US20030199464A1 - Regeneration of endogenous myocardial tissue by induction of neovascularization - Google Patents

Regeneration of endogenous myocardial tissue by induction of neovascularization Download PDF

Info

Publication number
US20030199464A1
US20030199464A1 US10/128,738 US12873802A US2003199464A1 US 20030199464 A1 US20030199464 A1 US 20030199464A1 US 12873802 A US12873802 A US 12873802A US 2003199464 A1 US2003199464 A1 US 2003199464A1
Authority
US
United States
Prior art keywords
agent
subject
progenitor cells
cardiomyocyte
endothelial progenitor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/128,738
Inventor
Silviu Itescu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University of New York
Original Assignee
Silviu Itescu
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Silviu Itescu filed Critical Silviu Itescu
Priority to US10/128,738 priority Critical patent/US20030199464A1/en
Priority to EP10164397.1A priority patent/EP2292631B1/en
Priority to CNB038147157A priority patent/CN100379751C/en
Priority to AU2003231090A priority patent/AU2003231090B2/en
Priority to JP2003587162A priority patent/JP4897199B2/en
Priority to US10/512,518 priority patent/US7887796B2/en
Priority to EP03724217A priority patent/EP1501852A4/en
Priority to ZA200408777A priority patent/ZA200408777B/en
Priority to CA2482996A priority patent/CA2482996C/en
Priority to EP11157749A priority patent/EP2366706A1/en
Priority to PCT/US2003/012768 priority patent/WO2003090512A2/en
Priority to US10/693,480 priority patent/US8663652B2/en
Publication of US20030199464A1 publication Critical patent/US20030199464A1/en
Assigned to TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE reassignment TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW YORK, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ITESCU, SILVIU
Priority to IL164671A priority patent/IL164671A/en
Priority to US11/648,769 priority patent/US8242091B2/en
Priority to AU2009213032A priority patent/AU2009213032B2/en
Priority to JP2011021983A priority patent/JP5619644B2/en
Priority to JP2013249643A priority patent/JP5911841B2/en
Priority to US14/196,711 priority patent/US20150056161A1/en
Priority to IL235149A priority patent/IL235149B/en
Priority to JP2016014321A priority patent/JP2016155804A/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2053—IL-8
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/193—Colony stimulating factors [CSF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/075—Ethers or acetals
    • A61K31/085—Ethers or acetals having an ether linkage to aromatic ring nuclear carbon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/34—Muscles; Smooth muscle cells; Heart; Cardiac stem cells; Myoblasts; Myocytes; Cardiomyocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/44—Vessels; Vascular smooth muscle cells; Endothelial cells; Endothelial progenitor cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1825—Fibroblast growth factor [FGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1858—Platelet-derived growth factor [PDGF]
    • A61K38/1866—Vascular endothelial growth factor [VEGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1891—Angiogenesic factors; Angiogenin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/195—Chemokines, e.g. RANTES
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/10—Drugs for disorders of the urinary system of the bladder
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2866—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/069—Vascular Endothelial cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2510/00—Detection of programmed cell death, i.e. apoptosis

