Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS20050049215 A1
Publication typeApplication
Application numberUS 10/888,449
Publication dateMar 3, 2005
Filing dateJul 9, 2004
Priority dateJul 15, 1994
Also published asCA2270345A1, CA2270345C, CN1235609A, CN100338086C, CN101265285A, DE69736331D1, DE69736331T2, EP0948510A1, EP0948510A4, EP0948510B1, EP1714969A2, EP1714969A3, EP1746159A2, EP1746159A3, EP2322615A1, EP2360252A1, US6207646, US7402572, US7517861, US7674777, US7723022, US7723500, US7879810, US7888327, US8058249, US8129351, US8158592, US8258106, US20030050261, US20040132685, US20040147468, US20040167089, US20040198688, US20040229835, US20050004061, US20050032736, US20050049216, US20050054602, US20050059625, US20050070491, US20050123523, US20050148537, US20050171047, US20050215500, US20050233995, US20050233999, US20050239732, US20050267064, US20050277604, US20050277609, US20060003955, US20060089326, US20070066553, US20070078104, US20080026011, US20080031936, US20090202575, US20100125101, WO1998018810A1
Publication number10888449, 888449, US 2005/0049215 A1, US 2005/049215 A1, US 20050049215 A1, US 20050049215A1, US 2005049215 A1, US 2005049215A1, US-A1-20050049215, US-A1-2005049215, US2005/0049215A1, US2005/049215A1, US20050049215 A1, US20050049215A1, US2005049215 A1, US2005049215A1
InventorsArthur Krieg, Joel Kline, Dennis Klinman, Alfred Steinberg
Original AssigneeThe University Of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., United States Of America, As Represented By The Secretary, Department Of Health & Human Services
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Immunostimulatory nucleic acid molecules
US 20050049215 A1
Abstract
Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
Images(19)
Previous page
Next page
Claims(16)
1-18. (Cancelled)
19. A method of stimulating interferon-alpha in a subject comprising administering to a subject an immunostimulatory oligonucleotide/delivery complex, said delivery complex comprising a oligonucleotide linked to a biodegradable delivery complex, wherein the oligonucleotide comprises the sequence 5′-C, G-3′, in an amount sufficient to increase interferon-alpha in the subject.
20. The method of claim 19, wherein said complex is antigen-free.
21. The method of claim 19, wherein said complex further comprises an antigen.
22. The method of claim 19, wherein said delivery complex is a liquid phase microcarrier.
23. The method of claim 19, wherein said immunostimulatory oligonucleotide is covalently linked to said delivery complex.
24. The method of claim 19, wherein said immunostimulatory oligonucleotide is non-covalently linked to said delivery complex.
25. The method of claim 19, wherein said immunostimulatory oligonucleotide comprises a phosphate backbone modification.
26. The method of claim 25, wherein said phosphate backbone modification is a phosphorothioate.
27. The method of claim 19, wherein the immunostimulatory oligonucleotide is 8 to 40 nucleotides in length and comprises:
5′X1X2CGX3X43′, wherein C and G are unmethylated and X1, X2, X3, and X4 are nucleotides.
28. The method of claim 27, wherein the immunostimulatory oligonucleotide does not include a GCG trinucleotide at a 5′ and/or 3′ terminal.
29. The method of claim 19 wherein the immunostimulatory oligonucleotide does not contain a 5′X1X2CGX3X43′ palindrome.
30. The method of claim 27 wherein the immunostimulatory oligonucleotide does not contain a 5′X1X2CGX3X43′ palindrome.
31. The method of claim 19, wherein said oligonucleotide comprises the sequence 5′-T, C, G-3′.
32. The method of claim 19, wherein the individual has a viral infection.
33. The method of claim 19, wherein said delivery complex is less than 10 μm in size.
Description
    RELATED APPLICATIONS
  • [0001]
    This application is a divisional of co-pending U.S. patent application Ser. No. 08/738,652, filed Oct. 30, 1996, which is a continuation-in-part of U.S. patent application Ser. No. 08/386,063, filed Feb. 7, 1995, now issued as U.S. Pat. No. 6,194,388, which is a continuation-in-part of U.S. patent application Ser. No. 08/276,358, filed Jul. 15, 1994, now abandoned.
  • Government Support
  • [[0002]]
    The work resulting in this invention was supported in part by National Institute of Health Grant No. R29-AR42556-01. The U.S. Government may therefore be entitled to certain rights in the invention.
  • BACKGROUND OF THE INVENTION
  • [0003]
    DNA binds to cell membranes and is internalized In the 1970's, several investigators reported the binding of high molecular weight DNA to cell membranes (Lerner, R. A., W. Meinke, and D. A. Goldstein. 1971. “Membrane-associated DNA in the cytoplasm of diploid human lymphocytes”. Proc. Natl. Acad. Sci. USA 68:1212; Agrawal, S. K., R. W. Wagner, P. K. McAllister, and B. Rosenberg. 1975. “Cell-surface-associated nucleic acid in tumorigenic cells made visible with platinum-pyrimidine complexes by electron microscopy”. Proc. Natl. Acad. Sci. USA 72:928). In 1985, Bennett et al. presented the first evidence that DNA binding to lymphocytes is similar to a ligand receptor interaction: binding is saturable, competitive, and leads to DNA endocytosis and degradation into oligonucleotides (Bennett, R. M., G. T. Gabor, and M. M. Merritt. 1985. “DNA binding to human leukocytes. Evidence for a receptor-mediated association, internalization, and degradation of DNA”. J. Clin. Invest. 76:2182). Like DNA, oligodeoxyribonucleotides (ODNs) are able to enter cells in a saturable, sequence independent, and temperature and energy dependent fashion (reviewed in Jaroszewski, J. W., and J. S. Cohen. 1991. “Cellular uptake of antisense oligodeoxynucleotides”. Advanced Drug Delivery Reviews 6:235; Akhtar, S., Y. Shoji, and R. L. Juliano. 1992. “Pharmaceutical aspects of the biological stability and membrane transport characteristics of antisense oligonucleotides”. In: Gene Regulation: Biology of Antisense RNA and DNA. R. P. Erickson, and J. G. Izant, eds. Raven Press, Ltd. New York, pp. 133; and Zhao, Q., T. Waldschmidt, E. Fisher, C. J. Herrera, and A. M. Krieg., 1994. “Stage specific oligonucleotide uptake in murine bone marrow B cell precursors”. Blood, 84:3660). No receptor for DNA or ODN uptake has yet been cloned, and it is not yet clear whether ODN binding and cell uptake occurs through the same or a different mechanism from that of high molecular weight DNA.
  • [0004]
    Lymphocyte ODN uptake has been shown to be regulated by cell activation. Spleen cells stimulated with the B cell mitogen LPS had dramatically enhanced ODN uptake in the B cell population, while spleen cells treated with the T cell mitogen Con A showed enhanced ODN uptake by T but not B cells (Krieg, A. M., F. Gmelig-Meyling, M. F. Gourley, W. J. Kisch, L. A. Chrisey, and A. D. Steinberg. 1991. “Uptake of oligodeoxyribonucleotides by lymphoid cells is heterogeneous and inducible”. Antisense Research and Development 1:161).
  • [0005]
    Immune Effects of Nucleic Acids
  • [0006]
    Several polynucleotides have been extensively evaluated as biological response modifiers. Perhaps the best example is poly (I,C) which is a potent inducer of IFN production as well as a macrophage activator and inducer of NK activity (Talmadge, J. E., J. Adams, H. Phillips, M. Collins, B. Lenz, M. Schneider, E. Schlick, R. Ruffmann, R. H. Wiltrout, and M. A. Chirigos. 1985. “Immunomodulatory effects in mice of polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose”. Cancer Res. 45:1058; Wiltrout, R. H., R. R. Salup, T. A. Twilley, and J. E. Talmadge. 1985. “Immunomodulation of natural killer activity by polyribonucleotides”. J. Biol. Resp. Mod. 4:512; Krown, S. E. 1986. “Interferons and interferon inducers in cancer treatment”. Sem. Oncol. 13:207; and Ewel, C. H., S. J. Urba, W. C. Kopp, J. W. Smith II, R. G. Steis, J. L. Rossio, D. L. Longo, M. J. Jones, W. G. Alvord, C. M. Pinsky, J. M. Beveridge, K. L. McNitt, and S. P. Creekmore. 1992. “Polyinosinic-polycytidylic acid complexed with poly-L-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects”. Canc. Res. 52:3005). It appears that this murine NK activation may be due solely to induction of IFN-β secretion (Ishikawa, R., and C. A. Biron. 1993. “IFN induction and associated changes in splenic leukocyte distribution”. J. Immunol. 150:3713). This activation was specific for the ribose sugar since deoxyribose was ineffective. Its potent in vitro antitumor activity led to several clinical trials using poly (I,C) complexed with poly-L-lysine and carboxymethylcellulose (to reduce degradation by RNAse) (Talmadge, J. E., et al., 1985. cited supra; Wiltrout, R. H., et al., 1985. cited supra); Krown, S. E., 1986. cited supra); and Ewel, C. H., et al., 1992. cited supra). Unfortunately, toxic side effects have thus far prevented poly (I,C) from becoming a useful therapeutic agent.
  • [0007]
    Guanine ribonucleotides substituted at the C8 position with either a bromine or a thiol group are B cell mitogens and may replace “B cell differentiation factors” (Feldbush, T. L., and Z. K. Ballas. 1985. “Lymphokine-like activity of 8-mercaptoguanosine: induction of T and B cell differentiation”. J. Immunol. 134:3204; and Goodman, M. G. 1986. “Mechanism of synergy between T cell signals and C8-substituted guanine nucleosides in humoral immunity: B lymphotropic cytokines induce responsiveness to 8-mercaptoguanosine”. J. Immunol. 136:3335). 8-mercaptoguanosine and 8-bromoguanosine also can substitute for the cytokine requirement for the generation of MHC restricted CTL (Feldbush, T. L., 1985. cited supra), augment murine NK activity (Koo, G. C., M. E. Jewell, C. L. Manyak, N. H. Sigal, and L. S. Wicker. 1988. “Activation of murine natural killer cells and macrophages by 8-bromoguanosine”. J. Immunol. 140:3249), and synergize with IL-2 in inducing murine LAK generation (Thompson, R. A., and Z. K. Ballas. 1990. “Lymphokine-activated killer (LAK) cells. V. 8-Mercaptoguanosine as an IL-2-sparing agent in LAK generation”. J. Immunol. 145:3524). The NK and LAK augmenting activities of these C8-substituted guanosines appear to be due to their induction of IFN (Thompson, R. A., et al. 1990. cited supra). Recently, a 5′ triphosphorylated thymidine produced by a mycobacterium was found to be mitogenic for a subset of human γδ T cells (Constant, P., F. Davodeau, M. -A. Peyrat, Y. Poquet, G. Puzo, M. Bonneville, and J. -J. Foumie. 1994. “Stimulation of human γδ T cells by nonpeptidic mycobacterial ligands” Science 264:267). This report indicated the possibility that the immune system may have evolved ways to preferentially respond to microbial nucleic acids.
  • [0008]
    Several observations suggest that certain DNA structures may also have the potential to activate lymphocytes. For example, Bell et al. reported that nucleosomal protein-DNA complexes (but not naked DNA) in spleen cell supernatants caused B cell proliferation and immunoglobulin secretion (Bell, D. A., B. Morrison, and P. VandenBygaart. 1990. “Immunogenic DNA-related factors”. J. Clin. Invest. 85:1487). In other cases, naked DNA has been reported to have immune effects. For example, Messina et al. have recently reported that 260 to 800 bp fragments of poly (dG)·(dC) and poly (dG·dC) were mitogenic for B cells (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1993. “The influence of DNA structure on the in vitro stimulation of murine lymphocytes by natural and synthetic polynucleotide antigens”. Cell. Immunol. 147:148). Tokunaga, et al. have reported that dG·dC induces IFN-γ and NK activity (Tokunaga, S. Yamamoto, and K. Namba. 1988. “A synthetic single-stranded DNA, poly(dG,dC), induces interferon-α/β and -γ, augments natural killer activity, and suppresses tumor growth” Jpn. J Cancer Res. 79:682). Aside from such artificial homopolymer sequences, Pisetsky et al. reported that pure mammalian DNA has no detectable immune effects, but that DNA from certain bacteria induces B cell activation and immunoglobulin secretion (Messina, J. P., G. S. Gilkeson, and D. S. Pisetsky. 1991. “Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA”. J. Immunol. 147:1759). Assuming that these data did not result from some unusual contaminant, these studies suggested that a particular structure or other characteristic of bacterial DNA renders it capable of triggering B cell activation. Investigations of mycobacterial DNA sequences have demonstrated that ODN which contain certain palindrome sequences can activate NK cells (Yamamoto, S., T. Yamamoto, T. Kataoka, E. Kuramoto, O. Yano, and T. Tokunaga. 1992. “Unique palindromic sequences in synthetic oligonucleotides are required to induce INF and augment INF-mediated natural killer activity”. J. Immunol. 148:4072; Kuramoto, E., O. Yano, Y. Kimura, M. Baba, T. Makino, S. Yamamoto, T. Yamamoto, T. Kataoka, and T. Tokunaga. 1992. “Oligonucleotide sequences required for natural killer cell activation”. Jpn. J. Cancer Res. 83:1128).
  • [0009]
    Several phosphorothioate modified ODN have been reported to induce in vitro or in vivo B cell stimulation (Tanaka, T., C. C. Chu, and W. E. Paul. 1992. “An antisense oligonucleotide complementary to a sequence in Iγ2b increases γ2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion”. J. Exp. Med. 175:597; Branda, R. F., A. L. Moore, L. Mathews, J. J. McCormack, and G. Zon. 1993. “Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1”. Biochem. Pharmacol. 45:2037; McIntyre, K. W., K. Lombard-Gillooly, J. R. Perez, C. Kunsch, U. M. Sarmiento, J. D. Larigan, K. T. Landreth, and R. Narayanan. 1993. “A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NFκB T65 causes sequence-specific immune stimulation”. Antisense Res. Develop. 3:309; and Pisetsky, D. S., and C. F. Reich. 1993. “Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus”. Life Sciences 54:101). These reports do not suggest a common structural motif or sequence element in these ODN that might explain their effects.
  • [0010]
    The CREB/ATF Family of Transcription Factors and Their Role in Replication
  • [0011]
    The cAMP response element binding protein (CREB) and activating transcription factor (ATF) or CREB/ATF family of transcription factors is a ubiquitously expressed class of transcription factors of which 11 members have so far been cloned (reviewed in de Groot, R. P., and P. Sassone-Corsi: “Hormonal control of gene expression: Multiplicity and versatility of cyclic adenosine 3′,5′-monophosphate-responsive nuclear regulators”. Mol. Endocrin. 7:145, 1993; Lee, K. A. W., and N. Masson: “Transcriptional regulation by CREB and its relatives”. Biochim. Biophys. Acta 1174:221, 1993.). They all belong to the basic region/leucine zipper (bZip) class of proteins. All cells appear to express one or more CREB/ATF proteins, but the members expressed and the regulation of mRNA splicing appear to be tissue-specific. Differential splicing of activation domains can determine whether a particular CREB/ATF protein will be a transcriptional inhibitor or activator. Many CREB/ATF proteins activate viral transcription, but some splicing variants which lack the activation domain are inhibitory. CREB/ATF proteins can bind DNA as homo- or hetero-dimers through the cAMP response element, the CRE, the consensus form of which is the umethylated sequence TGACGTC (binding is abolished if the CpG is methylated) (Iguchi-Ariga, S. M. M., and W. Schaffner: “CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation”. Genes & Develop. 3:612, 1989.).
  • [0012]
    The transcriptional activity of the CRE is increased during B cell activation (Xie, H. T. C. Chiles, and T. L. Rothstein: “Induction of CREB activity via the surface Ig receptor of B cells”. J. Immunol. 151:880, 1993.). CREB/ATF proteins appear to regulate the expression of multiple genes through the CRE including immunologically important genes such as fos, jun B, Rb-1, IL-6, IL-1 (Tsukada, J., K. Saito, W. R. Waterman, A. C. Webb, and P. E. Auron: “Transcription factors NF-IL6 and CREB recognize a common essential site in the human prointerleukin 1β gene”. Mol. Cell. Biol. 14:7285, 1994; Gray, G. D., O. M. Hernandez, D. Hebel, M. Root, J. M. Pow-Sang, and E. Wickstrom: “Antisense DNA inhibition of tumor growth induced by c-Ha-ras oncogene in nude mice”. Cancer Res. 53:577, 1993), IFN-β (Du, W., and T. Maniatis: “An ATF/CREB binding site protein is required for virus induction of the human interferon B gene”. Proc. Natl. Acad. Sci. USA 89:2150, 1992), TGF-β1 (Asiedu, C. K., L. Scott, R. K. Assoian, M. Ehrlich: “Binding of AP-1/CREB proteins and of MDBP to contiguous sites downstream of the human TGF-B1 gene”. Biochim. Biophys. Acta 1219:55, 1994.), TGF-β2, class II MHC (Cox, P. M., and C. R. Goding: “An ATF/CREB binding motif is required for aberrant constitutive expression of the MHC class II DRa promoter and activation by SV40 T-antigen”. Nucl. Acids Res. 20:4881, 1992.), E-selectin, GM-CSF, CD-8α, the germline Igα constant region gene, the TCR Vβ gene, and the proliferating cell nuclear antigen (Huang, D., P. M. Shipman-Appasamy, D. J. Orten, S. H. Hinrichs, and M. B. Prystowsky: “Promoter activity of the proliferating-cell nuclear antigen gene is associated with inducible CRE-binding proteins in interleukin 2-stimulated T lymphocytes”. Mol. Cell. Biol. 14:4233, 1994.). In addition to activation through the cAMP pathway, CREB can also mediate transcriptional responses to changes in intracellular Ca++ concentration (Sheng, M., G. McFadden, and M. E. Greenberg: “Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB”. Neuron 4:571, 1990).
  • [0013]
    The role of protein-protein interactions in transcriptional activation by CREB/ATF proteins appears to be extremely important. There are several published studies reporting direct or indirect interactions between NFκB proteins and CREB/ATF proteins (Whitley, et. al., (1994) Mol. & Cell. Biol. 14:6464; Cogswell, et al., (1994) J. Immun. 153:712; Hines, et al., (1993) Oncogene 8:3189; and Du, et al., (1993) Cell 74:887. Activation of CREB through the cyclic AMP pathway requires protein kinase A (PKA), which phosphorylates CREB341 on ser133 and allows it to bind to a recently cloned protein, CBP (Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bachinger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman: “Nuclear protein CBP is a coactivator for the transcription factor CREB”. Nature 370:223, 1994; Arias, J., A. S. Alberts, P. Brindle, F. X. Claret, T. Smea, M. Karin, J. Feramisco, and M. Montminy: “Activation of cAMP and mitogen responsive genes relies on a common nuclear factor”. Nature 370:226, 1994.). CBP in turn interacts with the basal transcription factor TFIIB causing increased transcription. CREB also has been reported to interact with dTAFII 110, a TATA binding protein-associated factor whose binding may regulate transcription (Ferreri, K., G. Gill, and M. Montminy: “The cAMP-regulated transcription factor CREB interacts with a component of the TFIID complex”. Proc. Natl. Acad. Sci. USA 91:1210, 1994.). In addition to these interactions, CREB/ATF proteins can specifically bind multiple other nuclear factors (Hoeffler, J. P., J. W. Lustbader, and C. -Y. Chen: “Identification of multiple nuclear factors that interact with cyclic adenosine 3′,5′-monophosphate response element-binding protein and activating transcription factor-2 by protein-protein interactions”. Mol. Endocrinol. 5:256, 1991) but the biologic significance of most of these interactions is unknown. CREB is normally thought to bind DNA either as a homodimer or as a heterodimer with several other proteins. Surprisingly, CREB monomers constitutively activate transcription (Krajewski, W., and K. A. W. Lee: “A monomeric derivative of the cellular transcription factor CREB functions as a constitutive activator”. Mol. Cell. Biol. 14:7204, 1994.).
  • [0014]
    Aside from their critical role in regulating cellular transcription, it has recently been shown that CREB/ATF proteins are subverted by some infectious viruses and retroviruses, which require them for viral replication. For example, the cytomegalovirus immediate early promoter, one of the strongest known mammalian promoters, contains eleven copies of the CRE which are essential for promoter function (Chang, Y. -N., S. Crawford, J. Stall, D. R. Rawlins, K. -T. Jeang, and G. S. Hayward: “The palindromic series I repeats in the simian cytomegalovirus major immediate-early promoter behave as both strong basal enhancers and cyclic AMP response elements”. J. Virol. 64:264, 1990). At least some of the transcriptional activating effects of the adenovirus E1A protein, which induces many promoters, are due to its binding to the DNA binding domain of the CREB/ATF protein, ATF-2, which mediates E1A inducible transcription activation (Liu, F., and M. R. Green: “Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains”. Nature 368:520, 1994). It has also been suggested that E1A binds to the CREB-binding protein, CBP (Arany, Z., W. R. Sellers, D. M. Livingston, and R. Eckner: “E1A-associated p300 and CREB-associated CBP belong to a conserved family of coactivators”. Cell 77:799, 1994). Human T lymphotropic virus-I (HTLV-1), the retrovirus which causes human T cell leukemia and tropical spastic paresis, also requires CREB/ATF proteins for replication. In this case, the retrovirus produces a protein, Tax, oligonucleotides do not include a GCG trinucleotide sequence at or near the 5′ and/or 3′ terminals and/or the consensus mitogenic CpG motif is not a palindrome. Prolonged immunostimulation can be obtained using stabilized oligonucleotides, particularly phosphorothioate stabilized oligonucleotides.
  • [0015]
    In a second aspect, the invention features useful therapies, which are based on the immunostimulatory activity of the nucleic acid molecules. For example, the immunostimulatory nucleic acid molecules can be used to treat, prevent or ameliorate an immune system deficiency (e.g., a tumor or cancer or a viral, fungal, bacterial or parasitic infection in a subject). In addition, immunostimulatory nucleic acid molecules can be administered to stimulate a subject's response to a vaccine.
  • [0016]
    Further, by redirecting a subject's immune response from Th2 to Th1, the instant claimed nucleic acid molecules can be administered to treat or prevent the symptoms of asthma. In addition, the instant claimed nucleic acid molecules can be administered in conjunction with a particular allergen to a subject as a type of desensitization therapy to treat or prevent the occurrence of an allergic reaction.
  • [0017]
    Further, the ability of immunostimulatory nucleic acid molecules to induce leukemic cells to enter the cell cycle supports the use of immunostimulatory nucleic acid molecules in treating leukemia by increasing the sensitivity of chronic leukemia cells and then administering conventional ablative chemotherapy, or combining the immunostimulatory nucleic acid molecules with another immunotherapy.
  • [0018]
    Other features and advantages of the invention will become more apparent from the following detailed description and claims.
  • BRIEF DESCRIPTION OF THE FIGURES
  • [0019]
    FIG. 1A-C are graphs plotting dose-dependent IL-6 production in response to various DNA sequences in T cell depleted spleen cell cultures. A. E. coli DNA (●) and calf thymus DNA (▪) sequences and LPS (at 10× the concentration of E. coli and calf thymus DNA) (♦). B. Control phosphodiester oligodeoxynucleotide (ODN) 5′ATGGAAGGTCCAGTGTTCTC3′ (SEQ ID NO:1) (▪) and two phosphodiester CpG ODN5′ATCGACCTACGTGCGTTCTC3′ (SEQ ID NO:2) (♦) and 5′TCCATAACGTTCCTGATGCT3′ (SEQ ID NO:3) (●). C. Control phosphorothioate ODN5′GCTAGATGTTAGCGT3′ (SEQ ID NO:4) (▪) and two phosphorothioate CpG ODN5′GAGAACGTCGACCTTCGAT3′ (SEQ ID NO:5) (♦) and 5′GCATGACGTTGAGCT3′ (SEQ ID NO:6) (●). Data present the mean±standard deviation of triplicates.
  • [0020]
    FIG. 2 is a graph plotting IL-6 production induced by CpG DNA in vivo as determined 1-8 hrs after injection. Data represent the mean from duplicate analyses of sera from two mice. BALB/c mice (two mice/group) were injected iv. with 100 ill of PBS (□) or 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (ζ) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) (♦).
  • [0021]
    FIG. 3 is an autoradiograph showing IL-6 mRNA expression as determined by reverse transcription polymerase chain reaction in liver, spleen, and thymus at various time periods after in vivo stimulation of BALB/c mice (two mice/group) injected iv with 100 μl of PBS, 200 μg of CpG phosphorothioate ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG phosphorothioate ODN 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8).
  • [0022]
    FIG. 4A is a graph plotting dose-dependent inhibition of CpG-induced IgM production by anti-IL-6. Splenic B-cells from DBA/2 mice were stimulated with CpG ODN5′TCCAAGACGTTCCTGATGCT3′ (SEQ ID NO:9) in the presence of the indicated concentrations of neutralizing anti-IL-6 (♦) or isotype control Ab (●) and IgM levels in culture supernatants determined by ELISA. In the absence of CpG ODN, the anti-IL-6 Ab had no effect on IgM secretion (▪).
  • [0023]
    FIG. 4B is a graph plotting the stimulation index of CpG-induced splenic B cells cultured with anti-IL-6 and CpG S-ODN 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) (♦) or anti-IL-6 antibody only (▪). Data present the mean±standard deviation of triplicates.
  • [0024]
    FIG. 5 is a bar graph plotting chloramphenicol acetyltransferase (CAT) activity in WEHI-231 cells transfected with a promoter-less CAT construct (pCAT), positive control plasmid (RSV), or IL-6 promoter-CAT construct alone or cultured with CpG 5′ TCCATGACGTTCCTGATGCT 3′ (SEQ ID NO:7) or non-CpG 5′ TCCATGAGCTTCCTGAGTCT 3′ (SEQ ID NO:8) phosphorothioate ODN at the indicated concentrations. Data present the mean of triplicates.
  • [0025]
    FIG. 6 is a schematic overview of the immune effects of the immunostimulatory unmethylated CpG containing nucleic acids, which can directly activate both B cells and monocytic cells (including macrophages and dendritic cells) as shown. The immunostimulatory oligonucleotides do not directly activate purified NK cells, but render them competent to respond to IL-12 with a marked increase in their IFN-γ production. By inducing IL-12 production and the subsequent increased IFN-γ secretion by NK cells, the immunostimulatory nucleic acids promote a Th1 type immune response. No direct activation of proliferation of cytokine secretion by highly purified T cells has been found. However, the induction of Th1 cytokine secretion by the immunostimulatory oligonucleotides promotes the development of a cytotoxic lymphocyte response.
  • [0026]
    FIG. 7 is an autoradiograph showing NFκB mRNA induction in monocytes treated with E. coli (EC) DNA (containing unmethylated CpG motifs), control (CT) DNA (containing no unmethylated CpG motifs) and lipopolysaccharide (LPS) at various measured times, 15 and 30 minutes after contact.
  • [0027]
    FIG. 8A shows the results from a flow cytometry study using mouse B cells with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. The dye only sample in Panel A of the figure shows the background level of cells positive for the dye at 28.6%. This level of reactive oxygen species was greatly increased to 80% in the cells treated for 20 minutes with PMA and ionomycin, a positive control (Panel B). The cells treated with the CpG oligo (TCCATGACGTTCCTGACGTT SEQ ID NO:10) also showed an increase in the level of reactive oxygen species such that more than 50% of the cells became positive (Panel D). However, cells treated with an oligonucleotide with the identical sequence except that the CpGs were switched (TCCATGAGCTTCCTGAGTGCT SEQ ID NO:11) did not show this significant increase in the level of reactive oxygen species (Panel E).
  • [0028]
    FIG. 8B shows the results from a flow cytometry study using mouse B cells in the presence of chloroquine with the dihydrorhodamine 123 dye to determine levels of reactive oxygen species. Chloroquine slightly lowers the background level of reactive oxygen species in the cells such that the untreated cells in Panel A have only 4.3% that are positive. Chloroquine completely abolishes the induction of reactive oxygen species in the cells treated with CpG DNA (Panel B) but does not reduce the level of reactive oxygen species in the cells treated with PMA and ionomycin (Panel E).
  • [0029]
    FIG. 9 is a graph plotting lung lavage cell count over time. The graph shows that when the mice are initially injected with Schistosoma mansoni eggs “egg”, which induces a Th2 immune response, and subsequently inhale Schistosoma mansoni egg antigen “SEA” (open circle), many inflammatory cells are present in the lungs. However, when the mice are initially given CpG oligo (SEQ ID NO:10) along with egg, the
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4452775 *Dec 3, 1982Jun 5, 1984Syntex (U.S.A.) Inc.Cholesterol matrix delivery system for sustained release of macromolecules
US4981684 *Oct 24, 1989Jan 1, 1991Coopers Animal Health LimitedFormation of adjuvant complexes
US5023243 *May 15, 1989Jun 11, 1991Molecular Biosystems, Inc.Oligonucleotide therapeutic agent and method of making same
US5178860 *Dec 7, 1990Jan 12, 1993Coopers Animal Health LimitedAdjuvant complexes and vaccine made therefrom
US5514577 *Mar 12, 1993May 7, 1996Isis Pharmaceuticals, Inc.Oligonucleotide therapies for modulating the effects of herpes viruses
US5527899 *Nov 16, 1993Jun 18, 1996Gilead Sciences, Inc.Oligonucleotides with inverted polarity
US5594122 *Sep 19, 1994Jan 14, 1997Genesys Pharma Inc.Antisense oligonucleotides targeted against human immunodeficiency virus
US5595756 *Dec 22, 1993Jan 21, 1997Inex Pharmaceuticals CorporationLiposomal compositions for enhanced retention of bioactive agents
US5705385 *Jun 7, 1995Jan 6, 1998Inex Pharmaceuticals CorporationLipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer
US5723335 *Sep 11, 1996Mar 3, 1998Isis Pharmaceuticals, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US5728518 *Aug 8, 1994Mar 17, 1998The Immune Response CorporationAntiviral poly-and oligonucleotides
US5736152 *Oct 27, 1995Apr 7, 1998Atrix Laboratories, Inc.Non-polymeric sustained release delivery system
US5753613 *May 16, 1995May 19, 1998Inex Pharmaceuticals CorporationCompositions for the introduction of polyanionic materials into cells
US5766920 *Jan 6, 1995Jun 16, 1998Cellcor, Inc.Ex vivo activation of immune cells
US5858987 *May 5, 1995Jan 12, 1999Mitotix, Inc.E6AP antisense constructs and methods of use
US6027726 *Sep 29, 1995Feb 22, 2000Inex Phamaceuticals Corp.Glycosylated protein-liposome conjugates and methods for their preparation
US6027732 *Feb 20, 1997Feb 22, 2000Morein; BrorIscom or iscom-matrix comprising hydrophobic receptor molecules for antigenic substances
US6030954 *Jun 2, 1995Feb 29, 2000University Of ConnecticutTargeted delivery of poly- or oligonucleotides to cells
US6030955 *Mar 21, 1996Feb 29, 2000The Trustees Of Columbia University In The City Of New York And Imclone Systems, Inc.Methods of affecting intracellular phosphorylation of tyrosine using phosphorothioate oligonucleotides, and antiangiogenic and antiproliferative uses thereof
US6031086 *Jul 26, 1996Feb 29, 2000The Regents Of The University Of CaliforniaAntisense oligonucleitide containing compositions and method of forming duplexes
US6174872 *Dec 15, 1998Jan 16, 2001The Regents Of The University Of CaliforniaMethod for treating allergic lung disease
US6184369 *Apr 25, 1994Feb 6, 2001Aronex Pharmaceuticals, Inc.Anti-viral guanosine-rich oligonucleotides
US6191257 *Jun 7, 1995Feb 20, 2001Baylor College Of MedicineNatural or recombinant DNA binding proteins as carriers for gene transfer or gene therapy
US6194388 *Feb 7, 1995Feb 27, 2001The University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US6207646 *Oct 30, 1996Mar 27, 2001University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US6214806 *Feb 25, 1998Apr 10, 2001University Of Iowa Research FoundationUse of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
US6218371 *Apr 2, 1999Apr 17, 2001University Of Iowa Research FoundationMethods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US6221882 *Jul 2, 1998Apr 24, 2001University Of Iowa Research FoundationMethods for inhibiting immunostimulatory DNA associated responses
US6225292 *Jun 5, 1998May 1, 2001The Regents Of The University Of CaliforniaInhibitors of DNA immunostimulatory sequence activity
US6239116 *Oct 30, 1997May 29, 2001University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US6339068 *May 20, 1998Jan 15, 2002University Of Iowa Research FoundationVectors and methods for immunization or therapeutic protocols
US6348312 *Nov 10, 1994Feb 19, 2002Hoescht AktiengesellschaftStabilized oligonucleotides and their use
US6503533 *Nov 25, 1998Jan 7, 2003Georgetown UniversityAntisense ogligonucleotides against Hepatitis B viral replication
US6521637 *Apr 2, 2002Feb 18, 2003University Of Iowa Research FoundationMethods for inhibiting immunostimulatory DNA associated responses
US6727230 *Jan 20, 1998Apr 27, 2004Coley Pharmaceutical Group, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US7001890 *Jan 23, 1998Feb 21, 2006Coley Pharmaceutical GmbhPharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US7157437 *Mar 9, 2001Jan 2, 2007Dynavax Technologies CorporationMethods of ameliorating symptoms of herpes infection using immunomodulatory polynucleotide sequences
US7183111 *Aug 10, 2001Feb 27, 2007Dynavax Technologies CorporationImmunomodulatory formulations and methods for use thereof
US7214380 *Apr 28, 2000May 8, 2007The Board Of Trustees Of The Leland Stanford Junior UniversityAdjuvant therapy
US7223741 *Jul 14, 2003May 29, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20020055477 *Mar 9, 2001May 9, 2002Nest Gary VanImmunomodulatory formulations and methods for use thereof
US20020064515 *Apr 2, 2001May 30, 2002Krieg Arthur M.Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20030022852 *Aug 10, 2001Jan 30, 2003Nest Gary VanBiodegradable immunomodulatory formulations and methods for use thereof
US20030026801 *Jun 22, 2001Feb 6, 2003George WeinerMethods for enhancing antibody-induced cell lysis and treating cancer
US20030027782 *May 13, 2002Feb 6, 2003Carson Dennis A.Method for treating allergic lung disease
US20030029783 *Jul 12, 2002Feb 13, 2003Donald Hubbard H.Aerobic treatment plant with filter pipe
US20030049266 *Dec 27, 2001Mar 13, 2003Fearon Karen L.Immunomodulatory polynucleotides and methods of using the same
US20030050261 *Mar 27, 2001Mar 13, 2003Krieg Arthur M.Immunostimulatory nucleic acid molecules
US20030050263 *Aug 16, 2001Mar 13, 2003The University Of Iowa Research FoundationMethods and products for treating HIV infection
US20030050268 *Mar 29, 2002Mar 13, 2003Krieg Arthur M.Immunostimulatory nucleic acid for treatment of non-allergic inflammatory diseases
US20030055014 *Dec 14, 2001Mar 20, 2003Bratzler Robert L.Inhibition of angiogenesis by nucleic acids
US20030059773 *Aug 10, 2001Mar 27, 2003Gary Van NestImmunomodulatory formulations and methods for use thereof
US20030078223 *Mar 15, 2002Apr 24, 2003Eyal RazCompositions and methods for modulating an immune response
US20030091599 *Nov 20, 2002May 15, 2003Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030092663 *Aug 26, 2002May 15, 2003Eyal RazImmunization-free methods for treating antigen-stimulated inflammation in a mammalian host and shifting the host's antigen immune responsiveness to a Th1 phenotype
US20030100527 *Jun 3, 2002May 29, 2003The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules for activating dendritic cells
US20040006034 *Apr 11, 2003Jan 8, 2004Eyal RazImmunostimulatory oligonucleotides, compositions thereof and methods of use thereof
US20040009949 *Jun 5, 2003Jan 15, 2004Coley Pharmaceutical Group, Inc.Method for treating autoimmune or inflammatory diseases with combinations of inhibitory oligonucleotides and small molecule antagonists of immunostimulatory CpG nucleic acids
US20040030118 *Feb 24, 2003Feb 12, 2004Hermann WagnerMethods for regulating hematopoiesis using CpG-oligonucleotides
US20040053882 *May 10, 2001Mar 18, 2004Smith Mark PeartCombination chemotherapy
US20040067902 *Feb 2, 2001Apr 8, 2004Bratzler Robert L.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040067905 *Jul 3, 2003Apr 8, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040087534 *Jul 30, 2003May 6, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040087538 *Nov 21, 2003May 6, 2004University Of Iowa Research FoundationMethods of treating cancer using immunostimulatory oligonucleotides
US20040092472 *Jul 3, 2003May 13, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20050004061 *May 17, 2004Jan 6, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050004062 *May 17, 2004Jan 6, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050009774 *Jul 9, 2004Jan 13, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050032734 *May 3, 2004Feb 10, 2005Krieg Arthur M.Vectors and methods for immunization or therapeutic protocols
US20050032736 *Jul 9, 2004Feb 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050037403 *Jul 9, 2004Feb 17, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050037985 *Aug 25, 2003Feb 17, 2005Krieg Arthur M.Methods and products for treating HIV infection
US20050043529 *Apr 23, 2004Feb 24, 2005Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050049216 *Jul 16, 2004Mar 3, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050054601 *Jul 16, 2004Mar 10, 2005Coley Pharmaceutical GmbhPharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050054602 *Jul 16, 2004Mar 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050059619 *Aug 19, 2003Mar 17, 2005Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US20050059625 *Jul 2, 2004Mar 17, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050070491 *Jul 3, 2003Mar 31, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050075302 *Aug 18, 2003Apr 7, 2005Coley Pharmaceutical Group, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US20050100983 *Nov 5, 2004May 12, 2005Coley Pharmaceutical GmbhCell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101554 *Jul 25, 2003May 12, 2005University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20050101557 *Aug 18, 2004May 12, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003955 *Feb 25, 2005Jan 5, 2006University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003962 *Jul 15, 2005Jan 5, 2006Coley Pharmaceutical Group, Ltd.Methods and products related to treatment and prevention of hepatitis C virus infection
US20060019916 *Apr 4, 2005Jan 26, 2006Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for inducing IL-10 responses
US20060019923 *Jul 18, 2005Jan 26, 2006Coley Pharmaceutical Group, Ltd.Methods and compositions for inducing innate immune responses
US20060058251 *Mar 6, 2003Mar 16, 2006University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20060089326 *Dec 7, 2005Apr 27, 2006University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060094683 *Dec 7, 2005May 4, 2006University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070006010 *Jun 30, 2005Jan 4, 2007Paul WallnerSynchronous signal generator
US20070009482 *May 11, 2005Jan 11, 2007University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070010470 *May 11, 2005Jan 11, 2007University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070037767 *Sep 22, 2006Feb 15, 2007Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20070065467 *Aug 11, 2006Mar 22, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules for activating dendritic cells
US20070066553 *Aug 11, 2006Mar 22, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20070066554 *Aug 18, 2006Mar 22, 2007Coley Pharmaceutical GmbhImmunostimulatory nucleic acids
US20070078104 *Sep 22, 2006Apr 5, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US7271156Dec 9, 2002Sep 18, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acids
US7410975Jun 18, 2004Aug 12, 2008Coley Pharmaceutical Group, Inc.Small molecule toll-like receptor (TLR) antagonists
US7534772Jun 22, 2001May 19, 2009University Of Iowa Research FoundationMethods for enhancing antibody-induced cell lysis and treating cancer
US7662949Nov 22, 2006Feb 16, 2010Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
US7674777Mar 9, 2010University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7713529Nov 27, 2002May 11, 2010University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US7723022Jan 14, 2005May 25, 2010University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7723500Aug 11, 2006May 25, 2010University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7741300Jun 22, 2010National Jewish Medical And Research CenterMethods of using nucleic acid vector-lipid complexes
US7776343Aug 17, 2010Csl LimitedImmunogenic complexes and methods relating thereto
US7776344Aug 17, 2010University Of Iowa Research FoundationMethods related to immunostimulatory nucleic acid-induced interferon
US7795235Sep 14, 2010Coley Pharmaceutical GmbhSemi-soft c-class immunostimulatory oligonucleotides
US7807803Jul 3, 2003Oct 5, 2010Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US7820379Oct 26, 2010Coley Pharmaceutical GmbhProcess for high throughput screening of CpG-based immuno-agonist/antagonist
US7879810Oct 1, 2004Feb 1, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7888327Feb 15, 2011University Of Iowa Research FoundationMethods of using immunostimulatory nucleic acid molecules to treat allergic conditions
US7935675May 3, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US7956043Dec 11, 2003Jun 7, 2011Coley Pharmaceutical Group, Inc.5′ CpG nucleic acids and methods of use
US7998492Oct 29, 2003Aug 16, 2011Coley Pharmaceutical Group, Inc.Methods and products related to treatment and prevention of hepatitis C virus infection
US8008266Aug 30, 2011University Of Iowa FoundationMethods of treating cancer using immunostimulatory oligonucleotides
US8058249Nov 15, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US8114419May 26, 2009Feb 14, 2012Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US8114848May 11, 2005Feb 14, 2012The United States Of America As Represented By The Department Of Health And Human ServicesImmunomodulatory oligonucleotides
US8129351Feb 25, 2005Mar 6, 2012The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US8148340Jul 9, 2004Apr 3, 2012The United States Of America As Represented By The Department Of Health And Human ServicesImmunomodulatory oligonucleotides
US8153141Apr 4, 2003Apr 10, 2012Coley Pharmaceutical GmbhImmunostimulatory G, U-containing oligoribonucleotides
US8158592Apr 17, 2012Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acid molecules
US8173141May 8, 2012Csl LimitedImmunogenic complexes and methods relating thereto
US8188254May 29, 2012Coley Pharmaceutical GmbhC-class oligonucleotide analogs with enhanced immunostimulatory potency
US8202688Jun 19, 2012University Of Iowa Research FoundationUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US8258106Sep 4, 2012University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US8283328Oct 9, 2012Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US8304396Oct 4, 2006Nov 6, 2012Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US8309527Feb 26, 2004Nov 13, 2012University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US8354522Jan 15, 2013Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
US8574599May 21, 1999Nov 5, 2013Ottawa Hospital Research InstituteMethods and products for inducing mucosal immunity
US8580268Sep 27, 2007Nov 12, 2013Coley Pharmaceutical GmbhCpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US8658607Mar 3, 2006Feb 25, 2014Zoetis BelgiumImmunostimulatory G, U-containing oligoribonucleotides
US8834900Aug 19, 2002Sep 16, 2014University Of Iowa Research FoundationCombination motif immune stimulatory oligonucleotides with improved activity
US8883174Mar 25, 2010Nov 11, 2014The Board Of Regents, The University Of Texas SystemCompositions for stimulation of mammalian innate immune resistance to pathogens
US9186400Oct 21, 2014Nov 17, 2015The Board Of Regents, The University Of Texas SystemCompositions for stimulation of mammalian innate immune resistance to pathogens
US9382545Oct 4, 2013Jul 5, 2016Coley Pharmaceutical GmbhCpG oligonucleotide analogs containing hydrophobic T analogs with enhanced immunostimulatory activity
US20020164341 *Dec 18, 2001Nov 7, 2002Loeb Health Research Institute At The Ottawa HospitalUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030026801 *Jun 22, 2001Feb 6, 2003George WeinerMethods for enhancing antibody-induced cell lysis and treating cancer
US20030091599 *Nov 20, 2002May 15, 2003Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030139364 *Oct 15, 2002Jul 24, 2003University Of Iowa Research FoundationMethods and products for enhancing immune responses using imidazoquinoline compounds
US20030148976 *Aug 19, 2002Aug 7, 2003Krieg Arthur M.Combination motif immune stimulatory oligonucleotides with improved activity
US20030191079 *Nov 27, 2002Oct 9, 2003University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20030212026 *Dec 9, 2002Nov 13, 2003University Of Iowa Research FoundationImmunostimulatory nucleic acids
US20030224010 *May 9, 2003Dec 4, 2003Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20030232074 *Apr 4, 2003Dec 18, 2003Coley Pharmaceutical GmbhImmunostimulatory G, U-containing oligoribonucleotides
US20040067905 *Jul 3, 2003Apr 8, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040087538 *Nov 21, 2003May 6, 2004University Of Iowa Research FoundationMethods of treating cancer using immunostimulatory oligonucleotides
US20040092472 *Jul 3, 2003May 13, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040106568 *Jul 25, 2003Jun 3, 2004University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20040131628 *Sep 19, 2003Jul 8, 2004Bratzler Robert L.Nucleic acids for the treatment of disorders associated with microorganisms
US20040142469 *Feb 26, 2004Jul 22, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040147468 *Oct 3, 2003Jul 29, 2004Krieg Arthur MImmunostimulatory nucleic acid molecules
US20040152649 *Jul 3, 2003Aug 5, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040152657 *Feb 26, 2004Aug 5, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040157791 *Feb 5, 2004Aug 12, 2004Dow Steven W.Systemic immune activation method using nucleic acid-lipid complexes
US20040167089 *Jan 30, 2004Aug 26, 2004The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20040171150 *Feb 26, 2004Sep 2, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040171571 *Dec 11, 2003Sep 2, 2004Coley Pharmaceutical Group, Inc.5' CpG nucleic acids and methods of use
US20040181045 *Feb 26, 2004Sep 16, 2004University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20040198680 *Jul 3, 2003Oct 7, 2004Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20040229835 *Jun 24, 2004Nov 18, 2004The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20040234512 *Jun 25, 2004Nov 25, 2004Coley Pharmaceutical GmbhMethods for regualting hematopoiesis using CpG-oligonucleotides
US20040235774 *Apr 23, 2004Nov 25, 2004Bratzler Robert L.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20040235777 *Jun 25, 2004Nov 25, 2004Coley Pharmaceutical GmbhMethods for regulating hematopoiesis using CpG-oligonucleotides
US20040235778 *Jun 25, 2004Nov 25, 2004Coley Pharmaceutical GmbhMethods for regulating hematopoiesis using CpG-oligonucleotides
US20050004061 *May 17, 2004Jan 6, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050004062 *May 17, 2004Jan 6, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050009774 *Jul 9, 2004Jan 13, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050013812 *Jul 14, 2003Jan 20, 2005Dow Steven W.Vaccines using pattern recognition receptor-ligand:lipid complexes
US20050032736 *Jul 9, 2004Feb 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050043529 *Apr 23, 2004Feb 24, 2005Coley Pharmaceutical GmbhUse of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US20050049216 *Jul 16, 2004Mar 3, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050054601 *Jul 16, 2004Mar 10, 2005Coley Pharmaceutical GmbhPharmaceutical composition comprising a polynucleotide and optionally an antigen especially for vaccination
US20050054602 *Jul 16, 2004Mar 10, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050059619 *Aug 19, 2003Mar 17, 2005Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids
US20050070491 *Jul 3, 2003Mar 31, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050075302 *Aug 18, 2003Apr 7, 2005Coley Pharmaceutical Group, Inc.Immune stimulation by phosphorothioate oligonucleotide analogs
US20050100983 *Nov 5, 2004May 12, 2005Coley Pharmaceutical GmbhCell-free methods for identifying compounds that affect toll-like receptor 9 (TLR9) signaling
US20050101554 *Jul 25, 2003May 12, 2005University Of Iowa Research FoundationMethods for treating and preventing infectious disease
US20050101557 *Aug 18, 2004May 12, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050119273 *Jun 18, 2004Jun 2, 2005Coley Pharmaceutical GmbhSmall molecule toll-like receptor (TLR) antagonists
US20050123523 *Aug 26, 2004Jun 9, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050130911 *Sep 27, 2004Jun 16, 2005Coley Pharmaceutical Group, Inc.Nucleic acid-lipophilic conjugates
US20050148537 *Nov 12, 2004Jul 7, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050171047 *Jan 14, 2005Aug 4, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050181422 *Mar 18, 2005Aug 18, 2005Coley Pharmaceutical GmbhProcess for high throughput screening of CpG-based immuno-agonist/antagonist
US20050197314 *Apr 19, 2005Sep 8, 2005University Of Iowa Research FoundationMethods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
US20050233999 *Oct 1, 2004Oct 20, 2005Krieg Arthur MImmunostimulatory nucleic acid molecules
US20050239732 *Oct 1, 2004Oct 27, 2005Krieg Arthur MImmunostimulatory nucleic acid molecules
US20050239733 *Oct 29, 2004Oct 27, 2005Coley Pharmaceutical GmbhSequence requirements for inhibitory oligonucleotides
US20050239734 *Oct 29, 2004Oct 27, 2005Coley Pharmaceutical GmbhC-class oligonucleotide analogs with enhanced immunostimulatory potency
US20050244379 *May 11, 2005Nov 3, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050245477 *May 11, 2005Nov 3, 2005University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20050256073 *Feb 18, 2005Nov 17, 2005Coley Pharmaceutical Group, Inc.Immunostimulatory viral RNA oligonucleotides
US20050267057 *Jul 14, 2003Dec 1, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050277604 *May 9, 2003Dec 15, 2005University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20050277609 *Jan 7, 2005Dec 15, 2005The University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003955 *Feb 25, 2005Jan 5, 2006University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20060003962 *Jul 15, 2005Jan 5, 2006Coley Pharmaceutical Group, Ltd.Methods and products related to treatment and prevention of hepatitis C virus infection
US20060094683 *Dec 7, 2005May 4, 2006University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20060140875 *Oct 20, 2005Jun 29, 2006Coley Pharmaceutical Group, Inc.Semi-soft C-class immunostimulatory oligonucleotides
US20060154890 *Dec 9, 2005Jul 13, 2006Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20060211644 *Feb 24, 2006Sep 21, 2006Coley Pharmaceutical Group, Inc.Immunostimulatory oligonucleotides
US20060229271 *Apr 10, 2006Oct 12, 2006Coley Pharmaceutical Group, Inc.Methods for treating infectious disease exacerbated asthma
US20060241076 *Apr 26, 2006Oct 26, 2006Coley Pharmaceutical GmbhModified oligoribonucleotide analogs with enhanced immunostimulatory activity
US20060246035 *Oct 29, 2003Nov 2, 2006Coley Pharmaceutical GmbhMethods and products related to treatment and prevention of hepatitis c virus infection
US20060286070 *Jul 8, 2005Dec 21, 2006Coley Pharmaceutical GmbhMethods related to immunostimulatory nucleic acid-induced interferon
US20070009710 *Aug 11, 2006Jan 11, 2007Toyo Boseki Kabushiki KaishaFlexible metal-clad laminate and method for producing the same
US20070010470 *May 11, 2005Jan 11, 2007University Of Iowa Research FoundationImmunomodulatory oligonucleotides
US20070037767 *Sep 22, 2006Feb 15, 2007Coley Pharmaceutical Group, Inc.Immunostimulatory nucleic acids for the treatment of asthma and allergy
US20070065467 *Aug 11, 2006Mar 22, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules for activating dendritic cells
US20070078104 *Sep 22, 2006Apr 5, 2007University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20070202128 *Dec 22, 2006Aug 30, 2007Coley Pharmaceutical Group, IncImmunomodulatory oligonucleotides
US20080009455 *Feb 24, 2006Jan 10, 2008Coley Pharmaceutical Group, Inc.Immunostimulatory oligonucleotides
US20080026011 *Jun 5, 2007Jan 31, 2008University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20080026986 *Jun 1, 2007Jan 31, 2008Rong-Fu WangReversal of the suppressive function of specific t cells via toll-like receptor 8 signaling
US20080031936 *Nov 10, 2006Feb 7, 2008University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20080045473 *Feb 15, 2007Feb 21, 2008Coley Pharmaceutical GmbhCompositions and methods for oligonucleotide formulations
US20080226649 *Mar 19, 2007Sep 18, 2008Coley Pharmaceutical GmbhCPG-like nucleic acids and methods of use thereof
US20090060927 *Mar 26, 2004Mar 5, 2009Coley Pharmaceutical GmbhPharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US20090117132 *Jun 30, 2006May 7, 2009Pfizer, Inc.Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment
US20090137519 *Dec 17, 2008May 28, 2009Coley Pharmaceutical Group, Inc.Semi-soft c-class immunostimulatory oligonucleotides
US20090142362 *Nov 6, 2007Jun 4, 2009Avant Immunotherapeutics, Inc.Peptide-based vaccine compositions to endogenous cholesteryl ester transfer protein (CETP)
US20090214578 *Sep 15, 2006Aug 27, 2009Coley Pharmaceutical GmbhImmunostimulatory Single-Stranded Ribonucleic Acid with Phosphodiester Backbone
US20090306177 *Sep 15, 2006Dec 10, 2009Coley Pharmaceutical GmbhModulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification
US20090311277 *Dec 17, 2009Coley Pharmaceutical Group, Inc.Nucleic acid compositions for stimulating immune responses
US20100125101 *Mar 25, 2009May 20, 2010Krieg Arthur MImmunostimulatory nucleic acid molecules
US20100183639 *Nov 10, 2009Jul 22, 2010Coley Pharmaceutical Group, Inc.Nucleic acid-lipophilic conjugates
US20100316659 *Dec 16, 2010Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
US20110033421 *Jul 13, 2010Feb 10, 2011Coley Pharmaceutical GmbhMethods related to immunostimulatory nucleic acid-induced interferon
US20110081366 *Nov 15, 2010Apr 7, 2011University Of Iowa Research FoundationImmunostimulatory nucleic acid molecules
US20110201672 *Aug 18, 2011Krieg Arthur MSemi-soft c-class immunostimulatory oligonucleotides
US20110206719 *Aug 25, 2011Coley Pharmaceutical GmbhImmunostimulatory oligoribonucleotides
Classifications
U.S. Classification514/44.00A
International ClassificationA61P17/06, A61P31/04, A61P37/08, A61K31/70, A61P1/04, A61K31/47, A61K31/175, A61P1/02, C07H21/02, A61K31/335, C07K14/52, A61K9/127, C07H21/04, A61K39/39, A61P19/02, A61P31/12, A61P43/00, A61P33/00, A61K45/00, A61K39/395, A61K48/00, A61K47/48, C12N15/117, A61P11/06, A61P35/00, A61K31/7088, C12N15/09, A61P37/04, A61P1/00, A61P37/02, C12Q1/68, A61K31/00, C07H21/00, A61K31/4706, A61P37/06
Cooperative ClassificationC12N2310/17, A61K31/00, A61K39/00, A61K2039/55561, C07H21/00, C12N15/117, A61K31/7048, A61K31/711, A61K31/4706, A61K39/39, C12Q1/68, C12N2310/315, A61K31/7125
European ClassificationC07H21/00, C12N15/117, A61K39/00, A61K39/39, C12Q1/68, A61K31/00, A61K31/4706, A61K31/7048, A61K31/711, A61K31/7125
Legal Events
DateCodeEventDescription
Jan 13, 2005ASAssignment
Owner name: COLEY PHARMACEUTICAL GROUP, INC., MASSACHUSETTS
Free format text: CHANGE OF NAME;ASSIGNOR:CPG IMMUNOPHARMACEUTICALS, INC.;REEL/FRAME:015589/0687
Effective date: 20000121
Owner name: UNIVERSITY OF IOWA RESEARCH FOUNDATION, THE, IOWA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KRIEG, ARTHUR M.;REEL/FRAME:015590/0277
Effective date: 19961211
Owner name: IOWA RESEARCH FOUNDATION, THE UNIVERSITY OF, IOWA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KLINE, JOEL;REEL/FRAME:015590/0258
Effective date: 19970623
Owner name: CPG IMMUNOPHARMACEUTICALS, INC., MASSACHUSETTS
Free format text: LETTER OF AGREEMENT;ASSIGNOR:STEINBERG, ALFRED D.;REEL/FRAME:015589/0698
Effective date: 19981030
Owner name: UNITED STATES OF AMERICA, AS REPRESENTED BY THE SE
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KLINMAN, DENNIS;REEL/FRAME:015589/0685
Effective date: 20000301
Oct 10, 2008ASAssignment
Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF
Free format text: CONFIRMATORY LICENSE;ASSIGNOR:UNIVERSITY OF IOWA;REEL/FRAME:021670/0807
Effective date: 20040809