US20040142469A1 - Immunomodulatory oligonucleotides - Google Patents

Immunomodulatory oligonucleotides Download PDF

Info

Publication number
US20040142469A1
US20040142469A1 US10/789,051 US78905104A US2004142469A1 US 20040142469 A1 US20040142469 A1 US 20040142469A1 US 78905104 A US78905104 A US 78905104A US 2004142469 A1 US2004142469 A1 US 2004142469A1
Authority
US
United States
Prior art keywords
oligonucleotide
subject
cpg
cells
odn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/789,051
Inventor
Arthur Krieg
Dennis Klinman
Alfred Steinberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Iowa Research Foundation UIRF
US Department of Health and Human Services
Coley Pharmaceutical Group Inc
Original Assignee
University of Iowa Research Foundation UIRF
US Department of Health and Human Services
Coley Pharmaceutical Group Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/386,063 external-priority patent/US6194388B1/en
Application filed by University of Iowa Research Foundation UIRF, US Department of Health and Human Services, Coley Pharmaceutical Group Inc filed Critical University of Iowa Research Foundation UIRF
Priority to US10/789,051 priority Critical patent/US20040142469A1/en
Assigned to CPG IMMUNOPHARMCALS, INC. reassignment CPG IMMUNOPHARMCALS, INC. AGREEMENT Assignors: STEINBERG, ALFRED D.
Assigned to THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN reassignment THE UNITED STATES OF AMERICA, AS REPRESENTED BY THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KLINMAN, DENNIS
Assigned to COLEY PHARMACEUTICAL GROUP, INC. reassignment COLEY PHARMACEUTICAL GROUP, INC. CHANGE OF NAME (SEE DOCUMENT FOR DETAILS). Assignors: CPG IMMUNOPHARMACEUTICALS, INC.
Assigned to UNIVERSITY OF IOWA RESEARCH FOUNDATION reassignment UNIVERSITY OF IOWA RESEARCH FOUNDATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KRIEG, ARTHUR M.
Publication of US20040142469A1 publication Critical patent/US20040142469A1/en
Assigned to PFIZER INC. reassignment PFIZER INC. CONFIRMATION OF EXCLUSIVE PATENT LICENSE Assignors: COLEY PHARMACEUTICAL GROUP, INC., COLEY PHARMACEUTICAL GROUP, LTD., COLEY PHARMACEUTICAL, GMBH
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: UNIVERSITY OF IOWA
Abandoned legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/47064-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants

Abstract

Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.

Description

    GOVERNMENT SUPPORT
  • [0001] The work resulting in this invention was supported in part by National Institute of Health-Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.
  • BACKGROUND OF THE INVENTION
  • DNA Binds to Cell Membrane and is Internalized [0002]
  • In the 1970's, several investigators reported the binding of high molecular weight DNA to cell-membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. “Membrane-associated-DNA in the cytoplasm of diploid human lymphocytesi”. [0003] Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K, R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. “Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy”. Proc. Natl. Acad. Sci. USA 72:928). In 1985 Bennett ct al; presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation (Benett, P-M., G; T. Gabor, and M. M. Merritt, 1985. “DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA”. J. Clin. Invest; 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen 1991. “cellular uptake of antisense oligodeoxynucleotides”. Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992; “Pharmaceutical-aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides”. In: Gene Regulation: Biology of Antisense RNA and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmindt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. “Stage specific oligonucleotide uptake in murine bone marrow B cell precursors”. Blood, 84:3660) No receptor DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN-binding and cell uptake occurs through the same-or a different mechanism from that of high molecular weight DNA.
  • Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. [0004] Antisense Research and Development 1:161).
  • Immune Effects of Nucleic Acids [0005]
  • Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985. “Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L:-lysine and carboxymethylcellulose”. [0006] Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. “Immunomodulation of natural killer activity by polyribonucleotides”. J. Biol. Resp. Mod 4:512; Krown, S. E. 1986. “Interferons and interferon inducers in cancer treatment”. Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. “Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin 2 in patients with cancer: clinical and immunological effects”. Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN β secretion (Ishikawa, R., and C. A. Biron. 1993. “IFN induction and associated changes in splenic leukocyte distribution”. J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, RIH., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.
  • Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. [0007] J. Immunol. 134:3204; and Goodman, M. G. 1986 “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTI (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, RA., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation”. J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Tompson, R. A., et al. 1990. cited supra). Recently, a 5′ triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human γδ T cells (Constant, P., F. Davodeau, M.-A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J.-J. Fournie. 1994. “Stimulation of human γδ T cells by nonpeptidic mycobacterial ligands” Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.
  • Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart 1990. “Immunogenic DNA-related factors”. [0008] J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG).(dC) and poly (dG.dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. “The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens”. Cell. Immunol. 147:148). Tokunaga, et al have reported that dG dC induces γ-IFN and NK activity (Tokunaga, S. Yamamoto, and K Namba. 1988. “A synthetic single-stranded DNA, poly(dG,dC), induces interferon-α/β and −γ, augments natural killer activity, and suppresses tumor growth” Jpn. J. Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. “Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA”. J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yararnoto, S., T. Yarnamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. “Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity”. J. Immunol. 148:4072; Kurumoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. “Oligonucleotide sequences required for natural killer cell activation”. Jpn. J. Cancer Res. 83:1128).
  • Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. “An antisense oligonucleotide complementary to a sequence in Iγ2b increases γ2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion”. [0009] J. Exp. Med 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. “Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1”. Biochem. Pharmacol 45:2037; McIntyre, YW., K Lombard-Gillooly, J. R Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R Narayarnan. 1993. “A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NF-κ β T65 causes sequence-specific immune stimulation”. Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich 1993. “Stimulation of murine-lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus”. Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.
  • The CREB/ATF Family of Transcription Factors and Their Role in Replication [0010]
  • The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassoine-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. [0011] Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of “mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero- dimers through the cAMP response element, the CRE, the consensus form of which is the unmethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).
  • The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles; and T. L. Rothstein: “Induction of CREB activity via the surface Ig receptor of B cells”. [0012] J. Immunol. 151:880,1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1β gene”. Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: “Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice”. Cancer Res. 53:577, 1993), IFN-β (Du, W., and T. Maniatis: “An ATF/CREB-binding site protein is required for virus induction of the human interferon B gene”. Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-β1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B 1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF-β2, class II MHC (Cox, P. M., and C. R Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40-T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8α, the germline Igα constant region gene, the TCR Vβ gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: “Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes”. Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca++ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: “Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB”. Neuron 4:571, 1990).
  • The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB[0013] 341 on ser133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”.
  • Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: “Activation of cAMP and mitogen responsive genes relies on a common nuclear factor”. [0014] Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler., J. P., J. W. Lustbader, and C.-Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and KA. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994.).
  • Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y.-N., S. Crawford, J. Stall, D. R. Rawlins, K.-T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. [0015] J. Virol 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus EA protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates E1A inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: “E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators”. Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, which binds to CREB/ATF proteins and redirects them from their normal cellular binding sites to different DNA sequences (flanked by G- and C-rich sequences) present within the H V transcriptional enhancer (Paca-Uccaralertkun, S., L.-J. Zhao, N. Adya, J. V. Cross, B. R. Cullen, I. M. Boros, and C.-Z. Giarn: “In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax”. Mol. Cell. Biol. 14:456, 1994; Adya, N., L.-J. Zhao, W. Huang, I. Boros, and C.-Z. Giarn: “Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB”. Proc. Natl. Acad. Sci. USA 91:5642, 1994).
  • SUMMARY OF THE INVENTION
  • The instant invention is based on the finding that certain oligonucleotides containing unmethylated cytosine-guanine (CpG) dinucleotides activate lymphocytes as evidenced by in vitro and in vivo data. Based on this finding, the invention features, in one aspect, novel immunostimulatory oligonucleotide compositions. [0016]
  • In a preferred embodiment, an immunostimulatory oligonucleotide is synthetic, between 2 to 100 base pairs in size and contains a consensus mitogenic CpG motif represented by the formula: [0017]
  • 5′X1X2CGX3X43′
  • wherein C and G are unmethylated, X[0018] 1, X2, X3 and X4 are nucleotides and
  • a GCG trinucleotide sequence is not present at or near the 5′ and 3′ termini. [0019]
  • For facilitating uptake into cells, CpG containing immunostimulatory oligonucleotides are preferably in the range of 8 to 40 base pairs in size. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides. Enhanced immunostimulatory activity has been observed where X[0020] 1X2 is the dinucleotide GpA and/or X3X4 is the dinucleotide is most preferably TpC or also TpT. Further enhanced immunostimulatory activity has been observed where the consensus motif X1X2CGX3X4 is preceded on the 5′ end by a T.
  • In a second aspect, the invention features useful methods, which are based on the immunostimulatory activity of the oligonucleotides. For example, lymphocytes can either be obtained from a subject and stimulated ex vivo upon contact with an appropriate oligonucleotide; or a non-methylated CpG containing oligonucleotide can be administered to a subject to facilitate in vivo activation of a subject's lymphocytes. Activated lymphocytes, stimulated by the methods described herein (e.g. either ex vivo or in vivo), can boost a subject's immune response. The immunostimulatory oligonucleotides can therefore be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject. In addition, immunostimulator oligonucleotides can also be administered as a vaccine adjuvant, to stimulate a subject s response to a vaccine. Further, the ability of immunostimulatory cells to induce leukemic cells to enter the cell cycle, suggests a utility for treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy. [0021]
  • In a third aspect, the invention features neutral oligonucleotides (i.e. oligonucleotide that do not contain an unmethylated CpG or which contain a methylated CpG dinucleotide). In a preferred embodiment, a neutralizing oligonucleotide is complementary to an immunostimulatory sequence but contains a methylated instead of an unmethylated CpG dinucleotide sequence and therefore can compete for binding with unmethylated CpG containing oligonucleotides. In a preferred embodiment, the methylation occurs at one or more of the four carbons and two nitrogens comprising the cytosine six member ring or at one or more of the five carbons and four nitrogens comprising the guanine nine member double ring. 5′ methyl cytosine is a preferred methylated CpG. [0022]
  • In a fourth aspect, the invention features useful methods using the neutral oligonucleotides. For example, in vivo administration of neutral oligonucleotides should prove useful for treating diseases such as systemic lupus erythematosus, sepsis and autoimmune diseases, which are caused or exacerbated by the presence of unmethylated CpG dimers in a subject. In addition, methylation CpG containing antisense oligonucleotides or oligonucleotide probes would not initiate an immune reaction when administered to a subject in vivo and therefore would be safer than corresponding unmethylated oligonucleotides. [0023]
  • In a fifth aspect, the invention features immunoinhibitory oligonucleotides, which are capable of interfering with the activity of viral or cellular transcription factors. In a preferred embodiment, immunoinhibitory oligonucleotides are between 2 to 100 base pairs in size and contain a consensus immunoinhibitory CpG motif represented by the formula: [0024]
  • 5′GCGXnGCG3′
  • wherein X=a nucleotide and n=in the range of 0-50. In a preferred embodiment, X is a pyrimidine. [0025]
  • For facilitating uptake into cells, immunoinhibitory oligonucleotides are preferably in the range of 8 to 40 base pairs in size. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides. [0026]
  • In a sixth and final aspect, the invention features various uses for immunoinhibitory oligonucleotides. Immunoinhibitory oligonucleotides have antiviral activity, independent of any antisense effect due to complementarity between the oligonucleotide and the viral sequence being targeted. [0027]
  • Other features and advantages of the invention will become more apparent from the following detailed description and claims.[0028]
  • DETAILED DESCRIPTION OF THE INVENTION
  • Definitions [0029]
  • As used herein, the following terms and phrases shall have the meanings set forth below: [0030]
  • An “oligonucleotide” or “oligo” shall mean multiple nucleotides (i.e. molecules comprising a sugar-(e.g. ribose-or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymine (m or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). The term “oligonucleotide” as used herein refers to both oligoribonucleotides (ORNs) and oligodeoxyribonucleotides (ODNs). The term “oligonucleotide” shall also include oligonucleosides (i.e. an oligonucleotide minus the phosphate) and any other organic base containing polymer. Oligonucleotides can be obtained from existing nucleic acid sources (e.g. genomic or cDNA), but are preferably synthetic (e.g. produced by oligonucleotide synthesis). [0031]
  • A “stabilized oligonucleotide” shall mean an oligonucleotide that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Preferred stabilized oligonucleotides of the instant invention have a modified phosphate backbone. Especially preferred oligonucleotides have a phosphorothioate modified phosphate backbone (i.e. at least one of the phosphate oxygens is replaced by sulfur). Other stabilized oligonucleotides include: nonionic DNA analogs, such as alkyl- and aryl- phosphonates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Oligonucleotides which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation. [0032]
  • An immunostimulatory oligonucleotide”, “immunostimulatory CpG containing oligonucleotide”, or “CpG ODN” refer to an oligonucleotide, which contains a cytosine, guanine dinucleotide sequence and stimulates (e.g. has a mitogenic effect) on vertebrate lymphocyte. Preferred immunostimulatory oligonucleotides are between 2 to 100 base pairs in size and contain a consensus mitogenic CpG motif represented by the formula: [0033]
  • 5′X1X2CGX3X43′
  • wherein C and G are unmethylated, X[0034] 1, X2, X3 and X4 are nucleotides and
  • a GCG trinucleotide sequence is not present at or near the 5′ and 3′ termini. [0035]
  • Preferably the immunostimulatory oligonucleotides range between 8 to 40 base pairs in size. In addition, the immunostimulatory oligonucleotides are preferably stabilized oligonucleotides, particularly preferred are phosphorothioate stabilized oligonucleotides. In one preferred embodiment, X[0036] 1X2 is the dinucleotide GpA. In another preferred embodiment, X3X4 is preferably the dinucleotide TpC or also TpT. In a particularly preferred embodiment, the consensus motif X1X2CGX3X4 is preceded on the 5′ end by a T. Particularly preferred consensus sequences are TGACGTT or TGACGTC.
  • A “neutral oligonucleotide” refers to an oligonucleotide that does not contain an unmethylated CpG or an oligonucleotide which contains a methylated CpG dinucleotide. In a preferred embodiment, a neutralizing oligonucleotide is complementary to an immunostimulatory sequence, but contains a methylated instead of an unmethylated CpG dinucleotide sequence and therefore can compete for binding with unmethylated CpG containing oligonucleotides. In a preferred embodiment, the methylation occurs at one or more of the four carbons and two nitrogens comprising the cytosine six member ring or at one or more of the five carbons and four nitrogens comprising the guanine nine member double ring. 5′ methyl cytosine is a preferred methylated CpG. [0037]
  • An “immunoinhibitory oligonucleotide” or “immunoinhibitory CpG containing oligonucleotide” is an oligonucleotide that. Preferable immunoinhibitory oligonucleotides are between 2 to 100 base pairs in size and can be represented by the formula: [0038]
  • 5′GCGXnGCG3′
  • wherein X=a nucleotide and n=in the range of 0-50. In a preferred embodiment, X is a pyrimidine. [0039]
  • For facilitating uptake into cells, immunoinhibitory oligonucleotides are preferably in the range of 8 to 40 base pairs in size. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized “Palindromic sequence” shall mean an inverted repeat (i.e. a sequence such as ABCDEE′D′C′B′A′ in which A and A′ are bases capable of forming the usual Watson-Crick base pairs. In vivo, such sequences may form double stranded structures. [0040]
  • An “oligonucleotide delivery complex” shall mean an oligonucleotide associated with (e.g. ionically or covalently bound to; or encapsulated within) a targeting means (e.g. a molecule that results in higher affinity binding to target cell (e.g. B-cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells). Examples of oligonucleotide delivery complexes include oligonucleotides associated with: a sterol (e.g. cholesterol), a lipid (e.g. a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g. a ligand recognized by target cell specific receptor). Preferred complexes must be sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell. However, the complex should be cleavable under appropriate conditions within the cell so that the oligonucleotide is released in a functional form. [0041]
  • An “immune system deficiency” shall mean a disease or disorder in which the subject's immune system is not functioning in normal capacity or in which it would be useful to boost a subject's immune response for example to eliminate a tumor or cancer (e.g. tumors of the brain, lung (e.g. small cell and non-small cell), ovary, breast, prostate, colon, as well as other carcinomas and sarcomas) or a viral (e g. HIV, herpes), fungal (e.g. Candida sp.), bacterial or parasitic (e.g. Leishmania, Toxoplasma) infection in a subject. A “disease associated with immune system activation7 shall mean a disease or condition caused or exacerbated by activation of the subject's immune system. Examples include systemic lupus erythematosus, sepsis- and autoimmune diseases such as rheumatoid arthritis and multiple sclerosis. [0042]
  • A “subject” shall mean a human or vertebrate animal including a dog, cat, horse, cow, pig, sheep, goat, chicken, monkey, rat, mouse, etc. [0043]
  • Certain Unmethylated CpG Containing Oligos Have B Cell Stimulatory Activity As Shown in vitro and in vivo [0044]
  • In the course of investigating the lymphocyte stimulatory effects of two-antisense oligonucleotides-specific for endogenous retroviral sequences, using protocols described in the attached Examples 1 and 2, it was surprisingly found that two out of twenty-four “controls” (including various scrambled, sense, and mismatch controls for a panel of “antisense” ODN) also mediated B cell activation and IgM secretion, while the other “controls” had no effect. [0045]
  • Two observations suggested that the mechanism of this B cell activation by the “control” ODN may not involve antisense-effects 1) comparison of vertebrate DNA sequences listed in GenBank showed no greater homology than that seen with non-stimulatory ODN and 2) the two controls showed no hybridization to Northern blots with 10 μg of spleen poly A+RNA. Resynthesis of these ODN on a different synthesizer or extensive purification by polyacrylamide gel electrophoresis or high pressure liquid chromatography gave identical stimulation, eliminating the possibility of an impurity. Similar stimulation was seen using B cells from C3H/HeJ mice, eliminating the possibility that lipopolysaccharide (LPS) contamination could account for the results. [0046]
  • The fact that two “control” ODN caused B cell activation similar to that of the two “antisense” ODN raised the possibility that all four ODN were stimulating B cells through some non-antisense mechanism involving a sequence motif that was absent in all of the other nonstimulatory control ODN. In comparing these sequences, it was discovered that all of the four stimulatory ODN contained ODN dinucleotides that were in a/different sequence context from the nonstimulatory control. [0047]
  • To determine whether the CpG motif present in the stimulatory ODN was responsible for the observed stimulation, over 300 ODN ranging in length from 5 to 42 bases that contained methylated, unmethylated, or no CpG dinucleotides in various sequence contexts were synthesized. These ODNs, including the two original “controls” (ODN 1 and 2) and two originally-synthesized as “antisense” (ODN 3D and 3M; Krieg, A. M. J. Immunol. 143:2448 (1989)), were then examined for in vitro effects on spleen cells (representative sequences are listed in Table 1). Several ODN that contained CpG dinucleotides induced B cell activation and IgM secretion; the magnitude of this stimulation typically could be increased by adding more CpG dinucleotides Cable 1; compare ODN 2 to 2a or 3D to 3Da and 3 Db). Stimulation did not appear to result from an antisense mechanism or impurity ODN caused no detectable activation of γδ or other T cell populations. [0048]
  • Mitogenic ODN sequences uniformly became nonstimulatory if the CpG dinucleotide was mutated (Table 1; compare ODN 1 to 1a; 3D to 3Dc; 3M to 3Ma; and 4 to 4a) or if the cytosine of the CpG dinucleotide was replaced by 5-methylcytosine (Table 0.1; ODN 1b, 2b, 2c, 3Dd, and 3 Mb). In contrast, methylation of other cytosines did not reduce ODN activity (ODN 1c, 2d, 3De and 3Mc). These data confirmed that a CpG motif is the essential element present in ODN that activate B cells. [0049]
  • In the course of these studies, it became clear that the bases flanking the CpG dinucleotide played an important role in determining the B cell activation induced by an ODN. The optimal stimulatory motif was determined to consist of a CpG flanked by two 5′ purines (preferably a GpA dinucleotide) and two 3′ pyrimidines (preferably a TpT or TpC dinucleotide). Mutations of ODN to bring the CpG motif closer to this ideal improved stimulation (e.g. compare ODN 2 to 2e; 3M to 3Md) while mutations that disturbed the motif reduced stimulation (e.g. compare ODN 3D to 3Df; 4 to 4b, 4c and 4d) On the other hand, mutations outside the CpG motif did not reduce stimulation (e.g. compare ODN. 1 to 1d; 3D to 3Dg; 3M to 3Me). [0050]
  • Of those tested, ODNs shorter than 8 bases were non-stimulatory (e.g. ODN 4e). Among the forty-eight 8 base ODN tested, the most stimulatory sequence identified was TCAACGTT (ODN 4) which contains the self complementary “palindrome” AACGTT. Ii further optimizing this motif, it was found that ODN containing Gs at both ends showed increased stimulation, particularly if the the ODN were rendered nuclease resistant by phosphorothioate modification of the terminal internucleotide linkages. ODN 1585 (5′ GGGGTCAACGTTCAGGGGGG 3′ (SEQ ID NO: 1)), in which the first two and last five internucleotide linkages are phosphorothioate modified caused an average 25.4 fold increase in mouse spleen cell proliferation compared to an average 3.2 fold increase in proliferation induced by ODN 1638, which has the same sequence-as ODN 1585 except that the 10 Gs at the two ends are replaced by 10 As. The effect of the G-rich ends is cis; addition of an ODN with poly G ends but no CpG motif to cells along with 1638gave no increased proliferation. [0051]
  • Other octamer ODN containing a 6 base palindrome with a TpC dinucleotide at the 5′ end were also active if they were close to the optimal motif (e.g. ODN 4b,4c). Other dinucleotides at the 5′ end gave reduced stimulation (eg ODN 4f; all sixteen possible dinucleotides were tested). The presence of a 3′ dinucleotide was insufficient to compensate for the lack of a 5′ dinucleotide (eg. ODN. 4g). Disruption of the palindrome eliminated stimulation in octamer ODN (eg., ODN 4h), but palindromes were not required in longer ODN. [0052]
    TABLE 1
    Oligonucleotide Stimulation of B Cells
    Stimulation Index'
    ODN Sequence (5′ to 3′)† 3H Uridine IgM Production
    1 (SEQ ID NO: 2) GCTAGACGTTAGCGT 6.1 ± 0.8 17.9 ± 3.6 
    1a (SEQ. ID NO: 3) ......T........ 1.2 ± 0.2 1.7 ± 0.5
    1b (SEQ ID NO: 4) ......Z........ 1.2 ± 0.1 1.8 ± 0.0
    1c (SEQ ID NO: 5) ............Z.. 10.3 ± 4.4  9.5 ± 1.8
    1d (SEQ ID NO: 6) ..AT......GAGC. 13.0 ± 2.3  18.3 ± 7.5 
    2 (SEQ ID NO: 7) ATGGAAGGTCCAGCGTTCTC 2.9 ± 0.2 13.6 ± 2.0 
    2a (SEQ ID NO: 8) ..C..CTC..G......... 7.7 ± 0.8 24.2 ± 3.2 
    2b (SEQ ID NO: 9) ..Z..CTC.ZG..Z...... 1.6 ± 0.5 2.8 ± 2.2
    2c (SEQ ID NO: 10) ..Z..CTC..G......... 3.1 ± 0.6 7.3 ± 1.4
    2d (SEQ ID NO: 11) ..C..CTC..G......Z.. 7.4 ± 1.4 27.7 ± 5.4 
    2e (SEQ ID NO: 12) ............A....... 5.6 ± 2.0 ND
    3D (SEQ ID NO: 13) GAGAACGCTGGACCTTCCAT 4.9 ± 0.5 19.9 ± 3.6 
    3Da (SEQ ID NO: 14) .........C.......... 6.6 ± 1.5 33.9 ± 6.8 
    3Db (SEQ ID NO: 15) .........C.......G.. 10.1 ± 2.8  25.4 ± 0.8 
    3Dc (SEQ ID NO: 16) ...C.A.............. 1.0 ± 0.1 1.2 ± 0.5
    3Dd (SEQ ID NO: 17) .....Z.............. 1.2 ± 0.2 1.0 ± 0.4
    3De (SEQ ID NO: 18) .............Z...... 4.4 ± 1.2 18.8 ± 4.4 
    3Df (SEQ ID NO: 19) .......A............ 1.6 ± 0.1 7.7 ± 0.4
    3Dg (SEQ ID NO: 20) .........CC.G.ACTG.. 6.1 ± 1.5 18.6 ± 1.5 
    3M (SEQ ID NO: 21) TCCATGTCGGTCCTGATGCT 4.1 ± 0.2 23.2 ± 4.9 
    3Ma (SEQ ID NO: 22) ......CT............ 0.9 ± 0.1 1.8 ± 0.5
    3Mb (SEQ ID NO: 23) .......Z............ 1.3 ± 0.3 1.5 ± 0.6
    3Mc (SEQ ID NO: 24) ...........Z........ 5.4 ± 1.5 8.5 ± 2.6
    3Md (SEQ ID NO: 25) ......A..T.......... 17.2 ± 9.4  ND
    3Me (SEQ ID NO: 26) ...............C..A. 3.6 ± 0.2 14.2 ± 5.2 
    4 TCAACGTT 6.1 ± 1.4 19.2 ± 5.2 
    4a ....GC.. 1.1 ± 0.2 1.5 ± 1.1
    4b ...GCGC. 4.5 ± 0.2 9.6 ± 3.4
    4c ...TCGA. 2.7 ± 1.0 ND
    4d ..TT..AA 1.3 ± 0.2 ND
    4e -....... 1.3 ± 0.2 1.1 ± 0.5
    4f C....... 3.9 ± 1.4 ND
    4g --......CT 1.4 ± 0.3 ND
    4h .......C 1.2 ± 0.2 ND
    LPS 7.8 ± 2.5 4.8 ± 1.0
  • The kinetics of lymphocyte activation were investigated using mouse spleen cells. When the cells were pulsed at the same time as ODN addition and harvested just four hours later, there was already a two-fold increase in [0053] 3H uridine incorporation. Stimulation peaked at 12-48 hours and then decreased. After 24 hours, no intact ODN were detected, perhaps accounting for the subsequent fall in stimulation when purified B cells with or without anti-IgM (at a submitogenic dose) were cultured with CpG ODN, proliferation was found to synergistically increase about 10-fold by the two mitogens in combination after 48 hours. The magnitude of stimulation was concentration dependent and consistently exceeded that of LPS under optimal conditions for both. Oligonucleotides containing a nuclease resistant phosphorothioate backbone were approximately two hundred times more potent than unmodified oligonucleotides.
  • Cell cycle analysis was used to determine the proportion of B cells activated by CpG-ODN. CpG-ODN-induced cycling in more than 95% of B cells (Table 2). Splenic B lymphocytes sorted by flow cytometry into CD23−(marginal zone) and CD23+(follicular) subpopulations were equally responsive to ODN-induced stimulation, as were both resting and activated populations of B cells isolated by fractionation over Percoll gradients. These studies demonstrated that CpG-ODN induce essentially all B cells to enter the cell cycle. [0054]
    TABLE 2
    Cell Cycle Analysis with CpG ODN
    Percent of cells in
    Treatment G0 G1 SA + G2 + M
    Media 97.6 2.4 0.02
    ODN 1a 95.2 4.8 0.04
    ODN 1d 2.7 74.4 22.9
    ODN 3Db 3.5 76.4 20.1
    LPS (30 μg/ml) 17.3 70.5 12.2
  • The mitogenic effects of CpG ODN on human cells, were tested on peripheral blood mononuclear cells (PBMCs) obtained from two patients with chronic lymphocytic leukemia (CLL), as described in Example 1. Control ODN containing up CpG dinucleotide sequence showed no effect on the basal proliferation of 442 cpm and 874 cpm (proliferation measured by [0055] 3H thymidine incorporation) of the human cells. However, a phosphorothioate modified CpG ODN 3Md (SEQ ID NO: 25) induced increased proliferation of 7210 and 86795 cpm respectively in the two patients at a concentration of just 1 μM. Since these cells had been frozen, they may have been less responsive to the oligos than fresh cells in vivo. In addition, cells from CLL patients typically are non-proliferating, which is why traditional chemotherapy is not effective.
  • Certain B cell lines such as WEHI-231 are induced to undergo growth arrest and/or apoptosis in response to crosslinking of their antigen receptor by anti-IgM (Jakway, J. P. et al., “Growth regulation of the B lymphoma cell line WEHI-231 by anti-immunoglobulin, lipopolysaccharide and other bacterial products” [0056] J. Immunol. 137: 2225(1986); Tsubata, T., J. Wu and T. Honjo: B-cell apoptosis induced by antigen receptor crosslinking is blocked by a T-cell signal through CD40.” Nature 364:645 (1993)). WEHI-231 cells are rescued from this growth arrest by certain stimuli such as LPS and by the CD40 ligand. ODN containing the CpG motif were also found to protect WEHI-231 from anti-IgM induced growth arrest, indicating that accessory cell populations are not required for the effect.
  • To better understand the immune effects of unmethylated CpG ODN, the levels of cytokines and prostaglandins in vitro and in vivo were measured. Unlike LPS, CpG ODN were not found to induce purified macrophages to produce prostaglandin PGE2. In fact, no apparent direct effect of CpG ODN was detected on either macrophages or T cells. In vivo or in whole spleen cells, no significant increase in the following interleukins: IL-2, IL-3, IL4, or IL-10 was detected within the first six hours. However, the level of IL-6 increased strikingly within 2 hours in the serum of mice injected with CpG ODN. Increased expression of IL-12 and interferon gamma (IFN-γ) by spleen cells was also detected within the first two hours. [0057]
  • To determine whether CpG ODN can cause in vivo immune stimulation, DBA/2 mice were injected once intraperitoneally with PBS or phosphorothioate CpG or non-CpG ODN at a dose of 33 mg/kg (approximately 500 μg/mouse). Pharmacokinetic studies in mice indicate that this dose of phosphorothioate gives levels of approximately 10 μg/g in spleen tissue (within the effective concentration range determined from the in vitro studies described herein) for longer than twenty-four-hours (Agrawal, S. et al. (1991) [0058] Proc. Natl. Acad. Sci. USA 91:7595). Spleen cells from mice were examined twenty-four-hours after ODN injection for expression of B cells surface activation markers Ly6A/E, Bla-1, and class II MHC using three color flow cytometry and for their spontaneous proliferation using 3H thymidine. Expression of all three activation markers was significantly increased in B cells from mice injected with CpG ODN, but not from mice injected with PBS or non-CpG-ODN. Spontaneous 3H thymidine incorporation was increased by 2-6 fold in spleen cells from mice injected with the stimulatory ODN compared to PBS or non-CpG ODN-injected mice. After. 4 days, serum IgM levels in mice injected with CpG ODN in vivo were increased by approximately 3-fold compared to controls. Consistent with the inability of these agents to activate T cells, there was minimal change in T cell expression of the IL-2R or CD44.
  • Degradation of phophodiester ODN in serum is predominantly mediated by 3′ exonucleases, while intracellular ODN degradation is more complex, involving 5′ and 3′ exonucleases and endonucleases. Using a panel of ODN bearing the 3D sequence with varying numbers of phosphorothioate modified linkages at the 5′ and 3′ ends, it was empirically determined that two 5′ and five 3′ modified linkages are-required to provide optimal stimulation with this CpG ODN. [0059]
  • Unmethylated CpG Containing Oligos Have NK Cell Stimulatory Activity [0060]
  • As described in further detail in Example 4, experiments were conducted to determine whether CpG containing oligonucleotides stimulated the activity of natural killer (NK) cells in addition to B cells. As shown in Table 3, a marked induction of NK activity among spleen cells cultured with CpG ODN 1 and 3Dd was observed. In contrast, there was relatively no induction in effectors that had been treated with non-CpG control ODN. [0061]
    TABLE 3
    Induction Of NK Activity By CpG Oligodeoxynucleotides (ODN)
    % YAC-1 % 2C11
    Specific Lysis* Specific Lysis
    Effector: Target Effector: Target
    ODN 50:1 100:1 50:1 100:1
    None −1.1 −1.4 15.3 16.6
    1 16.1 24.5 38.7 47.2
    3Dd 17.1 27.0 37.0 40.0
    non-CpG ODN −1.6 −1.7 14.8 15.4
  • Neutralizing Activity of Methylated CpG Containing Oligos [0062]
  • B cell mitogenicity of ODN in which cytosines in CpG motifs or elsewhere were replaced by 5-methylcytosine were tested as described in Example 1. As shown in Table 1 above, ODN containing methylated CpG motifs were non-mitogenic (Table 1; ODN 1c, 2f, 3De, and 3Mc). However, methylation of cytosines other than in a CpG dinucleotide retained their stimulatory properties Table 1, ODN 1d, 2d, 3Df, and 3Md). [0063]
  • Immunoinhibitory Activity of Oligos Containing a GCG Trinucleotide Sequence at or Near Both Termini [0064]
  • In some cases, ODN containing CpG dinucleotides that are not in the stimulatory motif described above were found to block the stimulatory effect of other mitogenic CpG ODN. Specifically the addition of an a typical CpG motif consisting of a GCG near or at the 5′ and/or 3′ end of CpG ODN actually inhibited stimulation of proliferation by other CpG motifs. Methylation or substitution of the cytosine in a GCG motif reverses this effect. By itself, a GCG motif in an ODN has a modest mitogenic effect, though far lower than that seen with the preferred CpG motif. [0065]
  • Proposed Mechanisms of Action of Immunostimulatory, Neutralizing and Immunoinhibitory Oligonucleotides [0066]
  • Unlike antigens that trigger B cells through their surface Ig receptor, CpG-ODN did not induce any detectable Ca[0067] 2+ flux, changes in protein tyrosine phosphorylation, or IP 3 generation. Flow cytometry with FITC-conjugated ODN with or without a CpG motif was performed as described in Zhao, Q et al.,(Antisense Research and Development 3:53-66 (1993)), and showed equivalent membrane binding, cellular uptake, efflux, and intracellular localization. This suggests that there may not be cell membrane proteins specific for CpG-ODN. Rather than acting through the cell membrane, that data suggests that unmethylated CpG containing oligonucleotides require cell uptake for activity: ODN covalently linked to a solid Teflon support were nonstimulatory, as were biotinylated ODN immobilized on either avidin beads or avidin coated petri dishes. CpG ODN conjugated to either-FITC or biotin retained full mitogenic properties, indicating no steric hindrance.
  • The optimal CpG motif (TGACGTT/C is identical to the CRE (cyclic AMP response element). Like the mitogenic effects of CpG ODN, binding of CREB to the CRE is abolished if the central CpG is methylated. Electrophoretic mobility shift assays were used to determine whether CpG ODN, which are single stranded, could compete with the binding of. B cell CREB/ATF proteins to their normal binding site, the doublestranded CRE. Competition assays demonstrated that single stranded ODN containing CpG motifs could completely compete the binding of CREB to its binding site, while ODN without CpG motifs could not. These data support the conclusion that CpG ODN exert their mitogenic effects through interacting with one or more B cell CREB/ATF proteins in some way. Conversely, the presence of GCG sequences or other a typical CPG motifs near the 5′ and/or 3′ ends of ODN likely interact with CREB/ATF proteins in a way that does not cause activation, and may even prevent it. [0068]
  • The stimulatory CpG motif is common in microbial genomic DNA, but quite rare in vertebrate DNA. In addition, bacterial DNA has been reported to induce B cell proliferation and immunoglobulin (Ig) production, while mammalian DNA does not (Messina, J. P. et al., [0069] J. Immunol. 147:1759 (1991)). Experiments further described in Example 3, in which methylation of bacterial DNA with CpG methylase was found to abolish mitogenicity, demonstrates that the difference in CpG status is the cause of B cell stimulation by bacterial DNA. This data supports the following conclusion: that unmethylated CpG dinucleotides present within bacterial DNA are responsible for the stimulatory effects of bacterial DNA.
  • Teleologically, it appears likely that lymphocyte activation by the CpG motif represents an immune defense mechanism that can thereby distinguish bacterial from host DNA. Host DNA would induce little or no lymphocyte activation due to it CpG suppression and methylation. Bacterial DNA would cause selective lymphocyte activation in infected tissues. Since the CpG pathway synergizes with B cell activation through the antigen receptor, B cells bearing antigen receptor specific for bacterial antigens would receive one activation signal through cell membrane Ig and a second signal from bacterial DNA, and would therefore tend to be preferentially activated. The interrelationship of this pathway with other pathways of B cell activation provide a physiologic mechanism employing a polyclonal antigen to induce antigen-specific responses. [0070]
  • Method for Making Immunostimulatory Oligos [0071]
  • For use in the instant invention, oligonucleotides can be synthesized de novo using any of a number of procedures well known in the art. For example, the β-cyanoethyl phosphoramidite method (S. L. Beaucage and M. H. Caruthers, (1981) [0072] Tet. Let. 22:1859); nucleoside H-phosphonate method (Garegg et al., (1986) Tet. Let. 27: 4051-4054; Froehler et al., (1986) Nucl. Acid Res. 14: 5399-5407; Garegg et al., (1986) Tet. Let. 27: 4055-4058, Gaffney et al., (1988) Tet. Let. 29:2619-2622). These chemistries can be performed by a variety of automated oligonucleotide synthesizers available in the market. Alternatively, oligonucleotides can be prepared from existing nucleic acid sequences (e.g. genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases.
  • For use in vivo, oligonucleotides are preferably relatively resistant to degradation (e.g. via endo- and exo- nucleases). Oligonucleotide stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized oligonucleotide has a phosphorothioate modified backbone. The pharmacokinetics of phosphorothioate ODN show that they have a systemic half-life of forty-eight hours in rodents and suggest that they may be useful for in vivo applications (Agrawal, S. et al. (1991) [0073] Proc. Natl. Acad. Sci. USA 88:7595). Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H phosphonate chemistries. Aryl- and alky- phosphonates can be made e.g. (as described in U.S. Pat. No. 4,469,863); and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated-solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev. 90:544; Goodchild, J. (1990) Bioconjugate Chem. 1:165).
  • For administration in vivo, oligonucleotides may be associated with a molecule that results in higher affinity binding to target cell (e.g. B-cell and natural killer (NK) cell) surfaces and/or increased cellular uptake by target cells to form an “oligonucleotide delivery complex”. Oligonucleotides can be ionically, or covalently associated with appropriate molecules using techniques which are well known in the art. A variety of coupling or crosslinking agents can be used e.g. protein A, carbodiimide, and N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP). Oligonucleotides can alternatively be encapsulated in liposomes or virosomes using well-known techniques. [0074]
  • The present invention is further illustrated by the following Examples which in no way should be construed as further limiting. The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this: application are hereby expressly incorporated by reference. [0075]
  • Therapeutic Uses of Immunostimulatory Oligos [0076]
  • Based on their immunostimulatory properties, oligonucleotides containing at least-one unmethylated CpG dinucleotide can be administered to a subject in vivo to treat an “immune system deficiency”. Alternatively, oligonucleotides containing at least one unmethylated CpG dinucleotide can be contacted with lymphocytes (e.g. B cells or NK cells) obtained from a subject having an immune system deficiency ex vivo and activated lymphocytes can then be reimplanted in the subject. [0077]
  • Immunostimulatory oligonucleotides can also be administered to a subject in conjunction with a vaccine, as an adjuvant, to boost a subject's immune system to effect better response from the vaccine. Preferably the unmethylated CpG dinucleotide is administered slightly before or at the same time as the vaccine. [0078]
  • Preceding chemotherapy with an immunostimulatory oligonucleotide should prove useful for increasing the responsiveness of the malignant cells to subsequent chemotherapy. CpG ODN also increased natural killer cell activity in both human and murine cells. Induction of NK activity may likewise be beneficial in cancer immunotherapy. [0079]
  • Therapeutic Uses for Neutral Oligonucleotides [0080]
  • Oligonucleotides that are complementary to certain target sequences can be synthesized and administered to a subject in vivo. For example, antisense oligonucleotides hybridize to complementary mRNA, thereby preventing expression of a specific target gene. The sequence-specific effects of antisense oligonucleotides have made them useful research tools for the investigation of protein function. Phase I/II human trials of systemic antisense therapy are now underway for acute myelogenous leukemia and HIV. [0081]
  • In addition, oligonucleotide probes (i.e. oligonucleotides with a detectable label) can be administered to a subject to detect the presence of a complementary sequence based on detection of bound label. In vivo administration and detection of oligonucleotide probes may be useful for diagnosing certain diseases that are caused or exacerbated by certain DNA sequences (e.g. systemic lupus erythematosus, sepsis and autoimmune diseases). [0082]
  • Antisense oligonucleotides or oligonucleotide probes in which any or all CpG dinucleotide is methylated, would not produce an immune reaction when administered to a subject in vivo and therefore would be safer than the corresponding non-methylated CpG containing oligonucleotide. [0083]
  • For use in therapy, an effective amount of an appropriate oligonucleotide 0.10 alone or formulated as an oligonucleotide delivery complex can be administered to a subject by any mode allowing the oligonucleotide to be taken up by the appropriate target cells (e.g. B-cells and NK cells). Preferred routes of administration include oral and transdermal (e.g. via a patch). Examples of other routes of administration include injection (subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal, etc.). The injection can be in a bolus or a continuous infusion. [0084]
  • An oligonucleotide alone or as an oligonucleotide delivery complex can be administered in conjunction with a pharmaceutically acceptable carrier. As used herein, the phrase “pharmaceutically acceptable carrier” is intended to include substances that can be coadministered with an oligonucleotide or an oligonucleotide delivery complex and allows the oligonucleotide to perform its intended function. Examples of such carriers include solutions, solvents, dispersion media, delay agents, emulsions and the like. The use of such media for pharmaceutically active substances are well known in the art. Any other conventional carrier suitable for use with the oligonucleotides falls within the scope of the instant invention. [0085]
  • The language “effective amount” of an oligonucleotide refers to that amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of an oligonucleotide containing at least one methylated CpG for treating an immune system deficiency could be that amount necessary to eliminate a tumor, cancer, or bacterial, viral or fungal infection. An effective amount for use as a vaccine adjuvant could be that amount useful for boosting a subject's immune response to a vaccine. An “effective amount” of an oligonucleotide lacking a non-methylated CpG for use in treating a disease associated with immune system activation, could be that amount necessary to outcompete non-methylated CpG containing nucleotide sequences. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular oligonucleotide being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular oligonucleotide without necessitating undue experimentation. [0086]
  • The studies reported above indicate that unmethylated CpG containing oligonucleotides are directly mitogenic for lymphocytes (eg. B cells and NK cells). Together, with the presence of these sequences in bacterial DNA, these results suggest that the underrepresentation of CpG dinucleotides in animal genomes, and the extensive methylation of cytosines present in such dinucleotides, may be explained by the existence of an immune defense mechanism that can distinguish bacterial from host DNA. Host DNA would commonly be present in many anatomic regions and areas-of inflammation due to apoptosis (cell death), but generally induces little or no lymphocyte activation. However, the presence of bacterial DNA containing unmethylated CpG motifs can cause lymphocyte activation precisely in infected anatomic regions, where it is beneficial. This novel activation pathway provides a rapid alternative to T cell dependent antigen specific-B cell activation. However, it is likely that B cell activation would not be totally nonspecific. B cells bearing antigen receptors specific for bacterial products could receive one activation signal through cell membrane Ig, and a second from bacterial DNA, thereby more vigorously triggering antigen specific immune responses. [0087]
  • As with other immune defense mechanisms, the response to bacterial DNA could have undesirable consequences in some settings. For example, autoimmune responses to self antigens would also tend to be preferentially triggered by bacterial infections, since autoantigens could also provide a second activation signal to autoreactive B cells triggered by bacterial DNA. Indeed the induction of autoimmunity by bacterial infections is a common clinical observance. For example, the autoimmune disease systemic lupus erythematosus, which is: i) characterized by the production of anti-DNA antibodies; ii) induced by drugs which inhibit DNA methyltransferase (Cornacchia, E. J. et al., [0088] J. Clin. Invest. 92:38 (1993)); and iii) associated with reduced DNA methylation (Richardson, B., L. et al., Arth. Rheum 35:647 (1992)), is likely triggered at least in part by activation of DNA-specific B cells through stimulatory signals provided by CpG motifs, as well as by binding of bacterial DNA to antigen receptors.
  • Further, sepsis, which is characterized by high morbidity and mortality due to massive and nonspecific activation of the immune system may be initiated by bacterial DNA and other products released from dying bacteria that reach concentrations sufficient to directly activate many lymphocytes. [0089]
  • Lupus, sepsis and other “diseases associated with immune system activation” may be treated, prevented or ameliorated by administering to a subject oligonucleotides lacking an unmethylated CpG dinucleotide (e.g. oligonucleotides that do not include a CpG motif or oligonucleotides in which the CpG motif is methylated) to block the binding of unmethylated CpG containing nucleic acid sequences. Oligonucleotides lacking an unmethylated CpG motif can be administered alone or in conjunction with compositions that block an immune cell's response to other mitogenic bacterial-products (e.g. LPS). [0090]
  • The following serves to illustrate mechanistically how oligonucleotides containing an unmethylated CpG dinucleotide can treat, prevent or ameliorate the disease lupus. Lupus is commonly thought to be triggered by bacterial or viral infections. Such infections have been reported to stimulate the production of nonpathogenic antibodies to single stranded DNA. These antibodies likely recognize primarily bacterial sequences including unmethylated CpGs. As disease develops in lupus, the anti-DNA: antibodies shift to pathogenic antibodies that are specific for double-stranded DNA. These antibodies would have increased binding for methylated CpG sequences and their production would result from a breakdown of tolerance in lupus. Alternatively, lupus may result when a patient's DNA becomes hypomethylated, thus allowing anti-DNA antibodies specific for unmethylated CpGs to bind to self DNA and trigger more widespread autoimmunity through the process referred to as “epitope spreading”. [0091]
  • In either case, it may be possible to restore tolerance in lupus patients by coupling antigenic oligonucleotides to a protein carrier such as gamma globulin (IgG). Calf-thymus DNA complexed to gamma globulin has been reported to reduce anti-DNA antibody formation. [0092]
  • Therapeutic Uses of Oligos Containing GCG Trinucleotide Sequence at or Near Both Termini [0093]
  • Based on their interaction with CREB/ATF, oligonucleotides containing GCG trinucleotide sequences at or near both termini have antiviral activity, independent of any antisense effect due to complementarity between the oligonucleotide and the viral sequence being targeted. Based on this activity, an effective amount of inhibitory oligonucleotides can be administered to a subject to treat or prevent a viral infection. [0094]
  • EXAMPLES Example 1 Effects of ODNs on B Cell Total RNA Synthesis and Cell Cycle
  • B cells were purified from spleens obtained from 6-12 wk old specific pathogen free DBA/20 or BXSB mice (bred in the University of Iowa animal care facility; no substantial strain differences were noted) that were depleted of T cells with anti-Thy-1.2 and complement and centrifugation over lympholyte M (Cedarlane Laboratories, Hornby, Ontario, Canada) (“B cells”). B cells contained fewer than 1% CD4[0095] + or CD8+ cells. 8×104 B cells were dispensed in triplicate into 96 well microtiter plates in 100 μl RPMI containing 10% FBS (heat inactivated to 65° C. for 30 min.), 50 μM 2-mercaptoethanol, 100 U/ml penicillin, 100 ug/ml streptomycin, and 2 mM L-glutamate. 20 μM ODN were added at the start of culture for 20 h at 37° C., cells pulsed with 1 μCi of 3H uridine, and harvested and counted 4 hr later. Ig secreting B cells were enumerated using the ELISA spot assay after culture of whole spleen cells with ODN at 20 μM for 48 hr. Data, reported in Table 1, represent the stimulation index compared to cells cultured without ODN. Cells cultured without ODN gave 687 cpm, while cells cultured with 20 μg/ml LPS (determined by titration to be the optimal concentration) gave 99,699 cpm in this experiment. 3H thymidine incorporation assays showed similar results, but with some nonspecific inhibition by thymidine released from degraded ODN (Matson. S and A. M. Krieg (1992) Nonspecific suppression of 3H-thymidine incorporation by control oligonucleotides. Antisense Research and Development 2:325).
  • For cell cycle analysis, 0.2×10[0096] 6 B cells were cultered for 48 hr. in 2 ml tissue culture medium alone, or with 30 μg/ml LPS or with the indicated phosphorothioate modified ODN at 1 μM. Cell cycle analysis was performed as described in (Darzynkiewicz, Z. et al., Proc. Natl. Acad. Sci. USA 78:2881 (1981)).
  • To test the mitogenic effects of CpG ODN on human cells, perpheral blood monocyte cells (PBMCs) were obtained from two patients with chronic lymphocytic leukemia (CLL), a disease in which the circulating cells are malignant B cells. Cells were cultured for 48 hrs and pulsed for 4 hours with tritiated thymidine as described above. [0097]
  • Example 2 [0098]
  • Effects of ODN on Production of IgM from B Cells
  • Single cell suspensions from the spleens of freshly killed mice were treated with anti-Thyl, anti-CD4, and anti-CD8 and complement by the method of Leibson et al., [0099] J. Exp. Med 154:1681 (1981)). Resting B cells (<.02% T cell contamination) were isolated from the 63-70% band of a discontinuous Percoll gradient by the procedure of DeFranco et al, J. Exp. Med 155:1523 (1982). These were cultured as described above in 30 μM ODN or 20 μg/ml LPS for 48 hr. The number of B cells actively secreting IgM was maximal at this time point, as determined by ELIspot assay (Klinman, D. M. et al. J. Immunol. 144:506 (1990)). In that assay, B cells were incubated for 6 hrs on anti-Ig coated microtiter plates. The Ig they produced (>99% IgM) was detected using phosphatase-labelled anti-Ig (Southern Biotechnology Associated, Birmingham, Ala.). The antibodies produced by individuals B cells were visualized by addition of BCIP (Sigma Chemical Co., St. Louis Mo.) which forms an insoluble blue-precipitate in the presence of phosphatase. The dilution of cells producing 20-40 spots/well was used to determine the total number of antibody-secreting B cells/sample. All assays were performed in triplicate. In some experiments, culture supernatants were assayed for IgM by ELISA, and showed similar increases in response to CpG-ODN.
  • table 1 [0100]
  • Example 3 B cell Stimulation by Bacterial DNA
  • DBA/2 B cells were cultured with no DNA or 50 μg/ml of a) [0101] Micrococcus lysodeikticus; b) NZB/N mouse spleen; and c) NFS/N mouse spleen genomic DNAs for 48 hours, then pulsed with 3H thymidine for 4 hours prior to cell harvest. Duplicate DNA samples were digested with DNAse I for 30 minutes at 37 C prior to addition to cell cultures. E coli DNA also induced an 8.8 fold increase in the number of IgM secreting B cells by 48 hours using the ELISA-spot assay.
  • DBA/2 B cells were cultured with either no additive, 50 μg/ml LPS or the ODN 1; 1a; 4; or 4a at 20 uM. Cells were cultured and harvested at 4, 8, 24 and 48 hours. BXSB cells were cultured as in Example 1 with 5, 10, 20, 40 or 80 μM of ODN 1; 1a; 4; or 4a or LPS. In this experiment, wells with no ODN had 3833 cpm. Each experiment was performed at least three times with similar results. Standard deviations of the triplicate wells were <5%. [0102]
  • Example 4 Effects of ODN on Natural Killer (NK) Activity
  • 10×10[0103] 6 C57BL/6 spleen cells were cultured in two ml RPMI (supplemented as described for Example 1) with or without 40 μM CpG or non-CpG ODN for forty-eight hours. Cells were washed, and then used as effector cells in a short term 51Cr release assay with YAC-1 and 2C11, two NK sensitive target cell lines (Ballas, Z. K. et al. (1993) J. Immunol. 150:17). Effector cells were added at various concentrations to 104 51Cr-labeled target cells in V-bottom microtiter plates in 0.2 ml, and incubated in 5% CO2 for 4 hr. at 37° C. Plates were then centrifuged, and an aliquot of the supernatant counted for radioactivity. Percent specific lysis was determined by calculating the ratio of the 51Cr released in the presence of effector cells minus the 51Cr released when the target cells are cultured alone, over the total counts released after cell lysis in 2% acetic acid minus the 51Cr cpm released when the cells are cultured alone.
  • Example 5 In-vivo Studies with CPG Phosphorothioate ODN
  • Mice were weighed and injected IP with 0.25 ml of sterile PBS or the indicated phosphorothioate ODN dissolved in PBS. Twenty four hours later, spleen cells were harvested, washed, and stained for flow cytometry using phycoerythrin conjugated 6B2 to gate on B cells in conjunction with biotin conjugated anti Ly-6A/E or anti-Ia[0104] d (Pharmingen, San Diego, Calif.) or anti-Bla-1 (Hardy, PR. et al., J. Exp. Med 159:1169 (1984). Two mice were studied for each condition and analyzed individually.
  • Example 6 Titration of Phosphorothioate ODN for B Cell Stimulation
  • B cells were cultured with phosphorothioate ODN with the sequence of control ODN 1a or the CpG ODN-1d and 3 Db and then either pulsed after 20 hr with [0105] 3H uridine or after 44 hr with 3H thymidine before harvesting and determining cpm.
  • Example 7 Rescue of B Cells From Apoptosis
  • WEHI-231 cells (5×10[0106] 4/well) were cultured for 1 hr. at 37 C in the presence or absence of LPS or the control ODN 1a or the CpG ODN 1d and 3 Db before addition of anti-IgM (1 μ/ml). Cells were cultured for a further 20 hr. before a 4 hr. pulse with 2 μCi/well 3H thymidine. In this experiment, cells with no ODN or anti-IgM gave 90.4×103 by addition of anti-IgM. The phosphodiester ODN shown in Table 1 gave similar protection; though with some nonspecific suppression due to ODN degradation. Each experiment was repeated at least 3 times with similar results.
  • Example 8 In vivo Induction of IL-6
  • DBA/2 female mice (2 mos. old) were injected IP with 500 μg CPG or control phosphorothioate ODN. At various time points-after injection, the mice were bled. Two mice were studied for each time point. IL-6was measured by Elisa, and IL-6 concentration was calculated by comparison to a standard curve generated using recombinant IL-6. The sensitivity of the assay was 10 pg/ml. Levels were undetectable after 8-hr. [0107]
  • Example 9 Binding of B cell CREB/ATF to a Radiolabelled Doublestranded CRE Probe CREB).
  • Whole cell extracts from CH12.LX B cells showed 2 retarded bands when analyzed by EMSA with the CRE probe (free probe is off the bottom of the figure). The CREB/ATF protein(s) binding to the CRE were competed by the indicated amount of cold CRE, and by single-stranded CpG ODN, but not by non-CpG ODN. [0108]
  • Equivalents [0109]
  • Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims. [0110]

Claims (27)

1. An oligonucleotide comprising from about 2 to about 100 nucleotides and containing at least one unmethylated CpG dinucleotide.
2. The oligonucleotide of claim 1 which is represented by the following formula:
5′X1X2CGX3X43′
wherein C and G are unmethylated, X1, X2, X3 and X4 are nucleotides and
a GCG trinucleotide sequence is not present at or near the 5′ and 3′ termini.
3. The oligonucleotide of claim 2 having a phosphate backbone modification.
4. The oligonucleotide of claim 3 wherein the phosphate backbone modification is a phosphorothioate backbone modification.
5. The oligonucleotide of claim 4 comprising the following nucleotide sequence:
5′ GGGGTCAACGTTGAGGGGGG 3′ (SEQ ID NO:1)
6. The oligonucleotide of claim 5 having a phosphate backbone modification.
7. The oligonucleotide of claim 6 wherein the phosphate backbone modification is a phosphorothioate modification.
8. An oligonucleotide delivery complex comprising the oligonucleotide of claim 1 and a targeting means.
9. An oligonucleotide delivery complex of claim 8, wherein the targeting means is selected from the group consisting of cholesterol, virosome, liposome, lipid, a target cell specific binding agent
10. A pharmaceutical composition comprising the oligonucleotide of claim 9 and a pharmaceutically acceptable carrier.
11. A pharmaceutical composition comprising the oligonucleotide of claim 2 and a pharmaceutically acceptable carrier.
12. A method for activating a subject's B cells comprising contacting the B cells with an effective amount of the oligonucleotide of claim 1.
13. A method for activating a subject's B cells comprising contacting the B cells with an effective amount of the oligonucleotide of claim 2.
14. A method for activating a subject's natural killer cells comprising contacting the natural killer cells with an effective amount of the oligonucleotide of claim 1.
15. A method for activating a subject's natural killer cells comprising contacting the natural killer cells with an effective amount of the oligonucleotide of claim 2.
16. A method for treating, preventing or ameliorating an immune system deficiency in a subject comprising administering to the subject an effective amount of a pharmaceutical composition of claim 10.
17. A method for treating, preventing or ameliorating an immune system deficiency in a subject comprising the steps of:
a) contacting lymphocytes obtained from the subject with a composition of claim 1 ex vivo, thereby producing activated lymphocytes; and
b) readministering the activated lymphocytes obtained in step a) to the subject.
18. A method for vaccinating a subject comprising administering to the subject a composition of claim 10 in conjunction with administration of a vaccine.
19. A method for treating a disease associated with an immune system activation in a subject comprising administering to the subject an effective amount of a neutral oligonucleotide alone or in conjunction with a pharmaceutically acceptable carrier.
20. A method of claim 19 wherein the disease associated with immune system activation is systemic lupus erythematosus.
30. A method of claim 19 wherein the disease associated with immune system activation is sepsis.
31. An improved method for performing antisense therapy comprising methylating CpG containing oligonucleotides prior to administration to a subject.
32. An improved method for in vivo diagnoses using oligonucleotide probes comprising methylating CpG containing oligonucleotides prior to administration to a subject
33. An oligonucleotide which is capable of interfering with the activity of viral or cellular transcription factors and containing a consensus immunoinhibitory CpG motif represented by the formula:
5′GCGXnGCG3′
wherein X=a nucleotide and n=in the range of 0-50.
34. An oligonucleotide of claim 33, wherein X is a pyrimidine.
35. An oligonucleotide of claim 34, wherein Xn is a CpG dinucleotide
36. A method for treating or preventing a viral infection in a subject comprising administering to the subject an immunoinhibitory oligonucleotide of claim 33.
US10/789,051 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides Abandoned US20040142469A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/789,051 US20040142469A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US27635894A 1994-07-15 1994-07-15
US08/386,063 US6194388B1 (en) 1994-07-15 1995-02-07 Immunomodulatory oligonucleotides
US09/415,142 US20030026782A1 (en) 1995-02-07 1999-10-08 Immunomodulatory oligonucleotides
US10/690,495 US20040143112A1 (en) 1994-07-15 2003-10-21 Immunomodulatory oligonucleotides
US10/789,051 US20040142469A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US10/690,495 Continuation US20040143112A1 (en) 1994-07-15 2003-10-21 Immunomodulatory oligonucleotides

Publications (1)

Publication Number Publication Date
US20040142469A1 true US20040142469A1 (en) 2004-07-22

Family

ID=23524008

Family Applications (19)

Application Number Title Priority Date Filing Date
US09/415,142 Abandoned US20030026782A1 (en) 1994-07-15 1999-10-08 Immunomodulatory oligonucleotides
US10/631,676 Abandoned US20040087534A1 (en) 1994-07-15 2003-07-30 Immunomodulatory oligonucleotides
US10/690,495 Abandoned US20040143112A1 (en) 1994-07-15 2003-10-21 Immunomodulatory oligonucleotides
US10/769,626 Abandoned US20040162258A1 (en) 1994-07-15 2004-01-30 Immunomodulatory oligonucleotides
US10/787,737 Abandoned US20040171150A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/789,353 Abandoned US20040162262A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/789,536 Expired - Fee Related US8309527B2 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/788,191 Abandoned US20040152656A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/788,199 Abandoned US20040181045A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/789,051 Abandoned US20040142469A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/847,650 Abandoned US20050004062A1 (en) 1994-07-15 2004-05-17 Immunomodulatory oligonucleotides
US10/888,089 Expired - Fee Related US8148340B2 (en) 1994-07-15 2004-07-09 Immunomodulatory oligonucleotides
US10/888,885 Abandoned US20050009774A1 (en) 1994-07-15 2004-07-09 Immunomodulatory oligonucleotides
US11/067,516 Abandoned US20050239736A1 (en) 1994-07-15 2005-02-25 Immunomodulatory oligonucleotides
US11/128,127 Abandoned US20070009482A9 (en) 1994-07-15 2005-05-11 Immunomodulatory oligonucleotides
US11/127,797 Expired - Fee Related US8114848B2 (en) 1994-07-15 2005-05-11 Immunomodulatory oligonucleotides
US11/127,803 Abandoned US20050244379A1 (en) 1994-07-15 2005-05-11 Immunomodulatory oligonucleotides
US11/296,644 Abandoned US20060094683A1 (en) 1994-07-15 2005-12-07 Immunomodulatory oligonucleotides
US11/645,106 Abandoned US20070202128A1 (en) 1994-07-15 2006-12-22 Immunomodulatory oligonucleotides

Family Applications Before (9)

Application Number Title Priority Date Filing Date
US09/415,142 Abandoned US20030026782A1 (en) 1994-07-15 1999-10-08 Immunomodulatory oligonucleotides
US10/631,676 Abandoned US20040087534A1 (en) 1994-07-15 2003-07-30 Immunomodulatory oligonucleotides
US10/690,495 Abandoned US20040143112A1 (en) 1994-07-15 2003-10-21 Immunomodulatory oligonucleotides
US10/769,626 Abandoned US20040162258A1 (en) 1994-07-15 2004-01-30 Immunomodulatory oligonucleotides
US10/787,737 Abandoned US20040171150A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/789,353 Abandoned US20040162262A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/789,536 Expired - Fee Related US8309527B2 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/788,191 Abandoned US20040152656A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides
US10/788,199 Abandoned US20040181045A1 (en) 1994-07-15 2004-02-26 Immunomodulatory oligonucleotides

Family Applications After (9)

Application Number Title Priority Date Filing Date
US10/847,650 Abandoned US20050004062A1 (en) 1994-07-15 2004-05-17 Immunomodulatory oligonucleotides
US10/888,089 Expired - Fee Related US8148340B2 (en) 1994-07-15 2004-07-09 Immunomodulatory oligonucleotides
US10/888,885 Abandoned US20050009774A1 (en) 1994-07-15 2004-07-09 Immunomodulatory oligonucleotides
US11/067,516 Abandoned US20050239736A1 (en) 1994-07-15 2005-02-25 Immunomodulatory oligonucleotides
US11/128,127 Abandoned US20070009482A9 (en) 1994-07-15 2005-05-11 Immunomodulatory oligonucleotides
US11/127,797 Expired - Fee Related US8114848B2 (en) 1994-07-15 2005-05-11 Immunomodulatory oligonucleotides
US11/127,803 Abandoned US20050244379A1 (en) 1994-07-15 2005-05-11 Immunomodulatory oligonucleotides
US11/296,644 Abandoned US20060094683A1 (en) 1994-07-15 2005-12-07 Immunomodulatory oligonucleotides
US11/645,106 Abandoned US20070202128A1 (en) 1994-07-15 2006-12-22 Immunomodulatory oligonucleotides

Country Status (1)

Country Link
US (19) US20030026782A1 (en)

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010044416A1 (en) * 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US20030191079A1 (en) * 1994-07-15 2003-10-09 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20030212026A1 (en) * 1999-09-25 2003-11-13 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040171150A1 (en) * 1994-07-15 2004-09-02 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040198688A1 (en) * 1994-07-15 2004-10-07 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040235774A1 (en) * 2000-02-03 2004-11-25 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040266719A1 (en) * 1998-05-22 2004-12-30 Mccluskie Michael J. Methods and products for inducing mucosal immunity
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050181422A1 (en) * 2000-09-15 2005-08-18 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20050218499A1 (en) * 2004-03-31 2005-10-06 Advanced Semiconductor Engineering, Inc. Method for manufacturing leadless semiconductor packages
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050256073A1 (en) * 2004-02-19 2005-11-17 Coley Pharmaceutical Group, Inc. Immunostimulatory viral RNA oligonucleotides
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060166923A1 (en) * 2002-05-22 2006-07-27 Bo Young Ahn Immune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US20060229271A1 (en) * 2005-04-08 2006-10-12 Coley Pharmaceutical Group, Inc. Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) * 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20060286070A1 (en) * 1999-09-27 2006-12-21 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US20060287263A1 (en) * 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing antigen-specific immune responses
US20080026986A1 (en) * 2006-06-05 2008-01-31 Rong-Fu Wang Reversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US7566703B2 (en) 2004-10-20 2009-07-28 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US7569553B2 (en) 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US20090306177A1 (en) * 2005-09-16 2009-12-10 Coley Pharmaceutical Gmbh Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20100021470A1 (en) * 2003-02-26 2010-01-28 Institute For Research In Biomedicine Monoclonal antibody production by ebv transformation of b cells
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US7741300B2 (en) 1998-06-25 2010-06-22 National Jewish Medical And Research Center Methods of using nucleic acid vector-lipid complexes
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8188254B2 (en) 2003-10-30 2012-05-29 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity

Families Citing this family (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5849719A (en) * 1993-08-26 1998-12-15 The Regents Of The University Of California Method for treating allergic lung disease
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
IL139646A0 (en) * 1998-05-14 2002-02-10 Coley Pharm Group Inc Methods for regulating hematopoiesis using cpg-oligonucleotides
US6693086B1 (en) * 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
AU4343700A (en) * 1999-04-12 2000-11-14 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Oligodeoxynucleotide and its use to induce an immune response
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US20050002958A1 (en) * 1999-06-29 2005-01-06 Smithkline Beecham Biologicals Sa Vaccines
WO2001051500A1 (en) * 2000-01-14 2001-07-19 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20030129251A1 (en) * 2000-03-10 2003-07-10 Gary Van Nest Biodegradable immunomodulatory formulations and methods for use thereof
US7129222B2 (en) * 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
KR100917101B1 (en) * 2000-08-04 2009-09-15 도요 보세키 가부시키가이샤 Flexible metal laminate and production method thereof
ES2307568T3 (en) * 2000-12-08 2008-12-01 Coley Pharmaceutical Gmbh CPG TYPE NUCLEIC ACIDS AND SAME USE METHODS.
PT1404873E (en) * 2001-06-21 2013-07-30 Dynavax Tech Corp Chimeric immunomodulatory compounds and methods of using the same
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
US7354909B2 (en) * 2001-08-14 2008-04-08 The United States Of America As Represented By Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
EP1450856B1 (en) 2001-09-14 2009-11-11 Cytos Biotechnology AG Packaging of immunostimulatory cpg into virus-like particles: method of preparation and use
CN1633598A (en) * 2001-10-05 2005-06-29 科勒制药股份公司 Toll-like receptor 3 signaling agonists and antagonists
WO2003054161A2 (en) 2001-12-20 2003-07-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services USE OF CpG OLIGODEOXYNUCLEOTIDES TO INDUCE ANGIOGENESIS
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
US7605138B2 (en) * 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8263091B2 (en) * 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US7537767B2 (en) * 2003-03-26 2009-05-26 Cytis Biotechnology Ag Melan-A- carrier conjugates
US20050013812A1 (en) * 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
AU2004289975B2 (en) 2003-11-04 2011-11-03 Geron Corporation RNA amidates and thioamidates for RNAI
EP1753453A2 (en) * 2004-06-08 2007-02-21 Coley Pharmaceutical GmbH Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
AU2006216493A1 (en) * 2005-02-24 2006-08-31 Coley Pharmaceutical Gmbh Immunostimulatory oligonucleotides
SG163583A1 (en) * 2005-07-07 2010-08-30 Coley Pharm Group Inc Anti-ctla-4 antibody and cpg-motif-containing synthetic oligodeoxynucleotide combination therapy for cancer treatment
WO2007092315A2 (en) * 2006-02-03 2007-08-16 The Regents Of The University Of California Immunostimulation by cpg oligonucleotide-virus complexes
ES2553284T5 (en) * 2006-02-15 2021-08-31 Rechtsanwalt Thomas Beck Compositions and Procedures for Oligonucleotide Formulations
US8173219B2 (en) * 2006-06-09 2012-05-08 Georgia-Pacific Chemicals Llc Porous fiberglass materials having reduced formaldehyde emissions
RU2468819C2 (en) * 2007-08-01 2012-12-10 Идера Фармасьютикалз, Инк. New synthetic tlr9 agonists
EP2123758A1 (en) * 2008-05-20 2009-11-25 Wageningen Universiteit Influenza cap-leader sequence
TWI351288B (en) * 2008-07-04 2011-11-01 Univ Nat Pingtung Sci & Tech Cpg dna adjuvant in avian vaccines
GB0815675D0 (en) * 2008-08-28 2008-10-08 Mabtech Ab Antibody secreting cell elispot
EP2376107B1 (en) 2008-12-09 2014-05-21 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US8552165B2 (en) * 2008-12-09 2013-10-08 Heather Davis Immunostimulatory oligonucleotides
ES2536747T3 (en) 2009-01-20 2015-05-28 Transgene Sa Soluble ICAM 1 as a biomarker for therapeutic response prediction
NZ595290A (en) 2009-03-24 2012-09-28 Transgene Sa Biomarker for monitoring patients
MX2011010050A (en) 2009-03-25 2011-12-14 Univ Texas Compositions for stimulation of mammalian innate immune resistance to pathogens.
NZ594896A (en) 2009-04-17 2013-07-26 Transgene Sa Biomarker for monitoring patients
US20110009477A1 (en) * 2009-07-08 2011-01-13 Idera Pharmaceuticals, Inc. Oligonucleotide-based compounds as inhibitors of toll-like receptors
DK2452194T3 (en) 2009-07-10 2015-11-30 Transgene Sa Biomarker PATIENT SELECTION AND RELATED PRACTICES
WO2013007703A1 (en) * 2011-07-08 2013-01-17 Universität Zürich CLASS A CpG OLIGONUCLEOTIDES FOR PREVENTION OF VIRAL INFECTION IN CATS
BR112014001472A2 (en) * 2011-07-22 2017-02-21 Abbott Lab galactooligosaccharides to prevent injury and / or promote healing of the gastrointestinal tract
JP6697384B2 (en) 2013-07-25 2020-05-20 イグジキュア, インコーポレーテッドExicure, Inc. Spherical nucleic acid-based constructs as immunostimulants for prophylactic and therapeutic use
CN105683372A (en) * 2013-09-20 2016-06-15 国立研究开发法人医疗基盘健康荣养研究所 Complex containing oligonucleotide having immunopotentiating activity and use thereof
CA2932122C (en) 2013-12-03 2022-04-19 Northwestern University Liposomal particles, methods of making same and uses thereof
AU2015269412B2 (en) 2014-06-04 2020-03-12 Exicure Operating Company Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
US10286065B2 (en) 2014-09-19 2019-05-14 Board Of Regents, The University Of Texas System Compositions and methods for treating viral infections through stimulated innate immunity in combination with antiviral compounds
WO2016081911A2 (en) 2014-11-21 2016-05-26 Northwestern University The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
WO2018039629A2 (en) 2016-08-25 2018-03-01 Northwestern University Micellar spherical nucleic acids from thermoresponsive, traceless templates
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
EP3652186A4 (en) 2017-07-13 2021-03-31 Northwestern University General and direct method for preparing oligonucleotide-functionalized metal-organic framework nanoparticles
KR102578060B1 (en) * 2018-03-23 2023-09-13 한림대학교 산학협력단 An anti-bacterial antibody and a use of the same
CN111378622B (en) * 2018-12-29 2022-12-02 华东师范大学 Nucleic acid-encoded CAR-T cells and preparation method and application thereof
EP4104830A1 (en) 2021-06-16 2022-12-21 Burghardt Wittig Sequential innate and adaptive immune modulation for cancer treatment

Citations (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4741914A (en) * 1984-11-13 1988-05-03 Ajinomoto Co., Inc. Flavor enhancing seasoning containing deodorized garlic extract and process
US4806376A (en) * 1986-05-22 1989-02-21 Ajinomoto Co., Inc. Process for producing a taste-enriching seasoning from beer yeast
US4994442A (en) * 1987-05-29 1991-02-19 Union Industrial Y Agro-Ganadera, S.A. (Uniasa) Method for stimulation or repair and regeneration of intestinal gut cells in infants and enhancing the immune response of t-cells
US5087617A (en) * 1989-02-15 1992-02-11 Board Of Regents, The University Of Texas System Methods and compositions for treatment of cancer using oligonucleotides
US5288509A (en) * 1988-07-22 1994-02-22 Lever Brothers Company Method for the preparation of a yeast extract, said yeast extract, its use as a food flavour, and a food composiiton comprising the yeast extract
US5488039A (en) * 1994-01-10 1996-01-30 Abbott Laboratories Method for the production of an enteral formula containing ribo-nucleotides
US5492899A (en) * 1994-01-10 1996-02-20 Abbott Laboratories Infant nutritional formula with ribo-nucleotides
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US5591721A (en) * 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5594122A (en) * 1993-06-23 1997-01-14 Genesys Pharma Inc. Antisense oligonucleotides targeted against human immunodeficiency virus
US5602109A (en) * 1994-01-10 1997-02-11 Abbott Laboratories Method to enhance the immune system of a human
US5612060A (en) * 1995-05-25 1997-03-18 Alexander; J. Wesley Enhancement of transplant graft survival through nutritional immunomodulation and immunosuppressive therapy
US5712256A (en) * 1993-06-30 1998-01-27 Board Of Regents, The University Of Texas System Ribonucleotide preparations and uses thereof
US5723335A (en) * 1994-03-25 1998-03-03 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
US5756353A (en) * 1991-12-17 1998-05-26 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol-and liposome-based delivery
US5756097A (en) * 1985-06-28 1998-05-26 Landucci; Gary R. Lymphokine activated effector cells for antibody-dependent cellular cytotoxicity (ADCC) treatment of cancer and other diseases
US5858987A (en) * 1995-05-05 1999-01-12 Mitotix, Inc. E6AP antisense constructs and methods of use
US5877309A (en) * 1997-08-13 1999-03-02 Isis Pharmaceuticals, Inc. Antisense oligonucleotides against JNK
US5895652A (en) * 1996-07-29 1999-04-20 Longevity Institute International Method of metabolic adjuvanation and cellular repair
US6022853A (en) * 1991-08-30 2000-02-08 Creative Biomolecules, Inc. Morphogen-enriched dietary composition
US6031086A (en) * 1994-03-18 2000-02-29 The Regents Of The University Of California Antisense oligonucleitide containing compositions and method of forming duplexes
US6184369B1 (en) * 1993-04-23 2001-02-06 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich oligonucleotides
US6191257B1 (en) * 1993-04-27 2001-02-20 Baylor College Of Medicine Natural or recombinant DNA binding proteins as carriers for gene transfer or gene therapy
US6194388B1 (en) * 1994-07-15 2001-02-27 The University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6214806B1 (en) * 1997-02-28 2001-04-10 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
US6218371B1 (en) * 1998-04-03 2001-04-17 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6221882B1 (en) * 1997-07-03 2001-04-24 University Of Iowa Research Foundation Methods for inhibiting immunostimulatory DNA associated responses
US6225292B1 (en) * 1997-06-06 2001-05-01 The Regents Of The University Of California Inhibitors of DNA immunostimulatory sequence activity
US6239116B1 (en) * 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6339068B1 (en) * 1997-05-20 2002-01-15 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols
US6339630B1 (en) * 2000-05-18 2002-01-15 The United States Of America As Represented By The United States Department Of Energy Sealed drive screw operator
US20020028784A1 (en) * 2000-03-10 2002-03-07 Nest Gary Van Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
US20020055477A1 (en) * 2000-03-10 2002-05-09 Nest Gary Van Immunomodulatory formulations and methods for use thereof
US6503533B1 (en) * 1994-07-28 2003-01-07 Georgetown University Antisense ogligonucleotides against Hepatitis B viral replication
US20030022852A1 (en) * 2000-03-10 2003-01-30 Nest Gary Van Biodegradable immunomodulatory formulations and methods for use thereof
US6514948B1 (en) * 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20030027782A1 (en) * 1993-08-26 2003-02-06 Carson Dennis A. Method for treating allergic lung disease
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US20030049266A1 (en) * 2000-12-27 2003-03-13 Fearon Karen L. Immunomodulatory polynucleotides and methods of using the same
US6534062B2 (en) * 2000-03-28 2003-03-18 The Regents Of The University Of California Methods for increasing a cytotoxic T lymphocyte response in vivo
US6552006B2 (en) * 2000-01-31 2003-04-22 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US20030092663A1 (en) * 1997-09-05 2003-05-15 Eyal Raz Immunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype
US20030091599A1 (en) * 1997-03-10 2003-05-15 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030100527A1 (en) * 1994-07-15 2003-05-29 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20040006010A1 (en) * 1996-10-11 2004-01-08 Carson Dennis A. Immunostimulatory polynucleotide/immunomodulatory molecule conjugates
US20040006034A1 (en) * 1998-06-05 2004-01-08 Eyal Raz Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040009942A1 (en) * 2000-03-10 2004-01-15 Gary Van Nest Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences
US20040030118A1 (en) * 1998-05-14 2004-02-12 Hermann Wagner Methods for regulating hematopoiesis using CpG-oligonucleotides
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040067902A9 (en) * 2000-02-03 2004-04-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20040087534A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050013812A1 (en) * 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050031638A1 (en) * 1997-12-24 2005-02-10 Smithkline Beecham Biologicals S.A. Vaccine
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20050064401A1 (en) * 2000-09-01 2005-03-24 Alexander Olek Diagnosis of illnesses or predisposition to certain illnesses
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060019916A1 (en) * 2004-04-02 2006-01-26 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing IL-10 responses
US20060019923A1 (en) * 2004-07-18 2006-01-26 Coley Pharmaceutical Group, Ltd. Methods and compositions for inducing innate immune responses
US7157437B2 (en) * 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US20070066554A1 (en) * 1999-09-25 2007-03-22 Coley Pharmaceutical Gmbh Immunostimulatory nucleic acids

Family Cites Families (257)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2006A (en) * 1841-03-16 Clamp for crimping leather
US2204A (en) * 1841-07-30 Improvement in the mode of propelling ships, boats, and other vessels
US2004A (en) * 1841-03-12 Improvement in the manner of constructing and propelling steam-vessels
US2007A (en) * 1841-03-16 Improvement in the mode of harvesting grain
US2002A (en) * 1841-03-12 Tor and planter for plowing
US2003A (en) * 1841-03-12 Improvement in horizontal windivhlls
US2005A (en) * 1841-03-16 Improvement in the manner of constructing molds for casting butt-hinges
US2215233A (en) 1937-11-13 1940-09-17 Simon L Ruskin Iron compound of nucleotides and their organic hydrolytic decomposition products and method of making same
US3627874A (en) 1969-07-16 1971-12-14 Merck & Co Inc Vaccine preparation
US3906092A (en) 1971-11-26 1975-09-16 Merck & Co Inc Stimulation of antibody response
US3911117A (en) 1971-12-20 1975-10-07 Fredrik Ender Raw fish and iron chelated with glutamic or ribonucleic acid in a mink diet
US3914450A (en) 1973-04-09 1975-10-21 Anheuser Busch Concentrated extract of yeast and processes of making same
DE2643213C2 (en) 1976-09-25 1985-02-21 Bayer Ag, 5090 Leverkusen Process for attenuating or inactivating microorganisms
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
ES8301593A1 (en) 1981-11-16 1983-01-01 Union Ind Y Agro Ganader S A U Nucleotide enriched humanized milk and process for its preparation
US5766920A (en) * 1982-08-11 1998-06-16 Cellcor, Inc. Ex vivo activation of immune cells
US4452775A (en) * 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
JPS60126220A (en) * 1983-12-09 1985-07-05 Otsuka Pharmaceut Factory Inc Nucleic acid component composition
IT1178044B (en) 1984-10-09 1987-09-03 Polifarma Spa PHARMACEUTICAL ACTIVE AGENT FOR THE TREATMENT OF CEREBRAL DISEASES BASED ON URIDINE
JPH0669953B2 (en) 1985-08-16 1994-09-07 日産化学工業株式会社 Cerebrospinal system neurotrophic agent
US4956296A (en) 1987-06-19 1990-09-11 Genex Corporation Cloned streptococcal genes encoding protein G and their use to construct recombinant microorganisms to produce protein G
US5194428A (en) * 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5075109A (en) * 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
US5276019A (en) * 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US6338853B1 (en) * 1987-04-23 2002-01-15 Jean-Claude Bystryn Anti-cancer vaccine
DE3867308D1 (en) 1987-05-20 1992-02-13 Chugai Pharmaceutical Co Ltd SALT REPLACEMENT AND FOOD CONTAINING THIS.
CA1339596C (en) 1987-08-07 1997-12-23 New England Medical Center Hospitals, Inc. Viral expression inhibitors
GB2216416B (en) 1988-03-11 1992-06-24 Sandoz Ltd Nucleobase source for the stimulation of the immune system
US5268365A (en) 1988-03-11 1993-12-07 Rudolph Frederick B Nucleotides, nucleosides, and nucleobases in immune function restoration enhancement or maintenance
US5004810A (en) * 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers
NZ230747A (en) 1988-09-30 1992-05-26 Bror Morein Immunomodulating matrix comprising a complex of at least one lipid and at least one saponin; certain glycosylated triterpenoid saponins derived from quillaja saponaria molina
US5231085A (en) * 1988-10-31 1993-07-27 Sandoz Ltd. Compositions and methods for the enhancement of host defense mechanisms
US6214804B1 (en) * 1989-03-21 2001-04-10 Vical Incorporated Induction of a protective immune response in a mammal by injecting a DNA sequence
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5399346A (en) * 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US5178860A (en) * 1989-09-01 1993-01-12 Coopers Animal Health Limited Adjuvant complexes and vaccine made therefrom
US4981684A (en) * 1989-10-24 1991-01-01 Coopers Animal Health Limited Formation of adjuvant complexes
US5232829A (en) * 1989-09-29 1993-08-03 Hoffmann-La Roche Inc. Detection of chlamydia trachomatis by polymerase chain reaction using biotin labelled lina primers and capture probes
US5786189A (en) * 1989-11-29 1998-07-28 Smithkline Beecham Biologicals (S.A.) Vaccine
US5457189A (en) * 1989-12-04 1995-10-10 Isis Pharmaceuticals Antisense oligonucleotide inhibition of papillomavirus
US5506212A (en) * 1990-01-11 1996-04-09 Isis Pharmaceuticals, Inc. Oligonucleotides with substantially chirally pure phosphorothioate linkages
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5248670A (en) * 1990-02-26 1993-09-28 Isis Pharmaceuticals, Inc. Antisense oligonucleotides for inhibiting herpesviruses
EP0468520A3 (en) 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
US5234811A (en) 1991-09-27 1993-08-10 The Scripps Research Institute Assay for a new gaucher disease mutation
US6042838A (en) * 1991-02-15 2000-03-28 Uab Research Foundation immunogenic compositions for mucosal administration of pneumococcal surface protein A (PspA)
US6030954A (en) * 1991-09-05 2000-02-29 University Of Connecticut Targeted delivery of poly- or oligonucleotides to cells
US5858784A (en) * 1991-12-17 1999-01-12 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol- and liposome-based delivery
DE69332045T2 (en) 1992-02-04 2002-10-17 Chiron Corp HEPATISTHERAPEUTIKUM
US5643578A (en) * 1992-03-23 1997-07-01 University Of Massachusetts Medical Center Immunization by inoculation of DNA transcription unit
US6498147B2 (en) 1992-05-22 2002-12-24 The Scripps Research Institute Suppression of nuclear factor-κb dependent processes using oligonucleotides
JPH067114A (en) 1992-06-24 1994-01-18 Kuroda Munetada Production of aqueous of nucleic acid
EP1251170A3 (en) * 1992-07-17 2002-10-30 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of NF-kappaB dependent animal diseases
US5585479A (en) 1992-07-24 1996-12-17 The United States Of America As Represented By The Secretary Of The Navy Antisense oligonucleotides directed against human ELAM-I RNA
JPH08502723A (en) * 1992-07-27 1996-03-26 ハイブライドン インコーポレイテッド Oligonucleotide alkylphosphonothioate
US6107062A (en) * 1992-07-30 2000-08-22 Inpax, Inc. Antisense viruses and antisense-ribozyme viruses
DK0664833T3 (en) 1992-10-05 1997-04-14 Hybridon Inc Therapeutic anti-HIV oligonucleotide and drug
US5575613A (en) * 1992-11-16 1996-11-19 Mcneall Engineering Pty. Ltd. Pallet dispenser
US5593972A (en) * 1993-01-26 1997-01-14 The Wistar Institute Genetic immunization
US5650156A (en) * 1993-02-22 1997-07-22 Vivorx Pharmaceuticals, Inc. Methods for in vivo delivery of nutriceuticals and compositions useful therefor
ATE209887T1 (en) * 1993-04-02 2001-12-15 Anticancer Inc METHOD FOR ADMINISTRATION OF BENEFICIAL COMPOSITIONS TO HAIR FOLLICLES
JPH09501562A (en) * 1993-07-19 1997-02-18 ジェン−プローブ・インコーポレイテッド Oligonucleotide having activity against human immunodeficiency virus
US6004534A (en) 1993-07-23 1999-12-21 Massachusetts Institute Of Technology Targeted polymerized liposomes for improved drug delivery
US6605708B1 (en) 1993-07-28 2003-08-12 Hybridon, Inc. Building blocks with carbamate internucleoside linkages and oligonucleotides derived therefrom
US5679647A (en) * 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
US5830877A (en) 1993-08-26 1998-11-03 The Regents Of The University Of California Method, compositions and devices for administration of naked polynucleotides which encode antigens and immunostimulatory
US5985847A (en) 1993-08-26 1999-11-16 The Regents Of The University Of California Devices for administration of naked polynucleotides which encode biologically active peptides
US20030109469A1 (en) * 1993-08-26 2003-06-12 Carson Dennis A. Recombinant gene expression vectors and methods for use of same to enhance the immune response of a host to an antigen
US5804566A (en) 1993-08-26 1998-09-08 The Regents Of The University Of California Methods and devices for immunizing a host through administration of naked polynucleotides with encode allergenic peptides
FR2711670B1 (en) * 1993-10-22 1996-01-12 Pasteur Institut Nucleotide vector, composition containing it and vaccine for immunization against hepatitis.
JP2906949B2 (en) * 1993-10-27 1999-06-21 富士ゼロックス株式会社 Hypertext device
DE4338704A1 (en) * 1993-11-12 1995-05-18 Hoechst Ag Stabilized oligonucleotides and their use
US5595756A (en) * 1993-12-22 1997-01-21 Inex Pharmaceuticals Corporation Liposomal compositions for enhanced retention of bioactive agents
US5712384A (en) * 1994-01-05 1998-01-27 Gene Shears Pty Ltd. Ribozymes targeting retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs
US5700590A (en) 1994-01-10 1997-12-23 Abbott Laboratories Nutritional formula with ribo-nucleotides
US5646126A (en) * 1994-02-28 1997-07-08 Epoch Pharmaceuticals Sterol modified oligonucleotide duplexes having anticancer activity
WO1995024929A2 (en) 1994-03-15 1995-09-21 Brown University Research Foundation Polymeric gene delivery system
US5543152A (en) 1994-06-20 1996-08-06 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5741516A (en) 1994-06-20 1998-04-21 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US7935675B1 (en) * 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
DE69527206T2 (en) * 1994-09-30 2003-02-27 Inex Pharmaceuticals Corp AGENT FOR INSERTING POLYANIONIC MATERIALS IN CELLS
US6027726A (en) * 1994-09-30 2000-02-22 Inex Phamaceuticals Corp. Glycosylated protein-liposome conjugates and methods for their preparation
US5753613A (en) * 1994-09-30 1998-05-19 Inex Pharmaceuticals Corporation Compositions for the introduction of polyanionic materials into cells
US6630455B1 (en) 1995-01-13 2003-10-07 Vanderbilt University Methods for inducing mucosal immune responses
DE19502912A1 (en) 1995-01-31 1996-08-01 Hoechst Ag G-Cap Stabilized Oligonucleotides
JP3580900B2 (en) 1995-04-20 2004-10-27 ホクレン農業協同組合連合会 Food and feed containing, as an active ingredient, a composition mainly comprising a sugar containing an α-glucosidase inhibitor
US5955059A (en) * 1995-06-06 1999-09-21 Trustees Of Boston University Use of locally applied DNA fragments
JP4335310B2 (en) 1995-06-07 2009-09-30 ザ ユニバーシティ オブ ブリティッシュ コロンビア Lipid-nucleic acid particles prepared through hydrophobic lipid-nucleic acid complex intermediates and use for gene transfer
US5976580A (en) 1995-06-07 1999-11-02 Novus International, Inc. Nutrient formulation and process for enhancing the health, livability, cumulative weight gain or feed efficiency in poultry and other animals
US5994315A (en) 1995-06-07 1999-11-30 East Carolina University Low adenosine agent, composition, kit and method for treatment of airway disease
US5705385A (en) * 1995-06-07 1998-01-06 Inex Pharmaceuticals Corporation Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5981501A (en) 1995-06-07 1999-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
WO1997003702A1 (en) 1995-07-21 1997-02-06 Brown University Research Foundation A method for gene therapy using nucleic acid loaded polymeric microparticles
US6248720B1 (en) * 1996-07-03 2001-06-19 Brown University Research Foundation Method for gene therapy using nucleic acid loaded polymeric microparticles
CN1141740A (en) 1995-07-28 1997-02-05 伍梅四 Roe powder serial health-care food
US5968909A (en) 1995-08-04 1999-10-19 Hybridon, Inc. Method of modulating gene expression with reduced immunostimulatory response
EE9800105A (en) 1995-10-04 1998-10-15 Immunex Corporation Dendritic cell stimulating factor
US5736152A (en) * 1995-10-27 1998-04-07 Atrix Laboratories, Inc. Non-polymeric sustained release delivery system
US5780448A (en) * 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
GB9525902D0 (en) 1995-12-16 1996-02-21 Zeneca Ltd Fungus
WO1997028259A1 (en) 1996-01-30 1997-08-07 The Regents Of The University Of California Gene expression vectors which generate an antigen specific immune response and methods of using the same
US5994316A (en) 1996-02-21 1999-11-30 The Immune Response Corporation Method of preparing polynucleotide-carrier complexes for delivery to cells
SE9600648D0 (en) * 1996-02-21 1996-02-21 Bror Morein Receptor binding unit
US6620805B1 (en) * 1996-03-14 2003-09-16 Yale University Delivery of nucleic acids by porphyrins
US6030955A (en) * 1996-03-21 2000-02-29 The Trustees Of Columbia University In The City Of New York And Imclone Systems, Inc. Methods of affecting intracellular phosphorylation of tyrosine using phosphorothioate oligonucleotides, and antiangiogenic and antiproliferative uses thereof
CN1151840C (en) * 1996-05-09 2004-06-02 太平洋制药控股公司 Stimulation of host defence mechanisms against tumors
US6184037B1 (en) 1996-05-17 2001-02-06 Genemedicine, Inc. Chitosan related compositions and methods for delivery of nucleic acids and oligonucleotides into a cell
US5705109A (en) * 1996-06-20 1998-01-06 Westvaco Corporation Ozone treatment for composite paperboard/polymer package
US5965542A (en) 1997-03-18 1999-10-12 Inex Pharmaceuticals Corp. Use of temperature to control the size of cationic liposome/plasmid DNA complexes
US6426334B1 (en) * 1997-04-30 2002-07-30 Hybridon, Inc. Oligonucleotide mediated specific cytokine induction and reduction of tumor growth in a mammal
US6835395B1 (en) 1997-05-14 2004-12-28 The University Of British Columbia Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles
US20030104044A1 (en) * 1997-05-14 2003-06-05 Semple Sean C. Compositions for stimulating cytokine secretion and inducing an immune response
US6589940B1 (en) * 1997-06-06 2003-07-08 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US5922766A (en) * 1997-07-02 1999-07-13 Acosta; Phyllis J. B. Palatable elemental medical food
AU8428998A (en) 1997-07-24 1999-02-16 Inex Pharmaceuticals Corporation Preparation of lipid-nucleic acid particles using a solvent extraction and direct hydration method
US7393630B2 (en) * 1997-12-16 2008-07-01 Novartis Vaccines And Diagnostics, Inc. Use of microparticles combined with submicron oil-in-water emulsions
JPH11209289A (en) * 1998-01-22 1999-08-03 Taisho Pharmaceut Co Ltd Mucosal immunity inducer
EP0933368A1 (en) * 1998-02-02 1999-08-04 SSP Co., Ltd. Triazole derivative or salt thereof, preparation process thereof and pharmaceutical containing said compound as an effective ingredient (antimycotic)
JP2002513763A (en) 1998-05-06 2002-05-14 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Methods for preventing and treating parasitic infections and related diseases using CPG oligonucleotides
IL139813A0 (en) 1998-05-22 2002-02-10 Loeb Health Res Inst At The Ot Methods and products for inducing mucosal immunity
US6248329B1 (en) 1998-06-01 2001-06-19 Ramaswamy Chandrashekar Parasitic helminth cuticlin nucleic acid molecules and uses thereof
US6086898A (en) 1998-06-23 2000-07-11 The Board Of Trustees Of The Leland Stanford Junior University Method of converting a Th2-type allergic immune response into a Th1-type immune response
US20040247662A1 (en) 1998-06-25 2004-12-09 Dow Steven W. Systemic immune activation method using nucleic acid-lipid complexes
US6693086B1 (en) 1998-06-25 2004-02-17 National Jewish Medical And Research Center Systemic immune activation method using nucleic acid-lipid complexes
US20030022854A1 (en) * 1998-06-25 2003-01-30 Dow Steven W. Vaccines using nucleic acid-lipid complexes
US6241086B1 (en) * 1998-07-07 2001-06-05 Case Logic, Inc. Sleeve for holding digital video discs and graphics
JP2002521489A (en) 1998-07-27 2002-07-16 ユニバーシティ オブ アイオワ リサーチ ファウンデーション Stereoisomers of CpG oligonucleotides and related methods
PT1104306E (en) 1998-08-10 2006-05-31 Antigenics Inc CPG COMPOSITIONS AND SAPONIN ADJUVANTS AND THEIR METHODS
WO2000014217A2 (en) 1998-09-03 2000-03-16 Coley Pharmaceutical Gmbh G-motif oligonucleotides and uses thereof
US20020065236A1 (en) * 1998-09-09 2002-05-30 Yew Nelson S. CpG reduced plasmids and viral vectors
FR2783170B1 (en) * 1998-09-11 2004-07-16 Pasteur Merieux Serums Vacc IMMUNOSTIMULATING EMULSION
AU766492B2 (en) * 1998-09-18 2003-10-16 Dynavax Technologies Corporation Methods of treating IgE-associated disorders and compositions for use therein
AU776288B2 (en) 1998-10-05 2004-09-02 Regents Of The University Of California, The Methods and adjuvants for stimulating mucosal immunity
EP1117433A1 (en) 1998-10-09 2001-07-25 Dynavax Technologies Corporation Anti hiv compositions comprising immunostimulatory polynucleotides and hiv antigens
JP2002536344A (en) 1999-02-05 2002-10-29 ジエンザイム コーポレイション Use of cationic lipids to generate anti-tumor immunity
US6207819B1 (en) * 1999-02-12 2001-03-27 Isis Pharmaceuticals, Inc. Compounds, processes and intermediates for synthesis of mixed backbone oligomeric compounds
AU4343700A (en) * 1999-04-12 2000-11-14 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Oligodeoxynucleotide and its use to induce an immune response
US6977245B2 (en) * 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
WO2000062787A1 (en) 1999-04-15 2000-10-26 The Regents Of The University Of California Methods and compositions for use in potentiating antigen presentation by antigen presenting cells
WO2000062800A2 (en) * 1999-04-19 2000-10-26 Smithkline Beecham Biologicals Sa Adjuvant composition comprising saponin and an immunostimulatory oligonucleotide
US6558670B1 (en) * 1999-04-19 2003-05-06 Smithkline Beechman Biologicals S.A. Vaccine adjuvants
WO2000067023A1 (en) 1999-04-29 2000-11-09 Coley Pharmaceutical Gmbh Screening for immunostimulatory dna functional modifyers
US6737066B1 (en) * 1999-05-06 2004-05-18 The Immune Response Corporation HIV immunogenic compositions and methods
AU6051800A (en) * 1999-06-16 2001-01-02 University Of Iowa Research Foundation, The Antagonism of immunostimulatory cpg-oligonucleotides by 4-aminoquinolines and other weak bases
DE19935756A1 (en) * 1999-07-27 2001-02-08 Mologen Forschungs Entwicklung Covalently closed nucleic acid molecule for immune stimulation
ES2233426T3 (en) 1999-08-13 2005-06-16 Hybridon, Inc. MODULATION OF IMMUNE STIMULATION MEASURED BY CPG OF OLIGONUCLEOTIDE BY MODIFICATION OF THE POSITION OF NUCLEOSIDS.
WO2001012223A2 (en) 1999-08-19 2001-02-22 Dynavax Technologies Corporation Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
US20050249794A1 (en) 1999-08-27 2005-11-10 Semple Sean C Compositions for stimulating cytokine secretion and inducing an immune response
US6949520B1 (en) * 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US20010031262A1 (en) * 1999-12-06 2001-10-18 Michael Caplan Controlled delivery of antigens
WO2001051500A1 (en) * 2000-01-14 2001-07-19 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US20010044416A1 (en) 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
AU4175101A (en) * 2000-02-23 2001-09-03 Univ California Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
US20030130217A1 (en) * 2000-02-23 2003-07-10 Eyal Raz Method for treating inflammatory bowel disease and other forms of gastrointestinal inflammation
US20020156033A1 (en) * 2000-03-03 2002-10-24 Bratzler Robert L. Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer
US20040131628A1 (en) * 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20020098199A1 (en) 2000-03-10 2002-07-25 Gary Van Nest Methods of suppressing hepatitis virus infection using immunomodulatory polynucleotide sequences
US20020107212A1 (en) 2000-03-10 2002-08-08 Nest Gary Van Methods of reducing papillomavirus infection using immunomodulatory polynucleotide sequences
WO2001071885A1 (en) * 2000-03-20 2001-09-27 Alpha Technologies, Inc. Uninterruptible power supplies employing fuel cells
WO2001076642A1 (en) 2000-04-07 2001-10-18 The Regents Of The University Of California Synergistic improvements to polynucleotide vaccines
DK1280521T3 (en) * 2000-05-12 2005-08-08 Pharmacia & Upjohn Co Llc Vaccine composition, method of preparation thereof and method of vaccination of vertebrates
US20020165178A1 (en) 2000-06-28 2002-11-07 Christian Schetter Immunostimulatory nucleic acids for the treatment of anemia, thrombocytopenia, and neutropenia
US20020198165A1 (en) 2000-08-01 2002-12-26 Bratzler Robert L. Nucleic acids for the prevention and treatment of gastric ulcers
US20020091097A1 (en) * 2000-09-07 2002-07-11 Bratzler Robert L. Nucleic acids for the prevention and treatment of sexually transmitted diseases
CA2419894A1 (en) * 2000-09-15 2002-03-21 Coley Pharmaceutical Gmbh Process for high throughput screening of cpg-based immuno-agonist/antagonist
FR2814958B1 (en) * 2000-10-06 2003-03-07 Aventis Pasteur VACCINE COMPOSITION
GB0025577D0 (en) * 2000-10-18 2000-12-06 Smithkline Beecham Biolog Vaccine
ES2307568T3 (en) 2000-12-08 2008-12-01 Coley Pharmaceutical Gmbh CPG TYPE NUCLEIC ACIDS AND SAME USE METHODS.
US20030055014A1 (en) 2000-12-14 2003-03-20 Bratzler Robert L. Inhibition of angiogenesis by nucleic acids
US20020193332A1 (en) * 2001-02-12 2002-12-19 Hedley Mary Lynne Methods of treating bladder disorders
US6969484B2 (en) * 2001-06-18 2005-11-29 Toray Industries, Inc. Manufacturing method and device for electret processed product
US7785610B2 (en) * 2001-06-21 2010-08-31 Dynavax Technologies Corporation Chimeric immunomodulatory compounds and methods of using the same—III
PT1404873E (en) * 2001-06-21 2013-07-30 Dynavax Tech Corp Chimeric immunomodulatory compounds and methods of using the same
WO2003000232A2 (en) 2001-06-25 2003-01-03 Yissum Research Development Company Of The Hebrew University Of Jerusalem Method for preparation of vesicles loaded with immunostimulator y oligodeoxynucleotides
US7666674B2 (en) * 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
AU2002318944A1 (en) 2001-08-01 2003-02-17 Coley Pharmaceutical Gmbh Methods and compositions relating to plasmacytoid dendritic cells
JP4607452B2 (en) * 2001-08-07 2011-01-05 ダイナバックス テクノロジーズ コーポレイション Immunomodulating composition, formulation and method of use thereof
DE10138833A1 (en) * 2001-08-14 2003-02-27 Daimler Chrysler Ag Device and method for remote diagnostics of vehicles
US7354909B2 (en) * 2001-08-14 2008-04-08 The United States Of America As Represented By Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
WO2003015711A2 (en) 2001-08-17 2003-02-27 Coley Pharmaceutical Group, Inc. Combination motif immune stimulatory oligonucleotides with improved activity
WO2003027313A2 (en) * 2001-09-24 2003-04-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services SUPPRESSORS OF CpG OLIGONUCLEOTIDES AND METHODS OF USE
US7514415B2 (en) * 2002-08-01 2009-04-07 The United States Of America As Represented By The Department Of Health And Human Services Method of treating inflammatory arthropathies with suppressors of CpG oligonucleotides
US20030119774A1 (en) * 2001-09-25 2003-06-26 Marianna Foldvari Compositions and methods for stimulating an immune response
DK1434603T3 (en) * 2001-09-28 2010-04-26 Purdue Research Foundation Method of treatment using ligand-immunogen conjugates
CN1633598A (en) 2001-10-05 2005-06-29 科勒制药股份公司 Toll-like receptor 3 signaling agonists and antagonists
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US7276489B2 (en) * 2002-10-24 2007-10-02 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
AU2002340662B2 (en) 2001-11-07 2008-07-03 Tekmira Pharmaceuticals Corporation Mucosal adjuvants comprising an oligonucleotide and a cationic lipid
CN1169434C (en) 2001-11-20 2004-10-06 成都天友生物科技股份有限公司 Temp-sensitive lethality male silkworm breeding method
WO2003054161A2 (en) * 2001-12-20 2003-07-03 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services USE OF CpG OLIGODEOXYNUCLEOTIDES TO INDUCE ANGIOGENESIS
JP2005526497A (en) * 2002-02-04 2005-09-08 ビオミラ,インコーポレーテッド Immunostimulatory, covalently lipidated oligonucleotide
US8088388B2 (en) * 2002-02-14 2012-01-03 United Biomedical, Inc. Stabilized synthetic immunogen delivery system
CA2480775C (en) * 2002-04-04 2016-05-31 Coley Pharmaceutical Gmbh Immunostimulatory g,u-containing oligoribonucleotides
KR101092043B1 (en) * 2002-04-22 2011-12-12 바이오니취 라이프 사이언시즈 인코포레이티드 Oligonucleotide compositions and their use for the modulation of immune responses
CA2531280A1 (en) * 2002-07-03 2004-01-15 Cambridge Scientific, Inc. Vaccines to induce mucosal immunity
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) * 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
AU2003255969A1 (en) 2002-07-17 2004-02-02 Coley Pharmaceutical Gmbh Use of cpg nucleic acids in prion-disease
WO2004014322A2 (en) * 2002-08-12 2004-02-19 Dynavax Technologies Corporation Immunomodulatory compositions, methods of making, and methods of use thereof
DE10239495A1 (en) * 2002-08-28 2004-03-11 BSH Bosch und Siemens Hausgeräte GmbH Sieve for dishwashing machine may be cleared by periodic reversals of current and side of sieve facing material to be filtered is faced with non-stick material
US8263091B2 (en) * 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
WO2004026888A2 (en) 2002-09-19 2004-04-01 Coley Pharmaceutical Gmbh Toll-like receptor 9 (tlr9) from various mammalian species
US8043622B2 (en) * 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
CA2504493C (en) * 2002-11-01 2015-12-29 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of preventing infections from bioterrorism agents with immunostimulatory cpg oligonucleotides
WO2004053104A2 (en) 2002-12-11 2004-06-24 Coley Pharmaceutical Group, Inc. 5’ cpg nucleic acids and methods of use
KR100525321B1 (en) * 2002-12-13 2005-11-02 안웅식 Pharmaceutical composition for prophylaxis and treatment of papillomavirus-derived diseases comprising papillomavirus antigen protein and CpG-oligodeoxynucleotide
BRPI0408623A (en) * 2003-03-26 2006-03-07 Cytos Biotechnology Ag particle conjugates similar to the melan-a peptide analog virus
WO2004087203A2 (en) 2003-04-02 2004-10-14 Coley Pharmaceutical Group, Ltd. Immunostimulatory nucleic acid oil-in-water formulations for topical application
WO2005016235A2 (en) * 2003-04-14 2005-02-24 The Regents Of The University Of California Combined use of impdh inhibitors with toll-like receptor agonists
WO2004094671A2 (en) 2003-04-22 2004-11-04 Coley Pharmaceutical Gmbh Methods and products for identification and assessment of tlr ligands
ATE476196T1 (en) * 2003-06-17 2010-08-15 Mannkind Corp COMPOSITION FOR INITIATING, IMPROVEMENT AND MAINTAINING IMMUNE RESPONSES AGAINST MHC CLASS I RESTRICTED EPITOPES, FOR PROPHYLACTIC OR THERAPEUTIC PURPOSES
EP1635846A4 (en) * 2003-06-20 2009-01-28 Coley Pharm Gmbh Small molecule toll-like receptor (tlr) antagonists
US20060251623A1 (en) * 2003-07-10 2006-11-09 Caytos Biotechnology Ag Packaged virus-like particles
MXPA06000619A (en) * 2003-07-15 2006-04-11 Hybridon Inc Synergistic stimulation of the immune system using immunostimulatory oligonucleotides and/or immunomer compounds in conjunction with cytokines and/or chemotherapeutic agents or radiation therapy.
CA2535527A1 (en) 2003-08-28 2005-03-10 The Immune Response Corporation Immunogenic hiv compositions and related methods
EA200600540A1 (en) * 2003-09-05 2006-08-25 Анадис Фармасьютикалз, Инк. INTRODUCTION OF TLR7 LIGANDS AND THEIR TREATMENTS FOR THE TREATMENT OF HEPATITIS C VIRUS INFECTION
CN1211443C (en) 2003-09-10 2005-07-20 江苏鸿业涂料科技产业有限公司 Resin emulsion for high penetrating powder cathod electrophoresis paint
US7615539B2 (en) * 2003-09-25 2009-11-10 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US20050215501A1 (en) * 2003-10-24 2005-09-29 Coley Pharmaceutical Group, Inc. Methods and products for enhancing epitope spreading
SG122973A1 (en) * 2003-10-30 2006-06-29 Coley Pharm Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
AU2004304770B2 (en) * 2003-12-08 2010-05-06 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties by small oligonucleotide-based compounds
US9090673B2 (en) 2003-12-12 2015-07-28 City Of Hope Synthetic conjugate of CpG DNA and T-help/CTL peptide
US20050181035A1 (en) 2004-02-17 2005-08-18 Dow Steven W. Systemic immune activation method using non CpG nucleic acids
EP1720568A2 (en) * 2004-02-19 2006-11-15 Coley Pharmaceutical Group, Inc. Immunostimulatory viral rna oligonucleotides
DE602005012376D1 (en) * 2004-05-03 2009-03-05 Eiichi Nakamura NEW 15O-MARKED MONOSACCHARIDE AND METHOD FOR THE PRODUCTION THEREOF
EP1753453A2 (en) 2004-06-08 2007-02-21 Coley Pharmaceutical GmbH Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
WO2006002038A2 (en) * 2004-06-15 2006-01-05 Hybridon, Inc. Immunostimulatory oligonucleotide multimers
KR100958505B1 (en) * 2004-07-18 2010-05-17 씨에스엘 리미티드 Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses
US7897810B2 (en) * 2004-09-02 2011-03-01 Eastman Chemical Company Optimized production of aromatic dicarboxylic acids
MY159370A (en) * 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
AU2006216493A1 (en) * 2005-02-24 2006-08-31 Coley Pharmaceutical Gmbh Immunostimulatory oligonucleotides
SG161260A1 (en) * 2005-04-08 2010-05-27 Coley Pharm Group Inc Methods for treating infectious disease exacerbated asthma
AU2006241149A1 (en) * 2005-04-26 2006-11-02 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
SG163583A1 (en) 2005-07-07 2010-08-30 Coley Pharm Group Inc Anti-ctla-4 antibody and cpg-motif-containing synthetic oligodeoxynucleotide combination therapy for cancer treatment
AU2006284889B2 (en) * 2005-08-31 2011-08-18 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods of altering an immune response induced by CpG oligodeoxynucleotides
EA013468B1 (en) 2005-09-16 2010-04-30 Коли Фармасьютикал Гмбх Immunostimulatory single-stranded ribonucleic acid with phosphodiester backbone
EP1924692A2 (en) 2005-09-16 2008-05-28 Coley Pharmaceutical GmbH Modulation of immunostimulatory properties of short interfering ribonucleic acid (sirna) by nucleotide modification
EP1957647B1 (en) * 2005-11-25 2015-03-04 Zoetis Belgium S.A. Immunostimulatory oligoribonucleotides
ES2553284T5 (en) 2006-02-15 2021-08-31 Rechtsanwalt Thomas Beck Compositions and Procedures for Oligonucleotide Formulations
BRPI0709972A2 (en) * 2006-04-14 2011-08-02 Merck & Co Inc compound, pharmaceutical composition, and use of a compound
US8027888B2 (en) 2006-08-31 2011-09-27 Experian Interactive Innovation Center, Llc Online credit card prescreen systems and methods
WO2008033432A2 (en) 2006-09-12 2008-03-20 Coley Pharmaceutical Group, Inc. Immune modulation by chemically modified ribonucleosides and oligoribonucleotides
PT2078080E (en) 2006-09-27 2015-09-18 Coley Pharm Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
EP2068912A2 (en) 2006-09-27 2009-06-17 Coley Pharmaceutical Group, Inc. Compositions of tlr ligands and antivirals
US20100144846A1 (en) 2006-10-26 2010-06-10 Coley Pharmaceutical Gmbh Oligoribonucleotides and uses thereof
US20090142362A1 (en) 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
JP2010511408A (en) * 2006-12-04 2010-04-15 ザ・ボード・オブ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・イリノイ Compositions and methods for treating cancer with CpG rich DNA and cupredoxins
EP2160199A2 (en) 2007-05-17 2010-03-10 Coley Pharmaceutical Group, Inc. Class a oligonucleotides with immunostimulatory potency
KR20100068422A (en) * 2007-10-09 2010-06-23 콜리 파마슈티칼 게엠베하 Immune stimulatory oligonucleotide analogs containing modified sugar moieties
US8268492B2 (en) * 2007-11-30 2012-09-18 GM Global Technology Operations LLC Fuel cell stack features for improved water management
WO2009143292A2 (en) * 2008-05-21 2009-11-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating pneumoconiosis with oligodeoxynucleotides
TWI351288B (en) * 2008-07-04 2011-11-01 Univ Nat Pingtung Sci & Tech Cpg dna adjuvant in avian vaccines
US8053422B2 (en) * 2008-12-04 2011-11-08 The United States Of America As Represented By The Department Of Health And Human Services Anti-cancer oligodeoxynucleotides

Patent Citations (99)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4741914A (en) * 1984-11-13 1988-05-03 Ajinomoto Co., Inc. Flavor enhancing seasoning containing deodorized garlic extract and process
US5756097A (en) * 1985-06-28 1998-05-26 Landucci; Gary R. Lymphokine activated effector cells for antibody-dependent cellular cytotoxicity (ADCC) treatment of cancer and other diseases
US4806376A (en) * 1986-05-22 1989-02-21 Ajinomoto Co., Inc. Process for producing a taste-enriching seasoning from beer yeast
US4994442A (en) * 1987-05-29 1991-02-19 Union Industrial Y Agro-Ganadera, S.A. (Uniasa) Method for stimulation or repair and regeneration of intestinal gut cells in infants and enhancing the immune response of t-cells
US5288509A (en) * 1988-07-22 1994-02-22 Lever Brothers Company Method for the preparation of a yeast extract, said yeast extract, its use as a food flavour, and a food composiiton comprising the yeast extract
US5087617A (en) * 1989-02-15 1992-02-11 Board Of Regents, The University Of Texas System Methods and compositions for treatment of cancer using oligonucleotides
US5514577A (en) * 1990-02-26 1996-05-07 Isis Pharmaceuticals, Inc. Oligonucleotide therapies for modulating the effects of herpes viruses
US6022853A (en) * 1991-08-30 2000-02-08 Creative Biomolecules, Inc. Morphogen-enriched dietary composition
US5756353A (en) * 1991-12-17 1998-05-26 The Regents Of The University Of California Expression of cloned genes in the lung by aerosol-and liposome-based delivery
US6184369B1 (en) * 1993-04-23 2001-02-06 Aronex Pharmaceuticals, Inc. Anti-viral guanosine-rich oligonucleotides
US6191257B1 (en) * 1993-04-27 2001-02-20 Baylor College Of Medicine Natural or recombinant DNA binding proteins as carriers for gene transfer or gene therapy
US5594122A (en) * 1993-06-23 1997-01-14 Genesys Pharma Inc. Antisense oligonucleotides targeted against human immunodeficiency virus
US5712256A (en) * 1993-06-30 1998-01-27 Board Of Regents, The University Of Texas System Ribonucleotide preparations and uses thereof
US20030027782A1 (en) * 1993-08-26 2003-02-06 Carson Dennis A. Method for treating allergic lung disease
US5488039A (en) * 1994-01-10 1996-01-30 Abbott Laboratories Method for the production of an enteral formula containing ribo-nucleotides
US5602109A (en) * 1994-01-10 1997-02-11 Abbott Laboratories Method to enhance the immune system of a human
US5492899A (en) * 1994-01-10 1996-02-20 Abbott Laboratories Infant nutritional formula with ribo-nucleotides
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
US6031086A (en) * 1994-03-18 2000-02-29 The Regents Of The University Of California Antisense oligonucleitide containing compositions and method of forming duplexes
US5723335A (en) * 1994-03-25 1998-03-03 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6727230B1 (en) * 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20050075302A1 (en) * 1994-03-25 2005-04-07 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US20050037403A1 (en) * 1994-07-15 2005-02-17 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050070491A1 (en) * 1994-07-15 2005-03-31 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6194388B1 (en) * 1994-07-15 2001-02-27 The University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20070078104A1 (en) * 1994-07-15 2007-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20070066553A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20070065467A1 (en) * 1994-07-15 2007-03-22 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20070010470A9 (en) * 1994-07-15 2007-01-11 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6239116B1 (en) * 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20070009482A9 (en) * 1994-07-15 2007-01-11 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20060089326A1 (en) * 1994-07-15 2006-04-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060058251A1 (en) * 1994-07-15 2006-03-16 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20060003955A1 (en) * 1994-07-15 2006-01-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040087534A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040087538A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US20030100527A1 (en) * 1994-07-15 2003-05-29 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US20050059625A1 (en) * 1994-07-15 2005-03-17 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050054602A1 (en) * 1994-07-15 2005-03-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050049216A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030050263A1 (en) * 1994-07-15 2003-03-13 The University Of Iowa Research Foundation Methods and products for treating HIV infection
US20030050261A1 (en) * 1994-07-15 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid molecules
US20050049215A1 (en) * 1994-07-15 2005-03-03 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050037985A1 (en) * 1994-07-15 2005-02-17 Krieg Arthur M. Methods and products for treating HIV infection
US20050032736A1 (en) * 1994-07-15 2005-02-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050009774A1 (en) * 1994-07-15 2005-01-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20050004061A1 (en) * 1994-07-15 2005-01-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050004062A1 (en) * 1994-07-15 2005-01-06 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US6503533B1 (en) * 1994-07-28 2003-01-07 Georgetown University Antisense ogligonucleotides against Hepatitis B viral replication
US5591721A (en) * 1994-10-25 1997-01-07 Hybridon, Inc. Method of down-regulating gene expression
US5858987A (en) * 1995-05-05 1999-01-12 Mitotix, Inc. E6AP antisense constructs and methods of use
US5612060A (en) * 1995-05-25 1997-03-18 Alexander; J. Wesley Enhancement of transplant graft survival through nutritional immunomodulation and immunosuppressive therapy
US20030078223A1 (en) * 1996-01-30 2003-04-24 Eyal Raz Compositions and methods for modulating an immune response
US5895652A (en) * 1996-07-29 1999-04-20 Longevity Institute International Method of metabolic adjuvanation and cellular repair
US20040006010A1 (en) * 1996-10-11 2004-01-08 Carson Dennis A. Immunostimulatory polynucleotide/immunomodulatory molecule conjugates
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US7001890B1 (en) * 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US6214806B1 (en) * 1997-02-28 2001-04-10 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
US20030091599A1 (en) * 1997-03-10 2003-05-15 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050043529A1 (en) * 1997-03-10 2005-02-24 Coley Pharmaceutical Gmbh Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050032734A1 (en) * 1997-05-20 2005-02-10 Krieg Arthur M. Vectors and methods for immunization or therapeutic protocols
US6339068B1 (en) * 1997-05-20 2002-01-15 University Of Iowa Research Foundation Vectors and methods for immunization or therapeutic protocols
US6225292B1 (en) * 1997-06-06 2001-05-01 The Regents Of The University Of California Inhibitors of DNA immunostimulatory sequence activity
US6521637B2 (en) * 1997-07-03 2003-02-18 University Of Iowa Research Foundation Methods for inhibiting immunostimulatory DNA associated responses
US6221882B1 (en) * 1997-07-03 2001-04-24 University Of Iowa Research Foundation Methods for inhibiting immunostimulatory DNA associated responses
US5877309A (en) * 1997-08-13 1999-03-02 Isis Pharmaceuticals, Inc. Antisense oligonucleotides against JNK
US20030092663A1 (en) * 1997-09-05 2003-05-15 Eyal Raz Immunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype
US20050031638A1 (en) * 1997-12-24 2005-02-10 Smithkline Beecham Biologicals S.A. Vaccine
US6218371B1 (en) * 1998-04-03 2001-04-17 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20040030118A1 (en) * 1998-05-14 2004-02-12 Hermann Wagner Methods for regulating hematopoiesis using CpG-oligonucleotides
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US20040006034A1 (en) * 1998-06-05 2004-01-08 Eyal Raz Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US6514948B1 (en) * 1999-07-02 2003-02-04 The Regents Of The University Of California Method for enhancing an immune response
US20070066554A1 (en) * 1999-09-25 2007-03-22 Coley Pharmaceutical Gmbh Immunostimulatory nucleic acids
US6552006B2 (en) * 2000-01-31 2003-04-22 The Regents Of The University Of California Immunomodulatory polynucleotides in treatment of an infection by an intracellular pathogen
US20070037767A1 (en) * 2000-02-03 2007-02-15 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040067902A9 (en) * 2000-02-03 2004-04-08 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20020055477A1 (en) * 2000-03-10 2002-05-09 Nest Gary Van Immunomodulatory formulations and methods for use thereof
US20030059773A1 (en) * 2000-03-10 2003-03-27 Gary Van Nest Immunomodulatory formulations and methods for use thereof
US20040009942A1 (en) * 2000-03-10 2004-01-15 Gary Van Nest Methods of preventing and treating respiratory viral infection using immunomodulatory polynucleotide sequences
US20050059626A1 (en) * 2000-03-10 2005-03-17 Gary Van Nest Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
US7157437B2 (en) * 2000-03-10 2007-01-02 Dynavax Technologies Corporation Methods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US20030022852A1 (en) * 2000-03-10 2003-01-30 Nest Gary Van Biodegradable immunomodulatory formulations and methods for use thereof
US20020028784A1 (en) * 2000-03-10 2002-03-07 Nest Gary Van Methods of preventing and treating viral infections using immunomodulatory polynucleotide sequences
US6534062B2 (en) * 2000-03-28 2003-03-18 The Regents Of The University Of California Methods for increasing a cytotoxic T lymphocyte response in vivo
US6339630B1 (en) * 2000-05-18 2002-01-15 The United States Of America As Represented By The United States Department Of Energy Sealed drive screw operator
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US20050064401A1 (en) * 2000-09-01 2005-03-24 Alexander Olek Diagnosis of illnesses or predisposition to certain illnesses
US20030049266A1 (en) * 2000-12-27 2003-03-13 Fearon Karen L. Immunomodulatory polynucleotides and methods of using the same
US20030050268A1 (en) * 2001-03-29 2003-03-13 Krieg Arthur M. Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040067905A1 (en) * 2002-07-03 2004-04-08 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20050059619A1 (en) * 2002-08-19 2005-03-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US20050013812A1 (en) * 2003-07-14 2005-01-20 Dow Steven W. Vaccines using pattern recognition receptor-ligand:lipid complexes
US20060019916A1 (en) * 2004-04-02 2006-01-26 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for inducing IL-10 responses
US20060019923A1 (en) * 2004-07-18 2006-01-26 Coley Pharmaceutical Group, Ltd. Methods and compositions for inducing innate immune responses

Cited By (98)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8058249B2 (en) 1994-07-15 2011-11-15 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050054602A1 (en) * 1994-07-15 2005-03-10 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8309527B2 (en) 1994-07-15 2012-11-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20030191079A1 (en) * 1994-07-15 2003-10-09 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US8258106B2 (en) 1994-07-15 2012-09-04 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20080026011A1 (en) * 1994-07-15 2008-01-31 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8158592B2 (en) 1994-07-15 2012-04-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acid molecules
US20040087538A1 (en) * 1994-07-15 2004-05-06 University Of Iowa Research Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US8148340B2 (en) 1994-07-15 2012-04-03 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US20040171150A1 (en) * 1994-07-15 2004-09-02 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040181045A1 (en) * 1994-07-15 2004-09-16 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US8129351B2 (en) 1994-07-15 2012-03-06 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040229835A1 (en) * 1994-07-15 2004-11-18 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US8114848B2 (en) 1994-07-15 2012-02-14 The United States Of America As Represented By The Department Of Health And Human Services Immunomodulatory oligonucleotides
US8008266B2 (en) 1994-07-15 2011-08-30 University Of Iowa Foundation Methods of treating cancer using immunostimulatory oligonucleotides
US20050009774A1 (en) * 1994-07-15 2005-01-13 University Of Iowa Research Foundation Immunomodulatory oligonucleotides
US20040106568A1 (en) * 1994-07-15 2004-06-03 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US20070078104A1 (en) * 1994-07-15 2007-04-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050070491A1 (en) * 1994-07-15 2005-03-31 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050101554A1 (en) * 1994-07-15 2005-05-12 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7888327B2 (en) 1994-07-15 2011-02-15 University Of Iowa Research Foundation Methods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US7879810B2 (en) 1994-07-15 2011-02-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050148537A1 (en) * 1994-07-15 2005-07-07 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050171047A1 (en) * 1994-07-15 2005-08-04 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7723022B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7723500B2 (en) 1994-07-15 2010-05-25 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7713529B2 (en) 1994-07-15 2010-05-11 University Of Iowa Research Foundation Methods for treating and preventing infectious disease
US7674777B2 (en) 1994-07-15 2010-03-09 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20040198688A1 (en) * 1994-07-15 2004-10-07 The University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050267057A1 (en) * 1994-07-15 2005-12-01 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20060003955A1 (en) * 1994-07-15 2006-01-05 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20050054601A1 (en) * 1997-01-23 2005-03-10 Coley Pharmaceutical Gmbh Pharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US8202688B2 (en) 1997-03-10 2012-06-19 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050197314A1 (en) * 1998-04-03 2005-09-08 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US8574599B1 (en) 1998-05-22 2013-11-05 Ottawa Hospital Research Institute Methods and products for inducing mucosal immunity
US20040266719A1 (en) * 1998-05-22 2004-12-30 Mccluskie Michael J. Methods and products for inducing mucosal immunity
US7741300B2 (en) 1998-06-25 2010-06-22 National Jewish Medical And Research Center Methods of using nucleic acid vector-lipid complexes
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US7271156B2 (en) 1999-09-25 2007-09-18 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20030212026A1 (en) * 1999-09-25 2003-11-13 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US20060286070A1 (en) * 1999-09-27 2006-12-21 Coley Pharmaceutical Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US7776344B2 (en) 1999-09-27 2010-08-17 University Of Iowa Research Foundation Methods related to immunostimulatory nucleic acid-induced interferon
US20010044416A1 (en) * 2000-01-20 2001-11-22 Mccluskie Michael J. Immunostimulatory nucleic acids for inducing a Th2 immune response
US20040235774A1 (en) * 2000-02-03 2004-11-25 Bratzler Robert L. Immunostimulatory nucleic acids for the treatment of asthma and allergy
US7534772B2 (en) 2000-06-22 2009-05-19 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US20030026801A1 (en) * 2000-06-22 2003-02-06 George Weiner Methods for enhancing antibody-induced cell lysis and treating cancer
US7820379B2 (en) 2000-09-15 2010-10-26 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US20050181422A1 (en) * 2000-09-15 2005-08-18 Coley Pharmaceutical Gmbh Process for high throughput screening of CpG-based immuno-agonist/antagonist
US8834900B2 (en) 2001-08-17 2014-09-16 University Of Iowa Research Foundation Combination motif immune stimulatory oligonucleotides with improved activity
US20030139364A1 (en) * 2001-10-12 2003-07-24 University Of Iowa Research Foundation Methods and products for enhancing immune responses using imidazoquinoline compounds
US8658607B2 (en) 2002-04-04 2014-02-25 Zoetis Belgium Immunostimulatory G, U-containing oligoribonucleotides
US9428536B2 (en) 2002-04-04 2016-08-30 Zoetis Belgium Sa Immunostimulatory G, U-containing oligoribonucleotides
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US20060166923A1 (en) * 2002-05-22 2006-07-27 Bo Young Ahn Immune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US8883987B2 (en) 2002-05-22 2014-11-11 Eyegene Inc. Immune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US7507802B2 (en) 2002-05-22 2009-03-24 Eyegene, Inc. Immune stimulating and controlling composition comprising bacterial chromosomal DNA fragments and non-toxic lipopolysaccharides
US20040009949A1 (en) * 2002-06-05 2004-01-15 Coley Pharmaceutical Group, Inc. Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US7569553B2 (en) 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8114419B2 (en) 2002-07-03 2012-02-14 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US8304396B2 (en) 2002-08-19 2012-11-06 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US7998492B2 (en) 2002-10-29 2011-08-16 Coley Pharmaceutical Group, Inc. Methods and products related to treatment and prevention of hepatitis C virus infection
US20060003962A1 (en) * 2002-10-29 2006-01-05 Coley Pharmaceutical Group, Ltd. Methods and products related to treatment and prevention of hepatitis C virus infection
US7956043B2 (en) 2002-12-11 2011-06-07 Coley Pharmaceutical Group, Inc. 5′ CpG nucleic acids and methods of use
US9290786B2 (en) 2003-02-26 2016-03-22 Institute For Research In Biomedicine Monoclonal antibody production by EBV transformation of B cells
US20100021470A1 (en) * 2003-02-26 2010-01-28 Institute For Research In Biomedicine Monoclonal antibody production by ebv transformation of b cells
US8071371B2 (en) 2003-02-26 2011-12-06 Humabs Llc Monoclonal antibody production by EBV transformation of B cells
US20050119273A1 (en) * 2003-06-20 2005-06-02 Coley Pharmaceutical Gmbh Small molecule toll-like receptor (TLR) antagonists
US7410975B2 (en) 2003-06-20 2008-08-12 Coley Pharmaceutical Group, Inc. Small molecule toll-like receptor (TLR) antagonists
US20050130911A1 (en) * 2003-09-25 2005-06-16 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US7615539B2 (en) 2003-09-25 2009-11-10 Coley Pharmaceutical Group, Inc. Nucleic acid-lipophilic conjugates
US8188254B2 (en) 2003-10-30 2012-05-29 Coley Pharmaceutical Gmbh C-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050239733A1 (en) * 2003-10-31 2005-10-27 Coley Pharmaceutical Gmbh Sequence requirements for inhibitory oligonucleotides
US20050100983A1 (en) * 2003-11-06 2005-05-12 Coley Pharmaceutical Gmbh Cell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050256073A1 (en) * 2004-02-19 2005-11-17 Coley Pharmaceutical Group, Inc. Immunostimulatory viral RNA oligonucleotides
US20050218499A1 (en) * 2004-03-31 2005-10-06 Advanced Semiconductor Engineering, Inc. Method for manufacturing leadless semiconductor packages
US20060287263A1 (en) * 2004-07-18 2006-12-21 Csl Limited Methods and compositions for inducing antigen-specific immune responses
US7795235B2 (en) 2004-10-20 2010-09-14 Coley Pharmaceutical Gmbh Semi-soft c-class immunostimulatory oligonucleotides
US7566703B2 (en) 2004-10-20 2009-07-28 Coley Pharmaceutical Group, Inc. Semi-soft C-class immunostimulatory oligonucleotides
US20060229271A1 (en) * 2005-04-08 2006-10-12 Coley Pharmaceutical Group, Inc. Methods for treating infectious disease exacerbated asthma
US20060241076A1 (en) * 2005-04-26 2006-10-26 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20090306177A1 (en) * 2005-09-16 2009-12-10 Coley Pharmaceutical Gmbh Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20090214578A1 (en) * 2005-09-16 2009-08-27 Coley Pharmaceutical Gmbh Immunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US20100316659A1 (en) * 2005-11-25 2010-12-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US8354522B2 (en) 2005-11-25 2013-01-15 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US20110206719A1 (en) * 2005-11-25 2011-08-25 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US7662949B2 (en) 2005-11-25 2010-02-16 Coley Pharmaceutical Gmbh Immunostimulatory oligoribonucleotides
US20080026986A1 (en) * 2006-06-05 2008-01-31 Rong-Fu Wang Reversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US8580268B2 (en) 2006-09-27 2013-11-12 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9382545B2 (en) 2006-09-27 2016-07-05 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US10260071B2 (en) 2006-09-27 2019-04-16 Coley Pharmaceutical Gmbh CpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US20090142362A1 (en) * 2006-11-06 2009-06-04 Avant Immunotherapeutics, Inc. Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)

Also Published As

Publication number Publication date
US20040087534A1 (en) 2004-05-06
US8114848B2 (en) 2012-02-14
US20040171150A1 (en) 2004-09-02
US20070202128A1 (en) 2007-08-30
US20040181045A1 (en) 2004-09-16
US20050244379A1 (en) 2005-11-03
US20040152657A1 (en) 2004-08-05
US20040143112A1 (en) 2004-07-22
US8148340B2 (en) 2012-04-03
US20040152656A1 (en) 2004-08-05
US20050037403A1 (en) 2005-02-17
US20050009774A1 (en) 2005-01-13
US20050239736A1 (en) 2005-10-27
US20070010470A9 (en) 2007-01-11
US20060094683A1 (en) 2006-05-04
US20070009482A9 (en) 2007-01-11
US20050244380A1 (en) 2005-11-03
US20050004062A1 (en) 2005-01-06
US20040162258A1 (en) 2004-08-19
US20040162262A1 (en) 2004-08-19
US20050245477A1 (en) 2005-11-03
US20030026782A1 (en) 2003-02-06
US8309527B2 (en) 2012-11-13

Similar Documents

Publication Publication Date Title
US8148340B2 (en) Immunomodulatory oligonucleotides
US6194388B1 (en) Immunomodulatory oligonucleotides
AU754463B2 (en) Immunomodulatory oligonucleotides

Legal Events

Date Code Title Description
AS Assignment

Owner name: THE UNITED STATES OF AMERICA, AS REPRESENTED BY TH

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KLINMAN, DENNIS;REEL/FRAME:015034/0450

Effective date: 20000301

Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION, IOWA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KRIEG, ARTHUR M.;REEL/FRAME:015034/0475

Effective date: 20031212

Owner name: COLEY PHARMACEUTICAL GROUP, INC., MASSACHUSETTS

Free format text: CHANGE OF NAME;ASSIGNOR:CPG IMMUNOPHARMACEUTICALS, INC.;REEL/FRAME:015034/0461

Effective date: 20000113

Owner name: CPG IMMUNOPHARMCALS, INC., MASSACHUSETTS

Free format text: AGREEMENT;ASSIGNOR:STEINBERG, ALFRED D.;REEL/FRAME:015148/0751

Effective date: 19981030

AS Assignment

Owner name: PFIZER INC., NEW YORK

Free format text: CONFIRMATION OF EXCLUSIVE PATENT LICENSE;ASSIGNORS:COLEY PHARMACEUTICAL GROUP, INC.;COLEY PHARMACEUTICAL GROUP, LTD.;COLEY PHARMACEUTICAL, GMBH;REEL/FRAME:017353/0372

Effective date: 20050506

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF IOWA;REEL/FRAME:021670/0047

Effective date: 20040317

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION