Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS20040259247 A1
Publication typeApplication
Application numberUS 10/433,050
PCT numberPCT/EP2001/013968
Publication dateDec 23, 2004
Filing dateNov 29, 2001
Priority dateDec 1, 2000
Also published asCA2429814A1, CA2429814C, CN1568373A, CN100523215C, DE60130583D1, DE60130583T2, EP1407044A2, EP1407044B1, EP1873259A1, EP1873259B1, EP2348133A1, EP2348133B1, US7056704, US7078196, US8329463, US8362231, US8372968, US8445237, US8765930, US8778902, US8796016, US8853384, US8895718, US8895721, US8933044, US8993745, US20040229266, US20040259248, US20050026278, US20050234006, US20050234007, US20070093445, US20080269147, US20090155174, US20100010207, US20100292456, US20100316703, US20110014123, US20110020234, US20110027883, US20110054159, US20110065109, US20110065773, US20110070162, US20110112283, US20110306651, US20130125259, US20150141492, WO2002044321A2, WO2002044321A3
Publication number10433050, 433050, PCT/2001/13968, PCT/EP/1/013968, PCT/EP/1/13968, PCT/EP/2001/013968, PCT/EP/2001/13968, PCT/EP1/013968, PCT/EP1/13968, PCT/EP1013968, PCT/EP113968, PCT/EP2001/013968, PCT/EP2001/13968, PCT/EP2001013968, PCT/EP200113968, US 2004/0259247 A1, US 2004/259247 A1, US 20040259247 A1, US 20040259247A1, US 2004259247 A1, US 2004259247A1, US-A1-20040259247, US-A1-2004259247, US2004/0259247A1, US2004/259247A1, US20040259247 A1, US20040259247A1, US2004259247 A1, US2004259247A1
InventorsThomas Tuschl, Sayda Elbashir, Winfried Lendeckel, Matthias Wilm, Reinhard Luhrmann
Original AssigneeThomas Tuschl, Elbashir Sayda Mahgoub, Winfried Lendeckel, Matthias Wilm, Reinhard Luhrmann
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Rna interference mediating small rna molecules
US 20040259247 A1
Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a Drosophila in vitro system, we demonstrate that 19-23 nt short RNA fragments are the sequence-specific mediators of RNAi. The short interfering RNAs (siRNAs) are generated by an RNase III-like processing reaction from long dsRNA. Chemically synthesized siRNA duplexes with overhanging 3′ ends mediate efficient target RNA cleavage in the lysate, and the cleavage site is located near the center of the region spanned by the guiding siRNA. Furthermore, we provide evidence that the direction of dsRNA processing determines whether sense or antisense target RNA can be cleaved by the produced siRNP complex.
Previous page
Next page
1. Isolated double-stranded RNA molecule, wherein each RNA strand has a length from 19-25 nucleotides, wherein said RNA molecule is capable of target-specific nucleic acid modifications.
2. The RNA molecule of claim 1 wherein at least one strand has a 3′-overhang from 1-5 nucleotides.
3. The RNA molecule of claim 1 or 2 capable of target-specific RNA interference and/or DNA methylation.
4. The RNA molecule of any one of claims 1-3, wherein each strand has a length from 19-23, particularly from 20-22 nucleotides.
5. The RNA molecule of any one of claims 2-4, wherein the 3′-overhang is from 1-3 nucleotides.
6. The RNA molecule of any one of claims 2-5, wherein the 3′-overhang is stabilized against degradation.
7. The RNA molecule of any one of claims 1-6, which contains at least one modified nucleotide analogue.
8. The RNA molecule of claim 7, wherein the modified nucleotide analogue is selected from sugar- or backbone modified ribonucleotides.
9. The RNA molecule according to claim 7 or 8, wherein the nucleotide analogue is a sugar-modified ribonucleotide, wherein the 2′-OH group is replaced by a group selected from H, OR, R, halo, SH, SR1, NH2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
10. The RNA molecule of claim 7 or 8, wherein the nucleotide analogue is a backbone-modified ribonucleotide containing a phosphothioate group.
11. The RNA molecule of any one of claims 1-10, which has a sequence having an identity of at least 50 percent to a predetermined mRNA target molecule.
12. The RNA molecule of claim 1 1, wherein the identity is at least 70 percent.
13. A method of preparing a double-stranded RNA molecule of any one of claims 1-12 comprising the steps:
(a) synthesizing two RNA strands each having a length from 19-25 nucleotides, wherein said RNA strands are capable of forming a double-stranded RNA molecule,
(b) combining the synthesized RNA strands under conditions, wherein a double-stranded RNA molecule is formed, which is capable of target-specific nucleic acid modifications.
14. The method of claim 13, wherein the RNA strands are chemically synthesized.
15. The method of claim 13, wherein the RNA strands are enzymatically synthesized.
16. A method of mediating target-specific nucleic acid modifications in a cell or an organism comprising the steps:
(a) contacting said cell or organism with the double-stranded RNA molecule of any one of claims 1-12 under conditions wherein target-specific nucleic acid modifications can occur, and
(b) mediating a target-specific nucleic acid modification effected by the double-stranded RNA towards a target nucleic acid having a sequence portion substantially corresponding to the double-stranded RNA.
17. The method of claim 16, wherein the nucleic acid modification is RNA interference and/or DNA methylation.
18. The method of claim 16 and 17 wherein said contacting comprises introducing said double-stranded RNA molecule into a target cell in which the target-specific nucleic acid modification can occur.
19. The method of claim 18 wherein the introducing comprises a carrier-mediated delivery or injection.
20. Use of the method of any one of claims 16-19 for determining the function of a gene in a cell or an organism.
21. Use of the method of any one of claims 16-19 for modulating the function of a gene in a cell or an organism.
22. The use of claim 20 or 21, wherein the gene is associated with a pathological condition.
23. The use of claim 22, wherein the gene is a pathogen-associated gene.
24. The use of claim 23, wherein the gene is a viral gene.
25. The use of claim 22, wherein the gene is a tumor-associated gene.
26. The use of claim 22, wherein the gene is an autoimmune disease-associated gene.
27. Pharmaceutical composition containing as an active agent at least one double-stranded RNA molecule of any one of claims 1-12 and a pharmaceutical carrier.
28. The composition of claim 27 for diagnostic applications.
29. The composition of claim 27 for therapeutic applications.
30. A eukaryotic cell or a eukaryotic non-human organism exhibiting a target gene-specific knockout phenotype wherein said cell or organism is transfected with at least one double-stranded RNA molecule capable of inhibiting the expression of an endogeneous target gene or with a DNA encoding at least one double-stranded RNA molecule capable of inhibiting the expression of at least one endogeneous target gene.
31. The cell or organism of claim 30 which is a mammalian cell.
32. The cell or organism of claim 31 which is a human cell.
33. The cell or organism of any one of claims 30-32 which is further transfected with at least one exogeneous target nucleic acid coding for the target protein or a variant or mutated form of the target protein, wherein said exogeneous target nucleic acid differs from the endogeneous target gene on the nucleic acid level such that the expression of the exogeneous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogeneous target gene.
34. The cell or organism of claim 33 wherein the exogeneous target nucleic acid is fused to a further nucleic acid sequence encoding a detectable peptide or polypeptide.
35. Use of the cell or organism of any of claims 30-34 for analytic procedures.
36. The use of claim 35 for the analysis of gene expression profiles.
37. The use of claim 35 for a proteome analysis.
38. The use of any one of claims 35-37 wherein an analysis of a variant or mutant form of the target protein encoded by an exogeneous target nucleic acid is carried out.
39. The use of claim 38 for identifying functional domains of the target protein.
40. The use of any one of claims 35-39 wherein a comparison of at least two cells or organisms is carried out selected from:
(i) a control cell or control organism without target gene inhibition,
(ii) a cell or organism with target gene inhibition and
(iii) a cell or organism with target gene inhibition plus target gene complementation by an exogeneous target nucleic acid.
41. The use of any one of claims 35-40 wherein the analysis comprises a functional and/or phenotypic analysis.
42. Use of a cell of any one of claims 30-34 for preparative procedures.
43. The use of claim 41 for the isolation of proteins or protein complexes from eukaryotic cells.
44. The use of claim 43 for the isolation of high molecular weight protein complexes which may optionally contain nucleic acids.
45. The use of any one of claims 35-44 in a procedure for identifying and/or characterizing pharmacological agents.
46. A system for identifying and/or characterizing a pharmacological agent acting on at least one target protein comprising:
(a) a eukaryotic cell or a eukaryotic non-human organism capable of expressing at least one target gene coding for said at least one target protein,
(b) at least one double-stranded RNA molecule capable of inhibiting the expression of said at least one endogeneous target gene, and
(c) a test substance or a collection of test substances wherein pharmacological properties of said test substance or said collection are to be identified and/or characterized.
47. The system of claim 46 further comprising:
(d) at least one exogeneous target nucleic acid coding for the target protein or a variant or mutated from of the target protein wherein said exogeneous target nucleic acid differs from the endogeneous target gene on the nucleic acid level such that the expression of the exogeneous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogeneous target gene.
  • [0001]
    The present invention relates to sequence and structural features of double-stranded (ds)RNA molecules required to mediate target-specific nucleic acid modifications such as RNA-interference and/or DNA methylation.
  • [0002]
    The term “RNA interference” (RNAi) was coined after the discovery that injection of dsRNA into the nematode C. elegans leads to specific silencing of genes highly homologous in sequence to the delivered dsRNA (Fire et al., 1998). RNAi was subsequently also observed in insects, frogs (Oelgeschlager et al., 2000), and other animals including mice (Svoboda et al., 2000; Wianny and Zernicka-Goetz, 2000) and is likely to also exist in human. RNAi is closely linked to the post-transcriptional gene-silencing (PTGS) mechanism of co-suppression in plants and quelling in fungi (Catalanotto et al., 2000; Cogoni and Macino, 1999; Dalmay et al., 2000; Ketting and Plasterk, 2000; Mourrain et al., 2000; Smardon et al., 2000) and some components of the RNAi machinery are also necessary for post-transcriptional silencing by co-suppression (Catalanotto et al., 2000; Dernburg et al., 2000; Ketting and Plasterk, 2000). The topic has also been reviewed recently (Bass, 2000; Bosher and Labouesse, 2000; Fire, 1999; Plasterk and Ketting, 2000; Sharp, 1999; Sijen and Kooter, 2000), see also the entire issue of Plant Molecular Biology, vol. 43, issue 2/3, (2000).
  • [0003]
    In plants, in addition to PTGS, introduced transgenes can also lead to transcriptional gene silencing via RNA-directed DNA methylation of cytosines (see references in Wassenegger, 2000). Genomic targets as short as 30 bp are methylated in plants in an RNA-directed manner (Pelissier, 2000). DNA methylation is also present in mammals.
  • [0004]
    The natural function of RNAi and co-suppression appears to be protection of the genome against invasion by mobile genetic elements such as retro-transposons and viruses which produce aberrant RNA or dsRNA in the host cell when they become active (Jensen et al, 1999; Ketting et al., 1999; Ratcliff et al., 1999; Tabara et al., 1999). Specific mRNA degradation prevents transposon and virus replication although some viruses are able to overcome or prevent this process by expressing proteins that suppress PTGS (Lucy et al., 2000; Voinnet et al., 2000).
  • [0005]
    DsRNA triggers the specific degradation of homologous RNAs only within the region of identity with the dsRNA (Zamore et al., 2000). The dsRNA is processed to 21-23 nt RNA fragments and the target RNA cleavage sites are regularly spaced 21-23 nt apart. It has therefore been suggested that the 21-23 nt fragments are the guide RNAs for target recognition (Zamore et al., 2000). These short RNAs were also detected in extracts prepared from D. melanogaster Schneider 2 cells which were transfected with dsRNA prior to cell lysis (Hammond et al., 2000), however, the fractions that displayed sequence-specific nuclease activity also contained a large fraction of residual dsRNA. The role of the 21-23 nt fragments in guiding mRNA cleavage is further supported by the observation that 21-23 nt fragments isolated from processed dsRNA are able, to some extent, to mediate specific mRNA degradation (Zamore et al., 2000). RNA molecules of similar size also accumulate in plant tissue that exhibits PTGS (Hamilton and Baulcombe, 1999).
  • [0006]
    Here, we use the established Drosophila in vitro system (Tuschl et al., 1999; Zamore et al., 2000) to further explore the mechanism of RNAi. We demonstrate that short 21 and 22 nt RNAs, when base-paired with 3′ overhanging ends, act as the guide RNAs for sequence-specific mRNA degradation. Short 30 bp dsRNAs are unable to mediate RNAi in this system because they are no longer processed to 21 and 22 nt RNAs. Furthermore, we defined the target RNA cleavage sites relative to the 21 and 22 nt short interfering RNAs (siRNAs) and provide evidence that the direction of dsRNA processing determines whether a sense or an antisense target RNA can be cleaved- by the produced siRNP endonuclease complex. Further, the siRNAs may also be important tools for transcriptional modulating, e.g. silencing of mammalian genes by guiding DNA methylation.
  • [0007]
    Further experiments in human in vivo cell culture systems (HeLa cells) show that double-stranded RNA molecules having a length of preferably from 19-25 nucleotides have RNAi activity. Thus, in contrast to the results from Drosophila also 24 and 25 nt long double-stranded RNA molecules are efficient for RNAi.
  • [0008]
    The object underlying the present invention is to provide novel agents capable of mediating target-specific RNA interference or other target-specific nucleic acid modifications such as DNA methylation, said agents having an improved efficacy and safety compared to prior art agents.
  • [0009]
    The solution of this problem is provided by an isolated double-stranded RNA molecule, wherein each RNA strand has a length from 19-25, particularly from 19-23 nucleotides, wherein said RNA molecule is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation. Preferably at least one strand has a 3′-overhang from 1-5 nucleotides, more preferably from 1-3 nucleotides and most preferably 2 nucleotides. The other strand may be blunt-ended or has up to 6 nucleotides 3′ overhang. Also, if both strands of the dsRNA are exactly 21 or 22 nt, it is possible to observe some RNA interference when both ends are blunt (0 nt overhang). The RNA molecule is preferably a synthetic RNA molecule which is substantially free from contaminants occurring in cell extracts, e.g. from Drosophila embryos. Further, the RNA molecule is preferably substantially free from any non-target-specific contaminants, particularly non-target-specific RNA molecules e.g. from contaminants occuring in cell extracts.
  • [0010]
    Further, the invention relates to the use of isolated double-stranded RNA molecules, wherein each RNA strand has a length from 19-25 nucleotides, for mediating, target-specific nucleic acid modifications, particularly RNAi, in mammalian cells, particularly in human cells.
  • [0011]
    Surprisingly, it was found that synthetic short double-stranded RNA molecules particularly with overhanging 3′-ends are sequence-specific mediators of RNAi and mediate efficient target-RNA cleavage, wherein the cleavage site is located near the center of the region spanned by the guiding short RNA.
  • [0012]
    Preferably, each strand of the RNA molecule has a length from 20-22 nucleotides (or 20-25 nucleotides in mammalian cells), wherein the length of each strand may be the same or different. Preferably, the length of the 3′-overhang reaches from 1-3 nucleotides, wherein the length of the overhang may be the same or different for each strand. The RNA-strands preferably have 3′-hydroxyl groups. The 5′-terminus preferably comprises a phosphate, diphosphate, triphosphate or hydroxyl group. The most effective dsRNAs are composed of two 21 nt strands which are paired such that 1-3, particularly 2 nt 3′ overhangs are present on both ends of the dsRNA.
  • [0013]
    The target RNA cleavage reaction guided by siRNAs is highly sequence-specific. However, not all positions of a siRNA contribute equally to target recognition. Mismatches in the center of the siRNA duplex are most critical and essentially abolish target RNA cleavage. In contrast, the 3′ nucleotide of the siRNA strand (e.g. position 21) that is complementary to the single-stranded target RNA, does not contribute to specificity of the target recognition. Further, the sequence of the unpaired 2-nt 3′ overhang of the siRNA strand with the same polarity as the target RNA is not critical for target RNA cleavage as only the antisense siRNA strand guides target recognition. Thus, from the single-stranded overhanging nucleotides only the penultimate position of the antisense siRNA (e.g. position 20) needs to match the targeted sense mRNA.
  • [0014]
    Surprisingly, the double-stranded RNA molecules of the present invention exhibit a high in vivo stability in serum or in growth medium for cell cultures. In order to further enhance the stability, the 3′-overhangs may be stablized against degradation, e.g. they may be selected such that they consist of purine nucleotides, particularly adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g. substitution of uridine 2 nt 3′ overhangs by 2′-deoxythymidine is tolerated and does not affect the efficiency of RNA interference. The absence of a 2′ hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium.
  • [0015]
    In an especially preferred embodiment of the present invention the RNA molecule may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the target-specific activity, e.g. the RNAi mediating activity is not substantially effected, e.g. in a region at the 5′-end and/or the 3′-end of the double-stranded RNA molecule. Particularly, the overhangs may be stabilized by incorporating modified nucleotide analogues.
  • [0016]
    Preferred nucleotide analogues are selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5-bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g. N6-methyl adenosine are suitable. In preferred sugar-modified ribonucleotides the 2′OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. In preferred backbone-modified ribonucleotides the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g. of phosphothioate group. It should be noted that the above modifications may be combined.
  • [0017]
    The sequence of the double-stranded RNA molecule of the present invention has to have a sufficient identity to a nucleic acid target molecule in order to mediate target-specific RNAi and/or DNA methylation. Preferably, the sequence has an identity of at least 50%, particularly of at least 70% to the desired target molecule in the double-stranded portion of the RNA molecule. More preferably, the identity is at least 85% and most preferably 100% in the double-stranded portion of the RNA molecule. The identity of a double-stranded RNA molecule to a predetermined nucleic acid target molecule, e.g. an mRNA target molecule may be determined as follows: I = n L × 100
  • [0018]
    wherein I is the identity in percent, n is the number of identical nucleotides in the double-stranded portion of the ds RNA and the target and L is the length of the sequence overlap of the double-stranded portion of the dsRNA and the target.
  • [0019]
    Alternatively, the identity of the double-stranded RNA molecule to the target sequence may also be defined including the 3′ overhang, particularly an overhang having a length from 1-3 nucleotides. In this case the sequence identity is preferably at least 50%, more preferably at least 70% and most preferably at least 85% to the target sequence. For example, the nucleotides from the 3′ overhang and up to 2 nucleotides from the 5′ and/or 3′ terminus of the double strand may be modified without significant loss of activity.
  • [0020]
    The double-stranded RNA molecule of the invention may be prepared by a method comprising the steps:
  • [0021]
    (a) synthesizing two RNA strands each having a length from 19-25, e.g. from 19-23 nucleotides, wherein said RNA strands are capable of forming a double-stranded RNA molecule, wherein preferably at least one strand has a 3′-overhang from 1-5 nucleotides,
  • [0022]
    (b) combining the synthesized RNA strands under conditions, wherein a double-stranded RNA molecule is formed, which is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation.
  • [0023]
    Methods of synthesizing RNA molecules are known in the art. In this context, it is particularly referred to chemical synthesis methods as described in Verma and Eckstein (1998).
  • [0024]
    The single-stranded RNAs can also be prepared by enzymatic transcription from synthetic DNA templates or from DNA plasmids isolated from recombinant bacteria. Typically, phage RNA polymerases are used such as T7, T3 or SP6 RNA polymerase (Milligan and Uhlenbeck (1989)).
  • [0025]
    A further aspect of the present invention relates to a method of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation in a cell or an organism comprising the steps:
  • [0026]
    (a) contacting the cell or organism with the double-stranded RNA molecule of the invention under conditions wherein target-specific nucleic acid modifications may occur and
  • [0027]
    (b) mediating a target-specific nucleic acid modificiation effected by the double-stranded RNA towards a target nucleic acid having a sequence portion substantially corresponding to the double-stranded RNA.
  • [0028]
    Preferably the contacting step (a) comprises introducing the double-stranded RNA molecule into a target cell, e.g. an isolated target cell, e.g. in cell culture, a unicellular microorganism or a target cell or a plurality of target cells within a multicellular organism. More preferably, the introducing step comprises a carrier-mediated delivery, e.g. by liposomal carriers or by injection.
  • [0029]
    The method of the invention may be used for determining the function of a gene in a cell or an organism or even for modulating the function of a gene in a cell or an organism, being capable of mediating RNA interference. The cell is preferably a eukaryotic cell or a cell line, e.g. a plant cell or an animal cell, such as a mammalian cell, e.g. an embryonic cell, a pluripotent stem cell, a tumor cell, e.g. a teratocarcinoma cell or a virus-infected cell. The organism is preferably a eukaryotic organism, e.g. a plant or an animal, such as a mammal, particularly a human.
  • [0030]
    The target gene to which the RNA molecule of the invention is directed may be associated with a pathological condition. For example, the gene may be a pathogen-associated gene, e.g. a viral gene, a tumor-associated gene or an autoimmune disease-associated gene. The target gene may also be a heterologous gene expressed in a recombinant cell or a genetically altered organism. By determinating or modulating, particularly, inhibiting the function of such a gene valuable information and therapeutic benefits in the agricultural field or in the medicine or veterinary medicine field may be obtained.
  • [0031]
    The dsRNA is usually administered as a pharmaceutical composition. The administration may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo. Commonly used gene transfer techniques include calcium phosphate, DEAE-dextran, electroporation and microinjection and viral methods (Graham, F. L. and van der Eb, A. J. (1973) Virol. 52, 456; McCutchan, J. H. and Pagano, J. S. (1968), J. Natl. Cancer Inst. 41, 351; Chu, G. et al (1987), Nucl. Acids Res. 15, 1311; Fraley, R. et al. (1980), J. Biol. Chem. 255, 10431; Capecchi, M. R. (1980), Cell 22, 479). A recent addition to this arsenal of techniques for the introduction of DNA into cells is the use of cationic liposomes (Feigner, P. L. et al. (1987), Proc. Natl. Acad. Sci USA 84, 7413). Commercially available cationic lipid formulations are e.g. Tfx 50 (Promega) or Lipofectamin 2000 (Life Technologies).
  • [0032]
    Thus, the invention also relates to a pharmaceutical composition containing as an active agent at least one double-stranded RNA molecule as described above and a pharmaceutical carrier. The composition may be used for diagnostic and for therapeutic applications in human medicine or in veterinary medicine.
  • [0033]
    For diagnostic or therapeutic applications, the composition may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like. The composition may be administered in any suitable way, e.g. by injection, by oral, topical, nasal, rectal application etc. The carrier may be any suitable pharmaceutical carrier. Preferably, a carrier is used, which is capable of increasing the efficacy of the RNA molecules to enter the target-cells. Suitable examples of such carriers are liposomes, particularly cationic liposomes. A further preferred administration method is injection.
  • [0034]
    A further preferred application of the RNAi method is a functional analysis of eukaryotic cells, or eukaryotic non-human organisms, preferably mammalian cells or organisms and most preferably human cells, e.g. cell lines such as HeLa or 293 or rodents, e.g. rats and mice. By transfection with suitable double-stranded RNA molecules which are homologous to a predetermined target gene or DNA molecules encoding a suitable double-stranded RNA molecule a specific knockout phenotype can be obtained in a target cell, e.g. in cell culture or in a target organism. Surprisingly it was found that the presence of short double-stranded RNA molecules does not result in an interferon response from the host cell or host organism.
  • [0035]
    Thus, a further subject matter of the invention is a eukaryotic cell or a eukaryotic non-human organism exhibiting a target gene-specific knockout phenotype comprising an at least partially deficient expression of at least one endogeneous target gene wherein said cell or organism is transfected with at least one double-stranded RNA molecule capable of inhibiting the expression of at least one endogeneous target gene or with a DNA encoding at least one double stranded RNA molecule capable of inhibiting the expression of at least one endogeneous target gene. It should be noted that the present invention allows a target-specific knockout of several different endogeneous genes due to the specificity of RNAi.
  • [0036]
    Gene-specific knockout phenotypes of cells or non-human organisms, particularly of human cells or non-human mammals may be used in analytic procedures, e.g. in the functional and/or phenotypical analysis of complex physiological processes such as analysis of gene expression profiles and/or proteomes. For example, one may prepare the knock-out phenotypes of human genes in cultured cells which are assumed to be regulators of alternative splicing processes. Among these genes are particularly the members of the SR splicing factor family, e.g. ASF/SF2, SC35, SRp20, SRp40 or SRp55. Further, the effect of SR proteins on the mRNA profiles of predetermined alternatively spliced genes such as CD44 may be analysed. Preferably the analysis is carried out by high-throughput methods using oligonucleotide based chips.
  • [0037]
    Using RNAi based knockout technologies, the expression of an endogeneous target gene may be inhibited in a target cell or a target organism.
  • [0038]
    The endogeneous gene may be complemented by an exogeneous target nucleic acid coding for the target protein or a variant or mutated form of the target protein, e.g. a gene or a cDNA, which may optionally be fused to a further nucleic acid sequence encoding a detectable peptide or polypeptide, e.g. an affinity tag, particularly a multiple affinity tag. Variants or mutated forms of the target gene differ from the endogeneous target gene in that they encode a gene product which differs from the endogeneous gene product on the amino acid level by substitutions, insertions and/or deletions of single or multiple amino acids. The variants or mutated forms may have the same biological activity as the endogeneous target gene. On the other hand, the variant or mutated target gene may also have a biological activity, which differs from the biological activity of the endogeneous target gene, e.g. a partially deleted activity, a completely deleted activity, an enhanced activity etc.
  • [0039]
    The complementation may be accomplished by coexpressing the polypeptide encoded by the exogeneous nucleic acid, e.g. a fusion protein comprising the target protein and the affinity tag and the double stranded RNA molecule for knocking out the endogeneous gene in the target cell. This coexpression may be accomplished by using a suitable expression vector expressing both the polypeptide encoded by the exogeneous nucleic acid, e.g. the tag-modified target protein and the double stranded RNA molecule or alternatively by using a combination of expression vectors. Proteins and protein complexes which are synthesized de novo in the target cell will contain the exogeneous gene product, e.g. the modified fusion protein. In order to avoid suppression of the exogeneous gene product expression by the RNAi duplex molecule, the nucleotide sequence encoding the exogeneous nucleic acid may be altered on the DNA level (with or without causing mutations on the amino acid level) in the part of the sequence which is homologous to the double stranded RNA molecule. Alternatively, the endogeneous target gene may be complemented by corresponding nucleotide sequences from other species, e.g. from mouse.
  • [0040]
    Preferred applications for the cell or organism of the invention is the analysis of gene expression profiles and/or proteomes. In an especially preferred embodiment an analysis of a variant or mutant form of one or several target proteins is carried out, wherein said variant or mutant forms are reintroduced into the cell or organism by an exogeneous target nucleic acid as described above. The combination of knockout of an endogeneous gene and rescue by using mutated, e.g. partially deleted exogeneous target has advantages compared to the use of a knockout cell. Further, this method is particularly suitable for identifying functional domains of the target protein. In a further preferred embodiment a comparison, e.g. of gene expression profiles and/or proteomes and/or phenotypic characteristics of at least two cells or organisms is carried out. These organisms are selected from:
  • [0041]
    (i) a control cell or control organism without target gene inhibition,
  • [0042]
    (ii) a cell or organism with target gene inhibition and
  • [0043]
    (iii) a cell or organism with target gene inhibition plus target gene complementation by an exogeneous target nucleic acid.
  • [0044]
    The method and cell of the invention are also suitable in a procedure for identifying and/or characterizing pharmacological agents, e.g. identifying new pharmacological agents from a collection of test substances and/or characterizing mechanisms of action and/or side effects of known pharmacological agents.
  • [0045]
    Thus, the present invention also relates to a system for identifying and/or characterizing pharmacological agents acting on at least one target protein comprising:
  • [0046]
    (a) a eukaryotic cell or a eukaryotic non-human organism capable of expressing at least one endogeneous target gene coding for said target protein,
  • [0047]
    (b) at least one double-stranded RNA molecule capable of inhibiting the expression of said at least one endogeneous target gene, and
  • [0048]
    (c) a test substance or a collection of test substances wherein pharmacological properties of said test substance or said collection are to be identified and/or characterized.
  • [0049]
    Further, the system as described above preferably comprises:
  • [0050]
    (d) at least one exogeneous target nucleic acid coding for the target protein or a variant or mutated form of the target protein wherein said exogeneous target nucleic acid differs from the endogeneous target gene on the nucleic acid level such that the expression of the exogeneous target nucleic acid is substantially less inhibited by the double stranded RNA molecule than the expression of the endogeneous target gene.
  • [0051]
    Furthermore, the RNA knockout complementation method may be used for preparative purposes, e.g. for the affinity purification of proteins or protein complexes from eukaryotic cells, particularly mammalian cells and more particularly human cells. In this embodiment of the invention, the exogeneous target nucleic acid preferably codes for a target protein which is fused to an affinity tag.
  • [0052]
    The preparative method may be employed for the purification of high molecular weight protein complexes which preferably have a mass of ≧150 kD and more preferably of ≧500 kD and which optionally may contain nucleic acids such as RNA. Specific examples are the heterotrimeric protein complex consisting of the 20 kD, 60 kD and 90 kD proteins of the U4/U6 snRNP particle, the splicing factor SF3b from the 17S U2 snRNP consisting of 5 proteins having molecular weights of 14, 49, 1 20, 145 and 155 kD and the 25S U41U6/U5 tri-snRNP particle containing the U4, U5 and U6 snRNA molecules and about 30 proteins, which has a molecular weight of about 1.7 MD.
  • [0053]
    This method is suitable for functional proteome analysis in mammalian cells, particularly human cells.
  • [0054]
    Further, the present invention is explained in more detail in the following figures and examples.
  • [0055]
    [0055]FIG. 1: Double-stranded RNA as short as 38 bp can mediate RNAi.
  • [0056]
    (A) Graphic representation of dsRNAs used for targeting Pp-luc mRNA. Three series of blunt-ended dsRNAs covering a range of 29 to 504 bp were prepared. The position of the first nucleotide of the sense strand of the dsRNA is indicated relative to the start codon of Pp-luc mRNA (p1). (B) RNA interference assay (Tuschl et al., 1999). Ratios of target Pp-luc to control Rr-luc activity were normalized to a buffer control (black bar). DsRNAs (5 nM) were preincubated in Drosophila lysate for 15 min at 25° C. prior to the addition of 7-methyl-guanosine-capped Pp-luc and Rr-luc mRNAs (˜50 pM). The incubation was continued for another hour and then analyzed by the dual luciferase assay (Promega). The data are the average from at least four independent experiments ± standard deviation.
  • [0057]
    [0057]FIG. 2: A 29 bp dsRNA is no longer processed to 21-23 nt fragments.
  • [0058]
    Time course of 21-23 mer formation from processing of internally 32p-labeled dsRNAs (5 nM) in the Drosophila lysate. The length and source of the dsRNA are indicated. An RNA size marker (M) has been loaded in the left lane and the fragment sizes are indicated. Double bands at time zero are due to incompletely denatured dsRNA.
  • [0059]
    [0059]FIG. 3: Short dsRNAs cleave the mRNA target only once.
  • [0060]
    (A) Denaturing gel electrophoreses of the stable 5′ cleavage products produced by 1 h incubation of 10 nM sense or antisense RNA 32P-labeled at the cap with 10 nM dsRNAs of the p133 series in Drosophila lysate. Length markers were generated by partial nuclease T1 digestion and partial alkaline hydrolysis (OH) of the cap-labeled target RNA. The regions targeted by the dsRNAs are indicated as black bars on both sides. The 20-23 nt spacing between the predominant cleavage sites for the 111 bp long dsRNA is shown. The horizontal arrow indicates unspecific cleavage not due to RNAi. (B) Position of the cleavage sites on sense and antisense target RNAs. The sequences of the capped 177 nt sense and 180 nt antisense target RNAs are represented in antiparallel orientation such that complementary sequence are opposing each other. The region targeted by the different dsRNAs are indicated by differently colored bars positioned between sense and antisense target sequences. Cleavage sites are indicated by circles: large circle for strong cleavage, small circle for weak cleavage. The 32P-radiolabeled phosphate group is marked by an asterisk.
  • [0061]
    [0061]FIG. 4: 21 and 22 nt RNA fragments are generated by an RNase III-like mechanism.
  • [0062]
    (A) Sequences of ˜21 nt RNAs after dsRNA processing. The ˜21 nt RNA fragments generated by dsRNA processing were directionally cloned and sequenced. Oligoribonucleotides originating from the sense strand of the dsRNA are indicated as blue lines, those originating from the antisense strand as red lines. Thick bars are used if the same sequence was present in multiple clones, the number at the right indicating the frequency. The target-RNA cleavage sites mediated by the dsRNA are indicated as orange circles, large circle for strong cleavage, small circle for weak cleavage (see FIG. 3B). Circles on top of the sense strand indicated cleavage sites within the sense target and circles at the bottom of the dsRNA indicate cleavage site in the antisense target. Up to five additional nucleotides were identified in ˜21 nt fragments derived from the 3′ ends of the dsRNA. These nucleotides are random combinations of predominantly C, G, or A residues and were most likely added in an untemplated fashion during T7 transcription of the dsRNA-constituting strands. (B) Two-dimensional TLC analysis of the nucleotide composition of ˜21 nt RNAs. The ˜21 nt RNAs were generated by incubation of internally radiolabeled 504 bp Pp-luc dsRNA in Drosophila lysate, gel-purified, and then digested to mononucleotides with nuclease P1 (top row) or ribonuclease T2 (bottom row). The dsRNA was internally radiolabeled by transcription in the presence of one of the indicated α-32P nucleoside triphosphates. Radioactivity was detected by phosphorimaging. Nucleoside 5′-monophosphates, nucleoside 3′-mono-phosphates, nucleoside 5′,3′-diphosphates, and inorganic phosphate are indicated as pN, Np, pNp, and pi, respectively. Black circles indicate UV-absorbing spots from non-radioactive carrier nucleotides. The 3′,5′-bis-phosphates (red circles) were identified by co-migration with radiolabeled standards prepared by 5′-phosphorylation of nucleoside 3′-mono-phosphates with T4 polynucleotide kinase and γ-32P-ATP.
  • [0063]
    [0063]FIG. 5: Synthetic 21 and 22 nt RNAs Mediate Target RNA Cleavage.
  • [0064]
    (A) Graphic representation of control 52 bp dsRNA and synthetic 21 and 22 nt dsRNAs. The sense strand of 21 and 22 nt short interfering RNAs (siRNAs) is shown blue, the antisense strand in red. The sequences of the siRNAs were derived from the cloned fragments of 52 and 111 bp dsRNAs (FIG. 4A), except for the 22 nt antisense strand of duplex 5. The siRNAs in duplex 6 and 7 were unique to the 111 bp dsRNA processing reaction. The two 3′ overhanging nucleotides indicated in green are present in the sequence of the synthetic antisense strand of duplexes 1 and 3. Both strands of the control 52 bp dsRNA were prepared by in vitro transcription and a fraction of transcripts may contain untemplated 3′ nucleotide addition. The target RNA cleavage sites directed by the siRNA duplexes are indicated as orange circles (see legend to FIG. 4A) and were determined as shown in FIG. 5B. (B) Position of the cleavage sites on sense and antisense target RNAs. The target RNA sequences are as described in FIG. 3B. Control 52 bp dsRNA (10 nM) or 21 and 22 nt RNA duplexes 1-7 (100 nM) were incubated with target RNA for 2.5 h at 25° C. in Drosophila lysate. The stable 5′ cleavage products were resolved on the gel. The cleavage sites are indicated in FIG. 5A. The region targeted by the 52 bp dsRNA or the sense (s) or antisense (as) strands are indicated by the black bars to the side of the gel. The cleavage sites are all located within the region of identity of the dsRNAs. For precise determination of the cleavage sites of the antisense strand, a lower percentage gel was used.
  • [0065]
    [0065]FIG. 6: Long 3′ overhangs on short dsRNAs inhibit RNAi.
  • [0066]
    (A) Graphic representation of 52 bp dsRNA constructs. The 3′ extensions of sense and antisense strand are indicated in blue and red, respectively. The observed cleavage sites on the target RNAs are represented as orange circles analogous to FIG. 4A and were determined as shown in FIG. 6B. (B) Position of the cleavage sites on sense and antisense target RNAs. The-target RNA sequences are as described in FIG. 3B. DsRNA (10 nM) was incubated with target RNA for 2.5 h at 25° C. in Drosophila lysate. The stable 5′ cleavage products were resolved on the gel. The major cleavage sites are indicated with a-horizontal arrow and also represented in FIG. 6A. The region targeted by the 52 bp dsRNA is represented as black bar at both sides of the gel.
  • [0067]
    [0067]FIG. 7: Proposed Model for RNAi.
  • [0068]
    RNAi is predicted to begin with processing of dsRNA (sense strand in black, antisense strand in red) to predominantly 21 and 22 nt short interfering RNAs (siRNAs). Short overhanging 3′ nucleotides, if present on the dsRNA, may be beneficial for processing of short dsRNAs. The dsRNA-processing proteins, which remain to be characterized, are represented as green and blue ovals, and assembled on the dsRNA in asymmetric fashion. In our model, this is illustrated by binding of a hypothetical blue protein or protein domain with the siRNA strand in 3′ to 5′ direction while the hypothetical green protein or protein domain is always bound to the opposing siRNA strand. These proteins or a subset remain associated with the siRNA duplex and preserve its orientation as determined by the direction of the dsRNA processing reaction. Only the siRNA sequence associated with the blue protein is able to guide target RNA cleavage. The endonuclease complex is referred to as small interfering ribonucleoprotein complex or siRNP. It is presumed here, that the endonuclease that cleaves the dsRNA may also cleave the target RNA, probably by temporarily displacing the passive siRNA strand not used for target recognition. The target RNA is then cleaved in the center of the region recognized by the sequence-complementary guide siRNA.
  • [0069]
    [0069]FIG. 8: Reporter constructs and siRNA duplexes.
  • [0070]
    (a) The firefly. (Pp-luc) and sea pansy (Rr-luc) luciferase reporter gene regions from plasmids pGL2-Control, pGL-3-Control and pRL-TK (Promega) are illustrated. SV40 regulatory elements, the HSV thymidine kinase promoter and two introns (lines) are indicated. The sequence of GL3 luciferase is 95% identical to GL2, but RL. is completely unrelated to both. Luciferase expression from pGL2 is approx. 10-fold lower than from pGL3 in transfected mammalian cells. The region targeted by the siRNA duplexes is indicated as black bar below the coding region of the luciferase genes. (b) The sense (top) and antisense (bottom) sequences of the siRNA duplexes targeting GL2, GL3 and RL luciferase are shown. The GL2 and GL3 siRNA duplexes differ by only 3 single nucleotide substitutions (boxed in gray). As unspecific control, a duplex with the inverted GL2 sequence, invGL2, was synthesized. The 2 nt 3′ overhang of 2′-deoxythymidine is indicated as TT; uGL2 is similar to GL2 siRNA but contains ribo-uridine 3′ overhangs.
  • [0071]
    [0071]FIG. 9: RNA interference by siRNA duplexes.
  • [0072]
    Ratios of target control luciferase were normalized to a buffer control (bu, black bars); gray bars indicate ratios of Photinus pyralis (Pp-luc) GL2 or GL3 luciferase to Renilla reniformis (Rr-luc) RL luciferase (left axis), white bars indicate RL to GL2 or GL3 ratios (right axis). Panels a, c, e, g and i describe experiments performed with the combination of pGL2-Control and pRL-TK reporter plasmids, panels b, d, f, h and j with pGL3-Control and pRL-TK reporter plasmids. The cell line used for the interference experiment is indicated at the top of each plot. The ratios of Pp-luc/Rr-luc for the buffer control (bu) varied between 0.5 and 10 for pGL2/pRL and between 0.03 and 1 for pGL3/pRL, respectively, before normalization and between the various cell lines tested. The plotted data were averaged from three independent experiments ±S.D.
  • [0073]
    [0073]FIG. 10: Effects of 21 nt siRNA, 50 bp and 500 bp dsRNAs on luciferase expression in HeLa cells.
  • [0074]
    The exact length of the long dsRNAs is indicated below the bars. Panels a, c and e describe experiments performed with pGL2-Control and pRL-TK reporter plasmids, panels b, d and f with pGL3-Control and pRL-TK reporter plasmids. The data were averaged from two independent experiments ±S.D. (a), (b) Absolute Pp-luc expression, plotted in arbitrary luminescence units. (c), (d) Rr-luc expression, plotted in arbitrary luminescence units. (e), (f) Ratios of normalized target to control luciferase. The ratios of luciferase activity for siRNA duplexes were normalized to a buffer control (bu, black bars); the luminescence ratios for 50 or 500 bp dsRNAs were normalized to the respective ratios observed for 50 and 500 bp dsRNA from humanized GFP (hG, black bars). It should be noted that the overall differences in sequences between the 49 and 484 bp dsRNAs targeting GL2 and GL3 are not sufficient to confer specificity between GL2 and GL3 targets (43 nt uninterrupted identity in 49 bp segment, 239 nt longest uninterrupted identity in 484 bp segment).
  • [0075]
    [0075]FIG. 11: Variation of the 3′ overhang of duplexes of 21-nt siRNAs.
  • [0076]
    (A) Outline of the experimental strategy. The capped and polyadenylated sense target mRNA is depicted and the relative positions of sense and antisense siRNAs are shown. Eight series of duplexes, according to the eight different antisense strands were prepared. The siRNA sequences and the number of overhanging nucleotides were changed in 1-nt steps. (B) Normalized relative luminescence of target luciferase (Photinus pyralis, Pp-luc) to control luciferase (Renilla reniformis, Rr-luc) in D. melanogaster embryo lysate in the presence of 5 nM blunt-ended dsRNAs. The luminescence ratios determined in the presence of dsRNA were normalized to the ratio obtained for a buffer control (bu, black bar). Normalized ratios less than 1 indicate specific interference. (C-J) Normalized interference ratios for eight series of 21-nt siRNA duplexes. The sequences of siRNA duplexes are depicted above the bar graphs. Each panel shows the interference ratio for a set of duplexes formed with a given antisense guide siRNA and 5 different sense siRNAs. The number of overhanging nucleotides (3′ overhang, positive numbers; 5′ overhangs, negative numbers) is indicated on the x-axis. Data points were averaged from at least 3 independent experiments, error bars represent standard deviations.
  • [0077]
    [0077]FIG. 12: Variation of the length of the sense strand of siRNA duplexes.
  • [0078]
    (A) Graphic representation of the experiment. Three 21-nt antisense strands were paired with eight sense siRNAs. The siRNAs were changed in length at their 3′ end. The 3′ overhang of the antisense siRNA was 1-nt (B), 2-nt (C), or 3-nt (D) while the sense siRNA overhang was varied for each series. The sequences of the siRNA duplexes and the corresponding interference ratios are indicated.
  • [0079]
    [0079]FIG. 13: Variation of the length of siRNA duplexes with preserved 2-nt 3′ overhangs.
  • [0080]
    (A) Graphic representation of the experiment. The 21-nt siRNA duplex is identical in sequence to the one shown in FIG. 11H or 12C. The siRNA duplexes were extended to the 3′ side of the sense siRNA (B) or the 5′ side of the sense siRNA (C). The siRNA duplex sequences and the respective interference ratios are indicated.
  • [0081]
    [0081]FIG. 14: Substitution of the 2′-hydroxyl groups of the siRNA ribose residues.
  • [0082]
    The 2′-hydroxyl groups (OH) in the strands of siRNA duplexes were replaced by 2′-deoxy (d) or 2′-O-methyl (Me). 2-nt and 4-nt 2′-deoxy substitutions at the 3′-ends are indicated as 2-nt d and 4-nt d, respectively. Uridine residues were replaced by 2′-deoxy thymidine.
  • [0083]
    [0083]FIG. 15: Mapping of sense and antisense target RNA cleavage by 21-nt siRNA duplexes with 2-nt 3′ overhangs.
  • [0084]
    (A) Graphic representation of 32P (asterisk) cap-labelled sense and antisense target RNAs and siRNA duplexes. The position of sense and antisense target RNA cleavage is indicated by triangles on top and below the siRNA duplexes, respectively. (B) Mapping of target RNA cleavage sites. After 2 h incubation of 10 nM target with 100 nM siRNA duplex in D. melanogaster embryo lysate, the 5′ cap-labelled substrate and the 5′ cleavage products were resolved on sequencing gels. Length markers were generated by partial RNase T1 digestion (T1) and partial alkaline hydrolysis (OH—) of the target RNAs. The bold lines to the left of the images indicate the region covered by the siRNA strands 1 and 5 of the same orientation as the target.
  • [0085]
    [0085]FIG. 16: The 5′ end of a guide siRNA defines the position of target RNA cleavage.
  • [0086]
    (A, B) Graphic representation of the experimental strategy. The antisense siRNA was the same in all siRNA duplexes, but the sense strand was varied between 18 to 25 nt by changing the 3′ end (A) or 18 to 23 nt by changing the 5′ end (B). The position of sense and antisense target RNA cleavage is indicated by triangles on top and below the siRNA duplexes, respectively. (C, D) Analysis of target RNA cleavage using cap-labelled sense (top panel) or antisense (bottom panel) target RNAs. Only the cap-labelled 5′ cleavage products are shown. The sequences of the siRNA duplexes are indicated, and the length of the sense siRNA strands is marked on top of the panel. The control lane marked with a dash in panel (C) shows target RNA incubated in absence of siRNAs. Markers were as described in FIG. 15. The arrows in (D), bottom panel, indicate the target RNA cleavage sites that differ by 1 nt.
  • [0087]
    [0087]FIG. 17: Sequence variation of the 3′ overhang of siRNA duplexes. The 2-nt 3′ overhang (NN, in gray) was changed in sequence and composition as indicated (T, 2′-deoxythymidine, dG, 2′-deoxyguanosine; asterisk, wild-type siRNA duplex). Normalized interference ratios were determined as described in FIG. 11. The wild-type sequence is the same as depicted in FIG. 14.
  • [0088]
    [0088]FIG. 18: Sequence specificity of target recognition.
  • [0089]
    The sequences of the mismatched siRNA duplexes are shown, modified sequence segments or single nucleotides are underlayed in gray. The reference duplex (ref) and the siRNA duplexes 1 to 7 contain 2′-deoxythymidine 2-nt overhangs. The silencing efficiency of the thymidine-modified reference duplex was comparable to the wild-type sequence (FIG. 17). Normnalized interference ratios were determined as described in FIG. 11.
  • [0090]
    [0090]FIG. 19: Variation of the length of siRNA duplexes with preserved 2-nt 3′ overhangs.
  • [0091]
    The siRNA duplexes were extended to the 3′ side of the sense siRNA (A) or the 5′ side of the sense siRNA (B). The siRNA duplex sequences and the respective interference ratios are indicated. For HeLa SS6 cells, siRNA duplexes (0.84 μg) targeting GL2 luciferase were transfected together with pGL2-Control and pRL-TK plasmids. For comparison, the in vitro RNAi activities of siRNA duplexes tested in D. melanogaster lysate are indicated.
  • [0092]
    RNA Interference Mediated by Small Synthetic RNAs
  • [0093]
    1.1. Experimental Procedures
  • [0094]
    1.1.1 In Vitro RNAi
  • [0095]
    In vitro RNAi and lysate preparations were performed as described previously (Tuschl et al., 1999; Zamore et al., 2000). It is critical to use freshly dissolved creatine kinase (Roche) for optimal ATP regeneration. The RNAi translation assays (FIG. 1) were performed with dsRNA concentrations of 5 nM and an-extended pre-incubation period of 15 min at 25° C. prior to the addition of in vitro transcribed, capped and polyadenylated Pp-luc and Rr-luc reporter mRNAs. The incubation was continued for 1 h and the relative amount of Pp-luc and Rr-luc protein was analyzed using the dual luciferase assay (Promega) and a Monolight 3010C luminometer (PharMingen).
  • [0096]
    1.1.2 RNA Synthesis
  • [0097]
    Standard procedures were used for in vitro transcription of RNA from PCR templates carrying T7 or SP6 promoter sequences, see for example (Tuschl et al., 1998). Synthetic RNA was prepared using Expedite RNA phosphoramidites (Proligo). The 3′ adapter oligonucleotide was synthesized using dimethoxytrityl-1,4-benzenedimethanol-succinyl-aminopropyl-CPG. The oligoribonucleotides were deprotected in 3 ml of 32% ammonia/ethanol (3/1) for 4 h at 55° C. (Expedite RNA) or 16 h at 55° C. (3′ and 5′ adapter DNA/RNA chimeric oligonucleotides) and then desilylated and gel-purified as described previously (Tuschl et al., 1993). RNA transcripts for dsRNA preparation including long 3′ overhangs were generated from PCR templates that contained a T7 promoter in sense and an SP6 promoter in antisense direction. The transcription template for sense and antisense target RNA was PCR-amplified with GCGTAATACGACTCACTATAGAACAATTGCTTTTACAG (underlined, T7 promoter) as 5′ primer and ATTTAGGTGACACTATAGGCATAAAGAATTGAAGA (underlined, SP6 promoter) as 3′ primer and the linearized Pp-luc plasmid (pGEM-luc sequence) (Tuschl et al., 1999) as template; the T7-transcribed sense RNA was 177 nt long with the Pp-luc sequence between pos. 113-273 relative to the start codon and followed by 17 nt of the complement of the SP6 promoter sequence at the 3′ end. Transcripts for blunt-ended dsRNA formation were prepared by transcription from two different PCR products which only contained a single promoter sequence.
  • [0098]
    DsRNA annealing was carried out using a phenol/chloroform extraction. Equimolar concentration of sense and antisense RNA (50 nM to 10 μM, depending on the length and amount available) in 0.3 M NaOAc (pH 6) were incubated for 30 s at 90° C. and then extracted at room temperature with an equal volume of phenol/chloroform, and followed by a chloroform extraction to remove residual phenol. The resulting dsRNA was precipitated by addition of 2.5-3 volumes of ethanol. The pellet was dissolved in lysis buffer (100 mM KCl, 30 mM HEPES-KOH, pH 7.4, 2 mM Mg(OAc)2) and the quality of the dsRNA was verified by standard agarose gel electrophoreses in 1×TAE-buffer. The 52 bp dsRNAs with the 17 nt and 20 nt 3′ overhangs (FIG. 6) were annealed by incubating for 1 min at 95 ° C., then rapidly cooled to 70° C. and followed by slow cooling to room temperature over a 3 h period (50 μl annealing reaction, 1 μM strand concentration, 300 mM NaCl, 10 mM Tris-HCl, pH 7.5). The dsRNAs were then phenol/chloroform extracted, ethanol-precipitated and dissolved in lysis buffer.
  • [0099]
    Transcription of internally 32P-radiolabeled RNA used for dsRNA preparation (FIGS. 2 and 4) was performed using 1 mM ATP, CTP, GTP, 0.1 or 0.2 mM UTP, and 0.2-0.3 μM-32P-UTP (3000 Ci/mmol), or the respective ratio for radiolabeled nucleoside triphosphates other than UTP. Labeling of the cap of the target RNAs was performed as described previously. The target RNAs were gel-purified after cap-labeling.
  • [0100]
    1.1.3 Cleavage Site Mapping
  • [0101]
    Standard RNAi reactions were performed by pre-incubating 10 nM dsRNA for 15 min followed by addition of 10 nM cap-labeled target RNA. The reaction was stopped after a further 2 h (FIG. 2A) or 2.5 h incubation (FIGS. 5B and 6B) by proteinase K treatment (Tuschl et al., 1999). The samples were then analyzed on 8 or 10% sequencing gels. The 21 and 22 nt synthetic RNA duplexes were used at 100 nM final concentration (FIG. 5B).
  • [0102]
    1.1.4 Cloning of ˜21 nt RNAs
  • [0103]
    The 21 nt RNAs were produced by incubation of radiolabeled dsRNA in Drosophila lysate in absence of target RNA (200 μl reaction, 1 h incubation, 50 nM dsP111, or 100 nM dsP52 or dsP39). The reaction mixture was subsequently treated with proteinase K (Tuschl et al., 1999) and the dsRNA-processing products were separated on a denaturing 15% polyacrylamide gel. A-band, including a size range of at least 18 to 24 nt, was excised, eluted into 0.3 M NaCl overnight at 4° C. and in siliconized tubes. The RNA was recovered by ethanol-precipitation and dephosphorylated (30 μl reaction, 30 min, 50° C., 10 U alkaline phosphatase, Roche). The reaction was stopped by phenol/chloroform extraction and the RNA was ethanol-precipitated. The 3′ adapter oligonucleotide (pUUUaaccgcatccttctcx: uppercase, RNA; lowercase, DNA; p, phosphate; x, 4-hydroxymethylbenzyl) was then ligated to the dephosphorylated ˜21 nt RNA (20 μl reaction, 30 min, 37° C., 5 μM 3′ adapter, 50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 0.2 mM ATP, 0.1 mg/ml acetylated BSA, 15% DMSO, 25 U T4 RNA ligase, Amersham-Pharmacia) (Pan and Uhlenbeck, 1992). The ligation reaction was stopped by the addition of an equal volume of 8 M urea/50 mM EDTA stopmix and directly loaded on a 15% gel. Ligation yields were greater 50%. The ligation product was recovered from the gel and 5′-phosphorylated (20 μl reaction, 30 min, 37° C., 2 mM ATP, 5 U T4 polynucleotide kinase, NEB). The phosphorylation reaction was stopped by phenol/chloroform extraction and RNA was recovered by ethanol-precipitation. Next, the 5′ adapter (tactaatacgactcactAAA: uppercase, RNA; lowercase, DNA) was ligated to the phosphorylated ligation product as described above. The new ligation product was gel-purified and eluted from the gel slice in the presence of reverse transcription primer (GACTAGCTGGAATTCAAGGATGCGGTTAAA: bold, Eco RI site) used as carrier. Reverse transcription (15 μl reaction, 30 min, 42° C., 150 U Superscript 11 reverse transcriptase, Life Technologies) was followed by PCR using as 5′ primer CAGCCAACGGAATTCATACGACTCACTAAA (bold, Eco RI site) and the 3′ RT primer. The PCR product was purified by phenol/chloroform extraction and ethanol-precipitated. The PCR product was then digested with Eco RI (NEB) and concatamerized using T4 DNA ligase (high conc., NEB). Concatamers of a size range of 200 to 800 bp were separated on a low-melt agarose gel, recovered from the gel by a standard melting and phenol extraction procedure, and ethanol-precipitated. The unpaired ends were filled in by incubation with Taq polymerase under standard conditions for 1 5 min at 72° C. and the DNA product was directly ligated into the pCR2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen). Colonies were screened using PCR and M13-20 and M13 Reverse sequencing primers. PCR products were directly submitted for custom sequencing (Sequence Laboratories Göttingen GmbH, Germany). On average, four to five 21 mer sequences were obtained per clone.
  • [0104]
    1.1.5 2D-TLC Analysis
  • [0105]
    Nuclease P1 digestion of radiolabeled, gel-purified siRNAs and 2D-TLC was carried out as described (Zamore et al., 2000). Nuclease T2 digestion was performed in 10 μl reactions for 3 h at 50° C. in 10 mM ammonium acetate (pH 4.5) using 2 μg/μl carrier tRNA and 30 U ribonuclease T2 (Life Technologies). The migration of non-radioactive standards was determined by UV shadowing. The identity of nucleoside-3′,5′-disphosphates was confirmed by co-migration of the T2 digestion products with standards prepared by 5′-32P-phosphorylation of commercial nucleoside 3′-monophosphates using γ-32P-ATP and T4 polynucleotide kinase (data not shown).
  • [0106]
    1.2 Results and Discussion
  • [0107]
    1.2.1 Length Requirements for Processing of dsRNA to 21 and 22 nt RNA Fragments
  • [0108]
    Lysate prepared from D. melanogaster syncytial embryos recapitulates RNAi in vitro providing a novel tool for biochemical analysis of the mechanism of RNAi (Tuschl et al., 1999; Zamore et al., 2000). In vitro and in vivo analysis of the length requirements of dsRNA for RNAi has revealed that short dsRNA (<1 50 bp) are less effective than longer dsRNAs in degrading target mRNA (Caplen et al., 2000; Hammond et al., 2000; Ngo et al., 1998); Tuschl et al., 1999). The reasons for reduction in mRNA degrading efficiency are not understood. We therefore examined the precise length requirement of dsRNA for target RNA degradation under optimized conditions in the Drosophila lysate (Zamore et al., 2000). Several series of dsRNAs were synthesized and directed against firefly luciferase (Pp-luc) reporter RNA. The specific suppression of target RNA expression was monitored by the dual luciferase assay (Tuschl et al., 1 999) (FIGS. 1A and 1B). We detected specific inhibition of target RNA expression for dsRNAs as short as 38 bp, but dsRNAs of 29 to 36 bp were not effective in this process. The effect was independent of the target position and the degree of inhibition of Pp-luc mRNA expression correlated with the length of the dsRNA, i.e. long dsRNAs were more effective than short dsRNAs.
  • [0109]
    It has been suggested that the 21-23 nt RNA fragments generated by processing of dsRNAs are the mediators of RNA interference and co-suppression (Hamilton and Baulcombe, 1999; Hammond et al., 2000; Zamore et al., 2000). We therefore analyzed the rate of 21-23 nt fragment formation for a subset of dsRNAs ranging in size between 501 to 29 bp. Formation of 21-23 nt fragments in Drosophila lysate (FIG. 2) was readily detectable for 39 to 501 bp long dsRNAs but was significantly delayed for the 29 bp dsRNA. This observation is consistent with a role of 21-23 nt fragments in guiding mRNA cleavage and provides an explanation for the lack of RNAi by 30 bp dsRNAs. The length dependence of 21-23 mer formation is likely to reflect a biologically relevant control mechanism to prevent the undesired activation of RNAi by short intramolecular base-paired structures of regular cellular RNAs.
  • [0110]
    1.2.2 39 bp dsRNA Mediates Target RNA Cleavage at a Single Site
  • [0111]
    Addition of dsRNA and 5′-capped target RNA to the Drosophila lysate results in sequence-specific degradation of the target RNA (Tuschl et al., 1999). The target mRNA is only cleaved within the region of identity with the dsRNA and many of the target cleavage sites were separated by 21-23 nt (Zamore et al., 2000). Thus, the number of cleavage sites for a given dsRNA was expected to roughly correspond to the length of the dsRNA divided by 21. We mapped the target cleavage sites on a sense and an antisense target RNA which was 5′ radiolabeled at the cap (Zamore et al., 2000) (FIGS. 3A and 3B). Stable 5′ cleavage products were separated on a sequencing gel and the position of cleavage was determined by comparison with a partial RNase T1 and an alkaline hydrolysis ladder from the target RNA.
  • [0112]
    Consistent with the previous observation (Zamore et al., 2000), all target RNA cleavage sites were located within the region of identity to the dsRNA. The sense or the antisense traget was only cleaved once by 39 bp dsRNA. Each cleavage site was located 10 nt from the 5′ end of the region covered by the dsRNA (FIG. 3B). The 52 bp dsRNA, which shares the same 5′ end with the 39 bp dsRNA, produces the same cleavage site on the sense target, located 10 nt from the 5′ end of the region of identity with the dsRNA, in addition to two weaker cleavage sites 23 and 24 nt downstream of the first site. The antisense target was only cleaved once, again 10 nt from the 5′ end of the region covered by its respective dsRNA. Mapping of the cleavage sites for the 38 to 49 bp dsRNAs shown in FIG. 1 showed that the first and predominant cleavage site was always located 7 to 10 nt downstream of the region covered by the dsRNA (data not shown). This suggests that the point of target RNA cleavage is determined by the end of the dsRNA and could imply that processing to 21-23 mers starts from the ends of the duplex.
  • [0113]
    Cleavage sites on sense and antisense target for the longer 111 bp dsRNA were much more frequent than anticipated and most of them appear in clusters separated by 20 to 23 nt (FIGS. 3A and 3B). As for the shorter dsRNAs, the first cleavage site on the sense target is 10 nt from the 5′ end of the region spanned by the dsRNA, and the first cleavage site on the antisense target is located 9 nt from the 5′ end of region covered by the dsRNA. It is unclear what causes this disordered cleavage, but one possibility could be that longer dsRNAs may not only get processed from the ends but also internally, or there are some specificity determinants for dsRNA processing which we do not yet understand. Some irregularities to the 21-23 nt spacing were also previously noted (Zamore et al., 2000). To better understand the molecular basis of dsRNA processing and target RNA recognition, we decided to analyze the sequences of the 21-23 nt fragments generated by processing of 39, 52, and 111 bp dsRNAs in the Drosophila lysate.
  • [0114]
    1.2.3 dsRNA is Processed to 21 and 22 nt RNAs by an RNase III-Like Mechanism
  • [0115]
    In order to characterize the 21-23 nt RNA fragments we examined the 5′ and 3′ termini of the RNA fragments. Periodate oxidation of gel-purified 21-23 nt RNAs followed by β-elimination indicated the presence of a terminal 2′ and 3′ hydroxyl groups. The 21-23 mers were also responsive to alkaline phosphatase treatment indicating the presence of a 5′ terminal phosphate group. The presence of 5′ phosphate and 3′ hydroxyl termini suggests that the dsRNA could be processed by an enzymatic activity similar to E. coli RNase III (for reviews, see (Dunn, 1982; Nicholson, 1999; Robertson, 1990; Robertson, 1982)).
  • [0116]
    Directional cloning of 21-23 nt RNA fragments was performed by ligation of a 3′ and 5′ adapter oligonucleotide to the purified 21-23 mers using T4 RNA ligase. The ligation products were reverse transcribed, PCR-amplified, concatamerized, cloned, and sequenced. Over 220 short RNAs were sequenced from dsRNA processing reactions of the 39, 52 and 111 bp dsRNAs (FIG. 4A). We found the following length distribution: 1% 18 nt, 5% 19 nt, 12% 20 nt, 45% 21 nt, 28% 22 nt, 6% 23 nt, and 2% 24 nt. Sequence analysis of the 5′ terminal nucleotide of the processed fragments indicated that oligonucleotides with a 5′ guanosine were underrepresented. This bias was most likely introduced by T4 RNA ligase which discriminates against 5′ phosphorylated guanosine as donor oligonucleotide; no significant sequence bias was seen at the 3′ end. Many of the ˜21 nt fragments derived from the 3′ ends of the sense or antisense strand of the duplexes include 3′ nucleotides that are derived from untemplated addition of nucleotides during RNA synthesis using T7 RNA polymerase. Interestingly, a significant number of endogenous Drosophila ˜21 nt RNAs were also cloned, some of them from LTR and non-LTR retrotransposons (data not shown). This is consistent with a possible role for RNAi in transposon silencing.
  • [0117]
    The ˜21 nt RNAs appear in clustered groups (FIG. 4A) which cover the entire dsRNA sequences. Apparently, the processing reaction cuts the dsRNA by leaving staggered 3′ ends, another characteristic of RNase III cleavage. For the 39 bp dsRNA, two clusters of ˜21 nt RNAs were found from each dsRNA-constituting strand including overhanging 3′ ends, yet only one cleavage site was detected on the sense and antisense target (FIGS. 3A and 3B). If the ˜21 nt fragments were present as single-stranded guide RNAs in a complex that mediates mRNA degradation, it could be assumed that at least two target cleavage sites exist, but this was not the case. This suggests that the ˜21 nt RNAs may be present in double-stranded form in the endonuclease complex but that only one of the strands can be used for target RNA recognition and cleavage. The use of only one of the ˜21 nt strands for target cleavage may simply be determined by the orientation in which the ˜21 nt duplex is bound to the nuclease complex. This orientation is defined by the direction in which the original dsRNA was processed.
  • [0118]
    The ˜21 mer clusters for the 52 bp and 111 bp dsRNA are less well defined when compared to the 39 bp dsRNA. The clusters are spread over regions of 25 to 30 nt most likely representing several distinct subpopulations of ˜21 nt duplexes and therefore guiding target cleavage at several nearby sites. These cleavage regions are still predominantly separated by 20 to. 23 nt intervals. The rules determining how regular dsRNA can be processed to ˜21 nt fragments are not yet understood, but it was previously observed that the approx. 21-23 nt spacing of cleavage sites could be altered by a run of uridines (Zamore et al., 2000). The specificity of dsRNA cleavage by E. coli RNase III appears to be mainly controlled by antideterminants, i.e. excluding some specific base-pairs at given positions relative to the cleavage site (Zhang and Nicholson, 1997).
  • [0119]
    To test whether sugar-, base- or cap-modification were present in processed ˜21 nt RNA fragments, we incubated radiolabeled 505 bp Pp-luc dsRNA in lysate for 1 h, isolated the ˜21 nt products, and digested it with P1 or T2 nuclease to mononucleotides. The nucleotide mixture was then analyzed by 2D thin-layer chromatography (FIG. 4B). None of the four natural ribonucleotides were modified as indicated by P1 or T2 digestion. We have previously analyzed adenosine to inosine conversion in the ˜21 nt fragments (after a 2 h incubation) and detected a small extent (<0.7%) deamination (Zamore et al., 2000); shorter incubation in lysate (1 h) reduced this inosine fraction to barely detectable levels. RNase T2, which cleaves 3′ of the phosphodiester linkage, produced nucleoside 3′-phosphate and nucleoside 3′,5′-diphosphate, thereby indicating the presence of a 5′-terminal monophosphate. All four nucleoside 3′,5′-diphosphates were detected and suggest that the internucleotidic linkage was cleaved with little or no sequence-specificity. In summary, the ˜21 nt fragments are unmodified and were generated from dsRNA such that 5′-monophosphates and 3′-hydroxyls were present at the 5′-end.
  • [0120]
    1.2.4 Synthetic 21 and 22 nt RNAs Mediate Target RNA Cleavage
  • [0121]
    Analysis of the products of dsRNA processing indicated that the ˜21 nt fragments are generated by a reaction with all the characteristics of an RNase III cleavage reaction (Dunn, 1982; Nicholson, 1999; Robertson, 1990; Robertson, 1982). RNase III makes two staggered cuts in both strands of the dsRNA, leaving a 3′ overhang of about 2 nt. We chemically synthesized 21 and 22 nt RNAs, identical in sequence to some of the cloned ˜21 nt fragments, and tested them for their ability to mediate target RNA degradation (FIGS. 5A and 5B). The 21 and 22 nt RNA duplexes were incubated at 100 nM concentrations in the lysate, a 10-fold higher concentrations-than the 52 bp control dsRNA. Under these conditions, target RNA cleavage is readily detectable. Reducing the concentration of 21 and 22 nt duplexes from 100 to 10 nM does still cause target RNA cleavage. Increasing the duplex concentration from 100 nM to 1000 nM however does not further increase target cleavage, probably due to a limiting protein factor within the lysate.
  • [0122]
    In contrast to 29 or 30 bp dsRNAs that did not mediate RNAi, the 21 and 22 nt dsRNAs with overhanging 3′ ends of 2 to 4 nt mediated efficient degradation of target RNA (duplexes 1, 3, 4, 6, FIGS. 5A and 5B). Blunt-ended 21 or 22 nt dsRNAs (duplexes 2, 5, and 7, FIGS. 5A and 5B) were reduced in their ability to degrade the target and indicate that overhanging 3′ ends are critical for reconstitution of the RNA-protein nuclease complex. The single-stranded overhangs may be required for high affinity binding of the ˜21 nt duplex to the protein components. A 5′ terminal phosphate, although present after dsRNA processing, was not required to mediate target RNA cleavage and was absent from the short synthetic RNAs.
  • [0123]
    The synthetic 21 and 22 nt duplexes guided cleavage of sense as well as antisense targets within the region covered by the short duplex. This is an important result considering that a 39 bp dsRNA, which forms two pairs of clusters of ˜21 nt fragments (FIG. 2), cleaved sense or antisense target only once and not twice. We interpret this result by suggesting that only one of two strands present in the ˜21 nt duplex is able to guide target RNA cleavage and that the orientation of the ˜21 nt duplex in the nuclease complex is determined by the initial direction of dsRNA processing. The presentation of an already perfectly processed ˜21 nt duplex to the in vitro system however does allow formation of the active sequence-specific nuclease complex with two possible orientations of the symmetric RNA duplex. This results in cleavage of sense as well as antisense target within the region of identity with the 21 nt RNA duplex.
  • [0124]
    The target cleavage site is located 11 or 1 2 nt downstream of the first nucleotide that is complementary to the 21 or 22 nt guide sequence, i.e. the cleavage site is near center of the region covered by the 21 or 22 nt RNAs (FIGS. 4A and 4B). Displacing the sense strand of a 22 nt duplex by two nucleotides (compare duplexes 1 and 3 in FIG. 5A) displaced the cleavage site of only the antisense target by two nucleotides. Displacing both sense and antisense strand by two nucleotides shifted both cleavage sites by two nucleotides (compare duplexes 1 and 4). We predict that it will be possible to design a pair of 21 or 22 nt RNAs to cleave a target RNA at almost any given position.
  • [0125]
    The specificity of target RNA cleavage guided by 21 and 22 nt RNAs appears exquisite as no aberrant cleavage sites are detected (FIG. 5B). It should however be noted, that the nucleotides present in the 3′ overhang of the 21 and 22 nt RNA duplex may contribute less to substrate recognition than the nucleotides near the cleavage site. This is based on the observation that the 3′ most nucleotide in the 3′ overhang of the active duplexes 1 or 3 (FIG. 5A) is not complementary to the target. A detailed analysis of the specificity of RNAi can now be readily undertaken using synthetic 21 and 22 nt RNAs.
  • [0126]
    Based on the evidence that synthetic 21 and 22 nt RNAs with overhanging 3′ ends mediate RNA interference, we propose to name the ˜21 nt RNAs “short interfering RNAs” or siRNAs and the respective RNA-protein complex a “small interfering ribonucleoprotein particle” or siRNP.
  • [0127]
    1.2.5 3′ Overhangs of 20 nt on Short dsRNAs Inhibit RNAi
  • [0128]
    We have shown that short blunt-ended dsRNAs appear to be processed from the ends of the dsRNA. During our study of the length dependence of dsRNA in RNAi, we have also analyzed dsRNAs with 17 to 20 nt overhanging 3′ ends and found to our surprise that they were less potent than blunt-ended dsRNAs. The inhibitory effect of long 3′ ends was particularly pronounced for dsRNAs up to 100 bp but was less dramatic for longer dsRNAs. The effect was not due to imperfect dsRNA formation based on native gel analysis (data not shown). We tested if the inhibitory effect of long overhanging 3′ ends could be used as a tool to direct dsRNA processing to only one of the two ends of a short RNA duplex.
  • [0129]
    We synthesized four combinations of the 52 bp model dsRNA, blunt-ended, 3′ extension on only the sense strand, 3′-extension on only the antisense strand, and double 3′ extension on both strands, and mapped the target RNA cleavage sites after incubation in lysate (FIGS. 6A and 6B). The first and predominant cleavage site of the sense target was lost when the 3′ end of the antisense strand of the duplex was extended, and vice versa, the strong cleavage site of the antisense target was lost when the 3′ end of sense strand of the duplex was extended. 3′ Extensions on both strands rendered the 52 bp dsRNA virtually inactive. One explanation for the dsRNA inactivation by ˜20 nt 3′ extensions could be the association of single-stranded RNA-binding proteins which could interfere with the association of one of the dsRNA-processing factors at this end. This result is also consistent with our model where only one of the strands of the siRNA duplex in the assembled siRNP is able to guide target RNA cleavage. The orientation of the strand that guides RNA cleavage is defined by the direction of the dsRNA processing reaction. It is likely that the presence of 3′ staggered ends may facilitate the assembly of the processing complex. A block at the 3′ end of the sense strand will only permit dsRNA processing from the opposing 3′ end of the antisense strand. This in turn generates siRNP complexes in which only the antisense strand of the siRNA duplex is able to guide sense target RNA cleavage. The same is true for the reciprocal situation.
  • [0130]
    The less pronounced inhibitory effect of long 3′ extensions in the case of longer dsRNAs (≧2500 bp, data not shown) suggests to us that long dsRNAs may also contain internal dsRNA-processing signals or may get processed cooperatively due to the association of multiple cleavage factors.
  • [0131]
    1.2.6 A Model for dsRNA-Directed mRNA Cleavage
  • [0132]
    The new biochemical data update the model for how dsRNA targets mRNA for destruction (FIG. 7). Double-stranded RNA is first processed to short RNA duplexes of predominantly 21 and 22 nt in length and with staggered 3′ ends similar to an RNase III-like reaction (Dunn, 1982; Nicholson, 1999; Robertson, 1982). Based on the 21-23 nt length of the processed RNA fragments it has already been speculated that an RNase III-like activity may be involved in RNAi (Bass, 2000). This hypothesis is further supported by the presence of 5′ phosphates and 3′ hydroxyls at the termini of the siRNAs as observed in RNase III reaction products (Dunn, 1 982; Nicholson, 1 999). Bacterial RNase III and the eukaryotic homologs Rnt1p in S. cerevisiae and Pac1p in S. pombe have been shown to function in processing of ribosomal RNA as well as snRNA and snoRNAs (see for example Chanfreau et al., 2000).
  • [0133]
    Little is known about the biochemistry of RNase III homologs from plants, animals or human. Two families of RNase III enzymes have been identified predominantly by database-guided sequence analysis or cloning of cDNAs. The first RNase-III family is represented by the 1327 amino acid long D. melanogaster protein drosha (Acc. AF116572). The C-terminus is composed of two RNase III and one dsRNA-binding domain and the N-terminus is of unknown function. Close homologs are also found in C. elegans (Acc. AF160248) and human (Acc. AF18901 1) (Filippov et al., 2000; Wu et al., 2000). The drosha-like human RNase III was recently cloned and characterized (Wu et al., 2000). The gene is ubiquitously expressed in human tissues and cell lines, and the protein is localized in the nucleus and the nucleolus of the cell. Based on results inferred from antisense inhibition studies, a role of this protein for rRNA processing was suggested. The second class is represented by the C. elegans gene K12H4.8 (Acc. S44849) coding for a 1822 amino acid long protein. This protein has an N-terminal RNA helicase motif which is followed by 2 RNase III catalytic domains and a dsRNA-binding motif, similar to the drosha RNase III family. There are close homologs in S. pombe (Acc. Q09884), A. thaliana (Acc. AF187317), D. melanogaster (Acc. AE003740), and human (Acc. AB028449) (Filippov et al., 2000; Jacobsen et al., 1 999; Matsuda et al., 2000). Possibly the K12H4.8 RNase III/helicase is the likely candidate to be involved in RNAi.
  • [0134]
    Genetic screens in C. elegans identified rde-1 and rde-4 as essential for activation of RNAi without an effect on transposon mobilization or co-suppression (Dernburg et al., 2000; Grishok et al., 2000; Ketting and Plasterk, 2000; Tabara et al., 1999). This led to the hypothesis that these genes are important for dsRNA processing but are not involved in mRNA target degradation. The function of both genes is as yet unknown, the rde-1 gene product is a member of a family of proteins similar to the rabbit protein elF2C (Tabara et al., 1999), and the sequence of rde-4 has not yet been described. Future biochemical characterization of these proteins should reveal their molecular function.
  • [0135]
    Processing to the siRNA duplexes appears to start from the ends of both blunt-ended dsRNAs or dsRNAs with short (1-5 nt) 3′ overhangs, and proceeds in approximately 21-23 nt steps. Long (˜20 nt) 3′ staggered ends on short dsRNAs suppress RNAi, possibly through interaction with single-stranded RNA-binding proteins. The suppression of RNAi by single-stranded regions flanking short dsRNA and the lack of siRNA formation from short 30 bp dsRNAs may explain why structured regions frequently encountered in mRNAs do not lead to activation of RNAi.
  • [0136]
    Without wishing to be bound by theory, we presume that the dsRNA-processing proteins or a subset of these remain associated with the siRNA duplex after the processing reaction. The orientation of the siRNA duplex relative to these proteins determines which of the two complementary strands functions in guiding, target RNA degradation. Chemically synthesized siRNA duplexes guide cleavage of sense as well as antisense target RNA as they are able to associate with the protein components in either of the two possible orientation.
  • [0137]
    The remarkable finding that synthetic 21 and 22 nt siRNA duplexes can be used for efficient mRNA degradation provides new tools for sequence-specific regulation of gene expression in functional genomics as well as biomedical studies. The siRNAs may be effective in mammalian systems where long dsRNAs cannot be used due to the activation of the PKR response (Clemens, 1997). As such, the siRNA duplexes represent a new alternative to antisense or ribozyme therapeutics.
  • [0138]
    RNA Interference in Human Tissue Cultures
  • [0139]
    2.1 Methods
  • [0140]
    2.1.1 RNA Preparation
  • [0141]
    21 nt RNAs were chemically synthesized using Expedite RNA phosphoramidites and thymidine phosphoramidite (Proligo, Germany). Synthetic oligonucleotides were deprotected and gel-purified (Example 1), followed by Sep-Pak C18 cartridge (Waters, Milford, Mass., USA) purification (Tuschl, 1993). The siRNA sequences targeting GL2 (Acc. X65324) and GL3 luciferase (Acc. U47296) corresponded to the coding regions 153-173 relative to the first nucleotide of the start codon, siRNAs targeting RL (Acc. AF025846) corresponded to region 119-129 after the start codon. Longer RNAs were transcribed with T7 RNA polymerase from PCR products, followed by gel and Sep-Pak purification. The 49 and 484 bp GL2 or GL3 dsRNAs corresponded to position 113-161 and 113-596, respectively, relative to the start of translation; the 50 and 501 bp RL dsRNAs corresponded to position 118-167 and 118-618, respectively. PCR templates for dsRNA synthesis targeting humanized GFP (hG) were amplified from pAD3 (Kehlenbach, 1998), whereby 50 and 501 bp hG dsRNA corresponded to position 118-167 and 118-618, respectively, to the start codon.
  • [0142]
    For annealing of siRNAs, 20 μM single strands were incubated in annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate) for 1 min at 90° C. followed by 1 h at 37° C. The 37° C. incubation step was extended overnight for the 50 and 500 bp dsRNAs and these annealing reactions were performed at 8.4 μM and 0.84 μM strand concentrations, respectively.
  • [0143]
    2.1.2 Cell Culture
  • [0144]
    S2 cells were propagated in Schneider's Drosophila medium (Life Technologies) supplemented with 10% FBS, 100 units/ml penicillin and 100 μg/ml streptomycin at 25° C. 293, NIH/3T3, HeLa S3, COS-7 cells were grown at 37° C. in Dulbecco's modified Eagle's medium supplemented with 10% FBS, 100 units/ml penicillin and 100 μg/ml streptomycin. Cells were regularly passaged to maintain exponential growth. 24 h before transfection at approx. 80% confluency, mammalian cells were trypsinized and diluted 1:5 with fresh medium without antibiotics (1-3×105 cells/ml) and transferred to 24-well plates (500 μl/well). S2 cells were not trypsinized before splitting. Transfection was carried out with Lipofectamine 2000 reagent (Life Technologies) as described by the manufacturer for adherent cell lines. Per well, 1.0 μg pGL2-Control (Promega) or pGL3-Control (Promega), 0.1 μg pRL-TK (Promega) and 0.28 μg siRNA duplex or dsRNA, formulated into liposomes, were applied; the final volume was 600 μl per well. Cells were incubated 20 h after transfection and appeared healthy thereafter. Luciferase expression was subsequently monitored with the Dual luciferase assay (Promega). Transfection efficiencies were determined by fluorescence microscopy for mammalian cell lines after co-transfection of 1.1 μg hGFP-encoding pAD3 and 0.28 μg invGL2 inGL2 siRNA and were 70-90%. Reporter plasmids were amplified in XL-1 Blue (Stratagene) and purified using the Qiagen EndoFree Maxi Plasmid Kit.
  • [0145]
    2.2 Results and Discussion
  • [0146]
    To test whether siRNAs are also capable of mediating RNAi in tissue culture, we synthesized 21 nt siRNA duplexes with symmetric 2 nt 3′ overhangs directed against reporter genes coding for sea pansy (Renilla reniformis) and two sequence variants of firefly (Photinus pyralis, GL2 and GL3) luciferases (FIG. 8a, b). The siRNA duplexes were co-transfected with the reporter plasmid combinations pGL2/pRL or pGL3/pRL into D. melanogaster Schneider S2 cells or mammalian cells using cationic liposomes. Luciferase activities were determined 20 h after transfection. In all cell lines tested, we observed specific reduction of the expression of the reporter genes in the presence of cognate siRNA duplexes (FIG. 9a-j). Remarkably, the absolute luciferase expression levels were unaffected by non-cognate siRNAs, indicating the absence of harmful side effects by 21 nt RNA duplexes (e.g. FIG. 10a-d for HeLa cells). In D. melanogaster S2 cells (FIG. 9a, b), the specific inhibition of luciferases was complete. In mammalian cells, where the reporter genes were 50- to 100-fold stronger expressed, the specific suppression was less complete (FIG. 9c-j). GL2 expression was reduced 3- to 12-fold, GL3 expression 9- to 25-fold and RL expression 1- to 3-fold, in response to the cognate siRNAs. For 293 cells, targeting of RL luciferase by RL siRNAs was ineffective, although GL2 and GL3 targets responded specifically (FIG. 9i, j). The lack of reduction of RL expression in 293 cells may be due to its 5- to 20-fold higher expression compared to any other mammalian cell line tested and/or to limited accessibility of the target sequence due to RNA secondary structure or associated proteins. Nevertheless, specific targeting of GL2 and GL3 luciferase by the cognate siRNA duplexes indicated that RNAi is also functioning in 293 cells.
  • [0147]
    The 2 nt 3′ overhang in all siRNA duplexes, except for uGL2, was composed of (2′-deoxy)thymidine. Substituion of uridine by thymidine in the 3′ overhang was well tolerated in the D. melanogaster in vitro sytem and the sequence of the overhang was uncritical for target recognition. The thymidine overhang was chosen, because it is supposed to enhance nuclease resistance of siRNAs in the tissue culture medium and within transfected cells. Indeed, the thymidine-modified GL2 siRNA was slightly more potent than the unmodified uGL2 siRNA in all cell lines tested (FIG. 9a, c, e, g, i). It is conceivable that further modifications of the 3′ overhanging nucleotides may provide additional benefits to the delivery and stability of siRNA duplexes.
  • [0148]
    In co-transfection experiments, 25 nM siRNA duplexes with respect to the final volume of tissue culture medium were used (FIG. 9, 10). Increasing the siRNA concentration to 100 nM did not enhance the specific silencing effects, but started to affect transfection efficiencies due to competition for liposome encapsulation between plasmid DNA and siRNA (data not shown). Decreasing the siRNA concentration to 1.5 nM did not reduce the specific silencing effect (data not shown), even though the siRNAs were now only 2- to 20-fold more concentrated than the DNA plasmids. This indicates that siRNAs are extraordinarily powerful reagents for mediating gene silencing and that siRNAs are effective at concentrations that are several orders of magnitude below the concentrations applied in conventional antisense or ribozyme gene targeting experiments.
  • [0149]
    In order to monitor the effect of longer dsRNAs on mammalian cells, 50 and 500 bp dsRNAs cognate to the reporter genes were prepared. As non-specific control, dsRNAs from humanized GFP (hG) (Kehlenbach, 1998) was used. When dsRNAs were co-transfected, in identical amounts (not concentrations) to the siRNA duplexes, the reporter gene expression was strongly and unspecifically reduced. This effect is illustrated for HeLa cells as a representative example (FIG. 10a-d). The absolute luciferase activities were decreased unspecifically 10- to 20-fold by 50 bp dsRNA and 20- to 200-fold by 500 bp dsRNA co-transfection, respectively. Similar unspecific effects were observed for COS-7 and NIH/3T3 cells. For 293 cells, a 10- to 20-fold unspecific reduction was observed only for 500 bp dsRNAs. Unspecific reduction in reporter gene expression by dsRNA >30 bp was expected as part of the interferon response.
  • [0150]
    Surprisingly, despite the strong unspecific decrease in reporter gene expression, we reproducibly detected additional sequence-specific, dsRNA-mediated silencing. The specific silencing effects, however, were only apparent when the relative reporter gene activities were normalized to the hG dsRNA controls (FIG. 10e, f). A 2- to 10-fold specific reduction in response to cognate dsRNA was observed, also in the other three mammalian cell lines tested (data not shown). Specific silencing effects with dsRNAs (356-1662 bp) were previously reported in CHO-K1 cells, but the amounts of dsRNA required to detect a 2- to 4-fold specific reduction were about 20-fold higher than in our experiments (Ui-Tei, 2000). Also CHO-K1 cells appear to be deficient in the interferon response. In another report, 293, NIH/3T3 and BHK-21 cells were tested for RNAi using luciferase/lacZ reporter combinations and 829 bp specific lacZ or 717 bp unspecific GFP dsRNA (Caplen, 2000). The failure of detecting RNAi in this case may be due to the less sensitive luciferase/lacZ reporter assay and the length differences of target and control dsRNA. Taken together, our results indicate that RNAi is active in mammalian cells, but that the silencing effect is difficult to detect, if the interferon system is activated by dsRNA >30 bp.
  • [0151]
    In summary, we have demonstrated for the first time siRNA-mediated gene silencing in mammalian cells. The use of short siRNAs holds great promise for inactivation of gene function in human tissue culture and the development of gene-specific therapeutics.
  • [0152]
    Specific Inhibition of Gene Expression by RNA Interference
  • [0153]
    3.1 Materials and Methods
  • [0154]
    3.1.1 RNA Preparation and RNAi Assay
  • [0155]
    Chemical RNA synthesis, annealing, and luciferase-based RNAi assays were performed as described in Examples 1 or 2 or in previous publications (Tuschl et al., 1999; Zamore et al., 2000). All siRNA duplexes were directed against firefly luciferase, and the luciferase mRNA sequence was derived from pGEM-luc (GenBank acc. X65316) as described (Tuschl et al., 1999). The siRNA duplexes were incubated in D. melanogaster RNAi/translation reaction for 15 min prior to addition of mRNAs. Translation-based RNAi assays were performed at least in triplicates.
  • [0156]
    For mapping of sense target RNA cleavage, a 177-nt transcript was generated, corresponding to the firefly luciferase sequence between positions 113-273 relative to the start codon, followed by the 17-nt complement of the SP6 promoter sequence. For mapping of antisense target RNA cleavage, a 166-nt transcript was produced from a template, which was amplified from plasmid sequence by PCR using 5′ primer TAATACGACTCACTATAGAGCCCATATCGTTTCATA (T7 promoter underlined) and 3! primer AGAGGATGGAACCGCTGG. The target sequence corresponds to the complement of the firefly luciferase sequence between positions 50-215 relative to the start codon. Guanylyl transferase labelling was performed as previously described (Zamore et al., 2000). For mapping of target RNA cleavage, 100 nM siRNA duplex was incubated with 5 to 10 nM target RNA in D. melanogaster embryo lysate under standard conditions (Zamore et al., 2000) for 2 h at 25° C. The reaction was stopped by the addition of 8 volumes of proteinase K buffer (200 mM Tris-HCl pH 7.5, 25 mM EDTA, 300 mM NaCl, 2% w/v sodium dodecyl sulfate). Proteinase K (E.M. Merck, dissolved in water) was added to a final concentration of 0.6 mg/ml. The reactions were then incubated for 15 min at 65° C., extracted with phenol/chloroform/isoamyl alcohol (25:24:1) and precipitated with 3 volumes of ethanol. Samples were located on 6% sequencing gels. Length standards were generated by partial RNase T1 digestion and partial base hydrolysis of the cap-labelled sense or antisense target RNAs.
  • [0157]
    3.2 Results
  • [0158]
    3.2.1 Variation of the 3′ Overhang in Duplexes of 21-nt siRNAs
  • [0159]
    As described above, 2 or 3 unpaired nucleotides at the 3′ end of siRNA duplexes were more efficient in target RNA degradation than the respective blunt-ended duplexes. To perform a more comprehensive analysis of the function of the terminal nucleotides, we synthesized five 21-nt sense siRNAs, each displayed by one nucleotide relative to the target RNA, and eight 21-nt antisense siRNAs, each displaced by one nucleotide relative to the target (FIG. 11A). By combining sense and antisense siRNAs, eight series of siRNA duplexes with synthetic overhanging ends were generated covering a range of 7-nt 3′ overhang to 4-nt 5′ overhang. The interference of siRNA duplexes was measured using the dual luciferase assay system (Tuschl et al., 1999; Zamore et al., 2000). siRNA duplexes were directed against firefly luciferase mRNA, and sea pansy luciferase mRNA was used as internal control. The luminescence ratio of target to control luciferase activity was determined in the presence of siRNA duplex and was normalized to the ratio observed in the absence of dsRNA. For comparison, the interference ratios of long dsRNAs (39 to 504 pb) are shown in FIG. 11B. The interference ratios were determined at concentrations of 5 nM for long dsRNAs (FIG. 11A) and at 100 nM for siRNA duplexes (FIG. 11C-J). The 100 nM concentrations of siRNAs was chosen, because complete processing of 5 nM 504 bp dsRNA would result in 120 nM total siRNA duplexes.
  • [0160]
    The ability of 21-nt siRNA duplexes to mediate RNAi is dependent on the number of overhanging nucleotides or base pairs formed. Duplexes with four to six 3′ overhanging nucleotides were unable to mediate RNAi (FIG. 11C-F), as were duplexes with two or more 5′ overhanging nucleotides (FIG. 11G-J). The duplexes with 2-nt 3′ overhangs were most efficient in mediating RNA interference, though the efficiency of silencing was also sequence-dependent, and up to 12-fold differences were observed for different siRNA duplexes with 2-nt 3′ overhangs (compare FIG. 11D-H). Duplexes with blunted ends, 1-nt 5′ overhang or 1 - to 3-nt 3′ overhangs were sometimes functional. The small silencing effect observed for the siRNA duplex with 7-nt 3′ overhang (FIG. 11C) may be due to an antisense effect of the long 3′ overhang rather than due to RNAi. Comparison of the efficiency of RNAi between long dsRNAs (FIG. 11B) and the most effective 21-nt siRNA duplexes (FIG. 11E, G, H) indicates that a single siRNA duplex at 100 nM concentration can be as effective as 5 nM 504 bp dsRNA.
  • [0161]
    3.2.2 Length Variation of the Sense siRNA Paired to an Invariant 21-nt Antisense siRNA
  • [0162]
    In order to investigate the effect of length of siRNA on RNAi, we prepared 3 series of siRNA duplexes, combining three 21-nt antisense strands with eight, 1 8- to 25-nt sense strands. The 3′ overhang of the antisense siRNA was fixed to 1, 2, or 3 nt in each siRNA duplex series, while the sense siRNA was varied at its 3′ end (FIG. 12A). Independent of the lenght of the sense siRNA, we found that duplexes with 2-nt 3′ overhang of anti-sense siRNA (FIG. 12C) were more active than those with 1- or 3-nt 3′ overhang (FIG. 12B, D). In the first series, with 1-nt 3′ overhang of antisense siRNA, duplexes with a 21- and 22-nt sense siRNAs, carrying a 1- and 2-nt 3′ overhang of sense siRNA, respectively, were most active. Duplexes with 19- to 25-nt sense siRNAs were also able to mediate RNA, but to a lesser extent. Similarly, in the second series, with 2-nt overhang of antisense siRNA, the 21-nt siRNA duplex with 2-nt 3′ overhang was most active, and any other combination with the 18- to 25-nt sense siRNAs was active to a significant degree. In the last series, with 3-nt anti-sense siRNA 3′ overhang, only the duplex with a 20-nt sense siRNA and the 2-nt sense 3′ overhang was able to reduce target RNA expression. Together, these results indicate that the length of the siRNA as well as the length of the 3′ overhang are important, and that duplexes of 21-nt siRNAs with 2-nt 3′ overhang are optimal for RNAi.
  • [0163]
    3.2.3 Length Variation of siRNA Duplexes with a Constant 2-nt 3′ Overhang
  • [0164]
    We then examined the effect of simultaneously changing the length of both siRNA strands by maintaining symmetric 2-nt 3′ overhangs (FIG. 13A). Two series of siRNA duplexes were prepared including the 21-nt siRNA duplex of FIG. 11H as reference. The length of the duplexes was varied between 20 to 25 bp by extending the base-paired segment at the 3′ end of the sense siRNA (FIG. 13B) or at the 3′ end of the antisense siRNA (FIG. 13C). Duplexes of 20 to 23 bp caused specific repression of target luciferase activity, but the 21-nt siRNA duplex was at least 8-fold more efficient than any of the other duplexes. 24- and 25-nt siRNA duplexes did not result in any detectable interference. Sequence-specific effects were minor as variations on both ends of the duplex produced similar effects.
  • [0165]
    3.2.4 2′-Deoxy and 2′-O-methyl-Modified siRNA Duplexes
  • [0166]
    To assess the importance of the siRNA ribose residues for RNAi, duplexes with 21-nt siRNAs and 2-nt 3′ overhangs with 2′-deoxy- or 2′-O-methyl-modified strands were examined (FIG. 14). Substitution of the 2-nt 3′ overhangs by 2′-deoxy nucleotides had no effect, and even the replacement of two additional riboncleotides adjacent to the overhangs in the paired region, produced significantly active siRNAs. Thus, 8 out of 42 nt of a siRNA duplex were replaced by DNA residues without loss of activity. Complete substitution of one or both siRNA strands by 2′-deoxy residues, however, abolished RNAi, as did substitution by 2′-O-methyl residues.
  • [0167]
    3.2.5 Definition of Target RNA Cleavage Sites
  • [0168]
    Target RNA cleavage positions-were previously determined for 22-nt siRNA duplexes and for a 21-nt/22-nt duplex. It was found that the position of the target RNA cleavage was located in the centre of the region covered by the siRNA duplex, 11 or 12 nt downstream of the first nucleotide that was complementary to the 21- or 22-nt siRNA guide sequence. Five distinct 21-nt siRNA duplexes with 2-nt 3′ overhang (FIG. 1 5A) were incubated with 5′ cap-labelled sense or antisense target RNA in D. melanogaster lysate (Tuschl et al., 1999; Zamore et al., 2000). The 5′ cleavage products were resolved on sequencing gels (FIG. 15B). The amount of sense target RNA cleaved correlates with the efficiency of siRNA duplexes determined in the translation-based assay, and siRNA duplexes 1, 2 and 4 (FIGS. 15B and 11H, G, E) cleave target RNA faster than duplexes 3 and 5 (FIGS. 15B and 11F, D). Notably, the sum of radioactivity of the 5′ cleavage product and the input target RNA were not constant over time, and the 5′ cleavage products did not accumulate. Presumably, the cleavage products, once released from the siRNA-endonuclease complex, are rapidly degraded due to the lack of either of the poly(A) tail of the 5′-cap.
  • [0169]
    The cleavage sites for both, sense and antisense target RNAs were located in the middle of the region spanned by the siRNA duplexes. The cleavage sites for each target produced by the 5 different duplexes varied by 1-nt according to the 1-nt displacement of the duplexes along the target sequences. The targets were cleaved precisely 11 nt downstream of the target position complementary to the 3′-most nucleotide of the sequence-complementary guide siRNA (FIG. 15A, B).
  • [0170]
    In order to determine, whether the 5′ or the 3′ end of the guide siRNA sets the ruler for target RNA cleavage, we devised the experimental strategy outlined in FIGS. 16A and B. A 21-nt antisense siRNA, which was kept invariant for this study, was paired with sense siRNAs that were modified at either of their 5′ or 3′ ends. The position of sense and antisense target RNA cleavage was determined as described above. Changes in the 3′ end of the sense siRNA, monitored for 1-nt 5′ overhang to 6-nt 3′ overhang, did neither effect the position of sense nor antisense target RNA cleavage (FIG. 16C). Changes in the 5′ end of the sense siRNA did no affect the sense target RNA cleavage (FIG. 16D, top panel), which was expected because the antisense siRNA was unchanged. However, the antisense target RNA cleavage was affected and strongly dependent on the 5′ end of the sense siRNA (FIG. 16D, bottom panel). The antisense target was only cleaved, when the sense siRNA was 20 or 21 nt in size, and the position of cleavage different by 1-nt, suggesting that the 5′ end of the target-recognizing siRNA sets the ruler for target RNA cleavage. The position is located between nucleotide 10 and 11 when counting in upstream direction from the target nucleotide paired to the 5′-most nucleotide of the guide siRNA (see also FIG. 15A).
  • [0171]
    3.2.6 Sequence Effects and 2′-deoxy Substitutions in the 3′ Overhang
  • [0172]
    A 2-nt 3′ overhang is preferred for siRNA function. We wanted to know, if the sequence of the overhanging nucleotides contributes to target recognition, or if it is only a feature required for reconstitution of the endonuclease complex (RISC or siRNP). We synthesized sense and antisense siRNAs with AA, CC, GG, UU, and UG 3′ overhangs and included the 2′-deoxy modifications TdG and TT. The wild-type siRNAs contained AA in the sense 3′ overhang and UG in the antisense 3′ overhang (AA/UG). All siRNA duplexes were functional in the interference assay and reduced target expression at least 5-fold (FIG. 17). The most efficient siRNA duplexes that reduced target expression more than 10-fold, were of the sequence type NN/UG, NN/UU, NN/TdG, and NN/TT (N, any nucleotide). siRNA duplexes with an antisense siRNA 3′ overhang of AA, CC or GG were less active by a factor 2 to 4 when compared to the wild-type sequence UG or the mutant UU. This reduction in RNAi efficiency is likely due to the contribution of the penultimate 3′ nucleotide to sequence-specific target recognition, as the 3′ terminal nucleotide was changed from G to U without effect.
  • [0173]
    Changes in the sequence of the 3′ overhang of the sense siRNA did not reveal any sequence-dependent effects, which was expected, because the sense siRNA must not contribute to sense target mRNA recognition.
  • [0174]
    3.2.7 Sequence Specifity of Target Recognition
  • [0175]
    In order to examine the sequence-specifity of target recognition, we introduced sequence changes into the paired segments of siRNA duplexes and determined the efficiency of silencing. Sequence changes were introduced by inverting short segments of 3- or 4-nt length or as point mutations (FIG. 18). The sequence changes in one siRNA strand were compensated in the complementary siRNA strand to avoid pertubing the base-paired siRNA duplex structure. The sequence of all 2-nt 3′ overhangs was TT (T, 2′-deoxythymidine) to reduce costs of synthesis. The TT/TT reference siRNA duplex was comparable in RNAi to the wild-type siRNA duplex AA/UG (FIG. 17). The ability to mediate reporter mRNA destruction was quantified using the translation-based luminescence assay. Duplexes of siRNAs with inverted sequence segments showed dramatically reduced ability for targeting the firefly luciferase reporter (FIG. 18). The sequence changes located between the 3′ end and the middle of the antisense siRNA completely abolished target RNA recognition, but mutations near the 5′ end of the antisense siRNA exhibit a small degree of silencing. Transversion of the A/U base pair located directly opposite of the predicted target RNA cleavage site, or one nucleotide further away from the predicted site, prevented target RNA cleavage, therefore indicating that single mutation within the centre of a siRNA duplex discriminate between mismatched targets.
  • [0176]
    3.3 Discussion
  • [0177]
    siRNAs are valuable reagents for inactivation of gene expression, not only in insect cells, but also in mammalian cells, with a great potential for therapeutic application. We have systematically analysed the structural determinants of siRNA duplexes required to promote efficient target RNA degradation in D. melanogaster embryo lysate, thus providing rules for the design of most potent siRNA duplexes. A perfect siRNA duplex is able to silence gene expression with an efficiency comparable to a 500 bp dsRNA, given that comparable quantities of total RNA are used.
  • [0178]
    3.4 The siRNA User Guide
  • [0179]
    Efficiently silencing siRNA duplexes are preferably composed of 21-nt antisense siRNAs, and should be selected to form a 19 bp double helix with 2-nt 3′ overhanging ends. 2′-deoxy substitutions of the 2-nt 3′ overhanging ribonucleotides do not affect RNAi, but help to reduce the costs of RNA synthesis and may enhance RNAse resistance of siRNA duplexes. More extensive 2′-deoxy or 2′-O-methyl modifications, however, reduce the ability of siRNAs to mediate RNAi, probably by interfering with protein association for siRNAP assembly.
  • [0180]
    Target recognition is a highly sequence-specific process, mediated by the siRNA complementary to the target. The 3′-most nucleotide of the guide siRNA does not contribute to specificity of target recognition, while the penultimate nucleotide of the 3′ overhang affects target RNA cleavage, and a mismatch reduces RNAi 2- to 4-fold. The 5′ end of a guide siRNA also appears more permissive for mismatched target RNA recognition when compared to the 3′ end. Nucleotides in the centre of the siRNA, located opposite the target RNA cleavage site, are important specificity determinants and even single nucleotide changes reduce RNAi to undetectable level. This suggests that siRNA duplexes may be able to discriminate mutant or polymorphic alleles in gene targeting experiments, which may become an important feature for future therapeutic developments.
  • [0181]
    Sense and antisense siRNAs, when associated with the protein components of the endonclease complex or its commitment complex, were suggested to play distinct roles; the relative orientation of the siRNA duplex in this complex defines which strand can be used for target recognition. Synthetic siRNA duplexes have dyad symmetry with respect to the double-helical structure, but not with respect to sequence. The association of siRNA duplexes with the RNAi proteins in the D. melanogaster lysate will lead to formation of two asymmetric complexes. In such hypothetical complexes, the chiral environment is distinct for sense and antisense siRNA, hence their function. The prediction obviously does not apply to palindromic siRNA sequences, or to RNAi proteins that could associate as homodimers. To minimize sequence effects, which may affect the ratio of sense and antisense-targeting siRNPs, we suggest to use siRNA sequences with identical 3′ overhanging sequences. We recommend to adjust the sequence of the overhang of the sense siRNA to that of the antisense 3′ overhang, because the sense siRNA does not have a target in typical knock-down experiments. Asymmetry in reconstitution of sense and antisense-cleaving siRNPs could be (partially) responsible for the variation in RNAi efficiency observed for various 21-nt siRNA duplexes with 2-nt 3′ overhangs used in this study (FIG. 14). Alternatively, the nucleotide sequence at the target site and/or the accessibility of the target RNA structure may be responsible for the variation in efficiency for these siRNA duplexes.
  • [0182]
  • [0183]
    Bass, B. L. (2000). Double-stranded RNA as a template for gene silencing. Cell 101, 235-238.
  • [0184]
    Bosher, J. M., and Labouesse, M. (2000). RNA interference: genetic wand and genetic watchdog. Nat. Cell Biol. 2, E31-36.
  • [0185]
    Caplen, N. J., Fleenor, J., Fire, A., and Morgan, R. A. (2000). dsRNA-mediated gene silencing in cultured Drosophila cells: a tissue culture model for the analysis of RNA interference. Gene 252, 95-105.
  • [0186]
    Catalanotto, C., Azzalin, G., Macino, G., and Cogoni, C. (2000). Gene silencing in worms and fungi. Nature 404, 245.
  • [0187]
    Chanfreau, G., Buckle, M., and Jacquier, A. (2000). Recognition of a conserved class of RNA tetraloops by Saccharomyces cerevisiae RNase III. Proc. Natl. Acad. Sci. USA 97, 3142-3147.
  • [0188]
    Clemens, M. J. (1997). PKR—a protein kinase regulated by double-stranded RNA. Int. J. Biochem. Cell Biol. 29, 945-949.
  • [0189]
    Cogoni, C., and Macino, G. (1999). Homology-dependent gene silencing in plants and fungi: a number of variations on the same theme. Curr. Opin. Microbiol. 2, 657-662.
  • [0190]
    Dalmay, T., Hamilton, A., Rudd, S., Angell, S., and Baulcombe, D. C. (2000). An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101, 543-553.
  • [0191]
    Dernburg, A. F., Zalevsky, J., Colaiacovo, M. P., and Villeneuve, A. M. (2000). Transgene-mediated cosuppression in the C. elegans germ line. Genes & Dev. 14, 1578-1583.
  • [0192]
    Dunn, J. J. (1982). Ribonuclease III. In The enzymes, vol 15, part B, P. D. Boyer, ed. (New York: Academic Press), pp. 485-499.
  • [0193]
    Filippov, V., Solovyev, V., Filippova, M., and Gill, S. S. (2000). A novel type-of RNase III family proteins in eukaryotes. Gene 245, 213-221.
  • [0194]
    Fire, A. (1999). RNA-triggered gene silencing. Trends Genet. 15, 358-363.
  • [0195]
    Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811.
  • [0196]
    Grishok, A., Tabara, H., and Mello, C. C. (2000). Genetic requirements for inheritance of RNAi in C. elegans. Science 287, 2494-2497.
  • [0197]
    Hamilton, A. J., and Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950-952.
  • [0198]
    Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293-296.
  • [0199]
    Jacobsen, S. E., Running, M. P., and M., M. E. (1999). Disruption of an RNA helicase/RNase III gene in Arabidopsis causes unregulated cell division in floral meristems. Development 126, 5231-5243.
  • [0200]
    Jensen, S., Gassama, M. P., and Heidmann, T. (1999). Taming of transposable elements by homology-dependent gene silencing. Nat. Genet. 21, 209-212.
  • [0201]
    Kehlenbach, R. H., Dickmanns, A. & Gerace, L. (1998). Nucleocytoplasmic shuttling factors including Ran and CRM1 mediate nuclear export of NFAT In vitro. J. Cell Biol. 141, 863-874.
  • [0202]
    Kennerdell, J. R., and Carthew, R. W. (1998). Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95, 1017-1026.
  • [0203]
    Ketting, R. F., Haverkamp, T. H., van Luenen, H. G., and Plasterk, R. H. (1999). Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99, 133-141.
  • [0204]
    Ketting, R. F., and Plasterk, R. H. (2000). A genetic link between co-suppression and RNA interference in C. elegans. Nature 404, 296-298.
  • [0205]
    Lucy, A. P., Guo, H. S., Li, W. X., and Ding, S. W. (2000). Suppression of post-transcriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J. 19, 1672-1680.
  • [0206]
    Matsuda, S., Ichigotani, Y., Okuda, T., Irimura, T., Nakatsugawa, S., and Hamaguchi, M. (2000). Molecular cloning and characterization of a novel human gene (HERNA) which encodes a putative RNA-helicase. Biochim. Biophys. Acta 31, 1-2.
  • [0207]
    Milligan, J. F., and Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol. 180, 51-62.
  • [0208]
    Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J. B., Jouette, D., Lacombe, A. M., Nikic, S., Picault, N., Remoue, K., Sanial, M., Vo, T. A., and Vaucheret, H. (2000). Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101, 533-542.
  • [0209]
    Ngo, H., Tschudi, C., Gull, K., and Ullu, E. (1998). Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 95, 14687-14692.
  • [0210]
    Nicholson, A. W. (1999). Function, mechanism and regulation of bacterial ribonucleases. FEMS Microbiol. Rev. 23, 371-390.
  • [0211]
    Oelgeschlager, M., Larrain, J., Geissert, D., and De Robertis, E. M. (2000). The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature 405, 757-763.
  • [0212]
    Pan, T., and Uhlenbeck, O. C. (1992). In vitro selection of RNAs that undergo autolytic cleavage with Pb2+. Biochemistry 31, 3887-3895.
  • [0213]
    Pelissier, T., and Wassenegger, M. (2000). A DNA target of 30 bp is sufficient for RNA-directed methylation. RNA 6, 55-65.
  • [0214]
    Plasterk, R. H., and Ketting, R. F. (2000). The silence of the genes. Curr. Opin. Genet. Dev. 10, 562-567.
  • [0215]
    Ratcliff, F. G., MacFarlane, S. A., and Baulcombe, D. C. (1999). Gene Silencing without DNA. RNA-mediated cross-protection between viruses. Plant Cell 11, 1207-1216.
  • [0216]
    Robertson, H. D. (1990). Escherichia coli ribonuclease III. Methods Enzymol. 181, 189-202.
  • [0217]
    Robertson, H. D. (1982). Escherichia coli ribonuclease III cleavage sites. Cell 30, 669-672.
  • [0218]
    Romaniuk, E., McLaughlin, L. W., Neilson, T., and Romaniuk, P. J. (1982). The effect of acceptor oligoribonucleotide sequence on the T4 RNA ligase reaction. Eur J Biochem 125, 639-643.
  • [0219]
    Sharp, P. A. (1999). RNAi and double-strand RNA. Genes & Dev. 13, 139-141.
  • [0220]
    Sijen, T., and Kooter, J. M. (2000). Post-transcriptional gene-silencing: RNAs on the attack or on the defense? Bioessays 22, 520-531.
  • [0221]
    Smardon, A., Spoerke, J., Stacey, S., Klein, M., Mackin, N., and Maine, E. (2000). EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans. Curr. Biol. 10, 169-178.
  • [0222]
    Svoboda, P., Stein, P., Hayashi, H., and Schultz, R. M. (2000). Selective reduction of dormant-maternal mRNAs in mouse oocytes by RNA interference. Development 127, 4147-4156.
  • [0223]
    Tabara, H., Sarkissian, M., Kelly, W. G., Fleenor, J., Grishok, A., Timmons, L., Fire, A., and Mello, C. C. (1999). The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99, 123-132.
  • [0224]
    Tuschl, T., Ng, M. M., Pieken, W., Benseler, F., and Eckstein, F. (1993). Importance of exocyclic base functional groups of central core guanosines for hammerhead ribozyme activity. Biochemistry 32, 11658-11668.
  • [0225]
    Tuschl, T., Sharp, P. A., and Bartel, D. P. (1998). Selection in vitro of novel ribozymes from a partially randomized U2 and U6 snRNA library. EMBO J. 17, 2637-2650.
  • [0226]
    Tuschl, T., Zamore, P. D., Lehmann, R., Bartel, D. P., and Sharp, P. A. (1999). Targeted mRNA degradation by double-stranded RNA in vitro. Genes & Dev. 13, 3191-3197.
  • [0227]
    Ui-Tei, K., Zenno, S., Miyata, Y. & Saigo, K. (2000). Sensitive assay of RNA interference in Drosophila and Chinese hamster cultured cells using firefly luciferase gene as target. FEBS Letters 479, 79-82.
  • [0228]
    Verma, S., and Eckstein, F. (1999). Modified oligonucleotides: Synthesis and strategy for users. Annu. Rev. Biochem. 67, 99-134.
  • [0229]
    Voinnet, O., Lederer, C., and Baulcombe, D. C. (2000). A viral movement protein prevents spread of the gene silencing signal in Nicotiana benthamiana. Cell 103, 157-167.
  • [0230]
    Wassenegger, M. (2000). RNA-directed DNA methylation. Plant Mol. Biol. 43, 203-220.
  • [0231]
    Wianny, F., and Zernicka-Goetz, M. (2000). Specific interference with gene function by double-stranded RNA in early mouse development. Nat. Cell Biol. 2, 70-75.
  • [0232]
    Wu, H., Xu, H., Miraglia, L. J., and Crooke, S. T. (2000). Human RNase III is a 160 kDa Protein Involved in Preribosomal RNA Processing. J. Biol. Chem. 17, 17.
  • [0233]
    Yang, D., Lu, H. and Erickson, J. W. (2000) Evidence that processed small dsRNAs may mediate sequence-specific mRNA degradation during RNAi in drosophilia embryos. Curr. Biol., 10, 1191-1200.
  • [0234]
    Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: Double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25-33.
  • [0235]
    Zhang, K., and Nicholson, A. W. (1997). Regulation of ribonuclease III processing by double-helical sequence antideterminants. Proc. Natl. Acad. Sci. USA 94, 13437-13441.
  • 1 96 1 38 DNA Artificial Sequence Description of Artificial Sequence 5′Primer 1 gcgtaatacg actcactata gaacaattgc ttttacag 38 2 35 DNA Artificial Sequence Description of Artificial Sequence3′Primer 2 atttaggtga cactataggc ataaagaatt gaaga 35 3 30 DNA Artificial Sequence Description of Artificial SequenceReverse transcription primer 3 gactagctgg aattcaagga tgcggttaaa 30 4 30 DNA Artificial Sequence Description of Artificial Sequence 5′Primer 4 cagccaacgg aattcatacg actcactaaa 30 5 36 DNA Artificial Sequence Description of Artificial Sequence 5′Primer 5 taatacgact cactatagag cccatatcgt ttcata 36 6 18 DNA Artificial Sequence Description of Artificial Sequence dsRNA, Figure 5A 6 agaggatgga accgctgg 18 7 177 RNA Drosophila 7 gaacaauugc uuuuacagau gcacauaucg aggugaacau cacguacgcg gaauacuucg 60 aaauguccgu ucgguuggca gaagcuauga aacgauaugg gcugaauaca aaucacagaa 120 ucgucguaug cagugaaaac ucucuucaau ucuuuaugcc uauaguguca ccuaaau 177 8 180 RNA Drosophila Description of Artificial Sequence siRNA duplex, antisense 8 ggcauaaaga auugaagaga guuuucacug cauacgacga uucugugauu uguauucagc 60 ccauaucguu ucauagcuuc ugccaaccga acggacauuu cgaaguauuc cgcguacgug 120 auguucaccu cgauaugugc aucuguaaaa gcaauuguuc uauagugagu cguauuacgc 180 9 39 RNA Drosophila 9 gcacauaucg aggugaacau cacguacgcg gaauacuuc 39 10 52 RNA Drosophila 10 gcacauaucg aggugaacau cacguacgcg gaauacuucg aaauguccgu uc 52 11 111 RNA Drosophila 11 gcacauaucg aggugaacau cacguacgcg gaauacuucg aaauguccgu ucgguuggca 60 gaagcuauga aacgauaugg gcugaauaca aaucacagaa ucgucguaug c 111 12 52 RNA Artificial Sequence Description of Artificial Sequence dsRNA, Figure 5A 12 gcacauaucg aggugaacau cacguacgcg gaauacuucg aaauguccgu uc 52 13 54 RNA Artificial Sequence Description of Artificial Sequence dsRNA, Figure 5A 13 gaacggacau uucgaaguau uccgcguacg ugauguucac cucgauaugu gcac 54 14 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 8b, uGL2 14 cguacgcgga auacuucgau u 21 15 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 8b, uGL2 15 ucgaaguauu ccgcguacgu u 21 16 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex GL2 16 cguacgcgga auacuucgat t 21 17 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex GL2 17 ucgaaguauu ccgcguacgt t 21 18 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex GL3 18 cuuacgcuga guacuucgat t 21 19 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex GL3 19 ucgaaguacu cagcguaagt t 21 20 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex invGL2 20 agcuucauaa ggcgcaugct t 21 21 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex invGL2 21 gcaugcgccu uaugaagcut t 21 22 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule siRNA duplex RL 22 aaacaugcag aaaaugcugt t 21 23 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculesiRNA duplex RL 23 cagcauuuuc ugcauguuut t 21 24 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 24 aucacguacg cggaauacuu c 21 25 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 25 guauuccgcg uacgugaugu u 21 26 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 26 ucacguacgc ggaauacuuc g 21 27 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 27 cacguacgcg gaauacuucg a 21 28 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 28 acguacgcgg aauacuucga a 21 29 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 C 29 cguacgcgga auacuucgaa a 21 30 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 D 30 aguauuccgc guacgugaug u 21 31 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 E 31 aaguauuccg cguacgugau g 21 32 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 F 32 gaaguauucc gcguacguga u 21 33 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 G 33 cgaaguauuc cgcguacgug a 21 34 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 H 34 ucgaaguauu ccgcguacgu g 21 35 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 I 35 uucgaaguau uccgcguacg u 21 36 21 RNA Artificial Sequence Description of Artificial Sequence duplex of 21-nt siRNA, Figure 11 J 36 uuucgaagua uuccgcguac g 21 37 18 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 37 cguacgcgga auacuucg 18 38 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, antisense 38 uucgaaguau uccgcguacg u 21 39 19 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 39 cguacgcgga auacuucga 19 40 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 40 cguacgcgga auacuucgaa 20 41 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 41 cguacgcgga auacuucgaa a 21 42 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 42 cguacgcgga auacuucgaa au 22 43 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 43 cguacgcgga auacuucgaa aug 23 44 24 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 44 cguacgcgga auacuucgaa augu 24 45 25 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 B, sense 45 cguacgcgga auacuucgaa auguc 25 46 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 C, antisense 46 ucgaaguauu ccgcguacgu g 21 47 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 12 D, antisense 47 cgaaguauuc cgcguacgug a 21 48 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 48 cguacgcgga auacuucgaa 20 49 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 49 cgaaguauuc cgcguacgug 20 50 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 50 cguacgcgga auacuucgaa a 21 51 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 51 ucgaaguauu ccgcguacgu g 21 52 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 52 cguacgcgga auacuucgaa au 22 53 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 53 uucgaaguau uccgcguacg ug 22 54 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 54 cguacgcgga auacuucgaa aug 23 55 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 55 uuucgaagua uuccgcguac gug 23 56 24 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 56 cguacgcgga auacuucgaa augu 24 57 24 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 57 auuucgaagu auuccgcgua cgug 24 58 25 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, sense 58 cguacgcgga auacuucgaa auguc 25 59 25 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 B, antisense 59 cauuucgaag uauuccgcgu acgug 25 60 19 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, sense 60 guacgcggaa uacuucgaa 19 61 20 RNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 13 C 61 ucgaaguauu ccgcguacgu 20 62 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, sense 62 acguacgcgg aauacuucga aa 22 63 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, antisense 63 ucgaaguauu ccgcguacgu ga 22 64 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, sense 64 cacguacgcg gaauacuucg aaa 23 65 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 13 C, antisense 65 ucgaaguauu ccgcguacgu gau 23 66 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-2, sense 66 acguacgcgg aauacuucga a 21 67 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-2, antisense 67 cgaaguauuc cgcguacgug a 21 68 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-3, sense 68 cacguacgcg gaauacuucg a 21 69 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-3, antisense 69 gaaguauucc gcguacguga u 21 70 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-4, sense 70 ucacguacgc ggaauacuuc g 21 71 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-4, antisense 71 aaguauuccg cguacgugau g 21 72 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-5, sense 72 aucacguacg cggaauacuu c 21 73 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 A-5, antisense 73 aguauuccgc guacgugaug u 21 74 18 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 74 acgcggaaua cuucgaaa 18 75 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, antisense 75 ucgaaguauu ccgcguacgu g 21 76 19 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 76 uacgcggaau acuucgaaa 19 77 20 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 15 D, sense 77 guacgcggaa uacuucgaaa 20 78 21 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 78 cguacgcgga auacuucgaa a 21 79 22 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 79 acguacgcgg aauacuucga aa 22 80 23 RNA Artificial Sequence Description of Artificial Sequence siRNA duplex, Figure 16 D, sense 80 cacguacgcg gaauacuucg aaa 23 81 21 DNA Artificial Sequence Description of Combined DNA/RNA MoleculeReference 81 cguacgcgga auacuucgat t 21 82 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Reference 82 ucgaaguauu ccgcguacgt t 21 83 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 13 C 83 augccgcgga auacuucgat t 21 84 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-1 84 ucgaaguauu ccgcggcaut t 21 85 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-2 85 cguagcgcga auacuucgat t 21 86 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-2 86 ucgaaguauu cgcgcuacgt t 21 87 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-3 87 cguacgcgag uaacuucgat t 21 88 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-3 88 ucgaaguuac ucgcguacgt t 21 89 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-4 89 cguacgcgga auuucacgat t 21 90 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-4 90 ucgugaaauu ccgcguacgt t 21 91 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-5 91 cguacgcgga auacuuagct t 21 92 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-5 92 gcuaaguauu ccgcguacgt t 21 93 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-6 93 cguacgcggu auacuucgat t 21 94 21 DNA Artificial Sequence Description of Artificial Sequence siRNA duplex, antisense 94 ucgaaguaua ccgcguacgt t 21 95 21 DNA Artificial Sequence Description of Combined DNA/RNA Molecule Figure 18-7 95 cguacgcgga uuacuucgat t 21 96 21 DNA Artificial Sequence Description of Artificial Sequence siRNA duplex, antisense 96 ucgaaguaau ccgcguacgt t 21
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4469863 *Nov 12, 1980Sep 4, 1984Ts O Paul O PNonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5208149 *Apr 10, 1992May 4, 1993The Research Foundation Of State University Of New YorkNucleic acid constructs containing stable stem and loop structures
US5457189 *Mar 31, 1992Oct 10, 1995Isis PharmaceuticalsAntisense oligonucleotide inhibition of papillomavirus
US5514577 *Mar 12, 1993May 7, 1996Isis Pharmaceuticals, Inc.Oligonucleotide therapies for modulating the effects of herpes viruses
US5576208 *Aug 26, 1994Nov 19, 1996Isis Pharmaceuticals Inc.Antisense oligonucleotide inhibition of the RAS gene
US5578716 *Dec 1, 1993Nov 26, 1996Mcgill UniversityDNA methyltransferase antisense oligonucleotides
US5580859 *Mar 18, 1994Dec 3, 1996Vical IncorporatedDelivery of exogenous DNA sequences in a mammal
US5594122 *Sep 19, 1994Jan 14, 1997Genesys Pharma Inc.Antisense oligonucleotides targeted against human immunodeficiency virus
US5624803 *Oct 13, 1994Apr 29, 1997The Regents Of The University Of CaliforniaIn vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5624808 *Mar 28, 1995Apr 29, 1997Becton Dickinson And CompanyMethod for identifying cells committed to apoptosis by determining cellular phosphotyrosine content
US5670633 *Aug 12, 1991Sep 23, 1997Isis Pharmaceuticals, Inc.Sugar modified oligonucleotides that detect and modulate gene expression
US5672695 *Sep 23, 1991Sep 30, 1997Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V.Modified ribozymes
US5712257 *May 23, 1995Jan 27, 1998Hem Research, Inc.Topically active compositions of mismatched dsRNAs
US5770580 *May 30, 1995Jun 23, 1998Baylor College Of MedicineSomatic gene therapy to cells associated with fluid spaces
US5795715 *Dec 18, 1992Aug 18, 1998Cis Bio InternationalProcess for preparing double-stranded RNA, and its applications
US5801154 *Apr 8, 1997Sep 1, 1998Isis Pharmaceuticals, Inc.Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5814500 *Oct 31, 1996Sep 29, 1998The Johns Hopkins University School Of MedicineDelivery construct for antisense nucleic acids and methods of use
US5898031 *Jun 6, 1996Apr 27, 1999Isis Pharmaceuticals, Inc.Oligoribonucleotides for cleaving RNA
US5908779 *Dec 1, 1993Jun 1, 1999University Of ConnecticutTargeted RNA degradation using nuclear antisense RNA
US5919722 *Feb 3, 1997Jul 6, 1999Exxon Chemical Patents Inc.Zeolite L catalyst
US5972704 *Aug 13, 1997Oct 26, 1999Ribozyme Pharmaceuticals, Inc.HIV nef targeted ribozymes
US5998203 *Apr 16, 1996Dec 7, 1999Ribozyme Pharmaceuticals, Inc.Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
US6001990 *Jun 7, 1995Dec 14, 1999The General Hospital CorporationAntisense inhibition of hepatitis C virus
US6057153 *Jul 14, 1997May 2, 2000Yale UniversityStabilized external guide sequences
US6107094 *Jun 6, 1997Aug 22, 2000Isis Pharmaceuticals, Inc.Oligoribonucleotides and ribonucleases for cleaving RNA
US6225290 *Sep 19, 1996May 1, 2001The Regents Of The University Of CaliforniaSystemic gene therapy by intestinal cell transformation
US6475726 *Jun 25, 1999Nov 5, 2002Cubist Pharmaceuticals, Inc.Method for identifying validated target and assay combinations for drug development
US6476205 *Aug 10, 1998Nov 5, 2002Isis Pharmaceuticals, Inc.2′ Modified oligonucleotides
US6506559 *Dec 18, 1998Jan 14, 2003Carnegie Institute Of WashingtonGenetic inhibition by double-stranded RNA
US6531647 *Sep 22, 1998Mar 11, 2003Plant Bioscience LimitedGene silencing methods
US6635805 *Feb 12, 1998Oct 21, 2003Plant Bioscience LimitedMethods and DNA constructs for gene silencing in transgenic plants
US6753139 *Jan 26, 2000Jun 22, 2004Plant Bioscience LimitedGene silencing
US7056704 *Apr 27, 2004Jun 6, 2006Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US7078196 *Apr 27, 2004Jul 18, 2006Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften, E.V.RNA interference mediating small RNA molecules
US7232806 *Sep 27, 2002Jun 19, 2007Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.MicroRNA molecules
US20020086356 *Mar 30, 2001Jul 4, 2002Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20020114784 *Jan 4, 2002Aug 22, 2002Medical College Of Georgia Research Institute, Inc.Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20020132257 *Jan 31, 2002Sep 19, 2002Tony GiordanoUse of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
US20020137210 *Dec 7, 2000Sep 26, 2002Churikov Nikolai AndreevichMethod for modifying genetic characteristics of an organism
US20020160393 *Dec 28, 2001Oct 31, 2002Symonds Geoffrey P.Double-stranded RNA-mediated gene suppression
US20020162126 *May 24, 2001Oct 31, 2002David BeachMethods and compositions for RNA interference
US20030051263 *Oct 30, 2002Mar 13, 2003The Carnegie Institution Of WashingtonGenetic inhibition by double-stranded RNA
US20030055020 *Oct 30, 2002Mar 20, 2003The Carnegie Institution Of WashingtonGenetic inhibition by double-stranded RNA
US20030056235 *Oct 30, 2002Mar 20, 2003The Carnegie Institution Of WashingtonGenetic inhibition by double-stranded RNA
US20030064945 *Jul 25, 2001Apr 3, 2003Saghir AkhtarEnzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
US20030068301 *Jun 8, 2001Apr 10, 2003Kenneth DraperMethod and reagent for inhibiting hepatitis B virus replication
US20030084471 *Jan 22, 2002May 1, 2003David BeachMethods and compositions for RNA interference
US20030108923 *Sep 26, 2002Jun 12, 2003Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20030140362 *Oct 24, 2002Jul 24, 2003Dennis MacejakIn vivo models for screening inhibitors of hepatitis B virus
US20030148985 *Dec 5, 2002Aug 7, 2003David MorrisseyMethods and reagents for the inhibition of hepatitis B virus replication
US20030153521 *Sep 10, 2002Aug 14, 2003Mcswiggen JamesNucleic acid treatment of diseases or conditions related to levels of Ras
US20030171311 *Mar 26, 2001Sep 11, 2003Lawrence BlattEnzymatic nucleic acid treatment of diseases or conditions related to hepatitis C virus infection
US20030180756 *Nov 21, 2002Sep 25, 2003Yang ShiCompositions and methods for suppressing eukaryotic gene expression
US20030190654 *Jan 22, 2003Oct 9, 2003RibopharmaDouble-stranded RNA (dsRNA) and method of use for inhibiting expression of a fusion gene
US20030206887 *Sep 16, 2002Nov 6, 2003David MorrisseyRNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US20040001811 *Mar 7, 2003Jan 1, 2004Ribopharma AgCompositions and methods for inhibiting expression of anti-apoptotic genes
US20040002153 *Jan 3, 2003Jan 1, 2004Monia Brett P.Modulation of PTEN expression via oligomeric compounds
US20040005593 *Mar 6, 2003Jan 8, 2004Rigel Pharmaceuticals, Inc.Novel method for delivery and intracellular synthesis of siRNA molecules
US20040006035 *Apr 22, 2003Jan 8, 2004Dennis MacejakNucleic acid mediated disruption of HIV fusogenic peptide interactions
US20040018999 *May 16, 2001Jan 29, 2004David BeachMethods and compositions for RNA interference
US20040019001 *Jul 26, 2002Jan 29, 2004Mcswiggen James A.RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
US20040038921 *Aug 11, 2003Feb 26, 2004Ribopharma AgComposition and method for inhibiting expression of a target gene
US20040053875 *Mar 6, 2003Mar 18, 2004Ribopharma AgMethod and medicament for inhibiting the expression of a given gene
US20040053876 *Mar 26, 2003Mar 18, 2004The Regents Of The University Of MichigansiRNAs and uses therof
US20040054156 *Jan 15, 2003Mar 18, 2004Kenneth DraperMethod and reagent for inhibiting hepatitis B viral replication
US20040072779 *Mar 6, 2003Apr 15, 2004Ribopharma AgMethod and medicament for inhibiting the expression of a given gene
US20040086884 *Jan 24, 2003May 6, 2004Genetica, Inc.Methods and compositions for RNA interference
US20040096843 *Feb 13, 2003May 20, 2004Rossi John J.Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20040102408 *Mar 6, 2003May 27, 2004Ribopharma AgMethod and medicament for inhibiting the expression of a given gene
US20040121348 *Mar 7, 2003Jun 24, 2004Ribopharma AgCompositions and methods for treating pancreatic cancer
US20040126791 *Sep 19, 2003Jul 1, 2004Ribopharma AgCompositions and methods for treating trail-resistant cancer cells
US20040137471 *Sep 18, 2003Jul 15, 2004Timothy VickersEfficient reduction of target RNA's by single-and double-stranded oligomeric compounds
US20040175703 *Mar 7, 2003Sep 9, 2004Ribopharma AgCompositions and methods for inhibiting expression of a target gene
US20040191905 *Nov 24, 2003Sep 30, 2004University Of MassachusettsModulation of HIV replication by RNA interference
US20040192626 *May 23, 2003Sep 30, 2004Mcswiggen JamesRNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040203145 *Aug 7, 2003Oct 14, 2004University Of MassachusettsCompositions for RNA interference and methods of use thereof
US20040214330 *Jan 13, 2004Oct 28, 2004Waterhouse Peter MichaelMethods and means for obtaining modified phenotypes
US20040221337 *Mar 22, 2004Nov 4, 2004Baulcombe David C.Gene silencing
US20040224328 *Jan 12, 2004Nov 11, 2004Hans PrydzsiRNA screening method
US20040229266 *Apr 27, 2004Nov 18, 2004Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US20040231016 *Feb 19, 2004Nov 18, 2004Commonwealth Scientific And Industrial Research OrganizationEfficient gene silencing in plants using short dsRNA sequences
US20040241854 *Dec 16, 2003Dec 2, 2004Davidson Beverly L.siRNA-mediated gene silencing
US20040248296 *Mar 20, 2003Dec 9, 2004Beresford Paul J.HIV therapeutic
US20040248835 *Oct 25, 2002Dec 9, 2004Anja KrebsUse of a double-stranded ribonucleic acid for treating an infection with a positivestrand rna-virus
US20040259248 *Apr 27, 2004Dec 23, 2004Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US20050026278 *Apr 27, 2004Feb 3, 2005Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US20050234006 *Jun 2, 2005Oct 20, 2005Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US20050234007 *Jun 2, 2005Oct 20, 2005Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US20050282765 *Apr 21, 2005Dec 22, 2005The Corporation Of The Trustees Of The Order Of The Sisters Of Mercy In QueenslandEnzyme having S-adenosyl-L-homocysteine hydrolase (AHCY) type activity
US20070003960 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070003961 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070003962 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070003963 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070093445 *Dec 6, 2006Apr 26, 2007Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E. V.RNA interference mediating small RNA molecules
US20080132461 *Jul 19, 2007Jun 5, 2008Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US7348314 *Mar 7, 2003Mar 25, 2008Alnylam Europe AgCompositions and methods for inhibiting viral replication
US7422853 *Oct 6, 2003Sep 9, 2008Myriad Genetics, Inc.RNA interference using a universal target
US7459547Jun 2, 2004Dec 2, 2008University Of MassachusettsMethods and compositions for controlling efficacy of RNA silencing
US7507809 *Jan 6, 2006Mar 24, 2009Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV and therapeutic uses thereof
US7511132 *Oct 16, 2007Mar 31, 2009Dharmacon, Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US7514550 *Sep 20, 2007Apr 7, 2009Dharmacon, Inc.siRNA targeting myeloid cell leukemia sequence 1
US7517865 *Apr 26, 2006Apr 14, 2009Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV and therapeutic uses thereof
US7521431 *Oct 31, 2003Apr 21, 2009The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of HIF-1 alpha
US7541344 *Jun 3, 2004Jun 2, 2009Eli Lilly And CompanyModulation of survivin expression
US7550572 *Apr 9, 2007Jun 23, 2009Dharmacon, Inc.siRNA targeting cell division cycle 20 homolog (CDC20)
US7576196Oct 14, 2008Aug 18, 2009Dharmacon, Inc.siRNA targeting transducin (beta)-like 3 (TBL3)
US7576197Dec 9, 2008Aug 18, 2009Dharmacon, Inc.SiRNA targeting KRAS
US7579451Jul 21, 2005Aug 25, 2009Alnylam Pharmaceuticals, Inc.Oligonucleotides comprising a modified or non-natural nucleobase
US7582746Oct 26, 2007Sep 1, 2009Dharmacon, Inc.siRNA targeting complement component 3 (C3)
US7589191Feb 2, 2009Sep 15, 2009Dharmacon, Inc.siRNA targeting hypoxia-inducible factor 1
US7592322Jun 14, 2005Sep 22, 2009Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV, PIV and other respiratory viruses and uses thereof
US7592324 *Feb 1, 2006Sep 22, 2009Alcon, Inc.RNAi-mediated inhibition of ocular targets
US7592442Jun 13, 2007Sep 22, 2009Dharmacon, Inc.siRNA targeting ribonucleotide reductase M2 polypeptide (RRM2 or RNR-R2)
US7592443Oct 30, 2007Sep 22, 2009Dharmacon, Inc.siRNA targeting interleukin-1 receptor-associated kinase 4 (IRAK4)
US7592444Feb 11, 2009Sep 22, 2009Dharmacon, Inc.siRNA targeting myeloid cell leukemia sequence 1
US7595389Jul 23, 2007Sep 29, 2009Dharmacon, Inc.siRNA targeting casitas B cell lymphoma-B (CBL-B)
US7598369Nov 9, 2006Oct 6, 2009Dharmacon, Inc.siRNA targeting histamine receptor H1
US7598370Jun 15, 2007Oct 6, 2009Dharmacon, Inc.siRNA targeting polo-like kinase-1 (PLK-1)
US7605249Oct 20, 2009Medtronic, Inc.Treatment of neurodegenerative disease through intracranial delivery of siRNA
US7605250Nov 9, 2006Oct 20, 2009Dharmacon, Inc.siRNA targeting cAMP-specific phosphodiesterase 4D
US7605252 *Oct 20, 2009Dharmacon, Inc.siRNA targeting kinase insert domain receptor (KDR)
US7608706 *Nov 8, 2006Oct 27, 2009Dharmacon, Inc.siRNA targeting ras-related nuclear protein
US7608707 *Dec 4, 2006Oct 27, 2009Dharmacon, Inc.siRNA targeting survivin
US7612196Oct 30, 2007Nov 3, 2009Dharmacon, Inc.siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US7615541Nov 3, 2006Nov 10, 2009Dharmacon, Inc.siRNA targeting TIE-2
US7615618Nov 10, 2009Alnylam Pharmaceuticals, Inc.Oligonucleotides comprising a non-phosphate backbone linkage
US7618948 *Oct 19, 2005Nov 17, 2009Medtronic, Inc.Devices, systems and methods for improving and/or cognitive function through brain delivery of siRNA
US7619081 *May 30, 2007Nov 17, 2009Dharmacon, Inc.siRNA targeting coatomer protein complex, subunit beta 2 (COPB2)
US7626014Dec 1, 2009Alnylam PharmaceuticalsSingle-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US7632932Aug 4, 2005Dec 15, 2009Alnylam Pharmaceuticals, Inc.Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US7632938Oct 29, 2007Dec 15, 2009Dharmacon, Inc.siRNA targeting superoxide dismutase 1 (SOD1)
US7632939Dec 15, 2009Dharmacon, Inc.siRNA targeting proto-oncogene MET
US7635770Jul 24, 2007Dec 22, 2009Dharmacon, Inc.siRNA targeting protein kinase N-3 (PKN-3)
US7635771Oct 29, 2007Dec 22, 2009Dharmacon, Inc.siRNA targeting amyloid beta (A4) precursor protein (APP)
US7642349Jan 5, 2010Dharmacon, Inc.siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US7645744Jan 26, 2009Jan 12, 2010The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of HIF-1 alpha
US7655634 *Mar 26, 2007Feb 2, 2010The Burnham InstituteUse of hepatitis B X-interacting protein (HBXIP) in modulation of apoptosis
US7655789Oct 26, 2007Feb 2, 2010Dharmacon, Inc.siRNA targeting transient receptor potential cation channel, subfamily V, member 1 (TRPV1)
US7662950 *Feb 16, 2010Dharmacon, Inc.siRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US7662951 *Feb 16, 2010Sirna Therapeutics, Inc.RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
US7662952 *Sep 2, 2008Feb 16, 2010Sirna Therapeutics, Inc.RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA)
US7666853Feb 23, 2010Dharmacon, Inc.siRNA targeting connective tissue growth factor (CTGF)
US7667029 *Feb 23, 2010Sirna Therapeutics, Inc.RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US7674778Apr 29, 2005Mar 9, 2010Alnylam PharmaceuticalsOligonucleotides comprising a conjugate group linked through a C5-modified pyrimidine
US7678896Jun 15, 2007Mar 16, 2010Dharmacon, Inc.siRNA targeting serine/threonine kinase 12 (STK12 or aurora B kinase)
US7691821May 28, 2004Apr 6, 2010University Of South FloridaInhibition of SHIP to enhance stem cell harvest and transplantation
US7691824Apr 27, 2007Apr 6, 2010Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the JC virus
US7691997Apr 6, 2010Dharmacon, Inc.Functional and hyperfunctional siRNA
US7691998Apr 6, 2010Dharmacon, Inc.siRNA targeting nucleoporin 62kDa (Nup62)
US7695902Apr 13, 2010Isis Pharmaceuticals, Inc.Oligoribonucleotides and ribonucleases for cleaving RNA
US7696344Dec 7, 2006Apr 13, 2010Dharmacon, Inc.siRNA targeting complement factor B
US7704688Mar 22, 2004Apr 27, 2010Plant Bioscience LimitedMethods of detecting silencing mammalian cells
US7704965 *Jun 26, 2003Apr 27, 2010The Penn State Research FoundationMethods and materials for treating human papillomavirus infections
US7709456Nov 13, 2006May 4, 2010Board Of Regents, The University Of Texas SystemModulation of gene expression by oligomers targeted to chromosomal DNA
US7709616May 16, 2005May 4, 2010Rosetta Genomics Inc.Micrornas and uses thereof
US7709629Oct 29, 2007May 4, 2010Dharmacon, Inc.siRNA targeting diacylglycerol O-acyltransferase homolog 2 (DGAT2)
US7713945 *Apr 13, 2007May 11, 2010University Of South FloridaControl of NK cell function and survival by modulation of SHIP activity
US7718631 *Apr 3, 2008May 18, 2010National Taiwan UniversityTreatment tool for cancer: RNA interference of BCAS2
US7723512Jul 1, 2009May 25, 2010Alnylam PharmaceuticalsOligonucleotides comprising a non-phosphate backbone linkage
US7732590 *Feb 24, 2005Jun 8, 2010Isis Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 2 expression
US7732591Aug 8, 2006Jun 8, 2010Medtronic, Inc.Compositions, devices and methods for treatment of huntington's disease through intracranial delivery of sirna
US7732593Jun 13, 2008Jun 8, 2010University Of MassachusettsMethods and compositions for controlling efficacy of RNA silencing
US7737267Aug 4, 2009Jun 15, 2010Dharmacon, Inc.siRNA targeting hypoxia-inducible factor 1
US7741470May 28, 2009Jun 22, 2010Dharmacon, Inc.siRNA targeting gremlin
US7745418Jun 29, 2010Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting viral replication
US7745610Jun 29, 2010Dharmacon, Inc.siRNA targeting cyclin dependent kinase 11 (CDK11)
US7745611Jul 6, 2009Jun 29, 2010Dharmacon, Inc.siRNA targeting KRAS
US7745612Jul 28, 2009Jun 29, 2010Dharmacon, Inc.siRNA targeting interleukin-1 receptor-associated kinase 4 (IRAK4)
US7745651Jun 7, 2005Jun 29, 2010Protiva Biotherapeutics, Inc.Cationic lipids and methods of use
US7750144Aug 4, 2004Jul 6, 2010University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNA silencing
US7754698 *Jul 13, 2010Isis Pharmaceuticals, Inc.Modulation of FR-alpha expression
US7763590 *Mar 7, 2003Jul 27, 2010Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a mutant gene
US7763592Jun 12, 2006Jul 27, 2010University Of South FloridaSHIP-deficiency to increase megakaryocyte progenitor production
US7772203Jul 14, 2008Aug 10, 2010University Of MassachusettsMethods and compositions for controlling efficacy of RNA silencing
US7772387Jul 1, 2009Aug 10, 2010Alnylam PharmaceuticalsOligonucleotides comprising a modified or non-natural nucleobase
US7781575Sep 18, 2009Aug 24, 2010Dharmacon, Inc.siRNA targeting tumor protein 53 (p53)
US7790878Jun 25, 2009Sep 7, 2010Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV, PIV and other respiratory viruses and uses thereof
US7795419Sep 14, 2010Rosetta Genomics Ltd.Viral and viral associated miRNAs and uses thereof
US7795420Oct 17, 2007Sep 14, 2010Dharmacon, Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US7795421Sep 14, 2010Dharmacon, Inc.siRNA targeting apolipoprotein B (APOB)
US7799565Jun 7, 2005Sep 21, 2010Protiva Biotherapeutics, Inc.Lipid encapsulated interfering RNA
US7803933Nov 12, 2009Sep 28, 2010Dharmacon, Inc.siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US7807646Nov 22, 2004Oct 5, 2010University Of South FloridaSHIP-deficiency to increase megakaryocyte progenitor production
US7807814 *Dec 23, 2004Oct 5, 2010The Trustees Of The University Of PennsylvaniaCompositions and methods for combined therapy of disease
US7807815Jun 30, 2005Oct 5, 2010Protiva Biotherapeutics, Inc.Compositions comprising immunostimulatory siRNA molecules and DLinDMA or DLenDMA
US7807819Sep 10, 2009Oct 5, 2010Dharmacon, Inc.siRNA targeting survivin
US7812149Oct 12, 2010Isis Pharmaceuticals, Inc.2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US7816338 *Oct 19, 2010Sumitomo Chemical Company, LimitedCompositions and methods for inhibiting car gene expression by RNA interference
US7816512Oct 19, 2010Dharmacon, Inc.siRNA targeting proto-oncogene MET
US7819842Nov 21, 2006Oct 26, 2010Medtronic, Inc.Chronically implantable guide tube for repeated intermittent delivery of materials or fluids to targeted tissue sites
US7820632 *Feb 13, 2003Oct 26, 2010City Of HopeMethods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US7820635Oct 26, 2010The University Of British ColumbiaRNAi probes targeting cancer-related proteins
US7820809Oct 26, 2010Dharmacon, Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US7825235Aug 18, 2003Nov 2, 2010Isis Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 2 expression
US7829547 *Sep 22, 2005Nov 9, 2010Shiseido Company, Ltd.Method and pharmaceutical composition for treating psoriasis, squamous cell carcinoma and/or parakeratosis by inhibiting expression of squamous cell carcinoma-related antigen
US7829694Nov 9, 2010Medtronic, Inc.Treatment of neurodegenerative disease through intracranial delivery of siRNA
US7829696Nov 4, 2009Nov 9, 2010Dharmacon, Inc.siRNA targeting amyloid beta (A4) precursor protein (APP)
US7833989Nov 16, 2010Dharmacon, Inc.siRNA targeting connective tissue growth factor (CTGF)
US7834170Nov 16, 2010Dharmacon, Inc.Functional and hyperfunctional siRNA
US7838503 *Nov 23, 2010Children's Medical Center CorporationMethods for extending the replicative lifespan of cells
US7838658 *Nov 23, 2010Ian MaclachlansiRNA silencing of filovirus gene expression
US7851452 *Mar 22, 2005Dec 14, 2010The Trustees Of The University Of PennsylvaniaMethods of use of bcl-6-derived nucleotides to induce apoptosis
US7855186Dec 21, 2010Dharmacon, Inc.siRNA targeting TIE-2
US7855284Dec 17, 2009Dec 21, 2010Sirna Therapeutics, Inc.RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US7858769 *Feb 9, 2005Dec 28, 2010Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
US7868158Jan 11, 2011Baylor College Of MedicineModulation of cytokine signaling regulators and applications for immunotherapy
US7868159 *Jan 11, 2011Baylor College Of MedicineModulation of negative immune regulators and applications for immunotherapy
US7872117 *Mar 28, 2005Jan 18, 2011Van Andel Research Institutec-met siRNA adenovirus vectors inhibit cancer cell growth, invasion and tumorigenicity
US7872118Sep 6, 2007Jan 18, 2011Opko Ophthalmics, LlcsiRNA and methods of manufacture
US7875711Jan 25, 2011Alnylam Pharamaceuticals, Inc.Compositions and methods for inhibiting expression of XBP-1 gene
US7884084 *Feb 8, 2011Aventis Pharma S.A.Oligonucleotides which inhibit expression of the OB-RGRP protein
US7884086 *Feb 8, 2011Isis Pharmaceuticals, Inc.Conjugates for use in hepatocyte free uptake assays
US7888010Feb 15, 2011Asuragen, Inc.Methods and compositions involving microRNA
US7888498 *May 21, 2007Feb 15, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of IKK-B gene
US7892793Feb 22, 2011University Of MassachusettsAllele-specific RNA interference
US7893224Jul 31, 2009Feb 22, 2011Alnylam Pharmaceuticals, Inc.Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US7893247Feb 22, 2011Dharmacon, Inc.siRNA targeting spleen tyrosine kinase
US7897754Sep 11, 2009Mar 1, 2011Dharmacon, Inc.SiRNA targeting ras-related nuclear protein RAN
US7897755 *Mar 1, 2011Sirna Therapeutics, Inc.RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US7897756 *Jan 26, 2010Mar 1, 2011Merck Sharp & Dohme Corp.RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA)
US7897757 *Mar 1, 2011Merck Sharp & Dohme Corp.RNA interference mediated inhibition of protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA)
US7902168Jun 18, 2009Mar 8, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of Nav1.8 gene
US7902169Mar 8, 2011Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US7902351 *Mar 8, 2011Somagenics Inc.Inhibition of viral gene expression using small interfering RNA
US7902352Aug 9, 2006Mar 8, 2011Medtronic, Inc.Isolated nucleic acid duplex for reducing huntington gene expression
US7910724 *Aug 4, 2008Mar 22, 2011Sirna Therapeutics, Inc.RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US7910725 *Jan 6, 2010Mar 22, 2011Sirna Therapeutics, Inc.RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
US7915399Jun 8, 2007Mar 29, 2011Protiva Biotherapeutics, Inc.Modified siRNA molecules and uses thereof
US7919245Aug 11, 2007Apr 5, 2011Asuragen, Inc.Methods and compositions involving microRNA
US7923206 *Nov 18, 2005Apr 12, 2011Dharmacon, Inc.Method of determining a cellular response to a biological agent
US7923547 *Apr 12, 2011Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7923549 *Apr 12, 2011Merck Sharp & Dohme Corp.RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
US7928083Jan 16, 2008Apr 19, 2011Yissum Research Development Company Of The Hebrew University Of JerusalemH19 silencing nucleic acid agents for treating rheumatoid arthritis
US7928218Apr 19, 2011Merck Sharp & Dohme Corp.RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US7935811Nov 18, 2005May 3, 2011Dharmacon, Inc.Apparatus and system having dry gene silencing compositions
US7935813May 3, 2011Dharmacon, Inc.siRNA target hypoxia-inducible factor 1
US7939508 *Apr 30, 2010May 10, 2011Novartis AgRNAi inhibition of alpha-ENaC expression
US7939652 *May 10, 2011Quark Pharmaceuticals Inc.Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US7943592 *May 17, 2011Novartis AgRNAi inhibition of alpha-ENaC expression
US7943755 *Oct 22, 2004May 17, 2011Neuregenix LimitedNeuron regeneration
US7947658Sep 13, 2004May 24, 2011University Of MassachusettsRNA interference for the treatment of gain-of-function disorders
US7947660 *May 24, 2011Alcon, Inc.RNAi-mediated inhibition of frizzled related protein-1 for treatment of glaucoma
US7951935Jun 16, 2009May 31, 2011Dharmacon, Inc.siRNA targeting v-myc myelocytomatosis viral oncogene homolog (MYC)
US7956176Jun 7, 2011Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7956177 *Mar 23, 2007Jun 7, 2011Alnylam Pharmaceuticals, Inc.dsRNA compositions and methods for treating HPV infection
US7956178 *Dec 17, 2009Jun 7, 2011Mcswiggen JamesRNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA)
US7960359Aug 10, 2007Jun 14, 2011Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US7964717 *Jun 21, 2011The University Of British ColumbiaRNAi probes targeting cancer-related proteins
US7968524 *May 15, 2008Jun 28, 2011Helicon Therapeutics, Inc.Methods of enhancing long term memory formation by inhibition of Gpr12
US7973020Jul 5, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the ebola virus
US7977321 *Feb 12, 2009Jul 12, 2011University Of Tennessee Research FoundationSmall interfering RNAs targeting feline herpes virus
US7977471Sep 12, 2008Jul 12, 2011Dharmacon, Inc.siRNA targeting TNFα
US7981869Jul 19, 2011Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV and therapeutic uses thereof
US7982027 *Jul 19, 2011Protiva Biotherapeutics, Inc.Lipid encapsulated interfering RNA
US7985854Aug 10, 2010Jul 26, 2011Dharmacon, Inc.siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US7988668Nov 21, 2006Aug 2, 2011Medtronic, Inc.Microsyringe for pre-packaged delivery of pharmaceuticals
US7989612Aug 2, 2011Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7994305 *Apr 19, 2004Aug 9, 2011The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of angiopoietin 1 and 2 and their receptor Tie2
US7994307Jul 27, 2009Aug 9, 2011Alnylam Pharmaceuticals, Inc.RNAi modulation of the BCR-ABL fusion gene and uses thereof
US7999097Aug 16, 2011Dharmacon, Inc.siRNA targeting beta secretase (BACE)
US8000902Jun 11, 2010Aug 16, 2011Dharmacon, Inc.Methods and compositions for selecting siRNA of improved functionality
US8003320Aug 23, 2011Asuragen, Inc.Methods and compositions involving MicroRNA
US8007781Aug 30, 2011The Johns Hopkins UniversityMolecular vaccine linking an endoplasmic reticulum chaperone polypeptide to an antigen
US8008273Aug 30, 2011University Of South FloridaSHIP-deficiency to increase megakaryocyte progenitor production
US8008474May 3, 2010Aug 30, 2011Dharmacon, Inc.siRNA targeting KRAS
US8013136Jul 1, 2009Sep 6, 2011Alnylam Pharmaceuticals, Inc.Oligonucleotides comprising a non-phosphate backbone linkage
US8013143 *Dec 12, 2008Sep 6, 2011Merck Sharp & Dohme Corp.RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA)
US8013145Sep 6, 2011Dharmacon, Inc.SiRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US8017765Dec 17, 2009Sep 13, 2011Merck Sharp & Dohme Corp.RNA interference mediated treatment of alzheimer's disease using short interfering nucleic acid (siNA)
US8022198Sep 20, 2011Dharmacon, Inc.siRNA targeting histamine receptor H1
US8022199Dec 8, 2009Sep 20, 2011Dharmacon, Inc.SiRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US8030284Aug 23, 2005Oct 4, 2011Sylentis S.A.U.Treatment of eye disorders characterized by an elevated intraocular pressure by siRNAs
US8030474Apr 8, 2009Oct 4, 2011Dharmacon, Inc.siRNA targeting cyclin-dependent kinase 4 (CDK4)
US8030476Oct 4, 2011Dharmacon, Inc.siRNA targeting gremlin
US8034793Feb 4, 2010Oct 11, 2011Alnylam Pharmaceuticals, Inc.RNAi modulation of MLL-AF4 and uses thereof
US8034921Nov 21, 2007Oct 11, 2011Alnylam Pharmaceuticals, Inc.IRNA agents targeting CCR5 expressing cells and uses thereof
US8039610Oct 18, 2011Dharmacon, Inc.siRNA targeting superoxide dismutase 1 (SOD1)
US8058069Nov 15, 2011Protiva Biotherapeutics, Inc.Lipid formulations for nucleic acid delivery
US8058250Nov 15, 2011Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8058251Oct 31, 2007Nov 15, 2011Kaemmerer William FDevices, systems and methods for improving memory and/or cognitive function through brain delivery of siRNA
US8058252 *Dec 28, 2006Nov 15, 2011Institut Gustave RoussyUse of inhibitors of scinderin and/or ephrin-A1 for treating tumors
US8058255Jun 15, 2009Nov 15, 2011Applied Biosystems, LlcMethods and compositions concerning siRNA's as mediators of RNA interference
US8058257Mar 9, 2010Nov 15, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the JC virus
US8058448Jan 9, 2009Nov 15, 2011Alnylam Pharmaceuticals, Inc.Processes and reagents for sulfurization of oligonucleotides
US8063198Nov 22, 2011Alnylam Pharmaceuticals, Inc.Processes and reagents for desilylation of oligonucleotides
US8067573 *Jul 6, 2006Nov 29, 2011Yissum Research Development Company Of The Hebrew University Of JerusalemNucleic acid agents for downregulating H19 and methods of using same
US8067574Nov 29, 2011Yissum Research Development Company Of The Hebrew University Of JerusalemNucleic acid agents for downregulating H19, and methods of using same
US8067576Nov 29, 2011Dharmacon, Inc.siRNA targeting serine/threonine kinase 12 (STK12 or aurora B kinase)
US8071562Dec 6, 2011Mirna Therapeutics, Inc.MiR-124 regulated genes and pathways as targets for therapeutic intervention
US8071754Jul 12, 2010Dec 6, 2011Dharmacon, Inc.siRNA targeting apolipoprotein B (APOB)
US8076071Sep 14, 2010Dec 13, 2011City Of HopeMethods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US8076306 *Apr 12, 2007Dec 13, 2011Isis Pharmaceuticals, Inc.Compositions and their uses directed to hepcidin
US8076308 *Nov 3, 2006Dec 13, 2011British Columbia Cancer AgencyInhibition of autophagy genes in cancer chemotherapy
US8080532Apr 2, 2009Dec 20, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of Huntingtin gene
US8080652 *Dec 2, 2009Dec 20, 2011University Of Southern CaliforniaGene silencing using mRNA-cDNA hybrids
US8084599Dec 27, 2011City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8084600May 2, 2007Dec 27, 2011Novartis AgShort interfering ribonucleic acid (siRNA) with improved pharmacological properties
US8090542Jan 3, 2012Dharmacon Inc.Functional and hyperfunctional siRNA
US8093370Dec 6, 2010Jan 10, 2012Dharmacon, Inc.siRNA targeting spleen tyrosine kinase
US8097710Jan 17, 2012Plant Bioscience LimitedGene silencing
US8097712Aug 20, 2008Jan 17, 2012Beelogics Inc.Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US8097716Dec 18, 2008Jan 17, 2012Novartis AgInterfering RNA duplex having blunt-ends and 3′-modifications
US8101741 *Jan 24, 2012Protiva Biotherapeutics, Inc.Modified siRNA molecules and uses thereof
US8106022Jan 31, 2012Alnylam Pharmaceuticals, Inc.Carbohydrate conjugates as delivery agents for oligonucleotides
US8106181Feb 22, 2010Jan 31, 2012City Of HopeMethods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US8114853Sep 25, 2009Feb 14, 2012The J. David Gladstone InstitutesMethods of treating smooth muscle cell disorders
US8114984Sep 7, 2010Feb 14, 2012Alnylam Pharmaceuticals, Inc.RNAi modulation of Aha and therapeutic uses thereof
US8119611Aug 27, 2009Feb 21, 2012Medtronic, Inc.Treatment of neurodegenerative disease through intracranial delivery of SIRNA
US8119612 *Apr 30, 2010Feb 21, 2012Novartis AgRNAi inhibition of alpha-ENaC expression
US8124752Jul 9, 2007Feb 28, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the MYC gene
US8128922Apr 4, 2002Mar 6, 2012Johns Hopkins UniversitySuperior molecular vaccine linking the translocation domain of a bacterial toxin to an antigen
US8137910May 5, 2003Mar 20, 2012Duke UniversityMethod of regulating gene expression
US8138329Oct 1, 2010Mar 20, 2012Dharmacon, Inc.siRNA targeting connective tissue growth factor (CTGF)
US8143228 *Jul 12, 2005Mar 27, 2012Medical Research Fund Of Tel Aviv Sourasky Medical CenterAgents capable of downregulating an MSF-A dependent HIF-1α and use thereof in cancer treatment
US8148344Mar 26, 2009Apr 3, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for mediating RNAi in vivo
US8158773Apr 17, 2012Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV and therapeutic uses thereof
US8163710Jan 4, 2010Apr 24, 2012University Of South FloridaReduction of graft-versus-host disease by modulation of SHIP activity
US8163711Apr 9, 2010Apr 24, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the HAMP gene
US8168606 *Apr 30, 2010May 1, 2012Novartis AgRNAi inhibition of alpha-ENaC expression
US8168775Oct 20, 2009May 1, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of transthyretin
US8173611Nov 14, 2005May 8, 2012Asuragen Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8173617May 8, 2012Novartis AgRNAi-mediated inhibition of frizzled related protein-1 for treatment of glaucoma
US8188057Oct 25, 2006May 29, 2012Sylentis S.A.U.Modulation of 11beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases
US8188061Mar 19, 2010May 29, 2012Alnylam Pharmaceuticals, Inc.RNAi modulation of APOB and uses thereof
US8188263May 29, 2012Protiva Biotherapeutics, Inc.Modified siRNA molecules and uses thereof
US8198250 *Jul 9, 2008Jun 12, 2012Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8198258Jun 12, 2012Quark Pharmaceuticals Inc.Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US8198427Jun 12, 2012Dharmacon, Inc.SiRNA targeting catenin, beta-1 (CTNNB1)
US8202845Apr 16, 2003Jun 19, 2012Acuity Pharmaceuticals, Inc.Means and methods for the specific modulation of target genes in the CNS and the eye and methods for their identification
US8202979Jun 19, 2012Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US8217162Apr 30, 2010Jul 10, 2012Dharmacon, Inc.siRNA targeting interleukin-1 receptor-associated kinase 4(IRAK4)
US8222221Jul 17, 2012The Board Of Regents Of The University Of Texas SystemModulation of gene expression through endogenous small RNA targeting of gene promoters
US8222222Jul 17, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the PCSK9 gene
US8222395Jul 17, 2012Dharmacon, Inc.siRNA targeting kinase insert domain receptor (KDR)
US8222396Sep 8, 2010Jul 17, 2012Dharmacon, Inc.SiRNA targeting proto-oncogene MET
US8232383Jul 31, 2012Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US8232385Jul 5, 2011Jul 31, 2012Dharmacon, Inc.siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US8232386Oct 27, 2011Jul 31, 2012Dharmacon, Inc.SiRNA targeting apolipoprotein B (APOB)
US8236775Dec 3, 2009Aug 7, 2012The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of HIF-1 α
US8236942Apr 13, 2010Aug 7, 2012Dharmacon, Inc.SiRNA targeting glucagon receptor (GCGR)
US8242256 *Dec 17, 2009Aug 14, 2012Senesco Technologies, Inc.siRNA useful to supress expression of EIF-5A1
US8247169Aug 21, 2012Dharmacon, Inc.SiRNA targeting diacylglycerol O-acyltransferase homolog 2 (DGAT2)
US8247386 *Aug 21, 2012Sylentis SauMethods and compositions for the treatment of eye disorders with increased intraocular pressure
US8247387 *Aug 21, 2012Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8252758 *Jul 9, 2008Aug 28, 2012Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8252759 *Aug 28, 2012Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8252762 *Aug 25, 2009Aug 28, 2012Excaliard Pharmaceuticals, Inc.Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
US8252918 *Aug 21, 2003Aug 28, 2012The University Of British ColumbiaRNAi probes targeting cancer-related proteins
US8258110 *Sep 4, 2012Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8258111May 8, 2009Sep 4, 2012The Johns Hopkins UniversityCompositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8258112Sep 4, 2012Medtronic, IncMethods and sequences to suppress primate huntington gene Expression
US8258285Sep 4, 2012Plant Bioscience LimitedRNA molecules and vectors for gene silencing
US8258289Sep 4, 2012Isis Pharmaceuticals, IncModulation of diacylglycerol acyltransferase 2 expression
US8263569May 30, 2008Sep 11, 2012Plant Biosciences LimitedGene silencing
US8263572Sep 11, 2012Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV and therapeutic uses thereof
US8268799Sep 18, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the HAMP gene
US8273869Sep 25, 2012Alnylam Pharmaceuticals, Inc.Lipid formulated dsRNA targeting the PCSK9 gene
US8283333Jun 30, 2010Oct 9, 2012Protiva Biotherapeutics, Inc.Lipid formulations for nucleic acid delivery
US8283460Oct 14, 2009Oct 9, 2012Somagenics, Inc.Short hairpin RNAs for inhibition of gene expression
US8288354 *Dec 28, 2006Oct 16, 2012The Scripps Research InstituteNatural antisense and non-coding RNA transcripts as drug targets
US8288525Feb 12, 2009Oct 16, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of CD45 gene
US8293719Oct 23, 2012Alnylam Pharmaceuticals, Inc.iRNA agents targeting VEGF
US8293887Jul 1, 2011Oct 23, 2012Dharmacon, Inc.SiRNA targeting beta secretase (BACE)
US8299040 *Oct 30, 2012Board Of Regents, The University Of Texas SystemMethods for treating cancer targeting transglutaminase
US8299044Oct 30, 2012Genecare Research Institute Co., Ltd.Apoptosis inducer for cancer cell
US8299235Oct 30, 2012Plant Bioscience LimitedRNA molecules and vectors for gene silencing
US8304528Nov 6, 2012Dharmacon, Inc.SiRNA targeting fructose-1, 6-bisphosphatase 1 (FBP1)
US8304530Nov 6, 2012University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNA silencing
US8309533Nov 13, 2012University Of MassachusettsAllele-specific RNA interference
US8309704Nov 13, 2012University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNAi
US8309705Nov 13, 2012University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNA silencing
US8314075Oct 4, 2011Nov 20, 2012Alynylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of huntingtin gene
US8314229Nov 8, 2010Nov 20, 2012Dharmacon, Inc.siRNA targeting tie-2
US8324181Mar 30, 2010Dec 4, 2012Board Of Regents, The University Of Texas SystemModulation of gene expression by oligomers targeted to chromosomal DNA
US8324366Apr 29, 2009Dec 4, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for delivering RNAI using lipoproteins
US8324367Dec 4, 2012Medtronic, Inc.Compositions and methods for making therapies delivered by viral vectors reversible for safety and allele-specificity
US8324368Dec 4, 2012Alnylam Pharmaceuticals, Inc.GNAQ targeted dsRNA compositions and methods for inhibiting expression
US8324369Nov 26, 2008Dec 4, 2012Baylor College Of MedicineDendritic cell vaccine compositions and uses of same
US8329463Jul 19, 2010Dec 11, 2012MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8329892Dec 11, 2012University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNA silencing
US8334273Dec 16, 2010Dec 18, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor VII gene
US8344126Dec 16, 2010Jan 1, 2013Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of XBP-1 gene
US8344128Jan 1, 2013Novartis AgShort interfering ribonucleic acid (siRNA) for oral administration
US8349607Jul 23, 2009Jan 8, 2013Plant Bioscience LimitedGene silencing
US8354385Oct 20, 2006Jan 15, 2013Sylentis S.A.U.Modulation of TRPV expression levels
US8354390Jan 15, 2013Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the ebola virus
US8361714Sep 12, 2008Jan 29, 2013Asuragen, Inc.Micrornas differentially expressed in cervical cancer and uses thereof
US8362231Jan 6, 2010Jan 29, 2013Max-Planck-Gesellschaft zur Föderung der Wissenschaften E.V.RNA interference mediating small RNA molecules
US8372968Aug 7, 2009Feb 12, 2013MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8372969Feb 12, 2013University Of Southern CaliforniaRNA interference methods using DNA-RNA duplex constructs
US8377902 *Jan 6, 2011Feb 19, 2013National Cheng Kung UniversityRNAi compound targeted to thrombospondin-1 and applications thereof
US8389490Sep 2, 2010Mar 5, 2013Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8389711 *Dec 14, 2009Mar 5, 2013Kureha CorporationPharmaceutical composition for treatment of cancer and asthma
US8394628Oct 4, 2010Mar 12, 2013University Of MassachusettsRNA sequence-specific mediators of RNA interference
US8394947Mar 3, 2004Mar 12, 2013Isis Pharmaceuticals, Inc.Positionally modified siRNA constructs
US8404831Mar 26, 2013Novartis AgShort interfering ribonucleic acid (siRNA) for oral administration
US8404832Aug 26, 2011Mar 26, 2013Novartis AgShort interfering ribonucleic acid (siRNA) for oral administration
US8409796Jan 23, 2012Apr 2, 2013Duke UniversityMethod of regulating gene expression
US8410073Jan 26, 2012Apr 2, 2013Alnylam Pharmaceuticals, Inc.Methods and compositions for prevention or treatment of RSV infection
US8410261Apr 2, 2013Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the JC virus
US8415319Apr 9, 2013Medtronic, Inc.Devices, systems and methods for improving memory and/or cognitive function through brain delivery of siRNA
US8420391Oct 4, 2010Apr 16, 2013University Of MassachusettsRNA sequence-specific mediators of RNA interference
US8426380Mar 2, 2011Apr 23, 2013Somagenics, Inc.Inhibition of viral gene expression using small interfering RNA
US8426579 *Apr 23, 2013Dharmacon, Inc.SiRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US8431692Jun 7, 2009Apr 30, 2013Quark Pharmaceuticals, Inc.Compositions and methods for treatment of ear disorders
US8431693Feb 28, 2011Apr 30, 2013Alnylam Pharmaceuticals, Inc.Process for desilylation of oligonucleotides
US8444983Mar 23, 2010May 21, 2013Quark Pharmaceuticals, Inc.Composition of anti-ENDO180 antibodies and methods of use for the treatment of cancer and fibrotic diseases
US8445237Jul 12, 2010May 21, 2013MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8450467May 28, 2013Alnylam Pharmaceuticals, Inc.Carbohydrate conjugates as delivery agents for oligonucleotides
US8455455Mar 31, 2011Jun 4, 2013Protiva Biotherapeutics, Inc.Compositions and methods for silencing genes involved in hemorrhagic fever
US8455633Jun 4, 2013Rosetta Genomics Ltd.Viral and viral associated mirnas and uses thereof
US8461326Jun 11, 2013Dharmacon, Inc.SiRNA targeting connective tissue growth factor (CTGF)
US8465914Jun 18, 2013Asuragen, Inc.Method and compositions involving microRNA
US8470792Dec 4, 2009Jun 25, 2013Opko Pharmaceuticals, Llc.Compositions and methods for selective inhibition of VEGF
US8470799Aug 21, 2012Jun 25, 2013Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the HAMP gene
US8470988Oct 23, 2009Jun 25, 2013Alnylam Pharmaceuticals, Inc.Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US8492359Oct 5, 2011Jul 23, 2013Protiva Biotherapeutics, Inc.Lipid formulations for nucleic acid delivery
US8501929 *Aug 18, 2008Aug 6, 2013Biochrom Pharma Inc.PTHrP, its isoforms and antagonist thereto in the diagnosis and treatment of disease
US8507455Dec 4, 2008Aug 13, 2013Alnylam Pharmaceuticals, Inc.Folate conjugates
US8507457Dec 21, 2011Aug 13, 2013Beeologics Inc.Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US8513403Apr 26, 2012Aug 20, 2013Protiva Biotherapeutics, Inc.Modified siRNA molecules and uses thereof
US8524680 *Aug 31, 2009Sep 3, 2013Applied Biosystems, LlcHigh potency siRNAS for reducing the expression of target genes
US8541384Jun 8, 2006Sep 24, 2013The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of angiogenesis
US8546345Jun 8, 2006Oct 1, 2013The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of angiogenesis
US8546554Sep 25, 2009Oct 1, 2013Alnylam Pharmaceuticals, Inc.Lipid formulated compositions and methods for inhibiting expression of Serum Amyloid A gene
US8552171 *Oct 4, 2010Oct 8, 2013University Of MassachusettsRNA sequence-specific mediators of RNA interference
US8568971Sep 24, 2010Oct 29, 2013Asuragen, Inc.Methods and compositions involving microRNA
US8569256Jun 30, 2010Oct 29, 2013Protiva Biotherapeutics, Inc.Cationic lipids and methods for the delivery of therapeutic agents
US8569374Sep 15, 2005Oct 29, 2013The Trustees Of The University Of PennsylvaniaNADPH oxidase inhibition pharmacotherapies for obstructive sleep apnea syndrome and its associated morbidities
US8569474Mar 4, 2005Oct 29, 2013Isis Pharmaceuticals, Inc.Double stranded constructs comprising one or more short strands hybridized to a longer strand
US8592570Oct 6, 2009Nov 26, 2013Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of an RNA from West Nile virus
US8592571Apr 19, 2012Nov 26, 2013Alnylam Pharmaceuticals, Inc.RNAi modulation of APOB and uses thereof
US8598134 *Jul 23, 2010Dec 3, 2013South Alabama Medical Science FoundationRNAi modulation of RSV, PIV and other respiratory viruses and uses thereof
US8598139Aug 7, 2012Dec 3, 2013Alnylam Pharmaceuticals, Inc.Lipid formulated dsRNA targeting the PCSK9 gene
US8598143 *Nov 19, 2008Dec 3, 2013University Of MassachusettsSequence-specific inhibition of small RNA function
US8598333May 29, 2007Dec 3, 2013Alnylam Pharmaceuticals, Inc.SiRNA silencing of genes expressed in cancer
US8604183Nov 4, 2003Dec 10, 2013Isis Pharmaceuticals, Inc.Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US8609830 *May 17, 2004Dec 17, 2013Merck Sharp & Dohme Corp.Methods and compositions for RNA interference
US8618069Oct 8, 2009Dec 31, 2013Medtronic, Inc.Devices, systems and methods for improving memory and/or cognitive function through brain delivery of siRNA
US8618277May 25, 2012Dec 31, 2013Merck Sharp & Dohme Corp.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US8632997Oct 4, 2010Jan 21, 2014University Of MassachusettsRNA sequence-specific mediators of RNA interference
US8633306Aug 10, 2011Jan 21, 2014Thermo Fisher Scientific Biosciences Inc.SiRNA targeting histamine receptor H1
US8648185May 15, 2012Feb 11, 2014Merck Sharp & Dohme Corp.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US8658356Jun 3, 2011Feb 25, 2014City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8658782Jan 20, 2011Feb 25, 2014Alynylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor V
US8664188 *Dec 11, 2009Mar 4, 2014Xiangxue Group (Hong Kong) Company LimitedsiRNA compositions and methods for potently inhibiting viral infection
US8664189Sep 22, 2009Mar 4, 2014Rxi Pharmaceuticals CorporationRNA interference in skin indications
US8664193Sep 14, 2012Mar 4, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor VII gene
US8680063Dec 13, 2010Mar 25, 2014University Of MassachusettsRNA interference for the treatment of gain-of-function disorders
US8685946Nov 26, 2004Apr 1, 2014Universiy of MassachusettsSequence-specific inhibition of small RNA function
US8691786Jan 24, 2013Apr 8, 2014City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8703930May 22, 2013Apr 22, 2014Genecare Research Institute Co., Ltd.Cancer cell-specific apoptosis-inducing agents that target chromosome stabilization-associated genes
US8716464Jul 20, 2010May 6, 2014Thomas W. GeisbertCompositions and methods for silencing Ebola virus gene expression
US8722641Jan 28, 2011May 13, 2014St. Jude Children's Research HospitalOligonucleotides which inhibit p53 induction in response to cellular stress
US8729036Aug 7, 2003May 20, 2014University Of MassachusettsCompositions for RNA interference and methods of use thereof
US8729042 *Oct 25, 2011May 20, 2014Allergan, Inc.Treating ocular diseases using peroxisome proliferator—activated receptor delta antagonists
US8735369Sep 26, 2012May 27, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the Ebola virus
US8741866Mar 1, 2012Jun 3, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of transthyretin
US8742092Oct 4, 2010Jun 3, 2014University Of MassachusettsRNA sequence-specific mediators of RNA interference
US8759102Dec 17, 2004Jun 24, 2014Plant Bioscience LimitedShort RNA producing gene silencing in cells
US8759308Jul 28, 2010Jun 24, 2014The University Of British ColumbiaRNAi probes targeting cancer-related proteins
US8765709Aug 28, 2013Jul 1, 2014Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8765930Jun 4, 2010Jul 1, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8765932Sep 14, 2012Jul 1, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of XBP-1 gene
US8772260Aug 13, 2012Jul 8, 2014Isis Pharmaceuticals, IncMethods for inhibiting expression of connective tissue growth factor
US8772469 *Jul 11, 2002Jul 8, 2014Sanofi-Aventis Deutschland GmbhSynthetic double-stranded oligonucleotides for specific inhibition of gene expression
US8778902Jul 13, 2010Jul 15, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8779115Aug 22, 2012Jul 15, 2014Somagenics Inc.Short hairpin RNAs for inhibition of gene expression
US8779236Jul 23, 2009Jul 15, 2014Plant Bioscience LimitedGene silencing
US8785373Feb 6, 2012Jul 22, 2014The Medical Research, Infrastructure and Health Services Fund of the Tel Aviv Medical CenterAgents capable of downregulating an MSF-A-dependent HIF-1alpha and use thereof in cancer treatment
US8790922Oct 4, 2010Jul 29, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA sequence-specific mediators of RNA interference
US8791250May 23, 2013Jul 29, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the HAMP gene
US8796016Jun 21, 2010Aug 5, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8796235Feb 23, 2004Aug 5, 2014University Of South FloridaMethods for attenuating dengue virus infection
US8796443Sep 22, 2009Aug 5, 2014Rxi Pharmaceuticals CorporationReduced size self-delivering RNAi compounds
US8796444Jul 6, 2011Aug 5, 2014City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8802639 *Mar 24, 2005Aug 12, 2014Curis, Inc.RNA interference modulators of hedgehog signaling and uses thereof
US8809287 *Nov 15, 2005Aug 19, 2014Icahn School Of Medicine At Mount SinaiCompositions and methods for altering Wnt autocrine signaling
US8809292May 15, 2012Aug 19, 2014Alnylam Pharmaceuticals, IncCompositions and methods for inhibiting expression of the PCSK9 gene
US8809296Sep 27, 2012Aug 19, 2014Genecare Research Institute Co., Ltd.Apoptosis inducer for cancer cell
US8809515Jul 8, 2011Aug 19, 2014City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8815586Apr 23, 2010Aug 26, 2014The Board Of Regents Of The University Of Texas SystemModulation of gene expression using oligomers that target gene regions downstream of 3′ untranslated regions
US8815818Jul 17, 2009Aug 26, 2014Rxi Pharmaceuticals CorporationPhagocytic cell delivery of RNAI
US8815821Oct 20, 2011Aug 26, 2014Life Technologies CorporationDouble-stranded oligonucleotides
US8822426May 5, 2010Sep 2, 2014Beeologics Inc.Prevention and treatment of nosema disease in bees
US8822668Jun 26, 2013Sep 2, 2014Protiva Biotherapeutics, Inc.Lipid formulations for nucleic acid delivery
US8828956Dec 4, 2012Sep 9, 2014Alnylam Pharmaceuticals, Inc.Carbohydrate conjugates as delivery agents for oligonucleotides
US8846894Feb 16, 2007Sep 30, 2014Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US8853384Dec 2, 2009Oct 7, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8859516Sep 10, 2010Oct 14, 2014Alnylam Pharmaceuticals, Inc.Lipid formulated compositions and methods for inhibiting expression of Eg5 and VEGF genes
US8859750Mar 29, 2012Oct 14, 2014Alnylam Pharmaceuticals, Inc.RNAi modulation of RSV and therapeutic uses thereof
US8865884 *May 30, 2013Oct 21, 2014Isis Pharmaceuticals, Inc.Antisense modulation of kinesin-like 1 expression
US8871730Jul 13, 2010Oct 28, 2014Somagenics Inc.Chemical modification of short small hairpin RNAs for inhibition of gene expression
US8877917 *Apr 23, 2008Nov 4, 2014Alnylam Pharmaceuticals, Inc.Glycoconjugates of RNA interference agents
US8883996Jun 8, 2012Nov 11, 2014City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US8883997Aug 3, 2012Nov 11, 2014Isis Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 2 expression
US8883998 *Mar 20, 2013Nov 11, 2014Thermo Fisher Scientific Inc.siRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US8889644Sep 13, 2012Nov 18, 2014Alnylam Pharmaceuticals, Inc.GNAQ targeted dsRNA compositions and methods for inhibiting expression
US8895718Oct 4, 2010Nov 25, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8895721Dec 21, 2012Nov 25, 2014MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8912316Sep 12, 2012Dec 16, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of CD45 gene
US8916693Sep 16, 2010Dec 23, 2014Nektar TherapeuticsMonoconjugated chitosans as delivery agents for small interfering nucleic acids
US8927519Jan 27, 2014Jan 6, 2015City Of HopeMethods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US8933043 *Sep 28, 2006Jan 13, 2015St. Jude Children's Research HospitalMethods for regulation of p53 translation and function
US8933044Jan 6, 2010Jan 13, 2015MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8933049 *Feb 20, 2013Jan 13, 2015Medical Diagnostic Laboratories, LlcRepressor on IFN-λ promoter and siRNA against ZEB1 and BLIMP-1 to increase IFN-λ gene activity
US8946177Nov 17, 2011Feb 3, 2015Mima Therapeutics, IncMethods and compositions involving miRNA and miRNA inhibitor molecules
US8946180Jun 11, 2012Feb 3, 2015Opko Pharmaceuticals, LlcMeans and methods for the specific modulation of target genes in the CNS and the eye and methods for their identification
US8946403Sep 30, 2013Feb 3, 2015The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of angiogenesis
US8951982Jan 18, 2013Feb 10, 2015Sylentis S.A.U.Methods and compositions for the treatment of eye disorders with increased intraocular pressure
US8957041Oct 15, 2012Feb 17, 2015Novartis AgShort interfering ribonucleic acid (siRNA) for oral administration
US8957198Feb 16, 2011Feb 17, 2015Medtronic, Inc.Compositions, devices and methods for treatment of Huntington's disease through intracranial delivery of sirna
US8962584Apr 13, 2012Feb 24, 2015Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd.Compositions for controlling Varroa mites in bees
US8993745Sep 10, 2010Mar 31, 2015MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA interference mediating small RNA molecules
US8999943 *Mar 14, 2006Apr 7, 2015Board Of Regents, The University Of Texas SystemAntigene oligomers inhibit transcription
US9000143 *Dec 30, 2010Apr 7, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of IKK-B gene
US9006197Apr 9, 2012Apr 14, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of Eg5 and VEGF genes
US9006417Jun 30, 2011Apr 14, 2015Protiva Biotherapeutics, Inc.Non-liposomal systems for nucleic acid delivery
US9011866 *Jul 3, 2007Apr 21, 2015The Johns Hopkins UniversityRNA interference that blocks expression of pro-apoptotic proteins potentiates immunity induced by DNA and transfected dendritic cell vaccines
US9012138Mar 9, 2011Apr 21, 2015MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA sequence-specific mediators of RNA interference
US9012621Jan 18, 2011Apr 21, 2015MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V.RNA sequence-specific mediators of RNA interference
US9012624Feb 27, 2013Apr 21, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the JC virus
US9018179Feb 9, 2009Apr 28, 2015The Board Of Trustees Of The Leland Stanford Junior UniversityMethods and compositions for RNAi mediated inhibition of gene expression in mammals
US9018180 *Jul 10, 2008Apr 28, 2015Neurim Pharmaceuticals (1991) Ltd.CD44 splice variants in neurodegenerative diseases
US9018187Oct 1, 2013Apr 28, 2015Protiva Biotherapeutics, Inc.Cationic lipids and methods for the delivery of therapeutic agents
US9023820Jan 26, 2010May 5, 2015Protiva Biotherapeutics, Inc.Compositions and methods for silencing apolipoprotein C-III expression
US9029338Aug 13, 2010May 12, 2015Alnylam Pharmaceuticals, Inc.Lipid formulated compositions and methods for inhibiting expression of a gene from the ebola virus
US9029525Sep 13, 2012May 12, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of GSK-3 genes
US9040494Mar 26, 2012May 26, 2015Novartis AgRNAi-mediated inhibition of frizzled related protein-1 for treatment of glaucoma
US9051567Jun 15, 2010Jun 9, 2015Tekmira Pharmaceuticals CorporationMethods for increasing efficacy of lipid formulated siRNA
US9051570Oct 16, 2012Jun 9, 2015Arcturus Therapeutics, Inc.UNA oligomers for therapeutics
US9057069Mar 12, 2013Jun 16, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of Eg5 gene
US9062310Jan 15, 2014Jun 23, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor VII gene
US9068184Jun 21, 2012Jun 30, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibition of expression of protein C (PROC) genes
US9074202 *May 21, 2007Jul 7, 2015Medical Research CouncilMethod of inhibiting human Trabid
US9074208Jul 26, 2013Jul 7, 2015Protiva Biotherapeutics, Inc.Modified siRNA molecules and uses thereof
US9074211Nov 19, 2009Jul 7, 2015Rxi Pharmaceuticals CorporationInhibition of MAP4K4 through RNAI
US9074212 *Jan 6, 2010Jul 7, 2015Arrowhead Research CorporationRNAi inhibition of alpha-ENaC expression
US9080171Mar 24, 2011Jul 14, 2015RXi Parmaceuticals CorporationReduced size self-delivering RNAi compounds
US9080215Jan 7, 2013Jul 14, 2015Asuragen, Inc.MicroRNAs differentially expressed in cervical cancer and uses thereof
US9085638Mar 6, 2008Jul 21, 2015The Johns Hopkins UniversityDNA vaccine enhancement with MHC class II activators
US9089590Feb 13, 2013Jul 28, 2015University Of South FloridaPolynucleotides for reducing respiratory syncytial virus gene expression
US9089591Apr 22, 2013Jul 28, 2015Quark Pharmaceuticals, Inc.Compositions and methods for treatment of ear disorders
US9089610Aug 19, 2009Jul 28, 2015Nektar TherapeuticsComplexes of small-interfering nucleic acids
US9090895Jun 13, 2014Jul 28, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the HAMP gene
US9095504Mar 24, 2011Aug 4, 2015Rxi Pharmaceuticals CorporationRNA interference in ocular indications
US9095561 *Sep 17, 2013Aug 4, 2015University Of South CarolinaMethods for affecting homology-directed DNA double stranded break repair
US9096636Nov 4, 2003Aug 4, 2015Isis Pharmaceuticals, Inc.Chimeric oligomeric compounds and their use in gene modulation
US9096851Jun 25, 2012Aug 4, 2015Excaliard Pharmaceuticals, Inc.Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
US9101643Nov 3, 2010Aug 11, 2015Alnylam Pharmaceuticals, Inc.Lipid formulated compositions and methods for inhibiting expression of transthyretin (TTR)
US9121018Oct 17, 2012Sep 1, 2015University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNA silencing
US9127277Feb 27, 2013Sep 8, 2015Alnylam Pharmaceuticals, Inc.Methods and compositions for prevention or treatment of RSV infection
US9133517Sep 15, 2009Sep 15, 2015Medtronics, Inc.Methods and sequences to preferentially suppress expression of mutated huntingtin
US9139554Oct 9, 2009Sep 22, 2015Tekmira Pharmaceuticals CorporationAmino lipids and methods for the delivery of nucleic acids
US9150863Dec 19, 2014Oct 6, 2015The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of angiogenesis
US9173894Feb 2, 2012Nov 3, 2015Excaliard Pharamaceuticals, Inc.Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (CTGF)
US9175289May 15, 2014Nov 3, 2015Rxi Pharmaceuticals CorporationReduced size self-delivering RNAi compounds
US9181545Aug 6, 2010Nov 10, 2015Protiva Biotherapeutics, Inc.Lipid encapsulating interfering RNA
US9181546Aug 2, 2011Nov 10, 2015Beth Israel Deaconess Medical CenterCompositions for bacterial mediated gene silencing and methods of using same
US9181551Oct 14, 2014Nov 10, 2015Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9181584Jan 6, 2015Nov 10, 2015City Of HopeMethods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US9186370 *Mar 18, 2011Nov 17, 2015University Of South AlabamaMethods and compositions for the treatment of cancer
US9187516May 15, 2014Nov 17, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of a gene from the Ebola virus
US9187746Sep 22, 2010Nov 17, 2015Alnylam Pharmaceuticals, Inc.Dual targeting siRNA agents
US9187747Oct 21, 2013Nov 17, 2015Alnylam Pharmaceuticals, Inc.RNAi modulation of ApoB and uses thereof
US9187748Mar 28, 2014Nov 17, 2015Protiva Biotherapeutics, Inc.Compositions and methods for silencing ebola virus gene expression
US9193753Mar 14, 2013Nov 24, 2015University Of MassachusettsRNA sequence-specific mediators of RNA interference
US9200275 *Jun 14, 2007Dec 1, 2015Merck Sharp & Dohme Corp.Methods and compositions for regulating cell cycle progression
US9200276Jun 1, 2010Dec 1, 2015Halo-Bio Rnai Therapeutics, Inc.Polynucleotides for multivalent RNA interference, compositions and methods of use thereof
US9200282 *Oct 22, 2013Dec 1, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of an RNA from west nile virus
US9206421Aug 28, 2013Dec 8, 2015Alnylam Pharmaceuticals, Inc.Lipid formulated compositions and methods for inhibiting expression of serum amyloid A gene
US9222086 *Sep 23, 2010Dec 29, 2015Protiva Biotherapeutics, Inc.Compositions and methods for silencing genes expressed in cancer
US9228186Dec 5, 2013Jan 5, 2016Thermo Fisher Scientific Inc.Methods and compositions for selecting siRNA of improved functionality
US9228188Jun 21, 2012Jan 5, 2016Alnylam Pharmaceuticals, Inc.Compositions and method for inhibiting hepcidin antimicrobial peptide (HAMP) or HAMP-related gene expression
US9233121 *Mar 12, 2012Jan 12, 2016Board Of Regents Of The University Of NebraskaCompositions and methods for the treatment of cancer
US9234196Mar 20, 2014Jan 12, 2016Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of transthyretin
US9260471Oct 25, 2011Feb 16, 2016Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9260715Jun 21, 2012Feb 16, 2016The University Of QueenslandMethod of inducing an immune response
US9260718Jul 14, 2014Feb 16, 2016Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the PCSK9 gene
US9267145Jan 9, 2013Feb 23, 2016Duke UniversityMethod of regulating gene expression
US9273356May 23, 2007Mar 1, 2016Medtronic, Inc.Methods and kits for linking polymorphic sequences to expanded repeat mutations
US9297009May 4, 2015Mar 29, 2016Arcturus Therapeutics, Inc.UNA oligomers targeting micro-RNA for therapeutics
US9303259Dec 12, 2013Apr 5, 2016Rxi Pharmaceuticals CorporationRNA interference in skin indications
US9303260May 4, 2015Apr 5, 2016Arcturus Therapeutics, Inc.UNA duplex oligomers for therapeutics
US9315813Jun 21, 2012Apr 19, 2016Alnylam Pharmaceuticals, IncCompositions and methods for inhibition of expression of apolipoprotein C-III (APOC3) genes
US9322018 *Dec 18, 2013Apr 26, 2016Alnylam Pharmaceuticals, Inc.Angiopoietin-like 3 (ANGPTL3) iRNA compositions and methods of use thereof
US9334497Dec 2, 2013May 10, 2016University Of MassachusettsSequence-specific inhibition of small RNA function
US9340786Mar 24, 2011May 17, 2016Rxi Pharmaceuticals CorporationRNA interference in dermal and fibrotic indications
US9352048Jul 22, 2014May 31, 2016Alnylam Pharmaceuticals, Inc.Carbohydrate conjugates as delivery agents for oligonucleotides
US9364435Aug 18, 2014Jun 14, 2016Protiva Biotherapeutics, Inc.Lipid formulations for nucleic acid delivery
US9365849Sep 6, 2013Jun 14, 2016Integrated Dna Technologies, Inc.Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US9365852May 5, 2015Jun 14, 2016Mirna Therapeutics, Inc.Compositions and methods related to miRNA modulation of neovascularization or angiogenesis
US20020086356 *Mar 30, 2001Jul 4, 2002Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20030108923 *Sep 26, 2002Jun 12, 2003Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20030139363 *Sep 27, 2002Jul 24, 2003Kay Mark A.Methods and compositions for RNAi mediated inhibition of viral gene expression in mammals
US20030139585 *Jul 11, 2002Jul 24, 2003Eugen UhlmannSynthetic double-stranded oligonucleotides for specific inhibition of gene expression
US20030153519 *Jul 19, 2002Aug 14, 2003Kay Mark A.Methods and compositions for RNAi mediated inhibition of gene expression in mammals
US20030157030 *Nov 4, 2002Aug 21, 2003Insert Therapeutics, Inc.Methods and compositions for therapeutic use of rna interference
US20040005593 *Mar 6, 2003Jan 8, 2004Rigel Pharmaceuticals, Inc.Novel method for delivery and intracellular synthesis of siRNA molecules
US20040014956 *Feb 3, 2003Jan 22, 2004Sequitur, Inc.Double-stranded oligonucleotides
US20040053411 *May 5, 2003Mar 18, 2004Duke UniversityMethod of regulating gene expression
US20040054155 *Oct 2, 2003Mar 18, 2004Sequitur, Inc.Oligonucleotide compositions with enhanced efficiency
US20040063654 *May 15, 2003Apr 1, 2004Davis Mark E.Methods and compositions for therapeutic use of RNA interference
US20040086845 *Apr 4, 2002May 6, 2004Tzyy-Choou WuSuperior molecular vaccine linking the translocation domain of a bacterial toxin to an antigen
US20040091457 *Mar 7, 2003May 13, 2004Ribopharma AgCompositions and methods for inhibiting viral replication
US20040096843 *Feb 13, 2003May 20, 2004Rossi John J.Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses for such molecules
US20040096882 *Aug 21, 2003May 20, 2004Martin GleaveRNAi probes targeting cancer-related proteins
US20040147027 *Jan 28, 2003Jul 29, 2004Troy Carol M.Complex for facilitating delivery of dsRNA into a cell and uses thereof
US20040180357 *Oct 31, 2003Sep 16, 2004The Trustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of HIF-1 alpha
US20040191905 *Nov 24, 2003Sep 30, 2004University Of MassachusettsModulation of HIV replication by RNA interference
US20040192626 *May 23, 2003Sep 30, 2004Mcswiggen JamesRNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20040203145 *Aug 7, 2003Oct 14, 2004University Of MassachusettsCompositions for RNA interference and methods of use thereof
US20040219671 *Oct 31, 2003Nov 4, 2004Sirna Therapeutics, Inc.RNA interference mediated treatment of parkinson disease using short interfering nucleic acid (siNA)
US20040221337 *Mar 22, 2004Nov 4, 2004Baulcombe David C.Gene silencing
US20040242518 *Sep 29, 2003Dec 2, 2004Massachusetts Institute Of TechnologyInfluenza therapeutic
US20040248174 *Apr 19, 2004Dec 9, 2004Thetrustees Of The University Of PennsylvaniaCompositions and methods for siRNA inhibition of angiopoietin 1and 2 and their receptor Tie2
US20040248296 *Mar 20, 2003Dec 9, 2004Beresford Paul J.HIV therapeutic
US20050004064 *May 21, 2004Jan 6, 2005Mitsubishi Chemical CorporationMethod of inhibiting gene expression
US20050009042 *Feb 9, 2004Jan 13, 2005Aventis Pharma S.A.Oligonucleotides which inhibit expression of the OB-RGRP protein and method for detecting compounds which modify the interaction between proteins of the OB-RGRP family and the leptin receptor
US20050019918 *Apr 29, 2004Jan 27, 2005Hidetoshi SumimotoTreatment of cancer by inhibiting BRAF expression
US20050037988 *Jun 2, 2004Feb 17, 2005University Of MassachusettsMethods and compositions for controlling efficacy of RNA silencing
US20050043524 *Aug 18, 2003Feb 24, 2005Isis Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 2 expression
US20050074757 *Mar 7, 2003Apr 7, 2005Ribopharma AgCompositions and methods for inhibiting expression of a mutant gene
US20050096289 *Aug 5, 2004May 5, 2005Hans PrydzMethods and compositions for modulating tissue factor
US20050102709 *Dec 17, 2004May 12, 2005Plant Bioscience LimitedRNA molecules and vectors for gene silencing
US20050102710 *Dec 17, 2004May 12, 2005Plant Bioscience LimitedCells and animals produced by gene silencing
US20050136430 *Jul 15, 2004Jun 23, 2005California Institute Of TechnologyInhibitor nucleic acids
US20050136437 *Aug 24, 2004Jun 23, 2005Nastech Pharmaceutical Company Inc.Nanoparticles for delivery of nucleic acids and stable double-stranded RNA
US20050142578 *Aug 19, 2004Jun 30, 2005Sirn Therapeutics, Inc.RNA interference mediated target discovery and target validation using short interfering nucleic acid (siNA)
US20050148526 *Jan 22, 2003Jul 7, 2005Kisielow Malgorzata A.Methods of obtaining isoform specific expression in mammalian cells
US20050159381 *Aug 20, 2004Jul 21, 2005Sirna Therapeutics, Inc.RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)
US20050164212 *Mar 4, 2004Jul 28, 2005Todd HauserModulation of gene expression using DNA-RNA hybrids
US20050176024 *Aug 20, 2004Aug 11, 2005Sirna Therapeutics, Inc.RNA interference mediated inhibition of epidermal growth factor receptor (EGFR) gene expression using short interfering nucleic acid (siNA)
US20050176025 *Aug 20, 2004Aug 11, 2005Sirna Therapeutics, Inc.RNA interference mediated inhibition of B-cell CLL/Lymphoma-2 (BCL-2) gene expression using short interfering nucleic acid (siNA)
US20050181382 *Jun 2, 2004Aug 18, 2005University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of RNAi
US20050202075 *Mar 12, 2004Sep 15, 2005Pardridge William M.Delivery of genes encoding short hairpin RNA using receptor-specific nanocontainers
US20050208658 *Nov 19, 2004Sep 22, 2005The University Of MarylandRNA interference mediated inhibition of 11beta hydroxysteriod dehydrogenase-1 (11beta HSD-1) gene expression
US20050227256 *Nov 26, 2004Oct 13, 2005Gyorgy HutvagnerSequence-specific inhibition of small RNA function
US20050234000 *Dec 10, 2004Oct 20, 2005Mitchell Gordon SSiRNA delivery into mammalian nerve cells
US20050239731 *Aug 20, 2004Oct 27, 2005Sirna Therapeutics, Inc.RNA interference mediated inhibition of MAP kinase gene expression using short interfering nucleic acid (siNA)
US20050245475 *Mar 18, 2005Nov 3, 2005Dharmacon, Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20050246794 *Apr 7, 2005Nov 3, 2005Dharmacon Inc.Functional and hyperfunctional siRNA
US20050255487 *Sep 14, 2004Nov 17, 2005Dharmacon, Inc.Methods and compositions for selecting siRNA of improved functionality
US20050256071 *Jan 27, 2005Nov 17, 2005California Institute Of TechnologyInhibitor nucleic acids
US20050256076 *Mar 24, 2005Nov 17, 2005Curis, Inc.RNA interference modulators of hedgehog signaling and uses thereof
US20050260214 *May 11, 2005Nov 24, 2005Simon Michael RComposition and method for introduction of RNA interference sequences into targeted cells and tissues
US20050272680 *Feb 24, 2005Dec 8, 2005Sanjay BhanotModulation of diacylglycerol acyltransferase 2 expression
US20050272682 *Mar 22, 2005Dec 8, 2005Evers Bernard MSiRNA targeting PI3K signal transduction pathway and siRNA-based therapy
US20050273868 *Feb 17, 2005Dec 8, 2005University Of MassachusettsMethods and compositions for enhancing RISC activity in vitro and in vivo
US20050277610 *Mar 15, 2005Dec 15, 2005City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20060003915 *Apr 16, 2003Jan 5, 2006Karina DrummMeans and methods for the specific modulation of target genes in the cns and the eye and methods for their identification
US20060008907 *Jun 9, 2005Jan 12, 2006The Curators Of The University Of MissouriControl of gene expression via light activated RNA interference
US20060008910 *Jun 7, 2005Jan 12, 2006Protiva Biotherapeuties, Inc.Lipid encapsulated interfering RNA
US20060009409 *Feb 2, 2005Jan 12, 2006Woolf Tod MDouble-stranded oligonucleotides
US20060014289 *Apr 15, 2005Jan 19, 2006Nastech Pharmaceutical Company Inc.Methods and compositions for enhancing delivery of double-stranded RNA or a double-stranded hybrid nucleic acid to regulate gene expression in mammalian cells
US20060025366 *Jun 30, 2005Feb 2, 2006Protiva Biotherapeutics, Inc.Immunostimulatory siRNA molecules and uses therefor
US20060030003 *Jul 21, 2005Feb 9, 2006Simon Michael RComposition and method for introduction of RNA interference sequences into targeted cells and tissues
US20060040882 *May 4, 2005Feb 23, 2006Lishan ChenCompostions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells
US20060051815 *Jun 23, 2005Mar 9, 2006The J. David Gladstone InstitutesMethods of treating smooth muscle cell disorders
US20060058252 *Jun 26, 2003Mar 16, 2006Clawson Gary AMethods and materials for treating human papillomavirus infections
US20060063181 *Aug 15, 2005Mar 23, 2006Green Pamela JMethod for identification and quantification of short or small RNA molecules
US20060069050 *Feb 17, 2005Mar 30, 2006University Of MassachusettsMethods and compositions for mediating gene silencing
US20060078902 *Apr 14, 2005Apr 13, 2006Michaeline BuntingMethod and compositions for RNA interference
US20060083780 *Jun 7, 2005Apr 20, 2006Protiva Biotherapeutics, Inc.Cationic lipids and methods of use
US20060089323 *Jun 14, 2005Apr 27, 2006Sailen BarikRNAi modulation of RSV, PIV and other respiratory viruses and uses thereof
US20060089324 *Jun 14, 2005Apr 27, 2006Sailen BarikRNAi modulation of RSV, PIV and other respiratory viruses and uses thereof
US20060094676 *Oct 29, 2004May 4, 2006Ronit LahavCompositions and methods for treating cancer using compositions comprising an inhibitor of endothelin receptor activity
US20060122137 *Sep 2, 2005Jun 8, 2006Nastech Pharmaceutical Company Inc.5'-methylpyrimidine and 2'-O-methyl ribonucleotide modified double-stranded ribonucleic acid molecules
US20060128650 *Sep 30, 2005Jun 15, 2006University Of MassachusettsAllele-specific RNA interference
US20060134189 *Nov 17, 2005Jun 22, 2006Protiva Biotherapeutics, IncsiRNA silencing of apolipoprotein B
US20060134787 *Dec 22, 2004Jun 22, 2006University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of single and double blunt-ended siRNA
US20060142230 *Sep 2, 2005Jun 29, 2006Nastech Pharmaceutical Company Inc.Double-stranded ribonucleic acid molecules having ribothymidine
US20060154856 *Sep 15, 2005Jul 13, 2006Veasey Sigrid CNADPH oxidase inhibition pharmacotherapies for Obstructive Sleep Apnea syndrome and its associated morbidities
US20060160123 *Feb 24, 2006Jul 20, 2006Nastech Pharmaceutical Company Inc.Method of minimizing off-target effects of siRNA molecules
US20060166921 *Jan 6, 2006Jul 27, 2006Rachel MeyersRNAi modulation of RSV and therapeutic uses thereof
US20060168669 *Mar 27, 2006Jul 27, 2006Baulcombe David CGene silencing
US20060172963 *Feb 1, 2006Aug 3, 2006Alcon, Inc.RNAi-mediated inhibition of ocular hypertension targets
US20060172965 *Feb 1, 2006Aug 3, 2006Alcon, Inc.RNAi-mediated inhibition of ocular targets
US20060178297 *May 23, 2005Aug 10, 2006Troy Carol MSystems and methods for silencing expression of a gene in a cell and uses thereof
US20060178328 *Oct 19, 2005Aug 10, 2006Medtronic Inc.Devices, systems and methods for improving memory and/or cognitive function through brain delivery of siRNA
US20060178329 *Feb 23, 2006Aug 10, 2006The University Of British ColumbiaRNAi probes targeting cancer-related proteins
US20060189564 *Mar 24, 2006Aug 24, 2006Medtronic, Inc.Methods and sequences to suppress pro-inflamatory cytokine actions locally to treat pain
US20060205635 *Mar 14, 2006Sep 14, 2006Board Of Regents, The University Of Texas SystemAntigene oligomers inhibit transcription
US20060211637 *Aug 6, 2003Sep 21, 2006Intradigm CorporationMethods of down regulating target gene expression in vivo by introduction of interfering rna
US20060217324 *Jan 24, 2006Sep 28, 2006Juergen SoutschekRNAi modulation of the Nogo-L or Nogo-R gene and uses thereof
US20060223749 *May 28, 2004Oct 5, 2006University Of South FloridaInhibition of SHIP to enhance stem cell harvest and transplantation
US20060223773 *Mar 10, 2006Oct 5, 2006Alcon, Inc.RNAi-mediated inhibition of Frizzled Related Protein-1 for treatment of glaucoma
US20060239971 *Feb 23, 2004Oct 26, 2006Mohapatra Shyam SVectors for regulating gene expression
US20060240093 *Jun 27, 2006Oct 26, 2006Protiva Biotherapeutics, Inc.Lipid encapsulated interfering rna
US20060240425 *Jul 29, 2003Oct 26, 2006Oncotherapy Science, IncGenes and polypeptides relating to myeloid leukemia
US20060257380 *Sep 19, 2002Nov 16, 2006Inst.Nat. De La Sante Et De La Recherche MEDUse of sirnas for gene silencing in antigen presenting cells
US20060258608 *Apr 26, 2006Nov 16, 2006Rachel MeyersRNAi modulation of RSV and therapeutic uses thereof
US20060269519 *Jun 23, 2005Nov 30, 2006Baylor College Of MedicineModulation of cytokine signaling regulators and applications for immunotherapy
US20060269530 *Feb 23, 2004Nov 30, 2006The Penn State Research FoundationRNA interference compositions and methods
US20060276635 *Aug 4, 2006Dec 7, 2006Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20060281175 *Aug 11, 2006Dec 14, 2006Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20060287259 *Dec 23, 2004Dec 21, 2006The Trustees Of The University Of PennsylvaniaCompositions and methods for combined therapy of disease
US20060287269 *May 15, 2006Dec 21, 2006The Regents Of The University Of CaliforniaShort interfering nucleic acid hybrids and methods thereof
US20060292119 *Jan 19, 2006Dec 28, 2006Baylor College Of MedicineModulation of negative immune regulators and applications for immunotherapy
US20060293256 *Aug 5, 2003Dec 28, 2006Masateru YamadaRemedy or preventive for kidney disease and method of diagnosing kidney disease
US20060293271 *Aug 4, 2006Dec 28, 2006Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20070003575 *Aug 28, 2006Jan 4, 2007Itzhak BentwichViral and viral associated MiRNAs and uses thereof
US20070003960 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070003961 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070003962 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070003963 *Jun 26, 2006Jan 4, 2007Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20070004664 *Aug 4, 2006Jan 4, 2007Sirna Therapeutics, Inc.RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US20070010468 *Apr 23, 2004Jan 11, 2007Georgetown UniversityMethods and compositions for the inhibition of stat5 in prostate cancer cells
US20070031844 *Nov 14, 2003Feb 8, 2007Anastasia KhvorovaFunctional and hyperfunctional siRNA
US20070037762 *Jun 8, 2006Feb 15, 2007Tolentino Michael JCOMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20070054873 *Aug 28, 2006Mar 8, 2007Protiva Biotherapeutics, Inc.Glucocorticoid modulation of nucleic acid-mediated immune stimulation
US20070072823 *Dec 4, 2006Mar 29, 2007Dharmacon Inc.siRNA targeting survivin
US20070087991 *Nov 16, 2006Apr 19, 2007Axordia LimitedPluripotential stem cells
US20070088154 *Dec 7, 2006Apr 19, 2007Dharmacon Inc.siRNA targeting complement factor B
US20070111227 *Jul 28, 2006May 17, 2007Green Pamela JSmall regulatory RNAs and methods of use
US20070111963 *Nov 13, 2006May 17, 2007Board Of Regents, The University Of Texas SystemModulation of gene expression by oligomers targeted to chromosomal DNA
US20070128640 *Nov 8, 2006Jun 7, 2007Dharmacon, Inc.siRNA targeting ras-related nuclear protein
US20070134697 *Nov 3, 2006Jun 14, 2007Dharmacon, Inc.siRNA targeting TIE-2
US20070134698 *Nov 9, 2006Jun 14, 2007Dharmacon, Inc.siRNA targeting histamine receptor H1
US20070135370 *Oct 20, 2006Jun 14, 2007Protiva Biotherapeutics, Inc.siRNA silencing of filovirus gene expression
US20070135372 *Nov 2, 2006Jun 14, 2007Protiva Biotherapeutics, Inc.Modified siRNA molecules and uses thereof
US20070141009 *Jan 5, 2004Jun 21, 2007Shaharyar KhanSirna mediated post-transriptional gene silencing of genes involved in alopecia
US20070141601 *Nov 9, 2006Jun 21, 2007Dharmacon, Inc.siRNA targeting cAMP-specific phosphodiesterase 4D
US20070141602 *Nov 9, 2006Jun 21, 2007Dharmacon, Inc.siRNA targeting aquaporin 4
US20070149468 *May 17, 2004Jun 28, 2007Jackson Aimee LMethods and compositions for rna interference
US20070149470 *Jun 1, 2006Jun 28, 2007Kaspar Roger LInhibition of viral gene expression using small interfering RNA
US20070155658 *Nov 7, 2006Jul 5, 2007Nastech Pharmaceutical Company Inc.Nanoparticles for delivery of nucleic acids and stable double-stranded rna
US20070160586 *Jun 14, 2006Jul 12, 2007Children's Medical Center CorporationMethods for extending the replicative lifespan of cells
US20070161547 *Jun 3, 2004Jul 12, 2007Balkrishen BhatModulation of survivin expression
US20070161586 *Jan 14, 2005Jul 12, 2007Takeda Pharmaceutical Company LimitedDrug for preventing and treating atherosclerosis
US20070180242 *Jan 30, 2006Aug 2, 2007Nagaraj Thadi MGSM authentication in a CDMA network
US20070185320 *Apr 9, 2007Aug 9, 2007Dharmacon, Inc.siRNA targeting cell division cycle 20 homolog (CDC20)
US20070202134 *Feb 22, 2005Aug 30, 2007Kufe Donald WMuc1 Antagonist Enhancement of Death Receptor Ligand-Induced Apoptosis
US20070207491 *Mar 21, 2007Sep 6, 2007Dharmacon, Inc.siRNA targeting minichromosome maintenance deficient 4 (MCM4)
US20070207974 *Mar 30, 2005Sep 6, 2007Dharmacon Inc.Functional and hyperfunctional siRNA
US20070219362 *Apr 4, 2007Sep 20, 2007Dharmacon, Inc.siRNA targeting azurocidin 1 (Cartionic Antimicrobial protein 37)
US20070232555 *Mar 28, 2005Oct 4, 2007Nariyoshi ShinomiyaC-Met Sirna Adenovirus Vectors Inhibit Cancer Cell Growth, Invasion and Tumorigenicity
US20070238676 *Dec 6, 2004Oct 11, 2007Mohapatra Shyam SPolynucleotides for Reducing Respiratory Syncytial Virus Gene Expression
US20070238691 *Mar 28, 2007Oct 11, 2007Senesco Technologies, Inc.Inhibition of HIV replication and expression of p24 with eIF-5A
US20070243570 *May 19, 2004Oct 18, 2007Genecare Research Institute Co., LtdApoptosis Inducer for Cancer Cell
US20070244311 *May 30, 2007Oct 18, 2007Dharmacon, Inc.siRNA targeting coatomer protein complex, subunit beta 2 (CPOB2)
US20070258993 *Nov 12, 2004Nov 8, 2007The Austin Research InstituteDna-Carrier Conjugate
US20070259827 *Jan 25, 2007Nov 8, 2007University Of MassachusettsCompositions and methods for enhancing discriminatory RNA interference
US20070265220 *May 1, 2007Nov 15, 2007City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20070265438 *Jun 15, 2007Nov 15, 2007Dharmacon, Inc.siRNA targeting polo-like kinase-1 (PLK-1)
US20070269892 *May 18, 2007Nov 22, 2007Nastech Pharmaceutical Company Inc.FORMULATIONS FOR INTRACELLULAR DELIVERY dsRNA
US20070270369 *Mar 26, 2007Nov 22, 2007The Burnham InstituteUse of hepatitis b x-interacting protein (hbxip) in modulation of apoptosis
US20070275913 *Apr 12, 2007Nov 29, 2007Monia Brett PCompositions and their uses directed to hepcidin
US20070275923 *Feb 16, 2007Nov 29, 2007Nastech Pharmaceutical Company Inc.CATIONIC PEPTIDES FOR siRNA INTRACELLULAR DELIVERY
US20070276135 *Jun 4, 2007Nov 29, 2007Dharmacon, Inc.siRNA targeting dual specificity phosphate 5 (DUSP5)
US20070276136 *Jun 15, 2007Nov 29, 2007Dharmacon, Inc.siRNA targeting serine/threonine kinase 12 (STK12 or aurora B kinase)
US20080014191 *May 21, 2007Jan 17, 2008The Scripps Research InstituteTreatment of Protein Misfolding
US20080039411 *Feb 23, 2005Feb 14, 2008Ulf SmithUse Of Resistin Antisense Oligonucleotides And/Or Sirna Molecules In The Treatment Of Rheumatoid Arthritis
US20080039412 *Feb 9, 2005Feb 14, 2008Sirna Therapeutics, Inc.Rna Interference Mediated Inhibition of Gene Expression Using Multifunctional Short Interfering Nucleic Acid (Multifunctional Sina)
US20080039415 *Aug 11, 2006Feb 14, 2008Gregory Robert StewartRetrograde transport of sirna and therapeutic uses to treat neurologic disorders
US20080057062 *Jul 17, 2007Mar 6, 2008National Institute Of Advanced Industrial Science And TechnologyAgent for Inducing senescence and apoptosis of cancer cell
US20080064865 *May 29, 2007Mar 13, 2008Dharmacon, Inc.siRNA targeting cyclin dependent kinase 11 (CDK11)
US20080069840 *Jul 3, 2007Mar 20, 2008Tzyy-Choou WuRNA Interference That Blocks Expression of Pro-Apoptotic Proteins Potentiates Immunity Induced by DNA and Transfected Dendritic Cell Vaccines
US20080070857 *Feb 14, 2006Mar 20, 2008Jun NishihiraPharmaceutical Agents for Preventing Metastasis of Cancer
US20080071073 *Oct 25, 2007Mar 20, 2008Dharmacon, Inc.siRNA targeting ubiquitin ligases
US20080076731 *Apr 13, 2007Mar 27, 2008University Of South FloridaControl of NK cell function and survival by modulation of ship activity
US20080076908 *Oct 24, 2007Mar 27, 2008Dharmacon, Inc.siRNA targeting nuclear receptors
US20080085998 *Oct 26, 2007Apr 10, 2008Dharmacon, Inc.siRNA targeting transient receptor potential cation channel, subfamily V, member 1 (TRPV1)
US20080085999 *Jul 30, 2007Apr 10, 2008Oligoengine, Inc.Modulation of gene expression using dna-rna hybrids
US20080090997 *Oct 26, 2007Apr 17, 2008Dharmacon, Inc.siRNA targeting complement component 3 (C3)
US20080091001 *Oct 15, 2007Apr 17, 2008Dharmacon Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20080091003 *Oct 16, 2007Apr 17, 2008Dharmacon Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20080097090 *Oct 17, 2007Apr 24, 2008Dharmacon Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20080102084 *Jul 26, 2007May 1, 2008Tzyy-Choou WuAnti-cancer DNA Vaccine Employing Plasmids Encoding Mutant Oncoprotein Antigen and Calreticulin
US20080108584 *May 21, 2007May 8, 2008De Fougerolles AntoninCompositions and methods for inhibiting expression of ikk-b gene
US20080108802 *Oct 16, 2007May 8, 2008Dharmacon Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20080108803 *Oct 19, 2007May 8, 2008Dharmacon Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20080113369 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting diacylglycerol O-acyltransferase homolog 2 (DGAT2)
US20080113370 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting apolipoprotein B (APOB)
US20080113371 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting beta secretase (BACE)
US20080113372 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting glucagon receptor (GCGR)
US20080113373 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting amyloid beta (A4) precursor protein (APP)
US20080113374 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting fructose-1,6-bisphosphatase 1 (FBP1)
US20080113375 *Oct 29, 2007May 15, 2008Dharmacon, Inc.siRNA targeting superoxide dismutase 1 (SOD1)
US20080113376 *Oct 30, 2007May 15, 2008Dharmacon, Inc.siRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US20080113377 *Oct 30, 2007May 15, 2008Dharmacon, Inc.siRNA Targeting proto-oncogene MET
US20080113378 *Oct 30, 2007May 15, 2008Dharmacon, Inc.siRNA targeting interleukin-1 receptor-associated kinase 4 (IRAK4)
US20080114162 *Oct 16, 2007May 15, 2008Dharmacon Inc.Functional and hyperfunctional siRNA directed against Bcl-2
US20080125384 *Nov 21, 2006May 29, 2008Shuewi YangSimultaneous silencing and restoration of gene function
US20080132461 *Jul 19, 2007Jun 5, 2008Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20080132691 *Oct 26, 2007Jun 5, 2008Dharmacon, Inc.siRNA targeting kinase insert domain receptor (KDR)
US20080152654 *Jun 12, 2007Jun 26, 2008Exegenics, Inc., D/B/A Opko Health, Inc.COMPOSITIONS AND METHODS FOR siRNA INHIBITION OF ANGIOGENESIS
US20080153765 *Mar 22, 2005Jun 26, 2008Gewirtz Alan MMethods of Use of Bcl-6-Derived Nucleotides to Induce Apoptosis
US20080167256 *Mar 22, 2005Jul 10, 2008Hidetoshi SumimotoCancer Therapy Via the Inhibition of Skp-2 Expression
US20080167265 *Jan 8, 2008Jul 10, 2008Isis Pharmaceuticals IncModulation of fr-alpha expression
US20080171051 *Nov 26, 2004Jul 17, 2008Patrick Gerard JohnstonCancer Treatment
US20080171715 *Aug 10, 2007Jul 17, 2008David BrownMethods and compositions involving mirna and mirna inhibitor molecules
US20080171906 *Jan 16, 2007Jul 17, 2008Everaerts Frank J LTissue performance via hydrolysis and cross-linking
US20080176293 *Jan 24, 2008Jul 24, 2008Jacques RohayemRNA-Dependent RNA Polymerase, Methods And Kits For The Amplification And/Or Labelling Of RNA
US20080177051 *Oct 30, 2007Jul 24, 2008Dharmacon, Inc.siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US20080221059 *Apr 3, 2008Sep 11, 2008National Taiwan UniversityNovel treatment tool for cancer: rna interference of bcas2
US20080227967 *Jun 13, 2007Sep 18, 2008Dharmacon, Inc.siRNA targeting ribonucleotide reductase M2 polypeptide (RRM2 or RNR-R2)
US20080242627 *Oct 11, 2007Oct 2, 2008University Of Southern CaliforniaNovel rna interference methods using dna-rna duplex constructs
US20080249038 *Oct 6, 2004Oct 9, 2008Quark Biotech, Inc.Bone Morphogenetic Protein (Bmp) 2A and Uses Thereof
US20080249046 *Jun 8, 2007Oct 9, 2008Protiva Biotherapeutics, Inc.MODIFIED siRNA MOLECULES AND USES THEREOF
US20080253989 *Oct 22, 2004Oct 16, 2008Neuregenix LimitedNeuron Regeneration
US20080255345 *Nov 21, 2007Oct 16, 2008Alnylam Pharmaceuticals, Inc.IRNA Agents Targeting CCR5 Expressing Cells And Uses Thereof
US20080260765 *Mar 17, 2008Oct 23, 2008Johns Hopkins UniversityHPV DNA Vaccines and Methods of Use Thereof
US20080268457 *Jun 6, 2008Oct 30, 2008Dharmacon, Inc.siRNA targeting forkhead box P3 (FOXP3)
US20080269155 *Mar 17, 2008Oct 30, 2008Toray Industries Inc.Remedy or preventive for kidney disease and method of diagnosing kidney disease
US20080274996 *May 6, 2008Nov 6, 2008The University Of British ColumbiaRNAi Probes Targeting Cancer-Related Proteins
US20080279844 *Oct 5, 2007Nov 13, 2008Kapil MehtaMethods for Treating Cancer Targeting Transglutaminase
US20080287386 *Feb 28, 2008Nov 20, 2008Quark Biotech, Inc.Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US20080293593 *Jul 23, 2007Nov 27, 2008Dharmacon, Inc.siRNA targeting casitas B cell lymphoma-B (CBL-B)
US20080293595 *Jul 24, 2007Nov 27, 2008Dharmacon, Inc.siRNA targeting protein tyrosine phosphatase-1B (PTP1B)
US20080299659 *Feb 28, 2008Dec 4, 2008Nastech Pharmaceutical Company Inc.Nucleic acid compounds for inhibiting apob gene expression and uses thereof
US20080306015 *Jul 25, 2007Dec 11, 2008Dharmacon, Inc.siRNA targeting proprotein convertase subtilisin/kexin type 9 (PCSK9)
US20080312176 *May 30, 2008Dec 18, 2008David Charles BaulcombeGene silencing
US20080318896 *Jul 14, 2008Dec 25, 2008University Of MassachusettsMethods and Compositions for Controlling of Efficacy of RNA Silencing
US20080319180 *Jul 24, 2007Dec 25, 2008Dharmacon, Inc.siRNA targeting protein kinase N-3 (PKN-3)
US20090005330 *Aug 30, 2005Jan 1, 2009Sylentis S.A.Methods and Compositions to Inhibit P2x7 Receptor Expression
US20090005548 *Jul 27, 2007Jan 1, 2009Dharmacon, Inc.siRNA targeting nuclear receptor interacting protein 1 (NRIP1)
US20090022667 *May 15, 2008Jan 22, 2009Marco PetersMETHODS OF TREATING COGNITIVE DISORDERS BY INHIBITION OF Gpr12
US20090023675 *Apr 17, 2008Jan 22, 2009Sirna Therapeutics, Inc.RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA)
US20090028862 *Sep 29, 2005Jan 29, 2009Arndt Gregory MEmmprin antagonists and uses thereof
US20090029466 *Jun 20, 2008Jan 29, 2009City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded rna
US20090042826 *Jan 7, 2008Feb 12, 2009Quark Pharmaceuticals, Inc.Use of the AXL receptor for diagnosis and treatment of renal disease
US20090048111 *Sep 5, 2008Feb 19, 2009Myriad Genetics, IncorporatedRna interference using a universal target
US20090053298 *Jul 31, 2008Feb 26, 2009Sumitomo Chemical Company, LimitedCompositions and methods for inhibiting car gene expression by rna interference
US20090061487 *Sep 6, 2007Mar 5, 2009Samuel Jotham ReichSirna and methods of manufacture
US20090062225 *Apr 27, 2007Mar 5, 2009Pamela TanCompositions and methods for inhibiting expression of a gene from the jc virus
US20090074785 *Jan 16, 2008Mar 19, 2009Smith Jeffrey WCompositions and methods for treatment of colorectal cancer
US20090081789 *Apr 25, 2008Mar 26, 2009Greenville Hospital SystemActivation of nuclear factor kappa B
US20090082303 *Nov 20, 2008Mar 26, 2009Takeda Pharmaceutical Company LimitedDrug for preventing and treating atherosclerosis
US20090082556 *Jun 6, 2008Mar 26, 2009Dharmacon, Inc.siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US20090083873 *Nov 19, 2008Mar 26, 2009Uinversity Of MassachusettsSequence-specific inhibition of small rna function
US20090088563 *Oct 14, 2008Apr 2, 2009Dharmacon, Inc.siRNA targeting Transducin (beta)-like 3 (TBL3)
US20090092988 *Oct 6, 2008Apr 9, 2009Schwartz Jacob CModulating Gene Expression with agRNA and Gapmers Targeting Antisense Transcripts
US20090098127 *Jul 12, 2005Apr 16, 2009Medical Research Fund Of Tel Aviv Sourasky Medical CenterAgents Capable of Downregulating an MSF-A DEPENDENT HIF-1ALPHA and Use Thereof in Cancer Treatment
US20090098614 *Jun 13, 2008Apr 16, 2009Zamore Phillip DMethods and Compositions for controlling Efficacy of RNA Silencing
US20090099111 *Jul 9, 2008Apr 16, 2009Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090099112 *Jul 9, 2008Apr 16, 2009Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090099113 *Jul 9, 2008Apr 16, 2009Sylentis S.A.UMethods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090099114 *Jul 9, 2008Apr 16, 2009Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090105175 *Jul 9, 2008Apr 23, 2009Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090105176 *Jul 9, 2008Apr 23, 2009Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20090106852 *Dec 6, 2007Apr 23, 2009Massachusetts Institute Of TechnologyInfluenza Therapeutic
US20090118206 *Sep 13, 2004May 7, 2009University Of MassachusettsRna interference for the treatment of gain-of-function disorders
US20090118214 *Aug 20, 2008May 7, 2009Beeologics, LlcCompositions for conferring tolerance to viral disease in social insects, and the use thereof
US20090118489 *Jun 9, 2008May 7, 2009Dharmacon, Inc.siRNA targeting nucleoporin 62kDa (Nup62)
US20090123572 *Sep 22, 2005May 14, 2009Shiseido Company, Ltd.Method and Pharmaceutical Composition for Treating Psoriasis, Squamous Cell Carcinoma and/or Parakeratosis by Inhibiting Expression of Squamous Cell Carcinoma-Related Antigen
US20090124567 *Jul 3, 2008May 14, 2009Jianzhu ChenInfluenza Therapeutic
US20090130212 *May 15, 2007May 21, 2009Physical Pharmaceutica, LlcComposition and improved method for preparation of small particles
US20090143321 *Jul 6, 2006Jun 4, 2009Avraham HochbergNucleic acid agents for downregulating h19 and methods of using same
US20090148471 *Jan 15, 2008Jun 11, 2009The Johns Hopkins UniversityMolecular Vaccine Linking an Endoplasmic Reticulum Chaperone Polypeptide to an Antigen
US20090149377 *Sep 28, 2006Jun 11, 2009St. Jude Children's Research HospitalMETHODS FOR REGULATION OF p53 TRANSLATION AND FUNCTION
US20090149403 *May 29, 2007Jun 11, 2009Protiva Biotherapeutics, Inc.siRNA silencing of genes expressed in cancer
US20090149644 *Dec 9, 2008Jun 11, 2009Dharmacon Inc.siRNA Targeting KRAS
US20090156531 *Dec 28, 2006Jun 18, 2009Institut Gustave RoussyUse of Inhibitors of Scinderin and/or Ephrin-A1 for Treating Tumors
US20090156797 *Feb 2, 2009Jun 18, 2009Dharmacon, Inc.siRNA Targeting Hypoxia-inducible Factor 1
US20090163407 *Nov 15, 2005Jun 25, 2009Mount Sinai School Of Medicine Of New York UniversityCompositions and methods for altering wnt autocrine signaling
US20090163701 *Feb 10, 2009Jun 25, 2009Dharmacon Inc.siRNA targeting tumor necrosis factor receptor superfamily member 1A
US20090163702 *Feb 11, 2009Jun 25, 2009Dharmacon Inc.siRNA targeting Myeloid cell leukemia sequence 1
US20090170794 *Sep 12, 2005Jul 2, 2009Somagenics Inc.Small interfering rnas that efficiently inhibit viral expression and methods of use thereof
US20090186843 *Jul 23, 2009Whitehead Institute For Biomedical ResearchRNA sequence-specific mediators of RNA interference
US20090191625 *Jan 23, 2009Jul 30, 2009Dharmacon, Inc.siRNA targeting connective tissue growth factor (CTGF)
US20090192113 *Jul 30, 2009Jan WeilerInterfering RNA Duplex Having Blunt-Ends and 3`-Modifications
US20090203055 *Apr 18, 2006Aug 13, 2009Massachusetts Institute Of TechnologyCompositions and methods for RNA interference with sialidase expression and uses thereof
US20090203121 *Jan 16, 2008Aug 13, 2009Avraham HochbergNucleic acid agents for downregulating h19, and methods of using same
US20090203135 *Apr 23, 2008Aug 13, 2009Alnylam Pharmaceuticals, Inc.Glycoconjugates of RNA Interference Agents
US20090203138 *Feb 12, 2009Aug 13, 2009University Of Tennessee Research Foundation, Inc.Small Interfering RNAs Targeting Feline Herpes Virus
US20090203896 *Apr 27, 2009Aug 13, 2009Balkrishen BhatModulation of survivin expression
US20090226446 *Apr 5, 2007Sep 10, 2009Deutsches Krebsforschungszentrum Stiftung Des Offentilchen RechtsMethod to Inhibit the Propagation of an Undesired Cell Population
US20090227780 *May 14, 2009Sep 10, 2009Dharmacon, Inc.siRNA targeting connexin 43
US20090233983 *Oct 3, 2008Sep 17, 2009Sirna Therapeutics Inc.RNA Interference Mediated Inhibition of Protein Tyrosine Phosphatase-1B (PTP-1B) Gene Expression Using Short Interfering RNA
US20090233984 *Dec 2, 2008Sep 17, 2009Alnylam Pharmaceuticals, Inc.RNAi Modulation of RSV and Therapeutic Uses Thereof
US20090238772 *Dec 15, 2008Sep 24, 2009Alnylam Pharmaceuticals, Inc.Methods and compositions for prevention or treatment of rsv infection
US20090239814 *Dec 4, 2008Sep 24, 2009Alnylam Pharmaceuticals, Inc.Carbohydrate Conjugates as Delivery Agents for Oligonucleotides
US20090240043 *Jan 28, 2008Sep 24, 2009Alnylam Pharmaceuticals, Inc.RNAi MODULATION OF RSV AND THERAPEUTIC USES THEREOF
US20090247606 *Aug 28, 2008Oct 1, 2009Sirna Therapeutics, Inc.RNA Interference Mediated Inhibition of Adenosine A1 Receptor (ADORA1) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20090247608 *Dec 4, 2008Oct 1, 2009Alnylam Pharmaceuticals, Inc.Targeting Lipids
US20090247614 *Dec 4, 2008Oct 1, 2009Alnylam Pharmaceuticals, Inc.Folate Conjugates
US20090253776 *May 28, 2009Oct 8, 2009Dharmacon, Inc.siRNA targeting gremlin
US20090258934 *Jun 18, 2009Oct 15, 2009Alnylam Pharmaceuticals, Inc.COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Nav1.8 GENE
US20090264501 *Aug 30, 2005Oct 22, 2009Sylentis S.A.Methods and Compositions to Inhibit P2x7 Receptor Expression
US20090264505 *Oct 22, 2009Kay Mark AMethods and compositions for rnai mediated inhibition of gene expression in mammals
US20090275635 *May 21, 2007Nov 5, 2009Medical Research CouncilScreening method
US20090275638 *Nov 5, 2009Kevin FitzgeraldCompositions and Methods for Inhibiting Expression of XBP-1 Gene
US20090285861 *Nov 19, 2009Tzyy-Choou WuTumor cell-based cancer immunotherapeutic compositions and methods
US20090286254 *Jul 23, 2009Nov 19, 2009David Charles BaulcombeGene silencing
US20090288182 *Nov 19, 2009David Charles BaulcombeGene silencing
US20090304798 *Jan 9, 2009Dec 10, 2009Insert Therapeutics, Inc.Methods and compositions for therapeutic use of RNA interference
US20090306356 *Sep 12, 2008Dec 10, 2009Dharmacon,Inc.siRNA Targeting TNFalpha
US20090325285 *Aug 27, 2009Dec 31, 2009City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded rna
US20090325818 *Jul 28, 2009Dec 31, 2009Dharmacon, Inc.siRNA targeting interleukin-1 receptor-associated kinase 4 (IRAK4)
US20090326046 *Dec 31, 2009City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded rna
US20100003317 *Mar 26, 2009Jan 7, 2010Akin AkincCompositions and methods for mediating rnai in vivo
US20100004318 *Jan 7, 2010Integrated Dna Technologies, Inc.Methods and compositions for the specific inhibition of gene expression by double-stranded rna
US20100004436 *Jan 7, 2010Integrated Dna Technologies, Inc.Methods and compositions for the specific inhibition of gene expression by double-stranded rna
US20100010066 *Jun 4, 2009Jan 14, 2010Kevin FitzgeraldOptimized Methods For Delivery Of DSRNA Targeting The PCSK9 Gene
US20100015707 *May 2, 2007Jan 21, 2010Francois Jean-Charles NattSHORT INTERFERING RIBONUCLEIC ACID (siRNA) FOR ORAL ADMINISTRATION
US20100016176 *Jan 21, 2010Dharmacon. Inc.siRNA targeting histamine receptor H1
US20100016405 *Jul 9, 2007Jan 21, 2010Alnylam Pharmaceuticals, IncCompositions and Methods for Inhibiting Expression of the MYC Gene
US20100022413 *Sep 11, 2009Jan 28, 2010Dharmacon, Inc.siRNA targeting Ras-related nuclear protein RAN
US20100022623 *Sep 21, 2009Jan 28, 2010Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20100022624 *Jan 28, 2010Verdin Eric MMethods of Treating Smooth Muscle Cell Disorders
US20100022763 *Sep 3, 2009Jan 28, 2010Dharmacon, Inc.siRNA targeting kinase insert domain receptor (KDR)
US20100035966 *Jun 14, 2007Feb 11, 2010Rosetta Inpharmatics LlcMethods and compositions for regulating cell cycle progression
US20100062951 *Mar 11, 2010Dharmacon, Inc.siRNA targeting TIE-2
US20100069461 *Nov 7, 2006Mar 18, 2010Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor v leiden mutant gene
US20100075869 *Nov 12, 2009Mar 25, 2010Dharmacon, Inc.siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US20100087508 *Apr 8, 2010David BumcrotCompositions and Methods for Inhibiting Expression of Eg5 and VEGF Genes
US20100093831 *Sep 1, 2009Apr 15, 2010Vasgene Therapeutics, Inc.Nucleic acid compounds for inhibiting angiogenesis and tumor growth
US20100098664 *Nov 28, 2007Apr 22, 2010Mathieu Jean-Francois DesclauxLentiviral vectors allowing RNAi mediated inhibition of GFAP and vimentin expression
US20100099578 *Dec 3, 2009Apr 22, 2010Dharmacon, Inc.siRNA Targeting Fructose-1, 6-bisphosphatase 1 (FBP1)
US20100099740 *Oct 8, 2009Apr 22, 2010Kay Mark AMethods and compositions for rnai mediated inhibition of gene expression in mammals
US20100105759 *Jan 16, 2008Apr 29, 2010Abraham HochbergH19 silencing nucleic acid agents for treating rheumatoid arthritis
US20100112686 *Oct 14, 2009May 6, 2010Qing GeShort hairpin rnas for inhibition of gene expression
US20100113306 *Dec 23, 2009May 6, 2010Dharmacon, Inc.siRNA Targeting connective tissue growth factor (CTGF)
US20100113307 *Dec 15, 2009May 6, 2010Dharmacon, Inc.siRNA targeting vascular endothelial growth factor (VEGF)
US20100113332 *Sep 27, 2005May 6, 2010Nastech Pharmaceutical Company Inc.Method of treating an inflammatory disease by double stranded ribonucleic acid
US20100113564 *Jan 6, 2010May 6, 2010Mcswiggen JamesRNA Interference Mediated Inhibition of Interleukin and Interleukin Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100113760 *Dec 8, 2009May 6, 2010Dharmacon, Inc.siRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US20100120893 *Oct 20, 2009May 13, 2010Dinah Wen-Yee SahCompositions and Methods for Inhibiting Expression of Transthyretin
US20100129429 *Nov 3, 2006May 27, 2010British Columbia Cancer AgencyInhibition of autophagy genes in cancer chemotherapy
US20100130592 *Dec 17, 2009May 27, 2010Sirna Therapeutics, Inc.RNA Interference Mediated Inhibition of GRB2 Associated Binding Protein (GAB2) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100130595 *Aug 25, 2009May 27, 2010Dean Nicholas MAntisense oligonucleotides directed against connective tissue growth factor and uses thereof
US20100136026 *Sep 26, 2008Jun 3, 2010Kerr William GShip Inhibition to Direct Hematopoietic Stem Cells and Induce Extramedullary Hematopoiesis
US20100136101 *Dec 3, 2009Jun 3, 2010The Trustees Of The University Of PennsylvaniaCompositions and methods for sirna inhibition of hif-1 alpha
US20100144552 *Jan 21, 2010Jun 10, 2010Dharmacon, Inc.siRNA targeting serine/threonine kinase 12 (STK12 or aurora B kinase)
US20100144833 *Jun 25, 2009Jun 10, 2010Sailen BarikRNAi Modulation Of RSV, PIV And Other Respiratory Viruses And Uses Thereof
US20100144841 *Jan 4, 2010Jun 10, 2010University Of South FloridaControl of nk cell function and survival by modulation of ship activity
US20100144842 *Jan 26, 2010Jun 10, 2010Sirna Therapeutics, Inc.RNA Interference Mediated Inhibition of NOGO and NOGO Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100144851 *Jan 19, 2010Jun 10, 2010Sirna Therapeutics, Inc.RNA Interference Mediated Inhibition of Platelet-Derived Endothelial Cell Growth Factor (ECGF1) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100151470 *Oct 30, 2009Jun 17, 2010University Of MassachusettsMethods and compositions for locating snp heterozygosity for allele specific diagnosis and therapy
US20100168205 *Oct 23, 2009Jul 1, 2010Alnylam Pharmaceuticals, Inc.Methods and Compositions for Prevention or Treatment of RSV Infection Using Modified Duplex RNA Molecules
US20100168206 *Dec 10, 2009Jul 1, 2010Jared GollobGNAQ Targeted dsRNA Compositions And Methods For Inhibiting Expression
US20100168209 *Dec 21, 2009Jul 1, 2010Genecare Research Institute Co., Ltd.Apoptosis inducer for cancer cell
US20100183696 *Jan 28, 2008Jul 22, 2010Allergan, IncTreating Ocular Diseases Using Peroxisome Proliferator-Activated Receptor Delta Antagonists
US20100184824 *Jan 7, 2010Jul 22, 2010Sirna Therapeutics, Inc.RNA Interference Mediated Inhibition of Interleukin and Interleukin Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100184825 *Jul 22, 2010Merck Sharp & Dohme Corp.RNA Interference Mediated Inhibition of Protein Tyrosine Phosphatase-1B (PTP-1B) Gene Expression Using Short Interfering Nucleic Acid (siNA)
US20100184826 *Jul 22, 2010University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of rna silencing
US20100184827 *Jul 22, 2010University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of rna silencing
US20100184828 *Mar 29, 2010Jul 22, 2010University Of MassachusettsMethods and compositions for enhancing the efficacy and specificity of rna silencing
US20100190195 *Feb 2, 2010Jul 29, 2010The Burnham InstituteUse of Hepatitis B X-Interacting Protein (HBXIP) in Modulation of Apoptosis
US20100190714 *Jan 6, 2010Jul 29, 2010Novatis AgRNAi Inhibition of Alpha-ENaC Expression
US20100190971 *Mar 1, 2010Jul 29, 2010Dharmacon, Inc.siRNA Targeting Diacylglycerol O-Acyltransferase Homolog 2 (DGAT2)
US20100196403 *Jan 27, 2008Aug 5, 2010Jacob HochmanAntibody conjugates for circumventing multi-drug resistance
US20100197773 *Aug 5, 2010Birgit BramlageCompositions and methods for inhibiting expression of ptp1b genes
US20100197899 *Aug 5, 2010Alnylam Pharmaceuticals, Inc.Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US20100204306 *Aug 12, 2010Alnylam Pharmaceuticals, Inc.Method of Treating Neurodegenerative Disease
US20100204307 *Apr 9, 2010Aug 12, 2010Tomoko NakayamaCompositions And Methods For Inhibiting Expression Of The HAMP Gene
US20100210513 *Aug 19, 2010Novartis AgRNAi Inhibition of Alpha-ENaC Expression
US20100210514 *Apr 30, 2010Aug 19, 2010Novartis AgRNAi Inhibition of Alpha-ENaC Expression
US20100216866 *Mar 19, 2010Aug 26, 2010Alnylam Pharmaceuticals, Inc.RNAi Modulation of APOB and Uses Thereof
US20100216971 *Aug 26, 2010Novartis AgRNAi Inhibition of Alpha-ENaC Expression
US20100216972 *Apr 30, 2010Aug 26, 2010Novartis AgRNAi Inhibition of Alpha-ENaC Expression
US20100227915 *Sep 9, 2010Pamela TanCompositions and methods for inhibiting expression of a gene from the jc virus
US20100234446 *Sep 16, 2010Philipp HadwigerRNAi Modulation of the BCR-ABL Fusion Gene and Uses Thereof
US20100240441 *Sep 2, 2008Sep 23, 2010Konami Digital Entertainment Co., LtdGame system, and game apparatus and challenge notifying apparatus constituting the game system
US20100240730 *Mar 26, 2010Sep 23, 2010Merck Sharp And Dohme Corp.RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA)
US20100240734 *Jun 1, 2010Sep 23, 2010City Of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded rna
US20100248990 *Sep 30, 2010Dharmacon, Inc.siRNA targeting ribonucleotide reductase M2 polypeptide (RRM2 or RNR-R2)
US20100249052 *Mar 25, 2008Sep 30, 2010Alnylam Pharmaceuticals, Inc.Dsrna compositions and methods for treating hpv infections
US20100249212 *Dec 2, 2009Sep 30, 2010University Of Southern CaliforniaGene Silencing Using mRNA-cDNA Hybrids
US20100255023 *Nov 26, 2008Oct 7, 2010Si-Yi ChenDendritic cell vaccine compositions and uses of same
US20100256218 *Feb 4, 2010Oct 7, 2010Olaf HeidenreichRNAi MODULATION OF MLL-AF4 AND USES THEREOF
US20100260730 *Oct 14, 2010University Of South FloridaSHIP-Deficiency to Increase Megakaryocyte Progenitor Production
US20100267810 *Oct 21, 2010University Of MassachusettsMethods and compositions for treating neurological disease
US20100273863 *Oct 28, 2010Board Of Regents, The University Of Texas SystemModulation of Gene Expression Using Oligomers That Target Gene Regions Downstream of 3' Untranslated Regions
US20100278871 *May 5, 2004Nov 4, 2010Johns Hopkins UniversityAnti-cancer dna vaccine employing plasmids encoding signal sequence, mutant oncoprotein antigen, and heat shock protein
US20100280102 *Nov 4, 2010Alnylam PharmaceuticalsDouble-stranded ribonucleic acid with increased effectiveness in an organism
US20100286230 *Oct 20, 2006Nov 11, 2010Sylentis S.A.U.Modulation of trpv expression levels
US20100291188 *Nov 18, 2010Musc Foundation For Research DevelopmentPeriostin Inhibitory Compositions for Myocardial Regeneration, Methods of Delivery, and Methods of Using Same
US20100298405 *Apr 2, 2009Nov 25, 2010Dinah Wen-Yee SahCompositions And Methods For Inhibiting Expression Of Huntingtin Gene
US20100305191 *Dec 2, 2010Mcswiggen JamesRna interference mediated inhibition of adenosine a1 receptor (adora1) gene expression using short interfering rna
US20100311810 *Mar 26, 2010Dec 9, 2010Isis Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 2 expression
US20100316703 *Dec 16, 2010Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20100317105 *Jun 7, 2010Dec 16, 2010University Of MassachusettsMethods and compositions for controlling efficacy of RNA silencing
US20100323922 *Aug 10, 2010Dec 23, 2010Dharmacon, Inc.siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US20100330105 *Aug 22, 2007Dec 30, 2010John Hopkins UniversityAnticancer Combination Therapies
US20100331394 *Sep 2, 2010Dec 30, 2010Sylentis S.A.U.Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure
US20110003307 *Jan 6, 2011City Of HopeMethods for producing interfering rna molecules in mammalian cells and therapeutic uses for such molecules
US20110003879 *Mar 13, 2006Jan 6, 2011Vincent Mark DAntisense oligonucleotides targeted to the coding region of thymidylate synthase and uses thereof
US20110003882 *Sep 7, 2010Jan 6, 2011Alnylam Pharmaceuticals, Inc.RNAi Modulation of AHA and Therapeutic Uses Thereof
US20110009472 *Jul 28, 2010Jan 13, 2011The University Of British ColumbiaRNAi Probes Targeting Cancer-Related Proteins
US20110014123 *Jan 20, 2011Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.RNA interference mediating small RNA molecules
US20110015252 *Jun 15, 2010Jan 20, 2011Kevin FitzgeraldLipid formulated dsrna targeting the pcsk9 gene
US20110020300 *Jan 27, 2011Genentech, Inc.Compositions and methods for inhibiting expression of glucocorticoid receptor (gcr) genes
US20110021605 *Jan 27, 2011Schulte Ralf WilhelmMeans and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
US20110021606 *Jul 23, 2010Jan 27, 2011South Alabama Medical Science FoundationRNAi Modulation of RSV, PIV and Other Respiratory Viruses and Uses Thereof
US20110027883 *Feb 3, 2011Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20110034537 *Feb 12, 2009Feb 10, 2011De Fougerolles AntoninCompositions and methods for inhibiting expression of cd45 gene
US20110038922 *Jun 12, 2006Feb 17, 2011Faron Pharmaceuticals Oy (A Finnish Company)Compounds for treating or preventing amine oxidase related diseases or disorders
US20110053226 *Jun 9, 2009Mar 3, 2011Riboxx GmbhMethod for enzymatic synthesis of chemically modified rna
US20110054159 *Aug 7, 2009Mar 3, 2011Maxplanck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20110060031 *Mar 10, 2011Alnylam Pharmaceuticals, Inc.Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus
US20110060032 *Mar 10, 2011Protiva Biotherapeutics, Inc.Lipid encapsulating interfering rna
US20110064704 *Sep 16, 2010Mar 17, 2011University Of South FloridaShip-deficiency to increase megakaryocyte and platelet production
US20110065109 *Jul 19, 2010Mar 17, 2011Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20110065773 *Jan 6, 2010Mar 17, 2011Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20110070162 *Mar 24, 2011Max-Phanck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20110092565 *Apr 21, 2011Alnylam Pharmaceuticals, Inc.Method of treating neurodegenerative disease
US20110098460 *Dec 17, 2009Apr 28, 2011Senesco Technologies, Inc.SiRNA Useful to Suppress expression of eIF-5A1
US20110098461 *Oct 25, 2010Apr 28, 2011University Of Southern CaliforniaNovel RNA Interference Methods Using DNA-RNA Duplex Constructs
US20110105363 *Dec 23, 2010May 5, 2011Dharmacon, Inc.siRNA targeting TNFa
US20110110483 *May 12, 2011Searete Llc, A Limited Liability Corporation Of The State Of DelawareMethods and systems for migrating fuel assemblies in a nuclear fission reactor
US20110112178 *Dec 30, 2010May 12, 2011Alnylam Pharmaceuticals, Inc.Compositions And Methods For Inhibiting Expression Of IKK-B Gene
US20110112283 *Oct 4, 2010May 12, 2011Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V.Rna interference mediating small rna molecules
US20110117088 *May 19, 2011Simon Michael RComposition and method for introduction of rna interference sequences into targeted cells and tissues
US20110118335 *Nov 16, 2010May 19, 2011Vasant JadhavRNA Interference Mediated Inhibition Of Gene Expression Using Multifunctional Short Interfering Nucleic Acid (Multifunctional siNA)
US20110124708 *Dec 14, 2010May 26, 2011Alcon Inc.Rnai-mediated inhibition of ocular hypertension targets
US20110124711 *May 26, 2011Alnylam Pharmaceuticals, Inc.COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Nav1.8 GENE
US20110130443 *Jun 2, 2011Hans-Peter VornlocherCompositions And Methods For Inhibiting Expression Of Factor V Leiden Mutant Gene
US20110142917 *Jun 7, 2009Jun 16, 2011Egvenia AlpertCompositions and methods for treatment of ear disorders
US20110143400 *Dec 15, 2010Jun 16, 2011Opko Ophthalmics, LlcSirna and methods of manufacture
US20110150897 *Oct 11, 2007Jun 23, 2011Meyer Thomas FInfluenza targets
US20110152347 *Jun 7, 2010Jun 23, 2011University Of MassachusettsMethods and compositions for controlling efficacy of RNA silencing
US20110152350 *Dec 16, 2010Jun 23, 2011Kevin FitzgeraldCompositions and Methods for Inhibiting Expression of XBP-1 Gene
US20110160277 *Oct 25, 2006Jun 30, 2011Sylentis S.A.U.Modulation of 11 beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases
US20110160286 *Jun 30, 2011University Of MassachusettsAllele-specific rna interference
US20110166199 *Jan 6, 2011Jul 7, 2011National Cheng Kung UniversityRNAi COMPOUND TARGETED TO THROMBOSPONDIN-1 AND APPLICATIONS THEREOF
US20110172286 *Jul 10, 2008Jul 14, 2011Neurim Pharmaceuticals (1991) Ltd.Cd44 splice variants in neurodegenerative diseases
US20110172291 *Dec 13, 2010Jul 14, 2011University Of MassachusettsRna interference for the treatment of gain-of-function disorders
US20110177131 *Jul 21, 2011Protiva Biotherapeutics, Inc.siRNA SILENCING OF FILOVIRUS GENE EXPRESSION
US20110184046 *Jul 13, 2009Jul 28, 2011Dinah Wen-Yee SahCompositions And Methods For Inhibiting Expression Of GSK-3 Genes
US20110190380 *Oct 23, 2008Aug 4, 2011Elena FeinsteinMethods for delivery of sirna to bone marrow cells and uses thereof
US20110190381 *Aug 4, 2011Alcon Inc.Rnai-mediated inhibition of frizzled related protein-1 for treatment of glaucoma
US20110201667 *Jul 20, 2010Aug 18, 2011Protiva Biotherapeutics, Inc.Compositions and methods for silencing ebola virus gene expression
US20110201671 *Aug 18, 2011Alnylam Pharmaceuticals, Inc.Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus
US20110207796 *Feb 13, 2009Aug 25, 2011Elan Pharma International LimitedAlpha-synuclein kinase
US20110213328 *Sep 1, 2011Medtronic, Inc.Methods and Systems for Treatment of Neurological Diseases of the Central Nervous System
US20110230542 *Sep 4, 2009Sep 22, 2011Pamela TanCompositions and Methods for Inhibiting Expression of the PCSK9 Gene
US20110245325 *Dec 14, 2009Oct 6, 2011Kureha CorporationPharmaceutical composition for treatment of cancer and asthma
US20120010106 *Jan 12, 2012Dharmacon, Inc.siRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US20120029061 *Oct 4, 2010Feb 2, 2012Thomas TuschlRna sequence-specific mediators of rna interference
US20120136041 *May 31, 2012Allergan, Inc.Treating Ocular Diseases Using Peroxisome Proliferator-Activated Receptor Delta Antagonists
US20120202215 *Feb 23, 2012Aug 9, 2012Jichi Medical UniversityMitochondrial function of prohibitin 2 (phb2)
US20130065939 *Sep 23, 2010Mar 14, 2013Protiva Biotherapeutics, Inc.Compositions and methods for silencing genes expressed in cancer
US20130066058 *Aug 10, 2012Mar 14, 2013John E. ThompsonUse of Antisense Oligonucleotides or siRNA to Suppress Expression of eIF-5A1
US20130131331 *May 23, 2013Genecare Research Institute Co., Ltd.Cancer-cell-specific cytostatic agent
US20130210676 *Mar 20, 2013Aug 15, 2013Dharmacon, Inc.siRNA Targeting Myeloid Differentiation Primary Response Gene (88) (MYD88)
US20130224311 *Mar 18, 2011Aug 29, 2013University Of South AlabamaMethods and compositions for the treatment of cancer
US20130331435 *May 30, 2013Dec 12, 2013Isis Pharmaceuticals, Inc.Antisense modulation of kinesin-like 1 expression
US20140010893 *Sep 17, 2013Jan 9, 2014University Of South CarolinaMethods for Affecting Homology-Directed DNA Double Stranded Break Repair
US20140051747 *Oct 22, 2013Feb 20, 2014Alnylam Pharmaceuticals, Inc.Compositions and Methods for Inhibiting Expression of an RNA from West Nile Virus
US20140057960 *Feb 20, 2013Feb 27, 2014Medical Diagnostic Laboratories, LlcNovel repressor on ifn-lambda promoter and sirna against zeb1 and blimp-1 to increase ifn-lambda gene activity
US20140057962 *Mar 12, 2012Feb 27, 2014Surinder K. BatraCompositions and Methods for the Treatment of Cancer
US20140135379 *Jan 17, 2014May 15, 2014Niigata UniversityMethod of fixing and expressing physiologically active substance
US20140179768 *Dec 18, 2013Jun 26, 2014Alnylam Pharmaceuticals, Inc.ANGIOPOIETIN-LIKE 3 (ANGPTL3) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
US20140315973 *Oct 7, 2011Oct 23, 2014Agency For Science, Technology And ResearchParp-1 inhibitors
US20140364485 *Sep 20, 2012Dec 11, 2014University Of South AlabamaMethods and compositions for the treatment of cancer
US20150099797 *Dec 16, 2014Apr 9, 2015Life Technologies CorporationOligonucleotide compositions with enhanced efficiency
DE102011118024A1Aug 1, 2011Feb 7, 2013Technische Universität DresdenNew procaspase 1 expression inhibitor, useful for preventing and/or treating inflammatory diseases, which are autoinflammatory diseases
EP2514758A1 *Mar 15, 2005Oct 24, 2012City of HopeMethods and compositions for the specific inhibition of gene expression by double-stranded RNA
WO2005044976A2 *Jun 18, 2004May 19, 2005Isis Pharmaceuticals, Inc.Oligomeric compounds for use in gene modulation
WO2005044976A3 *Jun 18, 2004Feb 23, 2006Brenda F BakerOligomeric compounds for use in gene modulation
WO2006020557A2 *Aug 9, 2005Feb 23, 2006Immusol, Inc.Methods of using or identifying agents that inhibit cancer growth
WO2006033965A2 *Sep 15, 2005Mar 30, 2006The Trustees Of The University Of PennsylvaniaNadph oxidase inhibition pharmacotherapies for obstructive sleep apnea syndrome and its associated morbidities
WO2006074346A2 *Jan 6, 2006Jul 13, 2006Alnylam Pharmaceuticals, Inc.RNAi MODULATION OF RSV AND THERAPEUTIC USES THEREOF
WO2006074346A3 *Jan 6, 2006Jul 5, 2007Alnylam Pharmaceuticals IncRNAi MODULATION OF RSV AND THERAPEUTIC USES THEREOF
WO2007047692A2 *Oct 13, 2006Apr 26, 2007Medtronic, Inc.Devices, systems and methods for improving memory and/or cognitive function through brain delivery of sirna
WO2007047692A3 *Oct 13, 2006Aug 2, 2007Medtronic IncDevices, systems and methods for improving memory and/or cognitive function through brain delivery of sirna
WO2007127919A3 *Apr 27, 2007Oct 30, 2008Alnylam Pharmaceuticals IncCompositions and methods for inhibiting expression of a gene from the jc virus
WO2007137237A2 *May 21, 2007Nov 29, 2007The Scripps Research InstituteTreatment of protein misfolding
WO2008002678A3 *Jun 29, 2007Oct 16, 2008Kota V RamanaStructural-based inhibitors of the glutathione binding site in aldose reductase, methods of screening therefor and methods of use
WO2008088836A2 *Jan 16, 2008Jul 24, 2008The Burnham Institute For Medical ResearchCompositions and methods for treatment of colorectal cancer
WO2008088836A3 *Jan 16, 2008Oct 16, 2008Burnham Inst Medical ResearchCompositions and methods for treatment of colorectal cancer
WO2011035065A1Sep 16, 2010Mar 24, 2011Nektar TherapeuticsMonoconjugated chitosans as delivery agents for small interfering nucleic acids
Legal Events
Mar 10, 2004ASAssignment
Feb 11, 2009ASAssignment
Nov 9, 2009ASAssignment
Effective date: 20091103
Jul 13, 2011ASAssignment
Effective date: 20110314
Effective date: 20110314
Effective date: 20110314
Jul 20, 2011ASAssignment
Effective date: 20110314
Effective date: 20110314
Effective date: 20110314
Effective date: 20110314