Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS20050004061 A1
Publication typeApplication
Application numberUS 10/847,642
Publication dateJan 6, 2005
Filing dateMay 17, 2004
Priority dateJul 15, 1994
Also published asCA2270345A1, CA2270345C, CN1235609A, CN100338086C, CN101265285A, DE69736331D1, DE69736331T2, EP0948510A1, EP0948510A4, EP0948510B1, EP1714969A2, EP1714969A3, EP1746159A2, EP1746159A3, EP2322615A1, EP2360252A1, EP2360252B1, EP2360252B8, US6207646, US7402572, US7517861, US7674777, US7723022, US7723500, US7879810, US7888327, US8058249, US8129351, US8158592, US8258106, US20030050261, US20040132685, US20040147468, US20040167089, US20040198688, US20040229835, US20050032736, US20050049215, US20050049216, US20050054602, US20050059625, US20050070491, US20050123523, US20050148537, US20050171047, US20050215500, US20050233995, US20050233999, US20050239732, US20050267064, US20050277604, US20050277609, US20060003955, US20060089326, US20070066553, US20070078104, US20080026011, US20080031936, US20090202575, US20100125101, WO1998018810A1
Publication number10847642, 847642, US 2005/0004061 A1, US 2005/004061 A1, US 20050004061 A1, US 20050004061A1, US 2005004061 A1, US 2005004061A1, US-A1-20050004061, US-A1-2005004061, US2005/0004061A1, US2005/004061A1, US20050004061 A1, US20050004061A1, US2005004061 A1, US2005004061A1
InventorsArthur Krieg, Joel Kline, Dennis Klinman, Alfred Steinberg
Original AssigneeThe University Of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., United States Of America, As Represented By The Secretary, Department Of Health & Human Services
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Immunostimulatory nucleic acid molecules
US 20050004061 A1
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
Images(19)
Previous page
Next page
Claims(82)
1-18. (Canceled)
19. A method for preventing or suppressing antigen-stimulated, eosinophilic inflammation in an antigen-exposed subject comprising
administering to the subject an isolated immunostimulatory oligonucleotide comprising X1X2CGX3X4, wherein C and G are unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the immunostimulatory oligonucleotide is between 6 and 100 bases in length,
in an amount to suppress a Th2 immune response, whereby eosinophilic inflammation is prevented or suppressed.
20. The method of claim 19, wherein the immunostimulatory oligonucleotide includes a nucleotide sequence consisting of 5′-purine-purine-CG-pyrimidine-pyrimidine-3′.
21. The method of claim 20, wherein the nucleotide sequence consists of AACGTT.
22. The method of claim 19, wherein the immunostimulatory oligonucleotide comprises a nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
23. The method of claim 19, wherein the subject has asthma, allergic rhinitis, eczema, hay fever or urticaria.
24. The method of claim 19, wherein the eosinophilic inflammation occurs in a tissue affected by asthma, allergic rhinitis, eczema, hay fever or urticaria.
25. The method of claim 19, wherein the eosinophilic inflammation is in the lung.
26. The method of claim 25, wherein the subject has asthma.
27. The method of claim 19, wherein the immunostimulatory oligonucleotide is 8-100 bases in length.
28. The method of claim 19, wherein the immunostimulatory oligonucleotide is 8-40 bases in length.
29. A method for boosting an immune response of a subject comprising
administering to the subject an isolated immunostimulatory oligonucleotide comprising X1X2CGX3X4,
wherein C and G are unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the immunostimulatory oligonucleotide is between 6 and 100 bases in length, and
wherein an increase in activation of the subject's lymphocytes or NK cells indicates that the subject's immune response has been boosted.
30. The method of claim 29, wherein the activation of the subject's lymphocytes or NK cells is lymphocyte proliferation.
31. The method of claim 29, wherein the activation of the subject's lymphocytes or NK cells is IgM secretion.
32. The method of claim 29, wherein the activation of the subject's lymphocytes or NK cells is increased expression of IL-12 and IFN-gamma.
33. The method of claim 29, wherein the subject has an immune system deficiency.
34. The method of claim 33, wherein the immune system deficiency is an infection.
35. The method of claim 34, wherein the infection is a bacterial, viral, fungal or parasitic infection.
36. The method of claim 33, wherein the immune system deficiency is a bacterial infection by bacteria having bacterial antigens and wherein the increase in lymphocyte or NK activation is activated B cell with antigen receptors specific for the bacterial antigens.
37. The method of claim 33, wherein the immune system deficiency is cancer.
38. The method of claim 30, wherein the immunostimulatory oligonucleotide is 8-100 bases in length.
39. The method of claim 30, wherein the immunostimulatory oligonucleotide is 8-40 bases in length.
40. The method of claim 29, wherein the immunostimulatory oligonucleotide is administered in conjunction with a vaccine.
41. The method of claim 29, wherein the immunostimulatory oligonucleotide is not administered in conjunction with a vaccine.
42. The method of claim 29, wherein the immunostimulatory oligonucleotide includes a nucleotide sequence consisting of 5′-purine-purine-CG-pyrimidine-pyrimidine-3′.
43. The method of claim 42, wherein the nucleotide sequence consists of AACGTT.
44. The method of claim 29, wherein the immunostimulatory oligonucleotide comprises a nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
45. The method of claim 29, wherein the subject has asthma, allergic rhinitis, eczema, hay fever or urticaria.
46. The method of claim 29, wherein the immune response occurs in a tissue affected by eczema, allergic rhinitis, hay fever or urticaria.
47. The method of claim 29, wherein the immune response occurs in the lung.
48. The method of claim 45, wherein the subject has asthma and the subject develops a Th1 immune response to an allergen.
49. The method of claim 29, wherein the subject has a viral or a parasitic infection and the immune response to the infection is boosted.
50. The method of claim 49, wherein the infection is a viral infection.
51. A method for shifting the immune response of a subject to an antigen toward a Th1 immune response comprising
administering to the subject an isolated immunostimulatory oligonucleotide comprising X1X2CGX3X4, wherein C and G are unmethylated and X1, X2, X3 and X4 are nucleotides and wherein the immunostimulatory oligonucleotide is between 6 and 100 bases in length,
wherein detection of a Th1 type immune response by the subject indicates that the shift to the Th1 immune response has been achieved.
52. The method of claim 51, wherein the shift to the Th1 immune response is further associated with suppression of a Th2 immune response.
53. The method of claim 51, wherein the immunostimulatory oligonucleotide includes a nucleotide sequence consisting of 5′-purine-purine-CG-pyrimidine-pyrimidine-3′.
54. The method of claim 53, wherein the nucleotide sequence consists of AACGTT.
55. The method of claim 51, wherein the immunostimulatory oligonucleotide comprises a nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
56. The method of claim 51, wherein the subject has asthma, allergic rhinitis, eczema, hay fever or urticaria, and the shift to the Th1 immune response prevents or suppresses eosinophilic inflammation in the subject.
57. The method of claim 56, wherein the eosinophilic inflammation is in a tissue affected by asthma, allergic rhinitis, eczema, hay fever or urticaria
58. The method of claim 56, wherein the eosinophilic inflammation is in the lung.
59. The method of claim 51, wherein the subject has asthma and the shift to the Th1 immune response prevents or suppresses eosinophil infiltration into the lung of the subject.
60. The method of claim 51, wherein the subject has a viral or parasitic infection and the shift to the Th1 immune response boosts the immune response to the infection.
61. The method of claim 60, wherein the infection is a viral infection.
62. The method of claim 19, wherein the desired result is measured by detecting in a sample containing lymphocyte obtained from the immunostimulatory oligonucleotide treated subject: (1) a lower level of IL-4 in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control; or (2) a higher level of IL-12-and/or IFN gamma in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.
63. The method of claim 19, wherein prevention or suppression of eosinophilic inflammation is measured by detecting lower levels of eosinophils in an inflammatory infiltrate in the lung in an immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.
64. The method of claim 51, wherein the immunostimulatory oligonucleotide is 8-100 bases in length.
65. The method of claim 51, wherein the immunostimulatory oligonucleotide is 8-40 bases in length.
66. The method of claim 51, wherein the immunostimulatory oligonucleotide is administered in conjunction with a vaccine.
67. The method of claim 51, wherein the immunostimulatory oligonucleotide is not administered in conjunction with a vaccine.
68. A method for preventing or reducing antigen-stimulated, granulocyte-mediated inflammation in a tissue of an antigen-sensitized subject comprising
administering an isolated immunostimulatory oligonucleotide to the subject,
wherein a reduction in, or the absence of, a Th2 type immune response measured in the subject, or a reduction in, or the absence of, other clinical signs of inflammation in the subject after antigen challenge, indicates that the desired prevention or reduction in granulocyte-mediated inflammation has been achieved.
69. The method of claim 68, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence consisting of 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′.
70. The method of claim 69, wherein the hexameric nucleotide sequence consists of AACGTT.
71. The method of claim 68, wherein the immunostimulatory oligonucleotide comprises a hexameric nucleotide sequence selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
72. The method of claim 68, wherein the subject is suffering from an condition induced by the sensitizing antigen selected from the group of inflammatory conditions consisting of asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous basophil hypersensitivity.
73. The method of claim 68, wherein the inflammation is in skin or mucosa.
74. The method of claim 73, wherein the inflammation is in a respiratory tissue.
75. The method of claim 68, wherein the subject is suffering from asthma.
76. The method of claim 68, wherein the desired result is measured by detecting in a sample containing lymphocytes obtained from the immunostimulatory oligonucleotide treated subject: (1) a lower level of IL-4 in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control; or (2) a higher level of IL-12 and/or IFN gamma in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.
77. A method for boosting the immune responsiveness of a subject to a sensitizing antigen without immunization of the subject by the sensitizing antigen comprising administering an isolated immunostimulatory oligonucleotide to the subject, wherein an increase in the magnitude of the subject's immune response to the sensitizing antigen indicates that the desired boost to the subject's immune responsiveness has been achieved.
78. The method of claim 77, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence consisting of 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′.
79. The method of claim 78, wherein the hexameric nucleotide sequence consists of AACGTT.
80. The method of claim 77, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence is selected from the group of sequences consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
81. The method of claim 77, wherein the subject is suffering from an inflammatory condition induced by the sensitizing antigen selected from the group of inflammatory conditions consisting of asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous basophil hypersensitivity.
82. The method of claim 81, wherein the immune response is in skin or mucosa.
83. The method of claim 82, wherein the immune response is in respiratory tissue.
84. The method of claim 83, wherein the subject is suffering from asthma and the subject's immune responsiveness to a respiratory allergen is boosted.
85. The method of claim 77, wherein the antigen is presented by a pathogen and the subject's immune responsiveness to an intracellular infection by the pathogen is boosted.
86. The method of claim 85, wherein the pathogen is a virus.
87. A method for shifting the immune response of a subject to a sensitizing antigen toward a Th1 phenotype comprising
administering an isolated immunostimulatory oligonucleotide to the subject,
wherein detection of a Th1 type immune response by the subject indicates that the desired shift to the Th1 phenotype has been achieved.
88. The method of claim 87, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence consisting of 5′-Purine-Purine-[C]-[G]-Pyrimidine-Pyrimidine-3′.
89. The method of claim 88, wherein the hexameric nucleotide sequence consists of AACGTT.
90. The method of claim 87, wherein the immunostimulatory oligonucleotide includes a hexameric nucleotide sequence is selected from the group consisting of GTCGTT, GTCGCT, GTCGGT, GGCGTT, GGCGCT, GGCGGT, GACGTT, GACGCT, GACGGT, AACGTT, AACGCT and AACGGT.
91. The method of claim 87, wherein the subject is suffering from an inflammatory condition induced by the sensitizing antigen selected from the group of inflammatory conditions consisting of asthma, allergic rhinitis, atopic dermatitis, allergic conjunctivitis and cutaneous basophil hypersensitivity, and the shift to the Th1 phenotype reduces granulocyte-mediated inflammation in the affected tissue.
92. The method of claim 91, wherein the affected tissue is skin or mucosa.
93. The method of claim 92, wherein the affected tissue is respiratory tissue.
94. The method of claim 93, wherein the subject is suffering from asthma and the shift to the Th1 phenotype reduces eosinophil infiltration of the lung.
95. The method of claim 87, wherein the subject is suffering from an intracellular infection by a pathogen and the shift to the Th1 phenotype strengthens the subject's immune response to the pathogen.