Definitions

  • Vascular network formation is the end result of a complex process that begins in the pre-natal period with induction of vasculogenesis by hemangioblasts—cells derived from the human ventral aorta which give rise to both endothelial and hematopoietic elements (8-11).
  • CXC chemokines containing the ELR motif regulate migration of human bone marrow-derived endothelial progenitor cells to sites of tissue ischemia.
  • selective bone marrow homing and engraftment of hematopoietic progenitors depends on CXCR4 binding to SDF-1 expressed constitutively in the bone marrow (28-30)
  • interruption of CXCR4/SDF-1 interactions could redirect trafficking of human bone marrow-derived endothelial progenitor cells to sites of tissue ischemia, thereby augmenting therapeutic vasculogenesis.
  • CXC chemokines, including IL-8, Gro-alpha, and SDF-1 play a central role in regulating human adult bone marrow-dependent vasculogenesis.
  • This invention provides a method of treating a disorder of a subject's heart involving loss of cardiomyocytes which comprises administering to the subject an amount of an agent effective to cause cardiomyocyte proliferation within the subject's heart so as to thereby treat the disorder.
  • This invention further provides the instant method wherein the agent is human endothelial progenitor cells.
  • This invention further provides the instant method comprising administering an effective amount of a second agent that increases the cardiomyocyte proliferation caused by the human endothelial progenitor cells.
  • This invention also provides a method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising:
  • FIGS. 1 A- 1 D IL-8/Gro-Alpha CXC Chemokines Regulate Migration Of Human Endothelial progenitor cells (angioblasts) To Myocardial Tissue In Vivo And Subsequent Development Of Vasculogenesis.
  • FIGS. 2 A- 2 C Blocking CXCR4/SDF-1 Interactions Redirects Intravenously Injected Human Endothelial progenitor cells From Bone Marrow To Ischemic Myocardium.
  • (B) and (C) depict the effects of mAbs against CXCR4, SDF-1 or CD34 on trafficking of human CD34+endothelial progenitor cells (angioblasts) to rat bone marrow and myocardium following LAD ligation.
  • Co-administration of anti-CXCR4 or anti-SDF-1 significantly reduced trafficking of intravenously injected human CD34+ cells to rat bone marrow at 48 hours and increased trafficking to ischemic myocardium, whereas anti-CD34 mAb had no effect (results are expressed as mean+sem of bone marrow and cardiac studies performed in three LAD-ligated animals at 48 hours after injection).
  • FIGS. 3 A- 3 F Redirected Trafficking Of Human Endothelial progenitor cells (angioblasts) To The Site Of Infarction Induces Vasculogenesis And Protects Cardiomyocytes against Apoptosis.
  • the infarct zones of rats receiving either 10 3 or 10 5 endothelial progenitor cells (angioblasts) show myocardial scars composed of paucicellular, dense fibrous tissue stained blue by trichrome (x400).
  • the infarct zones of rats injected with 10 5 endothelial progenitor cells plus anti-CXCR4 mAb show significant increase in cellularity of granulation tissue, minimal matrix deposition and fibrosis, and numerous medium-sized capillaries of human origin.
  • the infarct zones of rats injected with 2 ⁇ 10 5 endothelial progenitor cells show a similar reduction in fibrous tissue and increase in medium-sized capillaries, and an additional increase in large-sized vessels of human origin.
  • (B) and (C) show the relationship between the number of human CD117 bright endothelial progenitor cells injected intravenously (10 3 , 10 5 , 10 5 plus anti-CXCR4 mAb, and 2 ⁇ 10 5 ) and development of rat infarct bed vasculogenesis at two weeks, defined as the mean number of capillaries/high power field (hpf) with medium- or large-sized lumen diameter (respectively, 0.02 mm mean diameter with 3-6 contiguous endothelial lining cells and 0.05 mm mean diameter with >6 contiguous endothelial lining cells). Results are expressed as the mean+sem of at least 15 hpf in three separate experiments.
  • (D) shows that co-administration of anti-CXCR4 mAb together with the highest concentration of endothelial progenitor cells (angioblasts), 2 ⁇ 10 5 , resulted in a further 23% increase in growth of large-lumen capillaries. More strikingly, there was a further 2-fold increase in capillary numbers when 2 ⁇ 10 5 endothelial progenitor cells were injected intravenously after direct intracardiac delivery of 1.0 ⁇ g/ml SDF-1 into infarcted hearts (p ⁇ 0.01) (results are expressed as mean+sem of three separate experiments).
  • (E) shows that at 2 weeks the numbers of apoptotic myocytes at the peri-infarct rim, defined by concomitant staining with anti-desmin mAb and DNA end-labeling using TUNEL technique, are significantly reduced in rats receiving either 2.0 ⁇ 10 5 endothelial progenitor cells or 10 5 endothelial progenitor cells together with anti-CXCR4 mAb in comparison to rats receiving 10 3 or 10 5 endothelial progenitor cells (p ⁇ 0.01) (results are expressed as mean+sem of three separate experiments).
  • (F) shows that co-administration of anti-CXCR4 mAb or intracardiac injection of SDF-1 resulted in further reductions in cardiomyocyte apoptosis of 65% and 76%, respectively, at two weeks (both p ⁇ 0.001) (results are expressed as mean+sem of three separate experiments).
  • FIGS. 4 A- 4 H Infarct Bed Vasculogenesis Improves Long-Term Myocardial Function Through Mechanisms Involving Both Cardiomyocyte Protection and Proliferation/Regeneration.
  • (A) and (B) show the relationship between the number of human CD117 bright endothelial progenitor cells (angioblasts) injected intravenously (10 3 , 10 5 , 10 5 plus anti-CXCR4 mAb, and 2 ⁇ 10 5 ) and improvement in myocardial function at 15 weeks, defined as mean improvement in left ventricular ejection fraction (LVEF) (A) and mean reduction in left ventricular area at end-systole (LVAs)
  • Bar graph shows that the group of animals receiving 2 ⁇ 10 5 human endothelial progenitor cells has a significantly higher index of cell cycling cardiomyocytes at the peri-infarct region than saline controls or sham operated animals (both p ⁇ 0.01). No difference between the groups is seen at sites distal to the infarct.
  • (E) shows that the index of cell-cycling cardiomyocytes at the peri-infarct rim was increased by a further 1.9-fold when 2 ⁇ 10 5 human endothelial progenitor cells were intravenously co-administered together with SDF-1 injected directly into the ischemic myocardium alone (p ⁇ 0.01), or an 8-fold cumulative increase in cell-cycling cardiomyocytes at two weeks compared with LAD-ligated controls receiving saline (results are expressed as mean+sem of three separate experiments).
  • (F) shows that intravenous co-administration of anti-CXCR4 mAb, or intracardiac co-administration of SDF-1, but not IL-8, results in 2.8 to 4-fold greater LVEF improvement, determined by echocardiography, compared with intravenous injection of 2 ⁇ 10 5 endothelial progenitor cells alone (p ⁇ 0.01) (results are expressed as mean+sem of three separate experiments).
  • (G) shows that at 15 weeks the mean proportion of scar/normal left ventricular myocardium in rats receiving either or 10 5 endothelial progenitor cells together with anti-CXCR4 mAb was significantly reduced in comparison to rats receiving either 10 3 or 10 5 endothelial progenitor cells (angioblasts) alone, or saline (p ⁇ 0.01).
  • the group receiving 2.0 ⁇ 10 5 endothelial progenitor cells demonstrated still 38% greater reduction in the ratio of scar/muscle tissue (results are expressed as mean+sem of three separate experiments).
  • FIG. 1 Sections of rat hearts stained with Masson's trichrome at 15 weeks after LAD ligation and injection of 2.0 ⁇ 10 6 G-CSF mobilized human cells containing 10 3 (left) or 2.0 ⁇ 10 5 (right) CD117 bright endothelial progenitor cells.
  • Hearts of rats receiving 10 3 endothelial progenitor cells had greater loss of anterior wall mass, collagen deposition (lighter gray), and septal hypertrophy compared with hearts of rats receiving 2.0 ⁇ 10 5 endothelial progenitor cells.
  • FIG. 5 This figure shows mRNA expression of three genes in the ischemic rat hearts at various time points. You will see that at 48 hours and 2 weeks after LAD ligation and ischemia, HBP23 (the rat homologue of human PAG/NKEF-A,B,C, all of which are part of the family of peroxiredoxins (Prx)) is decreased, and vitamin D3 upregulated protein VDUP-1 is increased. The early (48 hour) reduction in PRX and increase in VDUP-1 results in a compensatory increase in thiol reductase thioredoxin (TRX). Note that endothelial progenitor cell therapy reverses this pattern of mRNA expression.
  • HBP23 the rat homologue of human PAG/NKEF-A,B,C, all of which are part of the family of peroxiredoxins (Prx)
  • Prx peroxiredoxins
  • FIG. 6 DNA sequence (SEQ ID NO:1) corresponding to mRNA encoding VDUP-1.
  • FIG. 7 This figure shows catalytic DNA 5′-AT-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the coding region of VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 8 This figure shows catalytic DNA 5′-GC-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 9 This figure shows catalytic DNA 5′-GT-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 10 This figure shows catalytic DNA 5′-AC-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 11 This figure shows sites which can be cleaved by a hammerhead ribozyme in VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA coding region.
  • Uppercase “T” represents cleavage site.
  • VEGF vascular endothelial growth factor
  • VEGF-R vascular endothelial growth factor receptor
  • FGF fibroblast growth factor
  • IGF Insulin-like growth factor
  • SCF stem cell factor
  • G-CSF granulocyte colony stimulating factor
  • M-CSF macrophage colony stimulating factor
  • GM-CSF granulocyte-macrophage colony stimulating factor
  • MCP monocyte chemoattractant protein.
  • angioblasts is synonymous with the term “endothelial progenitor cells”.
  • CXC chemokine refers to the structure of the chemokine. Each “C” represents a cysteine and “X” represents any amino acid. “CXCR4” refers to CXC receptor 4.
  • CC chemokine refers to the structure of the chemokine.
  • Each “C” represents a cysteine.
  • Catalytic shall mean the functioning of an agent as a catalyst, i.e. an agent that increases the rate of a chemical reaction without itself undergoing a permanent structural change.
  • Nucleic acid shall include without limitation any nucleic acid, including, without limitation, DNA, RNA, oligonucleotides, or polynucleotides, and analogs or derivatives thereof.
  • the nucleotides that form the nucleic acid may be nucleotide analogs or derivatives thereof.
  • the nucleic acid may incorporate non nucleotides.
  • nucleotides shall include without limitation nucleotides and analogs or derivatives thereof.
  • nucleotides may comprise the bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art, and are exemplified in PCR Systems, Reagents and Consumables (Perkin Elmer Catalogue 1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J., U.S.A.).
  • “Proliferation” and “regeneration” are used synonymously when referring to cardiomyocytes in this application. “Proliferation” in respect to cardiomyocytes, shall mean a fold increase in proportion of cardiomyocytes entering the cell cycle relative to untreated rat heart.
  • Trafficking means the blood-borne migration of cells, in particular angioblast/endothelial progenitor cells.
  • This invention provides a method of treating a disorder of a subject's heart involving loss of cardiomyocytes which comprises administering to the subject an amount of an agent effective to cause cardiomyocyte proliferation within the subject's heart so as to thereby treat the disorder.
  • the agent is human endothelial progenitor cells.
  • the endothelial progenitor cells are bone marrow-derived. In another they are derived from cord blood, or embryonic or fetal sources. Effective amounts of endothelial progenitor cells sufficient to cause cardiomyocyte proliferation can be done based on animal data using routine computational methods. In one embodiment the effective amount is about 1.5 ⁇ 10 5 endothelial progenitor cells per kg body mass to about 3 ⁇ 10 5 per kg body mass. In another embodiment the effective amount is about 3 ⁇ 10 5 per kg body mass to about 4.5 ⁇ 10 5 endothelial progenitor cells per kg body mass.
  • the effective amount is about 4.5 ⁇ 10 5 per kg body mass to about 5.5 ⁇ 10 5 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 5.5 ⁇ 10 5 per kg body mass to about 7 ⁇ 10 5 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 7 ⁇ 10 5 per kg body mass to about 1 ⁇ 10 6 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 1 ⁇ 10 6 per kg body mass to about 1.5 ⁇ 10 6 endothelial progenitor cells per kg body mass.
  • the effective amount of human endothelial progenitor cells is between about 1.5 ⁇ 10 6 and 4.5 ⁇ 10 6 endothelial progenitor cells per kg of the subject's body mass and In a preferred embodiment the effective amount is about 5 ⁇ 10 5 endothelial progenitor cells per kg of the subject's body mass.
  • the endothelial progenitor cells are allogeneic with respect to the subject.
  • the subject is an adult or an embryo or a fetus.
  • the endothelial progenitor cells are derived from cloned autologous embryonic stem cells.
  • the agent induces expression of a mRNA encoding a peroxiredoxin.
  • the expression of peroxiredoxin mRNA may be increased, for example, by administration of 2(3)-t-butyl-4-hydroxyanisole (BHA) (see 106) which has been shown to increase expression of Peroxiredoxin-1 when administered by diet.
  • BHA 2(3)-t-butyl-4-hydroxyanisole
  • Peroxiredoxin mRNA expression such as that of thiol peroxidases, may also be induced by heme, cadmium or cobalt (see 108).
  • Peroxiredoxins include, but are not limited to, PAG, HBP23, MSP23, NKEF.
  • the agent induces expression of a mRNA encoding NF-E2-related factor 2 (Nrf2).
  • Cytomplasmic NF-E2-related factor 2 (Nrf2) expression can be indirectly increased by raising free Nrf2 levels. Since Nrf2 is tightly bound to keap1 in the cytoplasm then reducing expression of keap1 mRNA is a suitable target e.g. by keap1 antisense oligonucleotides or catalytic nucleic acids (see 109 for keap1). Also, blocking the interaction between Nrf2 and Keap1 by inhibiting the interaction of the Neh2 domain of Nrf2 and the DGR domain of keap1, e.g.
  • the agent induces dissociation of a Nrf2 protein from a Keap-1.
  • the agent inhibits association of a Nrf2 protein with a Keap-1.
  • the agent inhibits association of a thiol reductase thioredoxin with a VDUP-1 protein.
  • the agent inhibits c-Abl tyrosine kinase activation.
  • the agent is STI-571.
  • the agent is a CXC chemokine.
  • the agent is Stromal-Derived Factor-1, Il-8 or Gro-Alpha.
  • the amount of CXC chemokine administered is between 0.2 and 5 ⁇ g/ml at a max volume of 10 ml for a 70 kg human subject. In a preferred embodiment the amount is about 1 ⁇ g/ml.
  • the agent is an inhibitor of plasminogen activator inhibitor-1.
  • the agent is an antibody directed against an epitope of CXCR4.
  • the amount of antibody directed against an epitope of CXCR4 is between 25 and 75 ⁇ g/ml, at a max volume of 10 ml for a 70 kg human subject. A simple calculation is performed for subjects of different mass. In a preferred embodiment the amount is about 5 ⁇ g/ml.
  • the instant method further comprises administering an effective amount of a second agent that increases the cardiomyocyte proliferation caused by the human endothelial progenitor cells.
  • Effective amounts of the second agent are amounts sufficient to enhance or accelerate cardiomyocyte proliferation in the presence of administered endothelial progenitor cells.
  • the endothelial progenitor cells express CD117, CD34, AC133 or a high level of intracellular GATA-2 activity.
  • the administering comprises injecting directly into the subject's peripheral circulation, heart muscle, left ventricle, right ventricle, coronary artery, cerebro-spinal fluid, neural tissue, ischemic tissue, or post-ischemic tissue.
  • the second agent is an antisense oligonucleotide which specifically inhibits translation of Vitamin D3 Up-Regulated Protein-1 (VDUP-1) mRNA.
  • VDUP-1 Vitamin D3 Up-Regulated Protein-1
  • VDUP-1 protein (SEQ ID NO:2) expression
  • Antisense oligonucleotides are small fragments of DNA and derivatives thereof complementary to a defined sequence on a specified mRNA.
  • a VDUP-1 antisense oligonucleotide specifically binds to targets on the VDUP-1 mRNA (SEQ ID NO:1) molecule and in doing so inhibits the translation thereof into VDUP-1 protein (SEQ ID NO:2).
  • Antisense oligonucleotide molecules synthesized with a phosphorothioate backbone have proven particularly resistant to exonuclease damage compared to standard deoxyribonucleic acids, and so they are used in preference.
  • a phosphorothioate antisense oligonucleotide for VDUP-1 mRNA can be synthesized on an Applied Biosystems (Foster City, Calif.) model 380B DNA synthesizer by standard methods. E.g. Sulfurization can be performed using tetraethylthiuram disulfide/acetonitrile.
  • oligodeoxynucleotides can be base deblocked in ammonium hydroxide at 60° C. for 8 h and purified by reversed-phase HPLC [0.1M triethylammonium bicarbonate/acetonitrile; PRP-1 support]. Oligomers can be detritylated in 3% acetic acid and precipitated with 2% lithiumperchlorate/acetone, dissolved in sterile water and reprecipitated as the sodium salt from 1 M NaCl/ethanol. Concentrations of the full length species can be determined by UV spectroscopy.
  • Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • Hybridization of antisense oligonucleotides with VDUP-1 mRNA interferes with one or more of the normal functions of VDUP-1 1 mRNA.
  • the functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage.
  • oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof) are included.
  • Various salts, mixed salts and free acid forms are also included.
  • messenger RNA includes not only the information to encode a protein using the three letter genetic code, but also associated ribonucleotides which form a region known to such persons as the 5′-untranslated region, the 3′-untranslated region, the 5′ cap region and intron/exon junction ribonucleotides.
  • antisense oligonucleotides or the catalytic nucleic acids described below may be formulated in accordance with this invention which are targeted wholly or in part to these associated ribonucleotides as well as to the informational ribonucleotides.
  • the antisense oligonucleotides may therefore be specifically hybridizable with a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region.
  • the catalytic nucleic acids may specifically cleave a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region.
  • the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule).
  • 5′-AUG in transcribed mRNA molecules
  • 5′-ATG in the corresponding DNA molecule
  • a minority of genes have a translation initiation codon having the RNA sequence 5′-GUG, 5′UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo.
  • the term “translation initiation codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes.
  • translation initiation codon refers to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding VDUP-1, regardless of the sequence(s) of such codons.
  • a translation termination codon of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively).
  • the term “translation initiation codon region” refers to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. This region is one preferred target region.
  • translation termination codon region refers to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. This region is also one preferred target region.
  • Other preferred target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene.
  • 5′UTR 5′ untranslated region
  • 3′UTR 3′ untranslated region
  • mRNA splice sites may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions may also be preferred targets.
  • antisense oligonucleotides can be chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired disruption of the function of the molecule.
  • “Hybridization”, in the context of this invention means hydrogen bonding, also known as Watson-Crick base pairing, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them.
  • Specifically hybridizable and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the catalytic nucleic acids.
  • catalytic nucleic acids are synthesized once cleavage target sites on the VDUP-1 mRNA molecule.
  • antisense oligonucleotides or catalytic nucleic acids or analogs thereof it is preferred to administer antisense oligonucleotides or catalytic nucleic acids or analogs thereof to mammals suffering from cardiovascular disease, in either native form or suspended in a carrier medium in amounts and upon treatment schedules which are effective to therapeutically treat the mammals to reduce the detrimental effects of cardiovascular disease.
  • One or more different catalytic nucleic acids or antisense oligonucleotides or analogs thereof targeting different sections of the nucleic acid sequence of VDUP-1 mRNA may be administered together in a single dose or in different doses and at different amounts and times depending upon the desired therapy.
  • the catalytic nucleic acids or antisense oligonucleotides can be administered to mammals in a manner capable of getting the oligonucleotides initially into the blood stream and subsequently into cells, or alternatively in a manner so as to directly introduce the catalytic nucleic acids or antisense oligonucleotides into the cells or groups of cells, for example cardiomyocytes, by such means by electroporation or by direct injection into the heart.
  • Antisense oligonucleotides whose presence in cells can inhibit transcription or protein synthesis can be administered by intravenous injection, intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, orally or rectally.
  • Doses of the oligonucleotides or analogs thereof of the present invention in a pharmaceutical dosage unit will be an efficacious, nontoxic quantity administered to a human patient in need of cardiomyocyte regeneration (or inhibition of VDUP-1 expression) from 1-6 or more times daily or every other day. Dosage is dependent on severity and responsiveness of the effects of abnormal cardiovascular disease to be treated, with course of treatment lasting from several days to months or until a cure is effected or a reduction of the effects is achieved. Oral dosage units for human administration generally use lower doses. The actual dosage administered may take into account the size and weight of the patient, whether the nature of the treatment is prophylactic or therapeutic in nature, the age, weight, health and sex of the patient, the route of administration, and other factors.
  • the second agent is a pro-angiogenic agent.
  • the pro-angiogenic agent is vascular endothelial growth factor, fibroblast growth factor or angiopoietin.
  • the second agent induces expression of a pro-angiogenic factor.
  • the second agent is Hypoxia Inducible Factor-1.
  • the second agent is a catalytic nucleic acid which specifically inhibits translation of Vitamin D3 Up-Regulated Protein-1 mRNA.
  • the catalytic nucleic acid comprises deoxyribonucleotides.
  • the catalytic nucleic acid comprises ribonucleotides.
  • Catalytic nucleic acid molecules can cleave Vitamin D3 Up-Regulated Protein-1 (VDUP-1) mRNA (corresponding DNA shown in SEQ ID NO:1, FIG. 5) at each and any of the consensus sequences therein. Since catalytic ribo- and deoxyribo-nucleic acid consensus sequences are known, and the VDUP-1 Protein mRNA sequence is known, one of ordinary skill could readily construct a catalytic ribo- or deoxyribo nucleic acid molecule directed to any of the VDUP-1 protein mRNA consensus sequences based on the instant specification. In preferred embodiments of this invention the catalytic deoxyribonucleic acids include the 10-23 structure.
  • catalytic ribonucleic acids examples include hairpin and hammerhead ribozymes.
  • the catalytic ribonucleic acid molecule is formed in a hammerhead (50) or hairpin motif (51,52,53), but may also be formed in the motif of a hepatitis delta virus (54), group I intron (60), RNaseP RNA (in association with an RNA guide sequence) (55,56) or Neurospora VS RNA (57,58,59).
  • catalytic nucleic acids can be designed based on the consensus cleavage sites 5′-purine:pyrimidine-3′ in the VDUP-1 mRNA sequence (104) (see FIGS. 6 - 10 ) for cleavage sites on DNA corresponding to the mRNA encoding VDUP-1 (SEQ ID NO:2). Those potential cleavage sites located on an open loop of the mRNA according to RNA folding software e.g. RNADRaw 2.1 are particularly preferred as targets (61).
  • the DNA based catalytic nucleic acids can utilize the structure where two sequence-specific arms are attached to a catalytic core based on the VDUP-1 mRNA sequence.
  • catalytic DNA structure is detailed in (62) and (63).
  • Commercially available mouse brain polyA-RNA (Ambion) can serve as a template in the in vitro cleavage reaction to test the efficiency of the catalytic deoxyribonucleic acids.
  • Catalytic RNA is described above, is designed similarly.
  • Hammerhead ribozymes can cleave any 5′-NUH-3′ triplets of a mRNA, where U is conserved and N is any nucleotide and H can be C,U,A, but not G.
  • the sites which can be cleaved by a hammerhead ribozyme in human VDUP-1 mRNA coding region are shown in FIG. 10.
  • Cleaving of VDUP-1 mRNA with catalytic nucleic acids interferes with one or more of the normal functions of VDUP-1 mRNA.
  • the functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA.
  • the nucleotides may comprise other bases such as inosine, deoxyinosine, hypoxanthine may be used.
  • isoteric purine 2′deoxy-furanoside analogs, 2′-deoxynebularine or 2′deoxyxanthosine, or other purine or pyrimidine analogs may also be used.
  • inosine may be used to reduce hybridization specificity
  • diaminopurines may be used to increase hybridization specificity.
  • Adenine and guanine may be modified at positions N3, N7, N9, C2, C4, C5, C6, or C8 and still maintain their hydrogen bonding abilities.
  • Cytosine, thymine and uracil may be modified at positions N1, C2, C4, C5, or C6 and still maintain their hydrogen bonding abilities.
  • Some base analogs have different hydrogen bonding attributes than the naturally occurring bases. For example, 2-amino-2′-dA forms three (3), instead of the usual two (2), hydrogen bonds to thymine (T).
  • Examples of base analogs that have been shown to increase duplex stability include, but are not limited to, 5-fluoro-2′-dU, 5-bromo-2′-dU, 5-methyl-2′-dC, 5-propynyl-2′-dC, 5-propynyl-2′-dU, 2-amino-2′-dA, 7-deazaguanosine, 7-deazadenosine, and N2-Imidazoylpropyl-2′-dG.
  • Nucleotide analogs may be created by modifying and/or replacing a sugar moiety.
  • the sugar moieties of the nucleotides may also be modified by the addition of one or more substituents.
  • one or more of the sugar moieties may contain one or more of the following substituents: amino, alkylamino, araalkyl, heteroalkyl, heterocycloalkyl, aminoalkylamino, O, H, an alkyl, polyalkylamino, substituted silyl, F, Cl, Br, CN, CF 3 , OCF 3 , OCN, O-alkyl, S-alkyl, SOMe, SO 2 Me, ONO 2 , NH-alkyl, OCH 2 CH ⁇ CH 2 , OCH 2 CCH, OCCHO, allyl, O-allyl, NO 2 , N 3 , and NH 2 .
  • the 2′ position of the sugar may be modified to contain one of the following groups: H, OH, OCN, O-alkyl, F, CN, CF 3 , allyl, O-allyl, OCF 3 , S-alkyl, SOMe, SO 2 Me, ONO 2 , NO 2 , N 3 , NH 2 , NH-alkyl, or OCH ⁇ CH 2 , OCCH, wherein the alkyl may be straight, branched, saturated, or unsaturated.
  • the nucleotide may have one or more of its sugars modified and/or replaced so as to be a ribose or hexose (i.e. glucose, galactose) or have one or more anomeric sugars.
  • the nucleotide may also have one or more L-sugars.
  • the sugar may be modified to contain one or more linkers for attachment to other chemicals such as fluorescent labels.
  • the sugar is linked to one or more aminoalkyloxy linkers.
  • the sugar contains one or more alkylamino linkers. Aminoalkyloxy and alkylamino linkers may be attached to biotin, cholic acid, fluorescein, or other chemical moieties through their amino group.
  • Nucleotide analogs or derivatives may have pendant groups attached.
  • Pendant groups serve a variety of purposes which include, but are not limited to, increasing cellular uptake of the oligonucleotide, enhancing degradation of the target nucleic acid, and increasing hybridization affinity.
  • Pendant groups can be linked to any portion of the oligonucleotide but are commonly linked to the end(s) of the oligonucleotide chain. Examples of pendant groups include, but are not limited to: acridine derivatives (i.e.
  • cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II), o-phenanthroline-Cu(I), and porphyrin-Fe(II); alkylating moieties; nucleases such as amino-1-hexanolstaphylococcal nuclease and alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; amino; mercapto groups; radioactive markers; nonradioactive markers such as dyes; and polylysine or other polyamines.
  • cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin
  • artificial endonucleases such as EDTA-Fe(II), o
  • the nucleic acid comprises an oligonucleotide conjugated to a carbohydrate, sulfated carbohydrate, or gylcan.
  • Conjugates may be regarded as a way as to introduce a specificity into otherwise unspecific DNA binding molecules by covalently linking them to a selectively hybridizing oligonucleotide.
  • the catalytic nucleic acid binding domains i.e. the non-catalytic domains
  • antisense oligonucleotide may comprise modified bonds.
  • internucleosides bonds of the oligonucleotide may comprise phosphorothioate linkages.
  • the nucleic acid may comprise nucleotides having moiety may be modified by replacing one or both of the two bridging oxygen atoms of the linkage with analogues such as —NH, —CH 2 , or —S. Other oxygen analogues known in the art may also be used.
  • the phosphorothioate bonds may be stereo regular or stereo random.
  • the oligonucleotide moiety may have one or more of its sugars modified or replaced so as to be ribose, glucose, sucrose, or galactose, or any other sugar.
  • the phosphorothioate oligonucleotide may have one or more of its sugars substituted or modified in its 2′ position, i.e. 2′allyl or 2′-O-allyl.
  • An example of a 2′-O-allyl sugar is a 2′-O-methylribonucleotide.
  • the phosphorothioate oligonucleotide may have one or more of its sugars substituted or modified to form an ⁇ -anomeric sugar.
  • a catalytic nucleic acid may include non-nucleotide substitution.
  • the non-nucleotide substitution includes either abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid or polyhydrocarbon compounds.
  • abasic or “abasic nucleotide” as used herein encompasses sugar moieties lacking a base or having other chemical groups in place of base at the 1′ position.
  • Determining the effective amount of the instant nucleic acid molecules can be done based on animal data using routine computational methods.
  • the effective amount contains between about 10 ng and about 100 ⁇ g of the instant nucleic acid molecules per kg body mass. In another embodiment, the effective amount contains between about 100 ng and about 10 ⁇ g of the nucleic acid molecules per kg body mass. In a further embodiment, the effective amount contains between about 1 ⁇ g and about 5 ⁇ g, and in a further embodiment about 2 ⁇ g, of the nucleic acid molecules per kg body mass.
  • the second agent is cardiomyocyte progenitor cells.
  • the second agent is skeletal muscle progenitor cells. Either of theses cell types can be derived from embryonic, fetal or adult subjects.
  • the second agent promotes trafficking of the endothelial progenitor cells to the subject's heart.
  • the second agent that promotes trafficking is an antibody directed against an epitope of CXCR4.
  • the second agent that promotes trafficking is a CC chemokine.
  • the CC chemokine is RANTES, EOTAXIN, monocyte chemoattractant protein-1 (MCP-1), MCP-2, MCP-3, or MCP.
  • the second agent that promotes trafficking is a CXC chemokine.
  • the CXC chemokine is Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1.
  • This invention also provides a method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising:
  • This invention also provides a method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising:
  • a ratio that is at least two standard deviations above that found in control patients with normal hearts is considered a high ratio.
  • Quantitation of expression of protein in cardiomyocytes is performed using routine methods known to those of skill in the art, for example, northern and western blots.
  • the subject of any of the above methods is a mammal and in a preferred further embodiment the mammal is a human being.
  • the subject has a cardiovascular disease.
  • the subject has congestive heart failure, has suffered a myocardial infarct, has suffered myocardial ischemia, has angina, or has a cardiomyopathy.
  • LAD coronary artery ligation resulted in trafficking of intravenously injected human endothelial progenitor cells to the site of ischemic myocardium, it was also accompanied by increased distribution of human cells to rat bone marrow.
  • FIG. 2 a at 2-14 days after intravenous injection of 2 ⁇ 10 6 human CD34+ cells bone marrow from LAD-ligated rats contained 5-8 fold higher levels of human CD117 bright endothelial progenitor cells compared with bone marrow from normal rats, p ⁇ 0.001.
  • co-administration of mAbs against either human CXCR4 or rat SDF-1 significantly inhibited migration of intravenously administered human endothelial progenitor cells to ischemic rat bone marrow compared with anti-CD34 control antibody (both p ⁇ 0.001).
  • co-administration of mAbs against either human CXCR4 or rat SDF-1 increased trafficking of CD34+ human endothelial progenitor cells to ischemic rat myocardium by means of 24% and 17%, respectively (both p ⁇ 0.001), FIG. 2 c.
  • Induction of neovascularization at two weeks was measured by performing quantitative analysis of medium- and large-sized capillaries, defined, respectively, as having 3-6 or >6 contiguous endothelial lining cells.
  • Medium-sized capillaries had mean lumen diameter of 0.020 mm+0.002, while large-sized capillaries had mean lumen diameter of 0.053 mm+0.004 (p ⁇ 0.001).
  • large-lumen capillaries overlapped in size with arterioles which could be distinguished by a thin layer containing 2-3 smooth muscle cells of rat origin, as determined by positive staining with desmin and rat MHC class I mAbs. As shown in FIGS.
  • both the group receiving 2 ⁇ 10 5 endothelial progenitor cells and the one receiving 10 5 endothelial progenitor cells plus anti-CXCR4 mAb demonstrated 1.7-fold higher numbers of medium-sized capillaries compared with the other two groups (p ⁇ 0.01).
  • the group receiving 2 ⁇ 10 5 endothelial progenitor cells additionally demonstrated 3.3-fold higher numbers of large-lumen capillaries compared with the groups receiving 10 3 or 10 5 endothelial progenitor cells (p ⁇ 0.01), and 2-fold higher numbers of large-lumen capillaries compared with the group receiving 10 5 endothelial progenitor cells plus anti-CXCR4 mAb (p ⁇ 0.01).
  • FIG. 1 As shown in FIG.
  • FIG. 3 e the number of apoptotic cardiomyocytes at the infarct rim was significantly reduced in both rats receiving 10 5 endothelial progenitor cells plus anti-CXCR4 mAb and those receiving 2 ⁇ 10 5 endothelial progenitor cells compared with the groups receiving either 10 3 or 10 5 endothelial progenitor cells alone (both p ⁇ 0.001).
  • co-administration of anti-CXCR4 mAb or intracardiac injection of SDF-1 resulted in further reductions in cardiomyocyte apoptosis of 65% and 76%, respectively, FIG. 3 f (both p ⁇ 0.001).
  • FIGS. 4 a and b We next examined the effect of increasing the number of human endothelial progenitor cells trafficking to ischemic myocardium on long-term myocardial function, defined as the degree of improvement in left ventricular ejection fraction (LVEF) and reduction in left ventricular end-systolic area (LVAs) at 15 weeks after intravenous injection, FIGS. 4 a and b . No improvement in these parameters was observed in the groups receiving 10 3 or 10 5 endothelial progenitor cells in comparison to rats receiving saline alone.
  • LVEF left ventricular ejection fraction
  • LVAs left ventricular end-systolic area
  • rats receiving 10 5 endothelial progenitor cells plus anti-CXCR4 mAb demonstrated significant improvement in these parameters, 22+2% mean recovery in LVEF and 24+4% mean reduction in LVAs (both p ⁇ 0.001). Even more strikingly, the group receiving 2 ⁇ 10 5 endothelial progenitor cells had a mean recovery in LVEF of 34+4% and a mean reduction in LVAs of 37+6% (both p ⁇ 0.001), or 50% further improvement in both parameters.
  • the number of cardiomyocytes progressing through cell cycle at the peri-infarct region of rats receiving 2 ⁇ 10 5 human endothelial progenitor cells was 40-fold higher than that at sites distal to the infarct, where myocyte DNA activity was no different than in sham-operated rats. As shown in FIG.
  • animals receiving 2 ⁇ 10 5 human endothelial progenitor cells had a 20-fold higher number of cell-cycling cardiomyocytes at the peri-infarct rim than that found in non-infarcted hearts (1.19+0.2% vs 0.06+0.03%, p ⁇ 0.01) and 3.5-fold higher than in the same region in LAD-ligated controls receiving saline (1.19+0.2% vs 0.344+0.1%, p ⁇ 0.01).
  • intracardiac injection of SDF-1 in combination with intravenous injection of 2 ⁇ 10 5 human endothelial progenitor cells resulted in approximately an 8-fold cumulative increase in cell-cycling cardiomyocytes at two weeks compared with LAD-ligated controls receiving saline, and translated into over 4-fold greater LVEF improvement, determined by echocardiography, compared with intravenous injection of 2 ⁇ 10 5 endothelial progenitor cells alone (FIG. 4 f , p ⁇ 0.01).
  • Co-administration of anti-CXCR4 mAb augmented LVEF improvement by 2.8-fold (p ⁇ 0.01) while intracardiac injection of IL-8 conferred no additive benefit.
  • FIG. 4 h The overall effects of medium- and large-size neovasculature combining to both protect against myocyte apoptosis and induce myocyte proliferation/regeneration are shown dramatically in FIG. 4 h where, in contrast to saline controls, injection with 2 ⁇ 10 5 endothelial progenitor cells resulted in almost complete salvage of the anterior myocardium, normal septal size and minimal collagen deposition.
  • E2 catalytic nucleic acid
  • Vitamin D3 Up-Regulated Proteinl VDUP1
  • H 2 O 2 hydrogen peroxide
  • the cell cycle inhibitory activity of p21Cip1/WAF1 is intimately correlated with its nuclear localization and participation in quaternary complexes of cell cycle regulators by binding to G1 cyclin-CDK through its N-terminal domain and to proliferating cell nuclear antigen (PCNA) through its C-terminal domain (68-71).
  • PCNA cell nuclear antigen
  • the latter interaction blocks the ability of PCNA to activate DNA polymerase, the principal replicative DNA polymerase (72).
  • For a growth-arrested cell to subsequently enter an apoptotic pathway requires signals provided by specific apoptotic stimuli in concert with cell-cycle regulators.
  • caspase-mediated cleavage of p21 together with upregulation of cyclin A-associated cdk2 activity, have been shown to be critical steps for induction of cellular apoptosis by either deprivation of growth factors (73) or hypoxia of cardiomyocytes (74).
  • the apoptosis signal-regulating kinase 1 (ASK1) is a pivotal component in the mechanism of cytokine- and stress-induced apoptosis (75,76). Under basal conditions, resistance to ASK1-mediated apoptosis appears to be the result of complex formation between ASK1, cytoplasmic p21Cip1/WAF1 (77), and the thiol reductase thioredoxin (TRX) (78). Intact cytoplasmic expression of p21Cip1/WAF1 appears to be important for both prevention of apoptosis in response to ASK1 (75) and in maintaining a state of terminal differentiation (77).
  • the reduced form of TRX binds to the N-terminal portion of ASK1 and is a physiologic inhibitor of ASK1-mediated cellular apoptosis (78).
  • the recently-identified protein VDUP1 has been shown to compete with ASK1 for binding of the reduced form of TRX (78,79), resulting in augmention of ASK1-mediated apoptosis (80). This indicates that ASK1-mediated cellular apoptosis is increased by processes that result in a net dissociation of TRX from ASK1, such as either generation of TRX-VDUP1 complexes or generation of oxidised TRX by changes in cellular redox status accompanying oxidative stress.
  • TRX and glutathione constitute the major cellular reducing systems that maintain the thiol-disulfide status of the cytosol (81).
  • the redox-active/dithiol active site of TRX is highly conserved across all species, Trp-Cys-Gly-Pro-Cys-Lys.
  • the two cysteine residues at the active site, Cys-32 and Cys-35 undergo reversible oxidation-reduction reactions catalyzed by a NADPH-dependent enzyme TRX reductase. These reactions involve electron transfer via disulfide bridges formed with members of a family of antioxidant enzymes known as peroxiredoxins (Prxs), which show peroxidase activity (82,83).
  • Prxs peroxiredoxins
  • Prxs are distinct from other peroxidases in that they have no cofactors, such as metals or prosthetic groups. Prxs generally have two conserved cysteines at the N- and C-terminal regions (84), and their antioxidant effects are coupled with the physiological electron donor activity of the TRX system (82,85,86). Prxs with 95-97% sequence homology have been identified in rats (Heme-binding protein 23, HBP23) (87), mice (mouse macrophage stress protein 23, MSP23) (88) and humans (proliferation-associated gene product, PAG (89) and human natural killer cell-enhancing factor A (90)).
  • Prxs are members of a repertoire of oxidative stress responsive genes whose expression is regulated by NF-E2-related factor 2 (Nrf2) which binds to an anti-oxidant responsive element (ARE) present in the promoter of each (91). These include glutathione-S-transferase, heme oxygenase-1, and TRX. Under basal conditions, Nrf2 is bound to a specific protein, Keap1, in the cytosol (92). However, under conditions of oxidative stress Nrf2 dissociates from Keap1 and translocates to the nucleus where it induces transcriptional activation of the anti-oxidant genes containing ARE motifs.
  • Nrf2 NF-E2-related factor 2
  • ARE anti-oxidant responsive element
  • Nrf2 nuclear translocation of Nrf2 and subsequent ARE activation appear to be dependent on pathways activated by phosphatidylinositol 3-kinase (PI3 kinase) (93).
  • PI3 kinase phosphatidylinositol 3-kinase
  • hemin is a potent inducer of Nrf2 dissociation from Keap1, resulting in TRX gene transcription through the ARE (94).
  • Prxs During periods of rapid changes in cellular redox Prxs presumably serve to maintain the cytosolic levels of reduced TRX by accepting electrons from the oxidized form of TRX. This homeostatic mechanism likely enables maintenance of sufficient levels of reduced TRX to ensure adequate binding to ASK1 and prevention of cellular apoptosis. If the endogenous Prx system is overloaded, as might occur during changes in cellular redox when excess oxidized TRX is generated, cellular apoptosis will occur through the unopposed effects of ASK1. To counteract this, transcriptional activation of Prxs must occur following oxidative stress via nuclear translocation of Nrf2. This can be achieved either by Nrf2 dissociation from Keap1 via hemin- and PI3 kinase-dependent mechanisms (93,94), or by increasing Nrf2 mRNA and protein expression as occurs following increase in oxygen tension (95,96).
  • the Prx gene products specifically bind the SH3 domain of c-Abl, a non-receptor tyrosine kinase, inhibiting its activation by various stimuli, including agents that damage DNA (97).
  • c-Abl activation through the SH3 domain induces either arrest of the cell cycle in phase G1 or cellular apoptosis (98).
  • Cell cycle arrest is dependent on the kinase activity of c-Abl (96) and is mediated by the ability of c-Abl to downregulate the activity of the cyclin-dependent kinase Cdk2 and induce the expression of p21 (99).
  • c-Abl The apoptotic effects of c-Abl are dependent on the ability of nuclear c-Abl to phosphorylate p73, a member of the p53 family of tumor-suppressor proteins which can induce apoptosis (100,101). Recently, it has been shown that cytoplasmic, rather than nuclear, forms of c-Abl are activated by H 2 O 2 and that this results in mitochondrial localization of c-Abl, c-Abl dependent cytochrome c release, and cellular apoptosis following oxidative stress (102,103).
  • the PAG gene product By associating with c-Abl in vivo, the PAG gene product (and presumably the other Prxs) can inhibit tyrosine phosphorylation induced by c-Abl overexpression and rescue cells from both the cytostatic and pro-apoptotic effects of the activated c-Abl gene product (97).
  • Nrf2-dependent oxidative stress responsive genes are downregulated following myocardial ischemia likely reflects direct effects of hemin and oxygen deprivation.
  • the end result of Prx downregulation in the ischemic heart would be augmentation in ASK1-dependent cellular apoptosis as well as Abl-dependent apoptosis and cell cycle arrest.
  • the observed parallel increase in VDUP1 expression would further augment ASK1-dependent cellular apoptosis.
  • the ratio in expression of PAG or other Prx mRNA or protein to VDUP1 mRNA or protein can form the basis of a diagnostic assay to predict the degree of risk for cardiomyocyte apoptosis and cell cycle arrest after ischemia, as well as enable monitoring of the response to specific therapy after myocardial ischemia that protects cardiomyocytes against apototic death and enhances myocardial proliferation/regeneration.
  • Nrf2 mRNA or causing dissociation of Nrf2 protein from Keap1, or preferably cause both to occur simultaneously in the setting of myocardial ischemia in order to increase transcription and activity of members of a repertoire of oxidative stress responsive genes whose expression is regulated by binding of Nrf2 to an anti-oxidant responsive element (ARE) in their promoters, including the Prxs, TRX and glutathione-S-transferase would result in both protection of cardiomyocytes against apoptosis as well as induce cardiomyocyte cell cycle progression following oxidative stress.
  • ARE anti-oxidant responsive element
  • VDUP1 Reducing the expression of VDUP1 following myocardial ischemia would protect the ischemic myocardium against apoptosis by reducing binding of TRX to VDUP1, and consequently increasing TRX-ASK1 interactions.
  • Neovascularization of the myocardium by either bone marrow-derived endothelial progenitors or any other process, is an example of one method which causes induction of Prx expression and reduction in VDUP1 expression after myocardial ischemia, and results in both protection against redox-mediated apoptosis and induction of myocardial proliferation/regeneration.
  • Single-donor leukopheresis products were obtained from humans treated with recombinant G-CSF 10 mg/kg (Amgen, CA) sc daily for four days. Donors were healthy individuals undergoing standard institutional procedures of bone marrow mobilization, harvesting and isolation for allogeneic stem cell transplants. Mononuclear cells were separated by Ficoll-Hypaque, and highly-purified CD34+ cells (>98% positive) were obtained using magnetic beads coated with anti-CD34 monoclonal antibody (mAb) (Miltenyi Biotech, CA).
  • mAb anti-CD34 monoclonal antibody
  • CD34 cells were stained with fluorescein-conjugated mAbs against CD34 and CD117 (Becton Dickinson, CA), AC133 (Miltenyi Biotech, CA), CD54 (Immunotech, CA), CD62E (BioSource, MA), VEGFR-2, Tie-2, vWF, eNOS, CXCR1, CXCR2, and CXCR4 (all Santa Cruz Biotech, CA), and analyzed by four-parameter fluorescence using FACScan (Becton Dickinson, CA).
  • Cells positively selected for CD34 expression were also stained with phycoerythrin (PE)-conjugated anti-CD117 mAb (Becton Dickinson, CA), and sorted for bright and dim fluorescence using a Facstar Plus (Becton Dickinson) and a PE filter.
  • Intracellular staining for GATA-2 was performed by permeabilizing one million cells from each of the brightly and dimly fluorescing cell populations using a Pharmingen Cytofix/CytopermTM kit, incubating for 30 minutes on ice with 10 ⁇ l of fluorochrome-conjugated mAbs against both CD117 and CD34 surface antigens (Becton Dickinson, CA).
  • CD34+CD117 brigh t cells were plated in 48-well chemotaxis chambers fitted with membranes (8 mm pores) (Neuro Probe, MD). After incubation for 2 hours at 37° C., chambers were inverted and cells were cultured for 3 hours in medium containing IL-8, SDF-1 alpha/beta, and SCF at 0.2, 1.0 and 5.0 ⁇ g/ml. The membranes were fixed with methanol and stained with LeukostatTM (Fischer Scientific, Ill.). Chemotaxis was calculated by counting migrating cells in 10 high-power fields.
  • CD34+ cells obtained from a single donor after G-CSF mobilization were injected into the tail vein 48 hours after LAD ligation either alone or together with 50 ⁇ g/ml monoclonal antibody (mAb) with known functional inhibitory activity against either human CXCR1, human CXCR2, human CXCR4, rat SDF-1 (all R & D Systems, MN), human CD34 (Pharmingen, CA), or rat IL-8 (ImmunoLaboratories, Japan). Controls received either isotype control antibodies at the same concentration or saline after LAD ligation.
  • mAb monoclonal antibody
  • Quantitation of myocardial infiltration after injection of human cells was performed by assessment of DiI fluorescence in hearts from rats sacrificed 2 days after injection (expressed as number of DiI-positive cells per high power field, minimum 5 fields examined per sample). Quantitation of rat bone marrow infiltration by human cells was performed in 12 rats at baseline, days 2, 7, and 14 by flow cytometric and RT-PCR analysis of the proportion of HLA class I-positive cells relative to the total rat bone marrow population.
  • Poly(A)+ mRNA was extracted by standard methods from the hearts of 3 normal and 12 LAD-ligated rats. RT-PCR was used to quantify myocardial expression of rat IL-8 and Gro-alpha mRNA at baseline and at 6, 12, 24 and 48 hours after LAD ligation after normalizing for total rat RNA as measured by GAPDH expression.
  • cDNA was amplified in the polymerase chain reaction (PCR) using Taq polymerase (Invitrogen, Carlsbad, Calif., U.S.A.), radiolabeled dideoxy-nucleotide ([a32P]-ddATP: 3,000 Ci/mmol, Amersham, Arlington Heights, Ill.), and primers for rat Cinc (rat homologue of human IL-8/Gro-alpha and GAPDH (Fisher Genosys, CA).
  • Taq polymerase Invitrogen, Carlsbad, Calif., U.S.A.
  • radiolabeled dideoxy-nucleotide [a32P]-ddATP: 3,000 Ci/mmol, Amersham, Arlington Heights, Ill.
  • primers for rat Cinc rat homologue of human IL-8/Gro-alpha and GAPDH (Fisher Genosys, CA).
  • Primer pairs (sense/antisense) for rat Cinc and GAPDH were, gaagatagattgcaccgatg (SEQ ID NO:4)/catagcctctcacatttc SEQ ID NO:5), gcgcccgtccgccaatgagctgcgc SEQ ID NO:6)/cttggggacacccttcagcatctttgg SEQ ID NO:7), and ctctacccacggcaagttcaa SEQ ID NO:8)/gggatgaccttgcccacagc SEQ ID NO:9), respectively.
  • rat IL-8/Gro-alpha Serum levels of rat IL-8/Gro-alpha were measured at baseline and at 6, 12, 24 and 48 hours after LAD ligation in four rats by a commercial ELISA using polyclonal antibodies against the rat IL-8/Gro homologue Cinc (ImmunoLaboratories, Japan). The amount of protein in each serum sample was calculated according to a standard curve of optical density (OD) values constructed for known levels of rat IL-8/Gro-alpha protein.
  • OD optical density
  • Anti-Cinc antibodies were also used according to the manufacturer's instructions at 1:200 dilution in immunohistochemical studies to identify the cellular source of Cinc production in rat myocardium after LAD ligation. Positively-staining cells were visualized as brown through the Avidin/Biotin system described below.
  • Staining was performed by immunoperoxidase technique using an Avidin/Biotin Blocking Kit, a rat-absorbed biotinylated anti-mouse IgG, and a peroxidase-conjugate (all Vector Laboratories Burlingame, Calif.).
  • Capillary density was determined at 2 weeks post infarction from sections labeled with anti-CD31 mAb, and confirmed with anti-factor VIII mAb, and compared to the capillary density of the unimpaired myocardium. Values are expressed as the number of CD31-positive capillaries per HPF (400x).
  • Cardiomyocyte DNA synthesis and cell cycling was determined by dual staining of rat myocardial tissue sections obtained from LAD-ligated rats at two weeks after injection of either saline or CD34+ human cells, and from healthy rats as negative controls, for cardiomyocyte-specific troponin I and human- or rat-specific Ki-67. Briefly, paraffin embedded sections were microwaved in a 0.1M EDTA buffer, and stained with either a primary monoclonal antibody against rat Ki-67 at 1:3000 dilution (gift of Giorgio Catoretti, Columbia University) or human Ki-67 at 1:300 dilution (Dako, CA) and incubated overnight at 4 degrees C.
  • TUNEL dexynucleotidyl transferase
  • tissue sections were then digested with Proteinase K (10 ⁇ g/ml in Tris/HCL) for 30 minutes at 37° C.
  • the slides were then washed 3 times in PBS and incubated with 50 ⁇ l of the TUNEL reaction mixture (TdT and fluorescein-labeled dUTP) and incubated in a humid atmosphere for 60 minutes at 37° C.
  • TdT was eliminated from the reaction mixture.
  • the sections were then incubated for 30 minutes with an antibody specific for fluorescein-conjugated alkaline phosphatase (AP) (Boehringer Mannheim, Mannheim, Germany).
  • AP fluorescein-conjugated alkaline phosphatase
  • the TUNEL stain was visualized with a substrate system in which nuclei with DNA fragmentation stained blue, (BCIP/NBT substrate system, Dako, Carpinteria, Calif.). The reaction was terminated following three minutes of exposure with PBS. To determine the proportion of blue-staining apoptotic nuclei within myocytes, tissue was counterstained with a monoclonal antibody specific for desmin. Endogenous peroxidase was blocked by using a 3% hydrogen perioxidase solution in PBS for 15 minutes, followed by washing with 20% goat serum solution. An anti-troponin I antibody (Accurate Chemicals, CT) was incubated overnight (1:200) at 40 degrees C.
  • BCIP/NBT substrate system Dako, Carpinteria, Calif.
  • Tissue sections were examined microscopically at 200 ⁇ magnification. Within each 200 ⁇ field 4 regions were examined, containing at least 250 cells per region and cumulatively approximating 1 mm 2 of tissue, at both the peri-infarct site and distally to this site. Stained cells at the edges of the tissue were not counted. Results were expressed as the mean number of apoptotic myocytes per mm 2 at each site examined.
  • Echocardiographic studies were performed using a high frequency liner array transducer (SONOS 5500, Hewlett Packard, Andover, Mass.). 2D images were obtained at mid-papillary and apical levels. End-diastolic (EDV) and end-systolic (ESV) left ventricular volumes were obtained by bi-plane area-length method, and % left ventricular ejection fraction was calculated as [(EDV ⁇ ESV)/EDV] ⁇ 100.
  • SONOS 5500 High frequency liner array transducer
  • ESV End-diastolic
  • ESV end-systolic
  • messenger RNA was isolated from each heart, and 1 ⁇ g was used for first-strand cDNA synthesis with random primers.
  • the subtractive hybridization was performed with the PCR-select cDNA subtraction kit (CLONTECH), following the manufacturer's recommendations.
  • CLONTECH PCR-select cDNA subtraction kit
  • the two cDNA libraries were digested with RsaI. Digestion products of the “tester” library were ligated to a specific adapter (T7 promoter), then hybridized with a 30-fold excess of the “driver” library for subtraction. After hybridization, the remaining products were further amplified by PCR.
  • the ischemic tissue is the “tester” and the normal tissue is the “driver.”
  • the “tester” and the “driver” are switched to determine the genes that are down-regulated in the ischemic sample.
  • Nrf2 Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J Biological Chem 2000, 275:16023-16029
  • Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. Jan. 1, 1999;13(1):76-86.
  • Jost, C. A., Marin, M. C. & Kaelin, W. J. p73 is a human p53-related protein that can induce apoptosis. Nature 389, 191-194 (1997).

Abstract

This invention provides a method of treating a disorder of a subject's heart involving loss of cardiomyocytes which comprises administering to the subject an amount of an agent effective to cause cardiomyocyte proliferation within the subject's heart so as to thereby treat the disorder. This invention further provides the instant method wherein the agent is human endothelial progenitor cells. This invention also provides methods of determining the susceptibility of a cardiomyocyte in a subject to apoptosis.

Description

  • Throughout this application, various publications are referenced in parentheses by arabic numbers. Full citations for these references may be found at the end of the specification immediately preceding the claims. The disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains. [0001]
    • BACKGROUND
  • Healing of a myocardial infarct is complicated by the need for viable myocytes at the peri-infarct rim to undergo compensatory hypertrophy in order to increase pump function in response to the loss of infarcted tissue (1,2). This initiates a process termed cardiac remodelling which is characterized by apoptotic loss of hypertrophied myocytes, expansion of the initial infarct area, progressive collagen replacement, and heart failure (3-6). We have recently put forward the hypothesis that hypertrophied cardiac myocytes undergo apoptosis because the endogenous capillary network cannot provide the compensatory increase in perfusion required for cell survival (7). [0002]
  • Vascular network formation is the end result of a complex process that begins in the pre-natal period with induction of vasculogenesis by hemangioblasts—cells derived from the human ventral aorta which give rise to both endothelial and hematopoietic elements (8-11). [0003]
  • Cells which can differentiate into endothelial elements also exist in adult bone marrow (12-14) and can induce vasculogenesis in ischemic tissues (15-17). In the adult, new blood vessel formation can occur either through angiogenesis from pre-existing mature endothelium or vasculogenesis mediated by bone marrow-derived endothelial precursors. Recently, we identified a specific population of endothelial progenitor cells (angioblasts) derived from human adult bone marrow which has phenotypic and functional characteristics of embryonic angioblasts (7). We showed that intravenous administration of these cells resulted in selective homing to ischemic myocardium, induction of infarct bed vasculogenesis, prevention of peri-infarct myocyte apoptosis, and significant improvement in myocardial function (7). [0004]
  • We recently discovered that CXC chemokines containing the ELR motif regulate migration of human bone marrow-derived endothelial progenitor cells to sites of tissue ischemia. Moreover, since selective bone marrow homing and engraftment of hematopoietic progenitors depends on CXCR4 binding to SDF-1 expressed constitutively in the bone marrow (28-30), we demonstrated that interruption of CXCR4/SDF-1 interactions could redirect trafficking of human bone marrow-derived endothelial progenitor cells to sites of tissue ischemia, thereby augmenting therapeutic vasculogenesis. Our results indicated that CXC chemokines, including IL-8, Gro-alpha, and SDF-1, play a central role in regulating human adult bone marrow-dependent vasculogenesis. [0005]
  • Recent observations have suggested that a second compensatory response of viable cardiomyocytes is to proliferate and regenerate following injury (18,19). We have previously shown that pro-angiogenic fatcors, such as endothelial progenitor cells at a minimum concentration can induce vasculogenesis. Here we disclose the surprising result that careful dosing of endothelial progenitor cells/other pro-angiogenic agents can induce cardiomyocyte proliferation also, and this proliferation can be enhanced by manipulating CXCR4/stromal derived factor-1 interactions. Moreover, we show that the mechanisms for this enhanced proliferation is via modulation of mRNA expression of a number of stress-inducible genes involved in cardiomyocyte apoptosis and cell-cycling. [0006]
    • SUMMARY
  • This invention provides a method of treating a disorder of a subject's heart involving loss of cardiomyocytes which comprises administering to the subject an amount of an agent effective to cause cardiomyocyte proliferation within the subject's heart so as to thereby treat the disorder. [0007]
  • This invention further provides the instant method wherein the agent is human endothelial progenitor cells. [0008]
  • This invention further provides the instant method comprising administering an effective amount of a second agent that increases the cardiomyocyte proliferation caused by the human endothelial progenitor cells. [0009]
  • This invention also provides a method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising: [0010]
  • (a) quantitating the expression a peroxiredoxin in the cardiomyocyte; [0011]
  • (b) quantitating the expression of Vitamin D3 Up-Regulated Protein-1 in the cardiomyocyte; and [0012]
  • (c) determining the ratio of peroxiredoxin expression: Vitamin D3 Up-Regulated Protein-1 expression, wherein a low ratio indicates a high susceptibility of the cardiomyocyte to apoptosis and a high ratio indicates a low susceptibility of the cardiomyocyte to apoptosis in the subject. [0013]
    • BRIEF DESCRIPTION OF THE FIGURES
  • FIGS. [0014] 1A-1D: IL-8/Gro-Alpha CXC Chemokines Regulate Migration Of Human Endothelial progenitor cells (angioblasts) To Myocardial Tissue In Vivo And Subsequent Development Of Vasculogenesis.
  • (A) DiI-labelled human endothelial progenitor cells (angioblasts) (>98% CD34+purity) injected intravenously into nude rats infiltrate rat myocardium after coronary artery ligation and infarction but not after sham operation at 48 hours. [0015]
  • (B) Migration of human endothelial progenitor cells (angioblasts) to ischemic rat myocardium is inhibited by mAbs against either rat IL-8 or the IL-8/Gro-alpha chemokine family receptors CXCR1 and CXCR2 (all p<0.01), but not against VEGF or its receptor Flk-1 (results are expressed as mean+sem of three separate experiments). [0016]
  • (C) Masson's trichrome stain of rat myocardial infarct bed at two weeks after LAD ligation demonstrating diffuse increase in matrix deposition and few capillaries in representative animal injected with saline (x400), diffuse increase in capillaries (arrowheads) and reduction in matrix deposition in representative animal injected with human bone marrow-derived endothelial progenitor cells (x400), and reduction in capillary numbers in representative animal injected with human endothelial progenitor cells (angioblasts) together with mAb against human CXCR1/2 (x400). [0017]
  • (D) Intracardiac injection of IL-8 or SDF-1 at 1 μg/ml significantly increases in vivo chemotaxis of DiI-labelled human endothelial progenitor cells (angioblasts) (98% CD34+purity) into non-ischemic rat heart in comparison with injection of saline or stem cell factor (SCF), p<0.01 (results are expressed as mean+sem of three separate experiments). Below is shown representative fluorescence microscopy of intravenously-injected DiI-labelled human endothelial progenitor cells infiltrating non-ischemic rat heart after intracardiac injection with saline, IL-8 or SDF-1. [0018]
  • FIGS. [0019] 2A-2C: Blocking CXCR4/SDF-1 Interactions Redirects Intravenously Injected Human Endothelial progenitor cells From Bone Marrow To Ischemic Myocardium.
  • (A) the proportion of human CD34+CD117[0020] bright endothelial progenitor cells (angioblasts) in rat bone marrow 2-14 days after intravenous injection is significantly increased following ischemia induced by LAD ligation (results are expressed as mean+sem of bone marrow studies in three animals at each time point).
  • (B) and (C) depict the effects of mAbs against CXCR4, SDF-1 or CD34 on trafficking of human CD34+endothelial progenitor cells (angioblasts) to rat bone marrow and myocardium following LAD ligation. Co-administration of anti-CXCR4 or anti-SDF-1 significantly reduced trafficking of intravenously injected human CD34+ cells to rat bone marrow at 48 hours and increased trafficking to ischemic myocardium, whereas anti-CD34 mAb had no effect (results are expressed as mean+sem of bone marrow and cardiac studies performed in three LAD-ligated animals at 48 hours after injection). [0021]
  • FIGS. [0022] 3A-3F. Redirected Trafficking Of Human Endothelial progenitor cells (angioblasts) To The Site Of Infarction Induces Vasculogenesis And Protects Cardiomyocytes Against Apoptosis.
  • (A) Myocardial infarct bed two weeks post-LAD ligation from representative animals in each group stained with Masson's trichrome (upper panel) or immunoperoxidase after binding of anti-CD31 mAb (lower panel). The infarct zones of rats receiving either 10[0023] 3 or 105 endothelial progenitor cells (angioblasts) show myocardial scars composed of paucicellular, dense fibrous tissue stained blue by trichrome (x400). In contrast, the infarct zones of rats injected with 105 endothelial progenitor cells plus anti-CXCR4 mAb show significant increase in cellularity of granulation tissue, minimal matrix deposition and fibrosis, and numerous medium-sized capillaries of human origin. The infarct zones of rats injected with 2×105 endothelial progenitor cells show a similar reduction in fibrous tissue and increase in medium-sized capillaries, and an additional increase in large-sized vessels of human origin.
  • (B) and (C) show the relationship between the number of human CD117[0024] bright endothelial progenitor cells injected intravenously (103, 105, 105 plus anti-CXCR4 mAb, and 2×105) and development of rat infarct bed vasculogenesis at two weeks, defined as the mean number of capillaries/high power field (hpf) with medium- or large-sized lumen diameter (respectively, 0.02 mm mean diameter with 3-6 contiguous endothelial lining cells and 0.05 mm mean diameter with >6 contiguous endothelial lining cells). Results are expressed as the mean+sem of at least 15 hpf in three separate experiments.
  • (B) the groups receiving either 2×10[0025] 5 endothelial progenitor cells (angioblasts) or 105 endothelial progenitor cells plus anti-CXCR4 mAb demonstrated 1.7-fold higher numbers of medium-sized capillaries compared with the other two groups (p<0.01).
  • (C) the group receiving 2×10[0026] 5 endothelial progenitor cells (angioblasts) additionally demonstrated 3.3-fold higher numbers of large-lumen capillaries compared with the groups receiving 103 or 105 endothelial progenitor cells (p<0.01), and 2-fold higher numbers of large-lumen capillaries compared with the group receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb (p<0.01).
  • (D) shows that co-administration of anti-CXCR4 mAb together with the highest concentration of endothelial progenitor cells (angioblasts), 2×10[0027] 5, resulted in a further 23% increase in growth of large-lumen capillaries. More strikingly, there was a further 2-fold increase in capillary numbers when 2×105 endothelial progenitor cells were injected intravenously after direct intracardiac delivery of 1.0 μg/ml SDF-1 into infarcted hearts (p<0.01) (results are expressed as mean+sem of three separate experiments).
  • (E) shows that at 2 weeks the numbers of apoptotic myocytes at the peri-infarct rim, defined by concomitant staining with anti-desmin mAb and DNA end-labeling using TUNEL technique, are significantly reduced in rats receiving either 2.0×10[0028] 5 endothelial progenitor cells or 105 endothelial progenitor cells together with anti-CXCR4 mAb in comparison to rats receiving 103 or 105 endothelial progenitor cells (p<0.01) (results are expressed as mean+sem of three separate experiments).
  • (F) shows that co-administration of anti-CXCR4 mAb or intracardiac injection of SDF-1 resulted in further reductions in cardiomyocyte apoptosis of 65% and 76%, respectively, at two weeks (both p<0.001) (results are expressed as mean+sem of three separate experiments). [0029]
  • FIGS. [0030] 4A-4H. Infarct Bed Vasculogenesis Improves Long-Term Myocardial Function Through Mechanisms Involving Both Cardiomyocyte Protection and Proliferation/Regeneration.
  • (A) and (B) show the relationship between the number of human CD117[0031] bright endothelial progenitor cells (angioblasts) injected intravenously (103, 105, 105 plus anti-CXCR4 mAb, and 2×105) and improvement in myocardial function at 15 weeks, defined as mean improvement in left ventricular ejection fraction (LVEF) (A) and mean reduction in left ventricular area at end-systole (LVAs)
  • (B). No significant improvement in these parameters was observed in the groups receiving 10[0032] 3 or 105 endothelial progenitor cells in comparison to rats receiving saline alone. In contrast, rats receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb demonstrated significant recovery in LVEF and reduction in LVAs (both p<0.001). The group receiving 2×105 endothelial progenitor cells demonstrated still 50% greater recovery in LVEF and reduction in LVAs (both p<0.001).
  • (C) Section from infarct of representative animal receiving 2×10[0033] 5 endothelial progenitor cells (angioblasts) showing a high frequency of cardiomyocytes staining positively for both cardiac-specific troponin I and rat-specific Ki-67 (arrows). Note the proximity of Ki-67-positive cardiomyocytes to capillaries (arrowheads).
  • (D) Section from infarct of representative animal receiving 2×10[0034] 5 endothelial progenitor cells showing “finger” of cardiomyocytes of rat origin, as determined by expression of rat MHC class I molecules, extending from the peri-infarct region into the infarct zone. These cellular islands contain a high frequency of myocytes staining positively for both cardiac-specific troponin I and rat-specific Ki-67 (arrows). Sections from infarcts of representative animals receiving saline do not show same frequency of dual staining myocytes. Bar graph shows that the group of animals receiving 2×105 human endothelial progenitor cells has a significantly higher index of cell cycling cardiomyocytes at the peri-infarct region than saline controls or sham operated animals (both p<0.01). No difference between the groups is seen at sites distal to the infarct.
  • (E) shows that the index of cell-cycling cardiomyocytes at the peri-infarct rim was increased by a further 1.9-fold when 2×10[0035] 5 human endothelial progenitor cells were intravenously co-administered together with SDF-1 injected directly into the ischemic myocardium alone (p<0.01), or an 8-fold cumulative increase in cell-cycling cardiomyocytes at two weeks compared with LAD-ligated controls receiving saline (results are expressed as mean+sem of three separate experiments).
  • (F) shows that intravenous co-administration of anti-CXCR4 mAb, or intracardiac co-administration of SDF-1, but not IL-8, results in 2.8 to 4-fold greater LVEF improvement, determined by echocardiography, compared with intravenous injection of 2×10[0036] 5 endothelial progenitor cells alone (p<0.01) (results are expressed as mean+sem of three separate experiments).
  • (G) shows that at 15 weeks the mean proportion of scar/normal left ventricular myocardium in rats receiving either or 10[0037] 5 endothelial progenitor cells together with anti-CXCR4 mAb was significantly reduced in comparison to rats receiving either 103 or 105 endothelial progenitor cells (angioblasts) alone, or saline (p<0.01). The group receiving 2.0×105 endothelial progenitor cells demonstrated still 38% greater reduction in the ratio of scar/muscle tissue (results are expressed as mean+sem of three separate experiments).
  • (H) Sections of rat hearts stained with Masson's trichrome at 15 weeks after LAD ligation and injection of 2.0×10[0038] 6 G-CSF mobilized human cells containing 103 (left) or 2.0×105 (right) CD117bright endothelial progenitor cells. Hearts of rats receiving 103 endothelial progenitor cells had greater loss of anterior wall mass, collagen deposition (lighter gray), and septal hypertrophy compared with hearts of rats receiving 2.0×105 endothelial progenitor cells.
  • FIG. 5: This figure shows mRNA expression of three genes in the ischemic rat hearts at various time points. You will see that at 48 hours and 2 weeks after LAD ligation and ischemia, HBP23 (the rat homologue of human PAG/NKEF-A,B,C, all of which are part of the family of peroxiredoxins (Prx)) is decreased, and vitamin D3 upregulated protein VDUP-1 is increased. The early (48 hour) reduction in PRX and increase in VDUP-1 results in a compensatory increase in thiol reductase thioredoxin (TRX). Note that endothelial progenitor cell therapy reverses this pattern of mRNA expression. [0039]
  • FIG. 6: DNA sequence (SEQ ID NO:1) corresponding to mRNA encoding VDUP-1. [0040]
  • FIG. 7: This figure shows [0041] catalytic DNA 5′-AT-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the coding region of VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 8: This figure shows [0042] catalytic DNA 5′-GC-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 9: This figure shows [0043] catalytic DNA 5′-GT-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 10: This figure shows [0044] catalytic DNA 5′-AC-3′ cleavage sites on VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA. Cleavage site pairs are uppercase.
  • FIG. 11: This figure shows sites which can be cleaved by a hammerhead ribozyme in VDUP-1 DNA (SEQ ID NO:3) corresponding to the VDUP-1 mRNA coding region. Uppercase “T” represents cleavage site. [0045]
    • DETAILED DESCRIPTION
  • As used herein, “VEGF” is defined as vascular endothelial growth factor. “VEGF-R” is defined as vascular endothelial growth factor receptor. “FGF” is defined as fibroblast growth factor. “IGF” is defined as Insulin-like growth factor. “SCF” is defined as stem cell factor. “G-CSF” is defined as granulocyte colony stimulating factor. “M-CSF” is defined as macrophage colony stimulating factor. “GM-CSF” is defined as granulocyte-macrophage colony stimulating factor. “MCP” is defined as monocyte chemoattractant protein. [0046]
  • As used herein “angioblasts” is synonymous with the term “endothelial progenitor cells”. [0047]
  • As used herein, “CXC” chemokine refers to the structure of the chemokine. Each “C” represents a cysteine and “X” represents any amino acid. “CXCR4” refers to [0048] CXC receptor 4.
  • As used herein, “CC” chemokine refers to the structure of the chemokine. Each “C” represents a cysteine. [0049]
  • “Catalytic” shall mean the functioning of an agent as a catalyst, i.e. an agent that increases the rate of a chemical reaction without itself undergoing a permanent structural change. [0050]
  • “Nucleic acid” shall include without limitation any nucleic acid, including, without limitation, DNA, RNA, oligonucleotides, or polynucleotides, and analogs or derivatives thereof. The nucleotides that form the nucleic acid may be nucleotide analogs or derivatives thereof. The nucleic acid may incorporate non nucleotides. [0051]
  • “Nucleotides” shall include without limitation nucleotides and analogs or derivatives thereof. For example, nucleotides may comprise the bases A, C, G, T and U, as well as derivatives thereof. Derivatives of these bases are well known in the art, and are exemplified in PCR Systems, Reagents and Consumables (Perkin Elmer Catalogue 1996-1997, Roche Molecular Systems, Inc., Branchburg, N.J., U.S.A.). [0052]
  • “Proliferation” and “regeneration” are used synonymously when referring to cardiomyocytes in this application. “Proliferation” in respect to cardiomyocytes, shall mean a fold increase in proportion of cardiomyocytes entering the cell cycle relative to untreated rat heart. [0053]
  • “Trafficking” means the blood-borne migration of cells, in particular angioblast/endothelial progenitor cells. [0054]
  • This invention provides a method of treating a disorder of a subject's heart involving loss of cardiomyocytes which comprises administering to the subject an amount of an agent effective to cause cardiomyocyte proliferation within the subject's heart so as to thereby treat the disorder. [0055]
  • In one embodiment the agent is human endothelial progenitor cells. In one embodiment the endothelial progenitor cells are bone marrow-derived. In another they are derived from cord blood, or embryonic or fetal sources. Effective amounts of endothelial progenitor cells sufficient to cause cardiomyocyte proliferation can be done based on animal data using routine computational methods. In one embodiment the effective amount is about 1.5×10[0056] 5 endothelial progenitor cells per kg body mass to about 3×105 per kg body mass. In another embodiment the effective amount is about 3×105 per kg body mass to about 4.5×105 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 4.5×105 per kg body mass to about 5.5×105 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 5.5×105 per kg body mass to about 7×105 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 7×105 per kg body mass to about 1×106 endothelial progenitor cells per kg body mass. In another embodiment the effective amount is about 1×106 per kg body mass to about 1.5×106endothelial progenitor cells per kg body mass. In one embodiment the effective amount of human endothelial progenitor cells is between about 1.5×106 and 4.5×106 endothelial progenitor cells per kg of the subject's body mass and In a preferred embodiment the effective amount is about 5×105 endothelial progenitor cells per kg of the subject's body mass.
  • In one embodiment the endothelial progenitor cells are allogeneic with respect to the subject. In differing embodiments the subject is an adult or an embryo or a fetus. In another embodiment the endothelial progenitor cells are derived from cloned autologous embryonic stem cells. [0057]
  • In one embodiment the agent induces expression of a mRNA encoding a peroxiredoxin. The expression of peroxiredoxin mRNA may be increased, for example, by administration of 2(3)-t-butyl-4-hydroxyanisole (BHA) (see 106) which has been shown to increase expression of Peroxiredoxin-1 when administered by diet. Alternatively, local control of O[0058] 2 can have the same effect (see 107). Peroxiredoxin mRNA expression, such as that of thiol peroxidases, may also be induced by heme, cadmium or cobalt (see 108). Peroxiredoxins include, but are not limited to, PAG, HBP23, MSP23, NKEF.
  • In another embodiment the agent induces expression of a mRNA encoding NF-E2-related factor 2 (Nrf2). Cytomplasmic NF-E2-related factor 2 (Nrf2) expression can be indirectly increased by raising free Nrf2 levels. Since Nrf2 is tightly bound to keap1 in the cytoplasm then reducing expression of keap1 mRNA is a suitable target e.g. by keap1 antisense oligonucleotides or catalytic nucleic acids (see 109 for keap1). Also, blocking the interaction between Nrf2 and Keap1 by inhibiting the interaction of the Neh2 domain of Nrf2 and the DGR domain of keap1, e.g. by using the entire Neh2 domain of nrf2, amino acids 1-73, or only the hydrophilic region, amino acids 33-73 (see 109) will increase free cytoplasmic Nrf-2. In another embodiment the agent induces dissociation of a Nrf2 protein from a Keap-1. In another embodiment the agent inhibits association of a Nrf2 protein with a Keap-1. In another embodiment the agent inhibits association of a thiol reductase thioredoxin with a VDUP-1 protein. In another embodiment the agent inhibits c-Abl tyrosine kinase activation. In a further embodiment the agent is STI-571. [0059]
  • In one embodiment the agent is a CXC chemokine. In further embodiments the agent is Stromal-Derived Factor-1, Il-8 or Gro-Alpha. In one embodiment the amount of CXC chemokine administered is between 0.2 and 5 μg/ml at a max volume of 10 ml for a 70 kg human subject. In a preferred embodiment the amount is about 1 μg/ml. In one embodiment the agent is an inhibitor of plasminogen activator inhibitor-1. In another embodiment the agent is an antibody directed against an epitope of CXCR4. In one embodiment the amount of antibody directed against an epitope of CXCR4 is between 25 and 75 μg/ml, at a max volume of 10 ml for a 70 kg human subject. A simple calculation is performed for subjects of different mass. In a preferred embodiment the amount is about 5 μg/ml. [0060]
  • In a further embodiment the instant method further comprises administering an effective amount of a second agent that increases the cardiomyocyte proliferation caused by the human endothelial progenitor cells. Effective amounts of the second agent are amounts sufficient to enhance or accelerate cardiomyocyte proliferation in the presence of administered endothelial progenitor cells. In further embodiments the endothelial progenitor cells express CD117, CD34, AC133 or a high level of intracellular GATA-2 activity. In one embodiment the administering comprises injecting directly into the subject's peripheral circulation, heart muscle, left ventricle, right ventricle, coronary artery, cerebro-spinal fluid, neural tissue, ischemic tissue, or post-ischemic tissue. [0061]
  • In one embodiment the second agent is an antisense oligonucleotide which specifically inhibits translation of Vitamin D3 Up-Regulated Protein-1 (VDUP-1) mRNA. [0062]
  • Therapeutically useful targeted inhibition of VDUP-1 protein (SEQ ID NO:2) expression can be achieved through the use of antisense oligonucleotides. Antisense oligonucleotides are small fragments of DNA and derivatives thereof complementary to a defined sequence on a specified mRNA. A VDUP-1 antisense oligonucleotide specifically binds to targets on the VDUP-1 mRNA (SEQ ID NO:1) molecule and in doing so inhibits the translation thereof into VDUP-1 protein (SEQ ID NO:2). [0063]
  • Antisense oligonucleotide molecules synthesized with a phosphorothioate backbone have proven particularly resistant to exonuclease damage compared to standard deoxyribonucleic acids, and so they are used in preference. A phosphorothioate antisense oligonucleotide for VDUP-1 mRNA can be synthesized on an Applied Biosystems (Foster City, Calif.) model 380B DNA synthesizer by standard methods. E.g. Sulfurization can be performed using tetraethylthiuram disulfide/acetonitrile. Following cleavage from controlled pore glass support, oligodeoxynucleotides can be base deblocked in ammonium hydroxide at 60° C. for 8 h and purified by reversed-phase HPLC [0.1M triethylammonium bicarbonate/acetonitrile; PRP-1 support]. Oligomers can be detritylated in 3% acetic acid and precipitated with 2% lithiumperchlorate/acetone, dissolved in sterile water and reprecipitated as the sodium salt from 1 M NaCl/ethanol. Concentrations of the full length species can be determined by UV spectroscopy. [0064]
  • Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. [0065]
  • Hybridization of antisense oligonucleotides with VDUP-1 mRNA interferes with one or more of the normal functions of VDUP-1 1 mRNA. The functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA. [0066]
  • Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-alkylene phosphonates, 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and borano-phosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3′ to 3′, 5′ to 5′ or 2′ to 2′ linkage. Also, oligonucleotides having inverted polarity comprise a single 3′ to 3′ linkage at the 3′-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof) are included. Various salts, mixed salts and free acid forms are also included. [0067]
  • Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference. [0068]
  • In accordance with this invention, persons of ordinary skill in the art will understand that messenger RNA includes not only the information to encode a protein using the three letter genetic code, but also associated ribonucleotides which form a region known to such persons as the 5′-untranslated region, the 3′-untranslated region, the 5′ cap region and intron/exon junction ribonucleotides. Thus, antisense oligonucleotides or the catalytic nucleic acids described below may be formulated in accordance with this invention which are targeted wholly or in part to these associated ribonucleotides as well as to the informational ribonucleotides. The antisense oligonucleotides may therefore be specifically hybridizable with a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region. Similarly, the catalytic nucleic acids may specifically cleave a transcription initiation site region, a translation initiation codon region, a 5′ cap region, an intron/exon junction, coding sequences, a translation termination codon region or sequences in the 5′- or 3′-untranslated region. As is known in the art, the translation initiation codon is typically 5′-AUG (in transcribed mRNA molecules; 5′-ATG in the corresponding DNA molecule). A minority of genes have a translation initiation codon having the [0069] RNA sequence 5′-GUG, 5′UUG or 5′-CUG, and 5′-AUA, 5′-ACG and 5′-CUG have been shown to function in vivo. Thus, the term “translation initiation codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine in eukaryotes. It is also known in the art that eukaryotic genes may have two or more alternative translation initiation codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions. In the context of the invention, “translation initiation codon” refers to the codon or codons that are used in vivo to initiate translation of an mRNA molecule transcribed from a gene encoding VDUP-1, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon of a gene may have one of three sequences, i.e., 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA, 5′-TAG and 5′-TGA, respectively). The term “translation initiation codon region” refers to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation initiation codon. This region is one preferred target region. Similarly, the term “translation termination codon region” refers to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5′ or 3′) from a translation termination codon. This region is also one preferred target region. The open reading frame or “coding region,” which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively. Other preferred target regions include the 5′ untranslated region (5′UTR), known in the art to refer to the portion of an mRNA in the 5′ direction from the translation initiation codon, and thus including nucleotides between the 5′ cap site and the translation initiation codon of an mRNA or corresponding nucleotides on the gene, and the 3′ untranslated region (3′UTR), known in the art to refer to the portion of an mRNA in the 3′ direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3′ end of an mRNA or corresponding nucleotides on the gene. mRNA splice sites may also be preferred target regions, and are particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular mRNA splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions may also be preferred targets.
  • Once the target site or sites have been identified, antisense oligonucleotides can be chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired disruption of the function of the molecule. “Hybridization”, in the context of this invention, means hydrogen bonding, also known as Watson-Crick base pairing, between complementary bases, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymine are examples of complementary bases which form two hydrogen bonds between them. “Specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the DNA or RNA target and the catalytic nucleic acids. Similarly, catalytic nucleic acids are synthesized once cleavage target sites on the VDUP-1 mRNA molecule. [0070]
  • It is preferred to administer antisense oligonucleotides or catalytic nucleic acids or analogs thereof to mammals suffering from cardiovascular disease, in either native form or suspended in a carrier medium in amounts and upon treatment schedules which are effective to therapeutically treat the mammals to reduce the detrimental effects of cardiovascular disease. One or more different catalytic nucleic acids or antisense oligonucleotides or analogs thereof targeting different sections of the nucleic acid sequence of VDUP-1 mRNA may be administered together in a single dose or in different doses and at different amounts and times depending upon the desired therapy. The catalytic nucleic acids or antisense oligonucleotides can be administered to mammals in a manner capable of getting the oligonucleotides initially into the blood stream and subsequently into cells, or alternatively in a manner so as to directly introduce the catalytic nucleic acids or antisense oligonucleotides into the cells or groups of cells, for example cardiomyocytes, by such means by electroporation or by direct injection into the heart. Antisense oligonucleotides whose presence in cells can inhibit transcription or protein synthesis can be administered by intravenous injection, intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, orally or rectally. Human pharmacokinetics of certain antisense oligonucleotides have been studied. See (105) incorporated by reference in its entirety. It is within the scale of a person's skill in the art to determine optimum dosages and treatment schedules for such treatment regimens. [0071]
  • Doses of the oligonucleotides or analogs thereof of the present invention in a pharmaceutical dosage unit will be an efficacious, nontoxic quantity administered to a human patient in need of cardiomyocyte regeneration (or inhibition of VDUP-1 expression) from 1-6 or more times daily or every other day. Dosage is dependent on severity and responsiveness of the effects of abnormal cardiovascular disease to be treated, with course of treatment lasting from several days to months or until a cure is effected or a reduction of the effects is achieved. Oral dosage units for human administration generally use lower doses. The actual dosage administered may take into account the size and weight of the patient, whether the nature of the treatment is prophylactic or therapeutic in nature, the age, weight, health and sex of the patient, the route of administration, and other factors. [0072]
  • In another embodiment the second agent is a pro-angiogenic agent. In further embodiments the pro-angiogenic agent is vascular endothelial growth factor, fibroblast growth factor or angiopoietin. In another embodiment the second agent induces expression of a pro-angiogenic factor. In a further embodiment the second agent is Hypoxia Inducible Factor-1. [0073]
  • In another embodiment the second agent is a catalytic nucleic acid which specifically inhibits translation of Vitamin D3 Up-Regulated Protein-1 mRNA. In a further embodiment the catalytic nucleic acid comprises deoxyribonucleotides. In another embodiment the catalytic nucleic acid comprises ribonucleotides. [0074]
  • Catalytic nucleic acid molecules can cleave Vitamin D3 Up-Regulated Protein-1 (VDUP-1) mRNA (corresponding DNA shown in SEQ ID NO:1, FIG. 5) at each and any of the consensus sequences therein. Since catalytic ribo- and deoxyribo-nucleic acid consensus sequences are known, and the VDUP-1 Protein mRNA sequence is known, one of ordinary skill could readily construct a catalytic ribo- or deoxyribo nucleic acid molecule directed to any of the VDUP-1 protein mRNA consensus sequences based on the instant specification. In preferred embodiments of this invention the catalytic deoxyribonucleic acids include the 10-23 structure. Examples of catalytic ribonucleic acids include hairpin and hammerhead ribozymes. In preferred embodiments of this invention, the catalytic ribonucleic acid molecule is formed in a hammerhead (50) or hairpin motif (51,52,53), but may also be formed in the motif of a hepatitis delta virus (54), group I intron (60), RNaseP RNA (in association with an RNA guide sequence) (55,56) or Neurospora VS RNA (57,58,59). [0075]
  • To target the VDUP-1 mRNA (SEQ ID NO:1), catalytic nucleic acids can be designed based on the [0076] consensus cleavage sites 5′-purine:pyrimidine-3′ in the VDUP-1 mRNA sequence (104) (see FIGS. 6-10) for cleavage sites on DNA corresponding to the mRNA encoding VDUP-1 (SEQ ID NO:2). Those potential cleavage sites located on an open loop of the mRNA according to RNA folding software e.g. RNADRaw 2.1 are particularly preferred as targets (61). The DNA based catalytic nucleic acids can utilize the structure where two sequence-specific arms are attached to a catalytic core based on the VDUP-1 mRNA sequence. Further examples of catalytic DNA structure are detailed in (62) and (63). Commercially available mouse brain polyA-RNA (Ambion) can serve as a template in the in vitro cleavage reaction to test the efficiency of the catalytic deoxyribonucleic acids. Catalytic RNA, is described above, is designed similarly. Hammerhead ribozymes can cleave any 5′-NUH-3′ triplets of a mRNA, where U is conserved and N is any nucleotide and H can be C,U,A, but not G. For example, the sites which can be cleaved by a hammerhead ribozyme in human VDUP-1 mRNA coding region are shown in FIG. 10.
  • Cleaving of VDUP-1 mRNA with catalytic nucleic acids interferes with one or more of the normal functions of VDUP-1 mRNA. The functions of mRNA to be interfered with include all vital functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in by the RNA. [0077]
  • The nucleotides may comprise other bases such as inosine, deoxyinosine, hypoxanthine may be used. In addition, [0078] isoteric purine 2′deoxy-furanoside analogs, 2′-deoxynebularine or 2′deoxyxanthosine, or other purine or pyrimidine analogs may also be used. By carefully selecting the bases and base analogs, one may fine tune the hybridization properties of the oligonucleotide. For example, inosine may be used to reduce hybridization specificity, while diaminopurines may be used to increase hybridization specificity.
  • Adenine and guanine may be modified at positions N3, N7, N9, C2, C4, C5, C6, or C8 and still maintain their hydrogen bonding abilities. Cytosine, thymine and uracil may be modified at positions N1, C2, C4, C5, or C6 and still maintain their hydrogen bonding abilities. Some base analogs have different hydrogen bonding attributes than the naturally occurring bases. For example, 2-amino-2′-dA forms three (3), instead of the usual two (2), hydrogen bonds to thymine (T). Examples of base analogs that have been shown to increase duplex stability include, but are not limited to, 5-fluoro-2′-dU, 5-bromo-2′-dU, 5-methyl-2′-dC, 5-propynyl-2′-dC, 5-propynyl-2′-dU, 2-amino-2′-dA, 7-deazaguanosine, 7-deazadenosine, and N2-Imidazoylpropyl-2′-dG. [0079]
  • Nucleotide analogs may be created by modifying and/or replacing a sugar moiety. The sugar moieties of the nucleotides may also be modified by the addition of one or more substituents. For example, one or more of the sugar moieties may contain one or more of the following substituents: amino, alkylamino, araalkyl, heteroalkyl, heterocycloalkyl, aminoalkylamino, O, H, an alkyl, polyalkylamino, substituted silyl, F, Cl, Br, CN, CF[0080] 3, OCF3, OCN, O-alkyl, S-alkyl, SOMe, SO2Me, ONO2, NH-alkyl, OCH2CH═CH2, OCH2CCH, OCCHO, allyl, O-allyl, NO2, N3, and NH2. For example, the 2′ position of the sugar may be modified to contain one of the following groups: H, OH, OCN, O-alkyl, F, CN, CF3, allyl, O-allyl, OCF3, S-alkyl, SOMe, SO2Me, ONO2, NO2, N3, NH2, NH-alkyl, or OCH═CH2, OCCH, wherein the alkyl may be straight, branched, saturated, or unsaturated. In addition, the nucleotide may have one or more of its sugars modified and/or replaced so as to be a ribose or hexose (i.e. glucose, galactose) or have one or more anomeric sugars. The nucleotide may also have one or more L-sugars.
  • Representative U.S. patents that teach the preparation of such modified bases/nucleosides/nucleotides include, but are not limited to, U.S. Pat. Nos. 6,248,878, and 6,251,666 which are herein incorporated by reference. [0081]
  • The sugar may be modified to contain one or more linkers for attachment to other chemicals such as fluorescent labels. In an embodiment, the sugar is linked to one or more aminoalkyloxy linkers. In another embodiment, the sugar contains one or more alkylamino linkers. Aminoalkyloxy and alkylamino linkers may be attached to biotin, cholic acid, fluorescein, or other chemical moieties through their amino group. [0082]
  • Nucleotide analogs or derivatives may have pendant groups attached. Pendant groups serve a variety of purposes which include, but are not limited to, increasing cellular uptake of the oligonucleotide, enhancing degradation of the target nucleic acid, and increasing hybridization affinity. Pendant groups can be linked to any portion of the oligonucleotide but are commonly linked to the end(s) of the oligonucleotide chain. Examples of pendant groups include, but are not limited to: acridine derivatives (i.e. 2-methoxy-6-chloro-9-aminoacridine); cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II), o-phenanthroline-Cu(I), and porphyrin-Fe(II); alkylating moieties; nucleases such as amino-1-hexanolstaphylococcal nuclease and alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; amino; mercapto groups; radioactive markers; nonradioactive markers such as dyes; and polylysine or other polyamines. In one example, the nucleic acid comprises an oligonucleotide conjugated to a carbohydrate, sulfated carbohydrate, or gylcan. Conjugates may be regarded as a way as to introduce a specificity into otherwise unspecific DNA binding molecules by covalently linking them to a selectively hybridizing oligonucleotide. [0083]
  • The catalytic nucleic acid binding domains (i.e. the non-catalytic domains) or antisense oligonucleotide may comprise modified bonds. For example internucleosides bonds of the oligonucleotide may comprise phosphorothioate linkages. The nucleic acid may comprise nucleotides having moiety may be modified by replacing one or both of the two bridging oxygen atoms of the linkage with analogues such as —NH, —CH[0084] 2, or —S. Other oxygen analogues known in the art may also be used. The phosphorothioate bonds may be stereo regular or stereo random.
  • The oligonucleotide moiety may have one or more of its sugars modified or replaced so as to be ribose, glucose, sucrose, or galactose, or any other sugar. Alternatively, the phosphorothioate oligonucleotide may have one or more of its sugars substituted or modified in its 2′ position, i.e. 2′allyl or 2′-O-allyl. An example of a 2′-O-allyl sugar is a 2′-O-methylribonucleotide. Further, the phosphorothioate oligonucleotide may have one or more of its sugars substituted or modified to form an α-anomeric sugar. [0085]
  • A catalytic nucleic acid may include non-nucleotide substitution. The non-nucleotide substitution includes either abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid or polyhydrocarbon compounds. The term “abasic” or “abasic nucleotide” as used herein encompasses sugar moieties lacking a base or having other chemical groups in place of base at the 1′ position. [0086]
  • Determining the effective amount of the instant nucleic acid molecules can be done based on animal data using routine computational methods. In one embodiment, the effective amount contains between about 10 ng and about 100 μg of the instant nucleic acid molecules per kg body mass. In another embodiment, the effective amount contains between about 100 ng and about 10 μg of the nucleic acid molecules per kg body mass. In a further embodiment, the effective amount contains between about 1 μg and about 5 μg, and in a further embodiment about 2 μg, of the nucleic acid molecules per kg body mass. [0087]
  • In another embodiment the second agent is cardiomyocyte progenitor cells. In another embodiment the second agent is skeletal muscle progenitor cells. Either of theses cell types can be derived from embryonic, fetal or adult subjects. [0088]
  • In one embodiment the second agent promotes trafficking of the endothelial progenitor cells to the subject's heart. [0089]
  • In a further embodiment the second agent that promotes trafficking is an antibody directed against an epitope of CXCR4. [0090]
  • In another further embodiment the second agent that promotes trafficking is a CC chemokine. In further embodiments the CC chemokine is RANTES, EOTAXIN, monocyte chemoattractant protein-1 (MCP-1), MCP-2, MCP-3, or MCP. [0091]
  • In another further embodiment the second agent that promotes trafficking is a CXC chemokine. In further embodiments the CXC chemokine is Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1. [0092]
  • This invention also provides a method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising: [0093]
  • (a) quantitating the amount of a mRNA encoding peroxiredoxin in the cardiomyocyte; [0094]
  • (b) quantitating the amount of a mRNA encoding Vitamin D3 Up-Regulated Protein-1 in the cardiomyocyte; and [0095]
  • (c) determining the ratio of the amount of mRNA encoding peroxiredoxin: amount of mRNA encoding Vitamin D3 Up-Regulated Protein-1, wherein a low ratio indicates a high susceptibility of the cardiomyocyte to apoptosis and a high ratio indicates a low susceptibility of the cardiomyocyte to apoptosis in the subject. [0096]
  • This invention also provides a method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising: [0097]
  • (a) quantitating the expression of a peroxiredoxin protein in the cardiomyocyte; [0098]
  • (b) quantitating the expression of Vitamin D3 Up-Regulated Protein-1 in the cardiomyocyte; and [0099]
  • (c) determining the ratio of the peroxiredoxin protein expression: Vitamin D3 Up-Regulated Protein-1 expression, wherein a low ratio indicates a high susceptibility of the cardiomyocyte to apoptosis and a high ratio indicates a low susceptibility of the cardiomyocyte to apoptosis in the subject. [0100]
  • A ratio that is at least two standard deviations above that found in control patients with normal hearts is considered a high ratio. Quantitation of expression of protein in cardiomyocytes is performed using routine methods known to those of skill in the art, for example, northern and western blots. [0101]
  • In one embodiment the subject of any of the above methods is a mammal and in a preferred further embodiment the mammal is a human being. In one embodiment the subject has a cardiovascular disease. In further embodiments the subject has congestive heart failure, has suffered a myocardial infarct, has suffered myocardial ischemia, has angina, or has a cardiomyopathy. [0102]
  • This invention will be better understood by reference to the Experimental Details which follow, but those skilled in the art will readily appreciate that the specific experiments detailed are only illustrative of the invention as described more fully in the claims which follow thereafter. [0103]
    • EXPERIMENTAL RESULTS
  • Results [0104]
  • CXC Chemokines Regulate Endothelial Progenitor Cell Migration to the Heart [0105]
  • We investigated the in vivo role of CXC receptor-ligand interactions in mediating chemotaxis of human Endothelial progenitor cell to ischemic tissue and subsequent induction of vasculogenesis, using myocardial infarction in the LAD-ligated nude rat model. As shown in FIG. 1[0106] a, DiI-labelled human CD34+ cells obtained by G-CSF mobilization (>98% CD34 purity, containing 6-12% CD117bright endothelial progenitor cells) were selectively detected in infarcted myocardium after intravenous injection, but not in myocardium from sham-operated rats. Co-administration of blocking mAbs against rat Cinc (the rat homologue of human IL-8 and Gro-alpha), or against the human surface receptors for these pro-angiogenic chemokines, CXCR1 or CXCR2, reduced myocardial trafficking of human bone marrow-derived CD34+ cells at 48 hours by 40-60% relative to control antibodies (p<0.01), FIG. 1b. By two weeks, rats receiving human CD34+ cells demonstrated significantly increased infarct bed microvascularity in comparison to rats receiving saline, FIG. 1c, and this was reduced by 50% when anti-CXCR1/2 mAbs were co-administered. Since we have previously shown that the vasculogenic properties of CD34+ cells are abolished after depletion of the minor CD117bright angioblast fraction (7), these results indicate that by regulating angioblast migration to ischemic tisssues CXC chemokines influence the development of vasculogenesis at these sites. In contrast, although direct intracardiac injection of IL-8 or SDF-1 at 1.0 μg/ml into non-infarcted hearts resulted in 2.3 and 2.5-fold increases in myocardial infiltration by human CD34+ cells at 48 hours (both p<0.01), FIG. 1d, no vasculogenesis was observed at two weeks under these conditions. Together, these results indicate that following chemokine-induced migration to the infarct zone, differentiation of endothelial progenitor cell to mature endothelial cells and induction of vasculogenesis require additional factors, as yet undefined, which are produced under ischemic conditions.
  • Inhibiting CXCR4/SDF-1 Interactions Redirects Endothelial Progenitor Cells to the Heart [0107]
  • Although LAD coronary artery ligation resulted in trafficking of intravenously injected human endothelial progenitor cells to the site of ischemic myocardium, it was also accompanied by increased distribution of human cells to rat bone marrow. As shown in FIG. 2[0108] a, at 2-14 days after intravenous injection of 2×106 human CD34+ cells bone marrow from LAD-ligated rats contained 5-8 fold higher levels of human CD117bright endothelial progenitor cells compared with bone marrow from normal rats, p<0.001. This was presumably due to the proliferative effects of factors in ischemic serum since we have previously shown that culture for 2 days with ischemic serum increases proliferation of CD34+CD117bright human endothelial progenitor cells by 4-5 fold (7). Because the migration of actively cycling CD34+ cells to bone marrow is promoted by SDF-1 produced constitutively by marrow stromal cells (31), we investigated whether the distribution of human CD34+CD117bright endothelial progenitor cells to ischemic rat bone marrow involved SDF-1/CXCR4 interactions. As shown in FIG. 2b, co-administration of mAbs against either human CXCR4 or rat SDF-1 significantly inhibited migration of intravenously administered human endothelial progenitor cells to ischemic rat bone marrow compared with anti-CD34 control antibody (both p<0.001). Moreover, co-administration of mAbs against either human CXCR4 or rat SDF-1 increased trafficking of CD34+ human endothelial progenitor cells to ischemic rat myocardium by means of 24% and 17%, respectively (both p<0.001), FIG. 2c.
  • Capillary Lumen Size is Dependent on Absolute Angioblast Numbers [0109]
  • We next examined the relationship between angioblast number, myocardial neovascularization, and protection against myocyte apoptosis. Two days following LAD ligation animals were intravenously injected with G-CSF mobilized CD34+ human cells reconstituted with varying proportions of CD117[0110] bright endothelial progenitor cells (103, 105, 105 plus anti-CXCR4 mAb, 2×105, and 2×105 plus anti-CXCR4 mAb). Similar numbers of DiI-labelled human cells were detected in the infarct zone 48 hours after injecting each cellular population, data not shown. Induction of neovascularization at two weeks was measured by performing quantitative analysis of medium- and large-sized capillaries, defined, respectively, as having 3-6 or >6 contiguous endothelial lining cells. Medium-sized capillaries had mean lumen diameter of 0.020 mm+0.002, while large-sized capillaries had mean lumen diameter of 0.053 mm+0.004 (p<0.001). Notably, large-lumen capillaries overlapped in size with arterioles which could be distinguished by a thin layer containing 2-3 smooth muscle cells of rat origin, as determined by positive staining with desmin and rat MHC class I mAbs. As shown in FIGS. 3a-c, both the group receiving 2×105 endothelial progenitor cells and the one receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb demonstrated 1.7-fold higher numbers of medium-sized capillaries compared with the other two groups (p<0.01). The group receiving 2×105 endothelial progenitor cells additionally demonstrated 3.3-fold higher numbers of large-lumen capillaries compared with the groups receiving 103 or 105 endothelial progenitor cells (p<0.01), and 2-fold higher numbers of large-lumen capillaries compared with the group receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb (p<0.01). As shown in FIG. 3d, co-administration of anti-CXCR4 mAb together with the highest concentration of endothelial progenitor cells, 2×105, resulted in a further 23% increase in growth of large-lumen capillaries. More strikingly, there was a further 2-fold increase in capillary numbers when 2×105 endothelial progenitor cells were injected intravenously after direct intracardiac delivery of 1.0 μg/ml SDF-1 into infarcted hearts (p<0.01). Since no similar increase in peri-infarct capillary numbers was seen after intracardiac delivery of IL-8, we interpret these results to indicate that the endogenous IL-8 concentrations in ischemic rat hearts were sufficient to saturate angioblast CXCR1/2 receptors in vivo, whereas intracardiac injection of SDF-1 resulted in a shift in the balance of SDF-1 expression between bone marrow and heart, and consequently resulted in redirected angioblast trafficking to the ischemic heart.
  • As shown in FIG. 3[0111] e, the number of apoptotic cardiomyocytes at the infarct rim was significantly reduced in both rats receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb and those receiving 2×105 endothelial progenitor cells compared with the groups receiving either 103 or 105 endothelial progenitor cells alone (both p<0.001). Moreover, co-administration of anti-CXCR4 mAb or intracardiac injection of SDF-1 resulted in further reductions in cardiomyocyte apoptosis of 65% and 76%, respectively, FIG. 3f (both p<0.001). Together, these data indicate that post-infarct cardioprotection against myocyte apoptosis is dependent on myocardial neovascularization induced by a critical number of intravenously injected endothelial progenitor cells. This threshold can apparently be lowered by strategies that prevent endothelial progenitor cell redistribution to the bone marrow, such as interrupting CXCR4/SDF-1 interactions, or enhanced SDF-1 expression in the ischemic myocardium.
  • Capillary Lumen Size as Determinant of Improvement in Cardiac Function [0112]
  • We next examined the effect of increasing the number of human endothelial progenitor cells trafficking to ischemic myocardium on long-term myocardial function, defined as the degree of improvement in left ventricular ejection fraction (LVEF) and reduction in left ventricular end-systolic area (LVAs) at 15 weeks after intravenous injection, FIGS. 4[0113] a and b. No improvement in these parameters was observed in the groups receiving 103 or 105 endothelial progenitor cells in comparison to rats receiving saline alone. In contrast, rats receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb demonstrated significant improvement in these parameters, 22+2% mean recovery in LVEF and 24+4% mean reduction in LVAs (both p<0.001). Even more strikingly, the group receiving 2×105 endothelial progenitor cells had a mean recovery in LVEF of 34+4% and a mean reduction in LVAs of 37+6% (both p<0.001), or 50% further improvement in both parameters. These results were very surprising to us since both groups of animals had demonstrated the same degree of neovascularization involving medium-sized capillaries at two weeks together with similar levels of protection against early apoptosis of cardiomyocytes. This suggested that the additional functional long-term improvement in rats receiving 2×105 human endothelial progenitor cells was related to the early development of large-sized capillaries and was mediated through a different mechanism than protection against myocyte apoptosis.
  • Large Capillaries Induce Sustained Regeneration of Endogenous Myocytes [0114]
  • Although myocyte hypertrophy and increase in nuclear ploidy have generally been considered the primary mammalian cardiac responses to ischemia, damage, and overload (1,2) recent observations have suggested that human cardiomyocytes have the capacity to proliferate and regenerate in response to injury (18,19). Therefore, we investigated whether the additive improvement in cardiac function observed after injection of 2×10[0115] 5 human endothelial progenitor cells involved induction of cardiomyocyte proliferation and/or regeneration. At two weeks after LAD ligation rats receiving 2×105 human endothelial progenitor cells demonstrated numerous “fingers” of cardiomyocytes of rat origin, as determined by expression of rat MHC class I molecules, extending from the peri-infarct region into the infarct zone. Similar extensions were seen less frequently in animals receiving 103 and 105 endothelial progenitor cells, and very rarely in those receiving saline. As shown in FIG. 4c, the islands of cardiomyocytes at the peri-infarct rim in animals receiving 2×105 human endothelial progenitor cells contained a high frequency of rat myocytes with DNA activity, as determined by dual staining with mAbs reactive against cardiomyocyte-specific troponin I and rat Ki-67. In contrast, in animals receiving saline there was a high frequency of cells with fibroblast morphology and reactivity with rat Ki-67, but not troponin I, within the infarct zone. The number of cardiomyocytes progressing through cell cycle at the peri-infarct region of rats receiving 2×105 human endothelial progenitor cells was 40-fold higher than that at sites distal to the infarct, where myocyte DNA activity was no different than in sham-operated rats. As shown in FIG. 4d, animals receiving 2×105 human endothelial progenitor cells had a 20-fold higher number of cell-cycling cardiomyocytes at the peri-infarct rim than that found in non-infarcted hearts (1.19+0.2% vs 0.06+0.03%, p<0.01) and 3.5-fold higher than in the same region in LAD-ligated controls receiving saline (1.19+0.2% vs 0.344+0.1%, p<0.01). When 2×105 human endothelial progenitor cells were intravenously injected after direct intracardiac delivery of 1.0 μg/ml SDF-1 into infarcted hearts, the number of cell-cycling cardiomyocytes at the peri-infarct rim was increased by a further 1.9-fold compared with intravenous injection of 2×105 human endothelial progenitor cells alone (FIG. 4 e, p<0.01). Thus, intracardiac injection of SDF-1 in combination with intravenous injection of 2×105 human endothelial progenitor cells resulted in approximately an 8-fold cumulative increase in cell-cycling cardiomyocytes at two weeks compared with LAD-ligated controls receiving saline, and translated into over 4-fold greater LVEF improvement, determined by echocardiography, compared with intravenous injection of 2×105 endothelial progenitor cells alone (FIG. 4f, p<0.01). Co-administration of anti-CXCR4 mAb augmented LVEF improvement by 2.8-fold (p<0.01) while intracardiac injection of IL-8 conferred no additive benefit.
  • Quantitation of the ratio of fibrous tissue to myocytes at 15 weeks demonstrated significantly reduced proportions of scar/normal left ventricular myocardium in both the group receiving 2×10[0116] 5 endothelial progenitor cells and the one receiving 105 endothelial progenitor cells plus anti-CXCR4 mAb, respectively 13% and 21% compared with 37-46% for each of the other groups (p<0.01), FIG. 4g. Since both groups had nearly identical levels of protection against early cardiomyocyte apoptosis, we infer that the additional 38% reduction in scar/myocyte ratio seen in the group injected with 2×105 endothelial progenitor cells actually reflects proliferation/regeneration of endogenous rat cardiomyocytes induced by nutrient supply from large-vessel neovascularization. This presumably accounts for the increase in functional improvement seen in this group. We conclude that the ratio of scar size to left ventricular muscle mass reflects, in part, positive effects imparted by the ability of the residual myocardium to proliferate and regenerate, in addition to negative effects of the initial infarct size and positive effects of anti-apoptotic, cardioprotective mechanisms. The overall effects of medium- and large-size neovasculature combining to both protect against myocyte apoptosis and induce myocyte proliferation/regeneration are shown dramatically in FIG. 4h where, in contrast to saline controls, injection with 2×105 endothelial progenitor cells resulted in almost complete salvage of the anterior myocardium, normal septal size and minimal collagen deposition.
  • PAI-1-Inhibiting Catalytic Nucleic Acid Augments Human Angioblast-Dependent Cardiomyocyte Regeneration [0117]
  • We investigated whether possible neovascularization induced by a catalytic nucleic acid (designated E2) capable of inhibiting expression of PAI-1 was associated with cardiomyocyte regeneration. Injection of E2 alone did not induce cardiomyocyte regeneration despite the increase in neovascularization. Combining E2 injection with intravenously delivered human endothelial progenitor cells strikingly increased the degree of cardiomyocyte regeneration, to levels 7.5-fold higher than in saline controls (p<0.01). A scrambled DNA control enzyme (E0) had no such effect. Moreover, whereas E2 alone did not improve myocardial function, as determined by recovery in left ventricular ejection fraction at two weeks combining E2 with human endothelial progenitor cells resulted in almost doubling of the positive effect of endothelial progenitor cells alone on cardiac functional recovery. These results emphasize the importance of cardiomyocyte regeneration as the primary mechanism by which cardiac function is improved after infarction. Since combining E2 with human endothelial progenitor cells resulted in 62% greater numbers of large capillaries at the peri-infarct rim than use of either approach alone, these results indicate that angioblast-induced cardiomyocyte regeneration and improvement in cardiac function can be optimized by use of synergistic approaches, such as strategies that inhibit PAI-1 expression, which augment neovascularization either directly or through angioblast-dependent processes. [0118]
  • Gene Effects on Myocyte Proliferation [0119]
  • We hypothesized that myocardial neovascularization induces the signals required to elicit myocyte proliferation, and therapeutic intervention mimicking this could have striking implications for repair and regeneration of hearts damaged by episodes of ischemia or other insults. [0120]
  • To begin approaching this complex problem, we have employed the technique of cDNA Subtractive Hybridization. This technique enables comparison of the pattern of gene expression between two different sets of conditions. Our initial approach was to compare which genes are differentially expressed between hearts from normal rats and rats who have undergone left anterior descending (LAD) coronary artery ligation 48 hours earlier. We hypothesized that whatever the altered pattern of gene over- or underexpression after 48 hours of ischemia, neovascularization would result in a reversal in the pattern towards that seen in the non-ischemic rat heart. [0121]
  • Using cdNA subtractive hybridization we observed a striking reciprocal change in expression of a group of genes whose function is linked through their regulation of cellular apoptosis and cell cycle progression following oxidative stress and other inducers of DNA damage. Whereas expression of certain antioxidant genes such as superoxide dismutase was upregulated in ischemic tissue, the antioxidant stress responsive genes induced by hemin, notably heme binding protein 23 (HBP23) and glutathione-S-transferase, were downregulated. Moreover, a recently-identified protein, Vitamin D3 Up-Regulated Proteinl (VDUP1), whose mRNA expression is induced by hydrogen peroxide (H[0122] 2O2) following oxidative stress and whose function counterbalances that of HBP23, was upregulated in ischemic hearts. These findings are particularly striking when considered in the context of previous observations that the presence of deficits in antioxidants and increased oxidative stress accompanying myocardial infarction appear to be directly implicated in the pathogenesis of post-infarct heart failure (74,75).
  • As shown in FIG. 5, using RT-PCR, the reciprocal changes in mRNA expression of HBP23 and VDUP1 in ischemic vs normal rat hearts were confirmed. Moreover, mRNA expression of these two genes returned to normal in rat tissue two weeks after intravenous injection of human adult bone marrow-derived progenitors and infarct zone neovascularization. In contrast, in LAD-ligated rat hearts receiving saline, no change in mRNA expression of these genes was observed at two weeks in comparison to the pattern observed at 48 hours. To comprehend the relationship between the effects of neovascularization on these altered expression patterns of HBP23 and VDUP1 following ischemia, and the observed protection against cardiomyocyte apoptosis together with induction of cardiomyocyte proliferation/regeneration, it is important to understand in detail the molecular effects of the products encoded by these genes on cellular apoptosis and cell cycle progression. [0123]
  • When cells proliferate, the mitotic cycle progression is tightly regulated by an intricate network of positive and negative signals. Progress from one phase of the cell cycle to the next is controlled by the transduction of mitogenic signals to cyclically expressed proteins known as cyclins and subsequent activation or inactivation of several members of a conserved family of serine/threonine protein kinases known as the cyclin-dependent kinases (cdks) (67). Growth arrest observed with such diverse processes as DNA damage, terminal differentiation, and replicative senescence is due to negative regulation of cell cycle progression by two functionally distinct families of Cdk inhibitors, the Ink4 and Cip/Kip families (64). The cell cycle inhibitory activity of p21Cip1/WAF1 is intimately correlated with its nuclear localization and participation in quaternary complexes of cell cycle regulators by binding to G1 cyclin-CDK through its N-terminal domain and to proliferating cell nuclear antigen (PCNA) through its C-terminal domain (68-71). The latter interaction blocks the ability of PCNA to activate DNA polymerase, the principal replicative DNA polymerase (72). For a growth-arrested cell to subsequently enter an apoptotic pathway requires signals provided by specific apoptotic stimuli in concert with cell-cycle regulators. For example, caspase-mediated cleavage of p21, together with upregulation of cyclin A-associated cdk2 activity, have been shown to be critical steps for induction of cellular apoptosis by either deprivation of growth factors (73) or hypoxia of cardiomyocytes (74). [0124]
  • The apoptosis signal-regulating kinase 1 (ASK1) is a pivotal component in the mechanism of cytokine- and stress-induced apoptosis (75,76). Under basal conditions, resistance to ASK1-mediated apoptosis appears to be the result of complex formation between ASK1, cytoplasmic p21Cip1/WAF1 (77), and the thiol reductase thioredoxin (TRX) (78). Intact cytoplasmic expression of p21Cip1/WAF1 appears to be important for both prevention of apoptosis in response to ASK1 (75) and in maintaining a state of terminal differentiation (77). Moreover, the reduced form of TRX, but not the oxidized form, binds to the N-terminal portion of ASK1 and is a physiologic inhibitor of ASK1-mediated cellular apoptosis (78). The recently-identified protein VDUP1 has been shown to compete with ASK1 for binding of the reduced form of TRX (78,79), resulting in augmention of ASK1-mediated apoptosis (80). This indicates that ASK1-mediated cellular apoptosis is increased by processes that result in a net dissociation of TRX from ASK1, such as either generation of TRX-VDUP1 complexes or generation of oxidised TRX by changes in cellular redox status accompanying oxidative stress. [0125]
  • TRX and glutathione constitute the major cellular reducing systems that maintain the thiol-disulfide status of the cytosol (81). The redox-active/dithiol active site of TRX is highly conserved across all species, Trp-Cys-Gly-Pro-Cys-Lys. The two cysteine residues at the active site, Cys-32 and Cys-35, undergo reversible oxidation-reduction reactions catalyzed by a NADPH-dependent enzyme TRX reductase. These reactions involve electron transfer via disulfide bridges formed with members of a family of antioxidant enzymes known as peroxiredoxins (Prxs), which show peroxidase activity (82,83). Prxs are distinct from other peroxidases in that they have no cofactors, such as metals or prosthetic groups. Prxs generally have two conserved cysteines at the N- and C-terminal regions (84), and their antioxidant effects are coupled with the physiological electron donor activity of the TRX system (82,85,86). Prxs with 95-97% sequence homology have been identified in rats (Heme-binding [0126] protein 23, HBP23) (87), mice (mouse macrophage stress protein 23, MSP23) (88) and humans (proliferation-associated gene product, PAG (89) and human natural killer cell-enhancing factor A (90)).
  • Prxs are members of a repertoire of oxidative stress responsive genes whose expression is regulated by NF-E2-related factor 2 (Nrf2) which binds to an anti-oxidant responsive element (ARE) present in the promoter of each (91). These include glutathione-S-transferase, heme oxygenase-1, and TRX. Under basal conditions, Nrf2 is bound to a specific protein, Keap1, in the cytosol (92). However, under conditions of oxidative stress Nrf2 dissociates from Keap1 and translocates to the nucleus where it induces transcriptional activation of the anti-oxidant genes containing ARE motifs. Although the precise extracellular signalling pathways have not been elucidated, nuclear translocation of Nrf2 and subsequent ARE activation appear to be dependent on pathways activated by phosphatidylinositol 3-kinase (PI3 kinase) (93). In addition, hemin is a potent inducer of Nrf2 dissociation from Keap1, resulting in TRX gene transcription through the ARE (94). [0127]
  • During periods of rapid changes in cellular redox Prxs presumably serve to maintain the cytosolic levels of reduced TRX by accepting electrons from the oxidized form of TRX. This homeostatic mechanism likely enables maintenance of sufficient levels of reduced TRX to ensure adequate binding to ASK1 and prevention of cellular apoptosis. If the endogenous Prx system is overloaded, as might occur during changes in cellular redox when excess oxidized TRX is generated, cellular apoptosis will occur through the unopposed effects of ASK1. To counteract this, transcriptional activation of Prxs must occur following oxidative stress via nuclear translocation of Nrf2. This can be achieved either by Nrf2 dissociation from Keap1 via hemin- and PI3 kinase-dependent mechanisms (93,94), or by increasing Nrf2 mRNA and protein expression as occurs following increase in oxygen tension (95,96). [0128]
  • In addition to directly interacting with TRX, the Prx gene products (PAG, HBP23, MSP23, NKEF, etc) specifically bind the SH3 domain of c-Abl, a non-receptor tyrosine kinase, inhibiting its activation by various stimuli, including agents that damage DNA (97). c-Abl activation through the SH3 domain induces either arrest of the cell cycle in phase G1 or cellular apoptosis (98). Cell cycle arrest is dependent on the kinase activity of c-Abl (96) and is mediated by the ability of c-Abl to downregulate the activity of the cyclin-dependent kinase Cdk2 and induce the expression of p21 (99). The apoptotic effects of c-Abl are dependent on the ability of nuclear c-Abl to phosphorylate p73, a member of the p53 family of tumor-suppressor proteins which can induce apoptosis (100,101). Recently, it has been shown that cytoplasmic, rather than nuclear, forms of c-Abl are activated by H[0129] 2O2 and that this results in mitochondrial localization of c-Abl, c-Abl dependent cytochrome c release, and cellular apoptosis following oxidative stress (102,103). By associating with c-Abl in vivo, the PAG gene product (and presumably the other Prxs) can inhibit tyrosine phosphorylation induced by c-Abl overexpression and rescue cells from both the cytostatic and pro-apoptotic effects of the activated c-Abl gene product (97).
  • Our finding that Nrf2-dependent oxidative stress responsive genes are downregulated following myocardial ischemia likely reflects direct effects of hemin and oxygen deprivation. The end result of Prx downregulation in the ischemic heart would be augmentation in ASK1-dependent cellular apoptosis as well as Abl-dependent apoptosis and cell cycle arrest. The observed parallel increase in VDUP1 expression would further augment ASK1-dependent cellular apoptosis. Thus, the ratio in expression of PAG or other Prx mRNA or protein to VDUP1 mRNA or protein can form the basis of a diagnostic assay to predict the degree of risk for cardiomyocyte apoptosis and cell cycle arrest after ischemia, as well as enable monitoring of the response to specific therapy after myocardial ischemia that protects cardiomyocytes against apototic death and enhances myocardial proliferation/regeneration. [0130]
  • Reversing the reduced expression of the Prxs following myocardial ischemia would increase Prxs in the heart in order to protect the ischemic myocardium against apoptosis through both c-Abl inhibition and reduction of oxidised TRX, and to enable cardiomyocyte proliferation/regeneration by inhibiting the effects of c-Abl on cell cycle progression from G1 to S phase. [0131]
  • Increasing Nrf2 mRNA or causing dissociation of Nrf2 protein from Keap1, or preferably cause both to occur simultaneously, in the setting of myocardial ischemia in order to increase transcription and activity of members of a repertoire of oxidative stress responsive genes whose expression is regulated by binding of Nrf2 to an anti-oxidant responsive element (ARE) in their promoters, including the Prxs, TRX and glutathione-S-transferase would result in both protection of cardiomyocytes against apoptosis as well as induce cardiomyocyte cell cycle progression following oxidative stress. [0132]
  • Reducing the expression of VDUP1 following myocardial ischemia would protect the ischemic myocardium against apoptosis by reducing binding of TRX to VDUP1, and consequently increasing TRX-ASK1 interactions. [0133]
  • Neovascularization of the myocardium, by either bone marrow-derived endothelial progenitors or any other process, is an example of one method which causes induction of Prx expression and reduction in VDUP1 expression after myocardial ischemia, and results in both protection against redox-mediated apoptosis and induction of myocardial proliferation/regeneration. [0134]
  • Small molecules which specifically inhibit binding of Nrf2 to Keap1 would be expected to have similar protective effects against cardiomyocyte apoptosis and to induce myocardial proliferation/regeneration after ischemia. Similarly, small molecules that specifically inhibit binding of TRX to VDUP1, would be expected to have similar protective effects against cardiomyocyte apoptosis after ischemia. [0135]
  • Use of small molecules to specifically inhibit c-Abl tyrosine kinase activation after myocardial ischemia would be expected to have similar protective effects against cardiomyocyte apoptosis and to induce myocardial proliferation/regeneration after ischemia. A specific example of a small molecule to inhibit c-Abl tyrosine kinase activation is STI-571. Use of this or related molecules after myocardial infarction would protect against cardiomyocyte apoptosis and induce myocardial proliferation/regeneration. [0136]
    • Methods and Materials
  • Purification and Characterization of Cytokine-Mobilized Human CD34+ Cells: [0137]
  • Single-donor leukopheresis products were obtained from humans treated with recombinant G-[0138] CSF 10 mg/kg (Amgen, CA) sc daily for four days. Donors were healthy individuals undergoing standard institutional procedures of bone marrow mobilization, harvesting and isolation for allogeneic stem cell transplants. Mononuclear cells were separated by Ficoll-Hypaque, and highly-purified CD34+ cells (>98% positive) were obtained using magnetic beads coated with anti-CD34 monoclonal antibody (mAb) (Miltenyi Biotech, CA). Purified CD34 cells were stained with fluorescein-conjugated mAbs against CD34 and CD117 (Becton Dickinson, CA), AC133 (Miltenyi Biotech, CA), CD54 (Immunotech, CA), CD62E (BioSource, MA), VEGFR-2, Tie-2, vWF, eNOS, CXCR1, CXCR2, and CXCR4 (all Santa Cruz Biotech, CA), and analyzed by four-parameter fluorescence using FACScan (Becton Dickinson, CA). Cells positively selected for CD34 expression were also stained with phycoerythrin (PE)-conjugated anti-CD117 mAb (Becton Dickinson, CA), and sorted for bright and dim fluorescence using a Facstar Plus (Becton Dickinson) and a PE filter. Intracellular staining for GATA-2 was performed by permeabilizing one million cells from each of the brightly and dimly fluorescing cell populations using a Pharmingen Cytofix/Cytoperm™ kit, incubating for 30 minutes on ice with 10 μl of fluorochrome-conjugated mAbs against both CD117 and CD34 surface antigens (Becton Dickinson, CA). After resuspension in 250 μl of Cytofix/Cytoperm™ solution for 20 minutes at 4 degrees C., cells were incubated with a fluorochrome-labeled mAb against GATA-2 (Santa Cruz Biotech, CA) or IgG control for 30 minutes at 4 degrees C., and analyzed by three-parameter flow cytometry.
  • Chemotaxis of Human Bone-Marrow Derived Endothelial Progenitors: [0139]
  • Highly-purified CD34+CD117[0140] bright cells (>98% purity) were plated in 48-well chemotaxis chambers fitted with membranes (8 mm pores) (Neuro Probe, MD). After incubation for 2 hours at 37° C., chambers were inverted and cells were cultured for 3 hours in medium containing IL-8, SDF-1 alpha/beta, and SCF at 0.2, 1.0 and 5.0 μg/ml. The membranes were fixed with methanol and stained with Leukostat™ (Fischer Scientific, Ill.). Chemotaxis was calculated by counting migrating cells in 10 high-power fields.
  • Animals, Surgical Procedures, Injection of Human Cells, and Quantitation of Cellular Migration into Tissues: [0141]
  • Rowett (rnu/rnu) athymic nude rats (Harlan Sprague Dawley, Indianapolis, Ind.) were used in studies approved by the “Columbia University Institute for Animal Care and Use Committee”. After anesthesia, a left thoracotomy was performed, the pericardium was opened, and the left anterior descending (LAD) coronary artery was ligated. Sham-operated rats had a similar surgical procedure without having a suture placed around the coronary artery. For studies on cellular migration, 2.0×10[0142] 6 CD34+ cells obtained from a single donor after G-CSF mobilization were injected into the tail vein 48 hours after LAD ligation either alone or together with 50 μg/ml monoclonal antibody (mAb) with known functional inhibitory activity against either human CXCR1, human CXCR2, human CXCR4, rat SDF-1 (all R & D Systems, MN), human CD34 (Pharmingen, CA), or rat IL-8 (ImmunoLaboratories, Japan). Controls received either isotype control antibodies at the same concentration or saline after LAD ligation. Prior to injection, 2.0×106 human cells were incubated with 2.5 μg/mL of the fluorescent carbocyanine DiI dye (Molecular Probes) for 5 minutes at 37° C. and 15 minutes at 4° C. After washing in PBS, DiI-labeled human cells were resuspended in saline and injected intravenously. 2.0×106 CD34+ human cells were also injected into the tail vein of sham-operated or LAD-ligated rats receiving three intramyocardial injections of 1.0 μg/ml recombinant human IL-8, SDF-1, SCF or saline. Each group consisted of 6-10 rats. Quantitation of myocardial infiltration after injection of human cells was performed by assessment of DiI fluorescence in hearts from rats sacrificed 2 days after injection (expressed as number of DiI-positive cells per high power field, minimum 5 fields examined per sample). Quantitation of rat bone marrow infiltration by human cells was performed in 12 rats at baseline, days 2, 7, and 14 by flow cytometric and RT-PCR analysis of the proportion of HLA class I-positive cells relative to the total rat bone marrow population. For studies on neoangiogenesis and effects on myocardial viability and function, 2.0×106 DiI-labelled human CD34+ cells obtained from a single donor after G-CSF mobilization were reconstituted with 103, 105, or 2.0×105 immunopurified CD34+CD117bright cells, and injected into the rat tail vein 48 hours after LAD ligation, in the presence or absence of a mAb with known inhibitory activity against CXCR4. Each group consisted of 6-10 rats. Histologic and functional studies were performed at 2 and 15 weeks.
  • Measurement of Rat CXC Chemokine mRNA and Protein Expression: [0143]
  • Poly(A)+ mRNA was extracted by standard methods from the hearts of 3 normal and 12 LAD-ligated rats. RT-PCR was used to quantify myocardial expression of rat IL-8 and Gro-alpha mRNA at baseline and at 6, 12, 24 and 48 hours after LAD ligation after normalizing for total rat RNA as measured by GAPDH expression. After priming with oligo (dT) 15-mer and random hexamers, and reverse transcribed with Moloney murine lymphotrophic virus reverse transcriptase (Invitrogen, Carlsbad, Calif., U.S.A.), cDNA was amplified in the polymerase chain reaction (PCR) using Taq polymerase (Invitrogen, Carlsbad, Calif., U.S.A.), radiolabeled dideoxy-nucleotide ([a32P]-ddATP: 3,000 Ci/mmol, Amersham, Arlington Heights, Ill.), and primers for rat Cinc (rat homologue of human IL-8/Gro-alpha and GAPDH (Fisher Genosys, CA). Primer pairs (sense/antisense) for rat Cinc and GAPDH were, gaagatagattgcaccgatg (SEQ ID NO:4)/catagcctctcacatttc SEQ ID NO:5), gcgcccgtccgccaatgagctgcgc SEQ ID NO:6)/cttggggacacccttcagcatcttttgg SEQ ID NO:7), and ctctacccacggcaagttcaa SEQ ID NO:8)/gggatgaccttgcccacagc SEQ ID NO:9), respectively. The labelled samples were loaded into 2% agarose gels, separated by electrophoresis, and exposed for radiography for 6 h at −70° C. Serum levels of rat IL-8/Gro-alpha were measured at baseline and at 6, 12, 24 and 48 hours after LAD ligation in four rats by a commercial ELISA using polyclonal antibodies against the rat IL-8/Gro homologue Cinc (ImmunoLaboratories, Japan). The amount of protein in each serum sample was calculated according to a standard curve of optical density (OD) values constructed for known levels of rat IL-8/Gro-alpha protein. Anti-Cinc antibodies were also used according to the manufacturer's instructions at 1:200 dilution in immunohistochemical studies to identify the cellular source of Cinc production in rat myocardium after LAD ligation. Positively-staining cells were visualized as brown through the Avidin/Biotin system described below. [0144]
  • Histology and Measurement of Infarct Size: [0145]
  • Following excision at 2 and 15 weeks, left ventricles from each experimental animal were sliced at 10-15 transverse sections from apex to base. Representative sections were fixed in formalin and stained for routine histology (H&E) to determine cellularity of the myocardium, expressed as cell number per high power field (HPF) (600×). A Masson trichrome stain was performed, which labels collagen blue and myocardium red, to evaluate collagen content on a semiquantitative scale (0-3+), with 1+ light blue, 2+ light blue and patches of dark blue, and 3+ dark blue staining. This enabled measurement of the size of the myocardial scar using a digital image analyzer. The lengths of the infarcted surfaces, involving both epicardial and endocardial regions, were measured with a planimeter digital image analyzer and expressed as a percentage of the total ventricular circumference. Final infarct size was calculated as the average of all slices from each heart. All studies were performed by a blinded pathologist. Infarct size was expressed as percent of total left ventricular area. Final infarct size was calculated as the average of all slices from each heart. [0146]
  • Ouantitation of Capillary Density: [0147]
  • In order to quantitate capillary density and species origin of the capillaries, additional sections were stained freshly with mAbs directed against rat or human CD31 (Serotec, UK, and Research Diagnostics, NJ, respectively), factor VIII (Dako, CA), and rat or human MHC class I (Accurate Chemicals, CT). Arterioles were differentiated from large capillaries by the presence of a smooth muscle layer, identified by staining sections with a monoclonal antibody against muscle-specific desmin (Dako, CA). Staining was performed by immunoperoxidase technique using an Avidin/Biotin Blocking Kit, a rat-absorbed biotinylated anti-mouse IgG, and a peroxidase-conjugate (all Vector Laboratories Burlingame, Calif.). Capillary density was determined at 2 weeks post infarction from sections labeled with anti-CD31 mAb, and confirmed with anti-factor VIII mAb, and compared to the capillary density of the unimpaired myocardium. Values are expressed as the number of CD31-positive capillaries per HPF (400x). [0148]
  • Quantitation of Cardiomyocyte Proliferation: [0149]
  • Cardiomyocyte DNA synthesis and cell cycling was determined by dual staining of rat myocardial tissue sections obtained from LAD-ligated rats at two weeks after injection of either saline or CD34+ human cells, and from healthy rats as negative controls, for cardiomyocyte-specific troponin I and human- or rat-specific Ki-67. Briefly, paraffin embedded sections were microwaved in a 0.1M EDTA buffer, and stained with either a primary monoclonal antibody against rat Ki-67 at 1:3000 dilution (gift of Giorgio Catoretti, Columbia University) or human Ki-67 at 1:300 dilution (Dako, CA) and incubated overnight at 4 degrees C. Following washes, sections were incubated with a species-specific secondary antibody conjugated with alkaline phosphatase at 1:200 dilution (Vector Laboratories Burlingame, Calif.) for 30 minutes and positively-staining nuclei were visualized as blue with a BCIP/NBT substrate kit (Dako, CA). Sections were then incubated overnight at 4 degrees C. with a monoclonal antibody against cardiomyocyte-specific troponin I (Accurate Chemicals, CT) and positively-staining cells were visualized as brown through the Avidin/Biotin system described above. Cardiomyocytes progressing through cell cycle in the infarct zone, peri-infarct region, and area distal to the infarct were calculated as the proportion of troponin I-positive cells per high power field co-expressing Ki-67. [0150]
  • Measurement of Myocyte Apoptosis by DNA End-Labeling of Paraffin Tissue Sections: [0151]
  • For in situ detection of apoptosis at the single cell level we used the TUNEL method of DNA end-labeling mediated by dexynucleotidyl transferase (TdT) (Boehringer Mannheim, Mannheim, Germany). Rat myocardial tissue sections were obtained from LAD-ligated rats at two weeks after injection of either saline or CD34+ human cells, and from healthy rats as negative controls. Briefly, tissues were deparaffinized with xylene and rehydrated with graded dilutions of ethanol and two washes in phosphate-buffered saline (PBS). The tissue sections were then digested with Proteinase K (10 μg/ml in Tris/HCL) for 30 minutes at 37° C. The slides were then washed 3 times in PBS and incubated with 50 μl of the TUNEL reaction mixture (TdT and fluorescein-labeled dUTP) and incubated in a humid atmosphere for 60 minutes at 37° C. For negative controls TdT was eliminated from the reaction mixture. Following 3 washes in PBS, the sections were then incubated for 30 minutes with an antibody specific for fluorescein-conjugated alkaline phosphatase (AP) (Boehringer Mannheim, Mannheim, Germany). The TUNEL stain was visualized with a substrate system in which nuclei with DNA fragmentation stained blue, (BCIP/NBT substrate system, Dako, Carpinteria, Calif.). The reaction was terminated following three minutes of exposure with PBS. To determine the proportion of blue-staining apoptotic nuclei within myocytes, tissue was counterstained with a monoclonal antibody specific for desmin. Endogenous peroxidase was blocked by using a 3% hydrogen perioxidase solution in PBS for 15 minutes, followed by washing with 20% goat serum solution. An anti-troponin I antibody (Accurate Chemicals, CT) was incubated overnight (1:200) at 40 degrees C. Following 3 washes sections were then treated with an anti-rabbit IgG, followed by a biotin conjugated secondary antibody for 30 minutes (Sigma, Saint Louis, Mo.). An avidin-biotin complex (Vector Laboratories, Burlingame, Calif.) was then added for an additional 30 minutes and the myocytes were visualized brown following 5 minutes exposure in DAB solution mixture (Sigma, Saint Louis, Mo.). Tissue sections were examined microscopically at 200× magnification. Within each 200× [0152] field 4 regions were examined, containing at least 250 cells per region and cumulatively approximating 1 mm2 of tissue, at both the peri-infarct site and distally to this site. Stained cells at the edges of the tissue were not counted. Results were expressed as the mean number of apoptotic myocytes per mm2 at each site examined.
  • Analysis of Myocardial Function: [0153]
  • Echocardiographic studies were performed using a high frequency liner array transducer (SONOS 5500, Hewlett Packard, Andover, Mass.). 2D images were obtained at mid-papillary and apical levels. End-diastolic (EDV) and end-systolic (ESV) left ventricular volumes were obtained by bi-plane area-length method, and % left ventricular ejection fraction was calculated as [(EDV−ESV)/EDV]×100. [0154]
  • CDNA Subtractive Hybridization: [0155]
  • Briefly, messenger RNA was isolated from each heart, and 1 μg was used for first-strand cDNA synthesis with random primers. The subtractive hybridization was performed with the PCR-select cDNA subtraction kit (CLONTECH), following the manufacturer's recommendations. After second-strand synthesis, the two cDNA libraries were digested with RsaI. Digestion products of the “tester” library were ligated to a specific adapter (T7 promoter), then hybridized with a 30-fold excess of the “driver” library for subtraction. After hybridization, the remaining products were further amplified by PCR. In the forward subtraction, which determines the genes that are overexpressed in the ischemic sample, the ischemic tissue is the “tester” and the normal tissue is the “driver.” In the reverse subtraction, the “tester” and the “driver” are switched to determine the genes that are down-regulated in the ischemic sample. [0156]
  • References [0157]
  • 1. Soonpaa M H, Field L J. Assessment of cardiomyocyte DNA synthesis in normal and injured adult mouse hearts. Am J Physiol 272, H220-6 (1997). [0158]
  • 2. Kellerman S, Moore J A, Zierhut W, Zimmer H G, Campbell J, Gerdes A M Nuclear DNA content and nucleation patterns in rat cardiac myocytes from different models of cardiac hypertrophy. J [0159] Mol Cell Cardiol 24, 497-505 (1992).
  • 3. Colucci, W. S. Molecular and cellular mechanisms of myocardial failure. Am. J. Cardiol. 80(11A), 15L-25L (1997). [0160]
  • 4. Ravichandran, L. V. and Puvanakrishnan, R. In vivo labeling studies on the biosynthesis and degradation of collagen in experimental myocardial myocardial infarction. Biochem. Intl. 24, 405-414 (1991). [0161]
  • 5. Agocha, A., Lee, H. W., Eghali-Webb, M. Hypoxia regulates basal and induced DNA synthesis and collagen type I production in human cardiac fibroblasts: effects of TGF-beta, thyroid hormone, angiotensis II and basic fibroblast growth factor. J. Mol. Cell. Cardiol. 29, 2233-2244 (1997). [0162]
  • 6. Pfeffer, J. M., Pfeffer, M. A., Fletcher, P. J., Braunwald, E. Progressive ventricular remodeling in rat with myocardial infarction. Am. J. Physiol. 260, H1406-414 (1991). [0163]
  • 7. Kocher, A A, et al. Neovascularization of ischemic myocardium by human bone-marrow-derived endothelial progenitor cells prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. [0164] Nat Med 7, 430-6 (2001).
  • 8. Kennedy, M. et al. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature 386, 488-493 (1997). [0165]
  • 9. Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, Keller, G. A common precursor for hematopoietic and endothelial cells. Development 125, 725-732 (1998). [0166]
  • 10. Elefanty, A. G., Robb, L., Birner, R., Begley, C. G. Hematopoietic-specific genes are not induced during in vitro differentiation of scl-null embryonic stem cells. Blood 90, 1435-1447 (1997). [0167]
  • 11. Labastie, M. C., Cortes, F., Romeo, P. H., Dulac, C., Peault, B. Molecular identity of hematopoietic precursor cells emerging in the human embryo. Blood 92, 3624-3635 (1998). [0168]
  • 12. Rafii S, et al. Isolation and characterization of human bone marrow microvascular endothelial cells: hematopoietic progenitor cell adhesion. Blood 84, 10-19 (1994). [0169]
  • 13. Shi, Q. et al. Evidence for circulating bone marrow-derived endothelial cells. Blood 92, 362-367 (1998). [0170]
  • 14. Lin, Y., Weisdorf, D. J., Solovey, A., Hebbel, R. P. Origins of circulating endothelial cells and endothelial outgrowth from blood. J. Clin. Invest. 105, 71-77 (2000). [0171]
  • 15. Asahara, T. et al. Isolation of putative progenitor cells for endothelial angiogenesis. Science 275, 964-967 (1997). [0172]
  • 16. Takahashi, T. et al. Ischemia- and cytokine-induced mobilization of bone marrow-derived endothelial progenitor cells for neovascularization. Nat. Med. 5, 434-438 (1999). [0173]
  • 17. Kalka, C. et al. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization. Proc. Natl. Acad. Sci. USA 97, 3422-3427 (2000). [0174]
  • 18. Kajstura J, Leri A, Finato N, di Loreto N, Beltramo C A, Anversa P. Myocyte proliferation in end-stage cardiac failure in humans. Proc Natl Acad Sci USA 95, 8801-8805 (1998). [0175]
  • 19. Beltrami A P, et al. Evidence that human cardiac myocytes divide after myocardial infarction. N Engl J Med 344, 1750-7 (2001). [0176]
  • 20. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1:27 (1995). [0177]
  • 21. Strieter, R M. et al. Interleukin-8: a corneal factor that induces neovascularization. Am. J. Pathol. 141,1279-1284 (1992). [0178]
  • 22. Murdoch C, Monk P N, Finn A. Cxc chemokine receptor expression on human endothelial cells. Cytokine 11,704-12 (1999). [0179]
  • 23. Koch, A E. et al. Interleukin-8 (IL-8) as a macrophage-derived mediator of angiogenesis. Science, 258:1798-1801 (1992). [0180]
  • 24. Strieter, R M, et al The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J. Biol. Chem. 270, 27348-27357 (1995). [0181]
  • 25. Angiolillo, A L, et al. Human interferon-[0182] inducible protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med 182,155-62 (1995).
  • 26. Feil C, Augustin H G Endothelial cells differentially express functional CXC-chemokine receptor-4 (CXCR-4/fusin) under the control of autocrine activity and exogenous cytokines. Biochem Biophys Res Commun 247, 38-45 (1998). [0183]
  • 27. Tachibana, K. et al. The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 393, 591-594 (1998). [0184]
  • 28. Mohle R, Bautz F, Rafii S, Moore M A, Brugger W., Kanz L. The chemokine receptor CXCR-4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell-derived factor-1. Blood 91, 4523-30 (1998). [0185]
  • 29. Imai, K. et al. Selective secretion of chemoattractants for haemopoietic progenitor cells by bone marrow endothelial cells: a possible role in homing of haemopoietic progenior cells to bone marrow. Br J Haematol 106, 905-11 (1999). [0186]
  • 30. Peled, A. et al. Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4. Science 283, 845-88 (1999). [0187]
  • 31. Voermans C, Gerritsen W R, von dem Borne A E, van der Schoot C E. Increased migration of cord blood-derived CD34+ cells, as compared to bone marrow and mobilized peripheral blood CD34+ cells across uncoated or fibronectin-coated filters. Exp. Hematol. 27, 1806-14 (2000). [0188]
  • 32. Janowska-Wieczorek, A. et al. Growth factors and cytokines upregulate gelatinase expression in bone marrow CD34+ cells and their transmigration through reconstituted basement membrane. Blood 93, 3379-3390 (1999). [0189]
  • 33. Heymans, S. et al. Inhibition of plasminogen activators or matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and causes cardiac failure. Nat. Med. 5, 1135-1142 (1999). [0190]
  • 34. Luca M, Huang S, Gershenwald J E, Singh R K, Reich R, Bar-Eli M. Expression of interleukin-8 by human melanoma cells up-regulates MMP-2 activity and increases tumor growth and metastasis. Am J Pathol 151, 1105-1113 (1997). [0191]
  • 35. Masure, S., Proost, P., Van Damme, J., Opdenakker, MD. Purification and identification of 91-kDa neutrophil gelatinase. Release by the activating peptide interleukin-8. Eur. J. Biochem. 198,391-398 (1991). [0192]
  • 36. Hart, P. H. et al. Activation of human monocytes by granulocyte-macrophage colony-stimulating factor: increased urokinase-type plasminogen activator activity. Blood 77, 841-848 (1991). [0193]
  • 37. Stacey, K. J., Fowles, L. F., Colman, M. S., Ostrowski, M. C., Hume, D. A. Regulation of urokinase-type plasminogen activator gene transcription by macrophage colony-stimulating factor. Mol. Cell. Biol. 15, 3430-3441 (1995). [0194]
  • 38. Pei, X. H. et al. G-CSF increases secretion of urokinase-type plasminogen activator by human lung cancer cells. Clin. Exp. [0195] Metastasis 16, 551-558 (1998).
  • 39. Semerad, C L, et al. A role for G-CSF receptor signalling in the regulation of hematopoietic cell function but not lineage commitment or differentiation. Immunity 11, 153-161 (1999). [0196]
  • 40. Nagasawa, T, et al. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382, 635-638 (1996). [0197]
  • 41. Rempel S A, Dudas S, Ge S, Gutierrez J A. Identification and localization of the cytokine SDF1 and its receptor, [0198] CXC chemokine receptor 4, to regions of necrosis and angiogenesis in human glioblastoma. Clin Cancer Res 6, 102-11 (2000).
  • 42. Globerson, A. Hematopoietic stem cells and aging. Exp. Gerontol. 34, 137-146 (1999). [0199]
  • 43. de la Rubia, J., Diaz, M. A., Verdeguer, A., et al. Donor age-related differences in PBPC mobilization with rHuG-CSF. Transfusion 41, 201-205 (2001). [0200]
  • 44. Leferovich J M, et al. Heart regeneration in adult MRL mice. Proc Natl Acad Sci USA 98, 9830-9835 (2001). [0201]
  • 45. Vander Heiden M G, Plas D R, Rathmell J C, Fox C J, Harris M H, Thompson CB. Growth factors can influence cell survival through effects on glucose metabolism. Mol Cell Biol 21, 5899-5912 (2001). [0202]
  • 46. Rössig L, Jadidi A S, Urbich C, Badorff C, Zeiher A M, and Dimmeler S. Akt-dependent phosphorylation of p21Cip1 regulates PCNA binding and proliferation of endothelial cells. Mol Cell Biol 21, 5644-5657 (2001). [0203]
  • 47. Tomita S, et al. Autologous transplantation of bone marrow cells improves damaged heart function. [0204] Circulation 100, II-247 (1999).
  • 48. Orlic D, et al. Bone marrow cells regenerate infarcted myocardium. Nature 410, 701-705 (2001) [0205]
  • 49. Kehat I, et al. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest. 108, 407-14 (2001). [0206]
  • 50. Rossi et al., 1992, Aids Research and [0207] Human Retroviruses 8, 183.
  • 51. Hampel et al., EP0360257 [0208]
  • 52. Hampel and Tritz, 1989 Biochemistry 28, 4929. [0209]
  • 53. Hampel et al., 1990 Nucleic Acids Res. 18, 299. [0210]
  • 54. Perrotta and Been, 1992 [0211] Biochemistry 31, 16.
  • 55. Guerrier-Takada et al., 1983 Cell 35, 849. [0212]
  • 56. Forster and Altman, 1990 Science 249, 783. [0213]
  • 57. Saville and Collins, 1990 [0214] Cell 61, 685-696.
  • 58. Saville and Collins, 1991 Proc. Natl. Acad. Sci. USA 88, 8826-8830. [0215]
  • 59. Guo and Collins, 1995 EMBO J. 14, 368. [0216]
  • 60. Cech et al., U.S. Pat. No. 4,987,071. [0217]
  • 61. Matzura O, Wennborg A (1996) RNAdraw: an integrated program for RNA secondary structure calculation and analysis under 32-bit Microsoft Windows. [0218] Comput Appl Biosci 12:247-9.
  • 62. Santoro S W, Joyce G F (1997) A general purpose RNA-cleaving DNA enzyme. [0219] Proc Natl Acad Sci USA 94:4262-6.
  • 63. Santoro S W, Joyce G F (1998) Mechanism and utility of an RNA-cleaving DNA enzyme. [0220] Biochemistry 37:13330-42.
  • 64. MacLellan W R and Schneider M D. Genetic dissection of cardiac growth control pathways Annu. Rev. Physiol. 2000. 62:289-320.7. [0221]
  • 65. Sherr C J, Roberts J M. CDK inhibitors: positive and negative regulators of G(1)-phase progression. Genes Dev. 1999;13:1501-1512. [0222]
  • 66. Hill M F, Singal P K. Antioxidant and oxidative stress changes during heart failure subsequent to myocardial infarction in rats. Am J Pathol. 1996, 148:291-300. [0223]
  • 67. Hill M F, Singal P K. Right and left myocardial antioxidant responses during heart failure subsequent to myocardial infarction. Circulation 1997 96:2414-20. [0224]
  • 68. Li, Y. , Jenkins, C. W. , Nichols, M. A. and Xiong, Y. (1994) Cell cycle expression and p53 regulation of the cyclin-dependent kinase inhibitor p21. Oncogene, 9, 2261-2268 [0225]
  • 69. Steinman, R. A. , Hoffman, B. , Iro, A. , Guillouf, C. , Liebermann, D. A. and El-Houseini, M. E. (1994) Induction of p21 (WAF1/CIP1) during differentiation. Oncogene, 9, 3389-3396 [0226]
  • 70. Halevy, O. , Novitch, B. G. , Spicer, D. B. , Skapek, S. X. , Rhee, J. , Hannon, G. J. , Beach, D. and Lassar, A. B. (1995) Correlation of terminal cell cycle arrest of skeletal muscle with induction of p21 by MyoD. Science, 267, 1018-1021. [0227]
  • 71. Andres, V. and Walsh, K. (1996) Myogenin expression, cell cycle withdrawal and phenotypic differentiation are temporally separable events that precedes cell fusion upon myogenesis. J. Cell Biol., 132, 657-666. [0228]
  • 72. Tsurimoto, T. PCNA Binding Proteins. Frontiers in Bioscience, 4:849-858, 1999. [0229]
  • 73. Levkau B, Koyama H, Raines E W, Clurman B E, Herren B, Orth K, Roberts J M, Ross R. Cleavage of p21cip1/waf1 and p27 kip1 mediates apoptosis in endothelial cells through activation of cdk2: role of a caspase cascade. Mol Cell. 1998;1:553-563. [0230]
  • 74. Adachi S, et al. Cyclin A/cdk2 activation is involved in hypoxia-induced apoptosis in cardiomyocytes Circ Res. 88:408, 2001. [0231]
  • 75. Ichijo H, et al. Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways. Science 275:90-94 (1997). [0232]
  • 76. Tobiume, K. , Inage, T. , Takeda, K. , Enomoto, S., Miyazono, K. and Ichijo, H. (1997) Molecular cloning and characterization of the mouse apoptosis signal-regulating [0233] kinase 1. Biochem. Biophys. Res. Commun.,239, 905-910.
  • 77. Asada M, Yamada T, Ichijo h, Delia D, Miyazono K, Fukumuro K, and Mizutani S Apoptosis inhibitory activity of cytoplasmic p21Cip1/WAF1 in monocytic differentiation. EMBO J, 18:1223-1234, 1999. [0234]
  • 78. Saitoh H, et al. Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK)1. EMBO J. 17: 2596-2606, 1998. [0235]
  • 79. Nishiyama A, et al. Identification of Thioredoxin-binding Protein-2/Vitamin D3 Up-regulated [0236] Protein 1 as a Negative Regulator of Thioredoxin Function and Expression. J Biol Chem, 31, 21645-21650, 1999.
  • 80. Junn E, et al. Vitamin D3 Up-Regulated Protein1 Mediates Oxidative Stress Via Suppressing the Thioredoxin Function. J Immunol. 164:6287-6295, 2000. [0237]
  • 81. Holmgren, A. (1985) Annu. Rev. Biochem. 54, 237-271. [0238]
  • 82. Chae, H. Z., Chung, S. J. & Rhee, S. G. (1994) J. Biol. Chem. 269, 27670-27678. [0239]
  • 83. Netto, L. E. S., Chae, H. Z., Kang, S., Rhee, S. G. & Stadtman, E. R. (1996) J. Biol. Chem. 271, 15315-15321. [0240]
  • 84. Chae, H. Z., Uhm, T. B. & Rhee, S. G. (1994) Proc. Natl. Acad. Sci USA 91, 7022-7026. [0241]
  • 85. Kwon, S. J., Park, J., Choi, W., Kim, I. H. & Kim, K. (1994) Biochem. Biophys. Res. Comm. 201, 8-15. [0242]
  • 86. Kang, S. W., Baines, I. C. & Rhee, S. G. (1998) J. Biol. Chem. 273, 6303-6311. [0243]
  • 87. Hirotsu, S, et al. Crystal structure of a multifunctional 2-Cys peroxiredoxin heme-binding [0244] protein 23 kDa/proliferation-associated gene product. Proc. Natl Acad Sci, USA. 96, 12333-12338, 1999.
  • 88. Siow, R. C. M., et al. (1995) FEBS Lett. 368, 239-242. [0245]
  • 89. Prosperi, M., Ferbus, D., Karczinski, I. & Goubin, G. (1993) J. Biol. Chem. 268, 11050-11056. [0246]
  • 90. Sauri, H., Butterfield, L., Kim, A. & Shau, H. (1995) Biochem. Biophys. Res. Commun. 208, 964-969. [0247]
  • 91. Ishii T et al. Transcription factor Nrf2 coordinately regulates a group of oxidative stress-inducible genes in macrophages. J Biological Chem 2000, 275:16023-16029 [0248]
  • 92. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel J D, Yamamoto M. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. Jan. 1, 1999;13(1):76-86. [0249]
  • 93. Lee, J-M, et al. Phosphatidylinositol 3-Kinase, Not Extracellular Signal-regulated Kinase, Regulates Activation of the Antioxidant-Responsive Element in IMR-32 Human Neuroblastoma Cells J. Biol. Chem., 276:20011-20016, 2001. [0250]
  • 94. Kim Y C, Masutani H, Yamaguchi Y, Itoh K, Yamamoto M, Yodoi J. Hemin-induced activation of the thioredoxin gene by Nrf2. A differential regulation of the antioxidant responsive element by a switch of its binding factors. J Biol Chem. 2001 276:18399-406. [0251]
  • 95. Cho H Y, Jedlicka A E, Reddy S P, Kensler T W, Yamamoto M, Zhang L Y, Kleeberger S R. Role of NRF2 in Protection Against Hyperoxic Lung Injury in Mice. Am J Respir Cell Mol Biol 2002, 26:175-182. [0252]
  • 96. Kumuda C. Das, Paula M. B. Pahl, Xiao-Ling Guo, and Carl W. White. Induction of Peroxiredoxin Gene Expression by Oxygen in Lungs of Newborn Primates. Am. J. Respir. Cell Mol. Biol.2001,25:226-232. [0253]
  • 97. Wen S-T, and Van Etten, R A The PAG gene product, a stress-induced protein with antioxidant properties, is an Abl SH3-binding protein and a physiological inhibitor of c-Abl tyrosine kinase activity. Genes and Development, 19: 2456-2467, 1997. [0254]
  • 98. Kharbanda, S., Yuan, Z. M., Weichselbaum, R. & Kufe, D. Determination of cell fate by c-Abl activation in the response to DNA damage. Oncogene 17, 3309-3318 (1998). [0255]
  • 99. Yuan Z M et al, Nature 1996 18; 382(6588):272-4. [0256]
  • [0257] 100. Jost, C. A., Marin, M. C. & Kaelin, W. J. p73 is a human p53-related protein that can induce apoptosis. Nature 389, 191-194 (1997).
  • 101. Agami, R, Blandino G, Oren M, Shaul Y. Interaction of c-Abl and p73[alpha] and their collaboration to induce apoptosis Nature 399, 809-813 (1999). [0258]
  • 102. Sun X, et al. Activation of the cytoplasmic c-Abl tyrosine kinase by reactive oxygen species. J Biol. Chem. 2000, 275:17237-17240. [0259]
  • 103. Kumar S, et al. Targeting of the c-Abl Tyrosine Kinase to Mitochondria in the Necrotic Cell Death Response to Oxidative Stress J. Biol. Chem., 276, 17281-17285, 2001. [0260]
  • 104. Chen, K. S. and DeLuca, H. F. Isolation and characterization of a novel cDNA from HL-60 cells treated with 1,25-dihydroxyvitamin D-3 JOURNAL Biochim. Biophys. Acta 1219 (1), 26-32 (1994). [0261]
  • 105. Zhang et al. Clinical Pharmacology & Therapeutics (1995) 58(1), 44-53. [0262]
  • 106. Tetsuro Ishii, Ken Itoh, Junetsu Akasaka, Toru Yanagawa, Satoru Takahashil, Hiroshi Yoshida, Shiro Bannai and Masayuki Yamamoto, Carcinogenesis Vol. 21(5):1013-1016, (2000). [0263]
  • 107. Das K C, Pahl P M, Guo X L, White C W, Am. J. Respir. Cell Mol. Biol., (2001), 25(2):226-32. [0264]
  • 108. Immenschuh S, Iwahara S, Satoh H, Nell C, Katz N, Muller-Eberhard U., Biochemistry (1995) 17;34(41):13407-11. [0265]
  • 109. Ken Itoh, Nobunao Wakabayashi, Yasutake Katoh, Tetsuro Ishii, Kazuhiko Igarashi, James Douglas Engel,1 and Masayuki Yamamoto, Genes and Development, 13(1):76-86, (1999). [0266]
  • [0267]
  • 1 9 1 2780 DNA HOMO SAPIENS CDS (314)..(1489) 1 aaactaaccc ctctttttct ccaaaggagt gcttgtggag atcggatctt ttctccagca 60 attgggggaa agaaggcttt ttctctgact tcgcttagtg taaccagcgg cgtatatttt 120 ttaggcgcct tttcgaaaac ctagtagtta atattcattt gtttaaatct tattttattt 180 ttaagctcaa actgcttaag aataccttaa ttccttaaag tgaaataatt ttttgcaaag 240 gggtttcctc gatttggagc tttttttttc ttccaccgtc atttctaact cttaaaacca 300 actcagttcc atc atg gtg atg ttc aag aag atc aag tct ttt gag gtg 349 Met Val Met Phe Lys Lys Ile Lys Ser Phe Glu Val 1 5 10 gtc ttt aac gac cct gaa aag gtg tac ggc agt ggc gag aag gtg gct 397 Val Phe Asn Asp Pro Glu Lys Val Tyr Gly Ser Gly Glu Lys Val Ala 15 20 25 ggc cgg gtg ata gtg gag gtg tgt gaa gtt act cgt gtc aaa gcc gtt 445 Gly Arg Val Ile Val Glu Val Cys Glu Val Thr Arg Val Lys Ala Val 30 35 40 agg atc ctg gct tgc gga gtg gct aaa gtg ctt tgg atg cag gga tcc 493 Arg Ile Leu Ala Cys Gly Val Ala Lys Val Leu Trp Met Gln Gly Ser 45 50 55 60 cag cag tgc aaa cag act tcg gag tac ctg cgc tat gaa gac acg ctt 541 Gln Gln Cys Lys Gln Thr Ser Glu Tyr Leu Arg Tyr Glu Asp Thr Leu 65 70 75 ctt ctg gaa gac cag cca aca ggt gag aat gag atg gtg atc atg aga 589 Leu Leu Glu Asp Gln Pro Thr Gly Glu Asn Glu Met Val Ile Met Arg 80 85 90 cct gga aac aaa tat gag tac aag ttc ggc ttt gag ctt cct cag ggg 637 Pro Gly Asn Lys Tyr Glu Tyr Lys Phe Gly Phe Glu Leu Pro Gln Gly 95 100 105 cct ctg gga aca tcc ttc aaa gga aaa tat ggg tgt gta gac tac tgg 685 Pro Leu Gly Thr Ser Phe Lys Gly Lys Tyr Gly Cys Val Asp Tyr Trp 110 115 120 gtg aag gct ttt ctt gac cgc ccg agc cag cca act caa gag aca aag 733 Val Lys Ala Phe Leu Asp Arg Pro Ser Gln Pro Thr Gln Glu Thr Lys 125 130 135 140 aaa aac ttt gaa gta gtg gat ctg gtg gat gtc aat acc cct gat tta 781 Lys Asn Phe Glu Val Val Asp Leu Val Asp Val Asn Thr Pro Asp Leu 145 150 155 atg gca cct gtg tct gct aaa aaa gaa aag aaa gtt tcc tgc atg ttc 829 Met Ala Pro Val Ser Ala Lys Lys Glu Lys Lys Val Ser Cys Met Phe 160 165 170 att cct gat ggg cgg gtg tct gtc tct gct cga att gac aga aaa gga 877 Ile Pro Asp Gly Arg Val Ser Val Ser Ala Arg Ile Asp Arg Lys Gly 175 180 185 ttc tgt gaa ggt gat gag att tcc atc cat gct gac ttt gag aat aca 925 Phe Cys Glu Gly Asp Glu Ile Ser Ile His Ala Asp Phe Glu Asn Thr 190 195 200 tgt tcc cga att gtg gtc ccc aaa gct gcc att gtg gcc cgc cac act 973 Cys Ser Arg Ile Val Val Pro Lys Ala Ala Ile Val Ala Arg His Thr 205 210 215 220 tac ctt gcc aat ggc cag acc aag gtg ctg act cag aag ttg tca tca 1021 Tyr Leu Ala Asn Gly Gln Thr Lys Val Leu Thr Gln Lys Leu Ser Ser 225 230 235 gtc aga ggc aat cat att atc tca ggg aca tgc gca tca tgg cgt ggc 1069 Val Arg Gly Asn His Ile Ile Ser Gly Thr Cys Ala Ser Trp Arg Gly 240 245 250 aag agc ctt cgg gtt cag aag atc agg cct tct atc ctg ggc tgc aac 1117 Lys Ser Leu Arg Val Gln Lys Ile Arg Pro Ser Ile Leu Gly Cys Asn 255 260 265 atc ctt cga gtt gaa tat tcc tta ctg atc tat gtt agc gtt cct gga 1165 Ile Leu Arg Val Glu Tyr Ser Leu Leu Ile Tyr Val Ser Val Pro Gly 270 275 280 tcc aag aag gtc atc ctt gac ctg ccc ctg gta att ggc agc aga tca 1213 Ser Lys Lys Val Ile Leu Asp Leu Pro Leu Val Ile Gly Ser Arg Ser 285 290 295 300 ggt cta agc agc aga aca tcc agc atg gcc agc cga acc agc tct gag 1261 Gly Leu Ser Ser Arg Thr Ser Ser Met Ala Ser Arg Thr Ser Ser Glu 305 310 315 atg agt tgg gta gat ctg aac atc cct gat acc cca gaa gct cct ccc 1309 Met Ser Trp Val Asp Leu Asn Ile Pro Asp Thr Pro Glu Ala Pro Pro 320 325 330 tgc tat atg gat gtc att cct gaa gat cac cga ttg gag agc cca acc 1357 Cys Tyr Met Asp Val Ile Pro Glu Asp His Arg Leu Glu Ser Pro Thr 335 340 345 act cct ctg cta gat gac atg gat ggc tct caa gac agc cct atc ttt 1405 Thr Pro Leu Leu Asp Asp Met Asp Gly Ser Gln Asp Ser Pro Ile Phe 350 355 360 atg tat gcc cct gag ttc aag ttc atg cca cca ccg act tat act gag 1453 Met Tyr Ala Pro Glu Phe Lys Phe Met Pro Pro Pro Thr Tyr Thr Glu 365 370 375 380 gtg gat ccc tgc atc ctc aac aac aat gtg cag tga gcatgtggaa 1499 Val Asp Pro Cys Ile Leu Asn Asn Asn Val Gln 385 390 gaaaagaagc agctttacct acttgtttct ttttgtctct cttcctggac actcactttt 1559 tcagagactc aacagtctct gcaatggagt gtgggtccac cttagcctct gacttcctaa 1619 tgtaggaggt ggtcagcagg caatctcctg ggccttaaag gatgcggact catcctcagc 1679 cagcgcccat gttgtgatac aggggtgttt gttggatggg tttaaaaata actagaaaaa 1739 ctcaggccca tccattttct cagatctcct tgaaaattga ggccttttcg atagtttcgg 1799 gtcaggtaaa aatggcctcc tggcgtaagc ttttcaaggt tttttggagg ctttttgtaa 1859 attgtgatag gaactttgga ccttgaactt acgtatcatg tggagaagag ccaatttaac 1919 aaactaggaa gatgaaaagg gaaattgtgg ccaaaacttt gggaaaagga ggttcttaaa 1979 atcagtgttt cccctttgtg cacttgtaga aaaaaaagaa aaaccttcta gagctgattt 2039 gatggacaat ggagagagct ttccctgtga ttataaaaaa ggaagctagc tgctctacgg 2099 tcatctttgc ttaagagtat actttaacct ggcttttaaa gcagtagtaa ctgccccacc 2159 aaaggtctta aaagccattt ttggagccta ttgcactgtg ttctcctact gcaaatattt 2219 tcatatggga ggatggtttt ctcttcatgt aagtccttgg aattgattct aaggtgatgt 2279 tcttagcact ttaattcctg tcaaattttt tgttctcccc ttctgccatc ttaaatgtaa 2339 gctgaaactg gtctactgtg tctctagggt taagccaaaa gacaaaaaaa attttactac 2399 ttttgagatt gccccaatgt acagaattat ataattctaa cgcttaaatc atgtgaaagg 2459 gttgctgctg tcagccttgc ccactgtgac ttcaaaccca aggaggaact cttgatcaag 2519 atgcccaacc ctgtgatcag aacctccaaa tactgccatg agaaactaga gggcaggtct 2579 tcataaaagc cctttgaacc cccttcctgc cctgtgttag gagataggga tattggcccc 2639 tcactgcagc tgccagcact tggtcagtca ctctcagcca tagcactttg ttcactgtcc 2699 tgtgtcagag cactgagctc cacccttttc tgagagttat tacagccaga aagtgtgggc 2759 tgaagatggt tggtttcatg t 2780 2 391 PRT HOMO SAPIENS 2 Met Val Met Phe Lys Lys Ile Lys Ser Phe Glu Val Val Phe Asn Asp 1 5 10 15 Pro Glu Lys Val Tyr Gly Ser Gly Glu Lys Val Ala Gly Arg Val Ile 20 25 30 Val Glu Val Cys Glu Val Thr Arg Val Lys Ala Val Arg Ile Leu Ala 35 40 45 Cys Gly Val Ala Lys Val Leu Trp Met Gln Gly Ser Gln Gln Cys Lys 50 55 60 Gln Thr Ser Glu Tyr Leu Arg Tyr Glu Asp Thr Leu Leu Leu Glu Asp 65 70 75 80 Gln Pro Thr Gly Glu Asn Glu Met Val Ile Met Arg Pro Gly Asn Lys 85 90 95 Tyr Glu Tyr Lys Phe Gly Phe Glu Leu Pro Gln Gly Pro Leu Gly Thr 100 105 110 Ser Phe Lys Gly Lys Tyr Gly Cys Val Asp Tyr Trp Val Lys Ala Phe 115 120 125 Leu Asp Arg Pro Ser Gln Pro Thr Gln Glu Thr Lys Lys Asn Phe Glu 130 135 140 Val Val Asp Leu Val Asp Val Asn Thr Pro Asp Leu Met Ala Pro Val 145 150 155 160 Ser Ala Lys Lys Glu Lys Lys Val Ser Cys Met Phe Ile Pro Asp Gly 165 170 175 Arg Val Ser Val Ser Ala Arg Ile Asp Arg Lys Gly Phe Cys Glu Gly 180 185 190 Asp Glu Ile Ser Ile His Ala Asp Phe Glu Asn Thr Cys Ser Arg Ile 195 200 205 Val Val Pro Lys Ala Ala Ile Val Ala Arg His Thr Tyr Leu Ala Asn 210 215 220 Gly Gln Thr Lys Val Leu Thr Gln Lys Leu Ser Ser Val Arg Gly Asn 225 230 235 240 His Ile Ile Ser Gly Thr Cys Ala Ser Trp Arg Gly Lys Ser Leu Arg 245 250 255 Val Gln Lys Ile Arg Pro Ser Ile Leu Gly Cys Asn Ile Leu Arg Val 260 265 270 Glu Tyr Ser Leu Leu Ile Tyr Val Ser Val Pro Gly Ser Lys Lys Val 275 280 285 Ile Leu Asp Leu Pro Leu Val Ile Gly Ser Arg Ser Gly Leu Ser Ser 290 295 300 Arg Thr Ser Ser Met Ala Ser Arg Thr Ser Ser Glu Met Ser Trp Val 305 310 315 320 Asp Leu Asn Ile Pro Asp Thr Pro Glu Ala Pro Pro Cys Tyr Met Asp 325 330 335 Val Ile Pro Glu Asp His Arg Leu Glu Ser Pro Thr Thr Pro Leu Leu 340 345 350 Asp Asp Met Asp Gly Ser Gln Asp Ser Pro Ile Phe Met Tyr Ala Pro 355 360 365 Glu Phe Lys Phe Met Pro Pro Pro Thr Tyr Thr Glu Val Asp Pro Cys 370 375 380 Ile Leu Asn Asn Asn Val Gln 385 390 3 1176 DNA HOMO SAPIENS 3 atggtgatgt tcaagaagat caagtctttt gaggtggtct ttaacgaccc tgaaaaggtg 60 tacggcagtg gcgagaaggt ggctggccgg gtgatagtgg aggtgtgtga agttactcgt 120 gtcaaagccg ttaggatcct ggcttgcgga gtggctaaag tgctttggat gcagggatcc 180 cagcagtgca aacagacttc ggagtacctg cgctatgaag acacgcttct tctggaagac 240 cagccaacag gtgagaatga gatggtgatc atgagacctg gaaacaaata tgagtacaag 300 ttcggctttg agcttcctca ggggcctctg ggaacatcct tcaaaggaaa atatgggtgt 360 gtagactact gggtgaaggc ttttcttgac cgcccgagcc agccaactca agagacaaag 420 aaaaactttg aagtagtgga tctggtggat gtcaataccc ctgatttaat ggcacctgtg 480 tctgctaaaa aagaaaagaa agtttcctgc atgttcattc ctgatgggcg ggtgtctgtc 540 tctgctcgaa ttgacagaaa aggattctgt gaaggtgatg agatttccat ccatgctgac 600 tttgagaata catgttcccg aattgtggtc cccaaagctg ccattgtggc ccgccacact 660 taccttgcca atggccagac caaggtgctg actcagaagt tgtcatcagt cagaggcaat 720 catattatct cagggacatg cgcatcatgg cgtggcaaga gccttcgggt tcagaagatc 780 aggccttcta tcctgggctg caacatcctt cgagttgaat attccttact gatctatgtt 840 agcgttcctg gatccaagaa ggtcatcctt gacctgcccc tggtaattgg cagcagatca 900 ggtctaagca gcagaacatc cagcatggcc agccgaacca gctctgagat gagttgggta 960 gatctgaaca tccctgatac cccagaagct cctccctgct atatggatgt cattcctgaa 1020 gatcaccgat tggagagccc aaccactcct ctgctagatg acatggatgg ctctcaagac 1080 agccctatct ttatgtatgc ccctgagttc aagttcatgc caccaccgac ttatactgag 1140 gtggatccct gcatcctcaa caacaatgtg cagtga 1176 4 20 DNA ARTIFICIAL SEQUENCE PRIMER DIRECTED TO RAT Cinc 4 gaagatagat tgcaccgatg 20 5 18 DNA ARTIFICIAL SEQUENCE PRIMER DIRECTED TO RAT Cinc 5 catagcctct cacatttc 18 6 25 DNA ARTIFICIAL SEQUENCE PRIMER DIRECTED TO RAT Cinc 6 gcgcccgtcc gccaatgagc tgcgc 25 7 28 DNA ARTIFICIAL SEQUENCE PRIMER DIRECTED TO RAT Cinc 7 cttggggaca cccttcagca tcttttgg 28 8 21 DNA ARTIFICIAL SEQUENCE PRIMER DIRECTED TO RAT Cinc 8 ctctacccac ggcaagttca a 21 9 20 DNA ARTIFICIAL SEQUENCE PRIMER DIRECTED TO RAT Cinc 9 gggatgacct tgcccacagc 20

Claims (49)

What is claimed is:
1. A method of treating a disorder of a subject's heart involving loss of cardiomyocytes which comprises administering to the subject an amount of an agent effective to cause cardiomyocyte proliferation within the subject's heart so as to thereby treat the disorder.
2. The method of claim 1, wherein the agent is human endothelial progenitor cells.
3. The method of claim 2 which further comprises administering an effective amount of a second agent that increases the cardiomyocyte proliferation caused by the human endothelial progenitor cells.
4. The method of claim 3, wherein the agent is an antisense oligonucleotide which specifically inhibits translation of Vitamin D3 Up-Regulated Protein-1 (VDUP-1) mRNA.
5. The method of claim 3, wherein the agent is a catalytic nucleic acid which specifically inhibits translation of Vitamin D3 Up-Regulated Protein-1 mRNA.
6. The method of claim 5, wherein the catalytic nucleic acid comprises deoxyribonucleotides.
7. The method of claim 5, wherein the catalytic nucleic acid comprises ribonucleotides.
8. The method of claim 3, wherein the second agent is a pro-angiogenic agent.
9. The method of claim 8, wherein the pro-angiogenic agent is vascular endothelial growth factor, fibroblast growth factor or angiopoietin.
10. The method of claim 3, wherein the second agent induces expression of a pro-angiogenic factor.
11. The method of claim 10, wherein the second agent is Hypoxia Inducible Factor-1.
12. The method of claim 3, wherein the second agent promotes trafficking of the endothelial progenitor cells to the subject's heart.
13. The method of claim 12, wherein the second agent that promotes trafficking is an antibody directed against an epitope of CXCR4.
14. The method of claim 12, wherein the second agent that promotes trafficking is a CC chemokine.
15. The method of claim 14, wherein the CC chemokine is RANTES, EOTAXIN, monocyte chemoattractant protein-1 (MCP-1), MCP-2, MCP-3, or MCP.
16. The method of claim 12, wherein the second agent is a CXC chemokine.
17. The method of claim 16, wherein the CXC chemokine is Interleukin-8, Gro-Alpha, or Stromal-Derived Factor-1.
18. The method of claim 3, wherein the second agent is cardiomyocyte progenitor cells.
19. The method of claim 3, wherein the second agent is skeletal muscle progenitor cells.
20. The method of claim 2, wherein the effective amount of human endothelial progenitor cells is between 2.5×105 and 7.5×105 endothelial progenitor cells per kg of the subject's body mass.
21. The method of claim 20, wherein the effective amount is 5×105 endothelial progenitor cells per kg of the subject's body mass.
22. The method of claim 2, wherein the endothelial progenitor cells are allogeneic with respect to the subject.
23. The method of claim 22, wherein the subject is an adult.
24. The method of claim 22, wherein the subject is an embryo or a fetus.
25. The method of claim 2, wherein the administering comprises injecting directly into the subject's peripheral circulation, heart muscle, left ventricle, right ventricle, coronary artery, cerebro-spinal fluid, neural tissue, ischemic tissue, or post-ischemic tissue.
26. The method of claim 2, wherein the human endothelial progenitor cells express CD117, CD34 or AC133.
27. The method of claim 2, wherein endothelial progenitor cells express a high level of intracellular GATA-2 activity.
28. The method of claim 1, wherein the agent induces expression of a mRNA encoding a peroxiredoxin.
29. The method of claim 28, wherein the agent is 2(3)-t-butyl-4-hydroxyanisole.
30. The method of claim 1, wherein the agent induces expression of a mRNA encoding NF-E2-related factor 2 (Nrf2).
31. The method of claim 1, wherein the agent induces dissociation of a Nrf2 protein from a Keap-1.
32. The method of claim 1, wherein the agent inhibits association of a Nrf2 protein with a Keap-1.
33. The method of claim 1, wherein the agent inhibits association of a thiol reductase thioredoxin with a VDUP-1 protein.
34. The method of claim 1, wherein the agent inhibits c-Abl tyrosine kinase activation.
35. The method of claim 34, wherein the agent is STI-571.
36. The method of claim 1, wherein the agent is a CXC chemokine.
37. The method of claim 36, wherein the chemokine is Stromal-Derived Factor-1, Il-8 or Gro-Alpha.
38. The method of claim 1, wherein the agent is an inhibitor of plasminogen activator inhibitor-1.
39. The method of claim 1, wherein the agent is an antibody directed against an epitope of CXCR4.
40. The method of claim 1, wherein the subject has a cardiovascular disease.
41. The method of claim 40, wherein the subject has congestive heart failure.
42. The method of claim 40, wherein the subject has suffered a myocardial infarct.
43. The method of claim 40, wherein the subject has suffered myocardial ischemia.
44. The method of claim 40, wherein the subject has angina.
45. The method of claim 40, wherein the subject has a cardiomyopathy.
46. The method of claim 1, wherein the subject is a mammal.
47. The method of claim 46, wherein the mammal is a human being.
48. A method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising:
(a) quantitating the amount of mRNA encoding peroxiredoxin in the cardiomyocyte;
(b) quantitating the amount of mRNA encoding Vitamin D3 Up-Regulated Protein-1 in the cardiomyocyte; and
(c) determining the ratio of the amount of mRNA encoding peroxiredoxin: amount of mRNA encoding Vitamin D3 Up-Regulated Protein-1, wherein a low ratio indicates a high susceptibility of the cardiomyocyte to apoptosis and a high ratio indicates a low susceptibility of the cardiomyocyte to apoptosis in the subject.
49. A method of determining the susceptibility of a cardiomyocyte in a subject to apoptosis comprising:
(a) quantitating the expression of a peroxiredoxin protein in the cardiomyocyte;
(b) quantitating the expression of Vitamin D3 Up-Regulated Protein-1 in the cardiomyocyte; and
(c) determining the ratio of the peroxiredoxin protein expression: Vitamin D3 Up-Regulated Protein-1 expression, wherein a low ratio indicates a high susceptibility of the cardiomyocyte to apoptosis and a high ratio indicates a low susceptibility of the cardiomyocyte to apoptosis in the subject.
US10/128,738 2002-04-23 2002-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization Abandoned US20030199464A1 (en)

Priority Applications (20)

Application Number Priority Date Filing Date Title
US10/128,738 US20030199464A1 (en) 2002-04-23 2002-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
EP10164397.1A EP2292631B1 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
CNB038147157A CN100379751C (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
AU2003231090A AU2003231090B2 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
JP2003587162A JP4897199B2 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
US10/512,518 US7887796B2 (en) 2002-04-23 2003-04-23 Method of inhibiting collagen formation by VDUP1 inhibition
EP03724217A EP1501852A4 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
ZA200408777A ZA200408777B (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
CA2482996A CA2482996C (en) 2002-04-23 2003-04-23 Sdf-1 promotes cardiomyocyte proliferation to treat cardiomyocyte death-induced disorders
EP11157749A EP2366706A1 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
PCT/US2003/012768 WO2003090512A2 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
US10/693,480 US8663652B2 (en) 2002-04-23 2003-10-23 Regeneration of endogenous myocardial tissue
IL164671A IL164671A (en) 2002-04-23 2004-10-18 Cxc chemokine, cells expressing a cxc chemokine, a gene encoding a cxc chemokine for use in improving cardiac function
US11/648,769 US8242091B2 (en) 2002-04-23 2006-12-29 Treatment of tumor with dnazyme directed to peroxiredoxin
AU2009213032A AU2009213032B2 (en) 2002-04-23 2009-09-10 Regeneration of endogenous myocardial tissue by induction of neovascularization
JP2011021983A JP5619644B2 (en) 2002-04-23 2011-02-03 Regeneration of endogenous myocardial tissue by induction of neovascularization
JP2013249643A JP5911841B2 (en) 2002-04-23 2013-12-02 Regeneration of endogenous myocardial tissue by induction of neovascularization
US14/196,711 US20150056161A1 (en) 2002-04-23 2014-03-04 Regeneration of endogenous myocardial tissue
IL235149A IL235149B (en) 2002-04-23 2014-10-19 Regenaration of endogenous myocardial tissue by induction of neovascularization
JP2016014321A JP2016155804A (en) 2002-04-23 2016-01-28 Regeneration of endogenous myocardial tissue by induction of neovascularization

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
US10/128,738 US20030199464A1 (en) 2002-04-23 2002-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US10/512,518 Continuation-In-Part US7887796B2 (en) 2002-04-23 2003-04-23 Method of inhibiting collagen formation by VDUP1 inhibition
US10512518 Continuation-In-Part 2003-04-23
PCT/US2003/012768 Continuation-In-Part WO2003090512A2 (en) 2002-04-23 2003-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization

Publications (1)

Publication Number Publication Date
US20030199464A1 true US20030199464A1 (en) 2003-10-23

Family

ID=29215504

Family Applications (5)

Application Number Title Priority Date Filing Date
US10/128,738 Abandoned US20030199464A1 (en) 2002-04-23 2002-04-23 Regeneration of endogenous myocardial tissue by induction of neovascularization
US10/512,518 Expired - Fee Related US7887796B2 (en) 2002-04-23 2003-04-23 Method of inhibiting collagen formation by VDUP1 inhibition
US10/693,480 Expired - Fee Related US8663652B2 (en) 2002-04-23 2003-10-23 Regeneration of endogenous myocardial tissue
US11/648,769 Expired - Lifetime US8242091B2 (en) 2002-04-23 2006-12-29 Treatment of tumor with dnazyme directed to peroxiredoxin
US14/196,711 Abandoned US20150056161A1 (en) 2002-04-23 2014-03-04 Regeneration of endogenous myocardial tissue

Family Applications After (4)

Application Number Title Priority Date Filing Date
US10/512,518 Expired - Fee Related US7887796B2 (en) 2002-04-23 2003-04-23 Method of inhibiting collagen formation by VDUP1 inhibition
US10/693,480 Expired - Fee Related US8663652B2 (en) 2002-04-23 2003-10-23 Regeneration of endogenous myocardial tissue
US11/648,769 Expired - Lifetime US8242091B2 (en) 2002-04-23 2006-12-29 Treatment of tumor with dnazyme directed to peroxiredoxin
US14/196,711 Abandoned US20150056161A1 (en) 2002-04-23 2014-03-04 Regeneration of endogenous myocardial tissue

Country Status (9)

Country Link
US (5) US20030199464A1 (en)
EP (3) EP2366706A1 (en)
JP (4) JP4897199B2 (en)
CN (1) CN100379751C (en)
AU (2) AU2003231090B2 (en)
CA (1) CA2482996C (en)
IL (2) IL164671A (en)
WO (1) WO2003090512A2 (en)
ZA (1) ZA200408777B (en)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040258670A1 (en) * 2002-12-05 2004-12-23 Case Western Reserve University Cell-based therapies for ischemia
US20050069527A1 (en) * 2002-12-05 2005-03-31 Case Western Reserve University Cell-based therapies for ischemia
US20050158858A1 (en) * 2000-04-06 2005-07-21 Franco Wayne P. Growth factor therapy mobilization of stem cells into the periperal blood
US20050233992A1 (en) * 2002-04-23 2005-10-20 Silviu Itescu Regeneration of endogeneous myocardial tissue by induction of neovascularization
US20050232905A1 (en) * 2004-03-26 2005-10-20 Yeh Edward T Use of peripheral blood cells for cardiac regeneration
US20050265980A1 (en) * 2004-05-14 2005-12-01 Becton, Dickinson And Company Cell culture environments for the serum-free expansion of mesenchymal stem cells
US20060035290A1 (en) * 2004-08-13 2006-02-16 Medtronic, Inc. Isolation of endothelial progenitor cell subsets and methods for their use
US20060111290A1 (en) * 2000-06-05 2006-05-25 The Trustees Of Columbia University In The City Of New York Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury
US20060165667A1 (en) * 2004-12-03 2006-07-27 Case Western Reserve University Novel methods, compositions and devices for inducing neovascularization
US7166280B2 (en) 2000-04-06 2007-01-23 Franco Wayne P Combination growth factor therapy and cell therapy for treatment of acute and chronic heart disease
US20070105217A1 (en) * 2005-11-07 2007-05-10 Pecora Andrew L Compositions and methods of vascular injury repair
US20070135369A1 (en) * 2005-09-16 2007-06-14 Cooke John P Methods of modulating angiogenesis and screening compounds for activity in modulating angiogenesis
US7288521B2 (en) 2000-04-06 2007-10-30 Franco Wayne P Growth factor therapy mobilization of stem cells into the peripheral blood
US20070258943A1 (en) * 2002-08-22 2007-11-08 Cleveland Clinic Foundation Genetically engineered cells for therapeutic applications
US20080241246A1 (en) * 2006-11-15 2008-10-02 Arteriocyte Inc. Cell-based therapies for treating liver disease
EP2094288A2 (en) * 2006-10-23 2009-09-02 The Brighamn and Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
WO2009155669A1 (en) * 2008-06-27 2009-12-30 The Heart Research Institute Ltd Method of treatment of vascular complications
US20100034794A1 (en) * 2006-10-03 2010-02-11 Van Der Strate Barry W A Endothelial progenitor cell compositions and neovascularization
US20100143317A1 (en) * 2006-10-24 2010-06-10 Andrew Pecora Infarct area perfusion-improving compositions and methods of vascular injury repair
US20100166717A1 (en) * 2002-08-22 2010-07-01 Penn Marc S Method of treating ischemic disorders
US20100272679A1 (en) * 2007-12-14 2010-10-28 Penn Marc S Compositions and methods of promoting wound healing
US20100303769A1 (en) * 2000-04-06 2010-12-02 Franco Wayne P Combination growth factor therapy and cell therapy for treatment of acute and chronic heart disease
EP2360242A1 (en) * 2004-09-24 2011-08-24 Angioblast Systems, Inc. Method of enhancing proliferation and/or survival of mesenchymal procursor cells (MPC)
US8343485B2 (en) 2005-11-07 2013-01-01 Amorcyte, Inc. Compositions and methods of vascular injury repair
US8425899B2 (en) 2005-11-07 2013-04-23 Andrew L. Pecora Compositions and methods for treating progressive myocardial injury due to a vascular insufficiency
US8513213B2 (en) 2009-08-28 2013-08-20 The Cleveland Clinic Foundation SDF-1 delivery for treating ischemic tissue
EP2905331A4 (en) * 2012-10-05 2016-04-06 Samsung Life Public Welfare Foundation Composition comprising ischemic serum for promoting activation of stem cell and method for promoting activation of stem cell
US9308277B2 (en) 2010-02-25 2016-04-12 Mesoblast International Sàrl Protease-resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US9572817B2 (en) 2008-07-04 2017-02-21 The Heart Research Institute Ltd. Use of androgens for vascular regeneration and endothelial repair
US10662234B2 (en) 2011-06-07 2020-05-26 Mesoblast International Sàrl Methods for repairing tissue damage using protease-resistant mutants of stromal cell derived factor-1

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7351421B2 (en) * 1996-11-05 2008-04-01 Hsing-Wen Sung Drug-eluting stent having collagen drug carrier chemically treated with genipin
GB2424273B (en) * 2002-11-14 2007-06-27 Univ Nottingham Method for preparing tumour marker protein
DK1693451T3 (en) * 2003-11-21 2012-02-13 Daiichi Sankyo Co Ltd Method of culturing myocardial cells
EP1771196B1 (en) * 2004-06-21 2012-03-28 The Cleveland Clinic Foundation Ccr ligands for stem cell homing
RU2371478C2 (en) 2004-08-27 2009-10-27 Асубио Фарма Ко., Лтд. Method of cardiomyocyte selection with intracellular mitochondria used as indicator
US8999944B2 (en) * 2005-01-20 2015-04-07 University Of Rochester Thioredoxin interacting protein (TXNIP) as regulator of vascular function
TW200734462A (en) 2006-03-08 2007-09-16 In Motion Invest Ltd Regulating stem cells
US8574848B2 (en) * 2006-09-13 2013-11-05 Oncimmune Ltd. Immunoassay methods
WO2009126659A1 (en) 2008-04-07 2009-10-15 Kalobios Pharmaceuticals, Inc. Neutralization of gm-csf for the treatment of heart failure
WO2009137071A1 (en) * 2008-05-09 2009-11-12 Duke University Treatment for diseases relying on discovery that thioredoxin mediates nitric oxide release in cells
GB0814302D0 (en) * 2008-08-05 2008-10-01 Coretherapix Slu Compounds and methods
WO2010138180A2 (en) * 2009-05-26 2010-12-02 The University Of Vermont And State Agriculture College Compositions and methods for cardiac tissue repair
WO2011071992A1 (en) * 2009-12-08 2011-06-16 Health Research, Inc. Inhibition of tumor angiogenesis by inhibition of peroxiredoxin 1 (prx1)
CA2782132A1 (en) * 2009-12-08 2011-06-16 Sandra O. Gollnick Methods and compositions using peroxiredoxin 1 (prx1) as an adjuvant
WO2011081229A1 (en) 2009-12-29 2011-07-07 이화여자대학교 산학협력단 Pharmaceutical composition for inhibiting angiogenesis
BR112012021451B8 (en) * 2010-02-25 2021-05-25 Abt Holding Co use of cells that have a desired efficiency for expression and/or secretion of the pro-angiogenic factors vegf, cxcl5 and il8, methods to build a cell bank, to develop drug, and to increase the expression of one or more pro-angiogenic factors angiogenic in a cell performed in vitro, and composition
ES2831049T3 (en) 2011-05-16 2021-06-07 Genzyme Corp Use of cxcr4 antagonists to treat WHIM syndrome, myelocatexis, neutropenia, and lymphocytopenia
AR087364A1 (en) 2011-07-29 2014-03-19 Pf Medicament ANTI-CXCR4 ANTIBODY AND ITS USE FOR CANCERES DETECTION AND DIANOSTIC
AR087363A1 (en) 2011-07-29 2014-03-19 Pf Medicament USE OF ANTIBODY I-3859 FOR THE DETECTION AND DIAGNOSIS OF CANCERES
CN102382127A (en) * 2011-09-23 2012-03-21 复旦大学 Myocardial small molecular compound for idiosyncratically promoting proliferation of myocardial cells and application thereof
US20130142762A1 (en) * 2011-11-07 2013-06-06 Hina W. Chaudhry Methods of cardiac repair
US9585915B2 (en) * 2014-01-23 2017-03-07 Emory University Polypeptide hydrogels and uses related thereto
EP3154694A1 (en) 2014-06-13 2017-04-19 Children's Medical Center Corporation Products and methods to isolate mitochondria
US9375406B2 (en) * 2014-09-30 2016-06-28 Taigen Biotechnology Co., Ltd. Substituted pyrimidines for mobilizing cells expressing a type 4 CXC chemokine receptor
WO2017106630A1 (en) 2015-12-18 2017-06-22 The General Hospital Corporation Polyacetal polymers, conjugates, particles and uses thereof
CN105602888A (en) * 2016-01-12 2016-05-25 温州医科大学附属第一医院 Quick endothelial progenitor cell expansion system
EP4272834A3 (en) * 2016-01-15 2024-01-03 The Children's Medical Center Corporation Therapeutic use of mitochondria and combined mitochondrial agents
WO2018106738A1 (en) 2016-12-05 2018-06-14 Massachusetts Institute Of Technology Brush-arm star polymers, conjugates and particles, and uses thereof
WO2018107684A1 (en) 2016-12-15 2018-06-21 深圳瑞健生命科学研究院有限公司 Method for treating and preventing atherosclerosis and complications thereof
US11389515B2 (en) 2016-12-15 2022-07-19 Talengen International Limited Method for mitigating heart disease
JP7168990B2 (en) 2016-12-15 2022-11-10 タレンゲン インターナショナル リミテッド Methods and drugs for preventing and treating obesity
BR112019021282A2 (en) 2017-04-12 2020-05-19 Magenta Therapeutics Inc aryl hydrocarbon receptor antagonists and uses thereof
JP2020529992A (en) * 2017-08-01 2020-10-15 テンプル・ユニバーシティ−オブ・ザ・コモンウェルス・システム・オブ・ハイアー・エデュケイションＴｅｍｐｌｅ Ｕｎｉｖｅｒｓｉｔｙ−Ｏｆ Ｔｈｅ Ｃｏｍｍｏｎｗｅａｌｔｈ Ｓｙｓｔｅｍ Ｏｆ Ｈｉｇｈｅｒ Ｅｄｕｃａｔｉｏｎ Cortical bone stem cell-derived exosomes capable of enhancing cardiac function after trauma
AU2018358054A1 (en) 2017-10-31 2020-05-07 Magenta Therapeutics Inc. Compositions and methods for hematopoietic stem and progenitor cell transplant therapy
WO2019089826A1 (en) 2017-10-31 2019-05-09 Magenta Therapeutics Inc. Compositions and methods for the expansion of hematopoietic stem and progenitor cells
US11260079B2 (en) 2017-12-06 2022-03-01 Magenta Therapeutics, Inc. Dosing regimens for the mobilization of hematopoietic stem and progenitor cells
US10058573B1 (en) 2017-12-06 2018-08-28 Magenta Therapeutics, Inc. Dosing regimens for the mobilization of hematopoietic stem cells
WO2019113375A2 (en) 2017-12-06 2019-06-13 Magenta Therapeutics, Inc. Dosing regimens for the mobilization of hematopoietic stem and progenitor cells
CA3087527A1 (en) 2018-01-03 2019-07-11 Magenta Therapeutics, Inc. Compositions and methods for the expansion of hematopoietic stem and progenitor cells and treatment of inherited metabolic disorders
WO2019168685A1 (en) * 2018-02-27 2019-09-06 Cytori Therapeutics, Inc. Improvement of endothelial cell function
CN109589339A (en) * 2018-12-26 2019-04-09 山西医科大学 People's endometrium endothelial progenitor cells are improving the application on damaged cardiomyocytes
KR20220041896A (en) * 2019-07-30 2022-04-01 빅터 창 카디악 리서치 인스티튜트 KLF-induced cardiomyopathy
US20220401481A1 (en) 2019-11-01 2022-12-22 Magenta Therapeutics, Inc. Dosing regimens for the mobilization of hematopoietic stem and progenitor cells
WO2021222313A1 (en) 2020-04-27 2021-11-04 Magenta Therapeutics, Inc. Methods and compositions for transducing hematopoietic stem and progenitor cells in vivo
EP4308694A1 (en) 2021-03-16 2024-01-24 Magenta Therapeutics, Inc. Dosing regimens for hematopoietic stem cell mobilization for stem cell transplants in multiple myeloma patients

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5061620A (en) * 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
US5552381A (en) * 1989-07-21 1996-09-03 Washington University Recombinantly produced human membrane cofactor protein (MCP) pharmaceutical composition, and method of inhibiting complement activity
US5559703A (en) * 1993-12-14 1996-09-24 Nissan Motor Co., Ltd. Fuel cut and ignition timing control system for controlling acceleration slip
US5880090A (en) * 1997-09-19 1999-03-09 The Hope Heart Institute Treatment of vascular graft implants with G-CSF
US5980887A (en) * 1996-11-08 1999-11-09 St. Elizabeth's Medical Center Of Boston Methods for enhancing angiogenesis with endothelial progenitor cells
US6288103B1 (en) * 1997-08-07 2001-09-11 Zeneca Limited Indole derivatives as MCP-1 receptor antagonists

Family Cites Families (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
JPH03503894A (en) 1988-03-25 1991-08-29 ユニバーシィティ　オブ　バージニア　アランミ　パテンツ　ファウンデイション Oligonucleotide N-alkylphosphoramidate
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
CA1340323C (en) 1988-09-20 1999-01-19 Arnold E. Hampel Rna catalyst for cleaving specific rna sequences
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5008284A (en) * 1989-02-15 1991-04-16 E. R. Squibb & Sons, Inc. Method of reducing pre- and post-ischemic myocardial arrhythmias and fibrillation
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
EP0504257A4 (en) 1989-11-29 1993-03-03 Brigham And Women's Hospital (ala il-8) 77 as a leukocyte adhesion inhibitor
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
IE912365A1 (en) * 1990-07-23 1992-01-29 Zeneca Ltd Continuous release pharmaceutical compositions
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
JP2697495B2 (en) 1991-06-19 1998-01-14 富士レビオ株式会社 Aldehyde derivatives
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
US5599703A (en) * 1993-10-28 1997-02-04 The United States Of America As Represented By The Secretary Of The Navy In vitro amplification/expansion of CD34+ stem and progenitor cells
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5824784A (en) * 1994-10-12 1998-10-20 Amgen Inc. N-terminally chemically modified protein compositions and methods
DE4442665A1 (en) 1994-11-30 1996-06-05 Gruenenthal Gmbh Chimeric proteins with fibrinolytic and thrombin-inhibiting properties
US6506770B1 (en) * 1996-06-06 2003-01-14 Anormed, Inc. Antiviral compounds
US5980884A (en) * 1996-02-05 1999-11-09 Amgen, Inc. Methods for retreatment of patients afflicted with Hepatitis C using consensus interferon
US6110889A (en) 1996-06-14 2000-08-29 Board Of Regents, The University Of Texas System Peptide tumor cell growth inhibitors
JP3866800B2 (en) * 1996-08-29 2007-01-10 東菱薬品工業株式会社 Prophylactic and / or therapeutic agent for apoptosis-related diseases
WO1998027995A1 (en) * 1996-12-20 1998-07-02 Creative Biomolecules, Inc. Treatment of mammalian myocardium with morphogen locally, or with morphogenically-treated myogenic precursor cells
US6248878B1 (en) 1996-12-24 2001-06-19 Ribozyme Pharmaceuticals, Inc. Nucleoside analogs
US6251666B1 (en) 1997-03-31 2001-06-26 Ribozyme Pharmaceuticals, Inc. Nucleic acid catalysts comprising L-nucleotide analogs
CN1068517C (en) * 1997-04-04 2001-07-18 北京万业经贸发展公司 Use of 2(3) tertiary butyl-4-hydroxy-anisole in preparation of drug for preventing and curing tissue organ traumatic disease
AU8018498A (en) 1997-05-27 1998-12-30 Unichema Chemie Bv Oligomers of fatty acids
EP0897980A3 (en) 1997-08-20 2002-04-17 Smithkline Beecham Corporation CXCR4B: A human splice variant of CXCR4 chemokine receptor
JP4891477B2 (en) 1997-10-02 2012-03-07 マックス−プランク−ゲゼルシャフト ツール フォーデルング デル ヴィッセンシャフテン エー．ヴェー． Methods for the regulation of angiogenesis and / or development of side arteries and / or other arteries from existing arteriole networks
DE69839610D1 (en) 1997-10-06 2008-07-24 Acculase Inc DEVICE FOR TISSUE ABLATION
AU2559799A (en) 1998-01-22 1999-08-09 Genentech Inc. Antibody fragment-polymer conjugates and humanized anti-il-8 monoclonal antibodies and uses of same
AU2469299A (en) 1998-01-23 1999-08-09 Cornell Research Foundation Inc. Purified populations of stem cells
MXPA00008352A (en) 1998-02-27 2002-10-17 Univ Pennsylvania Vaccines, immunotherapeutics and methods for using the same.
EP1061800A4 (en) * 1998-03-09 2004-10-06 Caritas St Elizabeths Boston Compositions and methods for modulating vascularization
WO1999065507A1 (en) 1998-06-19 1999-12-23 The General Hospital Corporation Modulating platelet function
US20020107195A1 (en) * 1998-07-21 2002-08-08 Smithkline Beecham Corporation Method for inducing chemotaxis in endothelial cells by administering stromal cell derived factor-1alpha
US6124131A (en) * 1998-08-25 2000-09-26 The Johns Hopkins University School Of Medicine Mutant hypoxia inducible factor-1 HIF-1
US20060057722A1 (en) * 1999-03-30 2006-03-16 Myocardial Therapeutics, Inc. Conditioned medium of autologous or allogenic progenitor cells for angiogenesis treatment
ATE363293T1 (en) * 1999-03-30 2007-06-15 Ran Kornowski INJECTION OF AUTOLOGUE BONE MARROW INTO THE HEART MUSCLE
US20060051334A1 (en) * 1999-03-30 2006-03-09 Myocardial Therapeutics, Inc. Injection of bone marrow-derived conditioned medium for angiogenesis
EP1207900A2 (en) * 1999-08-13 2002-05-29 Chiron Corporation Dose of an angiogenic factor and method of administering to improve myocardial blood flow
EP2324839B1 (en) * 2000-06-05 2017-08-09 The Trustees of Columbia University in the City of New York Granulocyte-colony-stimulating-factor (g-csf) for use in the treatment of myocardial infarct
US20020098167A1 (en) * 2000-07-31 2002-07-25 Piero Anversa Methods and compositions for the repair and/or regeneration of damaged myocardium
US7547674B2 (en) * 2001-06-06 2009-06-16 New York Medical College Methods and compositions for the repair and/or regeneration of damaged myocardium
US20020115081A1 (en) * 2000-08-22 2002-08-22 Lee Richard T. Diagnosis and treatment of cardiovascular conditions
AU2001290694A1 (en) * 2000-09-08 2002-03-22 The Regents Of The University Of California Gene and sequence variation associated with lipid disorder
KR20030034177A (en) 2000-09-13 2003-05-01 쥬가이 세이야쿠 가부시키가이샤 Remedies for ischemic diseases
US20020094327A1 (en) * 2000-11-05 2002-07-18 Petersen Bryon E. Targeting pluripotent stem cells to tissues
IL146970A0 (en) 2001-12-06 2002-08-14 Yeda Res & Dev Migration of haematopoietic stem cells and progenitor cells to the liver
US20030199464A1 (en) * 2002-04-23 2003-10-23 Silviu Itescu Regeneration of endogenous myocardial tissue by induction of neovascularization
US7178755B2 (en) * 2003-07-30 2007-02-20 Lincoln Global, Inc Retainer ring for wire package
US7220407B2 (en) 2003-10-27 2007-05-22 Amgen Inc. G-CSF therapy as an adjunct to reperfusion therapy in the treatment of acute myocardial infarction

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5552381A (en) * 1989-07-21 1996-09-03 Washington University Recombinantly produced human membrane cofactor protein (MCP) pharmaceutical composition, and method of inhibiting complement activity
US5061620A (en) * 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
US5559703A (en) * 1993-12-14 1996-09-24 Nissan Motor Co., Ltd. Fuel cut and ignition timing control system for controlling acceleration slip
US5980887A (en) * 1996-11-08 1999-11-09 St. Elizabeth's Medical Center Of Boston Methods for enhancing angiogenesis with endothelial progenitor cells
US6288103B1 (en) * 1997-08-07 2001-09-11 Zeneca Limited Indole derivatives as MCP-1 receptor antagonists
US5880090A (en) * 1997-09-19 1999-03-09 The Hope Heart Institute Treatment of vascular graft implants with G-CSF

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7166280B2 (en) 2000-04-06 2007-01-23 Franco Wayne P Combination growth factor therapy and cell therapy for treatment of acute and chronic heart disease
US20100303769A1 (en) * 2000-04-06 2010-12-02 Franco Wayne P Combination growth factor therapy and cell therapy for treatment of acute and chronic heart disease
US20050158858A1 (en) * 2000-04-06 2005-07-21 Franco Wayne P. Growth factor therapy mobilization of stem cells into the periperal blood
US20090155227A1 (en) * 2000-04-06 2009-06-18 Franco Wayne P Combination growth factor therapy and cell therapy for treatment of acute and chronic heart disease
US7291597B2 (en) 2000-04-06 2007-11-06 Franco Wayne P Growth factor therapy mobilization of stem cells into the peripheral blood
US7288521B2 (en) 2000-04-06 2007-10-30 Franco Wayne P Growth factor therapy mobilization of stem cells into the peripheral blood
US20070196343A1 (en) * 2000-04-06 2007-08-23 Franco Wayne P Combination growth factor therapy and cell therapy for treatment of acute and chronic heart disease
US20060111290A1 (en) * 2000-06-05 2006-05-25 The Trustees Of Columbia University In The City Of New York Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury
US9387234B2 (en) 2000-06-05 2016-07-12 The Trustees Of Columbia University In The City Of New York Use of SDF-1 to improve ischemic myocardial function
US8486416B2 (en) 2000-06-05 2013-07-16 The Trustees Of Columbia University In The City Of New York Use of SDF-1 to improve ischemic myocardial function
US20090142296A1 (en) * 2000-06-05 2009-06-04 The Trustees Of Columbia University In The City Of New York Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue
US8153113B2 (en) 2000-06-05 2012-04-10 The Trustees Of Columbia University In The City Of New York Method of increasing trafficking of endothelial progenitor cells to ischemia-damaged tissue
US7662392B2 (en) 2000-06-05 2010-02-16 The Trustees Of Columbia University In The City Of New York Use of SDF-1 or G-CSF to improve myocardial function after ischemic injury
US8663652B2 (en) 2002-04-23 2014-03-04 The Trustees Of Columbia University In The City Of New York Regeneration of endogenous myocardial tissue
US20070172467A1 (en) * 2002-04-23 2007-07-26 The Trustees Of Columbia University In The City Of New York Regeneration of endogenous myocardial tissue by induction of neovascularization
US7887796B2 (en) 2002-04-23 2011-02-15 The Trustees Of Columbia University In The City Of New York Method of inhibiting collagen formation by VDUP1 inhibition
US8242091B2 (en) 2002-04-23 2012-08-14 The Trustees Of Columbia University In The City Of New York Treatment of tumor with dnazyme directed to peroxiredoxin
US20050233992A1 (en) * 2002-04-23 2005-10-20 Silviu Itescu Regeneration of endogeneous myocardial tissue by induction of neovascularization
US20100166717A1 (en) * 2002-08-22 2010-07-01 Penn Marc S Method of treating ischemic disorders
US20070258943A1 (en) * 2002-08-22 2007-11-08 Cleveland Clinic Foundation Genetically engineered cells for therapeutic applications
US9226978B2 (en) 2002-08-22 2016-01-05 The Cleveland Clinic Foundation Method of treating ischemic disorders
US7470538B2 (en) 2002-12-05 2008-12-30 Case Western Reserve University Cell-based therapies for ischemia
US20040258670A1 (en) * 2002-12-05 2004-12-23 Case Western Reserve University Cell-based therapies for ischemia
US20050069527A1 (en) * 2002-12-05 2005-03-31 Case Western Reserve University Cell-based therapies for ischemia
US20050232905A1 (en) * 2004-03-26 2005-10-20 Yeh Edward T Use of peripheral blood cells for cardiac regeneration
US20050265980A1 (en) * 2004-05-14 2005-12-01 Becton, Dickinson And Company Cell culture environments for the serum-free expansion of mesenchymal stem cells
US20060035290A1 (en) * 2004-08-13 2006-02-16 Medtronic, Inc. Isolation of endothelial progenitor cell subsets and methods for their use
EP2360242A1 (en) * 2004-09-24 2011-08-24 Angioblast Systems, Inc. Method of enhancing proliferation and/or survival of mesenchymal procursor cells (MPC)
US20060165667A1 (en) * 2004-12-03 2006-07-27 Case Western Reserve University Novel methods, compositions and devices for inducing neovascularization
US8236772B2 (en) * 2005-09-16 2012-08-07 The Board Of Trustees Of The Leland Stanford Junior University Methods of modulating angiogenesis and screening compounds for activity in modulating angiogenesis
US20070135369A1 (en) * 2005-09-16 2007-06-14 Cooke John P Methods of modulating angiogenesis and screening compounds for activity in modulating angiogenesis
US20070105217A1 (en) * 2005-11-07 2007-05-10 Pecora Andrew L Compositions and methods of vascular injury repair
US7794705B2 (en) 2005-11-07 2010-09-14 Amorcyte, Inc. Compositions and methods of vascular injury repair
US8637005B2 (en) 2005-11-07 2014-01-28 Amorcyte, Inc. Compositions and methods of vascular injury repair
US8425899B2 (en) 2005-11-07 2013-04-23 Andrew L. Pecora Compositions and methods for treating progressive myocardial injury due to a vascular insufficiency
US8088370B2 (en) 2005-11-07 2012-01-03 Amorcyte, Inc. Compositions and methods of vascular injury repair
US20090226402A1 (en) * 2005-11-07 2009-09-10 Andrew Pecora Compositions and Methods of Vascular Injury Repair
US9534202B2 (en) 2005-11-07 2017-01-03 Amorcyte, Inc. Compositions and methods for treating progressive myocardial injury due to a vascular insufficiency
US8343485B2 (en) 2005-11-07 2013-01-01 Amorcyte, Inc. Compositions and methods of vascular injury repair
US20100034794A1 (en) * 2006-10-03 2010-02-11 Van Der Strate Barry W A Endothelial progenitor cell compositions and neovascularization
EP2094288A4 (en) * 2006-10-23 2010-09-08 Brighamn And Women S Hospital Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US20100184950A1 (en) * 2006-10-23 2010-07-22 The Brigham And Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US7999067B2 (en) 2006-10-23 2011-08-16 The Brigham And Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US10774124B2 (en) 2006-10-23 2020-09-15 The Brigham And Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US9631005B2 (en) 2006-10-23 2017-04-25 The Brigham And Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
EP2094288A2 (en) * 2006-10-23 2009-09-02 The Brighamn and Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
EP2676674A1 (en) * 2006-10-23 2013-12-25 The Brigham and Women's Hospital, Inc. Protease resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US9034316B2 (en) 2006-10-24 2015-05-19 Amorcyte, Llc Infarct area perfusion-improving compositions and methods of vascular injury repair
US20100143317A1 (en) * 2006-10-24 2010-06-10 Andrew Pecora Infarct area perfusion-improving compositions and methods of vascular injury repair
US20080241246A1 (en) * 2006-11-15 2008-10-02 Arteriocyte Inc. Cell-based therapies for treating liver disease
US8679477B2 (en) 2007-12-14 2014-03-25 The Cleveland Clinic Foundation Use of SDF-1 to mitigate scar formation
US20100272679A1 (en) * 2007-12-14 2010-10-28 Penn Marc S Compositions and methods of promoting wound healing
EP2565275A1 (en) * 2008-06-27 2013-03-06 The Heart Research Institute Limited Method of treatment of vascular complications using modulators of TRX and TRXNIP
WO2009155669A1 (en) * 2008-06-27 2009-12-30 The Heart Research Institute Ltd Method of treatment of vascular complications
US9572817B2 (en) 2008-07-04 2017-02-21 The Heart Research Institute Ltd. Use of androgens for vascular regeneration and endothelial repair
US8513007B2 (en) 2009-08-28 2013-08-20 The Cleveland Clinic Foundation SDF-1 delivery for treating ischemic tissue
US8513213B2 (en) 2009-08-28 2013-08-20 The Cleveland Clinic Foundation SDF-1 delivery for treating ischemic tissue
US9844581B2 (en) 2009-08-28 2017-12-19 The Cleveland Clinic SDF-1 delivery for treating ischemic tissue
US8883756B2 (en) 2009-08-28 2014-11-11 Juventas Therapeutics, Inc. SDF-1 delivery for treating ischemic tissue
US9308277B2 (en) 2010-02-25 2016-04-12 Mesoblast International Sàrl Protease-resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US10456451B2 (en) 2010-02-25 2019-10-29 Mesoblast International Sàrl Protease-resistant mutants of stromal cell derived factor-1 in the repair of tissue damage
US10662234B2 (en) 2011-06-07 2020-05-26 Mesoblast International Sàrl Methods for repairing tissue damage using protease-resistant mutants of stromal cell derived factor-1
EP2905331A4 (en) * 2012-10-05 2016-04-06 Samsung Life Public Welfare Foundation Composition comprising ischemic serum for promoting activation of stem cell and method for promoting activation of stem cell

Also Published As

Publication number Publication date
ZA200408777B (en) 2007-04-25
US20050233992A1 (en) 2005-10-20
JP4897199B2 (en) 2012-03-14
WO2003090512A2 (en) 2003-11-06
US8242091B2 (en) 2012-08-14
US8663652B2 (en) 2014-03-04
AU2009213032B2 (en) 2013-06-27
AU2003231090A1 (en) 2003-11-10
US20040247564A1 (en) 2004-12-09
CN100379751C (en) 2008-04-09
EP2366706A1 (en) 2011-09-21
IL235149B (en) 2019-03-31
EP2292631B1 (en) 2017-02-15
JP2014088390A (en) 2014-05-15
AU2003231090B2 (en) 2009-10-01
JP2011137011A (en) 2011-07-14
US20150056161A1 (en) 2015-02-26
JP2005534290A (en) 2005-11-17
EP2292631A1 (en) 2011-03-09
JP2016155804A (en) 2016-09-01
JP5619644B2 (en) 2014-11-05
JP5911841B2 (en) 2016-05-11
US20070172467A1 (en) 2007-07-26
AU2009213032A1 (en) 2009-10-08
CA2482996C (en) 2017-02-07
US7887796B2 (en) 2011-02-15
EP1501852A4 (en) 2008-10-01
IL164671A (en) 2014-11-30
EP1501852A2 (en) 2005-02-02
WO2003090512A3 (en) 2004-11-04
CA2482996A1 (en) 2003-11-06
IL164671A0 (en) 2005-12-18
CN1662548A (en) 2005-08-31

Similar Documents

Publication Publication Date Title
US8242091B2 (en) Treatment of tumor with dnazyme directed to peroxiredoxin
EP2324839B1 (en) Granulocyte-colony-stimulating-factor (g-csf) for use in the treatment of myocardial infarct
Grote et al. The angiogenic factor CCN1 promotes adhesion and migration of circulating CD34+ progenitor cells: potential role in angiogenesis and endothelial regeneration
US10780128B2 (en) Mesenchymal stem cell particles

Legal Events

Date Code Title Description
AS Assignment

Owner name: TRUSTEES OF COLUMBIA UNIVERSITY IN THE CITY OF NEW

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ITESCU, SILVIU;REEL/FRAME:015537/0863

Effective date: 20040616

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION