amplified PCR and RACE products and the position of the cDNA clones in relation to the location in the complete H-SemaL cDNA and the open reading frame (ORF) for the encoded protein.
  • [0219]
    Bottom: Relative position of the exons in the H-SemaL gene in relation to the genomic sequence. The position of the oligonucleotide primer used is indicated by arrows.
  • [0220]
    [0220]FIG. 3:
  • [0221]
    Phylogenetic tree: Obtained by multiple alignment of the listed semaphorin sequences. The phylogenetic relationship of the semaphorins can be deduced from their grouping in the phylogenetic tree.
  • [0222]
    [0222]FIG. 4:
  • [0223]
    FACS analysis of H-SemaL expression in various cell lines and various cell types (compare Example 8).
  • [0224]
    [0224]FIG. 5:
  • [0225]
    Comparative analysis of CD100 and H-SemaL expression (compare Example 9).
  • [0226]
    [0226]FIG. 6:
  • [0227]
    Expression of secretable human SEMA-L (H-SemaL) in HiFive and Sf3 cells (compare Example 10).
  • [0228]
    Aa 42-649 in pMelBac-A (Invitrogen) in the baculovirus system (Bac-N-Blue, Invitrogen)
  • [0229]
    Detection with specific chicken antiserum (1:100) and anti-IgY-HRP conjugate (1:3000, from rabbits, Jackson Lab.)
  • [0230]
    1,4,6 uninfected HiFive cells (serum-free)
  • [0231]
    2,3,5,7,8 HiFive cells infected with recombinant baculovirus (serum-free)
  • [0232]
    M Rainbow molecular weight marker (Amersham RPN756)
  • [0233]
    9,10 infected Sf9 cells (serum-containing medium).
  • [0234]
    [0234]FIG. 7: Specificity of the antiserum
  • [0235]
    Lanes 1-3: chicken 1; lanes 4-6: chicken 2
  • [0236]
    Lanes 1 and 4: Preimmune serum
  • [0237]
    Lanes 2 and 5: 60th day of immunization
  • [0238]
    Lanes 4 and 6: 105th day of immunization
  • [0239]
    Immunization was carried out with amino acids 179-378 of H-SemaL (with amino-terminal His tag) (compare Example 8, Section 1.)
  • [0240]
    [0240]FIG. 8: Depiction of the plasmid map of pMelBacA-H-SEMAL.
  • [0241]
    The recombinant plasmid was prepared as described in Example 11.
  • TABLES
  • [0242]
    [0242]
    TABLE 1
    Various subtypes of semaphorins from various species
    Name Synonym Species Reference
    H-Sema III (H-SemaD) Human Sec. (Kolodkin et al. 1993)
    CD-100 Human TM, IC; CD45 associated, expressed in T cells (Hall et al. 1996)
    H-Sema V (H-SemaA) Human Sec.; Locus 3p21.3 (Sekido et al. 1996; Roche et al. 1996)
    H-Sema IV (H-Sema3F) Human Sec.; Locus 3p21.3 (Xiang et al. 1996; Sekido et al. 1996)
    H-SemaE Human Sec.; divergent from M-Sema-E at the 3′ end AB000220 (Yamada 1997 unpublished)
    (alignment of reading frame improved)
    H-SemaK KIAA0331 Human Sec.; (Nagase et al. 1997)
    H-SemaL SEMAL Human TM, no IC This application
    M-SemaA Mouse Sec. (Püchel et al. 1995)
    M-SemaB Mouse TM, IC (Püchel et al. 1995)
    M-SemaC Mouse TM, IC (Püchel et al. 1995)
    M-SemaD M-Sema III Mouse Sec. (Messersmith et al. 1995; Püchel et al. 1995)
    M-SemaE Mouse Sec.; 5′ partial sequence (Püchel et al. 1995)
    M-SemaF1 M-SemaF Mouse TM, IC (Inagaki et al. 1996)
    M-SemaG2 M-SemaG Mouse TM, IC; expressed in lymphoid cells, mouse (Furuyama et al. 1996)
    homolog of CD100
    M-SemaF2 M-SemaF Mouse TM, IC; Thrombospondin motif (Adams et al. 1996)
    M-SemaG1 M-SemaG Mouse TM, IC; Thrombospondin motif (Adams et al. 1996)
    M-SemaH Mouse Sec. (Christensen 1996 unpub) Z80941
    M-Sema Via Mouse TM, IC (Zhou et al. 1997)
    M-SemaL Semal Mouse Partial sequence This application
    Collapsin-1 Chicken Sec. (Luo et al. 1993)
    Collapsin-2 Chicken Sec. (Luo et al. 1995)
    Collapsin-3 Chicken Sec. (Luo et al. 1995)
    Collapsin-4 Chicken Partial sequence (Luo et al. 1995)
    Collapsin-5 Chicken Sec. (Luo et al. 1995)
    R-Sema III Rat Sec. (Giger et al. 1996)
    T-Sema I Tribolium TM, IC (Kolodkin et al. 1993)
    confusum
    Ce-Semal C. elegans TM, IC U15667 (Roy 1994 unpublished)
    G-Sema I Fasciclin-IV Grasshopper TM, IC (Kolodkin et al. 1992)
    D-Sema I Drosophila TM, IC (Kolodkin et al. 1993)
    D-Sema II Drosophila Sec. (Kolodkin et al. 1993)
    AHV-Sema AHV-1 Sec. (Ensser and Fleckenstein, 1995)
    ORF-A39 Vaccinia Sec. (Kolodkin et al. 1993)
    ORF-A39 Variola Sec.; (Kolodkin et al. 1993)
    homologous
  • [0243]
    [0243]
    TABLE 2
    cDNA sequence of H-SemaL (2636 nucleotides) (SEQ ID NO.: 1)
    1 cggggccacg ggatgacgcc tcctccgccc ggacgtgccg cccccagcgc
    51 accgcgcgcc cgcgtccctg gcccgccggc tcggttgggg cttccgctgc
    101 ggctgcggct gctgctgctg ctctgggcgg ccgccgcctc cgcccagggc
    151 cacctaagga gcggaccccg catcttcgcc gtctggaaag gccatgtagg
    201 gcaggaccgg gtggactttg gccagactga gccgcacacg gtgcttttcc
    251 acgagccagg cagctcctct gtgtgggtgg gaggacgtgg caaggtctac
    301 ctctttgact tccccgaggg caagaacgca tctgtgcgca cggtgaatat
    351 cggctccaca aaggggtcct gtctggataa gcgggactgc gagaactaca
    401 tcactctcct ggagaggcgg agtgaggggc tgctggcctg tggcaccaac
    451 gcccggcacc ccagctgctg gaacctggtg aatggcactg tggtgccact
    501 tggcgagatg agaggctacg cccccttcag cccggacgag aactccctgg
    551 ttctgtttga aggggacgag gtgtattcca ccatccggaa gcaggaatac
    601 aatgggaaga tccctcggtt ccgccgcatc cggggcgaga gtgagctgta
    651 caccagtgat actgtcatgc agaacccaca gttcatcaaa gccaccatcg
    701 tgcaccaaga ccaggcttac gatgacaaga tctactactt cttccgagag
    751 gacaatcctg acaagaatcc tgaggctcct ctcaatgtgt cccgtgtggc
    801 ccagttgtgc aggggggacc agggtgggga aagttcactg tcagtctcca
    851 agtggaacac ttttctgaaa gccatgctgg tatgcagtga tgctgccacc
    901 aacaagaact tcaacaggct gcaagacgtc ttcctgctcc ctgaccccag
    951 cggccagtgg agggacacca gggtctatgg tgttttctcc aacccctgga
    1001 actactcagc cgtctgtgtg tattccctcg gtgacattga caaggtcttc
    1051 cgtacctcct cactcaaggg ctaccactca agccttccca acccgcggcc
    1101 tggcaagtgc ctcccagacc agcagccgat acccacagag accttccagg
    1151 tggctgaccg tcacccagag gtggcgcaga gggtggagcc catggggcct
    1201 ctgaagacgc cattgttcca ctctaaatac cactaccaga aagtggccgt
    1251 tcaccgcatg caagccagcc acggggagac ctttcatgtg ctttacctaa
    1301 ctacagacag gggcactatc cacaaggtgg tggaaccggg ggagcaggag
    1351 cacagcttcg ccttcaacat catggagatc cagcccttcc gccgcgcggc
    1401 tgccatccag accatgtcgc tggatgctga gcggaggaag ctgtatgtga
    1451 gctcccagtg ggaggtgagc caggtgcccc tggacctgtg tgaggtctat
    1501 ggcgggggct gccacggttg cctcatgtcc cgagacccct actgcggctg
    1551 ggaccagggc cgctgcatct ccatctacag ctccgaacgg tcagtgctgc
    1601 aatccattaa tccagccgag ccacacaagg agtgtcccaa ccccaaacca
    1651 gacaaggccC cactgcagaa ggtttccctg gccccaaact ctcgctacta
    1701 cctgagctgc cccatggaat cccgccacgc cacctactca tggcgccaca
    1751 aggagaacgt ggagcagagc tgcgaacctg gtcaccagag ccccaactgc
    1801 atcctgttca tcgagaacct cacggcgcag cagtacggcc actacttctg
    1851 cgaggcccag gagggctcct acttccgcga ggctcagcac tggcagctgc
    1901 tgcccgagga cggcatcatg gccgagcacc tgctgggtca tgcctgtgcc
    1951 ctggctgcct ccctctggct gggggtgctg cccacactca ctcttggctt
    2001 gctggtccac tagggcctcc cgaggctggg catgcctcag gcttctgcag
    2051 cccagggcac tagaacgtct cacactcaga gccggctggc ccgggagctc
    2101 cttgcctgcc acttcttcca ggggacagaa taacccagtg gaggatgcca
    2151 ggcctggaga cgtccagccg caggcggctg ctgggcccca ggtggcgcac
    2201 ggatggtgag gggctgagaa tgagggcacc gactgtgaag ctggggcatc
    2251 gatgacccaa gactttatct tctggaaaat atttttcaga ctcctcaaac
    2301 ttgactaaat gcagcgatgc tcccagccca agagcccatg ggtcggggag
    2351 tgggtttgga taggagagct gggactccat ctcgaccctg gggctgaggc
    2401 ctgagtcctt ctggactctt ggtacccaca ttgcctcctt cccctccctc
    2451 tctcatggct gggtggctgg tgttcctgaa gacccagggc taccctctgt
    2501 ccagccctgt cctctgcagc tccctctctg gtcctgggtc ccacaggaca
    2551 gccgccttgc atgtttattg aaggatgttt gctttccgga cggaaggacg
    2601 gaaaaagctc tgaaaaaaaa aaaaaaaaaa aaaaaa
  • [0244]
    [0244]
    TABLE 3
    Nucleotide sequence of the cDNA of M-SemaL
    (partial, 1195 nucleotides) (SEQ ID NO.: 2)
    1 cggggctgcg ggatgacgcc tcctcctccc ggacgtgccg cccccagcgc
    51 accgcgcgcc cgcgtcctca gcctgccggc tcggttcggg ctcccgctgc
    101 ggctgcggct tctgctggtg ttctgggtgg ccgccgcctc cgcccaaggc
    151 cactcgagga gcggaccccg catctccgcc gtctggaaag ggcaggacca
    201 tgtggacttt agccagcctg agccacacac cgtgcttttc catgagccgg
    251 gcagcttctc tgtctgggtg ggtggacgtg gcaaggtcta ccacttcaac
    301 ttccccgagg gcaagaatgc ctctgtgcgc acggtgaaca tcggctccac
    351 aaaggggtcc tgtcaggaca aacaggactg tgggaattac atcactcttc
    401 tagaaaggcg gggtaatggg ctgctggtct gtggcaccaa tgcccggaag
    451 cccagctgct ggaacttggt gaatgacagt gtggtgatgt cacttggtga
    501 gatgaaaggc tatgccccct tcagcccgga tgagaactcc ctggttctgt
    551 ttgaaggaga tgaagtgtac tctaccatcc ggaagcagga atacaacggg
    601 aagatccctc ggtttcgacg cattcggggc gagagtgaac tgtacacaag
    651 tgatacagtc atgcagaacc cacagttcat caaggccacc attgtgcacc
    701 aagaccaagc ctatgatgat aagatctact acttcttccg agaagacaac
    751 cctgacaaga accccgaggc tcctctcaat gtgtcccgag tagcccagtt
    801 gtgcaggggg gaccagggtg gtgagagttc gttgtctgtc tccaagtgga
    851 acaccttcct gaaagccatg ttggtctgca gcgatgcagc caccaacagg
    901 aacttcaatc ggctgcaaga tgtcttcctg ctccctgacc ccagtggcca
    951 gtggagagat accagggtct atggcgtttt ctccaacccc tggaactact
    1001 cagctgtctg cgtgtattcg cttggtgaca ttgacagagt cttccgtacc
    1051 tcatcgctca aaggctacca catgggcctt tccaaccctc gacctggcat
    1101 gtgcctccca aaaaagcagc ccatacccac agaaaccttc caggtagctg
    1151 atagtcaccc agaggtggct cagagggtgg aacctatggg gcccc
  • [0245]
    [0245]
    TABLE 4
    Amino acid sequence of H-SemaL (666 amino acids)
    (SEQ ID NO.: 3)
    1 MTPPPPGRAA PSAPRARVPG PPARLGLPLR LRLLLLLWAA AASAQGHLRS
    51 GPRIFAVWKG HVGQDRVDFG QTEPHTVLFH EPGSSSVWVG GRGKVYLFDF
    101 PEGKNASVRT VNIGSTKGSC LDKRDCENYI TLLERRSEGL LACGTNARHP
    151 SCWNLVNGTV VPLGEMRGYA PFSPDENSLV LFEGDEVYST IRKQEYNGKI
    201 PRERRIRGES ELYTSDTVMQ NPQFIKATIV HQDQAYDDKI YYFFREDNPD
    251 KNPEAPLNVS RVAQLCRGDQ GGESSLSVSK WNTFLKAMLV CSDAATNKNF
    301 NRLQDVFLLP DPSGQWRDTR VYGVFSNPWN YSAVCVYSLG DIDKVFRTSS
    351 LKGYHSSLPN PRPGKCLPDQ QPIPTETFQV ADRHPEVAQR VEPMGPLKTP
    401 LFHSKYHYQK VAVHRMQASH GETFHVLYLT TDRGTIHKVV EPGEQEHSFA
    451 FNIMEIQPFR RAAAIQTMSL DAERRKLYVS SQWEVSQVPL DLCEVYGGGC
    501 HGCLMSRDPY GGWDQGRCIS IYSSERSVLQ SINPAEPHKE CPNPKPDKAP
    551 LQKVSLAPNS RYYLSCPMES RHATYSWRHK ENVEQSCEPG HQSPNCILFI
    601 ENLTAQQYGH YFCEAQEGSY FREAQHWQLL PEDGIMAEHL LGHACALAAS
    651 LWLGVLPTLT LGLLVH
  • [0246]
    [0246]
    TABLE 5
    (Partial) amino acid sequence of M-SemaL (394 amino acids,
    corresponding to position 1-396 of H-SemaL)
    (SEQ ID NO.: 4)
    1 MTPPPPGRAA PSAPRARVLS LPARFGLPLR LRLLLVFWVA AASAQGHSRS
    51 GPRISAVWKG QDHVDFSQPE PHTVLFHEPG SFSVWVGGRG KVYHFNFPEG
    101 KNASVRTVNI GSTKGSCQDK QDCGNYITLL ERRGNGLLVG GTNARKPSCW
    151 NLVNDSVVMS LGEMKGYAPF SPDENSLVLF EGDEVYSTIR KQEYNGKIPR
    201 FRRIRGESEL YTSDTVMQNP QFIKATIVHQ DQAYDDKIYY FFREDNPDKN
    251 PEAPLNVSRV AQLCRGDQGG ESSLSVSKWN TFLKAMLVCS DAATNRNFNR
    301 LQDVFLLPDP SGQWRDTRVY GVFSNPWNYS AVCVYSLGDI DRVFRTSSLK
    351 GYHMGLSNPR PGMCLPKKQP IPTETFQVAD SHPEVAQRVE PMGP
  • [0247]
    [0247]
    TABLE 6
    Synthetic oligonucleotides (Eurogentec, Seraing, Belgium)
    Number of the
    primer/name Nucleotide sequence of the primer (of the synthetic oligonucleotides)
    91506/AP2 actcactatagggctcgagcggc (SEQ ID NO.: 5)
    121234 agccgcacacggtgcttttc (SEQ ID NO.: 6)
    121235/Est 2 gcacagatgcgttcttgccc (SEQ ID NO.: 7)
    121236/Est 3 accatagaccctggtgtccc (SEQ ID NO.: 8)
    121237/Est 4 gcagtgatgctgccaccaac (SEQ ID NO.: 9)
    121238 ccagaccatgtcgctggatg (SEQ ID NO.: 10)
    121239/Est 6 acatgaggcaaccgtggcag (SEQ ID NO.: 11)
    131989/AP1 ccatcctaatacgactcactatagggc (SEQ ID NO.: 12)
    131990/Est 7 aggtagaccttgccacgtcc (SEQ ID NO.: 13)
    131991 gaacttcaacaggctgcaagacg (SEQ ID NO.: 14)
    131992 atgctgagcggaggaagctg (SEQ ID NO.: 15)
    131993 ccgccatacacctcacacag (SEQ ID NO.: 16)
    150788 ctggaagctttctgtgggtatcggctgc (SEQ ID NO.: 17)
    150789 tttggatccctggttctgtttgaag (SEQ ID NO.: 18)
    167579/cDNA ttctagaattcagcggccgcttttttttttttttttttttttttttttttvn (SEQ ID NO.: 19)
    Synthesis primer
    168421 ggggaaagttcactgtcagtctccaag (SEQ ID NO.: 20)
    168422 gggaatacacacagacggctgagtag (SEQ ID NO.: 21)
    207608/ agcaagttcagcctggttaagt (SEQ ID NO.: 22)
    Amplification of
    γgt10 insert
    207609/ ttatgagtatttcttccaggg (SEQ ID NO.: 23)
    Amplification of
    γgt10 insert
    232643/Est 13 ccattaatccagccgagccacacaag (SEQ ID NO.: 24)
    232644/Est 14 catctacagctccgaacggtcagtg (SEQ ID NO.: 25)
    233084 cagcggaagccccaaccgag (SEQ ID NO.: 26)
    240655/hs 5 gggatgacgcCtcctCcgCCcgg (SEQ ID NO.: 27)
    240656/hs 3 aagcttcacgtggaccagcaagccaagagtg (SEQ ID NO.: 28)
    240857/hs 3c aagctttttccgtccttccgtccgg (SEQ ID NO.: 29)
    243068 atggtgagcaagggcgaggagctg (SEQ ID NO.: 30)
    243069 cttgtacagctcgtccatgccgag (SEQ ID NO.: 31)
    260812 GGGTGGTGAGAGTTCGTTGTCTGTC (SEQ ID NO.: 32)
    260813 GAGCGATGAGGTACGGAAGACTCTG (SEQ ID NO.: 33)
  • [0248]
    [0248]
    TABLE 7
    Nucleotide sequence of the recombinant plasmid pCR2.1-H-
    SemaL (SEQ ID NO.: 34)
       1 AGCGCCCAAT ACGCAAACCG CCTCTCCCCG CGCGTTGGCC GATTCATTAA
      51 TGCAGCTGGC ACGACAGGTT TCCCGACTGG AAAGCGGGCA GTGAGCGCAA
     101 CGCAATTAAT GTGAGTTAGC TCACTCATTA GGCACCCCAG GCTTTACACT
     151 TTATGCTTCC GGCTCGTATG TTGTGTGGAA TTGTGAGCGG ATAACAATTT
     201 CACACAGGAA ACAGCTATGA CCATGATTAC GCCaagcttc acgtggacca
     251 gcaagccaag agtgagtgtg ggcagcaccc ccagccagag ggaggcagcc
     301 agggcacagg catgacccag caggtgctcg gccatgatgc cgtcctcggg
     351 cagcagctgc cagtgctgag cctcgcggaa gtaggagccc tcctgggcct
     401 cgcagaagta gtggccgtac tgctgcgccg tgaggttctc gatgaacagg
     451 atgcagttgg ggctctggtg accaggttcg cagctctgct ccacgttctc
     501 cttgtggcgc catgagtagg tggcgtggcg ggattccatg gggcagctca
     551 ggtagtagcg agagtttggg gccagggaaa ccttctgcag tggggccttg
     601 tctggtttgg ggttgggaca ctccttgtgt ggctcggctg gattaatgga
     651 ttgcagcact gaccgttcgg agctgtagat ggagatgcag cggccctggt
     701 cccagccgca gtaggggtct cgggacatga ggcaaccgtg gcagcccccg
     751 ccatagacct cacacaggtc caggggcacc tggctcacct cccactggga
     801 gctcacatac agcttcctcc gctcagcatc cagcgacatg gtctggatgg
     851 cagccgcgcg gcggaagggc tggatctcca tgatgttgaa ggcgaagctg
     901 tgctcctgct cccccggttc caccaccttg tggatagtgc ccctgtctgt
     951 agttaggtaa agcacatgaa aggtctcccc gtggctggct tgcatgcggt
    1001 gaacggccac tttctggtag tggtatttag agtggaacaa tggcgtcttc
    1051 agaggcccca tgggctccac cctctgcgcc acctctgggt gacggtcagc
    1101 cacctggaag gtctctgtgg gtatcggctg ctggtctggg aggcacttgc
    1151 caggccgcgg gttgggaagg cttgagtggt agcccttgag tgaggaggta
    1201 cggaagacct tgtcaatgtc accgagggaa tacacacaga cggctgagta
    1251 gttccagggg ttggagaaaa caccatagac cctggtgtcc ctccactggc
    1301 cgctggggtc agggagcagg aagacgtctt gcagcctgtt gaagttcttg
    1351 ttggtggcag catcactgca taccagcatg gctttcagaa aagtgttcca
    1401 cttggagact gacagtgaac tttccccacc ctggtccccc ctgcacaact
    1451 gggccacacg ggacacattg agaggagcct caggattctt gtcaggattg
    1501 tcctctcgga agaagtagta gatcttgtca tcgtaagcct ggtcttggtg
    1551 cacgatggtg gctttgatga actgtgggtt ctgcatgaca gtatcactgg
    1601 tgtacagctc actctcgccc cggatgcggc ggaaccgagg gatcttccca
    1651 ttgtattcct gcttccggat ggtggaatac acctcgtccc cttcaaacag
    1701 aaccagggag ttctcgtccg ggctgaaggg ggcgtagcct ctcatctcgc
    1751 caagtggcac cacagtgcca ttcaccaggt tccagcagct ggggtgccgg
    1801 gcgttggtgc cacaggccag cagcccctca ctccgcctct ccaggagagt
    1851 gatgtagttc tcgcagtccc gcttatccag acaggacccc tttgtggagc
    1901 cgatattcac cgtgcgcaca gatgcgttct tgccctcggg gaagtcaaag
    1951 aggtagacct tgccacgtcc tcccacccac acagaggagc tgcctggctc
    2001 gtggaaaagc accgtgtgcg gctcagtctg gccaaagtcc acccggtcct
    2051 gccctacatg gcctttccag acggcgaaga tgcggggtcc gctccttagg
    2101 tggccctggg cggaggcggc ggccgcccag agcagcagca gcagccgcag
    2151 ccgcagcgga agccccaacc gagccggcgg gccagggacg cgggcgcgcg
    2201 gtgcgctggg ggcggcacgt ccgggcggag gaggcgtcat cccaagccga
    2251 attcTGCAGA TATCCATCAC ACTGGCGGCC GCTCGAGCAT GCATCTAGAG
    2301 GGCCCAATTC GCCCTATAGT GAGTCGTATT ACAATTCACT GGCCGTCGTT
    2351 TTACAACGTC GTGACTGGGA AAACCCTGGC GTTACCCAAC TTAATCGCCT
    2401 TGCAGCACAT CCCCCTTTCG CCAGCTGGCG TAATAGCGAA GAGGCCCGCA
    2451 CCGATCGCCC TTCCCAACAG TTGCGCAGCC TGAATGGCGA ATGGGACGCG
    2501 CCCTGTAGCG GCGCATTAAG CGCGGCGGGT GTGGTGGTTA CGCGCAGCGT
    2551 GACCGCTACA CTTGCCAGCG CCCTAGCGCC CGCTCCTTTC GCTTTCTTCC
    2601 CTTCCTTTCT CGCCACGTTC GCCGGCTTTC CCCGTCAAGC TCTAAATCGG
    2651 GGGCTCCCTT TAGGGTTCCG ATTTAGAGCT TTACGGCACC TCGACCGCAA
    2701 AAAACTTGAT TTGGGTGATG GTTCACGTAG TGGGCCATCG CCCTGATAGA
    2751 CGGTTTTTCG CCCTTTGACG TTGGAGTCCA CGTTCTTTAA TAGTGGACTC
    2801 TTGTTCCAAA CTGGAACAAC ACTCAACCCT ATCGCGGTCT ATTCTTTTGA
    2851 TTTATAAGGG ATTTTGCCGA TTTCGGCCTA TTGGTTAAAA AATGAGCTGA
    2901 TTTAACAAAT TCAGGGCGCA AGGGCTGCTA AAGGAACCGG AACACGTAGA
    2951 AAGCCAGTCC GCAGAAACGG TGCTGACCCC GGATGAATGT CAGCTACTGG
    3001 GCTATCTGGA CAAGGGAAAA CGCAAGCGCA AAGAGAAAGC AGGTAGCTTG
    3051 CAGTGGGCTT ACATGGCGAT AGCTAGACTG GGCGGTTTTA TGGACAGCAA
    3101 GCGAACCGGA ATTGCCAGCT GGGGCGCCCT CTGGTAAGGT TGGGAAGCCC
    3151 TGCAAAGTAA ACTGGATGGC TTTCTTGCCG CCAAGGATCT GATGGCGCAG
    3201 GGGATCAAGA TCTGATCAAG AGACAGGATG AGGATCGTTT CGCATGATTG
    3251 AACAAGATGG ATTGCACGCA GGTTCTCCGG CCGCTTGGGT GGAGAGGCTA
    3301 TTCGGCTATG ACTGGGCACA ACAGACAATC GGCTGCTCTG ATGCCGCCGT
    3351 GTTCCGGCTG TCAGCGCAGG GGCGCCCGGT TCTTTTTGTC AAGACCGACC
    3401 TGTCCGGTGC CCTGAATGAA CTGCAGGACG AGGCAGCGCG GCTATCGTGG
    3451 CTGGCCACGA CGGGCGTTCC TTGCGCAGCT GTGCTCGACG TTGTCACTGA
    3501 AGCGGGAAGG GACTGGCTGC TATTGGGCGA AGTGCCGGGG CAGGATCTCC
    3551 TGTCATCTCG CCTTGCTCCT GCCGAGAAAG TATCCATCAT GGCTGATGCA
    3601 ATGCGGCGGC TGCATACGCT TGATCCGGCT ACCTGCCCAT TCGACCACCA
    3651 AGCGAAACAT CGCATCGAGC GAGCACGTAC TCGGATGGAA GCCGGTCTTG
    3701 TCGATCAGGA TGATCTGGAC GAAGAGCATC AGGGGCTCGC GCCAGCCGAA
    3751 CTGTTCGCCA GGCTCAAGGC GCGCATGCCC GACGGCGAGG ATCTCGTCGT
    3801 GATCCATGGC GATGCCTGCT TGCCGAATAT CATGGTGGAA AATGGCCGCT
    3851 TTTCTGGATT CAACGACTGT GGCCGGCTGG GTGTGGCGGA CCGCTATCAG
    3901 GACATAGCGT TGGATACCCG TGATATTGCT GAAGAGCTTG GCGGCGAATG
    3951 GGCTGACCGC TTCCTCGTGC TTTACGGTAT CGCCGCTCCC GATTCGCAGC
    4001 GCATCGCCTT CTATCGCCTT CTTGACGAGT TCTTCTGAAT TGAAAAAGGA
    4051 AGAGTATGAG TATTCAACAT TTCCGTGTCG CCCTTATTCC CTTTTTTGCG
    4101 GCATTTTGCC TTCCTGTTTT TGCTCACCCA GAAACGCTGG TGAAAGTAAA
    4151 AGATGCTGAA GATCAGTTGG GTGCACGAGT GGGTTACATC GAACTGGATC
    4201 TCAACAGCGG TAAGATCCTT GAGAGTTTTC GCCCCGAAGA ACGTTTTCCA
    4251 ATGATGAGCA CTTTTAAAGT TCTGCTATGT CATACACTAT TATCCCGTAT
    4301 TGACGCCGGG CAAGAGCAAC TCGGTCGCCG GGCGCGGTAT TCTCAGAATG
    4351 ACTTGGTTGA GTACTCACCA GTCACAGAAA AGCATCTTAC GGATGGCATG
    4401 ACAGTAAGAG AATTATGCAG TGCTGCCATA ACCATGAGTG ATAACACTGC
    4451 GGCCAACTTA CTTCTGACAA CGATCGGAGG ACCGAAGGAG CTAACCGCTT
    4501 TTTTGCACAA CATGGGGGAT CATGTAACTC GCCTTGATCG TTGGGAACCG
    4551 GAGCTGAATG AAGCCATACC AAACGACGAG AGTGACACCA CGATGCCTGT
    4601 AGCAATGCCA ACAACGTTGC GCAAACTATT AACTGGCGAA CTACTTACTC
    4651 TAGCTTCCCG GCAACAA1TA ATAGACTGGA TGGAGGCGGA TAAAGTTGCA
    4701 GGACCACTTC TGCGCTCGGC CCTTCCGGCT GGCTGGTTTA TTGCTGATAA
    4751 ATCTGGAGCC GGTGAGCGTG GGTCTCGCGG TATCATTGCA GCACTGGGGC
    4801 CAGATGGTAA GCCCTCCCGT ATCGTAGTTA TCTACACGAC GGGGAGTCAG
    4851 GCAACTATGG ATGAACGAAA TAGACAGATC GCTGAGATAG GTGCCTCACT
    4901 GATTAAGCAT TGGTAACTGT CAGACCAAGT TTACTCATAT ATACTTTAGA
    4951 TTGATTTAAA ACTTCATTTT TAATTTAAAA GGATCTAGGT GAAGATCCTT
    5001 TTTGATAATC TCATGACCAA AATCCCTTAA CGTGAGTTTT CGTTCCACTG
    5051 AGCGTCAGAC CCCGTAGAAA AGATCAAAGG ATCTTCTTGA GATCCTTTTT
    5101 TTCTGCGCGT AATCTGCTGC TTGCAAACAA AAAAACCACC GCTACCAGCG
    5151 GTGGTTTGTT TGCCGGATCA AGAGCTACCA ACTCTTTTTC CGAAGGTAAC
    5201 TGGCTTCAGC AGAGCGCAGA TACCAAATAC TGTCCTTCTA GTGTAGCCGT
    5251 AGTTAGGCCA CCACTTCAAG AACTCTGTAG CACCGCCTAC ATACCTCGCT
    5301 CTGCTAATCC TGTTACCAGT GGCTGCTGCC AGTGGCGATA AGTCGTGTCT
    5351 TACCGGGTTG GACTCAAGAC GATAGTTACC GGATAAGGCG CAGCGGTCGG
    5401 GCTGAACGGG GGGTTCGTGC ACACAGCCCA GCTTGGAGCG AACGACCTAC
    5451 ACCGAACTGA GATACCTACA GCGTGAGCAT TGAGAAAGCG CCACGCTTCC
    5501 CGAAGGGAGA AAGGCGGACA GGTATCCGGT AAGCGGCAGG GTCGGAACAG
    5551 GAGAGCGCAC GAGGGAGCTT CCAGGGGGAA ACGCCTGGTA TCTTTATAGT
    5601 CCTGTCGGGT TTCGCCACCT CTGACTTGAG CGTCGATTTT TGTGATGCTC
    5651 GTCAGGGGGG CGGAGCCTAT GGAAAAACGC CAGCAACGCG GCCTTTTTAC
    5701 GGTTCCTGGC CTTTTGCTGG CCTTTTGCTC ACATGTTCTT TCCTGCGTTA
    5751 TCCCCTGATT CTGTGGATAA CCGTATTACC GCCTTTGAGT GAGCTGATAC
    5801 CGCTCGCCGC AGCCGAACGA CCGAGCGCAG CGAGTCAGTG
    AGCGAGGAAG
    5851 CGGAAG
  • [0249]
    [0249]
    TABLE 8
    Nucleotide sequence of the recombinant expression plasmid
    pCDNA3.1(-)H-SemaL-MycHisA (SEQ ID NO.: 35)
       1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTCGACTCT CAGTACAATC
      51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT
     101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG
     151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG
     201 CTGCTTCGCG ATGTACGGGC CAGATATACG CGTTGACATT GATTATTGAC
     251 TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATATA
     301 TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG
     351 CCCAACGACC CCCGCCCATT GACGTCAATA ATGACGTATG TTCCCATAGT
     401 AACGCCAATA GGGACTTTCC ATTGACGTCA ATGGGTGGAC TATTTACGGT
     451 AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC AAGTACGCCC
     501 CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA
     551 CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTCA
     601 TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA
     651 TAGCGGTTTG ACTCACGGGG ATTTCCAAGT CTCCACCCCA TTGACGTCAA
     701 TGGGAGTTTG TTTTGGCACC AAAATCAACG GGACTTTCCA AAATGTCGTA
     751 ACAAGTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT
    ACGGTGGGAG
     801 GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG
     851 GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGC
     901 GTTTAAACGG GCCCTCTAGA CTCGAGCGGC CGCCACTGTG CTGGATATCT
     951 GcAgaattcg gcttgggatg acgcctcctc cgcccggacg tgccgccccc
    1001 agcgcaccgc gcgcccgcgt ccctggcccg ccggctcggt tggggcttcc
    1051 gctgcggctg cggctgctgc tgctgctctg ggcggccgcc gcctccgccc
    1101 agggccacct aaggagcgga ccccgcatct tcgccgtctg gaaaggccat
    1151 gtagggcagg accgggtgga ctttggccag actgagccgc acacggtgct
    1201 tttccacgag ccaggcagct cctctgtgtg ggtgggagga cgtggcaagg
    1251 tctacctctt tgacttcccc gagggcaaga acgcatctgt gcgcacggtg
    1301 aatatcggct ccacaaaggg gtcctgtctg gataagcggg actgcgagaa
    1351 ctacatcact ctcctggaga ggcggagtga ggggctgctg gcctgtggca
    1401 ccaacgcccg gcaccccagc tgctggaacc tggtgaatgg cactgtggtg
    1451 ccacttggcg agatgagagg ctacgccccc ttcagcccgg acgagaactc
    1501 cctggttctg tttgaagggg acgaggtgta ttccaccatc cggaagcagg
    1551 aatacaatgg gaagatccct cggttccgcc gcatccgggg cgagagtgag
    1601 ctgtacacca gtgatactgt catgcagaac ccacagttca tcaaagccac
    1651 catcgtgcac caagaccagg cttacgatga caagatctac tacttcttcc
    1701 gagaggacaa tcctgacaag aatcctgagg ctcctctcaa tgtgtcccgt
    1751 gtggcccagt tgtgcagggg ggaccagggt ggggaaagtt cactgtcagt
    1801 ctccaagtgg aacacttttc tgaaagccat gctggtatgc agtgatgctg
    1851 ccaccaacaa gaacttcaac aggctgcaag acgtcttcct gctccctgac
    1901 cccagcggcc agtggaggga caccagggtc tatggtgttt tctccaaccc
    1951 ctggaactac tcagccgtct gtgtgtattc cctcggtgac attgacaagg
    2001 tcttccgtac ctcctcactc aagggctacc actcaagcct tcccaacccg
    2051 cggcctggca agtgcctccc agaccagcag ccgataccca cagagacctt
    2101 ccaggtggct gaccgtcacc cagaggtggc gcagagggtg gagcccatgg
    2151 ggcctctgaa gacgccattg ttccactcta aataccacta ccagaaagtg
    2201 gccgttcacc gcatgcaagc cagccacggg gagacctttc atgtgcttta
    2251 cctaactaca gacaggggca ctatccacaa ggtggtggaa ccgggggagc
    2301 aggagcacag cttcgccttc aacatcatgg agatccagcc cttccgccgc
    2351 gcggctgcca tccagaccat gtcgctggat gctgagcgga ggaagctgta
    2401 tgtgagctcc cagtgggagg tgagccaggt gcccctggac ctgtgtgagg
    2451 tctatggcgg gggctgccac ggttgcctca tgtcccgaga cccctactgc
    2501 ggctgggacc agggccgctg catctccatc tacagctccg aacggtcagt
    2551 gctgcaatcc attaatccag ccgagccaca caaggagtgt cccaacccca
    2601 aaccagacaa ggccccactg cagaaggttt ccctggcccc aaactctcgc
    2651 tactacctga gctgccccat ggaatcccgc cacgccacct actcatggcg
    2701 ccacaaggag aacgtggagc agagctgcga acctggtcac cagagcccca
    2751 actgcatcct gttcatcgag aacctcacgg cgcagcagta cggccactac
    2801 ttctgcgagg cccaggaggg ctcctacttc cgcgaggctc agcactggca
    2851 gctgctgccc gaggacggca tcatggccga gcacctgctg ggtcatgcct
    2901 gtgccctggc tgcctccctc tggctggggg tgctgcccac actcactctt
    2951 ggcttgctgg tccacgtgaa gcttGGGCCC GAACAAAAAC TCATCTCAGA
    3001 AGAGGATCTG AATAGCGCCG TCGACCATCA TCATCATCAT CATTGAGTTT
    3051 AAACCGCTGA TCAGCCTCGA CTGTGCCTTC TAGTTGCCAG CCATCTGTTG
    3101 TTTGCCCCTC CCCCGTGCCT TCCTTGACCC TGGAAGGTGC CACTCCCACT
    3151 GTCCTTTCCT AATAAAATGA GGAAATTGCA TCGCATTGTC TGAGTAGGTG
    3201 TCATTCTATT CTGGGGGGTG GGGTGGGGCA GGACAGCAAG GGGGAGGATT
    3251 GGGAAGACAA TAGCAGGCAT GCTGGGGATG CGGTGGGCTC TATGGCTTCT
    3301 GAGGCGGAAA GAACCAGCTG GGGCTCTAGG GGGTATCCCC ACGCGCCCTG
    3351 TAGCGGCGCA TTAAGCGCGG CGGGTGTGGT GGTTACGCGC AGCGTGACCG
    3401 CTACACTTGC CAGCGGCCTA GCGCCCGCTC CTTTCGCTTT CTTCCCTTCC
    3451 TTTCTCGCCA CGTTCGCCGG CTTTCCCCGT CAAGCTCTAA ATCGGGGCAT
    3501 CCCTTTAGGG TTCCGATTTA GTGCTTTACG GCACCTCGAC CCCAAAAAAC
    3551 TTGATTAGGG TGATGGTTCA CGTAGTGGGC CATCGCCCTG ATAGACGGTT
    3601 TTTCGCCCTT TGACGTTGGA GTCCACGTTC TTTAATAGTG GACTCTTGTT
    3651 CCAAACTGGA ACAACACTCA ACCCTATCTC GGTCTATTCT TTTGATTTAT
    3701 AAGGGATTTT GGGGATTTCG GCCTATTGGT TAAAAAATGA GCTGATTTAA
    3751 CAAAAATTTA ACGCGAATTA ATTCTGTGGA ATGTGTGTCA GTTAGGGTGT
    3801 GGAAAGTCCC CAGGCTCCCC AGGCAGGCAG AAGTATGCAA AGCATGCATC
    3851 TCAATTAGTC AGCAACCAGG TGTGGAAAGT CCCCAGGCTC CCCAGCAGGC
    3901 AGAAGTATGC AAAGCATGCA TCTCAATTAG TCAGCAACCA TAGTCCCGCC
    3951 CCTAACTCCG CCCATCCCGC CCCTAACTCC GCCCAGTTCC GCCCATTCTC
    4001 CGCCCCATGG CTGACTAATT TTTTTTATTT ATGCAGAGGC CGAGGCCGCC
    4051 TCTGCCTCTG AGCTATTCCA GAAGTAGTGA GGAGGCTT1T TTGGAGGCCT
    4101 AGGCTTTTGC AAAAAGCTCC CGGGAGCTTG TATATCCATT TTCGGATCTG
    4151 ATCAAGAGAC AGGATGAGGA TCGTTTCGCA TGATTGAACA AGATGGATTG
    4201 CACGCAGGTT CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG
    4251 GGCACAACAG ACAATCGGCT GCTCTGATGC CGCCGTGTTC CGGCTGTCAG
    4301 CGCAGGGGCG CCCGGTTCTT TTTGTCAAGA CCGACCTGTC CGGTGCCCTG
    4351 AATGAACTGC AGGACGAGGC AGCGCGGCTA TCGTGGCTGG CCACGACGGG
    4401 CGTTCCTTGC GCAGCTGTGC TCGACGTTGT CACTGAAGCG GGAAGGGACT
    4451 GGCTGCTATT GGGCGAAGTG CCGGGGCAGG ATCTCCTGTC ATCTCACCTT
    4501 GCTCCTGCCG AGAAAGTATC CATCATGGCT GATGCAATGC GGCGGCTGCA
    4551 TACGCTTGAT CCGGCTACCT GCCCATTCGA CCACCAAGCG AAACATCGCA
    4601 TCGAGCGAGC ACGTACTCGG ATGGAAGCCG GTCTTGTCGA TCAGGATGAT
    4651 CTGGACGAAG AGCATCAGGG GCTCGCGCCA GCCGAACTGT TCGCCAGGCT
    4701 CAAGGCGCGC ATGCCCGACG GCGAGGATCT CGTCGTGACC CATGGCGATG
    4751 CCTGCTTGCC GAATATCATG GTGGAAAATG GCCGCTTTTC TGGATTCATC
    4801 GACTGTGGCC GGCTGGGTGT GGCGGACCGC TATCAGGACA TAGCGTTGGC
    4851 TACCCGTGAT ATTGCTGAAG AGCTTGGCGG CGAATGGGCT GACCGCTTCC
    4901 TCGTGCTTTA CGGTATCGCC GCTCCCGATT CGCAGCGCAT CGCCTTCTAT
    4951 CGCCTTCTTG ACGAGTTCTT CTGAGCGGGA CTCTGGGGTT CGAAATGACC
    5001 GACCAAGCGA CGCCCAACCT GCCATCACGA GATTTCGATT CCACCGCCGC
    5051 CTTCTATGAA AGGTTGGGCT TCGGAATCGT TTTCCGGGAC GCCGGCTGGA
    5101 TGATCCTCCA GCGCGGGGAT CTCATGCTGG AGTTCTTCGC CCACCCCAAC
    5151 TTGTTTATTG CAGCTTATAA TGGTTACAAA TAAAGCAATA GCATCACAAA
    5201 TTTCACAAAT AAAGCATTTT TTTCACTGCA TTCTAGTTGT GGTTTGTCCA
    5251 AACTCATCAA TGTATCTTAT CATGTCTGTA TACCGTCGAC CTCTAGCTAG
    5301 AGCTTGGCGT AATCATGGTC ATAGCTGTTT CCTGTGTGAA ATTGTTATCC
    5351 GCTCACAATT CCACACAACA TACGAGCCGG AAGCATAAAG TGTAAAGCCT
    5401 GGGGTGCCTA ATGAGTGAGC TAACTCACAT TAATTGCGTT GCGCTCACTG
    5451 CCCGCTTTCC AGTCGGGAAA CCTGTCGTGC CAGCTGCATT AATGAATCGG
    5501 CCAACGCGCG GGGAGAGGCG GTTTGCGTAT TGGGCGCTCT TCCGCTTCCT
    5551 CGCTCACTGA CTCGCTGCGC TCGGTCGTTC GGCTGCGGCG AGCGGTATCA
    5601 GCTCACTCAA AGGCGGTAAT ACGGTTATCC ACAGAATCAG GGGATAACGC
    5651 AGGAAAGAAC ATGTGAGCAA AAGGCCAGCA AAAGGCCAGG AACCGTAAAA
    5701 AGGCCGCGTT GCTGGCGTTT TTCCATAGGC TCCGCCCCCC TGACGAGCAT
    5751 CACAAAAATC GACGCTCAAG TCAGAGGTGG CGAAACCCGA CAGGACTATA
    5801 AAGATACCAG GCGTTTCCCC CTGGAAGCTC CCTCGTGCGC TCTCCTGTTC
    5851 CGACCCTGCC GCTTACCGGA TACCTGTCCG CCTTTCTCCC TTCGGGAAGC
    5901 GTGGCGCTTT CTCAATGCTC ACGCTGTAGG TATCTCAGTT CGGTGTAGGT
    5951 CGTTCGCTCC AAGCTGGGCT GTGTGCACGA ACCCCCCGTT CAGCCCGACC
    6001 GCTGCGCCTT ATCCGGTAAC TATCGTCTTG AGTCCAACCC GGTAAGACAC
    6051 GACTTATCGC CACTGGCAGC AGCCACTGGT AACAGGATTA GCAGAGCGAG
    6101 GTATGTAGGC GGTGCTACAG AGTTCTTGAA GTGGTGGCCT AACTACGGCT
    6151 ACACTAGAAG GACAGTATTT GGTATCTGCG CTCTGCTGAA GCCAGTTACC
    6201 TTCGGAAAAA GAGTTGGTAG CTCTTGATCC GGCAAACAAA CCACCGCTGG
    6251 TAGCGGTGGT TTTTTTGTTT GCAAGCAGCA GATTACGCGC AGAAAAAAAG
    6301 GATCTCAAGA AGATCCTTTG ATCTTTTCTA CGGGGTCTGA CGCTCAGTGG
    6351 AACGAAAACT CACGTTAAGG GATTTTGGTC ATGAGATTAT CAAAAAGGAT
    6401 CTTCACCTAG ATCCTTTTAA ATTAAAAATG AAGTTTTAAA TCAATCTAAA
    6451 GTATATATGA GTAAACTTGG TCTGACAGTT ACCAATGCTT AATCAGTGAG
    6501 GCACCTATCT CAGCGATCTG TCTATTTCGT TCATCCATAG TTGCCTGACT
    6551 CCCCGTCGTG TAGATAACTA CGATACGGGA GGGCTTACCA TCTGGCCCCA
    6601 GTGCTGCAAT GATACCGCGA GACCCACGCT CACCGGCTCC AGATTTATCA
    6651 GCAATAAACC AGCCAGCCGG AAGGGCCGAG CGCAGAAGTG GTCCTGCAAC
    6701 TTTATCCGCC TCCATCCAGT CTATTAATTG TTGCCGGGAA GCTAGAGTAA
    6751 GTAGTTCGCC AGTTAATAGT TTGCGCAACG TTGTTGCCAT TGCTACAGGC
    6801 ATCGTGGTGT CACGCTCGTC GTTTGGTATG GCTTCATTCA GCTCCGGTTC
    6851 CCAACGATCA AGGCGAGTTA CATGATCCCC CATGTTGTGC AAAAAAGCGG
    6901 TTAGCTCCTT CGGTCCTCCG ATCGTTGTCA GAAGTAAGTT GGCCGCAGTG
    6951 TTATCACTCA TGGTTATGGC AGCACTGCAT AATTCTCTTA CTGTCATGCC
    7001 ATCCGTAAGA TGCTTTTCTG TGACTGGTGA GTACTCAACC AAGTCATTCT
    7051 GAGAATAGTG TATGCGGCGA CCGAGTTGCT CTTGCCCGGC GTCAATACGG
    7101 GATAATACCG CGCCACATAG CAGAACTTTA AAAGTGCTCA TCATTGGAAA
    7151 ACGTTCTTCG GGGCGAAAAC TCTCAAGGAT CTTACCGCTG TTGAGATCCA
    7201 GTTCGATGTA ACCCACTCGT GCACCCAACT GATCTTCAGC ATCTTTTACT
    7251 TTCACCAGCG TTTCTGGGTG AGCAAAAACA GGAAGGCAAA ATGCCGCAAA
    7301 AAAGGGAATA AGGGCGACAC GGAAATGTTG AATACTCATA CTCTTCCTTT
    7351 TTCAATATTA TTGAAGCATT TATCAGGGTT ATTGTCTCAT GAGCGGATAC
    7401 ATATTTGAAT GTATTTAGAA AAATAAACAA ATAGGGGTTC CGCGCACATT
    7451 TCCCCGAAAA GTGCCACCTG ACGTC
  • [0250]
    [0250]
    TABLE 9
    Nucleotide sequence of the recombinant plasmid pcDNA3.1-H-
    SemaL-EGFP-MychisA (SEQ ID NO.: 36)
       1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTCGACTCT CAGTACAATC
      51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT
     101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG
     151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG
     201 CTGCTTCGCG ATGTACGGGC CAGATATACG CGTTGACATT GATTATTGAC
     251 TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATATA
     301 TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG
     351 CCCAACGACC CCCGCCCATT GACGTCAATA ATGACGTATG TTCCCATAGT
     401 AACGCCAATA GGGACTTTCC ATTGACGTCA ATGGGTGGAC TATTTACGGT
     451 AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC AAGTACGCCC
     501 CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT ATGCCCAGTA
     551 CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTCA
     601 TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA
     651 TAGCGGTTTG ACTCACGGGG ATTTCCAAGT CTCCACCCCA TTGACGTCAA
     701 TGGGAGTTTG TTTTGGCACC AAAATCAACG GGACTTTCCA AAATGTCGTA
     751 ACAACTCCGC CCCATTGACG CAAATGGGCG GTAGGCGTGT ACGGTGGGAG
     801 GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG
     851 GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGC
     901 GTTTAAACGG GCCCTCTAGA CTCGAGCGGC CGCCACTGTG CTGGATATCT
     951 GCAgaattcg gcttgggatg acgcctcctc cgcccggacg tgccgccccc
    1001 agcgcaccgc gcgcccgcgt ccctggcccg ccggctcggt tggggcttcc
    1051 gctgcggctg cggctgctgc tgctgctctg ggcggccgcc gcctccgccc
    1101 agggccacct aaggagcgga ccccgcatct tcgccgtctg gaaaggccat
    1151 gtagggcagg accgggtgga ctttggccag actgagccgc acacggtgct
    1201 tttccacgag ccaggcagct cctctgtgtg ggtgggagga cgtggcaagg
    1251 tctacctctt tgacttcccc gagggcaaga acgcatctgt gcgcacggtg
    1301 aatatcggct ccacaaaggg gtcctgtctg gataagcggg actgcgagaa
    1351 ctacatcact ctcctggaga ggcggagtga ggggctgctg gcctgtggca
    1401 ccaacgcccg gcaccccagc tgctggaacc tggtgaatgg cactgtggtg
    1451 ccacttggcg agatgagagg ctacgccccc ttcagcccgg acgagaactc
    1501 cctggttctg tttgaagggg acgaggtgta ttccaccatc cggaagcagg
    1551 aatacaatgg gaagatccct cggttccgcc gcatccgggg cgagagtgag
    1601 ctgtacacca gtgatactgt catgcagaac ccacagttca tcaaagccac
    1651 catcgtgcac caagaccagg cttacgatga caagatctac tacttcttcc
    1701 gagaggacaa tcctgacaag aatcctgagg ctcctctcaa tgtgtcccgt
    1751 gtggcccagt tgtgcagggg ggaccagggt ggggaaagtt cactgtcagt
    1801 ctccaagtgg aacacttttc tgaaagccat gctggtatgc agtgatgctg
    1851 ccaccaacaa gaacttcaac aggctgcaag acgtcttcct gctccctgac
    1901 cccagcggcc agtggaggga caccagggtc tatggtgttt tctccaaccc
    1951 ctggaactac tcagccgtct gtgtgtattc cctcggtgac attgacaagg
    2001 tcttccgtac ctcctcactc aagggctacc actcaagcct tcccaacccg
    2051 cggcctggca agtgcctccc agaccagcag ccgataccca cagagacctt
    2101 ccaggtggct gaccgtcacc cagaggtggc gcagagggtg gagcccatgg
    2151 ggcctctgaa gacgccattg ttccactcta aataccacta ccagaaagtg
    2201 gccgttcacc gcatgcaagc cagccacggg gagacctttc atgtgcttta
    2251 cctaactaca gacaggggca ctatccacaa ggtggtggaa ccgggggagc
    2301 aggagcacag cttcgccttc aacatcatgg agatccagcc cttccgccgc
    2351 gcggctgcca tccagaccat gtcgctggat gctgagcgga ggaagctgta
    2401 tgtgagctcc cagtgggagg tgagccaggt gcccctggac ctgtgtgagg
    2451 tctatggcgg gggctgccac ggttgcctca tgtcccgaga cccctactgc
    2501 ggctgggacc agggccgctg catctccatc tacagctccg aacggtcagt
    2551 gctgcaatcc attaatccag ccgagccaca caaggagtgt cccaacccca
    2601 aaccagacaa ggccccactg cagaaggttt ccctggcccc aaactctcgc
    2651 tactacctga gctgccccat ggaatcccgc cacgccacct actcatggcg
    2701 ccacaaggag aacgtggagc agagctgcga acctggtcac cagagcccca
    2751 actgcatcct gttcatcgag aacctcacgg cgcagcagta cggccactac
    2801 ttctgcgagg cccaggaggg ctcctacttc cgcgaggctc agcactggca
    2851 gctgctgccc gaggacggca tcatggccga gcacctgctg ggtcatgcct
    2901 gtgccctggc tgcctccctc tggctggggg tgctgcccac actcactctt
    2951 ggcttgctgg tccacATGGT GAGCAAGGGC GAGGAGCTGT TCACCGGGGT
    3001 GGTGCCCATC CTGGTCGAGC TGGACGGCGA CGTAAACGGC CACAAGTTCA
    3051 GCGTGTCCGG CGAGGGCGAG GGCGATGCCA CCTACGGCAA
    GCTGACCCTG
    3101 AAGTTCATCT GCACCACCGG CAAGCTGCCC GTGCCCTGGC CCACCCTCGT
    3151 GACCACCCTG ACCTACGGCG TGCAGTGCTT CAGCCGCTAC CCCGACCACA
    3201 TGAAGCAGCA CGACTTCTTC AAGTCCGCCA TGCCCGAAGG CTACGTCCAG
    3251 GAGCGCACCA TCTTCTTCAA GGACGACGGC AACTACAAGA CCCGCGCCGA
    3301 GGTGAAGTTC GAGGGCGACA CCCTGGTGAA CCGCATCGAG CTGAAGGGCA
    3351 TCGACTTCAA GGAGGACGGC AACATCCTGG GGCACAAGCT GGAGTACAAC
    3401 TACAACAGCC ACAACGTCTA TATCATGGCC GACAAGCAGA AGAACGGCAT
    3451 CAAGGTGAAC TTCAAGATCC GCCACAACAT CGAGGACGGC AGCGTGCAGC
    3501 TCGCCGACCA CTACCAGCAG AACACCCCCA TCGGCGACGG CCCCGTGCTG
    3551 CTGCCCGACA ACCACTACCT GAGCACCCAG TCCGCCCTGA GCAAAGACCC
    3601 CAACGAGAAG CGCGATCACA TGGTCCTGCT GGAGTTCGTG ACCGCCGCCG
    3651 GGATCACTCT CGGCATGGAC GAGCTGTACA Aggtgaagct tGGGCCCGAA
    3701 CAAAAACTCA TCTCAGAAGA GGATCTGAAT AGCGCCGTCG ACCATCATCA
    3751 TCATCATCAT TGAGTTTAAA CCGCTGATCA GCCTCGACTG TGCCTTCTAG
    3801 TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC TTGACCCTGG
    3851 AAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA AATTGCATCG
    3901 CATTGTCTGA GTAGGTGTCA TTCTATTCTG GGGGGTGGGG TGGGGCAGGA
    3951 CAGCAAGGGG GAGGATTGGG AAGACAATAG CAGGCATGCT GGGGATGCGG
    4001 TGGGCTCTAT GGCTTCTGAG GCGGAAAGAA CCAGCTGGGG CTCTAGGGGG
    4051 TATCCCCACG CGCCCTGTAG CGGCGCATTA AGCGCGGCGG GTGTGGTGGT
    4101 TACGCGCAGC GTGACCGCTA CACTTGCCAG CGCCCTAGCG CCCGCTCCTT
    4151 TCGCTTTCTT CCCTTCCTTT CTCGCCACGT TCGCCGGCTT TCCCCGTCAA
    4201 GCTCTAAATC GGGGCATCCC TTTAGGGTTC CGATTTAGTG CTTTACGGCA
    4251 CCTCGACCCC AAAAAACTTG ATTAGGGTGA TGGTTCACGT AGTGGGCCAT
    4301 CGCCCTGATA GACGGTTTTT CGCCCTTTGA CGTTGGAGTC CACGTTCTTT
    4351 AATAGTGGAC TCTTGTTCCA AACTGGAACA ACACTCAACC CTATCTCGGT
    4401 CTATTCTTTT GATTTATAAG GGATTTTGGG GATTTCGGCC TATTGGTTAA
    4451 AAAATGAGCT GATTTAACAA AAATTTAACG CGAATTAATT CTGTGGAATG
    4501 TGTGTCAGTT AGGGTGTGGA AAGTCCCCAG GCTCCCCAGG CAGGCAGAAG
    4551 TATGCAAAGC ATGCATCTCA ATTAGTCAGC AACCAGGTGT GGAAAGTCCC
    4601 CAGGCTCCCC AGCAGGCAGA AGTATGCAAA GCATGCATCT CAATTAGTCA
    4651 GCAACCATAG TCCCGCCCCT AACTCCGCCC ATCCCGCCCC TAACTCCGCC
    4701 CAGTTCCGCC CATTCTCCGC CCCATGGCTG ACTAATTTTT TTTATTTATG
    4751 CAGAGGCCGA GGCCGCCTCT GCCTCTGAGC TATTCCAGAA GTAGTGAGGA
    4801 GGCTTTTTTG GAGGCCTAGG CTTTTGCAAA AAGCTCCCGG GAGCTTGTAT
    4851 ATCCATTTTC GGATCTGATC AAGAGACAGG ATGAGGATCG TTTCGCATGA
    4901 TTGAACAAGA TGGATTGCAC GCAGGTTCTC CGGCCGCTTG GGTGGAGAGG
    4951 CTATTCGGCT ATGACTGGGC ACAACAGACA ATCGGCTGCT CTGATGCCGC
    5001 CGTGTTCCGG CTGTCAGCGC AGGGGCGCCC GGTTCTTTTT GTCAAGACCG
    5051 ACCTGTCCGG TGCCCTGAAT GAACTGCAGG ACGAGGCAGC GCGGCTATCG
    5101 TGGCTGGCCA CGACGGGCGT TCCTTGCGCA GCTGTGCTCG ACGTTGTCAC
    5151 TGAAGCGGGA AGGGACTGGC TGCTATTGGG CGAAGTGCCG GGGCAGGATC
    5201 TCCTGTCATC TCACCTTGCT CCTGCGGAGA AAGTATCCAT CATGGCTGAT
    5251 GCAATGCGGC GGCTGCATAC GCTTGATCCG GCTACCTGCC CATTCGACCA
    5301 CCAAGCGAAA CATCGCATCG AGCGAGCACG TACTCGGATG GAAGCCGGTC
    5351 TTGTCGATCA GGATGATCTG GACGAAGAGC ATCAGGGGCT CGCGCCAGCC
    5401 GAACTGTTCG CCAGGCTCAA GGCGCGCATG CCCGACGGCG AGGATCTCGT
    5451 CGTGACCCAT GGCGATGCCT GCTTGCCGAA TATCATGGTG GAAAATGGCC
    5501 GCTTTTCTGG ATTCATCGAC TGTGGCCGGC TGGGTGTGGC GGACCGCTAT
    5551 CAGGACATAG CGTTGGCTAC CCGTGATATT GCTGAAGAGC TTGGCGGCGA
    5601 ATGGGCTGAC CGCTTCCTCG TGCTTTACGG TATCGCCGCT CCCGATTCGC
    5651 AGCGCATCGC CTTCTATCGC CTTCTTGACG AGTTCTTCTG AGCGGGACTC
    5701 TGGGGTTCGA AATGACCGAC CAAGCGACGC CCAACCTGCC ATCACGAGAT
    5751 TTCGATTCCA CCGCCGCCTT CTATGAAAGG TTGGGCTTCG GAATCGTTTT
    5801 CCGGGACGCC GGCTGGATGA TCCTCCAGCG CGGGGATCTC ATGCTGGAGT
    5851 TCTTCGCCCA CCCCAACTTG TTTATTGCAG CTTATAATGG TTACAAATAA
    5901 AGCAATAGCA TCACAAATTT CACAAATAAA GCATTTTTTT CACTGCATTC
    5951 TAGTTGTGGT TTGTCCAAAC TCATCAATGT ATCTTATCAT GTCTGTATAC
    6001 CGTCGACCTC TAGCTAGAGC TTGGCGTAAT CATGGTCATA GCTGTTTCCT
    6051 GTGTGAAATT GTTATCCGCT CACAATTCCA CACAACATAC GAGCCGGAAG
    6101 CATAAAGTGT AAAGCCTGGG GTGCCTAATG AGTGAGCTAA CTCACATTAA
    6151 TTGCGTTGCG CTCACTGCCC GCTTTCCAGT CGGGAAACCT GTCGTGCCAG
    6201 CTGCATTAAT GAATCGGCCA ACGCGCGGGG AGAGGCGGTT TGCGTATTGG
    6251 GCGCTCTTCC GCTTCCTCGC TCACTGACTC GCTGCGCTCG GTCGTTCGGC
    6301 TGCGGCGAGC GGTATCAGCT CACTCAAAGG CGGTAATACG GTTATCCACA
    6351 GAATCAGGGG ATAACGCAGG AAAGAACATG TGAGCAAAAG GCCAGCAAAA
    6401 GGCCAGGAAC CGTAAAAAGG CCGCGTTGCT GGCGTTTTTC CATAGGCTCC
    6451 GCCCCCCTGA CGAGCATCAC AAAAATCGAC GCTCAAGTCA GAGGTGGCGA
    6501 AACCCGACAG GACTATAAAG ATACCAGGCG TTTCCCCCTG GAAGCTCCCT
    6551 CGTGCGCTCT CCTGTTCCGA CCCTGCCGCT TACCGGATAC CTGTCCGCCT
    6601 TTCTCCCTTC GGGAAGCGTG GCGCTTTCTC AATGCTCACG CTGTAGGTAT
    6651 CTCAGTTCGG TGTAGGTCGT TCGCTCCAAG CTGGGCTGTG TGCACGAACC
    6701 CCCCGTTCAG CCCGACCGCT GCGCCTTATC CGGTAACTAT CGTCTTGAGT
    6751 CCAACCCGGT AAGACACGAC TTATCGCCAC TGGCAGCAGC CACTGGTAAC
    6801 AGGATTAGGA GAGCGAGGTA TGTAGGCGGT GCTACAGAGT TCTTGAAGTG
    6851 GTGGCCTAAC TACGGCTACA CTAGAAGGAC AGTATTTGGT ATCTGCGCTC
    6901 TGCTGAAGCC AGTTACCTTC GGAAAAAGAG TTGGTAGCTC TTGATCCGGC
    6951 AAACAAACCA CCGCTGGTAG CGGTGGTTTT TTTGTTTGCA AGCAGCAGAT
    7001 TACGCGCAGA AAAAAAGGAT CTCAAGAAGA TCCTTTGATC TTTTCTACGG
    7051 GGTCTGACGC TCAGTGGAAC GAAAACTCAC GTTAAGGGAT TTTGGTCATG
    7101 AGATTATCAA AAAGGATCTT CACCTAGATC CTTTTAAATT AAAAATGAAG
    7151 TTTTAAATCA ATCTAAAGTA TATATGAGTA AACTTGGTCT GACAGTTACC
    7201 AATGCTTAAT CAGTGAGGCA CCTATCTCAG CGATCTGTCT ATTTCGTTCA
    7251 TCCATAGTTG CCTGACTCCC CGTCGTGTAG ATAACTACGA TACGGGAGGG
    7301 CTTACCATCT GGCCCCAGTG CTGCAATGAT ACCGCGAGAC CCACGCTCAC
    7351 CGGCTCCAGA TTTATCAGCA ATAAACCAGC CAGCCGGAAG GGCCGAGCGC
    7401 AGAAGTGGTC CTGCAACTTT ATCCGCCTCC ATCCAGTCTA TTAATTGTTG
    7451 CCGGGAAGCT AGAGTAAGTA GTTCGCCAGT TAATAGTTTG CGCAACGTTG
    7501 TTGCCATTGC TACAGGCATC GTGGTGTCAC GCTCGTCGTT TGGTATGGCT
    7551 TCATTCAGCT CCGGTTCCCA ACGATCAAGG CGAGTTACAT GATCCCCCAT
    7601 GTTGTGCAAA AAAGCGGTTA GCTCCTTCGG TCCTCCGATC GTTGTCAGAA
    7651 GTAAGTTGGC CGCAGTGTTA TCACTCATGG TTATGGCAGC ACTGCATAAT
    7701 TCTCTTACTG TCATGCCATC CGTAAGATGC TTTTCTGTGA CTGGTGAGTA
    7751 CTCAACCAAG TCATTCTGAG AATAGTGTAT GCGGCGACCG AGTTGCTCTT
    7801 GCCCGGCGTC AATACGGGAT AATACCGCGC CACATAGCAG AACTTTAAAA
    7851 GTGCTCATCA TTGGAAAACG TTCTTCGGGG CGAAAACTCT CAAGGATCTT
    7901 ACCGCTGTTG AGATCCAGTT CGATGTAACC CACTCGTGCA CCCAACTGAT
    7951 CTTCAGCATC TTTTACTTTC ACCAGCGTTT CTGGGTGAGC AAAAACAGGA
    8001 AGGCAAAATG CCGCAAAAAA GGGAATAAGG GCGACACGGA AATGTTGAAT
    8051 ACTCATACTC TTCCTTTTTC AATATTATTG AAGCATTTAT CAGGGTTATT
    8101 GTCTCATGAG CGGATACATA TTTGAATGTA TTTAGAAAAA TAAACAAATA
    8151 GGGGTTCCGC GCACATTTCC CCGAAAAGTG CCACCTGACG TC
  • [0251]
    [0251]
    TABLE 10
    Nucleotide sequence of the recombinant plasmid pIND-H-
    SemaL-EE (SEQ ID NO.:37)
       1 AGATCTCGGC CGCATATTAA GTGCATTGTT CTCGATACCG CTAAGTGCAT
      51 TGTTCTCGTT AGCTCGATGG ACAAGTGCAT TGTTCTCTTG CTGAAAGCTC
     101 GATGGACAAG TGCATTGTTC TCTTGCTGAA AGCTCGATGG ACAAGTGCAT
     151 TGTTCTCTTG CTGAAAGCTC AGTACCCGGG AGTACCCTCG ACCGCCGGAG
     201 TATAAATAGA GGCGCTTCGT CTACGGAGCG ACAATTCAAT TCAAACAAGC
     251 AAAGTGAACA CGTCGCTAAG CGAAAGCTAA GCAAATAAAC AAGCGCAGCT
     301 GAACAAGCTA AACAATCTGC AGTAAAGTGC AAGTTAAAGT GAATCAATTA
     351 AAAGTAACCA GCAACCAAGT AAATCAACTG CAACTACTGA AATCTGCCAA
     401 GAAGTAATTA TTGAATACAA GAAGAGAACT CTGAATACTT TCAACAAGTT
     451 ACCGAGAAAG AAGAACTCAC ACACAGCTAG CGTTTAAACT TAAGCTTGGT
     501 ACCGAGCTCG GATCCACTAG TCCAGTGTGG TGgaattcgg cttgggatga
     551 cgcctcctcc gcccggacgt gccgccccca gcgcaccgcg cgcccgcgtc
     601 cctggcccgc cggctcggtt ggggcttccg ctgcggctgc ggctgctgct
     651 gctgctctgg gcggccgccg cctccgccca gggccaccta aggagcggac
     701 cccgcatctt cgccgtctgg aaaggccatg tagggcagga ccgggtggac
     751 tttggccaga ctgagccgca cacggtgctt ttccacgagc caggcagctc
     801 ctctgtgtgg gtgggaggac gtggcaaggt ctacctcttt gacttccccg
     851 agggcaagaa cgcatctgtg cgcacggtga atatcggctc cacaaagggg
     901 tcctgtctgg ataagcggga ctgcgagaac tacatcactc tcctggagag
     951 gcggagtgag gggctgctgg cctgtggcac caacgcccgg caccccagct
    1001 gctggaacct ggtgaatggc actgtggtgc cacttggcga gatgagaggc
    1051 tacgccccct tcagcccgga cgagaactcc ctggttctgt ttgaagggga
    1101 cgaggtgtat tccaccatcc ggaagcagga atacaatggg aagatccctc
    1151 ggttccgccg catccggggc gagagtgagc tgtacaccag tgatactgtc
    1201 atgcagaacc cacagttcat caaagccacc atcgtgcacc aagaccaggc
    1251 ttacgatgac aagatctact acttcttccg agaggacaat cctgacaaga
    1301 atcctgaggc tcctctcaat gtgtcccgtg tggcccagtt gtgcaggggg
    1351 gaccagggtg gggaaagttc actgtcagtc tccaagtgga acacttttct
    1401 gaaagccatg ctggtatgca gtgatgctgc caccaacaag aacttcaaca
    1451 ggctgcaaga cgtcttcctg ctccctgacc ccagcggcca gtggagggac
    1501 accagggtct atggtgtttt ctccaacccc tggaactact cagccgtctg
    1551 tgtgtattcc ctcggtgaca ttgacaaggt cttccgtacc tcctcactca
    1601 agggctacca ctcaagcctt cccaacccgc ggcctggcaa gtgcctccca
    1651 gaccagcagc cgatacccac agagaccttc caggtggctg accgtcaccc
    1701 agaggtggcg cagagggtgg agcccatggg gcctctgaag acgccattgt
    1751 tccactctaa ataccactac cagaaagtgg ccgttcaccg catgcaagcc
    1801 agccacgggg agacctttca tgtgctttac ctaactacag acaggggcac
    1851 tatccacaag gtggtggaac cgggggagca ggagcacagc ttcgccttca
    1901 acatcatgga gatccagccc ttccgccgcg cggctgccat ccagaccatg
    1951 tcgctggatg ctgagcggag gaagctgtat gtgagctccc agtgggaggt
    2001 gagccaggtg cccctggacc tgtgtgaggt ctatggcggg ggctgccacg
    2051 gttgcctcat gtcccgagac ccctactgcg gctgggacca gggccgctgc
    2101 atctccatct acagctccga acggtcagtg ctgcaatcca ttaatccagc
    2151 cgagccacac aaggagtgtc ccaaccccaa accagacaag gccccactgc
    2201 agaaggtttc cctggcccca aactctcgct actacctgag ctgccccatg
    2251 gaatcccgcc acgccaccta ctcatggcgc cacaaggaga acgtggagca
    2301 gagctgcgaa cctggtcacc agagccccaa ctgcatcctg ttcatcgaga
    2351 acctcacggc gcagcagtac ggccactact tctgcgaggc ccaggagggc
    2401 tcctacttcc gcgaggctca gcactggcag ctgctgcccg aggacggcat
    2451 catggccgag cacctgctgg gtcatgcctg tgccctggct gcctccctct
    2501 ggctgggggt gctgcccaca ctcactcttg gcttgctggt ccacgtgaag
    2551 cttGGGCCCG TTTAAACCCG CTGATCAGCC TCGACTGTGC CTTCTAGTTG
    2601 CCAGCCATCT GTTGTTTGCC CCTCCCCCGT GCCTTCCTTG ACCCTGGAAG
    2651 GTGCCACTCC CACTGTCCTT TCCTAATAAA ATGAGGAAAT TGCATCGCAT
    2701 TGTCTGAGTA GGTGTCATTC TATTCTGGGG GGTGGGGTGG GGCAGGACAG
    2751 CAAGGGGGAG GATTGGGAAG ACAATAGCAG GCATGCTGGG GATGCGGTGG
    2801 GCTCTATGGC TTCTGAGGCG GAAAGAACCA GCTGGGGCTC TAGGGGGTAT
    2851 CCCCACGCGC CCTGTAGCGG CGCATTAAGC GCGGCGGGTG TGGTGGTTAC
    2901 GCGCAGCGTG ACCGCTACAC TTGCCAGCGC CCTAGCGCCC GCTCCTTTCG
    2951 CTTTCTTCCC TTCCTTTCTC GCCACGTTCG CCGGCTTTCC CCGTCAAGCT
    3001 CTAAATCGGG GCATCCCTTT AGGGTTCCGA TTTAGTGCTT TACGGCACCT
    3051 CGACCCCAAA AAACTTGATT AGGGTGATGG TTCACGTAGT GGGCCATCGC
    3101 CCTGATAGAC GGTTTTTCGC CCTTTGACGT TGGAGTCCAC GTTCTTTAAT
    3151 AGTGGACTCT TGTTCCAAAC TGGAACAACA CTCAACCCTA TCTCGGTCTA
    3201 TTCTTTTGAT TTATAAGGGA TTTTGGGGAT TTCGGCCTAT TGGTTAAAAA
    3251 ATGAGCTGAT TTAACAAAAA TTTAACGCGA ATTAATTCTG TGGAATGTGT
    3301 GTCAGTTAGG GTGTGGAAAG TCCCCAGGCT CCCCAGGCAG GCAGAAGTAT
    3351 GCAAAGCATG CATCTCAATT AGTCAGCAAC CAGGTGTGGA AAGTCCCCAG
    3401 GCTCCCCAGC AGGCAGAAGT ATGCAAAGCA TGCATCTCAA TTAGTCAGCA
    3451 ACCATAGTCC CGCCCCTAAC TCCGCCCATC CCGCCCCTAA CTCCGCCCAG
    3501 TTCCGCCCAT TCTCCGCCCC ATGGCTGACT AATTTTTTTT ATTTATGCAG
    3551 AGGCCGAGGC CGCCTCTGCC TCTGAGCTAT TCCAGAAGTA GTGAGGAGGC
    3601 TTTTTTGGAG GCCTAGGCTT TTGCAAAAAG CTCCCGGGAG CTTGTATATC
    3651 CATTTTCGGA TCTGATCAAG AGACAGGATG AGGATCGTTT CGCATGATTG
    3701 AACAAGATGG ATTGCACGCA GGTTCTCCGG CCGCTTGGGT GGAGAGGCTA
    3751 TTCGGCTATG ACTGGGCACA ACAGACAATC GGCTGCTCTG ATGCCGCCGT
    3801 GTTCCGGCTG TCAGCGCAGG GGCGCCCGGT TCTTTTTGTC AAGACCGACC
    3851 TGTCCGGTGC CCTGAATGAA CTGCAGGACG AGGCAGCGCG GCTATCGTGG
    3901 CTGGCCACGA CGGGCGTTCC TTGCGCAGCT GTGCTCGACG TTGTCACTGA
    3951 AGCGGGAAGG GACTGGCTGC TATTGGGCGA AGTGCCGGGG CAGGATCTCC
    4001 TGTCATCTCA CCTTGCTCCT GCCGAGAAAG TATCCATCAT GGCTGATGCA
    4051 ATGCGGCGGC TGCATACGCT TGATCCGGCT ACCTGCCCAT TCGACCACCA
    4101 AGCGAAACAT CGCATCGAGC GAGCACGTAC TCGGATGGAA GCCGGTCTTG
    4151 TCGATCAGGA TGATCTGGAC GAAGAGCATC AGGGGCTCGC GCCAGCCGAA
    4201 CTGTTCGCCA GGCTCAAGGC GCGCATGCCC GACGGCGAGG ATCTCGTCGT
    4251 GACCCATGGC GATGCCTGCT TGCCGAATAT CATGGTGGAA AATGGCCGCT
    4301 TTTCTGGATT CATCGACTGT GGCCGGCTGG GTGTGGCGGA CCGCTATCAG
    4351 GACATAGCGT TGGCTACCCG TGATATTGCT GAAGAGCTTG GCGGCGAATG
    4401 GGCTGACCGC TTCCTCGTGC TTTACGGTAT CGCCGCTCCC GATTCGCAGC
    4451 GCATCGCCTT CTATCGGCTT CTTGACGAGT TCTTCTGAGC GGGACTCTGG
    4501 GGTTCGAAAT GACCGACCAA GCGACGCCCA ACCTGCCATC ACGAGATTTC
    4551 GATTCCACCG CCGCCTTCTA TGAAAGGTTG GGCTTCGGAA TCGTTTTCCG
    4601 GGACGCCGGC TGGATGATCC TCCAGCGCGG GGATCTCATG CTGGAGTTCT
    4651 TCGCCCACCC CAACTTGTTT ATTGCAGCTT ATAATGGTTA CAAATAAAGC
    4701 AATAGCATCA CAAATTTCAC AAATAAAGCA TTTTTTTCAC TGCATTCTAG
    4751 TTGTGGTTTG TCCAAACTCA TCAATGTATC TTATCATGTC TGTATACCGT
    4801 CGACCTCTAG CTAGAGCTTG GCGTAATCAT GGTCATAGCT GTTTCCTGTG
    4851 TGAAATTGTT ATCCGCTCAC AATTCCACAC AACATACGAG CCGGAAGCAT
    4901 AAAGTGTAAA GCCTGGGGTG CCTAATGAGT GAGCTAACTC ACATTAATTG
    4951 CGTTGCGCTC ACTGCCCGCT TTCCAGTCGG GAAACCTGTC GTGCCAGCTG
    5001 CATTAATGAA TCGGCCAACG CGCGGGGAGA GGCGGTTTGC GTATTGGGCG
    5051 CTCTTCCGCT TCCTCGCTCA CTGACTCGCT GCGCTCGGTC GTTCGGCTGC
    5101 GGCGAGCGGT ATCAGCTCAC TCAAAGGCGG TAATACGGTT ATCCACAGAA
    5151 TCAGGGGATA ACGCAGGAAA GAACATGTGA GCAAAAGGCC AGCAAAAGGC
    5201 CAGGAACCGT XAAAAGGCCG CGTTGCTGGC GTTTTTCCAT AGGCTCCGCC
    5251 CCCCTGACGA GCATCACAAA AATCGACGCT CAAGTCAGAG GTGGCGAAAC
    5301 CCGACAGGAC TATAAAGATA CCAGGCGTTT CCCCCTGGAA GCTCCCTCGT
    5351 GCGCTCTCCT GTTCCGACCC TGCCGCTTAC CGGATACCTG TCCGCCTTTC
    5401 TCCCTTCGGG AAGCGTGGCG CTTTCTCAAT GCTCACGCTG TAGGTATCTC
    5451 AGTTCGGTGT AGGTCGTTCG CTCCAAGCTG GGCTGTGTGC ACGAACCCCC
    5501 CGTTCAGCCC GACCGCTGCG CCTTATCCGG TAACTATCGT CTTGAGTCCA
    5551 ACCCGGTAAG ACACGACTTA TCGCCACTGG CAGCAGCCAC TGGTAACAGG
    5601 ATTAGCAGAG CGAGGTATGT AGGCGGTGCT ACAGAGTTCT TGAAGTGGTG
    5651 GCCTAACTAC GGCTACACTA GAAGGACAGT ATTTGGTATC TGCGCTCTGC
    5701 TGAAGCCAGT TACCTTCGGA AAAAGAGTTG GTAGCTCTTG ATCCGGCAAA
    5751 CAAACCACCG CTGGTAGCGG TGGTTTTTTT GTTTGCAAGC AGCAGATTAC
    5801 GCGCAGAAAA AAAGGATCTC AAGAAGATCC TTTGATCTTT TCTACGGGGT
    5851 CTGACGCTCA GTGGAACGAA AACTCACGTT AAGGGATTTT GGTCATGAGA
    5901 TTATCAAAAA GGATCTTCAC CTAGATCCTT TTAAATTAAA AATGAAGTTT
    5951 TAAATCAATC TAAAGTATAT ATGAGTAAAC TTGGTCTGAC AGTTACCAAT
    6001 GCTTAATCAG TGAGGCACCT ATCTCAGCGA TCTGTCTATT TCGTTCATCC
    6051 ATAGTTGCCT GACTCCCCGT CGTGTAGATA ACTACGATAC GGGAGGGCTT
    6101 ACCATCTGGC CCCAGTGCTG CAATGATACC GCGAGACCCA CGCTCACCGG
    6151 CTCCAGATTT ATCAGCAATA AACCAGCCAG CCGGAAGGGC CGAGCGCAGA
    6201 AGTGGTCCTG CAACTTTATC CGCCTCCATC CAGTCTATTA ATTGTTGCCG
    6251 GGAAGCTAGA GTAAGTAGTT CGCCAGTTAA TAGTTTGCGC AACGTTGTTG
    6301 CCATTGCTAC AGGCATCGTG GTGTCACGCT CGTCGTTTGG TATGGCTTCA
    6351 TTCAGCTCCG GTTCCCAACG ATCAAGGCGA GTTACATGAT CCCCCATGTT
    6401 GTGCAAAAAA GCGGTTAGCT CCTTCGGTCC TCCGATCGTT GTCAGAAGTA
    6451 AGTTGGCCGC AGTGTTATCA CTCATGGTTA TGGCAGCACT GCATAATTCT
    6501 CTTACTGTCA TGCCATCCGT AAGATGCTTT TCTGTGACTG GTGAGTACTC
    6551 AACCAAGTCA TTCTGAGAAT AGTGTATGCG GCGACCGAGT TGCTCTTGCC
    6601 CGGCGTCAAT ACGGGATAAT ACCGCGCCAC ATAGCAGAAC TTTAAAAGTG
    6651 CTCATCATTG GAAAACGTTC TTCGGGGCGA AAACTCTCAA GGATCTTACC
    6701 GCTGTTGAGA TCCAGTTCGA TGTAACCCAC TCGTGCACCC AACTGATCTT
    6751 CAGCATCTTT TACTTTCACC AGCGTTTCTG GGTGAGCAAA AACAGGAAGG
    6801 CAAAATGCCG CAAAAAAGGG AATAAGGGCG ACACGGAAAT GTTGAATACT
    6851 CATACTCTTC CTTTTTCAAT ATTATTGAAG CATTTATCAG GGTTATTGTC
    6901 TCATGAGCGG ATACATATiT GAATGTATTT AGAAAAATAA ACAAATAGGG
    6951 GTTCCGCGCA CATTTCCCCG AAAAGTGCCA CCTGACGTCG ACGGATGGGG
  • [0252]
    [0252]
    TABLE 1
    Nucleotide sequence of the recombinant plasmid pIN D-H-
    SemaL-EA (SEQ ID NO.:38)
       1 AGATCTCGGC CGCATATTAA GTGCATTGTT CTCGATACCG CTAAGTGCAT
      51 TGTTCTCGTT AGCTCGATGG ACAAGTGCAT TGTTCTCTTG CTGAAAGCTC
     101 GATGGACAAG TGCATTGTTC TCTTGCTGAA AGCTCGATGG ACAAGTGCAT
     151 TGTTCTCTTG CTGAAAGCTC AGTACCCGGG AGTACCCTCG ACCGCCGGAG
     201 TATAAATAGA GGCGCTTCGT CTACGGAGCG ACAATTCAAT TCAAACAAGC
     251 AAAGTGAACA CGTCGCTAAG CGAAAGCTAA GCAAATAAAC AAGCGCAGCT
     301 GAACAAGCTA AACAATCTGC AGTAAAGTGC AAGTTAAAGT GAATCAATTA
     351 AAAGTAACCA GCAACCAAGT AAATCAACTG CAACTACTGA AATCTGCCAA
     401 GAAGTAATTA TTGAATACAA GAAGAGAACT CTGAATACTT TCAACAAGTT
     451 ACCGAGAAAG AAGAACTCAC ACACAGCTAG CGTTTAAACT TAAGCTTGGT
     501 ACCGAGCTCG GATCCACTAG TCCAGTGTGG TGgaattcgg cttgggatga
     551 cgcctcctcc gcccggacgt gccgccccca gcgcaccgcg cgcccgcgtc
     601 cctggcccgc cggctcggtt ggggcttccg ctgcggctgc ggctgctgct
     651 gctgctctgg gcggccgccg cctccgccca gggccaccta aggagcggac
     701 cccgcatctt cgccgtctgg aaaggccatg tagggcagga ccgggtggac
     751 tttggccaga ctgagccgca cacggtgctt ttccacgagc caggcagctc
     801 ctctgtgtgg gtgggaggac gtggcaaggt ctacctcttt gacttccccg
     851 agggcaagaa cgcatctgtg cgcacggtga atatcggctc cacaaagggg
     901 tcctgtctgg ataagcggga ctgcgagaac tacatcactc tcctggagag
     951 gcggagtgag gggctgctgg cctgtggcac caacgcccgg caccccagct
    1001 gctggaacct ggtgaatggc actgtggtgc cacttggcga gatgagaggc
    1051 tacgccccct tcagcccgga cgagaactcc ctggttctgt ttgaagggga
    1101 cgaggtgtat tccaccatcc ggaagcagga atacaatggg aagatccctc
    1151 ggttccgccg catccggggc gagagtgagc tgtacaccag tgatactgtc
    1201 atgcagaacc cacagttcat caaagccacc atcgtgcacc aagaccaggc
    1251 ttacgatgac aagatctact acttcttccg agaggacaat cctgacaaga
    1301 atcctgaggc tcctctcaat gtgtcccgtg tggcccagtt gtgcaggggg
    1351 gaccagggtg gggaaagttc actgtcagtc tccaagtgga acacttttct
    1401 gaaagccatg ctggtatgca gtgatgctgc caccaacaag aacttcaaca
    1451 ggctgcaaga cgtcttcctg ctccctgacc ccagcggcca gtggagggac
    1501 accagggtct atggtgtttt ctccaacccc tggaactact cagccgtctg
    1551 tgtgtattcc ctcggtgaca ttgacaaggt cttccgtacc tcctcactca
    1601 agggctacca ctcaagcctt cccaacccgc ggcctggcaa gtgcctccca
    1651 gaccagcagc cgatacccac agagaccttc caggtggctg accgtcaccc
    1701 agaggtggcg cagagggtgg agcccatggg gcctctgaag acgccattgt
    1751 tccactctaa ataccactac cagaaagtgg ccgttcaccg catgcaagcc
    1801 agccacgggg agacctttca tgtgctttac ctaactacag acaggggcac
    1851 tatccacaag gtggtggaac cgggggagca ggagcacagc ttcgccttca
    1901 acatcatgga gatccagccc ttccgccgcg cggctgccat ccagaccatg
    1951 tcgctggatg ctgagcggag gaagctgtat gtgagctccc agtgggaggt
    2001 gagccaggtg cccctggacc tgtgtgaggt ctatggcggg ggctgccacg
    2051 gttgcctcat gtcccgagac ccctactgcg gctgggacca gggccgctgc
    2101 atctccatct acagctccga acggtcagtg ctgcaatcca ttaatccagc
    2151 cgagccacac aaggagtgtc ccaaccccaa accagacaag gccccactgc
    2201 agaaggtttc cctggcccca aactctcgct actacctgag ctgccccatg
    2251 gaatcccgcc acgccaccta ctcatggcgc cacaaggaga acgtggagca
    2301 gagctgcgaa cctggtcacc agagccccaa ctgcatcctg ttcatcgaga
    2351 acctcacggc gcagcagtac ggccactact tctgcgaggc ccaggagggc
    2401 tcctacttcc gcgaggctca gcactggcag ctgctgcccg aggacggcat
    2451 catggccgag cacctgctgg gtcatgcctg tgccctggct gcctccctct
    2501 ggctgggggt gctgcccaca ctcactcttg gcttgctggt ccacgtgaag
    2551 cttGGGCCCG AACAAAAACT CATCTCAGAA GAGGATCTGA ATAGCGCCGT
    2601 CGACCATCAT CATCATCATC ATTGAGTTTA TCCAGCACAG TGGCGGCCGC
    2651 TCGAGTCTAG AGGGCCCGTT TAAACCCGCT GATCAGCCTC GACTGTGCCT
    2701 TCTAGTTGCC AGCCATCTGT TGTTTGCCCC TCCCCCGTGC CTTCCTTGAC
    2751 CCTGGAAGGT GCCACTCCCA CTGTCCTTTC CTAATAAAAT GAGGAAATTG
    2801 CATCGCATTG TCTGAGTAGG TGTCATTCTA TTCTGGGGGG TGGGGTGGGG
    2851 CAGGACAGCA AGGGGGAGGA TTGGGAAGAC AATAGCAGGC ATGCTGGGGA
    2901 TGCGGTGGGC TCTATGGCTT CTGAGGCGGA AAGAACCAGC TGGGGCTCTA
    2951 GGGGGTATCC CCACGCGCCC TGTAGCGGCG CATTAAGCGC GGCGGGTGTG
    3001 GTGGTTACGC GCAGCGTGAC CGCTACACTT GCCAGCGCCC TAGCGCCCGC
    3051 TCCTTTCGCT TTCTTCCCTT CCTTTCTCGC CACGTTCGCC GGCTTTCCCC
    3101 GTCAAGCTCT AAATCGGGGC ATCCCTTTAG GGTTCCGATT TAGTGCTTTA
    3151 CGGCACCTCG ACCCCAAAAA ACTTGATTAG GGTGATGGTT CACGTAGTGG
    3201 GCCATCGCCC TGATAGACGG TTTTTCGCCC TTTGACGTTG GAGTCCACGT
    3251 TCTTTAATAG TGGACTCTTG TTCCAAACTG GAACAACACT CAACCCTATC
    3301 TCGGTCTATT CTTTTGATTT ATAAGGGATT TTGGGGATTT CGGCCTATTG
    3351 GTTAAAAAAT GAGCTGATTT AACAAAAATT TAACGCGAAT TAATTCTGTG
    3401 GAATGTGTGT CAGTTAGGGT GTGGAAAGTC CCCAGGCTCC CCAGGCAGGC
    3451 AGAAGTATGC AAAGCATGCA TCTCAATTAG TCAGCAACCA GGTGTGGAAA
    3501 GTCCCCAGGC TCCCCAGCAG GCAGAAGTAT GCAAAGCATG CATCTCAATT
    3551 AGTCAGCAAC CATAGTCCCG CCCCTAACTC CGCCCATCCC GCCCCTAACT
    3601 CCGCCCAGTT CCGCCCATTC TCCGCCCCAT GGCTGACTAA TTTTTTTTAT
    3651 TTATGCAGAG GCCGAGGCCG CCTCTGCCTC TGAGCTATTC CAGAAGTAGT
    3701 GAGGAGGCTT TTTTGGAGGC CTAGGCTTTT GCAAAAAGCT CCCGGGAGCT
    3751 TCTATATCCA TTTTCGGATC TGATCAAGAG ACAGGATGAG GATCGTTTCG
    3801 CATGATTGAA CAAGATGGAT TGCACGCAGG TTCTCCGGCC GCTTGGGTGG
    3851 AGAGGCTATT CGGCTATGAC TGGGCACAAC AGACAATCGG CTGCTCTGAT
    3901 GCCGCCGTGT TCCGGCTGTC AGCGCAGGGG CGCCCGGTTC TTT1TGTCAA
    3951 GACCGACCTG TCCGGTGCCC TGAATGAACT GCAGGACGAG GCAGCGCGGC
    4001 TATCGTGGCT GGCCACGACG GGCGTTCCTT GCGCAGCTGT GCTCGACGTT
    4051 GTCACTGAAG CGGGAAGGGA CTGGCTGCTA TTGGGCGAAG TGCCGGGGCA
    4101 GGATCTCCTG TCATCTCACC TTGCTCCTGC CGAGAAAGTA TCCATCATGG
    4151 CTGATGCAAT GCGGCGGCTG CATACGCTTG ATCCGGCTAC CTGCCCATTC
    4201 GACCACCAAG CGAAACATCG CATCGAGCGA GCACGTACTC GGATGGAAGC
    4251 CGGTCTTGTC GATCAGGATG ATCTGGACGA AGAGCATCAG GGGCTCGCGC
    4301 CAGCCGAACT GTTCGCCAGG CTCAAGGCGC GCATGCCCGA CGGCGAGGAT
    4351 CTCGTCGTGA CCCATGGCGA TGCCTGCTTG CCGAATATCA TGGTGGAAAA
    4401 TGGCCGCTTT TCTGGATTCA TCGACTGTGG CCGGCTGGGT GTGGCGGACC
    4451 GCTATCAGGA CATAGCGTTG GCTACCCGTG ATATTGCTGA AGAGCTTGGC
    4501 GGCGAATGGG CTGACCGCTT CCTCGTGCTT TACGGTATCG CCGCTCCCGA
    4551 TTCGCAGCGC ATCGCCTTCT ATCGCC1TCT TGACGAGTTC TTCTGAGCGG
    4601 GACTCTGGGG TTCGAAATGA CCGACCAAGC GACGCCCAAC CTGCCATCAC
    4651 GAGATTTCGA TTCCACCGCC GCCTTCTATG AAAGGTTGGG CTTCGGAATC
    4701 GTTTTCCGGG ACGCCGGCTG GATGATCCTC CAGCGCGGGG ATCTCATGCT
    4751 GGAGTTCTTC GCCCACCCCA ACTTGTTTAT TGCAGCTTAT AATGGTTACA
    4801 AATAAAGCAA TAGGATCACA AATTTCACAA ATAAAGCATT TTTTTCACTG
    4851 CATTCTAGTT GTGGTTTGTC CAAACTCATC AATGTATCTT ATCATGTCTG
    4901 TATACCGTCG ACCTCTAGCT AGAGCTTGGC GTAATCATGG TCATAGCTGT
    4951 TTCCTGTGTG AAATTGTTAT CCGCTCACAA TTCCACACAA CATACGAGCC
    5001 GGAAGCATAA AGTGTAAAGC CTGGGGTGCC TAATGAGTGA GCTAACTCAC
    5051 ATTAATTGCG TTGCGCTCAC TGCCCGCTTT CCAGTCGGGA AACCTGTCGT
    5101 GCCAGCTGCA TTAATGAATC GGCCAACGCG CGGGGAGAGG CGGTTTGCGT
    5151 ATTGGGCGCT CTTCCGCTTC CTCGCTCACT GACTCGCTGC GCTCGGTCGT
    5201 TCGGCTGCGG CGAGCGGTAT CAGCTCACTC AAAGGCGGTA ATACGGTTAT
    5251 CCACAGAATC AGGGGATAAC GCAGGAAAGA ACATGTGAGC AAAAGGCCAG
    5301 CAAAAGGCCA GGAACCGTAA AAAGGCCGCG TTGCTGGCGT TTTTCCATAG
    5351 GCTCCGCCCC CCTGACGAGC ATCACAAAAA TCGACGCTCA AGTCAGAGGT
    5401 GGCGAAACCC GACAGGACTA TAAAGATACC AGGCGTTTCC CCCTGGAAGC
    5451 TCCCTCGTGC GCTCTCCTGT TCCGACCCTG CCGCTTACCG GATACCTGTC
    5501 CGCCTTTCTC CCTTCGGGAA GCGTGGCGCT TTCTCAATGC TCACGCTGTA
    5551 GGTATCTCAG TTCGGTGTAG GTCGTTCGCT CCAAGCTGGG CTGTGTGCAC
    5601 GAACCCCCCG TTCAGCCCGA CCGCTGCGCC TTATCCGGTA ACTATCGTCT
    5651 TGAGTCCAAC CCGGTAAGAC ACGACTTATC GCCACTGGCA GCAGCCACTG
    5701 GTAACAGGAT TAGCAGAGCG AGGTATGTAG GCGGTGCTAC AGAGTTCTTG
    5751 AAGTGGTGGC CTAACTACGG CTACACTAGA AGGACAGTAT TTGGTATCTG
    5801 CGCTCTGCTG AAGCCAGTTA CCTTCGGAAA AAGAGTTGGT AGCTCTTGAT
    5851 CCGGCAAACA AACCACCGCT GGTAGCGGTG GTTTTTTTGT TTGCAAGCAG
    5901 CAGATTACGC GCAGAAAAAA AGGATCTCAA GAAGATCCTT TGATCTTTTC
    5951 TACGGGGTCT GACGCTCAGT GGAACGAAAA CTCACGTTAA GGGATTTTGG
    6001 TCATGAGATT ATCAAAAAGG ATCTTCACCT AGATCCTTTT AAATTAAAAA
    6051 TGAAGTTTTA AATCAATCTA AAGTATATAT GAGTAAACTT GGTCTGACAG
    6101 TTACCAATGC TTAATCAGTG AGGCACCTAT CTCAGCGATC TGTCTATTTC
    6151 GTTCATCCAT AGTTGCCTGA CTCCCCGTCG TGTAGATAAC TACGATACGG
    6201 GAGGGCTTAC CATCTGGCCC CAGTGCTGCA ATGATACCGC GAGACCCACG
    6251 CTCACCGGCT CCAGATTTAT CAGCAATAAA CCAGCCAGCC GGAAGGGCCG
    6301 AGCGCAGAAG TGGTCCTGCA ACTTTATCCG CCTCCATCCA GTCTATTAAT
    6351 TGTTGCCGGG AAGCTAGAGT AAGTAGTTCG CCAGTTAATA GTTTGCGCAA
    6401 CGTTGTTGCC ATTGCTACAG GCATCGTGGT GTCACGCTCG TCGTTTGGTA
    6451 TGGCTTCATT CAGCTCCGGT TCCCAACGAT CAAGGCGAGT TACATGATCC
    6501 CCCATGTTGT GCAAAAAAGC GGTTAGCTCC TTCGGTCCTC CGATCGTTGT
    6551 CAGAAGTAAG TTGGCCGCAG TGTTATCACT CATGGTTATG GCAGCACTGC
    6601 ATAATTCTCT TACTGTCATG CCATCCGTAA GATGCTTTTC TGTGACTGGT
    6651 GAGTACTCAA CCAAGTCATT CTGAGAATAG TGTATGCGGC GACCGAGTTG
    6701 CTCTTGCCCG GCGTCAATAC GGGATAATAC CGCGCCACAT AGCAGAACTT
    6751 TAAAAGTGCT CATCATTGGA AAACGTTCTT CGGGGCGAAA ACTCTCAAGG
    6801 ATCTTACCGC TGTTGAGATC CAGTTCGATG TAACCCACTC GTGCACCCAA
    6851 CTGATCTTCA GCATCTTTTA CTTTCACCAG CGTTTCTGGG TGAGCAAAAA
    6901 CAGGAAGGCA AAATGCCGCA AAAAAGGGAA TAAGGGCGAC ACGGAAATGT
    6951 TGAATACTCA TACTCTTCCT TTTTCAATAT TATTGAAGCA TTTATCAGGG
    7001 TTATTGTCTC ATGAGCGGAT ACATATTTGA ATGTATTTAG AAAAATAAAC
    7051 AAATAGGGGT TCCGCGCACA TTTCCCCGAA AAGTGCCACC TGACGTCGAC
    7101 GGATCGGG
  • [0253]
    [0253]
    TABLE 12
    Sequence of the recombinant plasmid pQE30-H-SemaL-BH
    (SEQ ID NO.:39)
       1 CTCGAGAAAT CATAAAAAAT TTATTTGCTT TGTGAGCGGA TAACAATTAT
      51 AATAGATTCA ATTGTGAGCG GATAACAATT TCACACAGAA TTCATTAAAG
     101 AGGAGAAATT AACTATGAGA GGATCGCATC ACCATCACCA TCACGGAtcc
     151 ctggttctgt ttgaagggga cgaggtgtat tccaccatcc ggaagcagga
     201 atacaatggg aagatccctc ggttccgccg catccggggc gagagtgagc
     251 tgtacaccag tgatactgtc atgcagaacc cacagttcat caaagccacc
     301 atcgtgcacc aagaccaggc ttacgatgac aagatctact acttcttccg
     351 agaggacaat cctgacaaga atcctgaggc tcctctcaat gtgtcccgtg
     401 tggcccagtt gtgcaggggg gaccagggtg gggaaagttc actgtcagtc
     451 tccaagtgga acacttttct gaaagccatg ctggtatgca gtgatgctgc
     501 caccaacaag aacttcaaca ggctgcaaga cgtcttcctg ctccctgacc
     551 ccagcggcca gtggagggac accagggtct atggtgtttt ctccaacccc
     601 tggaactact cagccgtctg tgtgtattcc ctcggtgaca ttgacaaggt
     651 cttccgtacc tcctcactca agggctacca ctcaagcctt cccaacccgc
     701 ggcctggcaa gtgcctccca gaccagcagc cgatacccac agaAAGCTTA
     751 ATTAGCTGAG CTVGGACTCC TGTTGATAGA TCCAGTAATG ACCTCAGAAC
     801 TCCATCTGGA TTTGTTCAGA ACGCTCGGTT GCCGCCGGGC GTTTTTTATT
     851 GGTGAGAATC CAAGCTAGCT TGGCGAGATT TTCAGGAGCT AAGGAAGCTA
     901 AAATGGAGAA AAAAATCACT GGATATACCA CCGTTGATAT ATCCCAATGG
     951 CATCGTAAAG AACATTTTGA GGCATTTCAG TCAGTTGCTC AATGTACCTA
    1001 TAACCAGACC GTTCAGCTGG ATATTACGGG CTTTTTAAAG ACCGTAAAGA
    1051 AAAATAAGCA CAAGTTTTAT CCGGCCTTTA TTCACATTCT TGCCCGCCTG
    1101 ATGAATGCTC ATCCGGAATT TCGTATGGCA ATGAAAGACG GTGAGCTGGT
    1151 GATATGGGAT AGTGTTCACC CTTGTTACAC CGTTTTCCAT GAGCAAACTG
    1201 AAACGTTTTC ATCGCTCTGG AGTGAATACC ACGACGATTT CCGGCAGTTT
    1251 CTACACATAT ATTCGCAAGA TGTGGCGTGT TACGGTGAAA ACCTGGCCTA
    1301 TTTCCCTAAA GGGTTTATTG AGAATATGTT TTTCGTCTCA GCCAATCCCT
    1351 GGGTGAGTTT CACCAGTTTT GATTTAAACG TGGCCAATAT GGACAACTTC
    1401 TTCGCCCCCG TTTTCACCAT GGGCAAATAT TATACGCAAG GCGACAAGGT
    1451 GCTGATGCCG CTGGCGATTC AGGTTCATCA TGCCGTCTGT GATGGCTTCC
    1501 ATGTCGGCAG AATGCTTAAT GAATTACAAC AGTACTGCGA TGAGTGGCAG
    1551 GGCGGGGCGT AATTTTTTTA AGGCAGTTAT TGGTGCCCTT AAACGCCTGG
    1601 GGTAATGACT CTCTAGCTTG AGGCATCAAA TAAAACGAAA GGCTCAGTCG
    1651 AAAGACTGGG CCTTTCGTTT TATCTGTTGT TTGTCGGTGA ACGCTCTCCT
    1701 GAGTAGGACA AATCCGCCGC TCTAGAGCTG CCTCGCGCGT TTCGGTGATG
    1751 ACGGTGAAAA CCTCTGACAC ATGCAGCTCC CGGAGACGGT CACAGCTTGT
    1801 CTGTAAGCGG ATGCCGGGAG CAGACAAGCC CGTCAGGGCG CGTCAGCGGG
    1851 TGTTGGCGGG TGTCGGGGCG CAGCCATGAC CCAGTCACGT AGCGATAGCG
    1901 GAGTGTATAC TGGCTTAACT ATGCGGCATC AGAGCAGATT GTACTGAGAG
    1951 TGCACCATAT GCGGTGTGAA ATACCGCACA GATGCGTAAG GAGAAAATAC
    2001 CGCATCAGGC GCTCTTCCGC TTCCTCGCTC ACTGACTCGC TGCGCTCGGT
    2051 CTGTCGGCTG CGGCGAGCGG TATCAGCTCA CTCAAAGGCG GTAATACGGT
    2101 TATCCACAGA ATCAGGGGAT AACGCAGGAA AGAACATGTG AGCAAAAGGC
    2151 CAGCAAAAGG CCAGGAACCG TAAAAAGGCC GCGTTGCTGG CGTTTTTCCA
    2201 TAGGCTCCGC CCCCCTGACG AGCATCACAA AAATCGACGG TCAAGTCAGA
    2251 GGTGGCGAAA CCCGACAGGA CTATAAAGAT ACCAGGCGTT TCCCCCTGGA
    2301 AGCTCCCTCG TGCGCTCTCC TGTTCCGACC CTGCCGCTTA CCGGATACCT
    2351 GTCCGCCTTT CTCCCTTCGG GAAGCGTGGC GCTTTCTCAA TGCTCACGCT
    2401 GTAGGTATCT CAGTTCGGTG TAGGTCGTTC GCTCCAAGCT GGGCTGTGTG
    2451 CACGAACCCC CCGTTCAGCC CGACCGCTGC GCCTTATCCG GTAACTATCG
    2501 TCTTGAGTCC AACCCGGTAA GACACGACTT ATCGCCACTG GCAGCAGCCA
    2551 CTGGTAACAG GATTAGCAGA GCGAGGTATG TAGGCGGTGC TACAGAGTTC
    2601 TTGAAGTGGT GGCCTAACTA CGGCTACACT AGAAGGACAG TATTTGGTAT
    2651 CTGCGCTCTG CTGAAGCCAG TTACCTTCGG AAAAAGAGTT GGTAGCTCTT
    2701 GATCCGGCAA ACAAACCACC GCTGGTAGCG GTGGTTTTTT TGTTTGCAAG
    2751 CAGGAGATTA CGCGCAGAAA AAAAGGATCT CAAGAAGATC CTTTGATCTT
    2801 TVCTACGGGG TCTGACGCTC AGTGGAACGA AAACTCACGT TAAGGGATTT
    2851 TGGTCATGAG ATTATCAAAA AGGATCTTCA CCTAGATCCT TTTAAATTAA
    2901 AAATGAAGTT TTAAATCAAT CTAAAGTATA TATGAGTAAA CTTGGTCTGA
    2951 CAGTTACCAA TGCTTAATCA GTGAGGCACC TATCTCAGCG ATCTGTCTAT
    3001 TTCGTTCATC CATAGCTGCC TGACTCCCCG TCGTGTAGAT AACTACGATA
    3051 CGGGAGGGCT TACCATCTGG CCCCAGTGCT GCAATGATAC CGCGAGACCC
    3101 ACGCTCACCG GCTCCAGATT TATCAGCAAT AAACCAGCCA GCCGGAAGGG
    3151 CCGAGCGCAG AAGTGGTCCT GCAACTTTAT CCGCCTCCAT CCAGTCTATT
    3201 AATTGTTGCC GGGAAGCTAG AGTAAGTAGT TCGCCAGTTA ATAGTTTGCG
    3251 CAACGTTGTT GCCATTGCTA CAGGCATCGT GGTGTCACGC TCGTCGTTTG
    3301 GTATGGCTTC ATTCAGCTCC GGTTCCCAAC GATCAAGGCG AGTTACATGA
    3351 TCCCCCATGT TGTGCAAAAA AGCGGTTAGC TCCTTCGGTC CTCCGATCGT
    3401 TGTCAGAAGT AAGTTGGCCG CAGTGTTATC ACTCATGGTT ATGGCAGCAC
    3451 TGCATAATTC TCTTACTGTC ATGCCATCCG TAAGATGCTT TTCTGTGACT
    3501 GGTGAGTACT CAACCAAGTC ATTCTGAGAA TAGTGTATGC GGCGACCGAG
    3551 TTGCTCTTGC CCGGCGTCAA TACGGGATAA TACCGCGCCA CATAGCAGAA
    3601 CTTTAAAAGT GCTCATCATT GGAAAACGTT CTTCGGGGCG AAAACTCTCA
    3651 AGGATCTTAC CGCTGTTGAG ATCCAGTTCG ATGTAACCCA CTCGTGCACC
    3701 CAACTGATCT TCAGCATCTT TTACTTTCAC CAGCGTTTCT GGGTGAGCAA
    3751 AAACAGGAAG GCAAAATGCC GCAAAAAAGG GAATAAGGGC GACACGGAAA
    3801 TGTTGAATAC TCATACTCTT CCTTTTTCAA TATTATTGAA GCATTTATCA
    3851 GGGTTATTGT CTCATGAGCG GATACATATT TGAATGTATT TAGAAAAATA
    3901 AACAAATAGG GGTTCCGCGC ACATTTCCCC GAAAAGTGCC ACCTGACGTC
    3951 TAAGAAACCA TTATTATCAT GACATTAACC TATAAAAATA GGCGTATCAC
    4001 GAGGCCCTTT CGTCTTCAC
  • [0254]
    [0254]
    TABLE 13
    Sequence of the recombinant plasmid pQE3I-H-SemaL-SH
    (SEQ ID NO.:40)
       1 CTCGAGAAAT CATAAAAAAT TTATTTGCTT TGTGAGCGGA TAACAATTAT
      51 AATAGATTCA ATTGTGAGCG GATAACAATT TCACACAGAA TTCATTAAAG
     101 AGGAGAAATT AACTATGAGA GGATCGCATC ACCATCACCA TCACACGGAT
     151 CCGCATGCga gctcccagtg ggaggtgagc caggtgcccc tggacctgtg
     201 tgaggtctat ggcgggggct gccacggttg cctcatgtcc cgagacccct
     251 actgcggctg ggaccagggc cgctgcatct ccatctaoag ctccgaacgg
     301 tcagtgctgc aatccattaa tccagccgag ccacacaagg agtgtcccaa
     351 ccccaaacca gacaaggccc cactgcagaa ggtttccctg gccccaaact
     401 ctcgctacta cctgagctgc cccatggaat cccgccacgc cacctactca
     451 tggcgccaca aggagaacgt ggagcagagc tgcgaacctg gtcaccagag
     501 ccccaactgc atcctgttca tcgagaacct cacggcgcag cagtacggcc
     551 actacttctg cgaggcccag gagggctcct acttccgcga ggctcagcac
     601 tggcagctgc tgcccgagga cggcatcatg gccgagcacc tgctgggtca
     651 tgcctgtgcc ctggctgcct ccctctggct gggggtgctg cccacactca
     701 ctcttggctt gctggtccac gtgaagcttA ATTAGCTGAG CTTGGACTCC
     751 TGTTGATAGA TCCAGTAATG ACCTCAGAAC TCCATCTGGA TTTGTTCAGA
     801 ACGCTCGGTT GCCGCCGGGC GTTTTTTATT GGTGAGAATC CAAGCTAGCT
     851 TGGCGAGATT TTCAGGAGCT AAGGAAGCTA AAATGGAGAA AAAAATCACT
     901 GGATATACCA CCGTTGATAT ATCCCAATGG CATCGTAAAG AACATTTTGA
     951 GGCATTTCAG TCAGTTGCTC AATGTACCTA TAACCAGACC GTTCAGCTGG
    1001 ATATTACGGC CTTTTTAAAG ACCGTAAAGA AAAATAAGCA CAAGTTTTAT
    1051 CCGGCCTTTA TTCACATTCT TGCCCGCCTG ATGAATGCTC ATCCGGAATT
    1101 TCGTATGGCA ATGAAAGACG GTGAGCTGGT GATATGGGAT AGTGTTCACC
    1151 CTTGTTACAC CGTTTTCCAT GAGCAAACTG AAACGTTTTC ATCGCTCTGG
    1201 AGTGAATACC ACGACGATTT CCGGCAGTTT CTACACATAT ATTCGCAAGA
    1251 TGTGGCGTGT TACGGTGAAA ACCTGGCCTA TTTCCCTAAA GGGTTTATTG
    1301 AGAATATGTT TTTCGTCTCA GCCAATCCCT GGGTGAGTTT CACCAGTTTT
    1351 GATTTAAACG TGGCCAATAT GGACAACTTC TTCGCCCCCG TTTTCACCAT
    1401 GGGCAAATAT TATACGCAAG GCGACAAGGT GCTGATGCCG CTGGCGATTC
    1451 AGGTTCATCA TGCCGTCTGT GATGGCTTCC ATGTCGGCAG AATGCTTAAT
    1501 GAATTACAAC AGTACTGCGA TGAGTGGCAG GGCGGGGCGT AATTTTTTTA
    1551 AGGCAGTTAT TGGTGCCCTT AAACGCCTGG GGTAATGACT CTCTAGCTTG
    1601 AGGCATCAAA TAAAACGAAA GGCTCAGTCG AAAGACTGGG CCTTTCGTTT
    1651 TATCTGTTGT TTGTCGGTGA ACGCTCTCCT GAGTAGGACA AATCCGCCGC
    1701 TCTAGAGCTG CCTCGCGCGT TTCGGTGATG ACGGTGAAAA CCTCTGACAC
    1751 ATGCAGCTCC CGGAGACGGT CACAGCTTGT CTGTAAGCGG ATGCCGGGAG
    1801 CAGACAAGCC CGTCAGGGCG CGTCAGCGGG TGTTGGCGGG TGTCGGGGCG
    1851 CAGCCATGAC CCAGTCACGT AGCGATAGCG GAGTGTATAC TGGCTTAACT
    1901 ATGCGGCATC AGAGCAGATT GTACTGAGAG TGCACCATAT GCGGTGTGAA
    1951 ATACCGCACA GATGCGTAAG GAGAAAATAC CGCATCAGGC GCTCTTCCGC
    2001 TTCCTCGCTC ACTGACTCGC TGCGCTCGGT CTGTCGGCTG CGGCGAGCGG
    2051 TATCAGCTCA CTCAPAGGCG GTAATACGGT TATCCACAGA ATCAGGGGAT
    2101 AACGCAGGAA AGAACATGTG AGCAAAAGGC CAGCAAAAGG CCAGGAACCG
    2151 TAAAAAGGCC GCGTTGCTGG CGTTTTTCCA TAGGCTCCGC CCCCCTGACG
    2201 AGCATCACAA AAATCGACGC TCAAGTCAGA GGTGGCGAAA CCCGACAGGA
    2251 CTATAAAGAT ACCAGGCGTT TCCCCCTGGA AGCTCCCTCG TGCGCTCTCC
    2301 TGTTCCGACC CTGCCGCTTA CCGGATACCT GTCCGCCTTT CTCCCTTCGG
    2351 GAAGCGTGGC GCTTTCTCAA TGCTCACGCT GTAGGTATCT CAGTTCGGTG
    2401 TAGGTCGTTC GCTCCAAGCT GGGCTGTGTG CACGAACCCC CCGTTCAGCC
    2451 CGACCGCTGC GCCTTATCCG GTAACTATCG TCTTGAGTCC AACCCGGTAA
    2501 GACACGACTT ATCGCCACTG GCAGCAGCCA CTGGTAACAG GATTAGCAGA
    2551 GCGAGGTATG TAGGCGGTGC TACAGAGTTC TTGAAGTGGT GGCCTAACTA
    2601 CGGCTACACT AGAAGGACAG TATTTGGTAT CTGCGCTCTG CTGAAGCCAG
    2651 TTACCTTCGG AAAAAGAGTT GGTAGCTCTT GATCCGGCAA ACAAACCACC
    2701 GCTGGTAGCG GTGGTTTTTT TGTTTGCAAG CAGCAGATTA CGCGCAGAAA
    2751 AAAAGGATCT CAAGAAGATC CTTTGATCTT TTCTACGGGG TCTGACGCTC
    2801 AGTGGAACGA AAACTCACGT TAAGGGATTT TGGTCATGAG ATTATCAAAA
    2851 AGGATCTTCA CCTAGATCCT TTTAAATTAA AAATGAAGTT TTAAATCAAT
    2901 CTAAAGTATA TATGAGTAAA CTTGGTCTGA CAGTTACCAA TGCTTAATCA
    2951 GTGAGGCACC TATCTCAGCG ATCTGTCTAT TTCGTTCATC CATAGCTGCC
    3001 TGACTCCCCG TCGTGTAGAT AACTACGATA CGGGAGGGCT TACCATCTGG
    3051 CCCCAGTGCT GCAATGATAC CGCGAGACCC ACGCTCACCG GCTCCAGATT
    3101 TATCAGCAAT AAACCAGCCA GCCGGAAGGG CCGAGCGCAG AAGTGGTCCT
    3151 GCAACTTTAT CCGCCTCCAT CCAGTCTATT AATTGTTGCC GGGAAGCTAG
    3201 AGTAAGTAGT TCGCCAGTTA ATAGTTTGCG CAACGTTGTT GCCATTGCTA
    3251 CAGGCATCGT GGTGTCACGC TCGTCGTTTG GTATGGCTTC ATTCAGCTCC
    3301 GGTTCCCAAC GATCAAGGCG AGTTACATGA TCCCCCATGT TGTGCAAAAA
    3351 AGCGGTTAGC TCCTTCGGTC CTCCGATCGT TGTCAGAAGT AAGTTGGCCG
    3401 CAGTGTTATC ACTCATGGTT ATGGCAGCAC TGCATAATTC TCTTACTGTC
    3451 ATGCCATCCG TAAGATGCTT TTCTGTGACT GGTGAGTACT CAACCAAGTC
    3501 ATTCTGAGAA TAGTGTATGC GGCGACCGAG TTGCTCTTGC CCGGCGTCAA
    3551 TACGGGATAA TACCGCGCCA CATAGCAGAA CTTTAAAAGT GCTCATCATT
    3601 GGAAAACGTT CTTCGGGGCG AAAACTCTCA AGGATCTTAC CGCTGTTGAG
    3651 ATCCAGTTGG ATGTAACCCA CTCGTGCACG CAACTGATCT TCAGCATCTT
    3701 TTACTTTCAC CAGCGTTTCT GGGTGAGCAA AAACAGGAAG GCAAAATGCC
    3751 GCAAAAAAGG GAATAAGGGC GACACGGAAA TGTTGAATAC TCATACTCTT
    3801 CCTTTTTCAA TATTATTGAA GCATTTATCA GGGTTATTGT CTCATGAGCG
    3851 GATACATATT TGAATGTATT TAGAAAAATA AACAAATAGG GGTTCCGCGC
    3901 ACATTTCCCC GAAAAGTGCC ACCTGACGTC TAAGAAACCA TTATTATCAT
    3951 GACATTAACC TATAAAAATA GGCGTATCAC GAGGCCCTTT CGTCTTCAC
  • [0255]
    [0255]
    TABLE 14
    (Partial) nucleotide sequence of the human semaphorin L gene.
    (8888 nucleotides) (SEQ ID NO.:41):
    GAGCCGCACACGGTGCTTTTCCACGAGCCAGGCAGCTCCTCTGTGTGGGTGGGAGGACGT
    GGCAAGGTCTACCTCTTTGACTTCCCCGAGGGCAAGAACGCATCTGTGCGCACGGTGAGC
    CTCTCTCTTCCCCCAACACCCCCCCTACCCTCTTATCTCCCCTCTGGCCCTGCCAAGGGT
    CCTCAGGGAATCCGAGGGAGCTGGCTTCTCTTCCTAAACTGCCCCCACCTCCGTATCCTA
    TAAATGGCTCCTGGGGGAGGCTCCCTAAAGGTAGTCCAGATTGGAGTGGGGAGCTGGGGC
    GGTGTGGAGAAAAACAGGAGCTAATGGGCCTGGCCAGCTGGGCAGCGCTGCTGCGGAAAG
    CCCAGGCTGGAAGCTGGGCCCCAGAGCCCATGCCTGGTCTTCTGAACCCTCTGGGCCTCA
    GCTCTGGATATGAGACCCTGTTTGACCTCAGGTAGATCACTCACCCTCTCAGAGCCCCAG
    TTGCTCATCTGTCAGATGAGAATAATGGTTGCTTCCTTTGGGGCTTATCCTGAGGCTGTG
    TGGAAAGCATTTCAGGGGTACCTCACCCCTGGCAGATTGAACTAATGCTTCTCCCCTTCC
    CCAGGTGAATATCGGCTCCACAAAGGGGTCCTGTCTGGATAAGCGGGTGAGCGGGGGAGG
    GATCTGGAGGGGTCTGAGCCACTTGGTAAAGGGAGAGGAGACCCTGAGGGTCTAAGGAAG
    GAAGCATGGCCCTGCCCCACGAGTCCCAGACTGATGGGGAGACGTGGTCCTCTGTGCTTA
    GGGGATGGCGTCAGCTGCACACACTCTGGGCTGTCCCGGGAGGCTGTCACCTATGCTAAG
    CCCTTCTGACACCTTCTTCCCTGATCCTGGGGGTCCTAGTGCTAGGCTTGCCAGGGCCTT
    CCAGCAACCAATTTCTCTCCTCCCTTCTCTCTTCCCCGGGCAGGACTGCGAGAACTACAT
    CACTCTCCTGGAGAGGCGGAGTGAGGGGCTGCTGGCCTGTGGCACCAACGCCCGGCACCC
    CAGCTGCTGGAACCTGGTGAGAAGGCTGCTCCCCATGTGCCTGATCAGCTCACCTTCTAC
    TGCGTGGGCTTCTGCCCCTCATGGTGGGAAGGAGATGGCGAGACTCCAATGCTGGCCTTG
    CCCTGGGAGGATGGGGCTCCTGGCCGAGAAACTGGCCGTCATGGGAGGCAGTGGCTGTGG
    GATTATGTGGCCATCCAACCCTCTGGATCTCCCACAGGTGAATGGCACTGTGGTGCCACT
    TGGCGAGATGAGAGGCTACGCCCCCTTCAGCCCGGACGAGAACTCCCTGGTTCTGTTTGA
    AGGTTGGGGCATGCTTCGGAACTGGGCTGGGAGCAGGATGGTCAGCTCTTTGTCCAGTGT
    CCGGAGGAGGGACTTCCAGGAGCTGCCTGCCCTTACTCATTTCTCCCTCCCACTGACCCC
    AGGGGACGAGGTGTATTCCACCATCCGGAAGCAGGAATACAATGGGAAGATCCCTCGGTT
    CCGCCGCATCCGGGGCGAGAGTGAGCTGTACACCAGTGATACTGTCATGCAGAGTGAGTC
    AGGCTCCGGCTGGGCTGAGGGTGGGCAAGGGGGTGTGAGCACTTAAGGTGGCAGATGGGA
    TCCTGATGTTTCTGGGAGGGCTCCCTGAGGGCCGCTGGGGCCATGCAGGAAAGCAGGACC
    TTGGTATAGGCCTGAGAAGTTAGGGTTGGCTGGGAGCAGAGGAACAGACAAGGTATAGCA
    GTGGGATGGGCCCAGCCCTCTTCAGGAACACAAACAGAGGGAGCCCCAGACCCAGTGCAG
    GGTCCCCAGGAGCCAAAGTTTATCCTCTGCTGAGTTCACGTGGAGGCAGCCCCCCAACTC
    CCTCCTCATCAGGGCTCTGCCAATTGAGCAGAAGTGACATAGGGGCCCCCAGGGACCTTC
    CCCCACTCCCCAGGCATGAAGTCATTGCTCCTGGGCCGATGACATCTTTGTAGGAAGAGG
    GCAAAACAGGTGTGGGGTGGAGGTGCAGGGTCTAGGGCCCCTCGGGGAGTTGGACCTGAT
    GTTATGAGTCCTATTCCAGATCTGATTTGCCATGGTTTGTGCAGACCCGAAGGAGGGAGG
    AGAGTGTGCAGGGTTGGAATGGTCTCCCGGGCAAGCTTCCCAGCCTTACGCCCATTCGCT
    TCTGTGCCCTGGCAGACCCACAGTTCATCAAAGCCACCATCGTGCACCAAGACCAGGCTT
    ACGATGACAAGATCTACTACTTCTTCCGAGAGGACAATCCTGACAAGAATCCTGAGGCTC
    CTCTCAATGTGTCCCGTGTGGCCCAGTTGTGCAGGGTGAACACGGGCGTGAGGGCTGCTG
    GCTACGTGTCTGTGCATGAATAGGCCTGAGTGAGGGTGAGTTCTGTGTGTCCGTGTGCAT
    GTAGAAGTTGTGTGGATGTATGAGTGGGTCTGTGTCAGGGACTGTGGGAGCAGCTGTGTG
    TGCATGGAGCATCATGTGTCTGTGTGTGGGTAAAGGTGGCTGAGCTCCTGTGCACGTATG
    ATGGCGTGTGAGCGTGTGTATGATGGGGTGTGTGTGTGTGTGTGTGTGTGTGTTTTGCCT
    GTGTGAATGTGCTGTGCCACGTATGTGGGTGCGTGAGTCAGTAAATGTGTGTCTGAGTCC
    GTCTGCTCTGTGGGGACCTGGCACTCTCACCTGCCCTGACCCTGGGCACTGCTGGCCCTG
    GGCTCTGGATCAGCCAGGCCTGCTTGCAGGAGTCTCATCTGGAGACCTGCCCTGAGTCCT
    GGGGCACCCCCGGCAGGTCCTGGCCCCTCGCAGCCTGCCTTCCTCCTCTGGGCCCAGGTG
    TTGATATTGCTGGCAGTGGTTTCCTGGGGTGTGTGGGGAAGCCCGGGCAGGTGCTGAGGG
    GCCTCTTCTCCCCTCTACCCTTCCAGGGGGACCAGGGTGGGGAAAGTTCACTGTCAGTCT
    CCAAGTGGAACACTTTTCTGAAAGCCATGCTGGTATGCAGTGATGCTGCCACCAACAAGA
    ACTTCAACAGGCTGCAAGACGTCTTCCTGCTCCCTGACCCCAGCGGCCAGTGGAGGGACA
    CCAGGGTCTATGGTGTTTTCTCCAACCCCTGGTGAGTGGCCCTTGTCCTGGGGCCGGGGC
    TGGCATTGGTTCAGTGTCCAGTAGGGACAGGAGGCCTTGGGCCCTGCTGAGGGCCTCCCT
    GGTGTGGCAGGAGCAGGGGCTGCAGGCTCAAGAGGCTGGGCTGTTGCTGGGTGTGGGGTG
    GGGGGACAGCCAGTGCGATGTATGTACTGTTGTGTGAGTGAGTCTGCACTCATGGGTGTG
    TGTGCATGCCCTATATGCACACTCATGACTGCACTTGTGCCTGTGTGTCCCACCACCTGC
    TTGTGCCGAGAGTGGACACTGGGCCCAGGAGGAAGCTGCTGAAGCATCTCTCGGGGAGCT
    GGGTGOTATTACACCTGCTCAGGCACTGCCTGAGCCCGATAATTCACACTTCTTAATCAC
    TCTCATTGATTGAACACACGGCAGGCGGAAGTGTTGGGTGTGTGTGGGGAGAGTTAGGGA
    TAGAGTGGAGGAAGCCAAGACCCTGCTCTGTGGGTCCTGGGTGAGTGGGTCCCCCAGGCT
    GGGAAGGGGTTGGGGGTCTGGCCTCCTGGGGCATCAGCACCCCACAGCCTGTGCCCAGGG
    AGGGCTAGAGAACTGCTCAGCCTATGATGGGGTTCCTCCTGCCTTGGGGTTGGGTAGAGC
    AGATGGCCTCTAGACTCAGTGATTCTGTAACAGGATACAAGTTTGTGGTTTTAAATTGCA
    GCACAAAGAAATTAGGCTGAACTCCTCTCCTTCCTCCTCTCCATCCCTCCCCAThTTCAG
    TGGTGGTTGGCAACTCAGTGCCAGGCACAAGGCTGGCCTGGGTGAGTGGAGGTGGATGGG
    TGGGTTCTGGGCCCCCCATTGAGCTGGTCTCCATGTCACTGCAGGAACTACTCAGCCGTC
    TGTGTGTATTCCCTCGGTGACATTGACAAGGTCTTCCGTACCTCCTCACTCTTGGGCTAC
    CACTCAAGCCTTCCCAACCCGCGGCCTGGCAAGGTGAGCGTGACACCAGCCGTGGCCCAG
    GCCCAGCCCTCCTTCTGCCTCACCTCCCACCACCCCACTGACCTGGGCCTGCTCTCCTTG
    CCCAGTGCCTCCCAGACCAGCAGCCGATACCCACAGAGACCTTCCAGGTGGCTGACCGTC
    ACCCAGAGGTGGCGCAGAGGGTGGAGCCCATGGGGCCTCTGAAGACGCCATTGTTCCACT
    CTAAATACCACTACCAGAAAGTGGCCGTCCACCGCATGCAAGCCAGCCACGGGGAGACCT
    TTCATGTGCTTTACCTAACTACAGGTGAGAGGCTACCCCGGGACCCTCAGTTTGCTTTGT
    AAAAACGGGCATGAAAGGTGTAAGGAATAATGTAGTTAACATCTGGTTGGATCTTTACAT
    GTGGAAGGAATAATTGAGTGACTGGAGTTGTCAGGGGTTAATGTGTGTGGGTGTGGTTGA
    GCCAGGCAGGGAGAGCTTCCTGGAGGAGGTAGGGGCAAGAGGGAAAGGGGGATGGGAGAA
    AAGCAAGCACTGGGATTTGGAGGCGGAAATCTGGAGAGTCTGAGCAAAGCCAGGTGCACC
    TTTGGTCCAGATGTCTGACTCAGGGAAGAAGATGGTAGGAAGAGACGTGGCAAATGAGGA
    GGAGGGGCCTGAACCACAGGGATACTGGCCTCTGCCAGGCAGAATGAGGGAGTCAGGCCC
    TGCGCCTGTCTTTGGGATTGTGCAGGTGAGAAGAAACATTTGAGGAGTTGATGGGGCACA
    AATTAGGTATGGGGAAGGAGTTCCAGGGGGCAGAACCTTTGCCATCTCACAGAGGACAGG
    GGCAGCTTCTCTTCTTCCCTGGAGTAGGCCCTGCTGGGGGAAGCTGGGTGGAATGCCGTG
    GGAGATGCTCCTGCTTTCTGGAAAGCCACAGGACACGGAGGAGCCAGTCCTGAGTTGGGT
    TTGTCGCAGCTTCCCATGCCAGCTGCCTTCCTTGAGACTGGAAAGGGCCTCTAGCACCCC
    TGGGGCCATTCAATTCAGGCCCAGGCGCCCAACCTCAGTTGTTCACATTCCCCATGTGAT
    CTCCTGTTGCTGCTTCACCTTGGGACTGTCTCGGCTTTGGTGACCTTGTAGGAAACTGGA
    ACCCCAGCACCATTGTTTGGCTCCTGGAAGCCTTGGGGAGAGGAATTTCCCACAGGGCAG
    GGCCTGGGTCCTGATTCCCTGCCTCTTTACTCCCTATTCATCCCGGCTACACCCTTGGGC
    CCCCATCCTTGCTTGGCTCCAGTACTGGCTGGCACAGCTGTTGTGGTCATCCAGGGATGG
    CAGGGCACTGGGGAACAGAAGAGAGAGGTCACACAGTGCGGAACTGGGAGCAGGAGCTAG
    GACAAGGAAGGCTGGACTTGGGCCATGGATTCCCTTCCTGCAGACTTGGGAAGTGAGCAC
    ACTTGAGTGATTAGAGAAGGTGTCTTCGTTCTAAGGGCAGTGGAGGAGGCACCATTTTGG
    AGCCTGCATCATTCGTATTTGGGCTAGATTGAAAAATAGAGCTTTCTAAGTCCTCTGCAG
    AGAATGGGAGGCTCTCACAACTGGGAGAAGTATTGGCTCTTTTCCTGAGAATTTTGCCTT
    GGGTATGCTGTTACTGGGGCTGGTTTGGAAGGAGTATAGGGCNTTATGTCTGTGAAGGCA
    GTGGCTGGGGTGGGGCCTTATCAGGCCCAAGGAGCATCTGGCCACATCTCAGAGTCCACA
    GATGAGGATCACGGATGTGTAGAGGAAACATCCTAGGCAGGCAATCATCTGACTGCTTTT
    TTGGGGCAGGTGATGCCCTGGGAAATTGGGAGGGAGGGAGAGAGGGAGGTAGGCTATTCT
    AGAPACTGGGAGAGCAGGTGAGGTAGGATTGGGAGGACCAGGGGTCAGGGTCCCCATTGG
    TCCCTAATTGAGAACGGAGAGAGCATTGGTCTAGGAGGCAGGCAGCTCGGTTATAAGACC
    TTGGGAACTCTTGATTTAGAATCCAAGATCCTTTTTAGATCTAGGATTTTATAAAATTAA
    GATATCCCCTAAGATCAAATGCTTCGTGGAGTCCTGAATTGGATCCTAGTTCAGTTGTTG
    GACATTTGTGGAAAAACTAGTGAAATCCAAATAAAGTCTGTAGTTTTGTTAATAGTAATG
    CACCAATGTCAGTTGCCTAGTTGTGACAAATATACCGTGGTTATGTAAGATGGTAACATT
    AGGGGGAACTGGAGAAGGGTAGATTGGAGCTCTCTGTACTATCTTTGCAACTTTTCTGGG
    AATCTAAAATTACTCCAAAATAAAAAAAAAATGTATTTAAAGTAAATATATTCCCTTTGA
    GTCCAGGAGGCAGGGGAGTTGTAGAAGCAGCTGAGTGGTTGGGTTCTGACAGATTTGGTT
    CCAACTCGGTCTCTGCTGCTCACCAGCTGTGTGACCTTGAGCAAGTGGCTTAGCCTTTCT
    GAGCCTGATTTCCTTATCTGTGGAGTGGGGAAGATGACAGCCACCTCGCAGGGCTGTGGA
    GGGTTAAACGAGGTGATGCATGGACAGCAGCCGCACTGACCTTGCTGGTGTGGGGCTCCT
    GCTTCTGTTCTTCCCGTGCAGCCTTGGGAATGTTGGAGGCCGTATCCAGGGACCCCTGGG
    CCTCCTGGGATGGCCTCTCTGGATCAGCCTTGGAAGGTTCCAGGCTGCCCTTAGGCTCCC
    ACATTCTTCCCCAGTCACGCTCTCCTCGCCCTGCCCACACCAGTCCTGTGACCCTTGCCT
    GAGTTGTGACTTCCCACCCCTCCCCGGCCTAGAGGAAAGCTGCCTGGCCCCTCAGTGGGA
    CTCCCGCCCACTGACCCTCTGTCCACCATACACAGACAGGGGCACTATCCACAAGGTGGT
    GGAACCGGGGGAGCAGGAGCACAGCTTCGCCTTCAACATCATGGAGATCCAGCCCTTCCG
    CCGCGCGGCTGCCATCCAGACCATGTCGCTGGATGCTGAGCGGGTGAGCCTTCCCCCACT
    GCGTCCCATGGGCTATGCAGTGACTGCAGCTGAGGACAGGGCTCCTTTGCATGTGATTTG
    TGTGTTCTTTTAAGAGCTTCTAGGCCTTAGGGCCTGGACATTTAGGACTGAGTGTGGGGT
    GGGGCCCGGGCCTGACCCAATCCTGCTGTCCTTCCAGAGGAAGCTGTATGTGAGCTCCCA
    GTGGGAGGTGAGCCAGGTGCCCCTGGACCTGTGTGAGGTCTATGGCGGGGGCTGCCACGG
    TTGCCTCATGTCCCGAGACCCCTACTGCGGCTGGGACCAGGGCCGCTGCATCTCCATCTA
    CAGCTCCGAACGGTACGTTGGCCGGGATCCCTCCGTCCCTGGGACAAGGTGGGCATGGGA
    CAGGGGGAGGTGTTGTCGGGCTGGAAGAGGTGGCGGTACTGGGCCTTTCTTGTGGGACCT
    CCTCTCTACTGGAACTGCACTAGGGGTAAGGATATGAGGGTCAGGTCTGCAGCCTTGTAT
    CTGCTGATCCTCTTTCGTCCTTCCCACTCCAGGTCAGTGCTGCAATCCATTAATCCAGCC
    GAGCCACACAAGGAGTGTCCCAACCCCAAACCAGGTACCTGATCTGGCCCTGCTGGCGGC
    TGTGGCCCAATGAGTGGGGTACTGCCCTGCCCTGATTGTCCTGGTCTGAGGGAAACATGG
    CCTTGTCCTGTGGGCCCCAGGTACATGGGGCAGGATACAGTCCTGCAGAGGGAGCCCTCT
    TGGTGGGATGAGCGAGACGGGAGAAAAAAGGAGGACGCTGAGGGCTGGGTTCCCCACGTT
    CATTCAGAAGCCTTGTCCTGGGATCCCAGTCGGTGGGGAGGACACATCCTCCCCTGGGAG
    CTCTTTGTCCCTCCTCACGGCTGCTTCCCCACTGCCTCCCCAGACTTGGCCCCACTGCAG
    AAGGTTTCCCTGGCCCCAAACTCTCGCTACTACCTGAGCTGCCCCATGGAATCCCGCCAC
    GCCACCTACTCATGGCGCCACAAGGAGAACGTGGAGCAGAGCTGCGTTCCTGGTCACCAG
    AGCCCCAACTGCATCCTGTTCATCGAGAACCTCACGGCGCAGCAGTACGGCCACTACTTC
    TGCGAGGCCCAGGAGGGCTCCTACTTCCGCGAGGCTCAGCACTGGCAGCTGCTGCCCGAG
    GACGGCATCATGGCCGAGCACCTGCTGGGTCATGCCTGTGCCCTGGCCGCCTCCCTCTGG
    CTGGGGGTGCTGCCCACACTCACTCTTGGCTTGCTGGTCCACTAGGGCCTCCCGAGGCTG
    GGCATGCCTCAGGCTTCTGCAGCCCAGGGCACTAGTTCGTCTCACACTCAGAGCCGGCTG
    GCCCGGGAGCTCCTTGCCTGCCACTTCTTCCAGGGGACAGTTTTTCCCAGTGGAGGATGC
    CAGGCCTGGAGACGTCCAGCCGCAGGCGGCTGCTGGGCCCCAGGTGGCGCACGGATGGTG
    AGGGGCTGAGAATGAGGGCACCGACTGTGAAGCTGGGGCATCGATGACCCAAGACTTTAT
    CTTCTGGAAAATATTTTTCAGACTCCTCAAACTTGACTAAATGCAGCGATGCTCCCAGCC
    CAAGAGCCCATGGGTCGGGGAGTGGGTTTGGATAGGAGAGCTGGGACTCCATCTCGACCC
    TGGGGCTGAGGCCTGAGTCCTTCTGGACTCTTGGTACCCACATTGCCTCCTTCCCCTCCC
    TCTCTCATGGCTGGGTGGCTGGTGTTCCTGAAGACCCAGGGCTACCCTCTGTCCAGCCCT
    GTCCTCTGCAGCTCCCTCTCTGGTCCTGGGTCCCACAGGACAGCCGCCTTGCATGTTTAT
    TGAAGGATGTTTGCTTTCCGGACGGAAGGACGGAAAAAGCTCTGAAAAAAAAAAAAAAAA
    AAAAAAAA
  • [0256]
    [0256]
    TABLE 15
    Nucleotide sequence of pMeIBacA-H-SEMAL (6622bp)
    (SEQ ID NO:42)
       1 GATATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA
      51 TTTTACTGTT TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATGAA
     101 ATTCTTAGTC AACGTTGCCC TTGTTTTTAT GGTCGTATAC ATTTCTTACA
     151 TCTATGCGGA TCGATGG
                       gga tccgcccagg gccacctaag gagcggaccc
     201 cgcatcttcg ccgtctggaa aggccatgta gggcaggacc gggtggactt
     251 tggccagact gagccgcaca cggtgctttt ccacgagcca ggcagctcct
     301 ctgtgtgggt gggaggacgt ggcaaggtct acctctttga cttccccgag
     351 ggcaagaacg catctgtgcg cacggtgaat atcggctcca caaaggggtc
     401 ctgtctggat aagcgggact gcgagaacta catcactctc ctggagaggc
     451 ggagtgaggg gctgctggcc tgtggcacca acgcccggca ccccagctgc
     501 tggaacctgg tgaatggcac tgtggtgcca cttggcgaga tgagaggcta
     551 tgcccccttc agccGggaCg agaactccct ggttctgttt gaaggggacg
     601 aggtgtattc caccatccgg aagcaggaat acaatgggaa gatccctcgg
     651 ttccgccgca tccggggcga gagtgagctg tacaccagtg atactgtcat
     701 gcagaaccca cagttcatca aagccaccat cgtgcaccaa gaccaggctt
     751 acgatgacaa gatctactac ttcttccgag aggacaatcc tgacaagaat
     801 cctgaggctc ctctcaatgt gtcccgtgtg gcccagttgt gcagggggga
     851 ccagggtggg gaaagttcac tgtcagtctc caagtggaac acttttctga
     901 aagccatgct ggtatgcagt gatgctgcca ccaacaagaa cttcaacagg
     951 ctgcaagacg tcttcctgct ccctgacccc agcggccagt ggagggacac
    1001 cagggtctat ggtgttttct ccaacccctg gaactactca gccgtctgtg
    1051 tgtattccct cggtgacatt gacaaggtct tccgtacctc ctcactcaag
    1101 ggctaccact caagccttcc caacccgcgg cctggcaagt gcctcccaga
    1151 ccagcagccg atacccacag agaccttcca ggtggctgac cgtcacccag
    1201 aggtggcgca gagggtggag cccatggggc ctctgaagac gccattgttc
    1251 cactctaaat accactacca gaaagtggcc gttcaccgca tgcaagccag
    1301 ccacggggag acctttcatg tgctttacct aactacagac aggggcacta
    1351 tccacaaggt ggtggaaccg ggggagcagg agcacagctt cgccttcaac
    1401 atcatggaga tccagccctt ccgccgcgcg gctgccatcc agaccatgtc
    1451 gctggatgct gagcggagga agctgtatgt gagctcccag tgggaggtga
    1501 gccaggtgcc cctggacctg tgtgaggtct atggcggggg ctgccacggt
    1551 tgcctcatgt cccgagaccc ctactgcggc tgggaccagg gccgctgcat
    1601 ctccatctac agctccgaac ggtcagtgct gcaatccatt aatccagccg
    1651 agccacacaa ggagtgtccc aaccccaaac cagacaaggc cccactgcag
    1701 aaggtttccc tggccccaaa ctctcgctac tacctgagct gccccatgga
    1751 atcccgccac gccacctact catggcgcca caaggagaac gtggagcaga
    1801 gctgcgaacc tggtcaccag agccccaact gcatcctgtt catcgagaaG
    1851 ctcacggcgc agcagtacgg ccactacttc tgcgaggccc aggagggctc
    1901 ctacttccgc gaggctcagc actggcagct gctgcccgag gacggcatca
    1951 tggccgagca cctgctgggt catgcctgtg ccctggctgc ctgaattc
    2001 AGCTTGGAGT CGACTCTGCT GAAGAGGAGG AAATTCTCCT TGAAGTTTCC
    2051 CTGGTGTTCA AAGTAAAGGA GTTTGCACCA GACGCACCTC TGTTCACTGG
    2101 TCCGGCGTAT TAAAACACGA TACATTGTTA TTAGTACATT TATTAAGCGC
    2151 TAGATTCTGT GCGTTGTTGA TTTACAGACA ATTGTTGTAC GTATTTTAAT
    2201 AATTCATTAA ATTTATAATC TTTAGGGTGG TATGTTAGAG CGAAAATCAA
    2251 ATGATTTTCA GCGTCTTTAT ATCTGAATTT AAATATTAAA TCCTCAATAG
    2301 ATTTGTAAAA TAGGTTTCGA TTAGTTTCAA ACAAGGGTTG TTTTTCCGAA
    2351 CCGATGGCTG GACTATCTAA TGGATTTTCG CTCAACGCCA CAAAACTTGC
    2401 CAAATCTTGT AGCAGCAATC TAGCTTTGTC GATATTCGTT TGTGTTTTGT
    2451 TTTGTAATAA AGGTTCGACG TCGTTCAAAA TATTATGCGC TTTTGTATTT
    2501 CTTTCATCAC TGTCGTTAGT GTACAATTGA CTCGACGTAA ACACGTTAAA
    2551 TAAAGCCTGG ACATATTTAA CATCGGGCGT GTTAGCTTTA TTAGGCCGAT
    2601 TATCGTCGTC GTCCCAACCC TCGTCGTTAG AAGTTGCTTC CGAAGACGAT
    2651 TTTGCCATAG CCACACGACG CCTATTAATT GTGTCGGCTA ACACGTCCGC
    2701 GATCAAATTT GTAGTTGAGC TTTTTGGAAT TATTTCTGAT TGCGGGCGTT
    2751 TTTGGGCGGG TTTCAATCTA ACTGTGCCCG ATTTTAATTC AGACAACACG
    2801 TTAGAAAGCG ATGGTGCAGG CGGTGGTAAC ATTTCAGACG GCAAATCTAC
    2851 TAATGGCGGC GGTGGTGGAG CTGATGATAA ATCTACCATC GGTGGAGGCG
    2901 CAGGCGGGGC TGGCGGCGGA GGCGGAGGCG GAGGTGGTGG CGGTGATGCA
    2951 GACGGCGGTT TAGGCTCAAA TTGTCTCTTT CAGGCAACAC AGTCGGCACC
    3001 TCAACTATTG TACTGGTTTC GGGCGTATGG TGCACTCTCA GTACAATCTG
    3051 CTCTGATGCC GCATAGTTAA GCCAGCCCCG ACACCCGCCA ACACCCGCTG
    3101 ACGCGCCCTG ACGGGCTTGT CTGCTCCCGG CATCCGCTTA CAGACAAGCT
    3151 GTGACCGTCT CCGGGAGCTG CATGTGTCAG AGGTTTTCAC CGTCATCACC
    3201 GAAACGCGCG AGACGAAAGG GCCTCGTGAT ACGCCTATTT TTATAGGTTA
    3251 ATGTCATGAT AATAATGGTT TCTTAGACGT CAGGTGGCAC TTTTCGGGGA
    3301 AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC ATTCAAATAT
    3351 GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA
    3401 AAAGGAAGAG TATGAGTATT CAACATTTCC GTGTCGCCCT TATTCCCTTT
    3451 TTTGCGGCAT TTTGCCTTCC TGTTTTTGCT CACCCAGAAA CGCTGGTGAA
    3501 AGTAAAAGAT GCTGAAGATC AGTTGGGTGC ACGAGTGGGT TACATCGAAC
    3551 TGGATCTCAA CAGCGGTAAG ATCCTTGAGA GTTTTCGCCC CGAAGAACGT
    3601 TTTCCAATGA TGAGCACTTT TAAAGTTCTG CTATGTGGCG CGGTATTATC
    3651 CCGTATTGAC GCCGGGCAAG AGCAACTCGG TCGCCGCATA CACTATTCTC
    3701 AGAATGACTT GGTTGAGTAC TCACCAGTCA CAGAAAAGCA TCTTACGGAT
    3751 GGCATGACAG TAAGAGAATT ATGCAGTGCT GCCATAACCA TGAGTGATAA
    3801 CACTGCGGCC AACTTACTTC TGACAACGAT CGGAGGACCG AAGGAGCTAA
    3851 CCGCTTTTTT GCACAACATG GGGGATCATG TAACTCGCCT TGATCGTTGG
    3901 GAACCGGAGC TGAATGAAGC CATACCAAAC GACGAGCGTG ACACCACGAT
    3951 GCCTGTAGCA ATGGCAACAA CGTTGCGCAA ACTATTAACT GGCGAACTAC
    4001 TTACTCTAGC TTCCCGGCAA CAATTAATAG ACTGGATGGA GGCGGATAAA
    4051 GTTGCAGGAC CACTTCTGCG CTCGGCCCTT CCGGCTGGCT GGTTTATTGC
    4101 TGATAAATCT GGAGCCGGTG AGCGTGGGTC TCGCGGTATC ATTGCAGCAC
    4151 TGGGGCCAGA TGGTAAGCCC TCCCGTATCG TAGTTATCTA CACGACGGGG
    4201 AGTCAGGCAA CTATGGATGA ACGAAATAGA CAGATCGCTG AGATAGGTGC
    4251 CTCACTGATT AAGCATTGGT AACTGTCAGA CCAAGTTTAC TCATATATAC
    4301 TTTAGATTGA TTTAAAACTT CATTTTTAAT TTAAAAGGAT CTAGGTGAAG
    4351 ATCCTTTTTG ATAATCTCAT GACCAAAATC CCTTAACGTG AGTTTTCGTT
    4401 CCACTGAGCG TCAGACCCCG TAGAAAAGAT CAAAGGATCT TCTTGAGATC
    4451 CTTTTTTTCT GCGCGTAATC TGCTGCTTGC AAACAAAAAA ACCACCGCTA
    4501 CCAGCGGTGG TTTGTTTGCC GGATCAAGAG CTACCAACTC TTTTTCCGAA
    4551 GGTAACTGGC TTCAGCAGAG CGCAGATACC AAATACTGTT CTTCTAGTGT
    4601 AGCCGTAGTT AGGCCACCAC TTCAAGAACT CTGTAGCACC GCCTACATAC
    4651 CTCGCTCTGC TAATCCTGTT ACCAGTGGCT GCTGCCAGTG GCGATAAGTC
    4701 GTGTCTTACC GGGTTGGACT CAAGACGATA GTTACCGGAT AAGGCGCAGC
    4751 GGTCGGGCTG AACGGGGGGT TCGTGCACAC AGCCCAGCTT GGAGCGAACG
    4801 ACCTACACCG AACTGAGATA CCTACAGCGT GAGCTATGAG AAAGCGCCAC
    4851 GCTTCCCGAA GGGAGAAAGG CGGACAGGTA TCCGGTAAGC GGCAGGGTCG
    4901 GAACAGGAGA GCGCACGAGG GAGCTTCCAG GGGGAAACGC CTGGTATCTT
    4951 TATAGTCCTG TCGGGTTTCG CCACCTCTGA CTTGAGCGTC GATTTTTGTG
    5001 ATGCTCGTCA GGGGGGCGGA GCCTATGGAA AAACGCCAGC AACGCGGCCT
    5051 TTTTACGGTT CCTGGCCTTT TGCTGGCCTT TTGCTCACAT GTTCTTTCCT
    5101 GCGTTATCCC CTGATTCTGT GGATAACCGT ATTACCGCCT TTGAGTGAGC
    5151 TGATACCGCT CGCCGCAGCC GAACGACCGA GCGCAGCGAG TCAGTGAGCG
    5201 AGGAAGCATC CTGCACCATC GTCTGCTCAT CCATGACCTG ACCATGCAGA
    5251 GGATGATGCT CGTGACGGTT AACGCCTCGA ATCAGCAACG GCTTGCCGTT
    5301 CAGCAGCAGC AGACCATTTT CAATCCGCAC CTCGCGGAAA CCGACATCGC
    5351 AGGCTTCTGC TTCAATCAGC GTGCCGTCGG CGGTGTGCAG TTCAACCACC
    5401 GCACGATAGA GATTCGGGAT TTCGGCGCTC CACAGTTTCG GGTTTTCGAC
    5451 GTTCAGACGT AGTGTGACGC GATCGGTATA ACCACCACGC TCATCGATAA
    5501 TTTCACCGCC GAAAGGCGCG GTGCCGCTGG CGACCTGCGT TTCACCCTGC
    5551 CATAAAGAAA CTGTTACCCG TAGGTAGTCA CGCAACTCGC CGCACATCTG
    5601 AACTTCAGCC TCCAGTACAG CGCGGCTGAA ATCATCATTA AAGCGAGTGG
    5651 CAACATGGAA ATCGCTGATT TGTGTAGTCG GTTTATGCAG CAACGAGACG
    5701 TCACGGAAAA TGCCGCTCAT CCGCCACATA TCCTGATCTT CCAGATAACT
    5751 GCCGTCACTC CAACGCAGGA CCATCACCGC GAGGCGGTTT TCTCCGGCGC
    5801 GTAAAAATGC GCTCAGGTCA AATTCAGACG GCAAACGACT GTCCTGGCCG
    5851 TAACCGACCC AGCGCCCGTT GCACCACAGA TGAAACGCCG AGTTAACGCC
    5901 ATCAAAAATA ATTCGCGTCT GGCCTTCCTG TAGCCAGCTT TCATCAACAT
    5951 TAAATGTGAG CGAGTAACAA CCCGTCGGAT TCTCCGTGGG AACAAACGGC
    6001 GGATTGACCG TAATGGGATA GGTCACGTTG GTGTAGATGG GCGCATCGTA
    6051 ACCGTGCATC TGCCAGTTTG AGGGGACGAC GACAGTATCG GCCTCAGGAA
    6101 GATCGCACTC CAGCCAGCTT TCCGGCACCG CTTCTGGTGC CGGAAACCAG
    6151 GCAAAGCGCC ATTCGCCATT CAGGCTGCGC AACTGTTGGG AAGGGCGATC
    6201 GGTGCGGGCC TCTTCGCTAT TACGCCAGCT GGCGAAAGGG GGATGTGCTG
    6251 CAAGGCGATT AAGTTGGGTA ACGCCAGGGT TTTCCCAGTC ACGACGTTGT
    6301 AAAACGACGG GATCTATCAT TTTTAGCAGT GATTCTAATT GCAGCTGCTC
    6351 TTTGATACAA CTAATTTTAC GACGACGATG CGAGCTTTTA TTCAACCGAG
    6401 CGTGCATGTT TGCAATCGTG CAAGCGTTAT CAATTTTTCA TTATCGTATT
    6451 GTTGCACATC AACAGGCTGG ACACCACGTT GAACTCGCCG CAGTTTTGCG
    6501 GCAAGTTGGA CCCGCCGCGC ATCCAATGCA AACTTTCCGA CATTCTGTTG
    6551 CCTACGAACG ATTGATTCTT TGTCCATTGA TCGAAGCGAG TGCCTTCGAC
    6601 TTTTTCGTGT CCAGTGTGGC TT
  • [0257]
    The above description of the invention is intended to be illustrative and not limiting. Various changes or modifications in the embodiments described may occur to those skilled in the art. These can be made without departing from the spirit or scope of the invention. Accordingly, it is intended that the invention be limited only to the extent required by the claims and the applicable rules of law.
  • 1 44 2636 base pairs nucleic acid single linear DNA (genomic) 1 CGGGGCCACG GGATGACGCC TCCTCCGCCC GGACGTGCCG CCCCCAGCGC ACCGCGCGCC 60 CGCGTCCCTG GCCCGCCGGC TCGGTTGGGG CTTCCGCTGC GGCTGCGGCT GCTGCTGCT 120 CTCTGGGCGG CCGCCGCCTC CGCCCAGGGC CACCTAAGGA GCGGACCCCG CATCTTCGC 180 GTCTGGAAAG GCCATGTAGG GCAGGACCGG GTGGACTTTG GCCAGACTGA GCCGCACAC 240 GTGCTTTTCC ACGAGCCAGG CAGCTCCTCT GTGTGGGTGG GAGGACGTGG CAAGGTCTA 300 CTCTTTGACT TCCCCGAGGG CAAGAACGCA TCTGTGCGCA CGGTGAATAT CGGCTCCAC 360 AAGGGGTCCT GTCTGGATAA GCGGGACTGC GAGAACTACA TCACTCTCCT GGAGAGGCG 420 AGTGAGGGGC TGCTGGCCTG TGGCACCAAC GCCCGGCACC CCAGCTGCTG GAACCTGGT 480 AATGGCACTG TGGTGCCACT TGGCGAGATG AGAGGCTACG CCCCCTTCAG CCCGGACGA 540 AACTCCCTGG TTCTGTTTGA AGGGGACGAG GTGTATTCCA CCATCCGGAA GCAGGAATA 600 AATGGGAAGA TCCCTCGGTT CCGCCGCATC CGGGGCGAGA GTGAGCTGTA CACCAGTGA 660 ACTGTCATGC AGAACCCACA GTTCATCAAA GCCACCATCG TGCACCAAGA CCAGGCTTA 720 GATGACAAGA TCTACTACTT CTTCCGAGAG GACAATCCTG ACAAGAATCC TGAGGCTCC 780 CTCAATGTGT CCCGTGTGGC CCAGTTGTGC AGGGGGGACC AGGGTGGGGA AAGTTCACT 840 TCAGTCTCCA AGTGGAACAC TTTTCTGAAA GCCATGCTGG TATGCAGTGA TGCTGCCAC 900 AACAAGAACT TCAACAGGCT GCAAGACGTC TTCCTGCTCC CTGACCCCAG CGGCCAGTG 960 AGGGACACCA GGGTCTATGG TGTTTTCTCC AACCCCTGGA ACTACTCAGC CGTCTGTG 1020 TATTCCCTCG GTGACATTGA CAAGGTCTTC CGTACCTCCT CACTCAAGGG CTACCACT 1080 AGCCTTCCCA ACCCGCGGCC TGGCAAGTGC CTCCCAGACC AGCAGCCGAT ACCCACAG 1140 ACCTTCCAGG TGGCTGACCG TCACCCAGAG GTGGCGCAGA GGGTGGAGCC CATGGGGC 1200 CTGAAGACGC CATTGTTCCA CTCTAAATAC CACTACCAGA AAGTGGCCGT TCACCGCA 1260 CAAGCCAGCC ACGGGGAGAC CTTTCATGTG CTTTACCTAA CTACAGACAG GGGCACTA 1320 CACAAGGTGG TGGAACCGGG GGAGCAGGAG CACAGCTTCG CCTTCAACAT CATGGAGA 1380 CAGCCCTTCC GCCGCGCGGC TGCCATCCAG ACCATGTCGC TGGATGCTGA GCGGAGGA 1440 CTGTATGTGA GCTCCCAGTG GGAGGTGAGC CAGGTGCCCC TGGACCTGTG TGAGGTCT 1500 GGCGGGGGCT GCCACGGTTG CCTCATGTCC CGAGACCCCT ACTGCGGCTG GGACCAGG 1560 CGCTGCATCT CCATCTACAG CTCCGAACGG TCAGTGCTGC AATCCATTAA TCCAGCCG 1620 CCACACAAGG AGTGTCCCAA CCCCAAACCA GACAAGGCCC CACTGCAGAA GGTTTCCC 1680 GCCCCAAACT CTCGCTACTA CCTGAGCTGC CCCATGGAAT CCCGCCACGC CACCTACT 1740 TGGCGCCACA AGGAGAACGT GGAGCAGAGC TGCGAACCTG GTCACCAGAG CCCCAACT 1800 ATCCTGTTCA TCGAGAACCT CACGGCGCAG CAGTACGGCC ACTACTTCTG CGAGGCCC 1860 GAGGGCTCCT ACTTCCGCGA GGCTCAGCAC TGGCAGCTGC TGCCCGAGGA CGGCATCA 1920 GCCGAGCACC TGCTGGGTCA TGCCTGTGCC CTGGCTGCCT CCCTCTGGCT GGGGGTGC 1980 CCCACACTCA CTCTTGGCTT GCTGGTCCAC TAGGGCCTCC CGAGGCTGGG CATGCCTC 2040 GCTTCTGCAG CCCAGGGCAC TAGAACGTCT CACACTCAGA GCCGGCTGGC CCGGGAGC 2100 CTTGCCTGCC ACTTCTTCCA GGGGACAGAA TAACCCAGTG GAGGATGCCA GGCCTGGA 2160 CGTCCAGCCG CAGGCGGCTG CTGGGCCCCA GGTGGCGCAC GGATGGTGAG GGGCTGAG 2220 TGAGGGCACC GACTGTGAAG CTGGGGCATC GATGACCCAA GACTTTATCT TCTGGAAA 2280 ATTTTTCAGA CTCCTCAAAC TTGACTAAAT GCAGCGATGC TCCCAGCCCA AGAGCCCA 2340 GGTCGGGGAG TGGGTTTGGA TAGGAGAGCT GGGACTCCAT CTCGACCCTG GGGCTGAG 2400 CTGAGTCCTT CTGGACTCTT GGTACCCACA TTGCCTCCTT CCCCTCCCTC TCTCATGG 2460 GGGTGGCTGG TGTTCCTGAA GACCCAGGGC TACCCTCTGT CCAGCCCTGT CCTCTGCA 2520 TCCCTCTCTG GTCCTGGGTC CCACAGGACA GCCGCCTTGC ATGTTTATTG AAGGATGT 2580 GCTTTCCGGA CGGAAGGACG GAAAAAGCTC TGAAAAAAAA AAAAAAAAAA AAAAAA 2636 1195 base pairs nucleic acid single linear DNA (genomic) 2 CGGGGCTGCG GGATGACGCC TCCTCCTCCC GGACGTGCCG CCCCCAGCGC ACCGCGCGCC 60 CGCGTCCTCA GCCTGCCGGC TCGGTTCGGG CTCCCGCTGC GGCTGCGGCT TCTGCTGGT 120 TTCTGGGTGG CCGCCGCCTC CGCCCAAGGC CACTCGAGGA GCGGACCCCG CATCTCCGC 180 GTCTGGAAAG GGCAGGACCA TGTGGACTTT AGCCAGCCTG AGCCACACAC CGTGCTTTT 240 CATGAGCCGG GCAGCTTCTC TGTCTGGGTG GGTGGACGTG GCAAGGTCTA CCACTTCAA 300 TTCCCCGAGG GCAAGAATGC CTCTGTGCGC ACGGTGAACA TCGGCTCCAC AAAGGGGTC 360 TGTCAGGACA AACAGGACTG TGGGAATTAC ATCACTCTTC TAGAAAGGCG GGGTAATGG 420 CTGCTGGTCT GTGGCACCAA TGCCCGGAAG CCCAGCTGCT GGAACTTGGT GAATGACAG 480 GTGGTGATGT CACTTGGTGA GATGAAAGGC TATGCCCCCT TCAGCCCGGA TGAGAACTC 540 CTGGTTCTGT TTGAAGGAGA TGAAGTGTAC TCTACCATCC GGAAGCAGGA ATACAACGG 600 AAGATCCCTC GGTTTCGACG CATTCGGGGC GAGAGTGAAC TGTACACAAG TGATACAGT 660 ATGCAGAACC CACAGTTCAT CAAGGCCACC ATTGTGCACC AAGACCAAGC CTATGATGA 720 AAGATCTACT ACTTCTTCCG AGAAGACAAC CCTGACAAGA ACCCCGAGGC TCCTCTCAA 780 GTGTCCCGAG TAGCCCAGTT GTGCAGGGGG GACCAGGGTG GTGAGAGTTC GTTGTCTGT 840 TCCAAGTGGA ACACCTTCCT GAAAGCCATG TTGGTCTGCA GCGATGCAGC CACCAACAG 900 AACTTCAATC GGCTGCAAGA TGTCTTCCTG CTCCCTGACC CCAGTGGCCA GTGGAGAGA 960 ACCAGGGTCT ATGGCGTTTT CTCCAACCCC TGGAACTACT CAGCTGTCTG CGTGTATT 1020 CTTGGTGACA TTGACAGAGT CTTCCGTACC TCATCGCTCA AAGGCTACCA CATGGGCC 1080 TCCAACCCTC GACCTGGCAT GTGCCTCCCA AAAAAGCAGC CCATACCCAC AGAAACCT 1140 CAGGTAGCTG ATAGTCACCC AGAGGTGGCT CAGAGGGTGG AACCTATGGG GCCCC 1195 666 amino acids amino acid n/a linear amino acid 3 Met Thr Pro Pro Pro Pro Gly Arg Ala Ala Pro Ser Ala Pro Arg Al 1 5 10 15 Arg Val Pro Gly Pro Pro Ala Arg Leu Gly Leu Pro Leu Arg Leu Ar 20 25 30 Leu Leu Leu Leu Leu Trp Ala Ala Ala Ala Ser Ala Gln Gly His Le 35 40 45 Arg Ser Gly Pro Arg Ile Phe Ala Val Trp Lys Gly His Val Gly Gl 50 55 60 Asp Arg Val Asp Phe Gly Gln Thr Glu Pro His Thr Val Leu Phe Hi 65 70 75 80 Glu Pro Gly Ser Ser Ser Val Trp Val Gly Gly Arg Gly Lys Val Ty 85 90 95 Leu Phe Asp Phe Pro Glu Gly Lys Asn Ala Ser Val Arg Thr Val As 100 105 110 Ile Gly Ser Thr Lys Gly Ser Cys Leu Asp Lys Arg Asp Cys Glu As 115 120 125 Tyr Ile Thr Leu Leu Glu Arg Arg Ser Glu Gly Leu Leu Ala Cys Gl 130 135 140 Thr Asn Ala Arg His Pro Ser Cys Trp Asn Leu Val Asn Gly Thr Va 145 150 155 160 Val Pro Leu Gly Glu Met Arg Gly Tyr Ala Pro Phe Ser Pro Asp Gl 165 170 175 Asn Ser Leu Val Leu Phe Glu Gly Asp Glu Val Tyr Ser Thr Ile Ar 180 185 190 Lys Gln Glu Tyr Asn Gly Lys Ile Pro Arg Phe Arg Arg Ile Arg Gl 195 200 205 Glu Ser Glu Leu Tyr Thr Ser Asp Thr Val Met Gln Asn Pro Gln Ph 210 215 220 Ile Lys Ala Thr Ile Val His Gln Asp Gln Ala Tyr Asp Asp Lys Il 225 230 235 240 Tyr Tyr Phe Phe Arg Glu Asp Asn Pro Asp Lys Asn Pro Glu Ala Pr 245 250 255 Leu Asn Val Ser Arg Val Ala Gln Leu Cys Arg Gly Asp Gln Gly Gl 260 265 270 Glu Ser Ser Leu Ser Val Ser Lys Trp Asn Thr Phe Leu Lys Ala Me 275 280 285 Leu Val Cys Ser Asp Ala Ala Thr Asn Lys Asn Phe Asn Arg Leu Gl 290 295 300 Asp Val Phe Leu Leu Pro Asp Pro Ser Gly Gln Trp Arg Asp Thr Ar 305 310 315 320 Val Tyr Gly Val Phe Ser Asn Pro Trp Asn Tyr Ser Ala Val Cys Va 325 330 335 Tyr Ser Leu Gly Asp Ile Asp Lys Val Phe Arg Thr Ser Ser Leu Ly 340 345 350 Gly Tyr His Ser Ser Leu Pro Asn Pro Arg Pro Gly Lys Cys Leu Pr 355 360 365 Asp Gln Gln Pro Ile Pro Thr Glu Thr Phe Gln Val Ala Asp Arg Hi 370 375 380 Pro Glu Val Ala Gln Arg Val Glu Pro Met Gly Pro Leu Lys Thr Pr 385 390 395 400 Leu Phe His Ser Lys Tyr His Tyr Gln Lys Val Ala Val His Arg Me 405 410 415 Gln Ala Ser His Gly Glu Thr Phe His Val Leu Tyr Leu Thr Thr As 420 425 430 Arg Gly Thr Ile His Lys Val Val Glu Pro Gly Glu Gln Glu His Se 435 440 445 Phe Ala Phe Asn Ile Met Glu Ile Gln Pro Phe Arg Arg Ala Ala Al 450 455 460 Ile Gln Thr Met Ser Leu Asp Ala Glu Arg Arg Lys Leu Tyr Val Se 465 470 475 480 Ser Gln Trp Glu Val Ser Gln Val Pro Leu Asp Leu Cys Glu Val Ty 485 490 495 Gly Gly Gly Cys His Gly Cys Leu Met Ser Arg Asp Pro Tyr Cys Gl 500 505 510 Trp Asp Gln Gly Arg Cys Ile Ser Ile Tyr Ser Ser Glu Arg Ser Va 515 520 525 Leu Gln Ser Ile Asn Pro Ala Glu Pro His Lys Glu Cys Pro Asn Pr 530 535 540 Lys Pro Asp Lys Ala Pro Leu Gln Lys Val Ser Leu Ala Pro Asn Se 545 550 555 560 Arg Tyr Tyr Leu Ser Cys Pro Met Glu Ser Arg His Ala Thr Tyr Se 565 570 575 Trp Arg His Lys Glu Asn Val Glu Gln Ser Cys Glu Pro Gly His Gl 580 585 590 Ser Pro Asn Cys Ile Leu Phe Ile Glu Asn Leu Thr Ala Gln Gln Ty 595 600 605 Gly His Tyr Phe Cys Glu Ala Gln Glu Gly Ser Tyr Phe Arg Glu Al 610 615 620 Gln His Trp Gln Leu Leu Pro Glu Asp Gly Ile Met Ala Glu His Le 625 630 635 640 Leu Gly His Ala Cys Ala Leu Ala Ala Ser Leu Trp Leu Gly Val Le 645 650 655 Pro Thr Leu Thr Leu Gly Leu Leu Val His 660 665 394 amino acids amino acid n/a linear amino acid 4 Met Thr Pro Pro Pro Pro Gly Arg Ala Ala Pro Ser Ala Pro Arg Al 1 5 10 15 Arg Val Leu Ser Leu Pro Ala Arg Phe Gly Leu Pro Leu Arg Leu Ar 20 25 30 Leu Leu Leu Val Phe Trp Val Ala Ala Ala Ser Ala Gln Gly His Se 35 40 45 Arg Ser Gly Pro Arg Ile Ser Ala Val Trp Lys Gly Gln Asp His Va 50 55 60 Asp Phe Ser Gln Pro Glu Pro His Thr Val Leu Phe His Glu Pro Gl 65 70 75 80 Ser Phe Ser Val Trp Val Gly Gly Arg Gly Lys Val Tyr His Phe As 85 90 95 Phe Pro Glu Gly Lys Asn Ala Ser Val Arg Thr Val Asn Ile Gly Se 100 105 110 Thr Lys Gly Ser Cys Gln Asp Lys Gln Asp Cys Gly Asn Tyr Ile Th 115 120 125 Leu Leu Glu Arg Arg Gly Asn Gly Leu Leu Val Cys Gly Thr Asn Al 130 135 140 Arg Lys Pro Ser Cys Trp Asn Leu Val Asn Asp Ser Val Val Met Se 145 150 155 160 Leu Gly Glu Met Lys Gly Tyr Ala Pro Phe Ser Pro Asp Glu Asn Se 165 170 175 Leu Val Leu Phe Glu Gly Asp Glu Val Tyr Ser Thr Ile Arg Lys Gl 180 185 190 Glu Tyr Asn Gly Lys Ile Pro Arg Phe Arg Arg Ile Arg Gly Glu Se 195 200 205 Glu Leu Tyr Thr Ser Asp Thr Val Met Gln Asn Pro Gln Phe Ile Ly 210 215 220 Ala Thr Ile Val His Gln Asp Gln Ala Tyr Asp Asp Lys Ile Tyr Ty 225 230 235 240 Phe Phe Arg Glu Asp Asn Pro Asp Lys Asn Pro Glu Ala Pro Leu As 245 250 255 Val Ser Arg Val Ala Gln Leu Cys Arg Gly Asp Gln Gly Gly Glu Se 260 265 270 Ser Leu Ser Val Ser Lys Trp Asn Thr Phe Leu Lys Ala Met Leu Va 275 280 285 Cys Ser Asp Ala Ala Thr Asn Arg Asn Phe Asn Arg Leu Gln Asp Va 290 295 300 Phe Leu Leu Pro Asp Pro Ser Gly Gln Trp Arg Asp Thr Arg Val Ty 305 310 315 320 Gly Val Phe Ser Asn Pro Trp Asn Tyr Ser Ala Val Cys Val Tyr Se 325 330 335 Leu Gly Asp Ile Asp Arg Val Phe Arg Thr Ser Ser Leu Lys Gly Ty 340 345 350 His Met Gly Leu Ser Asn Pro Arg Pro Gly Met Cys Leu Pro Lys Ly 355 360 365 Gln Pro Ile Pro Thr Glu Thr Phe Gln Val Ala Asp Ser His Pro Gl 370 375 380 Val Ala Gln Arg Val Glu Pro Met Gly Pro 385 390 23 base pairs nucleic acid single linear DNA (genomic) 5 ACTCACTATA GGGCTCGAGC GGC 23 20 base pairs nucleic acid single linear DNA (genomic) 6 AGCCGCACAC GGTGCTTTTC 20 20 base pairs nucleic acid single linear DNA (genomic) 7 GCACAGATGC GTTCTTGCCC 20 20 base pairs nucleic acid single linear DNA (genomic) 8 ACCATAGACC CTGGTGTCCC 20 20 base pairs nucleic acid single linear DNA (genomic) 9 GCAGTGATGC TGCCACCAAC 20 20 base pairs nucleic acid single linear DNA (genomic) 10 CCAGACCATG TCGCTGGATG 20 20 base pairs nucleic acid single linear DNA (genomic) 11 ACATGAGGCA ACCGTGGCAG 20 27 base pairs nucleic acid single linear DNA (genomic) 12 CCATCCTAAT ACGACTCACT ATAGGGC 27 20 base pairs nucleic acid single linear DNA (genomic) 13 AGGTAGACCT TGCCACGTCC 20 23 base pairs nucleic acid single linear DNA (genomic) 14 GAACTTCAAC AGGCTGCAAG ACG 23 20 base pairs nucleic acid single linear DNA (genomic) 15 ATGCTGAGCG GAGGAAGCTG 20 20 base pairs nucleic acid single linear DNA (genomic) 16 CCGCCATACA CCTCACACAG 20 28 base pairs nucleic acid single linear DNA (genomic) 17 CTGGAAGCTT TCTGTGGGTA TCGGCTGC 28 25 base pairs nucleic acid single linear DNA (genomic) 18 TTTGGATCCC TGGTTCTGTT TGAAG 25 50 base pairs nucleic acid single linear DNA (genomic) 19 TTCTAGAATT CAGCGGCCGC TTTTTTTTTT TTTTTTTTTT TTTTTTTTTT 50 27 base pairs nucleic acid single linear DNA (genomic) 20 GGGGAAAGTT CACTGTCAGT CTCCAAG 27 26 base pairs nucleic acid single linear DNA (genomic) 21 GGGAATACAC ACAGACGGCT GAGTAG 26 22 base pairs nucleic acid single linear DNA (genomic) 22 AGCAAGTTCA GCCTGGTTAA GT 22 21 base pairs nucleic acid single linear DNA (genomic) 23 TTATGAGTAT TTCTTCCAGG G 21 26 base pairs nucleic acid single linear DNA (genomic) 24 CCATTAATCC AGCCGAGCCA CACAAG 26 25 base pairs nucleic acid single linear DNA (genomic) 25 CATCTACAGC TCCGAACGGT CAGTG 25 20 base pairs nucleic acid single linear DNA (genomic) 26 CAGCGGAAGC CCCAACCGAG 20 23 base pairs nucleic acid single linear DNA (genomic) 27 GGGATGACGC CTCCTCCGCC CGG 23 31 base pairs nucleic acid single linear DNA (genomic) 28 AAGCTTCACG TGGACCAGCA AGCCAAGAGT G 31 25 base pairs nucleic acid single linear DNA (genomic) 29 AAGCTTTTTC CGTCCTTCCG TCCGG 25 24 base pairs nucleic acid single linear DNA (genomic) 30 ATGGTGAGCA AGGGCGAGGA GCTG 24 24 base pairs nucleic acid single linear DNA (genomic) 31 CTTGTACAGC TCGTCCATGC CGAG 24 25 base pairs nucleic acid single linear DNA (genomic) 32 GGGTGGTGAG AGTTCGTTGT CTGTC 25 25 base pairs nucleic acid single linear DNA (genomic) 33 GAGCGATGAG GTACGGAAGA CTCTG 25 5856 base pairs nucleic acid single linear DNA (genomic) 34 AGCGCCCAAT ACGCAAACCG CCTCTCCCCG CGCGTTGGCC GATTCATTAA TGCAGCTGGC 60 ACGACAGGTT TCCCGACTGG AAAGCGGGCA GTGAGCGCAA CGCAATTAAT GTGAGTTAG 120 TCACTCATTA GGCACCCCAG GCTTTACACT TTATGCTTCC GGCTCGTATG TTGTGTGGA 180 TTGTGAGCGG ATAACAATTT CACACAGGAA ACAGCTATGA CCATGATTAC GCCAAGCTT 240 ACGTGGACCA GCAAGCCAAG AGTGAGTGTG GGCAGCACCC CCAGCCAGAG GGAGGCAGC 300 AGGGCACAGG CATGACCCAG CAGGTGCTCG GCCATGATGC CGTCCTCGGG CAGCAGCTG 360 CAGTGCTGAG CCTCGCGGAA GTAGGAGCCC TCCTGGGCCT CGCAGAAGTA GTGGCCGTA 420 TGCTGCGCCG TGAGGTTCTC GATGAACAGG ATGCAGTTGG GGCTCTGGTG ACCAGGTTC 480 CAGCTCTGCT CCACGTTCTC CTTGTGGCGC CATGAGTAGG TGGCGTGGCG GGATTCCAT 540 GGGCAGCTCA GGTAGTAGCG AGAGTTTGGG GCCAGGGAAA CCTTCTGCAG TGGGGCCTT 600 TCTGGTTTGG GGTTGGGACA CTCCTTGTGT GGCTCGGCTG GATTAATGGA TTGCAGCAC 660 GACCGTTCGG AGCTGTAGAT GGAGATGCAG CGGCCCTGGT CCCAGCCGCA GTAGGGGTC 720 CGGGACATGA GGCAACCGTG GCAGCCCCCG CCATAGACCT CACACAGGTC CAGGGGCAC 780 TGGCTCACCT CCCACTGGGA GCTCACATAC AGCTTCCTCC GCTCAGCATC CAGCGACAT 840 GTCTGGATGG CAGCCGCGCG GCGGAAGGGC TGGATCTCCA TGATGTTGAA GGCGAAGCT 900 TGCTCCTGCT CCCCCGGTTC CACCACCTTG TGGATAGTGC CCCTGTCTGT AGTTAGGTA 960 AGCACATGAA AGGTCTCCCC GTGGCTGGCT TGCATGCGGT GAACGGCCAC TTTCTGGT 1020 TGGTATTTAG AGTGGAACAA TGGCGTCTTC AGAGGCCCCA TGGGCTCCAC CCTCTGCG 1080 ACCTCTGGGT GACGGTCAGC CACCTGGAAG GTCTCTGTGG GTATCGGCTG CTGGTCTG 1140 AGGCACTTGC CAGGCCGCGG GTTGGGAAGG CTTGAGTGGT AGCCCTTGAG TGAGGAGG 1200 CGGAAGACCT TGTCAATGTC ACCGAGGGAA TACACACAGA CGGCTGAGTA GTTCCAGG 1260 TTGGAGAAAA CACCATAGAC CCTGGTGTCC CTCCACTGGC CGCTGGGGTC AGGGAGCA 1320 AAGACGTCTT GCAGCCTGTT GAAGTTCTTG TTGGTGGCAG CATCACTGCA TACCAGCA 1380 GCTTTCAGAA AAGTGTTCCA CTTGGAGACT GACAGTGAAC TTTCCCCACC CTGGTCCC 1440 CTGCACAACT GGGCCACACG GGACACATTG AGAGGAGCCT CAGGATTCTT GTCAGGAT 1500 TCCTCTCGGA AGAAGTAGTA GATCTTGTCA TCGTAAGCCT GGTCTTGGTG CACGATGG 1560 GCTTTGATGA ACTGTGGGTT CTGCATGACA GTATCACTGG TGTACAGCTC ACTCTCGC 1620 CGGATGCGGC GGAACCGAGG GATCTTCCCA TTGTATTCCT GCTTCCGGAT GGTGGAAT 1680 ACCTCGTCCC CTTCAAACAG AACCAGGGAG TTCTCGTCCG GGCTGAAGGG GGCGTAGC 1740 CTCATCTCGC CAAGTGGCAC CACAGTGCCA TTCACCAGGT TCCAGCAGCT GGGGTGCC 1800 GCGTTGGTGC CACAGGCCAG CAGCCCCTCA CTCCGCCTCT CCAGGAGAGT GATGTAGT 1860 TCGCAGTCCC GCTTATCCAG ACAGGACCCC TTTGTGGAGC CGATATTCAC CGTGCGCA 1920 GATGCGTTCT TGCCCTCGGG GAAGTCAAAG AGGTAGACCT TGCCACGTCC TCCCACCC 1980 ACAGAGGAGC TGCCTGGCTC GTGGAAAAGC ACCGTGTGCG GCTCAGTCTG GCCAAAGT 2040 ACCCGGTCCT GCCCTACATG GCCTTTCCAG ACGGCGAAGA TGCGGGGTCC GCTCCTTA 2100 TGGCCCTGGG CGGAGGCGGC GGCCGCCCAG AGCAGCAGCA GCAGCCGCAG CCGCAGCG 2160 AGCCCCAACC GAGCCGGCGG GCCAGGGACG CGGGCGCGCG GTGCGCTGGG GGCGGCAC 2220 CCGGGCGGAG GAGGCGTCAT CCCAAGCCGA ATTCTGCAGA TATCCATCAC ACTGGCGG 2280 GCTCGAGCAT GCATCTAGAG GGCCCAATTC GCCCTATAGT GAGTCGTATT ACAATTCA 2340 GGCCGTCGTT TTACAACGTC GTGACTGGGA AAACCCTGGC GTTACCCAAC TTAATCGC 2400 TGCAGCACAT CCCCCTTTCG CCAGCTGGCG TAATAGCGAA GAGGCCCGCA CCGATCGC 2460 TTCCCAACAG TTGCGCAGCC TGAATGGCGA ATGGGACGCG CCCTGTAGCG GCGCATTA 2520 CGCGGCGGGT GTGGTGGTTA CGCGCAGCGT GACCGCTACA CTTGCCAGCG CCCTAGCG 2580 CGCTCCTTTC GCTTTCTTCC CTTCCTTTCT CGCCACGTTC GCCGGCTTTC CCCGTCAA 2640 TCTAAATCGG GGGCTCCCTT TAGGGTTCCG ATTTAGAGCT TTACGGCACC TCGACCGC 2700 AAAACTTGAT TTGGGTGATG GTTCACGTAG TGGGCCATCG CCCTGATAGA CGGTTTTT 2760 CCCTTTGACG TTGGAGTCCA CGTTCTTTAA TAGTGGACTC TTGTTCCAAA CTGGAACA 2820 ACTCAACCCT ATCGCGGTCT ATTCTTTTGA TTTATAAGGG ATTTTGCCGA TTTCGGCC 2880 TTGGTTAAAA AATGAGCTGA TTTAACAAAT TCAGGGCGCA AGGGCTGCTA AAGGAACC 2940 AACACGTAGA AAGCCAGTCC GCAGAAACGG TGCTGACCCC GGATGAATGT CAGCTACT 3000 GCTATCTGGA CAAGGGAAAA CGCAAGCGCA AAGAGAAAGC AGGTAGCTTG CAGTGGGC 3060 ACATGGCGAT AGCTAGACTG GGCGGTTTTA TGGACAGCAA GCGAACCGGA ATTGCCAG 3120 GGGGCGCCCT CTGGTAAGGT TGGGAAGCCC TGCAAAGTAA ACTGGATGGC TTTCTTGC 3180 CCAAGGATCT GATGGCGCAG GGGATCAAGA TCTGATCAAG AGACAGGATG AGGATCGT 3240 CGCATGATTG AACAAGATGG ATTGCACGCA GGTTCTCCGG CCGCTTGGGT GGAGAGGC 3300 TTCGGCTATG ACTGGGCACA ACAGACAATC GGCTGCTCTG ATGCCGCCGT GTTCCGGC 3360 TCAGCGCAGG GGCGCCCGGT TCTTTTTGTC AAGACCGACC TGTCCGGTGC CCTGAATG 3420 CTGCAGGACG AGGCAGCGCG GCTATCGTGG CTGGCCACGA CGGGCGTTCC TTGCGCAG 3480 GTGCTCGACG TTGTCACTGA AGCGGGAAGG GACTGGCTGC TATTGGGCGA AGTGCCGG 3540 CAGGATCTCC TGTCATCTCG CCTTGCTCCT GCCGAGAAAG TATCCATCAT GGCTGATG 3600 ATGCGGCGGC TGCATACGCT TGATCCGGCT ACCTGCCCAT TCGACCACCA AGCGAAAC 3660 CGCATCGAGC GAGCACGTAC TCGGATGGAA GCCGGTCTTG TCGATCAGGA TGATCTGG 3720 GAAGAGCATC AGGGGCTCGC GCCAGCCGAA CTGTTCGCCA GGCTCAAGGC GCGCATGC 3780 GACGGCGAGG ATCTCGTCGT GATCCATGGC GATGCCTGCT TGCCGAATAT CATGGTGG 3840 AATGGCCGCT TTTCTGGATT CAACGACTGT GGCCGGCTGG GTGTGGCGGA CCGCTATC 3900 GACATAGCGT TGGATACCCG TGATATTGCT GAAGAGCTTG GCGGCGAATG GGCTGACC 3960 TTCCTCGTGC TTTACGGTAT CGCCGCTCCC GATTCGCAGC GCATCGCCTT CTATCGCC 4020 CTTGACGAGT TCTTCTGAAT TGAAAAAGGA AGAGTATGAG TATTCAACAT TTCCGTGT 4080 CCCTTATTCC CTTTTTTGCG GCATTTTGCC TTCCTGTTTT TGCTCACCCA GAAACGCT 4140 TGAAAGTAAA AGATGCTGAA GATCAGTTGG GTGCACGAGT GGGTTACATC GAACTGGA 4200 TCAACAGCGG TAAGATCCTT GAGAGTTTTC GCCCCGAAGA ACGTTTTCCA ATGATGAG 4260 CTTTTAAAGT TCTGCTATGT CATACACTAT TATCCCGTAT TGACGCCGGG CAAGAGCA 4320 TCGGTCGCCG GGCGCGGTAT TCTCAGAATG ACTTGGTTGA GTACTCACCA GTCACAGA 4380 AGCATCTTAC GGATGGCATG ACAGTAAGAG AATTATGCAG TGCTGCCATA ACCATGAG 4440 ATAACACTGC GGCCAACTTA CTTCTGACAA CGATCGGAGG ACCGAAGGAG CTAACCGC 4500 TTTTGCACAA CATGGGGGAT CATGTAACTC GCCTTGATCG TTGGGAACCG GAGCTGAA 4560 AAGCCATACC AAACGACGAG AGTGACACCA CGATGCCTGT AGCAATGCCA ACAACGTT 4620 GCAAACTATT AACTGGCGAA CTACTTACTC TAGCTTCCCG GCAACAATTA ATAGACTG 4680 TGGAGGCGGA TAAAGTTGCA GGACCACTTC TGCGCTCGGC CCTTCCGGCT GGCTGGTT 4740 TTGCTGATAA ATCTGGAGCC GGTGAGCGTG GGTCTCGCGG TATCATTGCA GCACTGGG 4800 CAGATGGTAA GCCCTCCCGT ATCGTAGTTA TCTACACGAC GGGGAGTCAG GCAACTAT 4860 ATGAACGAAA TAGACAGATC GCTGAGATAG GTGCCTCACT GATTAAGCAT TGGTAACT 4920 CAGACCAAGT TTACTCATAT ATACTTTAGA TTGATTTAAA ACTTCATTTT TAATTTAA 4980 GGATCTAGGT GAAGATCCTT TTTGATAATC TCATGACCAA AATCCCTTAA CGTGAGTT 5040 CGTTCCACTG AGCGTCAGAC CCCGTAGAAA AGATCAAAGG ATCTTCTTGA GATCCTTT 5100 TTCTGCGCGT AATCTGCTGC TTGCAAACAA AAAAACCACC GCTACCAGCG GTGGTTTG 5160 TGCCGGATCA AGAGCTACCA ACTCTTTTTC CGAAGGTAAC TGGCTTCAGC AGAGCGCA 5220 TACCAAATAC TGTCCTTCTA GTGTAGCCGT AGTTAGGCCA CCACTTCAAG AACTCTGT 5280 CACCGCCTAC ATACCTCGCT CTGCTAATCC TGTTACCAGT GGCTGCTGCC AGTGGCGA 5340 AGTCGTGTCT TACCGGGTTG GACTCAAGAC GATAGTTACC GGATAAGGCG CAGCGGTC 5400 GCTGAACGGG GGGTTCGTGC ACACAGCCCA GCTTGGAGCG AACGACCTAC ACCGAACT 5460 GATACCTACA GCGTGAGCAT TGAGAAAGCG CCACGCTTCC CGAAGGGAGA AAGGCGGA 5520 GGTATCCGGT AAGCGGCAGG GTCGGAACAG GAGAGCGCAC GAGGGAGCTT CCAGGGGG 5580 ACGCCTGGTA TCTTTATAGT CCTGTCGGGT TTCGCCACCT CTGACTTGAG CGTCGATT 5640 TGTGATGCTC GTCAGGGGGG CGGAGCCTAT GGAAAAACGC CAGCAACGCG GCCTTTTT 5700 GGTTCCTGGC CTTTTGCTGG CCTTTTGCTC ACATGTTCTT TCCTGCGTTA TCCCCTGA 5760 CTGTGGATAA CCGTATTACC GCCTTTGAGT GAGCTGATAC CGCTCGCCGC AGCCGAAC 5820 CCGAGCGCAG CGAGTCAGTG AGCGAGGAAG CGGAAG 5856 7475 base pairs nucleic acid single linear DNA (genomic) 35 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTCGACTCT CAGTACAATC TGCTCTGATG 60 CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT GGAGGTCGCT GAGTAGTGC 120 CGAGCAAAAT TTAAGCTACA ACAAGGCAAG GCTTGACCGA CAATTGCATG AAGAATCTG 180 TTAGGGTTAG GCGTTTTGCG CTGCTTCGCG ATGTACGGGC CAGATATACG CGTTGACAT 240 GATTATTGAC TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATAT 300 TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG CCCAACGAC 360 CCCGCCCATT GACGTCAATA ATGACGTATG TTCCCATAGT AACGCCAATA GGGACTTTC 420 ATTGACGTCA ATGGGTGGAC TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTG 480 ATCATATGCC AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCAT 540 ATGCCCAGTA CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTC 600 TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA TAGCGGTTT 660 ACTCACGGGG ATTTCCAAGT CTCCACCCCA TTGACGTCAA TGGGAGTTTG TTTTGGCAC 720 AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGC 780 GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCC 840 CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAG 900 GTTTAAACGG GCCCTCTAGA CTCGAGCGGC CGCCACTGTG CTGGATATCT GCAGAATTC 960 GCTTGGGATG ACGCCTCCTC CGCCCGGACG TGCCGCCCCC AGCGCACCGC GCGCCCGC 1020 CCCTGGCCCG CCGGCTCGGT TGGGGCTTCC GCTGCGGCTG CGGCTGCTGC TGCTGCTC 1080 GGCGGCCGCC GCCTCCGCCC AGGGCCACCT AAGGAGCGGA CCCCGCATCT TCGCCGTC 1140 GAAAGGCCAT GTAGGGCAGG ACCGGGTGGA CTTTGGCCAG ACTGAGCCGC ACACGGTG 1200 TTTCCACGAG CCAGGCAGCT CCTCTGTGTG GGTGGGAGGA CGTGGCAAGG TCTACCTC 1260 TGACTTCCCC GAGGGCAAGA ACGCATCTGT GCGCACGGTG AATATCGGCT CCACAAAG 1320 GTCCTGTCTG GATAAGCGGG ACTGCGAGAA CTACATCACT CTCCTGGAGA GGCGGAGT 1380 GGGGCTGCTG GCCTGTGGCA CCAACGCCCG GCACCCCAGC TGCTGGAACC TGGTGAAT 1440 CACTGTGGTG CCACTTGGCG AGATGAGAGG CTACGCCCCC TTCAGCCCGG ACGAGAAC 1500 CCTGGTTCTG TTTGAAGGGG ACGAGGTGTA TTCCACCATC CGGAAGCAGG AATACAAT 1560 GAAGATCCCT CGGTTCCGCC GCATCCGGGG CGAGAGTGAG CTGTACACCA GTGATACT 1620 CATGCAGAAC CCACAGTTCA TCAAAGCCAC CATCGTGCAC CAAGACCAGG CTTACGAT 1680 CAAGATCTAC TACTTCTTCC GAGAGGACAA TCCTGACAAG AATCCTGAGG CTCCTCTC 1740 TGTGTCCCGT GTGGCCCAGT TGTGCAGGGG GGACCAGGGT GGGGAAAGTT CACTGTCA 1800 CTCCAAGTGG AACACTTTTC TGAAAGCCAT GCTGGTATGC AGTGATGCTG CCACCAAC 1860 GAACTTCAAC AGGCTGCAAG ACGTCTTCCT GCTCCCTGAC CCCAGCGGCC AGTGGAGG 1920 CACCAGGGTC TATGGTGTTT TCTCCAACCC CTGGAACTAC TCAGCCGTCT GTGTGTAT 1980 CCTCGGTGAC ATTGACAAGG TCTTCCGTAC CTCCTCACTC AAGGGCTACC ACTCAAGC 2040 TCCCAACCCG CGGCCTGGCA AGTGCCTCCC AGACCAGCAG CCGATACCCA CAGAGACC 2100 CCAGGTGGCT GACCGTCACC CAGAGGTGGC GCAGAGGGTG GAGCCCATGG GGCCTCTG 2160 GACGCCATTG TTCCACTCTA AATACCACTA CCAGAAAGTG GCCGTTCACC GCATGCAA 2220 CAGCCACGGG GAGACCTTTC ATGTGCTTTA CCTAACTACA GACAGGGGCA CTATCCAC 2280 GGTGGTGGAA CCGGGGGAGC AGGAGCACAG CTTCGCCTTC AACATCATGG AGATCCAG 2340 CTTCCGCCGC GCGGCTGCCA TCCAGACCAT GTCGCTGGAT GCTGAGCGGA GGAAGCTG 2400 TGTGAGCTCC CAGTGGGAGG TGAGCCAGGT GCCCCTGGAC CTGTGTGAGG TCTATGGC 2460 GGGCTGCCAC GGTTGCCTCA TGTCCCGAGA CCCCTACTGC GGCTGGGACC AGGGCCGC 2520 CATCTCCATC TACAGCTCCG AACGGTCAGT GCTGCAATCC ATTAATCCAG CCGAGCCA 2580 CAAGGAGTGT CCCAACCCCA AACCAGACAA GGCCCCACTG CAGAAGGTTT CCCTGGCC 2640 AAACTCTCGC TACTACCTGA GCTGCCCCAT GGAATCCCGC CACGCCACCT ACTCATGG 2700 CCACAAGGAG AACGTGGAGC AGAGCTGCGA ACCTGGTCAC CAGAGCCCCA ACTGCATC 2760 GTTCATCGAG AACCTCACGG CGCAGCAGTA CGGCCACTAC TTCTGCGAGG CCCAGGAG 2820 CTCCTACTTC CGCGAGGCTC AGCACTGGCA GCTGCTGCCC GAGGACGGCA TCATGGCC 2880 GCACCTGCTG GGTCATGCCT GTGCCCTGGC TGCCTCCCTC TGGCTGGGGG TGCTGCCC 2940 ACTCACTCTT GGCTTGCTGG TCCACGTGAA GCTTGGGCCC GAACAAAAAC TCATCTCA 3000 AGAGGATCTG AATAGCGCCG TCGACCATCA TCATCATCAT CATTGAGTTT AAACCGCT 3060 TCAGCCTCGA CTGTGCCTTC TAGTTGCCAG CCATCTGTTG TTTGCCCCTC CCCCGTGC 3120 TCCTTGACCC TGGAAGGTGC CACTCCCACT GTCCTTTCCT AATAAAATGA GGAAATTG 3180 TCGCATTGTC TGAGTAGGTG TCATTCTATT CTGGGGGGTG GGGTGGGGCA GGACAGCA 3240 GGGGAGGATT GGGAAGACAA TAGCAGGCAT GCTGGGGATG CGGTGGGCTC TATGGCTT 3300 GAGGCGGAAA GAACCAGCTG GGGCTCTAGG GGGTATCCCC ACGCGCCCTG TAGCGGCG 3360 TTAAGCGCGG CGGGTGTGGT GGTTACGCGC AGCGTGACCG CTACACTTGC CAGCGCCC 3420 GCGCCCGCTC CTTTCGCTTT CTTCCCTTCC TTTCTCGCCA CGTTCGCCGG CTTTCCCC 3480 CAAGCTCTAA ATCGGGGCAT CCCTTTAGGG TTCCGATTTA GTGCTTTACG GCACCTCG 3540 CCCAAAAAAC TTGATTAGGG TGATGGTTCA CGTAGTGGGC CATCGCCCTG ATAGACGG 3600 TTTCGCCCTT TGACGTTGGA GTCCACGTTC TTTAATAGTG GACTCTTGTT CCAAACTG 3660 ACAACACTCA ACCCTATCTC GGTCTATTCT TTTGATTTAT AAGGGATTTT GGGGATTT 3720 GCCTATTGGT TAAAAAATGA GCTGATTTAA CAAAAATTTA ACGCGAATTA ATTCTGTG 3780 ATGTGTGTCA GTTAGGGTGT GGAAAGTCCC CAGGCTCCCC AGGCAGGCAG AAGTATGC 3840 AGCATGCATC TCAATTAGTC AGCAACCAGG TGTGGAAAGT CCCCAGGCTC CCCAGCAG 3900 AGAAGTATGC AAAGCATGCA TCTCAATTAG TCAGCAACCA TAGTCCCGCC CCTAACTC 3960 CCCATCCCGC CCCTAACTCC GCCCAGTTCC GCCCATTCTC CGCCCCATGG CTGACTAA 4020 TTTTTTATTT ATGCAGAGGC CGAGGCCGCC TCTGCCTCTG AGCTATTCCA GAAGTAGT 4080 GGAGGCTTTT TTGGAGGCCT AGGCTTTTGC AAAAAGCTCC CGGGAGCTTG TATATCCA 4140 TTCGGATCTG ATCAAGAGAC AGGATGAGGA TCGTTTCGCA TGATTGAACA AGATGGAT 4200 CACGCAGGTT CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG GGCACAAC 4260 ACAATCGGCT GCTCTGATGC CGCCGTGTTC CGGCTGTCAG CGCAGGGGCG CCCGGTTC 4320 TTTGTCAAGA CCGACCTGTC CGGTGCCCTG AATGAACTGC AGGACGAGGC AGCGCGGC 4380 TCGTGGCTGG CCACGACGGG CGTTCCTTGC GCAGCTGTGC TCGACGTTGT CACTGAAG 4440 GGAAGGGACT GGCTGCTATT GGGCGAAGTG CCGGGGCAGG ATCTCCTGTC ATCTCACC 4500 GCTCCTGCCG AGAAAGTATC CATCATGGCT GATGCAATGC GGCGGCTGCA TACGCTTG 4560 CCGGCTACCT GCCCATTCGA CCACCAAGCG AAACATCGCA TCGAGCGAGC ACGTACTC 4620 ATGGAAGCCG GTCTTGTCGA TCAGGATGAT CTGGACGAAG AGCATCAGGG GCTCGCGC 4680 GCCGAACTGT TCGCCAGGCT CAAGGCGCGC ATGCCCGACG GCGAGGATCT CGTCGTGA 4740 CATGGCGATG CCTGCTTGCC GAATATCATG GTGGAAAATG GCCGCTTTTC TGGATTCA 4800 GACTGTGGCC GGCTGGGTGT GGCGGACCGC TATCAGGACA TAGCGTTGGC TACCCGTG 4860 ATTGCTGAAG AGCTTGGCGG CGAATGGGCT GACCGCTTCC TCGTGCTTTA CGGTATCG 4920 GCTCCCGATT CGCAGCGCAT CGCCTTCTAT CGCCTTCTTG ACGAGTTCTT CTGAGCGG 4980 CTCTGGGGTT CGAAATGACC GACCAAGCGA CGCCCAACCT GCCATCACGA GATTTCGA 5040 CCACCGCCGC CTTCTATGAA AGGTTGGGCT TCGGAATCGT TTTCCGGGAC GCCGGCTG 5100 TGATCCTCCA GCGCGGGGAT CTCATGCTGG AGTTCTTCGC CCACCCCAAC TTGTTTAT 5160 CAGCTTATAA TGGTTACAAA TAAAGCAATA GCATCACAAA TTTCACAAAT AAAGCATT 5220 TTTCACTGCA TTCTAGTTGT GGTTTGTCCA AACTCATCAA TGTATCTTAT CATGTCTG 5280 TACCGTCGAC CTCTAGCTAG AGCTTGGCGT AATCATGGTC ATAGCTGTTT CCTGTGTG 5340 ATTGTTATCC GCTCACAATT CCACACAACA TACGAGCCGG AAGCATAAAG TGTAAAGC 5400 GGGGTGCCTA ATGAGTGAGC TAACTCACAT TAATTGCGTT GCGCTCACTG CCCGCTTT 5460 AGTCGGGAAA CCTGTCGTGC CAGCTGCATT AATGAATCGG CCAACGCGCG GGGAGAGG 5520 GTTTGCGTAT TGGGCGCTCT TCCGCTTCCT CGCTCACTGA CTCGCTGCGC TCGGTCGT 5580 GGCTGCGGCG AGCGGTATCA GCTCACTCAA AGGCGGTAAT ACGGTTATCC ACAGAATC 5640 GGGATAACGC AGGAAAGAAC ATGTGAGCAA AAGGCCAGCA AAAGGCCAGG AACCGTAA 5700 AGGCCGCGTT GCTGGCGTTT TTCCATAGGC TCCGCCCCCC TGACGAGCAT CACAAAAA 5760 GACGCTCAAG TCAGAGGTGG CGAAACCCGA CAGGACTATA AAGATACCAG GCGTTTCC 5820 CTGGAAGCTC CCTCGTGCGC TCTCCTGTTC CGACCCTGCC GCTTACCGGA TACCTGTC 5880 CCTTTCTCCC TTCGGGAAGC GTGGCGCTTT CTCAATGCTC ACGCTGTAGG TATCTCAG 5940 CGGTGTAGGT CGTTCGCTCC AAGCTGGGCT GTGTGCACGA ACCCCCCGTT CAGCCCGA 6000 GCTGCGCCTT ATCCGGTAAC TATCGTCTTG AGTCCAACCC GGTAAGACAC GACTTATC 6060 CACTGGCAGC AGCCACTGGT AACAGGATTA GCAGAGCGAG GTATGTAGGC GGTGCTAC 6120 AGTTCTTGAA GTGGTGGCCT AACTACGGCT ACACTAGAAG GACAGTATTT GGTATCTG 6180 CTCTGCTGAA GCCAGTTACC TTCGGAAAAA GAGTTGGTAG CTCTTGATCC GGCAAACA 6240 CCACCGCTGG TAGCGGTGGT TTTTTTGTTT GCAAGCAGCA GATTACGCGC AGAAAAAA 6300 GATCTCAAGA AGATCCTTTG ATCTTTTCTA CGGGGTCTGA CGCTCAGTGG AACGAAAA 6360 CACGTTAAGG GATTTTGGTC ATGAGATTAT CAAAAAGGAT CTTCACCTAG ATCCTTTT 6420 ATTAAAAATG AAGTTTTAAA TCAATCTAAA GTATATATGA GTAAACTTGG TCTGACAG 6480 ACCAATGCTT AATCAGTGAG GCACCTATCT CAGCGATCTG TCTATTTCGT TCATCCAT 6540 TTGCCTGACT CCCCGTCGTG TAGATAACTA CGATACGGGA GGGCTTACCA TCTGGCCC 6600 GTGCTGCAAT GATACCGCGA GACCCACGCT CACCGGCTCC AGATTTATCA GCAATAAA 6660 AGCCAGCCGG AAGGGCCGAG CGCAGAAGTG GTCCTGCAAC TTTATCCGCC TCCATCCA 6720 CTATTAATTG TTGCCGGGAA GCTAGAGTAA GTAGTTCGCC AGTTAATAGT TTGCGCAA 6780 TTGTTGCCAT TGCTACAGGC ATCGTGGTGT CACGCTCGTC GTTTGGTATG GCTTCATT 6840 GCTCCGGTTC CCAACGATCA AGGCGAGTTA CATGATCCCC CATGTTGTGC AAAAAAGC 6900 TTAGCTCCTT CGGTCCTCCG ATCGTTGTCA GAAGTAAGTT GGCCGCAGTG TTATCACT 6960 TGGTTATGGC AGCACTGCAT AATTCTCTTA CTGTCATGCC ATCCGTAAGA TGCTTTTC 7020 TGACTGGTGA GTACTCAACC AAGTCATTCT GAGAATAGTG TATGCGGCGA CCGAGTTG 7080 CTTGCCCGGC GTCAATACGG GATAATACCG CGCCACATAG CAGAACTTTA AAAGTGCT 7140 TCATTGGAAA ACGTTCTTCG GGGCGAAAAC TCTCAAGGAT CTTACCGCTG TTGAGATC 7200 GTTCGATGTA ACCCACTCGT GCACCCAACT GATCTTCAGC ATCTTTTACT TTCACCAG 7260 TTTCTGGGTG AGCAAAAACA GGAAGGCAAA ATGCCGCAAA AAAGGGAATA AGGGCGAC 7320 GGAAATGTTG AATACTCATA CTCTTCCTTT TTCAATATTA TTGAAGCATT TATCAGGG 7380 ATTGTCTCAT GAGCGGATAC ATATTTGAAT GTATTTAGAA AAATAAACAA ATAGGGGT 7440 CGCGCACATT TCCCCGAAAA GTGCCACCTG ACGTC 7475 8192 base pairs nucleic acid single linear DNA (genomic) 36 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTCGACTCT CAGTACAATC TGCTCTGATG 60 CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT GGAGGTCGCT GAGTAGTGC 120 CGAGCAAAAT TTAAGCTACA ACAAGGCAAG GCTTGACCGA CAATTGCATG AAGAATCTG 180 TTAGGGTTAG GCGTTTTGCG CTGCTTCGCG ATGTACGGGC CAGATATACG CGTTGACAT 240 GATTATTGAC TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT AGCCCATAT 300 TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC TGGCTGACCG CCCAACGAC 360 CCCGCCCATT GACGTCAATA ATGACGTATG TTCCCATAGT AACGCCAATA GGGACTTTC 420 ATTGACGTCA ATGGGTGGAC TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTG 480 ATCATATGCC AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCAT 540 ATGCCCAGTA CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC GTATTAGTC 600 TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA TGGGCGTGGA TAGCGGTTT 660 ACTCACGGGG ATTTCCAAGT CTCCACCCCA TTGACGTCAA TGGGAGTTTG TTTTGGCAC 720 AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGC 780 GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCC 840 CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAG 900 GTTTAAACGG GCCCTCTAGA CTCGAGCGGC CGCCACTGTG CTGGATATCT GCAGAATTC 960 GCTTGGGATG ACGCCTCCTC CGCCCGGACG TGCCGCCCCC AGCGCACCGC GCGCCCGC 1020 CCCTGGCCCG CCGGCTCGGT TGGGGCTTCC GCTGCGGCTG CGGCTGCTGC TGCTGCTC 1080 GGCGGCCGCC GCCTCCGCCC AGGGCCACCT AAGGAGCGGA CCCCGCATCT TCGCCGTC 1140 GAAAGGCCAT GTAGGGCAGG ACCGGGTGGA CTTTGGCCAG ACTGAGCCGC ACACGGTG 1200 TTTCCACGAG CCAGGCAGCT CCTCTGTGTG GGTGGGAGGA CGTGGCAAGG TCTACCTC 1260 TGACTTCCCC GAGGGCAAGA ACGCATCTGT GCGCACGGTG AATATCGGCT CCACAAAG 1320 GTCCTGTCTG GATAAGCGGG ACTGCGAGAA CTACATCACT CTCCTGGAGA GGCGGAGT 1380 GGGGCTGCTG GCCTGTGGCA CCAACGCCCG GCACCCCAGC TGCTGGAACC TGGTGAAT 1440 CACTGTGGTG CCACTTGGCG AGATGAGAGG CTACGCCCCC TTCAGCCCGG ACGAGAAC 1500 CCTGGTTCTG TTTGAAGGGG ACGAGGTGTA TTCCACCATC CGGAAGCAGG AATACAAT 1560 GAAGATCCCT CGGTTCCGCC GCATCCGGGG CGAGAGTGAG CTGTACACCA GTGATACT 1620 CATGCAGAAC CCACAGTTCA TCAAAGCCAC CATCGTGCAC CAAGACCAGG CTTACGAT 1680 CAAGATCTAC TACTTCTTCC GAGAGGACAA TCCTGACAAG AATCCTGAGG CTCCTCTC 1740 TGTGTCCCGT GTGGCCCAGT TGTGCAGGGG GGACCAGGGT GGGGAAAGTT CACTGTCA 1800 CTCCAAGTGG AACACTTTTC TGAAAGCCAT GCTGGTATGC AGTGATGCTG CCACCAAC 1860 GAACTTCAAC AGGCTGCAAG ACGTCTTCCT GCTCCCTGAC CCCAGCGGCC AGTGGAGG 1920 CACCAGGGTC TATGGTGTTT TCTCCAACCC CTGGAACTAC TCAGCCGTCT GTGTGTAT 1980 CCTCGGTGAC ATTGACAAGG TCTTCCGTAC CTCCTCACTC AAGGGCTACC ACTCAAGC 2040 TCCCAACCCG CGGCCTGGCA AGTGCCTCCC AGACCAGCAG CCGATACCCA CAGAGACC 2100 CCAGGTGGCT GACCGTCACC CAGAGGTGGC GCAGAGGGTG GAGCCCATGG GGCCTCTG 2160 GACGCCATTG TTCCACTCTA AATACCACTA CCAGAAAGTG GCCGTTCACC GCATGCAA 2220 CAGCCACGGG GAGACCTTTC ATGTGCTTTA CCTAACTACA GACAGGGGCA CTATCCAC 2280 GGTGGTGGAA CCGGGGGAGC AGGAGCACAG CTTCGCCTTC AACATCATGG AGATCCAG 2340 CTTCCGCCGC GCGGCTGCCA TCCAGACCAT GTCGCTGGAT GCTGAGCGGA GGAAGCTG 2400 TGTGAGCTCC CAGTGGGAGG TGAGCCAGGT GCCCCTGGAC CTGTGTGAGG TCTATGGC 2460 GGGCTGCCAC GGTTGCCTCA TGTCCCGAGA CCCCTACTGC GGCTGGGACC AGGGCCGC 2520 CATCTCCATC TACAGCTCCG AACGGTCAGT GCTGCAATCC ATTAATCCAG CCGAGCCA 2580 CAAGGAGTGT CCCAACCCCA AACCAGACAA GGCCCCACTG CAGAAGGTTT CCCTGGCC 2640 AAACTCTCGC TACTACCTGA GCTGCCCCAT GGAATCCCGC CACGCCACCT ACTCATGG 2700 CCACAAGGAG AACGTGGAGC AGAGCTGCGA ACCTGGTCAC CAGAGCCCCA ACTGCATC 2760 GTTCATCGAG AACCTCACGG CGCAGCAGTA CGGCCACTAC TTCTGCGAGG CCCAGGAG 2820 CTCCTACTTC CGCGAGGCTC AGCACTGGCA GCTGCTGCCC GAGGACGGCA TCATGGCC 2880 GCACCTGCTG GGTCATGCCT GTGCCCTGGC TGCCTCCCTC TGGCTGGGGG TGCTGCCC 2940 ACTCACTCTT GGCTTGCTGG TCCACATGGT GAGCAAGGGC GAGGAGCTGT TCACCGGG 3000 GGTGCCCATC CTGGTCGAGC TGGACGGCGA CGTAAACGGC CACAAGTTCA GCGTGTCC 3060 CGAGGGCGAG GGCGATGCCA CCTACGGCAA GCTGACCCTG AAGTTCATCT GCACCACC 3120 CAAGCTGCCC GTGCCCTGGC CCACCCTCGT GACCACCCTG ACCTACGGCG TGCAGTGC 3180 CAGCCGCTAC CCCGACCACA TGAAGCAGCA CGACTTCTTC AAGTCCGCCA TGCCCGAA 3240 CTACGTCCAG GAGCGCACCA TCTTCTTCAA GGACGACGGC AACTACAAGA CCCGCGCC 3300 GGTGAAGTTC GAGGGCGACA CCCTGGTGAA CCGCATCGAG CTGAAGGGCA TCGACTTC 3360 GGAGGACGGC AACATCCTGG GGCACAAGCT GGAGTACAAC TACAACAGCC ACAACGTC 3420 TATCATGGCC GACAAGCAGA AGAACGGCAT CAAGGTGAAC TTCAAGATCC GCCACAAC 3480 CGAGGACGGC AGCGTGCAGC TCGCCGACCA CTACCAGCAG AACACCCCCA TCGGCGAC 3540 CCCCGTGCTG CTGCCCGACA ACCACTACCT GAGCACCCAG TCCGCCCTGA GCAAAGAC 3600 CAACGAGAAG CGCGATCACA TGGTCCTGCT GGAGTTCGTG ACCGCCGCCG GGATCACT 3660 CGGCATGGAC GAGCTGTACA AGGTGAAGCT TGGGCCCGAA CAAAAACTCA TCTCAGAA 3720 GGATCTGAAT AGCGCCGTCG ACCATCATCA TCATCATCAT TGAGTTTAAA CCGCTGAT 3780 GCCTCGACTG TGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTT 3840 TTGACCCTGG AAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA AATTGCAT 3900 CATTGTCTGA GTAGGTGTCA TTCTATTCTG GGGGGTGGGG TGGGGCAGGA CAGCAAGG 3960 GAGGATTGGG AAGACAATAG CAGGCATGCT GGGGATGCGG TGGGCTCTAT GGCTTCTG 4020 GCGGAAAGAA CCAGCTGGGG CTCTAGGGGG TATCCCCACG CGCCCTGTAG CGGCGCAT 4080 AGCGCGGCGG GTGTGGTGGT TACGCGCAGC GTGACCGCTA CACTTGCCAG CGCCCTAG 4140 CCCGCTCCTT TCGCTTTCTT CCCTTCCTTT CTCGCCACGT TCGCCGGCTT TCCCCGTC 4200 GCTCTAAATC GGGGCATCCC TTTAGGGTTC CGATTTAGTG CTTTACGGCA CCTCGACC 4260 AAAAAACTTG ATTAGGGTGA TGGTTCACGT AGTGGGCCAT CGCCCTGATA GACGGTTT 4320 CGCCCTTTGA CGTTGGAGTC CACGTTCTTT AATAGTGGAC TCTTGTTCCA AACTGGAA 4380 ACACTCAACC CTATCTCGGT CTATTCTTTT GATTTATAAG GGATTTTGGG GATTTCGG 4440 TATTGGTTAA AAAATGAGCT GATTTAACAA AAATTTAACG CGAATTAATT CTGTGGAA 4500 TGTGTCAGTT AGGGTGTGGA AAGTCCCCAG GCTCCCCAGG CAGGCAGAAG TATGCAAA 4560 ATGCATCTCA ATTAGTCAGC AACCAGGTGT GGAAAGTCCC CAGGCTCCCC AGCAGGCA 4620 AGTATGCAAA GCATGCATCT CAATTAGTCA GCAACCATAG TCCCGCCCCT AACTCCGC 4680 ATCCCGCCCC TAACTCCGCC CAGTTCCGCC CATTCTCCGC CCCATGGCTG ACTAATTT 4740 TTTATTTATG CAGAGGCCGA GGCCGCCTCT GCCTCTGAGC TATTCCAGAA GTAGTGAG 4800 GGCTTTTTTG GAGGCCTAGG CTTTTGCAAA AAGCTCCCGG GAGCTTGTAT ATCCATTT 4860 GGATCTGATC AAGAGACAGG ATGAGGATCG TTTCGCATGA TTGAACAAGA TGGATTGC 4920 GCAGGTTCTC CGGCCGCTTG GGTGGAGAGG CTATTCGGCT ATGACTGGGC ACAACAGA 4980 ATCGGCTGCT CTGATGCCGC CGTGTTCCGG CTGTCAGCGC AGGGGCGCCC GGTTCTTT 5040 GTCAAGACCG ACCTGTCCGG TGCCCTGAAT GAACTGCAGG ACGAGGCAGC GCGGCTAT 5100 TGGCTGGCCA CGACGGGCGT TCCTTGCGCA GCTGTGCTCG ACGTTGTCAC TGAAGCGG 5160 AGGGACTGGC TGCTATTGGG CGAAGTGCCG GGGCAGGATC TCCTGTCATC TCACCTTG 5220 CCTGCCGAGA AAGTATCCAT CATGGCTGAT GCAATGCGGC GGCTGCATAC GCTTGATC 5280 GCTACCTGCC CATTCGACCA CCAAGCGAAA CATCGCATCG AGCGAGCACG TACTCGGA 5340 GAAGCCGGTC TTGTCGATCA GGATGATCTG GACGAAGAGC ATCAGGGGCT CGCGCCAG 5400 GAACTGTTCG CCAGGCTCAA GGCGCGCATG CCCGACGGCG AGGATCTCGT CGTGACCC 5460 GGCGATGCCT GCTTGCCGAA TATCATGGTG GAAAATGGCC GCTTTTCTGG ATTCATCG 5520 TGTGGCCGGC TGGGTGTGGC GGACCGCTAT CAGGACATAG CGTTGGCTAC CCGTGATA 5580 GCTGAAGAGC TTGGCGGCGA ATGGGCTGAC CGCTTCCTCG TGCTTTACGG TATCGCCG 5640 CCCGATTCGC AGCGCATCGC CTTCTATCGC CTTCTTGACG AGTTCTTCTG AGCGGGAC 5700 TGGGGTTCGA AATGACCGAC CAAGCGACGC CCAACCTGCC ATCACGAGAT TTCGATTC 5760 CCGCCGCCTT CTATGAAAGG TTGGGCTTCG GAATCGTTTT CCGGGACGCC GGCTGGAT 5820 TCCTCCAGCG CGGGGATCTC ATGCTGGAGT TCTTCGCCCA CCCCAACTTG TTTATTGC 5880 CTTATAATGG TTACAAATAA AGCAATAGCA TCACAAATTT CACAAATAAA GCATTTTT 5940 CACTGCATTC TAGTTGTGGT TTGTCCAAAC TCATCAATGT ATCTTATCAT GTCTGTAT 6000 CGTCGACCTC TAGCTAGAGC TTGGCGTAAT CATGGTCATA GCTGTTTCCT GTGTGAAA 6060 GTTATCCGCT CACAATTCCA CACAACATAC GAGCCGGAAG CATAAAGTGT AAAGCCTG 6120 GTGCCTAATG AGTGAGCTAA CTCACATTAA TTGCGTTGCG CTCACTGCCC GCTTTCCA 6180 CGGGAAACCT GTCGTGCCAG CTGCATTAAT GAATCGGCCA ACGCGCGGGG AGAGGCGG 6240 TGCGTATTGG GCGCTCTTCC GCTTCCTCGC TCACTGACTC GCTGCGCTCG GTCGTTCG 6300 TGCGGCGAGC GGTATCAGCT CACTCAAAGG CGGTAATACG GTTATCCACA GAATCAGG 6360 ATAACGCAGG AAAGAACATG TGAGCAAAAG GCCAGCAAAA GGCCAGGAAC CGTAAAAA 6420 CCGCGTTGCT GGCGTTTTTC CATAGGCTCC GCCCCCCTGA CGAGCATCAC AAAAATCG 6480 GCTCAAGTCA GAGGTGGCGA AACCCGACAG GACTATAAAG ATACCAGGCG TTTCCCCC 6540 GAAGCTCCCT CGTGCGCTCT CCTGTTCCGA CCCTGCCGCT TACCGGATAC CTGTCCGC 6600 TTCTCCCTTC GGGAAGCGTG GCGCTTTCTC AATGCTCACG CTGTAGGTAT CTCAGTTC 6660 TGTAGGTCGT TCGCTCCAAG CTGGGCTGTG TGCACGAACC CCCCGTTCAG CCCGACCG 6720 GCGCCTTATC CGGTAACTAT CGTCTTGAGT CCAACCCGGT AAGACACGAC TTATCGCC 6780 TGGCAGCAGC CACTGGTAAC AGGATTAGCA GAGCGAGGTA TGTAGGCGGT GCTACAGA 6840 TCTTGAAGTG GTGGCCTAAC TACGGCTACA CTAGAAGGAC AGTATTTGGT ATCTGCGC 6900 TGCTGAAGCC AGTTACCTTC GGAAAAAGAG TTGGTAGCTC TTGATCCGGC AAACAAAC 6960 CCGCTGGTAG CGGTGGTTTT TTTGTTTGCA AGCAGCAGAT TACGCGCAGA AAAAAAGG 7020 CTCAAGAAGA TCCTTTGATC TTTTCTACGG GGTCTGACGC TCAGTGGAAC GAAAACTC 7080 GTTAAGGGAT TTTGGTCATG AGATTATCAA AAAGGATCTT CACCTAGATC CTTTTAAA 7140 AAAAATGAAG TTTTAAATCA ATCTAAAGTA TATATGAGTA AACTTGGTCT GACAGTTA 7200 AATGCTTAAT CAGTGAGGCA CCTATCTCAG CGATCTGTCT ATTTCGTTCA TCCATAGT 7260 CCTGACTCCC CGTCGTGTAG ATAACTACGA TACGGGAGGG CTTACCATCT GGCCCCAG 7320 CTGCAATGAT ACCGCGAGAC CCACGCTCAC CGGCTCCAGA TTTATCAGCA ATAAACCA 7380 CAGCCGGAAG GGCCGAGCGC AGAAGTGGTC CTGCAACTTT ATCCGCCTCC ATCCAGTC 7440 TTAATTGTTG CCGGGAAGCT AGAGTAAGTA GTTCGCCAGT TAATAGTTTG CGCAACGT 7500 TTGCCATTGC TACAGGCATC GTGGTGTCAC GCTCGTCGTT TGGTATGGCT TCATTCAG 7560 CCGGTTCCCA ACGATCAAGG CGAGTTACAT GATCCCCCAT GTTGTGCAAA AAAGCGGT 7620 GCTCCTTCGG TCCTCCGATC GTTGTCAGAA GTAAGTTGGC CGCAGTGTTA TCACTCAT 7680 TTATGGCAGC ACTGCATAAT TCTCTTACTG TCATGCCATC CGTAAGATGC TTTTCTGT 7740 CTGGTGAGTA CTCAACCAAG TCATTCTGAG AATAGTGTAT GCGGCGACCG AGTTGCTC 7800 GCCCGGCGTC AATACGGGAT AATACCGCGC CACATAGCAG AACTTTAAAA GTGCTCAT 7860 TTGGAAAACG TTCTTCGGGG CGAAAACTCT CAAGGATCTT ACCGCTGTTG AGATCCAG 7920 CGATGTAACC CACTCGTGCA CCCAACTGAT CTTCAGCATC TTTTACTTTC ACCAGCGT 7980 CTGGGTGAGC AAAAACAGGA AGGCAAAATG CCGCAAAAAA GGGAATAAGG GCGACACG 8040 AATGTTGAAT ACTCATACTC TTCCTTTTTC AATATTATTG AAGCATTTAT CAGGGTTA 8100 GTCTCATGAG CGGATACATA TTTGAATGTA TTTAGAAAAA TAAACAAATA GGGGTTCC 8160 GCACATTTCC CCGAAAAGTG CCACCTGACG TC 8192 7000 base pairs nucleic acid single linear DNA (genomic) 37 AGATCTCGGC CGCATATTAA GTGCATTGTT CTCGATACCG CTAAGTGCAT TGTTCTCGTT 60 AGCTCGATGG ACAAGTGCAT TGTTCTCTTG CTGAAAGCTC GATGGACAAG TGCATTGTT 120 TCTTGCTGAA AGCTCGATGG ACAAGTGCAT TGTTCTCTTG CTGAAAGCTC AGTACCCGG 180 AGTACCCTCG ACCGCCGGAG TATAAATAGA GGCGCTTCGT CTACGGAGCG ACAATTCAA 240 TCAAACAAGC AAAGTGAACA CGTCGCTAAG CGAAAGCTAA GCAAATAAAC AAGCGCAGC 300 GAACAAGCTA AACAATCTGC AGTAAAGTGC AAGTTAAAGT GAATCAATTA AAAGTAACC 360 GCAACCAAGT AAATCAACTG CAACTACTGA AATCTGCCAA GAAGTAATTA TTGAATACA 420 GAAGAGAACT CTGAATACTT TCAACAAGTT ACCGAGAAAG AAGAACTCAC ACACAGCTA 480 CGTTTAAACT TAAGCTTGGT ACCGAGCTCG GATCCACTAG TCCAGTGTGG TGGAATTCG 540 CTTGGGATGA CGCCTCCTCC GCCCGGACGT GCCGCCCCCA GCGCACCGCG CGCCCGCGT 600 CCTGGCCCGC CGGCTCGGTT GGGGCTTCCG CTGCGGCTGC GGCTGCTGCT GCTGCTCTG 660 GCGGCCGCCG CCTCCGCCCA GGGCCACCTA AGGAGCGGAC CCCGCATCTT CGCCGTCTG 720 AAAGGCCATG TAGGGCAGGA CCGGGTGGAC TTTGGCCAGA CTGAGCCGCA CACGGTGCT 780 TTCCACGAGC CAGGCAGCTC CTCTGTGTGG GTGGGAGGAC GTGGCAAGGT CTACCTCTT 840 GACTTCCCCG AGGGCAAGAA CGCATCTGTG CGCACGGTGA ATATCGGCTC CACAAAGGG 900 TCCTGTCTGG ATAAGCGGGA CTGCGAGAAC TACATCACTC TCCTGGAGAG GCGGAGTGA 960 GGGCTGCTGG CCTGTGGCAC CAACGCCCGG CACCCCAGCT GCTGGAACCT GGTGAATG 1020 ACTGTGGTGC CACTTGGCGA GATGAGAGGC TACGCCCCCT TCAGCCCGGA CGAGAACT 1080 CTGGTTCTGT TTGAAGGGGA CGAGGTGTAT TCCACCATCC GGAAGCAGGA ATACAATG 1140 AAGATCCCTC GGTTCCGCCG CATCCGGGGC GAGAGTGAGC TGTACACCAG TGATACTG 1200 ATGCAGAACC CACAGTTCAT CAAAGCCACC ATCGTGCACC AAGACCAGGC TTACGATG 1260 AAGATCTACT ACTTCTTCCG AGAGGACAAT CCTGACAAGA ATCCTGAGGC TCCTCTCA 1320 GTGTCCCGTG TGGCCCAGTT GTGCAGGGGG GACCAGGGTG GGGAAAGTTC ACTGTCAG 1380 TCCAAGTGGA ACACTTTTCT GAAAGCCATG CTGGTATGCA GTGATGCTGC CACCAACA 1440 AACTTCAACA GGCTGCAAGA CGTCTTCCTG CTCCCTGACC CCAGCGGCCA GTGGAGGG 1500 ACCAGGGTCT ATGGTGTTTT CTCCAACCCC TGGAACTACT CAGCCGTCTG TGTGTATT 1560 CTCGGTGACA TTGACAAGGT CTTCCGTACC TCCTCACTCA AGGGCTACCA CTCAAGCC 1620 CCCAACCCGC GGCCTGGCAA GTGCCTCCCA GACCAGCAGC CGATACCCAC AGAGACCT 1680 CAGGTGGCTG ACCGTCACCC AGAGGTGGCG CAGAGGGTGG AGCCCATGGG GCCTCTGA 1740 ACGCCATTGT TCCACTCTAA ATACCACTAC CAGAAAGTGG CCGTTCACCG CATGCAAG 1800 AGCCACGGGG AGACCTTTCA TGTGCTTTAC CTAACTACAG ACAGGGGCAC TATCCACA 1860 GTGGTGGAAC CGGGGGAGCA GGAGCACAGC TTCGCCTTCA ACATCATGGA GATCCAGC 1920 TTCCGCCGCG CGGCTGCCAT CCAGACCATG TCGCTGGATG CTGAGCGGAG GAAGCTGT 1980 GTGAGCTCCC AGTGGGAGGT GAGCCAGGTG CCCCTGGACC TGTGTGAGGT CTATGGCG 2040 GGCTGCCACG GTTGCCTCAT GTCCCGAGAC CCCTACTGCG GCTGGGACCA GGGCCGCT 2100 ATCTCCATCT ACAGCTCCGA ACGGTCAGTG CTGCAATCCA TTAATCCAGC CGAGCCAC 2160 AAGGAGTGTC CCAACCCCAA ACCAGACAAG GCCCCACTGC AGAAGGTTTC CCTGGCCC 2220 AACTCTCGCT ACTACCTGAG CTGCCCCATG GAATCCCGCC ACGCCACCTA CTCATGGC 2280 CACAAGGAGA ACGTGGAGCA GAGCTGCGAA CCTGGTCACC AGAGCCCCAA CTGCATCC 2340 TTCATCGAGA ACCTCACGGC GCAGCAGTAC GGCCACTACT TCTGCGAGGC CCAGGAGG 2400 TCCTACTTCC GCGAGGCTCA GCACTGGCAG CTGCTGCCCG AGGACGGCAT CATGGCCG 2460 CACCTGCTGG GTCATGCCTG TGCCCTGGCT GCCTCCCTCT GGCTGGGGGT GCTGCCCA 2520 CTCACTCTTG GCTTGCTGGT CCACGTGAAG CTTGGGCCCG TTTAAACCCG CTGATCAG 2580 TCGACTGTGC CTTCTAGTTG CCAGCCATCT GTTGTTTGCC CCTCCCCCGT GCCTTCCT 2640 ACCCTGGAAG GTGCCACTCC CACTGTCCTT TCCTAATAAA ATGAGGAAAT TGCATCGC 2700 TGTCTGAGTA GGTGTCATTC TATTCTGGGG GGTGGGGTGG GGCAGGACAG CAAGGGGG 2760 GATTGGGAAG ACAATAGCAG GCATGCTGGG GATGCGGTGG GCTCTATGGC TTCTGAGG 2820 GAAAGAACCA GCTGGGGCTC TAGGGGGTAT CCCCACGCGC CCTGTAGCGG CGCATTAA 2880 GCGGCGGGTG TGGTGGTTAC GCGCAGCGTG ACCGCTACAC TTGCCAGCGC CCTAGCGC 2940 GCTCCTTTCG CTTTCTTCCC TTCCTTTCTC GCCACGTTCG CCGGCTTTCC CCGTCAAG 3000 CTAAATCGGG GCATCCCTTT AGGGTTCCGA TTTAGTGCTT TACGGCACCT CGACCCCA 3060 AAACTTGATT AGGGTGATGG TTCACGTAGT GGGCCATCGC CCTGATAGAC GGTTTTTC 3120 CCTTTGACGT TGGAGTCCAC GTTCTTTAAT AGTGGACTCT TGTTCCAAAC TGGAACAA 3180 CTCAACCCTA TCTCGGTCTA TTCTTTTGAT TTATAAGGGA TTTTGGGGAT TTCGGCCT 3240 TGGTTAAAAA ATGAGCTGAT TTAACAAAAA TTTAACGCGA ATTAATTCTG TGGAATGT 3300 GTCAGTTAGG GTGTGGAAAG TCCCCAGGCT CCCCAGGCAG GCAGAAGTAT GCAAAGCA 3360 CATCTCAATT AGTCAGCAAC CAGGTGTGGA AAGTCCCCAG GCTCCCCAGC AGGCAGAA 3420 ATGCAAAGCA TGCATCTCAA TTAGTCAGCA ACCATAGTCC CGCCCCTAAC TCCGCCCA 3480 CCGCCCCTAA CTCCGCCCAG TTCCGCCCAT TCTCCGCCCC ATGGCTGACT AATTTTTT 3540 ATTTATGCAG AGGCCGAGGC CGCCTCTGCC TCTGAGCTAT TCCAGAAGTA GTGAGGAG 3600 TTTTTTGGAG GCCTAGGCTT TTGCAAAAAG CTCCCGGGAG CTTGTATATC CATTTTCG 3660 TCTGATCAAG AGACAGGATG AGGATCGTTT CGCATGATTG AACAAGATGG ATTGCACG 3720 GGTTCTCCGG CCGCTTGGGT GGAGAGGCTA TTCGGCTATG ACTGGGCACA ACAGACAA 3780 GGCTGCTCTG ATGCCGCCGT GTTCCGGCTG TCAGCGCAGG GGCGCCCGGT TCTTTTTG 3840 AAGACCGACC TGTCCGGTGC CCTGAATGAA CTGCAGGACG AGGCAGCGCG GCTATCGT 3900 CTGGCCACGA CGGGCGTTCC TTGCGCAGCT GTGCTCGACG TTGTCACTGA AGCGGGAA 3960 GACTGGCTGC TATTGGGCGA AGTGCCGGGG CAGGATCTCC TGTCATCTCA CCTTGCTC 4020 GCCGAGAAAG TATCCATCAT GGCTGATGCA ATGCGGCGGC TGCATACGCT TGATCCGG 4080 ACCTGCCCAT TCGACCACCA AGCGAAACAT CGCATCGAGC GAGCACGTAC TCGGATGG 4140 GCCGGTCTTG TCGATCAGGA TGATCTGGAC GAAGAGCATC AGGGGCTCGC GCCAGCCG 4200 CTGTTCGCCA GGCTCAAGGC GCGCATGCCC GACGGCGAGG ATCTCGTCGT GACCCATG 4260 GATGCCTGCT TGCCGAATAT CATGGTGGAA AATGGCCGCT TTTCTGGATT CATCGACT 4320 GGCCGGCTGG GTGTGGCGGA CCGCTATCAG GACATAGCGT TGGCTACCCG TGATATTG 4380 GAAGAGCTTG GCGGCGAATG GGCTGACCGC TTCCTCGTGC TTTACGGTAT CGCCGCTC 4440 GATTCGCAGC GCATCGCCTT CTATCGCCTT CTTGACGAGT TCTTCTGAGC GGGACTCT 4500 GGTTCGAAAT GACCGACCAA GCGACGCCCA ACCTGCCATC ACGAGATTTC GATTCCAC 4560 CCGCCTTCTA TGAAAGGTTG GGCTTCGGAA TCGTTTTCCG GGACGCCGGC TGGATGAT 4620 TCCAGCGCGG GGATCTCATG CTGGAGTTCT TCGCCCACCC CAACTTGTTT ATTGCAGC 4680 ATAATGGTTA CAAATAAAGC AATAGCATCA CAAATTTCAC AAATAAAGCA TTTTTTTC 4740 TGCATTCTAG TTGTGGTTTG TCCAAACTCA TCAATGTATC TTATCATGTC TGTATACC 4800 CGACCTCTAG CTAGAGCTTG GCGTAATCAT GGTCATAGCT GTTTCCTGTG TGAAATTG 4860 ATCCGCTCAC AATTCCACAC AACATACGAG CCGGAAGCAT AAAGTGTAAA GCCTGGGG 4920 CCTAATGAGT GAGCTAACTC ACATTAATTG CGTTGCGCTC ACTGCCCGCT TTCCAGTC 4980 GAAACCTGTC GTGCCAGCTG CATTAATGAA TCGGCCAACG CGCGGGGAGA GGCGGTTT 5040 GTATTGGGCG CTCTTCCGCT TCCTCGCTCA CTGACTCGCT GCGCTCGGTC GTTCGGCT 5100 GGCGAGCGGT ATCAGCTCAC TCAAAGGCGG TAATACGGTT ATCCACAGAA TCAGGGGA 5160 ACGCAGGAAA GAACATGTGA GCAAAAGGCC AGCAAAAGGC CAGGAACCGT AAAAAGGC 5220 CGTTGCTGGC GTTTTTCCAT AGGCTCCGCC CCCCTGACGA GCATCACAAA AATCGACG 5280 CAAGTCAGAG GTGGCGAAAC CCGACAGGAC TATAAAGATA CCAGGCGTTT CCCCCTGG 5340 GCTCCCTCGT GCGCTCTCCT GTTCCGACCC TGCCGCTTAC CGGATACCTG TCCGCCTT 5400 TCCCTTCGGG AAGCGTGGCG CTTTCTCAAT GCTCACGCTG TAGGTATCTC AGTTCGGT 5460 AGGTCGTTCG CTCCAAGCTG GGCTGTGTGC ACGAACCCCC CGTTCAGCCC GACCGCTG 5520 CCTTATCCGG TAACTATCGT CTTGAGTCCA ACCCGGTAAG ACACGACTTA TCGCCACT 5580 CAGCAGCCAC TGGTAACAGG ATTAGCAGAG CGAGGTATGT AGGCGGTGCT ACAGAGTT 5640 TGAAGTGGTG GCCTAACTAC GGCTACACTA GAAGGACAGT ATTTGGTATC TGCGCTCT 5700 TGAAGCCAGT TACCTTCGGA AAAAGAGTTG GTAGCTCTTG ATCCGGCAAA CAAACCAC 5760 CTGGTAGCGG TGGTTTTTTT GTTTGCAAGC AGCAGATTAC GCGCAGAAAA AAAGGATC 5820 AAGAAGATCC TTTGATCTTT TCTACGGGGT CTGACGCTCA GTGGAACGAA AACTCACG 5880 AAGGGATTTT GGTCATGAGA TTATCAAAAA GGATCTTCAC CTAGATCCTT TTAAATTA 5940 AATGAAGTTT TAAATCAATC TAAAGTATAT ATGAGTAAAC TTGGTCTGAC AGTTACCA 6000 GCTTAATCAG TGAGGCACCT ATCTCAGCGA TCTGTCTATT TCGTTCATCC ATAGTTGC 6060 GACTCCCCGT CGTGTAGATA ACTACGATAC GGGAGGGCTT ACCATCTGGC CCCAGTGC 6120 CAATGATACC GCGAGACCCA CGCTCACCGG CTCCAGATTT ATCAGCAATA AACCAGCC 6180 CCGGAAGGGC CGAGCGCAGA AGTGGTCCTG CAACTTTATC CGCCTCCATC CAGTCTAT 6240 ATTGTTGCCG GGAAGCTAGA GTAAGTAGTT CGCCAGTTAA TAGTTTGCGC AACGTTGT 6300 CCATTGCTAC AGGCATCGTG GTGTCACGCT CGTCGTTTGG TATGGCTTCA TTCAGCTC 6360 GTTCCCAACG ATCAAGGCGA GTTACATGAT CCCCCATGTT GTGCAAAAAA GCGGTTAG 6420 CCTTCGGTCC TCCGATCGTT GTCAGAAGTA AGTTGGCCGC AGTGTTATCA CTCATGGT 6480 TGGCAGCACT GCATAATTCT CTTACTGTCA TGCCATCCGT AAGATGCTTT TCTGTGAC 6540 GTGAGTACTC AACCAAGTCA TTCTGAGAAT AGTGTATGCG GCGACCGAGT TGCTCTTG 6600 CGGCGTCAAT ACGGGATAAT ACCGCGCCAC ATAGCAGAAC TTTAAAAGTG CTCATCAT 6660 GAAAACGTTC TTCGGGGCGA AAACTCTCAA GGATCTTACC GCTGTTGAGA TCCAGTTC 6720 TGTAACCCAC TCGTGCACCC AACTGATCTT CAGCATCTTT TACTTTCACC AGCGTTTC 6780 GGTGAGCAAA AACAGGAAGG CAAAATGCCG CAAAAAAGGG AATAAGGGCG ACACGGAA 6840 GTTGAATACT CATACTCTTC CTTTTTCAAT ATTATTGAAG CATTTATCAG GGTTATTG 6900 TCATGAGCGG ATACATATTT GAATGTATTT AGAAAAATAA ACAAATAGGG GTTCCGCG 6960 CATTTCCCCG AAAAGTGCCA CCTGACGTCG ACGGATCGGG 7000 7108 base pairs nucleic acid single linear DNA (genomic) 38 AGATCTCGGC CGCATATTAA GTGCATTGTT CTCGATACCG CTAAGTGCAT TGTTCTCGTT 60 AGCTCGATGG ACAAGTGCAT TGTTCTCTTG CTGAAAGCTC GATGGACAAG TGCATTGTT 120 TCTTGCTGAA AGCTCGATGG ACAAGTGCAT TGTTCTCTTG CTGAAAGCTC AGTACCCGG 180 AGTACCCTCG ACCGCCGGAG TATAAATAGA GGCGCTTCGT CTACGGAGCG ACAATTCAA 240 TCAAACAAGC AAAGTGAACA CGTCGCTAAG CGAAAGCTAA GCAAATAAAC AAGCGCAGC 300 GAACAAGCTA AACAATCTGC AGTAAAGTGC AAGTTAAAGT GAATCAATTA AAAGTAACC 360 GCAACCAAGT AAATCAACTG CAACTACTGA AATCTGCCAA GAAGTAATTA TTGAATACA 420 GAAGAGAACT CTGAATACTT TCAACAAGTT ACCGAGAAAG AAGAACTCAC ACACAGCTA 480 CGTTTAAACT TAAGCTTGGT ACCGAGCTCG GATCCACTAG TCCAGTGTGG TGGAATTCG 540 CTTGGGATGA CGCCTCCTCC GCCCGGACGT GCCGCCCCCA GCGCACCGCG CGCCCGCGT 600 CCTGGCCCGC CGGCTCGGTT GGGGCTTCCG CTGCGGCTGC GGCTGCTGCT GCTGCTCTG 660 GCGGCCGCCG CCTCCGCCCA GGGCCACCTA AGGAGCGGAC CCCGCATCTT CGCCGTCTG 720 AAAGGCCATG TAGGGCAGGA CCGGGTGGAC TTTGGCCAGA CTGAGCCGCA CACGGTGCT 780 TTCCACGAGC CAGGCAGCTC CTCTGTGTGG GTGGGAGGAC GTGGCAAGGT CTACCTCTT 840 GACTTCCCCG AGGGCAAGAA CGCATCTGTG CGCACGGTGA ATATCGGCTC CACAAAGGG 900 TCCTGTCTGG ATAAGCGGGA CTGCGAGAAC TACATCACTC TCCTGGAGAG GCGGAGTGA 960 GGGCTGCTGG CCTGTGGCAC CAACGCCCGG CACCCCAGCT GCTGGAACCT GGTGAATG 1020 ACTGTGGTGC CACTTGGCGA GATGAGAGGC TACGCCCCCT TCAGCCCGGA CGAGAACT 1080 CTGGTTCTGT TTGAAGGGGA CGAGGTGTAT TCCACCATCC GGAAGCAGGA ATACAATG 1140 AAGATCCCTC GGTTCCGCCG CATCCGGGGC GAGAGTGAGC TGTACACCAG TGATACTG 1200 ATGCAGAACC CACAGTTCAT CAAAGCCACC ATCGTGCACC AAGACCAGGC TTACGATG 1260 AAGATCTACT ACTTCTTCCG AGAGGACAAT CCTGACAAGA ATCCTGAGGC TCCTCTCA 1320 GTGTCCCGTG TGGCCCAGTT GTGCAGGGGG GACCAGGGTG GGGAAAGTTC ACTGTCAG 1380 TCCAAGTGGA ACACTTTTCT GAAAGCCATG CTGGTATGCA GTGATGCTGC CACCAACA 1440 AACTTCAACA GGCTGCAAGA CGTCTTCCTG CTCCCTGACC CCAGCGGCCA GTGGAGGG 1500 ACCAGGGTCT ATGGTGTTTT CTCCAACCCC TGGAACTACT CAGCCGTCTG TGTGTATT 1560 CTCGGTGACA TTGACAAGGT CTTCCGTACC TCCTCACTCA AGGGCTACCA CTCAAGCC 1620 CCCAACCCGC GGCCTGGCAA GTGCCTCCCA GACCAGCAGC CGATACCCAC AGAGACCT 1680 CAGGTGGCTG ACCGTCACCC AGAGGTGGCG CAGAGGGTGG AGCCCATGGG GCCTCTGA 1740 ACGCCATTGT TCCACTCTAA ATACCACTAC CAGAAAGTGG CCGTTCACCG CATGCAAG 1800 AGCCACGGGG AGACCTTTCA TGTGCTTTAC CTAACTACAG ACAGGGGCAC TATCCACA 1860 GTGGTGGAAC CGGGGGAGCA GGAGCACAGC TTCGCCTTCA ACATCATGGA GATCCAGC 1920 TTCCGCCGCG CGGCTGCCAT CCAGACCATG TCGCTGGATG CTGAGCGGAG GAAGCTGT 1980 GTGAGCTCCC AGTGGGAGGT GAGCCAGGTG CCCCTGGACC TGTGTGAGGT CTATGGCG 2040 GGCTGCCACG GTTGCCTCAT GTCCCGAGAC CCCTACTGCG GCTGGGACCA GGGCCGCT 2100 ATCTCCATCT ACAGCTCCGA ACGGTCAGTG CTGCAATCCA TTAATCCAGC CGAGCCAC 2160 AAGGAGTGTC CCAACCCCAA ACCAGACAAG GCCCCACTGC AGAAGGTTTC CCTGGCCC 2220 AACTCTCGCT ACTACCTGAG CTGCCCCATG GAATCCCGCC ACGCCACCTA CTCATGGC 2280 CACAAGGAGA ACGTGGAGCA GAGCTGCGAA CCTGGTCACC AGAGCCCCAA CTGCATCC 2340 TTCATCGAGA ACCTCACGGC GCAGCAGTAC GGCCACTACT TCTGCGAGGC CCAGGAGG 2400 TCCTACTTCC GCGAGGCTCA GCACTGGCAG CTGCTGCCCG AGGACGGCAT CATGGCCG 2460 CACCTGCTGG GTCATGCCTG TGCCCTGGCT GCCTCCCTCT GGCTGGGGGT GCTGCCCA 2520 CTCACTCTTG GCTTGCTGGT CCACGTGAAG CTTGGGCCCG AACAAAAACT CATCTCAG 2580 GAGGATCTGA ATAGCGCCGT CGACCATCAT CATCATCATC ATTGAGTTTA TCCAGCAC 2640 TGGCGGCCGC TCGAGTCTAG AGGGCCCGTT TAAACCCGCT GATCAGCCTC GACTGTGC 2700 TCTAGTTGCC AGCCATCTGT TGTTTGCCCC TCCCCCGTGC CTTCCTTGAC CCTGGAAG 2760 GCCACTCCCA CTGTCCTTTC CTAATAAAAT GAGGAAATTG CATCGCATTG TCTGAGTA 2820 TGTCATTCTA TTCTGGGGGG TGGGGTGGGG CAGGACAGCA AGGGGGAGGA TTGGGAAG 2880 AATAGCAGGC ATGCTGGGGA TGCGGTGGGC TCTATGGCTT CTGAGGCGGA AAGAACCA 2940 TGGGGCTCTA GGGGGTATCC CCACGCGCCC TGTAGCGGCG CATTAAGCGC GGCGGGTG 3000 GTGGTTACGC GCAGCGTGAC CGCTACACTT GCCAGCGCCC TAGCGCCCGC TCCTTTCG 3060 TTCTTCCCTT CCTTTCTCGC CACGTTCGCC GGCTTTCCCC GTCAAGCTCT AAATCGGG 3120 ATCCCTTTAG GGTTCCGATT TAGTGCTTTA CGGCACCTCG ACCCCAAAAA ACTTGATT 3180 GGTGATGGTT CACGTAGTGG GCCATCGCCC TGATAGACGG TTTTTCGCCC TTTGACGT 3240 GAGTCCACGT TCTTTAATAG TGGACTCTTG TTCCAAACTG GAACAACACT CAACCCTA 3300 TCGGTCTATT CTTTTGATTT ATAAGGGATT TTGGGGATTT CGGCCTATTG GTTAAAAA 3360 GAGCTGATTT AACAAAAATT TAACGCGAAT TAATTCTGTG GAATGTGTGT CAGTTAGG 3420 GTGGAAAGTC CCCAGGCTCC CCAGGCAGGC AGAAGTATGC AAAGCATGCA TCTCAATT 3480 TCAGCAACCA GGTGTGGAAA GTCCCCAGGC TCCCCAGCAG GCAGAAGTAT GCAAAGCA 3540 CATCTCAATT AGTCAGCAAC CATAGTCCCG CCCCTAACTC CGCCCATCCC GCCCCTAA 3600 CCGCCCAGTT CCGCCCATTC TCCGCCCCAT GGCTGACTAA TTTTTTTTAT TTATGCAG 3660 GCCGAGGCCG CCTCTGCCTC TGAGCTATTC CAGAAGTAGT GAGGAGGCTT TTTTGGAG 3720 CTAGGCTTTT GCAAAAAGCT CCCGGGAGCT TGTATATCCA TTTTCGGATC TGATCAAG 3780 ACAGGATGAG GATCGTTTCG CATGATTGAA CAAGATGGAT TGCACGCAGG TTCTCCGG 3840 GCTTGGGTGG AGAGGCTATT CGGCTATGAC TGGGCACAAC AGACAATCGG CTGCTCTG 3900 GCCGCCGTGT TCCGGCTGTC AGCGCAGGGG CGCCCGGTTC TTTTTGTCAA GACCGACC 3960 TCCGGTGCCC TGAATGAACT GCAGGACGAG GCAGCGCGGC TATCGTGGCT GGCCACGA 4020 GGCGTTCCTT GCGCAGCTGT GCTCGACGTT GTCACTGAAG CGGGAAGGGA CTGGCTGC 4080 TTGGGCGAAG TGCCGGGGCA GGATCTCCTG TCATCTCACC TTGCTCCTGC CGAGAAAG 4140 TCCATCATGG CTGATGCAAT GCGGCGGCTG CATACGCTTG ATCCGGCTAC CTGCCCAT 4200 GACCACCAAG CGAAACATCG CATCGAGCGA GCACGTACTC GGATGGAAGC CGGTCTTG 4260 GATCAGGATG ATCTGGACGA AGAGCATCAG GGGCTCGCGC CAGCCGAACT GTTCGCCA 4320 CTCAAGGCGC GCATGCCCGA CGGCGAGGAT CTCGTCGTGA CCCATGGCGA TGCCTGCT 4380 CCGAATATCA TGGTGGAAAA TGGCCGCTTT TCTGGATTCA TCGACTGTGG CCGGCTGG 4440 GTGGCGGACC GCTATCAGGA CATAGCGTTG GCTACCCGTG ATATTGCTGA AGAGCTTG 4500 GGCGAATGGG CTGACCGCTT CCTCGTGCTT TACGGTATCG CCGCTCCCGA TTCGCAGC 4560 ATCGCCTTCT ATCGCCTTCT TGACGAGTTC TTCTGAGCGG GACTCTGGGG TTCGAAAT 4620 CCGACCAAGC GACGCCCAAC CTGCCATCAC GAGATTTCGA TTCCACCGCC GCCTTCTA 4680 AAAGGTTGGG CTTCGGAATC GTTTTCCGGG ACGCCGGCTG GATGATCCTC CAGCGCGG 4740 ATCTCATGCT GGAGTTCTTC GCCCACCCCA ACTTGTTTAT TGCAGCTTAT AATGGTTA 4800 AATAAAGCAA TAGCATCACA AATTTCACAA ATAAAGCATT TTTTTCACTG CATTCTAG 4860 GTGGTTTGTC CAAACTCATC AATGTATCTT ATCATGTCTG TATACCGTCG ACCTCTAG 4920 AGAGCTTGGC GTAATCATGG TCATAGCTGT TTCCTGTGTG AAATTGTTAT CCGCTCAC 4980 TTCCACACAA CATACGAGCC GGAAGCATAA AGTGTAAAGC CTGGGGTGCC TAATGAGT 5040 GCTAACTCAC ATTAATTGCG TTGCGCTCAC TGCCCGCTTT CCAGTCGGGA AACCTGTC 5100 GCCAGCTGCA TTAATGAATC GGCCAACGCG CGGGGAGAGG CGGTTTGCGT ATTGGGCG 5160 CTTCCGCTTC CTCGCTCACT GACTCGCTGC GCTCGGTCGT TCGGCTGCGG CGAGCGGT 5220 CAGCTCACTC AAAGGCGGTA ATACGGTTAT CCACAGAATC AGGGGATAAC GCAGGAAA 5280 ACATGTGAGC AAAAGGCCAG CAAAAGGCCA GGAACCGTAA AAAGGCCGCG TTGCTGGC 5340 TTTTCCATAG GCTCCGCCCC CCTGACGAGC ATCACAAAAA TCGACGCTCA AGTCAGAG 5400 GGCGAAACCC GACAGGACTA TAAAGATACC AGGCGTTTCC CCCTGGAAGC TCCCTCGT 5460 GCTCTCCTGT TCCGACCCTG CCGCTTACCG GATACCTGTC CGCCTTTCTC CCTTCGGG 5520 GCGTGGCGCT TTCTCAATGC TCACGCTGTA GGTATCTCAG TTCGGTGTAG GTCGTTCG 5580 CCAAGCTGGG CTGTGTGCAC GAACCCCCCG TTCAGCCCGA CCGCTGCGCC TTATCCGG 5640 ACTATCGTCT TGAGTCCAAC CCGGTAAGAC ACGACTTATC GCCACTGGCA GCAGCCAC 5700 GTAACAGGAT TAGCAGAGCG AGGTATGTAG GCGGTGCTAC AGAGTTCTTG AAGTGGTG 5760 CTAACTACGG CTACACTAGA AGGACAGTAT TTGGTATCTG CGCTCTGCTG AAGCCAGT 5820 CCTTCGGAAA AAGAGTTGGT AGCTCTTGAT CCGGCAAACA AACCACCGCT GGTAGCGG 5880 GTTTTTTTGT TTGCAAGCAG CAGATTACGC GCAGAAAAAA AGGATCTCAA GAAGATCC 5940 TGATCTTTTC TACGGGGTCT GACGCTCAGT GGAACGAAAA CTCACGTTAA GGGATTTT 6000 TCATGAGATT ATCAAAAAGG ATCTTCACCT AGATCCTTTT AAATTAAAAA TGAAGTTT 6060 AATCAATCTA AAGTATATAT GAGTAAACTT GGTCTGACAG TTACCAATGC TTAATCAG 6120 AGGCACCTAT CTCAGCGATC TGTCTATTTC GTTCATCCAT AGTTGCCTGA CTCCCCGT 6180 TGTAGATAAC TACGATACGG GAGGGCTTAC CATCTGGCCC CAGTGCTGCA ATGATACC 6240 GAGACCCACG CTCACCGGCT CCAGATTTAT CAGCAATAAA CCAGCCAGCC GGAAGGGC 6300 AGCGCAGAAG TGGTCCTGCA ACTTTATCCG CCTCCATCCA GTCTATTAAT TGTTGCCG 6360 AAGCTAGAGT AAGTAGTTCG CCAGTTAATA GTTTGCGCAA CGTTGTTGCC ATTGCTAC 6420 GCATCGTGGT GTCACGCTCG TCGTTTGGTA TGGCTTCATT CAGCTCCGGT TCCCAACG 6480 CAAGGCGAGT TACATGATCC CCCATGTTGT GCAAAAAAGC GGTTAGCTCC TTCGGTCC 6540 CGATCGTTGT CAGAAGTAAG TTGGCCGCAG TGTTATCACT CATGGTTATG GCAGCACT 6600 ATAATTCTCT TACTGTCATG CCATCCGTAA GATGCTTTTC TGTGACTGGT GAGTACTC 6660 CCAAGTCATT CTGAGAATAG TGTATGCGGC GACCGAGTTG CTCTTGCCCG GCGTCAAT 6720 GGGATAATAC CGCGCCACAT AGCAGAACTT TAAAAGTGCT CATCATTGGA AAACGTTC 6780 CGGGGCGAAA ACTCTCAAGG ATCTTACCGC TGTTGAGATC CAGTTCGATG TAACCCAC 6840 GTGCACCCAA CTGATCTTCA GCATCTTTTA CTTTCACCAG CGTTTCTGGG TGAGCAAA 6900 CAGGAAGGCA AAATGCCGCA AAAAAGGGAA TAAGGGCGAC ACGGAAATGT TGAATACT 6960 TACTCTTCCT TTTTCAATAT TATTGAAGCA TTTATCAGGG TTATTGTCTC ATGAGCGG 7020 ACATATTTGA ATGTATTTAG AAAAATAAAC AAATAGGGGT TCCGCGCACA TTTCCCCG 7080 AAGTGCCACC TGACGTCGAC GGATCGGG 7108 4019 base pairs nucleic acid single linear DNA (genomic) 39 CTCGAGAAAT CATAAAAAAT TTATTTGCTT TGTGAGCGGA TAACAATTAT AATAGATTCA 60 ATTGTGAGCG GATAACAATT TCACACAGAA TTCATTAAAG AGGAGAAATT AACTATGAG 120 GGATCGCATC ACCATCACCA TCACGGATCC CTGGTTCTGT TTGAAGGGGA CGAGGTGTA 180 TCCACCATCC GGAAGCAGGA ATACAATGGG AAGATCCCTC GGTTCCGCCG CATCCGGGG 240 GAGAGTGAGC TGTACACCAG TGATACTGTC ATGCAGAACC CACAGTTCAT CAAAGCCAC 300 ATCGTGCACC AAGACCAGGC TTACGATGAC AAGATCTACT ACTTCTTCCG AGAGGACAA 360 CCTGACAAGA ATCCTGAGGC TCCTCTCAAT GTGTCCCGTG TGGCCCAGTT GTGCAGGGG 420 GACCAGGGTG GGGAAAGTTC ACTGTCAGTC TCCAAGTGGA ACACTTTTCT GAAAGCCAT 480 CTGGTATGCA GTGATGCTGC CACCAACAAG AACTTCAACA GGCTGCAAGA CGTCTTCCT 540 CTCCCTGACC CCAGCGGCCA GTGGAGGGAC ACCAGGGTCT ATGGTGTTTT CTCCAACCC 600 TGGAACTACT CAGCCGTCTG TGTGTATTCC CTCGGTGACA TTGACAAGGT CTTCCGTAC 660 TCCTCACTCA AGGGCTACCA CTCAAGCCTT CCCAACCCGC GGCCTGGCAA GTGCCTCCC 720 GACCAGCAGC CGATACCCAC AGAAAGCTTA ATTAGCTGAG CTTGGACTCC TGTTGATAG 780 TCCAGTAATG ACCTCAGAAC TCCATCTGGA TTTGTTCAGA ACGCTCGGTT GCCGCCGGG 840 GTTTTTTATT GGTGAGAATC CAAGCTAGCT TGGCGAGATT TTCAGGAGCT AAGGAAGCT 900 AAATGGAGAA AAAAATCACT GGATATACCA CCGTTGATAT ATCCCAATGG CATCGTAAA 960 AACATTTTGA GGCATTTCAG TCAGTTGCTC AATGTACCTA TAACCAGACC GTTCAGCT 1020 ATATTACGGC CTTTTTAAAG ACCGTAAAGA AAAATAAGCA CAAGTTTTAT CCGGCCTT 1080 TTCACATTCT TGCCCGCCTG ATGAATGCTC ATCCGGAATT TCGTATGGCA ATGAAAGA 1140 GTGAGCTGGT GATATGGGAT AGTGTTCACC CTTGTTACAC CGTTTTCCAT GAGCAAAC 1200 AAACGTTTTC ATCGCTCTGG AGTGAATACC ACGACGATTT CCGGCAGTTT CTACACAT 1260 ATTCGCAAGA TGTGGCGTGT TACGGTGAAA ACCTGGCCTA TTTCCCTAAA GGGTTTAT 1320 AGAATATGTT TTTCGTCTCA GCCAATCCCT GGGTGAGTTT CACCAGTTTT GATTTAAA 1380 TGGCCAATAT GGACAACTTC TTCGCCCCCG TTTTCACCAT GGGCAAATAT TATACGCA 1440 GCGACAAGGT GCTGATGCCG CTGGCGATTC AGGTTCATCA TGCCGTCTGT GATGGCTT 1500 ATGTCGGCAG AATGCTTAAT GAATTACAAC AGTACTGCGA TGAGTGGCAG GGCGGGGC 1560 AATTTTTTTA AGGCAGTTAT TGGTGCCCTT AAACGCCTGG GGTAATGACT CTCTAGCT 1620 AGGCATCAAA TAAAACGAAA GGCTCAGTCG AAAGACTGGG CCTTTCGTTT TATCTGTT 1680 TTGTCGGTGA ACGCTCTCCT GAGTAGGACA AATCCGCCGC TCTAGAGCTG CCTCGCGC 1740 TTCGGTGATG ACGGTGAAAA CCTCTGACAC ATGCAGCTCC CGGAGACGGT CACAGCTT 1800 CTGTAAGCGG ATGCCGGGAG CAGACAAGCC CGTCAGGGCG CGTCAGCGGG TGTTGGCG 1860 TGTCGGGGCG CAGCCATGAC CCAGTCACGT AGCGATAGCG GAGTGTATAC TGGCTTAA 1920 ATGCGGCATC AGAGCAGATT GTACTGAGAG TGCACCATAT GCGGTGTGAA ATACCGCA 1980 GATGCGTAAG GAGAAAATAC CGCATCAGGC GCTCTTCCGC TTCCTCGCTC ACTGACTC 2040 TGCGCTCGGT CTGTCGGCTG CGGCGAGCGG TATCAGCTCA CTCAAAGGCG GTAATACG 2100 TATCCACAGA ATCAGGGGAT AACGCAGGAA AGAACATGTG AGCAAAAGGC CAGCAAAA 2160 CCAGGAACCG TAAAAAGGCC GCGTTGCTGG CGTTTTTCCA TAGGCTCCGC CCCCCTGA 2220 AGCATCACAA AAATCGACGC TCAAGTCAGA GGTGGCGAAA CCCGACAGGA CTATAAAG 2280 ACCAGGCGTT TCCCCCTGGA AGCTCCCTCG TGCGCTCTCC TGTTCCGACC CTGCCGCT 2340 CCGGATACCT GTCCGCCTTT CTCCCTTCGG GAAGCGTGGC GCTTTCTCAA TGCTCACG 2400 GTAGGTATCT CAGTTCGGTG TAGGTCGTTC GCTCCAAGCT GGGCTGTGTG CACGAACC 2460 CCGTTCAGCC CGACCGCTGC GCCTTATCCG GTAACTATCG TCTTGAGTCC AACCCGGT 2520 GACACGACTT ATCGCCACTG GCAGCAGCCA CTGGTAACAG GATTAGCAGA GCGAGGTA 2580 TAGGCGGTGC TACAGAGTTC TTGAAGTGGT GGCCTAACTA CGGCTACACT AGAAGGAC 2640 TATTTGGTAT CTGCGCTCTG CTGAAGCCAG TTACCTTCGG AAAAAGAGTT GGTAGCTC 2700 GATCCGGCAA ACAAACCACC GCTGGTAGCG GTGGTTTTTT TGTTTGCAAG CAGCAGAT 2760 CGCGCAGAAA AAAAGGATCT CAAGAAGATC CTTTGATCTT TTCTACGGGG TCTGACGC 2820 AGTGGAACGA AAACTCACGT TAAGGGATTT TGGTCATGAG ATTATCAAAA AGGATCTT 2880 CCTAGATCCT TTTAAATTAA AAATGAAGTT TTAAATCAAT CTAAAGTATA TATGAGTA 2940 CTTGGTCTGA CAGTTACCAA TGCTTAATCA GTGAGGCACC TATCTCAGCG ATCTGTCT 3000 TTCGTTCATC CATAGCTGCC TGACTCCCCG TCGTGTAGAT AACTACGATA CGGGAGGG 3060 TACCATCTGG CCCCAGTGCT GCAATGATAC CGCGAGACCC ACGCTCACCG GCTCCAGA 3120 TATCAGCAAT AAACCAGCCA GCCGGAAGGG CCGAGCGCAG AAGTGGTCCT GCAACTTT 3180 CCGCCTCCAT CCAGTCTATT AATTGTTGCC GGGAAGCTAG AGTAAGTAGT TCGCCAGT 3240 ATAGTTTGCG CAACGTTGTT GCCATTGCTA CAGGCATCGT GGTGTCACGC TCGTCGTT 3300 GTATGGCTTC ATTCAGCTCC GGTTCCCAAC GATCAAGGCG AGTTACATGA TCCCCCAT 3360 TGTGCAAAAA AGCGGTTAGC TCCTTCGGTC CTCCGATCGT TGTCAGAAGT AAGTTGGC 3420 CAGTGTTATC ACTCATGGTT ATGGCAGCAC TGCATAATTC TCTTACTGTC ATGCCATC 3480 TAAGATGCTT TTCTGTGACT GGTGAGTACT CAACCAAGTC ATTCTGAGAA TAGTGTAT 3540 GGCGACCGAG TTGCTCTTGC CCGGCGTCAA TACGGGATAA TACCGCGCCA CATAGCAG 3600 CTTTAAAAGT GCTCATCATT GGAAAACGTT CTTCGGGGCG AAAACTCTCA AGGATCTT 3660 CGCTGTTGAG ATCCAGTTCG ATGTAACCCA CTCGTGCACC CAACTGATCT TCAGCATC 3720 TTACTTTCAC CAGCGTTTCT GGGTGAGCAA AAACAGGAAG GCAAAATGCC GCAAAAAA 3780 GAATAAGGGC GACACGGAAA TGTTGAATAC TCATACTCTT CCTTTTTCAA TATTATTG 3840 GCATTTATCA GGGTTATTGT CTCATGAGCG GATACATATT TGAATGTATT TAGAAAAA 3900 AACAAATAGG GGTTCCGCGC ACATTTCCCC GAAAAGTGCC ACCTGACGTC TAAGAAAC 3960 TTATTATCAT GACATTAACC TATAAAAATA GGCGTATCAC GAGGCCCTTT CGTCTTCA 4019 3999 base pairs nucleic acid single linear DNA (genomic) 40 CTCGAGAAAT CATAAAAAAT TTATTTGCTT TGTGAGCGGA TAACAATTAT AATAGATTCA 60 ATTGTGAGCG GATAACAATT TCACACAGAA TTCATTAAAG AGGAGAAATT AACTATGAGA 120 GGATCGCATC ACCATCACCA TCACACGGAT CCGCATGCGA GCTCCCAGTG GGAGGTGAGC 180 CAGGTGCCCC TGGACCTGTG TGAGGTCTAT GGCGGGGGCT GCCACGGTTG CCTCATGTCC 240 CGAGACCCCT ACTGCGGCTG GGACCAGGGC CGCTGCATCT CCATCTACAG CTCCGAACGG 300 TCAGTGCTGC AATCCATTAA TCCAGCCGAG CCACACAAGG AGTGTCCCAA CCCCAAACCA 360 GACAAGGCCC CACTGCAGAA GGTTTCCCTG GCCCCAAACT CTCGCTACTA CCTGAGCTGC 420 CCCATGGAAT CCCGCCACGC CACCTACTCA TGGCGCCACA AGGAGAACGT GGAGCAGAGC 480 TGCGAACCTG GTCACCAGAG CCCCAACTGC ATCCTGTTCA TCGAGAACCT CACGGCGCAG 540 CAGTACGGCC ACTACTTCTG CGAGGCCCAG GAGGGCTCCT ACTTCCGCGA GGCTCAGCAC 600 TGGCAGCTGC TGCCCGAGGA CGGCATCATG GCCGAGCACC TGCTGGGTCA TGCCTGTGCC 660 CTGGCTGCCT CCCTCTGGCT GGGGGTGCTG CCCACACTCA CTCTTGGCTT GCTGGTCCAC 720 GTGAAGCTTA ATTAGCTGAG CTTGGACTCC TGTTGATAGA TCCAGTAATG ACCTCAGAAC 780 TCCATCTGGA TTTGTTCAGA ACGCTCGGTT GCCGCCGGGC GTTTTTTATT GGTGAGAATC 840 CAAGCTAGCT TGGCGAGATT TTCAGGAGCT AAGGAAGCTA AAATGGAGAA AAAAATCACT 900 GGATATACCA CCGTTGATAT ATCCCAATGG CATCGTAAAG AACATTTTGA GGCATTTCAG 960 TCAGTTGCTC AATGTACCTA TAACCAGACC GTTCAGCTGG ATATTACGGC CTTTTTAAAG 1020 ACCGTAAAGA AAAATAAGCA CAAGTTTTAT CCGGCCTTTA TTCACATTCT TGCCCGCCTG 1080 ATGAATGCTC ATCCGGAATT TCGTATGGCA ATGAAAGACG GTGAGCTGGT GATATGGGAT 1140 AGTGTTCACC CTTGTTACAC CGTTTTCCAT GAGCAAACTG AAACGTTTTC ATCGCTCTGG 1200 AGTGAATACC ACGACGATTT CCGGCAGTTT CTACACATAT ATTCGCAAGA TGTGGCGTGT 1260 TACGGTGAAA ACCTGGCCTA TTTCCCTAAA GGGTTTATTG AGAATATGTT TTTCGTCTCA 1320 GCCAATCCCT GGGTGAGTTT CACCAGTTTT GATTTAAACG TGGCCAATAT GGACAACTTC 1380 TTCGCCCCCG TTTTCACCAT GGGCAAATAT TATACGCAAG GCGACAAGGT GCTGATGCCG 1440 CTGGCGATTC AGGTTCATCA TGCCGTCTGT GATGGCTTCC ATGTCGGCAG AATGCTTAAT 1500 GAATTACAAC AGTACTGCGA TGAGTGGCAG GGCGGGGCGT AATTTTTTTA AGGCAGTTAT 1560 TGGTGCCCTT AAACGCCTGG GGTAATGACT CTCTAGCTTG AGGCATCAAA TAAAACGAAA 1620 GGCTCAGTCG AAAGACTGGG CCTTTCGTTT TATCTGTTGT TTGTCGGTGA ACGCTCTCCT 1680 GAGTAGGACA AATCCGCCGC TCTAGAGCTG CCTCGCGCGT TTCGGTGATG ACGGTGAAAA 1740 CCTCTGACAC ATGCAGCTCC CGGAGACGGT CACAGCTTGT CTGTAAGCGG ATGCCGGGAG 1800 CAGACAAGCC CGTCAGGGCG CGTCAGCGGG TGTTGGCGGG TGTCGGGGCG CAGCCATGAC 1860 CCAGTCACGT AGCGATAGCG GAGTGTATAC TGGCTTAACT ATGCGGCATC AGAGCAGATT 1920 GTACTGAGAG TGCACCATAT GCGGTGTGAA ATACCGCACA GATGCGTAAG GAGAAAATAC 1980 CGCATCAGGC GCTCTTCCGC TTCCTCGCTC ACTGACTCGC TGCGCTCGGT CTGTCGGCTG 2040 CGGCGAGCGG TATCAGCTCA CTCAAAGGCG GTAATACGGT TATCCACAGA ATCAGGGGAT 2100 AACGCAGGAA AGAACATGTG AGCAAAAGGC CAGCAAAAGG CCAGGAACCG TAAAAAGGCC 2160 GCGTTGCTGG CGTTTTTCCA TAGGCTCCGC CCCCCTGACG AGCATCACAA AAATCGACGC 2220 TCAAGTCAGA GGTGGCGAAA CCCGACAGGA CTATAAAGAT ACCAGGCGTT TCCCCCTGGA 2280 AGCTCCCTCG TGCGCTCTCC TGTTCCGACC CTGCCGCTTA CCGGATACCT GTCCGCCTTT 2340 CTCCCTTCGG GAAGCGTGGC GCTTTCTCAA TGCTCACGCT GTAGGTATCT CAGTTCGGTG 2400 TAGGTCGTTC GCTCCAAGCT GGGCTGTGTG CACGAACCCC CCGTTCAGCC CGACCGCTGC 2460 GCCTTATCCG GTAACTATCG TCTTGAGTCC AACCCGGTAA GACACGACTT ATCGCCACTG 2520 GCAGCAGCCA CTGGTAACAG GATTAGCAGA GCGAGGTATG TAGGCGGTGC TACAGAGTTC 2580 TTGAAGTGGT GGCCTAACTA CGGCTACACT AGAAGGACAG TATTTGGTAT CTGCGCTCTG 2640 CTGAAGCCAG TTACCTTCGG AAAAAGAGTT GGTAGCTCTT GATCCGGCAA ACAAACCACC 2700 GCTGGTAGCG GTGGTTTTTT TGTTTGCAAG CAGCAGATTA CGCGCAGAAA AAAAGGATCT 2760 CAAGAAGATC CTTTGATCTT TTCTACGGGG TCTGACGCTC AGTGGAACGA AAACTCACGT 2820 TAAGGGATTT TGGTCATGAG ATTATCAAAA AGGATCTTCA CCTAGATCCT TTTAAATTAA 2880 AAATGAAGTT TTAAATCAAT CTAAAGTATA TATGAGTAAA CTTGGTCTGA CAGTTACCAA 2940 TGCTTAATCA GTGAGGCACC TATCTCAGCG ATCTGTCTAT TTCGTTCATC CATAGCTGCC 3000 TGACTCCCCG TCGTGTAGAT AACTACGATA CGGGAGGGCT TACCATCTGG CCCCAGTGCT 3060 GCAATGATAC CGCGAGACCC ACGCTCACCG GCTCCAGATT TATCAGCAAT AAACCAGCCA 3120 GCCGGAAGGG CCGAGCGCAG AAGTGGTCCT GCAACTTTAT CCGCCTCCAT CCAGTCTATT 3180 AATTGTTGCC GGGAAGCTAG AGTAAGTAGT TCGCCAGTTA ATAGTTTGCG CAACGTTGTT 3240 GCCATTGCTA CAGGCATCGT GGTGTCACGC TCGTCGTTTG GTATGGCTTC ATTCAGCTCC 3300 GGTTCCCAAC GATCAAGGCG AGTTACATGA TCCCCCATGT TGTGCAAAAA AGCGGTTAGC 3360 TCCTTCGGTC CTCCGATCGT TGTCAGAAGT AAGTTGGCCG CAGTGTTATC ACTCATGGTT 3420 ATGGCAGCAC TGCATAATTC TCTTACTGTC ATGCCATCCG TAAGATGCTT TTCTGTGACT 3480 GGTGAGTACT CAACCAAGTC ATTCTGAGAA TAGTGTATGC GGCGACCGAG TTGCTCTTGC 3540 CCGGCGTCAA TACGGGATAA TACCGCGCCA CATAGCAGAA CTTTAAAAGT GCTCATCATT 3600 GGAAAACGTT CTTCGGGGCG AAAACTCTCA AGGATCTTAC CGCTGTTGAG ATCCAGTTCG 3660 ATGTAACCCA CTCGTGCACC CAACTGATCT TCAGCATCTT TTACTTTCAC CAGCGTTTCT 3720 GGGTGAGCAA AAACAGGAAG GCAAAATGCC GCAAAAAAGG GAATAAGGGC GACACGGAAA 3780 TGTTGAATAC TCATACTCTT CCTTTTTCAA TATTATTGAA GCATTTATCA GGGTTATTGT 3840 CTCATGAGCG GATACATATT TGAATGTATT TAGAAAAATA AACAAATAGG GGTTCCGCGC 3900 ACATTTCCCC GAAAAGTGCC ACCTGACGTC TAAGAAACCA TTATTATCAT GACATTAACC 3960 TATAAAAATA GGCGTATCAC GAGGCCCTTT CGTCTTCAC 3999 8888 base pairs nucleic acid single linear DNA (genomic) 41 GAGCCGCACA CGGTGCTTTT CCACGAGCCA GGCAGCTCCT CTGTGTGGGT GGGAGGACGT 60 GGCAAGGTCT ACCTCTTTGA CTTCCCCGAG GGCAAGAACG CATCTGTGCG CACGGTGAGC 120 CTCTCTCTTC CCCCAACACC CCCCCTACCC TCTTATCTCC CCTCTGGCCC TGCCAAGGGT 180 CCTCAGGGAA TCCGAGGGAG CTGGCTTCTC TTCCTAAACT GCCCCCACCT CCGTATCCTA 240 TAAATGGCTC CTGGGGGAGG CTCCCTAAAG GTAGTCCAGA TTGGAGTGGG GAGCTGGGGC 300 GGTGTGGAGA AAAACAGGAG CTAATGGGCC TGGCCAGCTG GGCAGCGCTG CTGCGGAAAG 360 CCCAGGCTGG AAGCTGGGCC CCAGAGCCCA TGCCTGGTCT TCTGAACCCT CTGGGCCTCA 420 GCTCTGGATA TGAGACCCTG TTTGACCTCA GGTAGATCAC TCACCCTCTC AGAGCCCCAG 480 TTGCTCATCT GTCAGATGAG AATAATGGTT GCTTCCTTTG GGGCTTATCC TGAGGCTGTG 540 TGGAAAGCAT TTCAGGGGTA CCTCACCCCT GGCAGATTGA ACTAATGCTT CTCCCCTTCC 600 CCAGGTGAAT ATCGGCTCCA CAAAGGGGTC CTGTCTGGAT AAGCGGGTGA GCGGGGGAGG 660 GATCTGGAGG GGTCTGAGCC ACTTGGTAAA GGGAGAGGAG ACCCTGAGGG TCTAAGGAAG 720 GAAGCATGGC CCTGCCCCAC GAGTCCCAGA CTGATGGGGA GACGTGGTCC TCTGTGCTTA 780 GGGGATGGCG TCAGCTGCAC ACACTCTGGG CTGTCCCGGG AGGCTGTCAC CTATGCTAAG 840 CCCTTCTGAC ACCTTCTTCC CTGATCCTGG GGGTCCTAGT GCTAGGCTTG CCAGGGCCTT 900 CCAGCAACCA ATTTCTCTCC TCCCTTCTCT CTTCCCCGGG CAGGACTGCG AGAACTACAT 960 CACTCTCCTG GAGAGGCGGA GTGAGGGGCT GCTGGCCTGT GGCACCAACG CCCGGCACCC 1020 CAGCTGCTGG AACCTGGTGA GAAGGCTGCT CCCCATGTGC CTGATCAGCT CACCTTCTAC 1080 TGCGTGGGCT TCTGCCCCTC ATGGTGGGAA GGAGATGGCG AGACTCCAAT GCTGGCCTTG 1140 CCCTGGGAGG ATGGGGCTCC TGGCCGAGAA ACTGGCCGTC ATGGGAGGCA GTGGCTGTGG 1200 GATTATGTGG CCATCCAACC CTCTGGATCT CCCACAGGTG AATGGCACTG TGGTGCCACT 1260 TGGCGAGATG AGAGGCTACG CCCCCTTCAG CCCGGACGAG AACTCCCTGG TTCTGTTTGA 1320 AGGTTGGGGC ATGCTTCGGA ACTGGGCTGG GAGCAGGATG GTCAGCTCTT TGTCCAGTGT 1380 CCGGAGGAGG GACTTCCAGG AGCTGCCTGC CCTTACTCAT TTCTCCCTCC CACTGACCCC 1440 AGGGGACGAG GTGTATTCCA CCATCCGGAA GCAGGAATAC AATGGGAAGA TCCCTCGGTT 1500 CCGCCGCATC CGGGGCGAGA GTGAGCTGTA CACCAGTGAT ACTGTCATGC AGAGTGAGTC 1560 AGGCTCCGGC TGGGCTGAGG GTGGGCAAGG GGGTGTGAGC ACTTAAGGTG GCAGATGGGA 1620 TCCTGATGTT TCTGGGAGGG CTCCCTGAGG GCCGCTGGGG CCATGCAGGA AAGCAGGACC 1680 TTGGTATAGG CCTGAGAAGT TAGGGTTGGC TGGGAGCAGA GGAACAGACA AGGTATAGCA 1740 GTGGGATGGG CCCAGCCCTC TTCAGGAACA CAAACAGAGG GAGCCCCAGA CCCAGTGCAG 1800 GGTCCCCAGG AGCCAAAGTT TATCCTCTGC TGAGTTCACG TGGAGGCAGC CCCCCAACTC 1860 CCTCCTCATC AGGGCTCTGC CAATTGAGCA GAAGTGACAT AGGGGCCCCC AGGGACCTTC 1920 CCCCACTCCC CAGGCATGAA GTCATTGCTC CTGGGCCGAT GACATCTTTG TAGGAAGAGG 1980 GCAAAACAGG TGTGGGGTGG AGGTGCAGGG TCTAGGGCCC CTCGGGGAGT TGGACCTGAT 2040 GTTATGAGTC CTATTCCAGA TCTGATTTGC CATGGTTTGT GCAGACCCGA AGGAGGGAGG 2100 AGAGTGTGCA GGGTTGGAAT GGTCTCCCGG GCAAGCTTCC CAGCCTTACG CCCATTCGCT 2160 TCTGTGCCCT GGCAGACCCA CAGTTCATCA AAGCCACCAT CGTGCACCAA GACCAGGCTT 2220 ACGATGACAA GATCTACTAC TTCTTCCGAG AGGACAATCC TGACAAGAAT CCTGAGGCTC 2280 CTCTCAATGT GTCCCGTGTG GCCCAGTTGT GCAGGGTGAA CACGGGCGTG AGGGCTGCTG 2340 GCTACGTGTC TGTGCATGAA TAGGCCTGAG TGAGGGTGAG TTCTGTGTGT CCGTGTGCAT 2400 GTAGAAGTTG TGTGGATGTA TGAGTGGGTC TGTGTCAGGG ACTGTGGGAG CAGCTGTGTG 2460 TGCATGGAGC ATCATGTGTC TGTGTGTGGG TAAAGGTGGC TGAGCTCCTG TGCACGTATG 2520 ATGGCGTGTG AGCGTGTGTA TGATGGGGTG TGTGTGTGTG TGTGTGTGTG TGTTTTGCCT 2580 GTGTGAATGT GCTGTGCCAC GTATGTGGGT GCGTGAGTCA GTAAATGTGT GTCTGAGTCC 2640 GTCTGCTCTG TGGGGACCTG GCACTCTCAC CTGCCCTGAC CCTGGGCACT GCTGGCCCTG 2700 GGCTCTGGAT CAGCCAGGCC TGCTTGCAGG AGTCTCATCT GGAGACCTGC CCTGAGTCCT 2760 GGGGCACCCC CGGCAGGTCC TGGCCCCTCG CAGCCTGCCT TCCTCCTCTG GGCCCAGGTG 2820 TTGATATTGC TGGCAGTGGT TTCCTGGGGT GTGTGGGGAA GCCCGGGCAG GTGCTGAGGG 2880 GCCTCTTCTC CCCTCTACCC TTCCAGGGGG ACCAGGGTGG GGAAAGTTCA CTGTCAGTCT 2940 CCAAGTGGAA CACTTTTCTG AAAGCCATGC TGGTATGCAG TGATGCTGCC ACCAACAAGA 3000 ACTTCAACAG GCTGCAAGAC GTCTTCCTGC TCCCTGACCC CAGCGGCCAG TGGAGGGACA 3060 CCAGGGTCTA TGGTGTTTTC TCCAACCCCT GGTGAGTGGC CCTTGTCCTG GGGCCGGGGC 3120 TGGCATTGGT TCAGTGTCCA GTAGGGACAG GAGGCCTTGG GCCCTGCTGA GGGCCTCCCT 3180 GGTGTGGCAG GAGCAGGGGC TGCAGGCTCA AGAGGCTGGG CTGTTGCTGG GTGTGGGGTG 3240 GGGGGACAGC CAGTGCGATG TATGTACTGT TGTGTGAGTG AGTCTGCACT CATGGGTGTG 3300 TGTGCATGCC CTATATGCAC ACTCATGACT GCACTTGTGC CTGTGTGTCC CACCACCTGC 3360 TTGTGCCGAG AGTGGACACT GGGCCCAGGA GGAAGCTGCT GAAGCATCTC TCGGGGAGCT 3420 GGGTGCTATT ACACCTGCTC AGGCACTGCC TGAGCCCGAT AATTCACACT TCTTAATCAC 3480 TCTCATTGAT TGAACACACG GCAGGCGGAA GTGTTGGGTG TGTGTGGGGA GAGTTAGGGA 3540 TAGAGTGGAG GAAGCCAAGA CCCTGCTCTG TGGCTCCTGG GTGAGTGGGT CCCCCAGGCT 3600 GGGAAGGGGT TGGGGGTCTG GCCTCCTGGG GCATCAGCAC CCCACAGCCT GTGCCCAGGG 3660 AGGGCTAGAG AACTGCTCAG CCTATGATGG GGTTCCTCCT GCCTTGGGGT TGGGTAGAGC 3720 AGATGGCCTC TAGACTCAGT GATTCTGTAA CAGGATACAA GTTTGTGGTT TTAAATTGCA 3780 GCACAAAGAA ATTAGGCTGA ACTCCTCTCC TTCCTCCTCT CCATCCCTCC CCATTTTCAG 3840 TGGTGGTTGG CAACTCAGTG CCAGGCACAA GGCTGGCCTG GGTGAGTGGA GGTGGATGGG 3900 TGGGTTCTGG GCCCCCCATT GAGCTGGTCT CCATGTCACT GCAGGAACTA CTCAGCCGTC 3960 TGTGTGTATT CCCTCGGTGA CATTGACAAG GTCTTCCGTA CCTCCTCACT CAAGGGCTAC 4020 CACTCAAGCC TTCCCAACCC GCGGCCTGGC AAGGTGAGCG TGACACCAGC CGTGGCCCAG 4080 GCCCAGCCCT CCTTCTGCCT CACCTCCCAC CACCCCACTG ACCTGGGCCT GCTCTCCTTG 4140 CCCAGTGCCT CCCAGACCAG CAGCCGATAC CCACAGAGAC CTTCCAGGTG GCTGACCGTC 4200 ACCCAGAGGT GGCGCAGAGG GTGGAGCCCA TGGGGCCTCT GAAGACGCCA TTGTTCCACT 4260 CTAAATACCA CTACCAGAAA GTGGCCGTCC ACCGCATGCA AGCCAGCCAC GGGGAGACCT 4320 TTCATGTGCT TTACCTAACT ACAGGTGAGA GGCTACCCCG GGACCCTCAG TTTGCTTTGT 4380 AAAAACGGGC ATGAAAGGTG TAAGGAATAA TGTAGTTAAC ATCTGGTTGG ATCTTTACAT 4440 GTGGAAGGAA TAATTGAGTG ACTGGAGTTG TCAGGGGTTA ATGTGTGTGG GTGTGGAAGA 4500 GCCAGGCAGG GAGAGCTTCC TGGAGGAGGT AGGGGCAAGA GGGAAAGGGG GATGGGAGAA 4560 AAGCAAGCAC TGGGATTTGG AGGCGGAAAT CTGGAGAGTC TGAGCAAAGC CAGGTGCACC 4620 TTTGGTCCAG ATGTCTGACT CAGGGAAGAA GATGGTAGGA AGAGACGTGG CAAATGAGGA 4680 GGAGGGGCCT GAACCACAGG GATACTGGCC TCTGCCAGGC AGAATGAGGG AGTCAGGCCC 4740 TGCGCCTGTC TTTGGGATTG TGCAGGTGAG AAGAAACATT TGAGGAGTTG ATGGGGCACA 4800 AATTAGGTAT GGGGAAGGAG TTCCAGGGGG CAGAACCTTT GCCATCTCAC AGAGGACAGG 4860 GGCAGCTTCT CTTCTTCCCT GGAGTAGGCC CTGCTGGGGG AAGCTGGGTG GAATGCCGTG 4920 GGAGATGCTC CTGCTTTCTG GAAAGCCACA GGACACGGAG GAGCCAGTCC TGAGTTGGGT 4980 TTGTCGCAGC TTCCCATGCC AGCTGCCTTC CTTGAGACTG GAAAGGGCCT CTAGCACCCC 5040 TGGGGCCATT CAATTCAGGC CCAGGCGCCC AACCTCAGTT GTTCACATTC CCCATGTGAT 5100 CTCCTGTTGC TGCTTCACCT TGGGACTGTC TCGGCTTTGG TGACCTTGTA GGAAACTGGA 5160 ACCCCAGCAC CATTGTTTGG CTCCTGGAAG CCTTGGGGAG AGGAATTTCC CACAGGGCAG 5220 GGCCTGGGTC CTGATTCCCT GCCTCTTTAC TCCCTATTCA TCCCGGCTAC ACCCTTGGGC 5280 CCCCATCCTT GCTTGGCTCC AGTACTGGCT GGCACAGCTG TTGTGGTCAT CCAGGGATGG 5340 CAGGGCACTG GGGAACAGAA GAGAGAGGTC ACACAGTGCG GAACTGGGAG CAGGAGCTAG 5400 GACAAGGAAG GCTGGACTTG GGCCATGGAT TCCCTTCCTG CAGACTTGGG AAGTGAGCAC 5460 ACTTGAGTGA TTAGAGAAGG TGTCTTCGTT CTAAGGGCAG TGGAGGAGGC ACCATTTTGG 5520 AGCCTGCATC ATTCGTATTT GGGCTAGATT GAAAAATAGA GCTTTCTAAG TCCTCTGCAG 5580 AGAATGGGAG GCTCTCACAA CTGGGAGAAG TATTGGCTCT TTTCCTGAGA ATTTTGCCAA 5640 GGGTATGCTG TTACTGGGGC TGGTTTGGAA GGAGTATAGG GCATTATGTC TGTGAAGGCA 5700 GTGGCTGGGG TGGGGCCTTA TCAGGCCCAA GGAGCATCTG GCCACATCTC AGAGTCCACA 5760 GATGAGGATC ACGGATGTGT AGAGGAAACA TCCTAGGCAG GCAATCATCT GACTGCTTTT 5820 TTGGGGCAGG TGATGCCCTG GGAAATTGGG AGGGAGGGAG AGAGGGAGGT AGGCTATTCT 5880 AGAAACTGGG AGAGCAGGTG AGGTAGGATT GGGAGGACCA GGGGTCAGGG TCCCCATTGG 5940 TCCCTAATTG AGAACGGAGA GAGCATTGGT CTAGGAGGCA GGCAGCTCGG TTATAAGACC 6000 TTGGGAACTC TTGATTTAGA ATCCAAGATC CTTTTTAGAT CTAGGATTTT ATAAAATTAA 6060 GATATCCCCT AAGATCAAAT GCAACGTGGA GTCCTGAATT GGATCCTAGA ACAGAAGAAG 6120 GACATTTGTG GAAAAACTAG TGAAATCCAA ATAAAGTCTG TAGTTTTGTT AATAGTAATG 6180 CACCAATGTC AGTTGCCTAG TTGTGACAAA TATACCGTGG TTATGTAAGA TGGTAACATT 6240 AGGGGGAACT GGAGAAGGGT AGATTGGAGC TCTCTGTACT ATCTTTGCAA CTTTTCTGGG 6300 AATCTAAAAT TACTCCAAAA TAAAAAAAAA ATGTATTTAA AGTAAATATA TTCCCTAAGA 6360 GTCCAGGAGG CAGGGGAGTT GTAGAAGCAG CTGAGTGGTT GGGTTCTGAC AGATTTGGTT 6420 CCAACTCGGT CTCTGCTGCT CACCAGCTGT GTGACCTTGA GCAAGTGGCT TAGCCTTTCT 6480 GAGCCTGATT TCCTTATCTG TGGAGTGGGG AAGATGACAG CCACCTCGCA GGGCTGTGGA 6540 GGGTTAAACG AGGTGATGCA TGGACAGCAG CCGCACTGAC CTTGCTGGTG TGGGGCTCCT 6600 GCTTCTGTTC TTCCCGTGCA GCCTTGGGAA TGTTGGAGGC CGTATCCAGG GACCCCTGGG 6660 CCTCCTGGGA TGGCCTCTCT GGATCAGCCT TGGAAGGTTC CAGGCTGCCC TTAGGCTCCC 6720 ACATTCTTCC CCAGTCACGC TCTCCTCGCC CTGCCCACAC CAGTCCTGTG ACCCTTGCCT 6780 GAGTTGTGAC TTCCCACCCC TCCCCGGCCT AGAGGAAAGC TGCCTGGCCC CTCAGTGGGA 6840 CTCCCGCCCA CTGACCCTCT GTCCACCATA CACAGACAGG GGCACTATCC ACAAGGTGGT 6900 GGAACCGGGG GAGCAGGAGC ACAGCTTCGC CTTCAACATC ATGGAGATCC AGCCCTTCCG 6960 CCGCGCGGCT GCCATCCAGA CCATGTCGCT GGATGCTGAG CGGGTGAGCC TTCCCCCACT 7020 GCGTCCCATG GGCTATGCAG TGACTGCAGC TGAGGACAGG GCTCCTTTGC ATGTGATTTG 7080 TGTGTTCTTT TAAGAGCTTC TAGGCCTTAG GGCCTGGACA TTTAGGACTG AGTGTGGGGT 7140 GGGGCCCGGG CCTGACCCAA TCCTGCTGTC CTTCCAGAGG AAGCTGTATG TGAGCTCCCA 7200 GTGGGAGGTG AGCCAGGTGC CCCTGGACCT GTGTGAGGTC TATGGCGGGG GCTGCCACGG 7260 TTGCCTCATG TCCCGAGACC CCTACTGCGG CTGGGACCAG GGCCGCTGCA TCTCCATCTA 7320 CAGCTCCGAA CGGTACGTTG GCCGGGATCC CTCCGTCCCT GGGACAAGGT GGGCATGGGA 7380 CAGGGGGAGG TGTTGTCGGG CTGGAAGAGG TGGCGGTACT GGGCCTTTCT TGTGGGACCT 7440 CCTCTCTACT GGAACTGCAC TAGGGGTAAG GATATGAGGG TCAGGTCTGC AGCCTTGTAT 7500 CTGCTGATCC TCTTTCGTCC TTCCCACTCC AGGTCAGTGC TGCAATCCAT TAATCCAGCC 7560 GAGCCACACA AGGAGTGTCC CAACCCCAAA CCAGGTACCT GATCTGGCCC TGCTGGCGGC 7620 TGTGGCCCAA TGAGTGGGGT ACTGCCCTGC CCTGATTGTC CTGGTCTGAG GGAAACATGG 7680 CCTTGTCCTG TGGGCCCCAG GTACATGGGG CAGGATACAG TCCTGCAGAG GGAGCCCTCT 7740 TGGTGGGATG AGCGAGACGG GAGAAAAAAG GAGGACGCTG AGGGCTGGGT TCCCCACGTT 7800 CATTCAGAAG CCTTGTCCTG GGATCCCAGT CGGTGGGGAG GACACATCCT CCCCTGGGAG 7860 CTCTTTGTCC CTCCTCACGG CTGCTTCCCC ACTGCCTCCC CAGACAAGGC CCCACTGCAG 7920 AAGGTTTCCC TGGCCCCAAA CTCTCGCTAC TACCTGAGCT GCCCCATGGA ATCCCGCCAC 7980 GCCACCTACT CATGGCGCCA CAAGGAGAAC GTGGAGCAGA GCTGCGAACC TGGTCACCAG 8040 AGCCCCAACT GCATCCTGTT CATCGAGAAC CTCACGGCGC AGCAGTACGG CCACTACTTC 8100 TGCGAGGCCC AGGAGGGCTC CTACTTCCGC GAGGCTCAGC ACTGGCAGCT GCTGCCCGAG 8160 GACGGCATCA TGGCCGAGCA CCTGCTGGGT CATGCCTGTG CCCTGGCCGC CTCCCTCTGG 8220 CTGGGGGTGC TGCCCACACT CACTCTTGGC TTGCTGGTCC ACTAGGGCCT CCCGAGGCTG 8280 GGCATGCCTC AGGCTTCTGC AGCCCAGGGC ACTAGAACGT CTCACACTCA GAGCCGGCTG 8340 GCCCGGGAGC TCCTTGCCTG CCACTTCTTC CAGGGGACAG AATAACCCAG TGGAGGATGC 8400 CAGGCCTGGA GACGTCCAGC CGCAGGCGGC TGCTGGGCCC CAGGTGGCGC ACGGATGGTG 8460 AGGGGCTGAG AATGAGGGCA CCGACTGTGA AGCTGGGGCA TCGATGACCC AAGACTTTAT 8520 CTTCTGGAAA ATATTTTTCA GACTCCTCAA ACTTGACTAA ATGCAGCGAT GCTCCCAGCC 8580 CAAGAGCCCA TGGGTCGGGG AGTGGGTTTG GATAGGAGAG CTGGGACTCC ATCTCGACCC 8640 TGGGGCTGAG GCCTGAGTCC TTCTGGACTC TTGGTACCCA CATTGCCTCC TTCCCCTCCC 8700 TCTCTCATGG CTGGGTGGCT GGTGTTCCTG AAGACCCAGG GCTACCCTCT GTCCAGCCCT 8760 GTCCTCTGCA GCTCCCTCTC TGGTCCTGGG TCCCACAGGA CAGCCGCCTT GCATGTTTAT 8820 TGAAGGATGT TTGCTTTCCG GACGGAAGGA CGGAAAAAGC TCTGAAAAAA AAAAAAAAAA 8880 AAAAAAAA 8888 6622 base pairs nucleic acid single linear DNA (genomic) 42 GATATCATGG AGATAATTAA AATGATAACC ATCTCGCAAA TAAATAAGTA TTTTACTGTT 60 TTCGTAACAG TTTTGTAATA AAAAAACCTA TAAATATGAA ATTCTTAGTC AACGTTGCCC 120 TTGTTTTTAT GGTCGTATAC ATTTCTTACA TCTATGCGGA TCGATGGGGA TCCGCCCAGG 180 GCCACCTAAG GAGCGGACCC CGCATCTTCG CCGTCTGGAA AGGCCATGTA GGGCAGGACC 240 GGGTGGACTT TGGCCAGACT GAGCCGCACA CGGTGCTTTT CCACGAGCCA GGCAGCTCCT 300 CTGTGTGGGT GGGAGGACGT GGCAAGGTCT ACCTCTTTGA CTTCCCCGAG GGCAAGAACG 360 CATCTGTGCG CACGGTGAAT ATCGGCTCCA CAAAGGGGTC CTGTCTGGAT AAGCGGGACT 420 GCGAGAACTA CATCACTCTC CTGGAGAGGC GGAGTGAGGG GCTGCTGGCC TGTGGCACCA 480 ACGCCCGGCA CCCCAGCTGC TGGAACCTGG TGAATGGCAC TGTGGTGCCA CTTGGCGAGA 540 TGAGAGGCTA TGCCCCCTTC AGCCCGGACG AGAACTCCCT GGTTCTGTTT GAAGGGGACG 600 AGGTGTATTC CACCATCCGG AAGCAGGAAT ACAATGGGAA GATCCCTCGG TTCCGCCGCA 660 TCCGGGGCGA GAGTGAGCTG TACACCAGTG ATACTGTCAT GCAGAACCCA CAGTTCATCA 720 AAGCCACCAT CGTGCACCAA GACCAGGCTT ACGATGACAA GATCTACTAC TTCTTCCGAG 780 AGGACAATCC TGACAAGAAT CCTGAGGCTC CTCTCAATGT GTCCCGTGTG GCCCAGTTGT 840 GCAGGGGGGA CCAGGGTGGG GAAAGTTCAC TGTCAGTCTC CAAGTGGAAC ACTTTTCTGA 900 AAGCCATGCT GGTATGCAGT GATGCTGCCA CCAACAAGAA CTTCAACAGG CTGCAAGACG 960 TCTTCCTGCT CCCTGACCCC AGCGGCCAGT GGAGGGACAC CAGGGTCTAT GGTGTTTTCT 1020 CCAACCCCTG GAACTACTCA GCCGTCTGTG TGTATTCCCT CGGTGACATT GACAAGGTCT 1080 TCCGTACCTC CTCACTCAAG GGCTACCACT CAAGCCTTCC CAACCCGCGG CCTGGCAAGT 1140 GCCTCCCAGA CCAGCAGCCG ATACCCACAG AGACCTTCCA GGTGGCTGAC CGTCACCCAG 1200 AGGTGGCGCA GAGGGTGGAG CCCATGGGGC CTCTGAAGAC GCCATTGTTC CACTCTAAAT 1260 ACCACTACCA GAAAGTGGCC GTTCACCGCA TGCAAGCCAG CCACGGGGAG ACCTTTCATG 1320 TGCTTTACCT AACTACAGAC AGGGGCACTA TCCACAAGGT GGTGGAACCG GGGGAGCAGG 1380 AGCACAGCTT CGCCTTCAAC ATCATGGAGA TCCAGCCCTT CCGCCGCGCG GCTGCCATCC 1440 AGACCATGTC GCTGGATGCT GAGCGGAGGA AGCTGTATGT GAGCTCCCAG TGGGAGGTGA 1500 GCCAGGTGCC CCTGGACCTG TGTGAGGTCT ATGGCGGGGG CTGCCACGGT TGCCTCATGT 1560 CCCGAGACCC CTACTGCGGC TGGGACCAGG GCCGCTGCAT CTCCATCTAC AGCTCCGAAC 1620 GGTCAGTGCT GCAATCCATT AATCCAGCCG AGCCACACAA GGAGTGTCCC AACCCCAAAC 1680 CAGACAAGGC CCCACTGCAG AAGGTTTCCC TGGCCCCAAA CTCTCGCTAC TACCTGAGCT 1740 GCCCCATGGA ATCCCGCCAC GCCACCTACT CATGGCGCCA CAAGGAGAAC GTGGAGCAGA 1800 GCTGCGAACC TGGTCACCAG AGCCCCAACT GCATCCTGTT CATCGAGAAC CTCACGGCGC 1860 AGCAGTACGG CCACTACTTC TGCGAGGCCC AGGAGGGCTC CTACTTCCGC GAGGCTCAGC 1920 ACTGGCAGCT GCTGCCCGAG GACGGCATCA TGGCCGAGCA CCTGCTGGGT CATGCCTGTG 1980 CCCTGGCTGC CTGAATTCGA AGCTTGGAGT CGACTCTGCT GAAGAGGAGG AAATTCTCCT 2040 TGAAGTTTCC CTGGTGTTCA AAGTAAAGGA GTTTGCACCA GACGCACCTC TGTTCACTGG 2100 TCCGGCGTAT TAAAACACGA TACATTGTTA TTAGTACATT TATTAAGCGC TAGATTCTGT 2160 GCGTTGTTGA TTTACAGACA ATTGTTGTAC GTATTTTAAT AATTCATTAA ATTTATAATC 2220 TTTAGGGTGG TATGTTAGAG CGAAAATCAA ATGATTTTCA GCGTCTTTAT ATCTGAATTT 2280 AAATATTAAA TCCTCAATAG ATTTGTAAAA TAGGTTTCGA TTAGTTTCAA ACAAGGGTTG 2340 TTTTTCCGAA CCGATGGCTG GACTATCTAA TGGATTTTCG CTCAACGCCA CAAAACTTGC 2400 CAAATCTTGT AGCAGCAATC TAGCTTTGTC GATATTCGTT TGTGTTTTGT TTTGTAATAA 2460 AGGTTCGACG TCGTTCAAAA TATTATGCGC TTTTGTATTT CTTTCATCAC TGTCGTTAGT 2520 GTACAATTGA CTCGACGTAA ACACGTTAAA TAAAGCCTGG ACATATTTAA CATCGGGCGT 2580 GTTAGCTTTA TTAGGCCGAT TATCGTCGTC GTCCCAACCC TCGTCGTTAG AAGTTGCTTC 2640 CGAAGACGAT TTTGCCATAG CCACACGACG CCTATTAATT GTGTCGGCTA ACACGTCCGC 2700 GATCAAATTT GTAGTTGAGC TTTTTGGAAT TATTTCTGAT TGCGGGCGTT TTTGGGCGGG 2760 TTTCAATCTA ACTGTGCCCG ATTTTAATTC AGACAACACG TTAGAAAGCG ATGGTGCAGG 2820 CGGTGGTAAC ATTTCAGACG GCAAATCTAC TAATGGCGGC GGTGGTGGAG CTGATGATAA 2880 ATCTACCATC GGTGGAGGCG CAGGCGGGGC TGGCGGCGGA GGCGGAGGCG GAGGTGGTGG 2940 CGGTGATGCA GACGGCGGTT TAGGCTCAAA TTGTCTCTTT CAGGCAACAC AGTCGGCACC 3000 TCAACTATTG TACTGGTTTC GGGCGTATGG TGCACTCTCA GTACAATCTG CTCTGATGCC 3060 GCATAGTTAA GCCAGCCCCG ACACCCGCCA ACACCCGCTG ACGCGCCCTG ACGGGCTTGT 3120 CTGCTCCCGG CATCCGCTTA CAGACAAGCT GTGACCGTCT CCGGGAGCTG CATGTGTCAG 3180 AGGTTTTCAC CGTCATCACC GAAACGCGCG AGACGAAAGG GCCTCGTGAT ACGCCTATTT 3240 TTATAGGTTA ATGTCATGAT AATAATGGTT TCTTAGACGT CAGGTGGCAC TTTTCGGGGA 3300 AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC ATTCAAATAT GTATCCGCTC 3360 ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA AAAGGAAGAG TATGAGTATT 3420 CAACATTTCC GTGTCGCCCT TATTCCCTTT TTTGCGGCAT TTTGCCTTCC TGTTTTTGCT 3480 CACCCAGAAA CGCTGGTGAA AGTAAAAGAT GCTGAAGATC AGTTGGGTGC ACGAGTGGGT 3540 TACATCGAAC TGGATCTCAA CAGCGGTAAG ATCCTTGAGA GTTTTCGCCC CGAAGAACGT 3600 TTTCCAATGA TGAGCACTTT TAAAGTTCTG CTATGTGGCG CGGTATTATC CCGTATTGAC 3660 GCCGGGCAAG AGCAACTCGG TCGCCGCATA CACTATTCTC AGAATGACTT GGTTGAGTAC 3720 TCACCAGTCA CAGAAAAGCA TCTTACGGAT GGCATGACAG TAAGAGAATT ATGCAGTGCT 3780 GCCATAACCA TGAGTGATAA CACTGCGGCC AACTTACTTC TGACAACGAT CGGAGGACCG 3840 AAGGAGCTAA CCGCTTTTTT GCACAACATG GGGGATCATG TAACTCGCCT TGATCGTTGG 3900 GAACCGGAGC TGAATGAAGC CATACCAAAC GACGAGCGTG ACACCACGAT GCCTGTAGCA 3960 ATGGCAACAA CGTTGCGCAA ACTATTAACT GGCGAACTAC TTACTCTAGC TTCCCGGCAA 4020 CAATTAATAG ACTGGATGGA GGCGGATAAA GTTGCAGGAC CACTTCTGCG CTCGGCCCTT 4080 CCGGCTGGCT GGTTTATTGC TGATAAATCT GGAGCCGGTG AGCGTGGGTC TCGCGGTATC 4140 ATTGCAGCAC TGGGGCCAGA TGGTAAGCCC TCCCGTATCG TAGTTATCTA CACGACGGGG 4200 AGTCAGGCAA CTATGGATGA ACGAAATAGA CAGATCGCTG AGATAGGTGC CTCACTGATT 4260 AAGCATTGGT AACTGTCAGA CCAAGTTTAC TCATATATAC TTTAGATTGA TTTAAAACTT 4320 CATTTTTAAT TTAAAAGGAT CTAGGTGAAG ATCCTTTTTG ATAATCTCAT GACCAAAATC 4380 CCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCCG TAGAAAAGAT CAAAGGATCT 4440 TCTTGAGATC CTTTTTTTCT GCGCGTAATC TGCTGCTTGC AAACAAAAAA ACCACCGCTA 4500 CCAGCGGTGG TTTGTTTGCC GGATCAAGAG CTACCAACTC TTTTTCCGAA GGTAACTGGC 4560 TTCAGCAGAG CGCAGATACC AAATACTGTT CTTCTAGTGT AGCCGTAGTT AGGCCACCAC 4620 TTCAAGAACT CTGTAGCACC GCCTACATAC CTCGCTCTGC TAATCCTGTT ACCAGTGGCT 4680 GCTGCCAGTG GCGATAAGTC GTGTCTTACC GGGTTGGACT CAAGACGATA GTTACCGGAT 4740 AAGGCGCAGC GGTCGGGCTG AACGGGGGGT TCGTGCACAC AGCCCAGCTT GGAGCGAACG 4800 ACCTACACCG AACTGAGATA CCTACAGCGT GAGCTATGAG AAAGCGCCAC GCTTCCCGAA 4860 GGGAGAAAGG CGGACAGGTA TCCGGTAAGC GGCAGGGTCG GAACAGGAGA GCGCACGAGG 4920 GAGCTTCCAG GGGGAAACGC CTGGTATCTT TATAGTCCTG TCGGGTTTCG CCACCTCTGA 4980 CTTGAGCGTC GATTTTTGTG ATGCTCGTCA GGGGGGCGGA GCCTATGGAA AAACGCCAGC 5040 AACGCGGCCT TTTTACGGTT CCTGGCCTTT TGCTGGCCTT TTGCTCACAT GTTCTTTCCT 5100 GCGTTATCCC CTGATTCTGT GGATAACCGT ATTACCGCCT TTGAGTGAGC TGATACCGCT 5160 CGCCGCAGCC GAACGACCGA GCGCAGCGAG TCAGTGAGCG AGGAAGCATC CTGCACCATC 5220 GTCTGCTCAT CCATGACCTG ACCATGCAGA GGATGATGCT CGTGACGGTT AACGCCTCGA 5280 ATCAGCAACG GCTTGCCGTT CAGCAGCAGC AGACCATTTT CAATCCGCAC CTCGCGGAAA 5340 CCGACATCGC AGGCTTCTGC TTCAATCAGC GTGCCGTCGG CGGTGTGCAG TTCAACCACC 5400 GCACGATAGA GATTCGGGAT TTCGGCGCTC CACAGTTTCG GGTTTTCGAC GTTCAGACGT 5460 AGTGTGACGC GATCGGTATA ACCACCACGC TCATCGATAA TTTCACCGCC GAAAGGCGCG 5520 GTGCCGCTGG CGACCTGCGT TTCACCCTGC CATAAAGAAA CTGTTACCCG TAGGTAGTCA 5580 CGCAACTCGC CGCACATCTG AACTTCAGCC TCCAGTACAG CGCGGCTGAA ATCATCATTA 5640 AAGCGAGTGG CAACATGGAA ATCGCTGATT TGTGTAGTCG GTTTATGCAG CAACGAGACG 5700 TCACGGAAAA TGCCGCTCAT CCGCCACATA TCCTGATCTT CCAGATAACT GCCGTCACTC 5760 CAACGCAGCA CCATCACCGC GAGGCGGTTT TCTCCGGCGC GTAAAAATGC GCTCAGGTCA 5820 AATTCAGACG GCAAACGACT GTCCTGGCCG TAACCGACCC AGCGCCCGTT GCACCACAGA 5880 TGAAACGCCG AGTTAACGCC ATCAAAAATA ATTCGCGTCT GGCCTTCCTG TAGCCAGCTT 5940 TCATCAACAT TAAATGTGAG CGAGTAACAA CCCGTCGGAT TCTCCGTGGG AACAAACGGC 6000 GGATTGACCG TAATGGGATA GGTCACGTTG GTGTAGATGG GCGCATCGTA ACCGTGCATC 6060 TGCCAGTTTG AGGGGACGAC GACAGTATCG GCCTCAGGAA GATCGCACTC CAGCCAGCTT 6120 TCCGGCACCG CTTCTGGTGC CGGAAACCAG GCAAAGCGCC ATTCGCCATT CAGGCTGCGC 6180 AACTGTTGGG AAGGGCGATC GGTGCGGGCC TCTTCGCTAT TACGCCAGCT GGCGAAAGGG 6240 GGATGTGCTG CAAGGCGATT AAGTTGGGTA ACGCCAGGGT TTTCCCAGTC ACGACGTTGT 6300 AAAACGACGG GATCTATCAT TTTTAGCAGT GATTCTAATT GCAGCTGCTC TTTGATACAA 6360 CTAATTTTAC GACGACGATG CGAGCTTTTA TTCAACCGAG CGTGCATGTT TGCAATCGTG 6420 CAAGCGTTAT CAATTTTTCA TTATCGTATT GTTGCACATC AACAGGCTGG ACACCACGTT 6480 GAACTCGCCG CAGTTTTGCG GCAAGTTGGA CCCGCCGCGC ATCCAATGCA AACTTTCCGA 6540 CATTCTGTTG CCTACGAACG ATTGATTCTT TGTCCATTGA TCGAAGCGAG TGCCTTCGAC 6600 TTTTTCGTGT CCAGTGTGGC TT 6622 31 base pairs nucleic acid single linear DNA (genomic) 43 CCGGATCCGC CCAGGGCCAC CTAAGGAGCG G 31 29 base pairs nucleic acid single linear DNA (genomic) 44 CTGAATTCAG GAGCCAGGGC ACAGGCATG 29
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US7232899Jan 14, 2000Jun 19, 2007The Scripps Research InstituteAdenovirus vectors, packaging cell lines, compositions, and methods for preparation and use
US7498407Nov 12, 2002Mar 3, 2009Georgetown UniversityVascular endothelial cell growth inhibitor, VEGI-192a
US7750133Dec 6, 2007Jul 6, 2010Georgetown UniversityVascular endothelial cell growth inhibitor, VEGI-192a
US9090709Mar 14, 2013Jul 28, 2015Vaccinex, Inc.Anti-SEMA4D antibodies and epitopes
US9243068Jun 20, 2014Jan 26, 2016Vaccinex, Inc.Combination of SEMA-4D inhibitors and immunomodulators to inhibit tumors and metastases
US9249227Jun 29, 2015Feb 2, 2016Vaccinex, Inc.Use of semaphorin-4D binding molecules for treating neurodegenerative disorders
US20030170242 *Nov 12, 2002Sep 11, 2003Luyuan LiNovel isoforms of vascular endothelial cell growth inhibitor
US20050196201 *Dec 15, 2004Sep 8, 2005Canon Kabushiki KaishaImage forming apparatus
WO2013055922A1 *Oct 11, 2012Apr 18, 2013Vaccinex, Inc.Use of semaphorin-4d binding molecules for modulation of blood brain barrier permeability
Classifications
U.S. Classification435/69.1, 530/350, 435/325, 536/23.5, 514/19.1, 514/19.6
International ClassificationC12N15/85, C12Q1/68, C07K14/725, G01N33/68, A61K38/00, C12R1/91, C12P21/02, C07K16/28, A61K48/00, C12N15/11, C12N15/62, C12N15/12, C12N5/10, C12N15/09, C07K14/47
Cooperative ClassificationC07K2319/02, A61K48/00, C07K14/4703
European ClassificationC07K14/47A1A
Legal Events
DateCodeEventDescription
Jan 4, 2006ASAssignment
Owner name: SANOFI-AVENTIS DEUTSCHLAND GMBH, GERMANY
Free format text: CHANGE OF NAME;ASSIGNOR:AVENTIS PHARMA DEUTSCHLAND GMBH;REEL/FRAME:016966/0311
Effective date: 20050901