96. The method of claim 91, wherein the pathogen is a virus.
97. The method of claim 87, wherein the desired result is measured by detecting in a sample containing lymphocytes obtained from the immunostimulatory oligonucleotide treated subject: (1) a lower level of IL-4 in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control; or (2) a higher level of IL-12 and/or IFN gamma in the immunostimulatory oligonucleotide treated subject as compared to an antigen-challenged control.
98. The method of claim 68, wherein reduction or suppression of inflammation is measured by assaying inflammatory infiltrate from the subject for a reduction in granulocyte counts in inflammatory infiltrate of an affected subject tissue as measured in an antigen challenged subject before and after ISS-ODN administration or detection of lower levels of granulocyte counts in an ISS-ODN treated subject as compared to an antigen-challenged control
99. The method of claim 48, wherein the allergen is pollen, animal dander or dust.
Description
    RELATED APPLICATIONS
  • [0001]
    This application is a divisional of co-pending U.S. patent application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a continuation-in-part of U.S. patent application Ser. No. 08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No. 6,194,388, which is a continuation-in-part of U.S. patent application Ser. No. 08/276,358, filed Jul. 15, 1994, now abandoned.
  • GOVERNMENT SUPPORT
  • [[0002]]
    The work resulting in this invention was supported in part by National Institute of Health Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.
  • BACKGROUND OF THE INVENTION
  • [0003]
    DNA Binds To Cell Membranes And Is Internalized
  • [0004]
    In the 1970's, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. “Membrane-associated DNA in the cytoplasm of diploid human lymphocytes”. Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. “Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy”. Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt. 1985. “DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA”. J. Clin. Invest. 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991. “Cellular uptake of antisense oligodeoxynucleotides”. Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992. “Pharmaceutical aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides”. In: Gene Regulation: Biology of Antisense RNA and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. “Stage specific oligonucleotide uptake in murine bone marrow B cell precursors”. Blood, 84:3660). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.
  • [0005]
    Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. Antisense Research and Development 1:161).
  • [0006]
    Immune Effects Of Nucleic Acids
  • [0007]
    Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985. “Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose”. Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. “Immunomodulation of natural killer activity by polyribonucleotides”. J. Biol. Resp. Mod. 4:512; Krown, S. E. 1986. “Interferons and interferon inducers in cancer treatment”. Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. “Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects”. Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-β secretion (Ishikawa, R., and C. A. Biron. 1993. “IFN induction and associated changes in splenic leukocyte distribution”. J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.
  • [0008]
    Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. J. Immunol. 134:3204; and Goodman, M. G. 1986. “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation”. J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5′ triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human γδ T cells (Constant, P., F. Davodeau, M. -A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J. -J. Foumie. 1994. “Stimulation of human γδ T cells by nonpeptidic mycobacterial ligands” Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.
  • [0009]
    Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart. 1990. “Immunogenic DNA-related factors”. J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG)●(dC) and poly (dG● dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. “The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens”. Cell. Immunol.147:148). Tokunaga, et al. have reported that dG●dC induces IFN-γ and NK activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. “A synthetic single-stranded DNA, poly(dG,dC), induces interferon-α/β and -γ, augments natural killer activity, and suppresses tumor growth” Jpn. J. Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. “Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA”. J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. “Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity”. J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. “Oligonucleotide sequences required for natural killer cell activation”. Jpn. J. Cancer Res. 83:1128).
  • [0010]
    Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. “An antisense oligonucleotide complementary to a sequence in Iγ2b increases γ2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion”. J. Exp. Med. 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. “Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1”. Biochem. Pharmacol. 45:2037; McIntyre, K. W., K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R. Narayanan. 1993. “A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NFκB T65 causes sequence-specific immune stimulation”. Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich. 1993. “Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus”. Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.
  • [0011]
    The CREB/ATF Family Of Transcription Factors And Their Role In Replication
  • [0012]
    The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero- dimers through the cAMP response element, the CRE, the consensus form of which is the unmethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).
  • [0013]
    The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein: “Induction of CREB activity via the surface Ig receptor of B cells”. J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1β gene”. Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: “Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice”. Cancer Res. 53:577, 1993), IFN-β (Du, W., and T. Maniatis: “An ATF/CREB binding site protein is required for virus induction of the human interferon B gene”. Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-β1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF-β2, class II MHC (Cox, P. M., and C. R. Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8α, the germline Iga constant region gene, the TCR Vβ gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: “Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes”. Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca++ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: “Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB”. Neuron 4:571, 1990).
  • [0014]
    The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. There are several published studies reporting direct or indirect interactions between NFKB proteins and CREB/ATF proteins (Whitley, et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB341 on ser133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”. Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: “Activation of cAMP and mitogen responsive genes relies on a common nuclear factor”. Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C. -Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and K. A. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994.).
  • [0015]
    Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y. -N., S. Crawford, J. Stall, D. R. Rawlins, K. -T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. J. Virol. 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus E1A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates EIA inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: “E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators”. Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, which binds to CREB/ATF proteins and redirects them from their normal cellular binding sites to different DNA sequences (flanked by G- and C-rich sequences) present within the HTLV transcriptional enhancer (Paca-Uccaralertkun, S., L. -J. Zhao, N. Adya, J. V. Cross, B. R. Cullen, I. M. Boros, and C. -Z. Giam: “In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax”. Mol. Cell. Biol. 14:456, 1994; Adya, N., L. -J. Zhao, W. Huang, I. Boros, and C. -Z. Giam: ”Expansion of CREB's DNA recognition specificity by Tax results from interaction with Ala-Ala-Arg at positions 282-284 near the conserved DNA-binding domain of CREB”. Proc. Natl. Acad. Sci. USA 91:5642, 1994).
  • SUMMARY OF THE INVENTION
  • [0016]
    The instant invention is based on the finding that certain nucleic acids containing unmethylated cytosine-guanine (CpG) dinucleotides activate lymphocytes in a subject and redirect a subject's immune response from a Th2 to a Th1 (e.g. by inducing monocytic cells and other cells to produce Th1 cytokines, including IL-12, IFN-γ and GM-CSF). Based on this finding, the invention features, in one aspect, novel immunostimulatory nucleic acid compositions.
  • [0017]
    In a preferred embodiment, the immunostimulatory nucleic acid contains a consensus mitogenic CpG motif represented by the formula:
    5′ X1CGX2 3′
  • [0018]
    wherein X1 is selected from the group consisting of A,G and T; and X2 is C or T.
  • [0019]
    In a particularly preferred embodiment an immunostimulatory nucleic acid molecule contains a consensus mitogenic CpG motif represented by the formula:
    5′ X1X2CGX3X4 3′
  • [0020]
    wherein C and G are unmethylated; and X1, X2, X3 and X4 are nucleotides.
  • [0021]
    Enhanced immunostimulatory activity of human cells occurs where X1X2 is selected from the group consisting of GpT, GpG, GpA and ApA and/or X3X4 is selected from the group consisting of TpT, CpT and GpT (Table 5). For facilitating uptake into cells, CpG containing immunostimulatory nucleic acid molecules are preferably in the range of 8 to 40 base pairs in size. However, nucleic acids of any size (even many kb long) are immunostimulatory if sufficient immunostimulatory motifs are present, since such larger nucleic acids are degraded into oligonucleotides inside of cells. Preferred synthetic oligonucleotides do not include a GCG trinucleotide sequence at or near the 5′ and/or 3′ terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.
  • [0022]
    In a second aspect, the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules. For example, the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject). In addition, immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.
  • [0023]
    Further, by redirecting a subject's immune response from Th2 to Th1, the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma. In addition, the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.
  • [0024]
    Further, the ability of immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.
  • [0025]
    Other features and advantages of the invention will become more apparent from the following detailed description and claims.
  • BRIEF DESCRIPTION OF THE FIGURES
  • [0026]
    FIG. 1A-C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures. A. E. coli DNA (●) and calf thymus DNA (▪) sequences and LPS (at 10× the concentration of E. coli and calf thymus DNA) (♦). B. Control phosphodiester oligodeoxynucleotide (ODN) 5′ATGGAAGGTCCAGTGTTCTC3′ (SEQ ID NO: 1) (▪) and two phosphodiester CpG ODN 5′ATCGACCTACGTGCGTTCTC3′ (SEQ ID NO:2) (♦) and 5′TCCATAACGTTCCTGATGCT3′ (SEQ ID NO:3) (●). C. Control phosphorothioate ODN 5′GCTAGATGTTAGCGT3′ (SEQ ID NO:4) (▪) and two phosphorothioate CpG ODN 5′GAGAACGTCGACCTTCGAT3′ (SEQ ID NO:5) (♦) and 5′GCATGACGTTGAGCT3′ (SEQ ID NO:6) (●). Data present the meanąstandard deviation of triplicates.
  • [0027]
    FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice. BALB/c mice (two mice/group) were injected iv. with 100 μl of PBS (□) or 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (▪) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) (♦).
  • [0028]
    FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 μl of PBS, 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8).
  • [0029]
    FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-L-6. Splenic B-cells from DBA/2 mice were stimulated with CpG ODN 5′TCCAAGACGTTCCTGATGCT3′ (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 (♦) or isotype control Ab (●) and IgM levels in culture supernatants determined by ELISA. In the absence of CpG ODN, the anti-L-6 Ab had no effect on IgM secretion (▪).
  • [0030]
    FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (♦) or anti- L-6 antibody only (▪). Data present the meanąstandard deviation of triplicates.
  • [0031]
    FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or L-6 promoter-CAT construct alone or cultured with CpG 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.
  • [0032]
    FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown. The immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN-γ
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US5112605 *Mar 17, 1989May 12, 1992Genentech, Inc.Temporal gamma-interferon administration for allergies
US5498410 *Sep 30, 1993Mar 12, 1996Gleich; Gerald J.Method for the treatment of eosinophil-associated conditions with anionic polymers
US5723335 *Sep 11, 1996Mar 3, 1998Isis Pharmaceuticals, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US5726160 *Nov 22, 1996Mar 10, 1998Milkhaus Laboratories, Inc.Methods for treating respiratory disease
US5908620 *Oct 3, 1997Jun 1, 1999National Jewish Medical And Research CenterTreatment for diseases involving inflammation
US6025339 *Nov 26, 1996Feb 15, 2000East Carolina UniversityComposition, kit and method for treatment of disorders associated with bronchoconstriction and lung inflammation
US6040296 *Jun 7, 1995Mar 21, 2000East Carolina UniversitySpecific antisense oligonucleotide composition & method for treatment of disorders associated with bronchoconstriction and lung inflammation
US6174872 *Dec 15, 1998Jan 16, 2001The Regents Of The University Of CaliforniaMethod for treating allergic lung disease
US6194388 *Feb 7, 1995Feb 27, 2001The University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US6207646 *Oct 30, 1996Mar 27, 2001University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US6214806 *Feb 25, 1998Apr 10, 2001University Of Iowa Research FoundationUse of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
US6218371 *Apr 2, 1999Apr 17, 2001University Of Iowa Research FoundationMethods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6221882 *Jul 2, 1998Apr 24, 2001University Of Iowa Research FoundationMethods for inhibiting immunostimulatory DNA associated responses
US6239116 *Oct 30, 1997May 29, 2001University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US6339068 *May 20, 1998Jan 15, 2002University Of Iowa Research FoundationVectors and methods for immunization or therapeutic protocols
US6399630 *Jan 23, 2001Jun 4, 2002University Of Iowa Research FoundationMethods for inhibiting immunostimulatory DNA associated responses
US6406705 *Jun 3, 1999Jun 18, 2002University Of Iowa Research FoundationUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6514948 *Jul 2, 1999Feb 4, 2003The Regents Of The University Of CaliforniaMethod for enhancing an immune response
US6521637 *Apr 2, 2002Feb 18, 2003University Of Iowa Research FoundationMethods for inhibiting immunostimulatory DNA associated responses
US6558670 *Apr 29, 1999May 6, 2003Smithkline Beechman Biologicals S.A.Vaccine adjuvants
US6562798 *Jun 1, 1999May 13, 2003Dynavax Technologies Corp.Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US6727230 *Jan 20, 1998Apr 27, 2004Coley Pharmaceutical Group, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US6994870 *Dec 23, 2002Feb 7, 2006Jaw-Ji TsaiLocal nasal immunotherapy with allergen strip for allergic rhinitis
US7001890 *Jan 23, 1998Feb 21, 2006Coley Pharmaceutical GmbhPharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US7208478 *Mar 20, 2003Apr 24, 2007The Regents Of The University Of CaliforniaImmunostimulatory polynucleotide/immunomodulatory molecule conjugates
US7223398 *Nov 14, 2000May 29, 2007Dynavax Technologies CorporationImmunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US7223741 *Jul 14, 2003May 29, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7354711 *Jan 3, 2003Apr 8, 2008University Of Iowa Research FoundationMethods for inhibiting immunostimulatory DNA associated responses
US7488490 *Dec 18, 2001Feb 10, 2009University Of Iowa Research FoundationMethod of inducing an antigen-specific immune response by administering a synergistic combination of adjuvants comprising unmethylated CpG-containing nucleic acids and a non-nucleic acid adjuvant
US7514414 *Sep 24, 2002Apr 7, 2009The United States Of America As Represented By The Department Of Health And Human ServicesSuppressors of CpG oligonucleotides and methods of use
US7514415 *Jul 31, 2003Apr 7, 2009The United States Of America As Represented By The Department Of Health And Human ServicesMethod of treating inflammatory arthropathies with suppressors of CpG oligonucleotides
US7517861 *Jul 9, 2004Apr 14, 2009University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7521063 *Jul 12, 2002Apr 21, 2009The United States Of America As Represented By The Department Of Health And Human ServicesMultiple CPG oligodeoxynucleotides and their use to induce an immune response
US7524828 *Aug 18, 2004Apr 28, 2009University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20030026782 *Oct 8, 1999Feb 6, 2003Arthur M. KriegImmunomodulatory oligonucleotides
US20030026801 *Jun 22, 2001Feb 6, 2003George WeinerMethods for enhancing antibody-induced cell lysis and treating cancer
US20030027782 *May 13, 2002Feb 6, 2003Carson Dennis A.Method for treating allergic lung disease
US20030050263 *Aug 16, 2001Mar 13, 2003The University Of Iowa Research FoundationMethods and products for treating HIV infection
US20030055014 *Dec 14, 2001Mar 20, 2003Bratzler Robert L.Inhibition of angiogenesis by nucleic acids
US20030064064 *Aug 6, 2002Apr 3, 2003Dino DinaMethods of treating IgE-associated disorders and compositions for use therein
US20030078223 *Mar 15, 2002Apr 24, 2003Eyal RazCompositions and methods for modulating an immune response
US20030091599 *Nov 20, 2002May 15, 2003Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030092663 *Aug 26, 2002May 15, 2003Eyal RazImmunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype
US20030100527 *Jun 3, 2002May 29, 2003The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules for activating dendritic cells
US20040009949 *Jun 5, 2003Jan 15, 2004Coley Pharmaceutical Group, Inc.Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040030118 *Feb 24, 2003Feb 12, 2004Hermann WagnerMethods for regulating hematopoiesis using CpG-oligonucleotides
US20040038922 *Oct 8, 2001Feb 26, 2004Jean HaenslerVaccine composition
US20040053880 *Jul 3, 2003Mar 18, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040064064 *Sep 30, 2002Apr 1, 2004Qienyuan ZhouMethod and system for detecting the effects of alzheimer's disease in the human retina
US20040067902 *Feb 2, 2001Apr 8, 2004Bratzler Robert L.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040067905 *Jul 3, 2003Apr 8, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040087534 *Jul 30, 2003May 6, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040087538 *Nov 21, 2003May 6, 2004University Of Iowa Research FoundationMethods of treating cancer using immunostimulatory oligonucleotides
US20040092472 *Jul 3, 2003May 13, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040106568 *Jul 25, 2003Jun 3, 2004University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20050004062 *May 17, 2004Jan 6, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050009774 *Jul 9, 2004Jan 13, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050013812 *Jul 14, 2003Jan 20, 2005Dow Steven W.Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050032734 *May 3, 2004Feb 10, 2005Krieg Arthur M.Vectors and methods for immunization or therapeutic protocols
US20050032736 *Jul 9, 2004Feb 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050037403 *Jul 9, 2004Feb 17, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050037985 *Aug 25, 2003Feb 17, 2005Krieg Arthur M.Methods and products for treating HIV infection
US20050043529 *Apr 23, 2004Feb 24, 2005Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050049215 *Jul 9, 2004Mar 3, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050049216 *Jul 16, 2004Mar 3, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050054601 *Jul 16, 2004Mar 10, 2005Coley Pharmaceutical GmbhPharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050054602 *Jul 16, 2004Mar 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050059619 *Aug 19, 2003Mar 17, 2005Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US20050059625 *Jul 2, 2004Mar 17, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050070491 *Jul 3, 2003Mar 31, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050075302 *Aug 18, 2003Apr 7, 2005Coley Pharmaceutical Group, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US20050100983 *Nov 5, 2004May 12, 2005Coley Pharmaceutical GmbhCell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101554 *Jul 25, 2003May 12, 2005University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20050101557 *Aug 18, 2004May 12, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050119273 *Jun 18, 2004Jun 2, 2005Coley Pharmaceutical GmbhSmall molecule toll-like receptor (TLR) antagonists
US20050123523 *Aug 26, 2004Jun 9, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050130911 *Sep 27, 2004Jun 16, 2005Coley Pharmaceutical Group, Inc.Nucleic acid-lipophilic conjugates
US20060003955 *Feb 25, 2005Jan 5, 2006University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003962 *Jul 15, 2005Jan 5, 2006Coley Pharmaceutical Group, Ltd.Methods and products related to treatment and prevention of hepatitis C virus infection
US20060019916 *Apr 4, 2005Jan 26, 2006Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for inducing IL-10 responses
US20060019923 *Jul 18, 2005Jan 26, 2006Coley Pharmaceutical Group, Ltd.Methods and compositions for inducing innate immune responses
US20060058251 *Mar 6, 2003Mar 16, 2006University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20060089326 *Dec 7, 2005Apr 27, 2006University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060094683 *Dec 7, 2005May 4, 2006University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20060140875 *Oct 20, 2005Jun 29, 2006Coley Pharmaceutical Group, Inc.Semi-soft C-class immunostimulatory oligonucleotides
US20070009482 *May 11, 2005Jan 11, 2007University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070010470 *May 11, 2005Jan 11, 2007University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070037767 *Sep 22, 2006Feb 15, 2007Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20070065467 *Aug 11, 2006Mar 22, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules for activating dendritic cells
US20070066553 *Aug 11, 2006Mar 22, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20070066554 *Aug 18, 2006Mar 22, 2007Coley Pharmaceutical GmbhImmunostimulatory nucleic acids
US20070078104 *Sep 22, 2006Apr 5, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20070129320 *Jul 18, 2005Jun 7, 2007Coley Pharmaceutical Group, Ltd.Methods and compositions for inducing innate immune responses
US20080009455 *Feb 24, 2006Jan 10, 2008Coley Pharmaceutical Group, Inc.Immunostimulatory oligonucleotides
US20080026011 *Jun 5, 2007Jan 31, 2008University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20080031936 *Nov 10, 2006Feb 7, 2008University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20080045473 *Feb 15, 2007Feb 21, 2008Coley Pharmaceutical GmbhCompositions and methods for oligonucleotide formulations
US20080113929 *Jun 8, 2005May 15, 2008Coley Pharmaceutical GmbhAbasic Oligonucleotide as Carrier Platform for Antigen and Immunostimulatory Agonist and Antagonist
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US7271156Dec 9, 2002Sep 18, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acids
US7410975Jun 18, 2004Aug 12, 2008Coley Pharmaceutical Group, Inc.Small molecule toll-like receptor (TLR) antagonists
US7507802Sep 26, 2002Mar 24, 2009Eyegene, Inc.Immune stimulating and controlling composition comprising bacterial chromosomal DNA fragments and non-toxic lipopolysaccharides
US7534772Jun 22, 2001May 19, 2009University Of Iowa Research FoundationMethods for enhancing antibody-induced cell lysis and treating cancer
US7662949Nov 22, 2006Feb 16, 2010Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
US7674777Jan 30, 2004Mar 9, 2010University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7713529Nov 27, 2002May 11, 2010University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US7723022Jan 14, 2005May 25, 2010University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7723500Aug 11, 2006May 25, 2010University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7741300Dec 27, 2005Jun 22, 2010National Jewish Medical And Research CenterMethods of using nucleic acid vector-lipid complexes
US7776343Feb 17, 2000Aug 17, 2010Csl LimitedImmunogenic complexes and methods relating thereto
US7776344Jul 8, 2005Aug 17, 2010University Of Iowa Research FoundationMethods related to immunostimulatory nucleic acid-induced interferon
US7795235Dec 17, 2008Sep 14, 2010Coley Pharmaceutical GmbhSemi-soft c-class immunostimulatory oligonucleotides
US7807803Jul 3, 2003Oct 5, 2010Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US7820379Mar 18, 2005Oct 26, 2010Coley Pharmaceutical GmbhProcess for high throughput screening of CpG-based immuno-agonist/antagonist
US7879810Oct 1, 2004Feb 1, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7888327Mar 25, 2009Feb 15, 2011University Of Iowa Research FoundationMethods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US7935675Jun 21, 1999May 3, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7956043Dec 11, 2003Jun 7, 2011Coley Pharmaceutical Group, Inc.5′ CpG nucleic acids and methods of use
US7998492Oct 29, 2003Aug 16, 2011Coley Pharmaceutical Group, Inc.Methods and products related to treatment and prevention of hepatitis C virus infection
US8008266Nov 21, 2003Aug 30, 2011University Of Iowa FoundationMethods of treating cancer using immunostimulatory oligonucleotides
US8058249Jul 16, 2004Nov 15, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US8114419May 26, 2009Feb 14, 2012Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US8114848May 11, 2005Feb 14, 2012The United States Of America As Represented By The Department Of Health And Human ServicesImmunomodulatory oligonucleotides
US8129351Feb 25, 2005Mar 6, 2012The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US8148340Jul 9, 2004Apr 3, 2012The United States Of America As Represented By The Department Of Health And Human ServicesImmunomodulatory oligonucleotides
US8153141Apr 4, 2003Apr 10, 2012Coley Pharmaceutical GmbhImmunostimulatory G, U-containing oligoribonucleotides
US8158592Jan 7, 2005Apr 17, 2012Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acid molecules
US8173141Jul 1, 2009May 8, 2012Csl LimitedImmunogenic complexes and methods relating thereto
US8188254Oct 29, 2004May 29, 2012Coley Pharmaceutical GmbhC-class oligonucleotide analogs with enhanced immunostimulatory potency
US8202688Nov 20, 2002Jun 19, 2012University Of Iowa Research FoundationUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US8258106Nov 10, 2006Sep 4, 2012University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US8283328Aug 19, 2003Oct 9, 2012Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US8304396Oct 4, 2006Nov 6, 2012Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US8309527Feb 26, 2004Nov 13, 2012University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US8354522Mar 14, 2011Jan 15, 2013Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
US8574599May 21, 1999Nov 5, 2013Ottawa Hospital Research InstituteMethods and products for inducing mucosal immunity
US8580268Sep 27, 2007Nov 12, 2013Coley Pharmaceutical GmbhCpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US8658607Mar 3, 2006Feb 25, 2014Zoetis BelgiumImmunostimulatory G, U-containing oligoribonucleotides
US8834900Aug 19, 2002Sep 16, 2014University Of Iowa Research FoundationCombination motif immune stimulatory oligonucleotides with improved activity
US8883174Mar 25, 2010Nov 11, 2014The Board Of Regents, The University Of Texas SystemCompositions for stimulation of mammalian innate immune resistance to pathogens
US9186400Oct 21, 2014Nov 17, 2015The Board Of Regents, The University Of Texas SystemCompositions for stimulation of mammalian innate immune resistance to pathogens
US9382545Oct 4, 2013Jul 5, 2016Coley Pharmaceutical GmbhCpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US9428536Jan 21, 2014Aug 30, 2016Zoetis Belgium SaImmunostimulatory G, U-containing oligoribonucleotides
US9504742Sep 23, 2015Nov 29, 2016The Board Of Regents, The University Of Texas SystemCompositions for stimulation of mammalian innate immune resistance to pathogens
US20010044416 *Jan 22, 2001Nov 22, 2001Mccluskie Michael J.Immunostimulatory nucleic acids for inducing a Th2 immune response
US20020164341 *Dec 18, 2001Nov 7, 2002Loeb Health Research Institute At The Ottawa HospitalUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030026801 *Jun 22, 2001Feb 6, 2003George WeinerMethods for enhancing antibody-induced cell lysis and treating cancer
US20030091599 *Nov 20, 2002May 15, 2003Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030139364 *Oct 15, 2002Jul 24, 2003University Of Iowa Research FoundationMethods and products for enhancing immune responses using imidazoquinoline compounds
US20030191079 *Nov 27, 2002Oct 9, 2003University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20030212026 *Dec 9, 2002Nov 13, 2003University Of Iowa Research FoundationImmunostimulatory nucleic acids
US20030224010 *May 9, 2003Dec 4, 2003Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030232074 *Apr 4, 2003Dec 18, 2003Coley Pharmaceutical GmbhImmunostimulatory G, U-containing oligoribonucleotides
US20040067905 *Jul 3, 2003Apr 8, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040087538 *Nov 21, 2003May 6, 2004University Of Iowa Research FoundationMethods of treating cancer using immunostimulatory oligonucleotides
US20040092472 *Jul 3, 2003May 13, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040106568 *Jul 25, 2003Jun 3, 2004University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20040131628 *Sep 19, 2003Jul 8, 2004Bratzler Robert L.Nucleic acids for the treatment of disorders associated with microorganisms
US20040132685 *Dec 22, 2003Jul 8, 2004The University Of Iowa Research FoundationImmunostimulatory nucleic acid
US20040142469 *Feb 26, 2004Jul 22, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040147468 *Oct 3, 2003Jul 29, 2004Krieg Arthur MImmunostimulatory nucleic acid molecules
US20040152649 *Jul 3, 2003Aug 5, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040152657 *Feb 26, 2004Aug 5, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040157791 *Feb 5, 2004Aug 12, 2004Dow Steven W.Systemic immune activation method using nucleic acid-lipid complexes
US20040167089 *Jan 30, 2004Aug 26, 2004The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20040171150 *Feb 26, 2004Sep 2, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040171571 *Dec 11, 2003Sep 2, 2004Coley Pharmaceutical Group, Inc.5' CpG nucleic acids and methods of use
US20040181045 *Feb 26, 2004Sep 16, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040198680 *Jul 3, 2003Oct 7, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040198688 *Apr 2, 2004Oct 7, 2004The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20040229835 *Jun 24, 2004Nov 18, 2004The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20040234512 *Jun 25, 2004Nov 25, 2004Coley Pharmaceutical GmbhMethods for regualting hematopoiesis using CpG-oligonucleotides
US20040235774 *Apr 23, 2004Nov 25, 2004Bratzler Robert L.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040235777 *Jun 25, 2004Nov 25, 2004Coley Pharmaceutical GmbhMethods for regulating hematopoiesis using CpG-oligonucleotides
US20040235778 *Jun 25, 2004Nov 25, 2004Coley Pharmaceutical GmbhMethods for regulating hematopoiesis using CpG-oligonucleotides
US20050004062 *May 17, 2004Jan 6, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050009774 *Jul 9, 2004Jan 13, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050013812 *Jul 14, 2003Jan 20, 2005Dow Steven W.Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050032736 *Jul 9, 2004Feb 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050043529 *Apr 23, 2004Feb 24, 2005Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050049215 *Jul 9, 2004Mar 3, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050049216 *Jul 16, 2004Mar 3, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050054601 *Jul 16, 2004Mar 10, 2005Coley Pharmaceutical GmbhPharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050054602 *Jul 16, 2004Mar 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050059619 *Aug 19, 2003Mar 17, 2005Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US20050070491 *Jul 3, 2003Mar 31, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050075302 *Aug 18, 2003Apr 7, 2005Coley Pharmaceutical Group, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US20050100983 *Nov 5, 2004May 12, 2005Coley Pharmaceutical GmbhCell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101554 *Jul 25, 2003May 12, 2005University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20050101557 *Aug 18, 2004May 12, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050119273 *Jun 18, 2004Jun 2, 2005Coley Pharmaceutical GmbhSmall molecule toll-like receptor (TLR) antagonists
US20050123523 *Aug 26, 2004Jun 9, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050130911 *Sep 27, 2004Jun 16, 2005Coley Pharmaceutical Group, Inc.Nucleic acid-lipophilic conjugates
US20050148537 *Nov 12, 2004Jul 7, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050171047 *Jan 14, 2005Aug 4, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050181422 *Mar 18, 2005Aug 18, 2005Coley Pharmaceutical GmbhProcess for high throughput screening of CpG-based immuno-agonist/antagonist
US20050197314 *Apr 19, 2005Sep 8, 2005University Of Iowa Research FoundationMethods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20050233999 *Oct 1, 2004Oct 20, 2005Krieg Arthur MImmunostimulatory nucleic acid molecules
US20050239732 *Oct 1, 2004Oct 27, 2005Krieg Arthur MImmunostimulatory nucleic acid molecules
US20050239733 *Oct 29, 2004Oct 27, 2005Coley Pharmaceutical GmbhSequence requirements for inhibitory oligonucleotides
US20050239734 *Oct 29, 2004Oct 27, 2005Coley Pharmaceutical GmbhC-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050244379 *May 11, 2005Nov 3, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050245477 *May 11, 2005Nov 3, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050256073 *Feb 18, 2005Nov 17, 2005Coley Pharmaceutical Group, Inc.Immunostimulatory viral RNA oligonucleotides
US20050267057 *Jul 14, 2003Dec 1, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050277604 *May 9, 2003Dec 15, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050277609 *Jan 7, 2005Dec 15, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003955 *Feb 25, 2005Jan 5, 2006University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003962 *Jul 15, 2005Jan 5, 2006Coley Pharmaceutical Group, Ltd.Methods and products related to treatment and prevention of hepatitis C virus infection
US20060094683 *Dec 7, 2005May 4, 2006University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20060140875 *Oct 20, 2005Jun 29, 2006Coley Pharmaceutical Group, Inc.Semi-soft C-class immunostimulatory oligonucleotides
US20060154890 *Dec 9, 2005Jul 13, 2006Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20060166923 *Mar 24, 2006Jul 27, 2006Bo Young AhnImmune stimulating composition comprising bacterial chromosomal DNA fragments having methylated CpG sequences and non-toxic lipopolysaccharides
US20060211644 *Feb 24, 2006Sep 21, 2006Coley Pharmaceutical Group, Inc.Immunostimulatory oligonucleotides
US20060229271 *Apr 10, 2006Oct 12, 2006Coley Pharmaceutical Group, Inc.Methods for treating infectious disease exacerbated asthma
US20060241076 *Apr 26, 2006Oct 26, 2006Coley Pharmaceutical GmbhModified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20060246035 *Oct 29, 2003Nov 2, 2006Coley Pharmaceutical GmbhMethods and products related to treatment and prevention of hepatitis c virus infection
US20060286070 *Jul 8, 2005Dec 21, 2006Coley Pharmaceutical GmbhMethods related to immunostimulatory nucleic acid-induced interferon
US20070009710 *Aug 11, 2006Jan 11, 2007Toyo Boseki Kabushiki KaishaFlexible metal-clad laminate and method for producing the same
US20070010470 *May 11, 2005Jan 11, 2007University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070037767 *Sep 22, 2006Feb 15, 2007Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20070065467 *Aug 11, 2006Mar 22, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules for activating dendritic cells
US20070078104 *Sep 22, 2006Apr 5, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20070202128 *Dec 22, 2006Aug 30, 2007Coley Pharmaceutical Group, IncImmunomodulatory oligonucleotides
US20080009455 *Feb 24, 2006Jan 10, 2008Coley Pharmaceutical Group, Inc.Immunostimulatory oligonucleotides
US20080026011 *Jun 5, 2007Jan 31, 2008University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20080026986 *Jun 1, 2007Jan 31, 2008Rong-Fu WangReversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US20080031936 *Nov 10, 2006Feb 7, 2008University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20080045473 *Feb 15, 2007Feb 21, 2008Coley Pharmaceutical GmbhCompositions and methods for oligonucleotide formulations
US20080226649 *Mar 19, 2007Sep 18, 2008Coley Pharmaceutical GmbhCPG-like nucleic acids and methods of use thereof
US20090060927 *Mar 26, 2004Mar 5, 2009Coley Pharmaceutical GmbhPharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US20090117132 *Jun 30, 2006May 7, 2009Pfizer, Inc.Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
US20090137519 *Dec 17, 2008May 28, 2009Coley Pharmaceutical Group, Inc.Semi-soft c-class immunostimulatory oligonucleotides
US20090142362 *Nov 6, 2007Jun 4, 2009Avant Immunotherapeutics, Inc.Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US20090214578 *Sep 15, 2006Aug 27, 2009Coley Pharmaceutical GmbhImmunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US20090306177 *Sep 15, 2006Dec 10, 2009Coley Pharmaceutical GmbhModulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20090311277 *May 26, 2009Dec 17, 2009Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20100010193 *Jul 1, 2009Jan 14, 2010Csl LimitedImmunogenic complexes and methods relating thereto
US20100125101 *Mar 25, 2009May 20, 2010Krieg Arthur MImmunostimulatory nucleic acid molecules
US20100183639 *Nov 10, 2009Jul 22, 2010Coley Pharmaceutical Group, Inc.Nucleic acid-lipophilic conjugates
US20100316659 *Dec 9, 2009Dec 16, 2010Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
US20110033421 *Jul 13, 2010Feb 10, 2011Coley Pharmaceutical GmbhMethods related to immunostimulatory nucleic acid-induced interferon
US20110081366 *Nov 15, 2010Apr 7, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20110201672 *Sep 14, 2010Aug 18, 2011Krieg Arthur MSemi-soft c-class immunostimulatory oligonucleotides
US20110206719 *Mar 14, 2011Aug 25, 2011Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
Classifications
U.S. Classification514/44.00R
International ClassificationA61K48/00, A61P33/00, A61P17/06, A61P37/02, A61P31/12, A61K39/39, A61K45/00, A61P1/02, A61P37/04, A61P1/04, A61K31/47, A61P35/00, A61P1/00, A61K31/70, A61K31/335, A61P31/04, A61P11/06, A61P19/02, C12N15/09, A61K47/48, A61K39/395, A61K31/7088, A61P43/00, A61P37/08, C07H21/04, A61K9/127, C07K14/52, C07H21/02, A61K31/175, C12N15/117, A61K31/00, C07H21/00, A61K31/4706, C12Q1/68, A61P37/06
Cooperative ClassificationC12N15/117, C07H21/00, C12N2310/17, A61K39/39, A61K2039/55561, A61K31/00, A61K31/7048, C12N2310/315, A61K31/4706, A61K39/00, A61K31/7125, C12Q1/68, A61K31/711
European ClassificationC07H21/00, C12N15/117, A61K39/00, A61K31/00, C12Q1/68, A61K39/39, A61K31/4706, A61K31/7048, A61K31/711, A61K31/7125
Legal Events
DateCodeEventDescription
Aug 10, 2004ASAssignment
Owner name: CPG IMMUNOPHARMACEUTICALS, INC., MASSACHUSETTS
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:STEINBERG, ALFRED D.;REEL/FRAME:015002/0683
Effective date: 19981030
Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION, THE, IOWA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KLINE, JOEL;REEL/FRAME:015002/0481
Effective date: 19970623
Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION, THE, IOWA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KRIEG, ARTHUR M.;REEL/FRAME:015001/0613
Effective date: 19961211
Owner name: COLEY PHARMACEUTICAL GROUP, INC., MASSACHUSETTS
Free format text: CHANGE OF NAME;ASSIGNOR:CPG IMMUNOPHARMACEUTICALS, INC.;REEL/FRAME:015001/0670
Effective date: 20000114
Owner name: UNITED STATE OF AMERICA, AS REPRESENTED BY THE SEC
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KLINMAN, DENNIS;REEL/FRAME:015057/0620
Effective date: 20000301
Dec 20, 2005ASAssignment
Owner name: PFIZER INC., NEW YORK
Free format text: CONFIRMATION OF EXCLUSIVE PATENT LICENSE;ASSIGNORS:COLEY PHARMACEUTICAL GROUP, INC.;COLEY PHARMACEUTICAL GROUP, LTD.;COLEY PHARMACEUTICAL, GMBH;REEL/FRAME:017353/0372
Effective date: 20050506