Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS20070299028 A1
Publication typeApplication
Application numberUS 11/679,159
Publication dateDec 27, 2007
Filing dateFeb 26, 2007
Priority dateOct 7, 2003
Also published asEP1687410A1, EP1687410A4, US8258105, US20050113326, WO2005038013A1
Publication number11679159, 679159, US 2007/0299028 A1, US 2007/299028 A1, US 20070299028 A1, US 20070299028A1, US 2007299028 A1, US 2007299028A1, US-A1-20070299028, US-A1-2007299028, US2007/0299028A1, US2007/299028A1, US20070299028 A1, US20070299028A1, US2007299028 A1, US2007299028A1
InventorsAndrew Siwkowski, Edward Wancewicz, Thomas Leedom, Lynnetta Watts, Mausumee Guha, Brett Monia, Richard Griffey, Richard Geary, Scott Henry, Arthur Levin
Original AssigneeSiwkowski Andrew M, Edward Wancewicz, Leedom Thomas A, Lynnetta Watts, Mausumee Guha, Monia Brett P, Griffey Richard H, Geary Richard S, Scott Henry, Arthur Levin
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Backbone modifications to modulate oligonucleotide targeting in vivo
US 20070299028 A1
Abstract
The present invention provides antisense compounds and methods for modulating the expression of target genes expressed in the kidney. In particular, this invention provides antisense oligonucleotide compounds optimized for targeting nucleic acid molecules expressed in the kidney. Such compounds are shown herein to efficiently modulate the expression of target genes PTEN, SGLT2 and connective tissue growth factor (CTGF) in the kidney.
Images(58)
Previous page
Next page
Claims(37)
1. A method of modulating pharmacokinetic and pharmacodynamic properties of a gapmer antisense compound by modulating the number of phosphodiester linkages.
2. The method of claim 2, wherein the gapmer comprises two wings and wherein the antisense compound has at least one phosphodiester linkage.
3. The method of claim 2, wherein the at least one phosphodiester linkage is in a wing.
4. The method of claim 3, wherein the wings have one or more regions of alternating phosphorothioate and phosphodiester linkages in the wings.
5. The method of claim 4, wherein each region comprise up to 2 nucleobases.
6. The method of claim 4, wherein each region comprises 1 nucleobase.
7. The method of claim 1, wherein the gapmer antisense compound comprises a first central region consisting of at least 5 contiguous 2′-deoxy nucleosides flanked by a second 5′ region and a third 3′ region, each of said second and third regions independently consisting of at least one 2′-O-methoxyethyl nucleoside.
8. The method of claim 1, wherein the pharmacodynamic property is tissue distribution.
9. The method of claim 1, wherein the pharamacodynamic property is serum protein binding.
10. A method of enhancing antisense inhibition of expression of a preselected cellular RNA target in a kidney cell or kidney tissue comprising contacting a kidney cell or tissue with an antisense compound 8 to 80 nucleobases in length which is substantially complementary to a preselected cellular RNA target,
wherein said antisense compound comprises a first central region consisting of at least 5 contiguous 2′-deoxy nucleosides flanked by a second 5′ region and a third 3′ region, each of said second and third regions independently consisting of at least one 2′-O-methoxyethyl nucleoside, and wherein the internucleoside linkages of the first region are phosphorothioate linkages and the internucleoside linkages of the second and third regions comprise at least one phosphodiester linkage, so that expression of said RNA target is inhibited.
11. The method of claim 10, wherein the antisense compound is an antisense oligonucleotide.
12. The method of claim 10, wherein the antisense compound comprises 10 to 50 nucleobases.
13. The method of claim 10, wherein the antisense compound comprises 13 to 30 nucleobases.
14. The method of claim 10, wherein the antisense compound comprises 15 to 25 nucleobases.
15. The method of claim 10, wherein the antisense compound comprises 18 to 22 nucleobases.
16. The method of claim 10, wherein the antisense compound has at least 70% complementarity with a nucleic acid molecule encoding said preselected cellular RNA target.
17. The method of claim 10, wherein the antisense compound has at least 80% complementarity with a nucleic acid molecule encoding said preselected cellular RNA target.
18. The method of claim 10, wherein the antisense compound has at least 90% complementarity with a nucleic acid molecule encoding said preselected cellular RNA target.
19. The method of claim 10, wherein the antisense compound has at least 95% complementarity with a nucleic acid molecule encoding said preselected cellular RNA target.
20. A gapped oligomeric compound comprising:
a contiguous sequence of nucleosides linked by internucleoside linking groups comprising an internal region of β-D-deoxyribonucleosides linked by phosphorothioate internucleoside linkages and flanked on each side by external regions of 2′-sugar modified nucleosides;
the oligomeric compound further comprising phosphorothioate internucleoside linkages at least between the two nucleosides located at the 5′ terminus, the two nucleosides located at the 3′ terminus and between the junctions located between each external region and the internal region; and
wherein each of the external regions independently comprises at least one phosphodiester internucleoside linkage.
21. The gapped oligomeric compound of claim 20 wherein each of the external regions comprises at least two phosphodiester internucleoside linkages.
22. The gapped oligomeric compound of claim 20 wherein each external region has alternating phosphorothioate and phosphodiester internucleoside linkages.
23. The gapped oligomeric compound of claim 20 wherein each of the 2′-sugar modified nucleosides comprises a 2′-substituent group, independently, selected from halo, amino, azido, O-allyl, O—C1-10 alkyl, OCF3, O—(CH2)2-O—CH3, O(CH2)2SCH3, O—(CH2)2-O—N(Rm)(Rn) or O—CH2-C(═O)—N(Rm)(Rn), wherein each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted C1-10 alkyl.
24. The gapped oligomeric compound of claim 23 wherein each 2′-substituent group is, independently, fluoro, O—CH3, OCF3 or O—(CH2)2-O—CH3.
25. The gapped oligomeric compound of claim 24 wherein each 2′-substituent group is O—(CH2)2-O—CH3.
26. The gapped oligomeric compound of claim 20 wherein each external region is, independently from 3 to about 6 nucleosides in length and the internal region is from about 7 to about 14 nucleosides in length.
27. The gapped oligomeric compound of claim 20 wherein each external region is, independently from 3 to about 5 nucleosides in length and the internal region is from about 7 to about 12 nucleosides in length.
28. The gapped oligomeric compound of claim 20 having from about 12 to about 30 nucleosides in length.
29. The gapped oligomeric compound of claim 20 having from about 12 to about 24 nucleosides in length.
30. The gapped oligomeric compound of claim 20 having the formula:

5′-Ms(Mj)nMs-(Ns)r-(Mj)mMsM-3′
wherein:
each M is a is a 2′-sugar modified nucleoside;
each N is a β-D-deoxyribonucleoside;
each s is a phosphorothioate internucleoside linkage;
each j is, independently, a phosphorothioate or phosphodiester internucleoside linkage;
n and m are each, independently, from 1 to 4;
r is from about 6 to about 14; and
wherein at least one j in each external region is a phosphodiester internucleoside linkage.
31. The gapped oligomeric compound of claim 30 wherein n and m are each 1.
32. The gapped oligomeric compound of claim 31 wherein n and m are each, independently, from 2 to 4.
33. The gapped oligomeric compound of claim 30 wherein n and m are each, independently, 3 and each external region independently comprises two phosphodiester internucleoside linkages.
34. A method of preventing or delaying the onset of a disease or condition in an animal, wherein said disease or condition is associated with expression of a preselected cellular RNA target expressed in the kidney, said method comprising administering to an animal an effective amount of the antisense compound of claim 20.
35. The method of claim 34, wherein said disease or condition is a metabolic disease or condition.
36. The method of claim 34, wherein said disease or condition is diabetes.
37. The method of claim 34, wherein said disease or condition is type 2 diabetes.
Description
  • [0001]
    This application is a continuation-in-part of U.S. patent application Ser. No. 10/946,498, filed Sep. 21, 2004, which claims the benefit of priority to U.S. provisional patent application Ser. No. 60/509,450, filed Oct. 7, 2003 and U.S. provisional patent application Ser. No. 60/517,334, filed Nov. 3, 2003, this application also claims the benefit of priority to U.S. provisional patent application Ser. No. 60/776,550, filed Feb. 24, 2006, each of which are hereby incorporated by reference in their entirety.
  • FIELD OF THE INVENTION
  • [0002]
    The present invention provides antisense compounds and methods for modulating the expression of target genes expressed in the kidney. In particular, this invention relates to antisense oligonucleotide compounds optimized for targeting nucleic acid molecules expressed in the kidney. Such compounds are shown herein to efficiently modulate the expression of target genes expressed in the kidney.
  • BACKGROUND OF THE INVENTION
  • [0003]
    One of the challenges of drug development is to direct compounds to the appropriate site of action in the body. For topical agents, this difficulty is readily overcome by application of the drug to the desired site of action. For systemically delivered agents, delivered by parenteral or non-parenteral routes, modifications are often made to active compounds identified using in vitro screening methods to promote desired tissue localization. These modifications must obviously be made without disrupting activity of the compound.
  • [0004]
    Pharmacokinetic and pharmacodynamic properties of antisense oligonucleotides (ASOs) are dependent substantially on the chemistry of the compound (e.g., sugar and backbone modifications, non-nucleic acid substituent groups) rather than the sequence of the compound.
  • [0005]
    Efficacy and sequence specific behavior of antisense compounds in biological systems depend upon a variety of factors, which include their resistance to enzymatic degradation, binding affinity for the target, susceptibility to RNase H cleavage when bound to a target mRNA and efficiency of cellular uptake. In order to achieve the proper balance of these features for efficient modulation of target gene expression, chemical modifications are made to the antisense compound. For example, unmodified phosphodiester antisense oligonucleotides are degraded rapidly in biological fluids containing hydrolytic enzymes (Shaw et al., Nucleic Acids Res. 1991, 19, 747-750; Woolf et al., Nucleic Acids Res. 1990, 18, 1763-1769) and first generation modified antisense compounds (i.e. 2′-deoxyphosphorothioate oligonucleotides) also are subject to activity-limiting degradation (Maier et al., Biomed. Pept., Proteins Nucleic Acids 1995, 1, 235-241; Agrawal et al., Proc. Natl. Acad. Sci. U.S.A. 1991, 88, 7595-7599). Thus, modifications that render the oligonucleotide more resistant to nuclease activity are desirable in order to enhance antisense activity of the compound. Sugar moieties of antisense compounds also have been modified to increase such properties as lipophilicity, binding affinity for the target mRNA, chemical stability and nuclease resistance.
  • [0006]
    Distribution to peripheral tissues and ultimate uptake into the cells of target organs also is critical to the effectiveness of antisense compounds for treatment of a wide range of diseases.
  • [0007]
    The highest concentrations of antisense compounds are typically found in the liver, kidney, spleen and lymph nodes, but can be detected in nearly all organs except for the brain (Geary et al., Curr. Opin. Investig. Drugs, 2001, 2, 562-573; Geary et al., J. Pharm. Exp. Therap., 2001, 296, 890-897). Despite the ability of current antisense compounds to be delivered to the kidney, there is a need for development of improved antisense compounds that effect target mRNA reduction in the kidney at lower doses and without toxicity.
  • [0008]
    The kidney is an important target for antisense therapeutics due to its role in controlling many metabolic processes. A number of genes expressed in the kidney have been associated with the development of metabolic disease. Two such examples are the sodium-dependent glucose cotransporter 2 (SGLT2) and connective tissue growth factor (CTGF), both of which have been linked to the development and/or progression of diabetes.
  • [0000]
    Sodium-Dependent Glucose Cotransporter 2 (SGLT2)
  • [0009]
    Diabetes is a disorder characterized by hyperglycemia due to deficient insulin action. Chronic hyperglycemia is a major risk factor for diabetes-associated complications, including heart disease, retinopathy, nephropathy and neuropathy. As the kidneys play a major role in the regulation of plasma glucose levels, renal glucose transporters are becoming attractive drug targets (Wright, Am. J. Physiol. Renal Physiol., 2001, 280, F10-18).
  • [0010]
    Synthetic agents that are derived from phlorizin, a specific inhibitor of sodium/glucose transporters, have been designed and include T-1095, and its metabolically active form T-1095A (Tsujihara et al., J. Med. Chem., 1999, 42, 5311-5324). Phlorizin, T-1095 and T-1095A all inhibited sodium-dependent glucose uptake in brush border membranes prepared from normal and diabetic rat kidney, rat small intestine, mouse kidney and dog kidney, as well as in Xenopus oocytes injected with human SGLT mRNA (Oku et al., Diabetes, 1999, 48, 1794-1800; Oku et al., Eur. J. Pharmacol., 2000, 391, 183-192). These agents have been tested as antidiabetic compounds in laboratory animals with genetic and streptozotocin-induced diabetes. In these models, administration of these compounds inhibited renal SGLT activity, increased urinary glucose excretion and improved glucose tolerance, hyperglycemia and hypoinsulemia (Arakawa et al., Br. J. Pharmacol., 2001, 132, 578-586; Oku et al., Diabetes, 1999, 48, 1794-1800; Oku et al., Eur. J. Pharmacol., 2000, 391, 183-192). Prolonged treatment of db/db mice with T-1095 yielded similar results and also almost completely suppressed the increase of urinary albumin and improved renal glomeruli pathology, indicating a beneficial influence on renal dysfunction and a protective effect against nephropathy, respectively (Arakawa et al., Br. J. Pharmacol., 2001, 132, 578-586). Diabetic nephropathy is the most common cause of end-stage renal disease that develops in many patients with diabetes. In Zucker diabetic fatty rats, long-term treatment with T-1095 lowered both fed and fasting glucose levels to near normal ranges. Also observed were recovered hepatic glucose production and glucose utilization rates without a significant improvement in skeletal muscle glucose utilization rate, indicating that hyperglycemia contributes to insulin resistance in hepatic and adipose tissue in this rat model of diabetes. These results further suggest that glucotoxicity, which results from long-term hyperglycemia, induces tissue-dependent insulin resistance in diabetic patients (Nawano et al., Am. J. Physiol. Endocrinol. Metab., 2000, 278, E535-543).
  • [0011]
    Other SGLT2 inhibiting compounds are known in the art, such as the c-aryl glucosides disclosed and claimed in U.S. Pat. No. 6,414,126, which are inhibitors of sodium dependent glucose transporters found in the intestine and kidney and are proposed to treat diabetes, hyperglycemia and related diseases when used alone or in combination with other antidiabetic agents (Ellsworth et al., 2002).
  • [0012]
    The US pre-grant publication 20030055019 claims and discloses isolated mutant proteins selected from a group which includes SGLT2, the corresponding nucleic acid molecules encoding said mutant proteins, isolated antisense derivatives of the nucleic acid sequences encoding said mutant proteins, as well as methods of delivering said antisense nucleic acid derivatives to treat or prevent hypertension, diabetes, insulin sensitivity, obesity, dyslipidemia and stroke. This application also discloses the antisense molecules may be DNA or RNA or a chimeric mixture, single-stranded or double-stranded or may comprise a ribozyme or catalytic RNA (Shimkets, 2003).
  • [0013]
    The European Patent Applications EP 1 293 569 and EP 1 308 459 claim and disclose a polynucleotide comprising a protein-coding region of the nucleotide sequence of any one of a group of sequences which includes a nucleic acid sequence encoding human SGLT2, an oligonucleotide comprising at least 15 nucleotides complementary to the nucleotide sequence or to a complementary strand thereof and an antisense polynucleotide against the claimed polynucleotide or a part thereof. These applications disclose the use of said antisense polynucleotides for suppressing the expression of a polypeptide of the invention and for gene therapy (Isogai et al., 2003; Isogai et al., 2003).
  • [0014]
    Although phlorizin and its derivatives are potent inhibitors of sodium-glucose cotransporters, these agents do not specifically inhibit a single species of SGLT, thus all SGLTs in all tissues are affected. Thus, there remains a need for therapeutic compounds that target specific SGLT species. Antisense technology is an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic and research applications for the modulation of SGLT2 expression. Furthermore, given the role of SGLT2 in the development of diabetes, antisense compounds with the ability to be delivered to the kidney and specifically inhibit SGLT2 are highly desirable.
  • [0000]
    Connective Tissue Growth Factor (CTGF)
  • [0015]
    Connective tissue growth factor (CTGF; also known as ctgrofact, fibroblast inducible secreted protein, fisp-12, NOV2, insulin-like growth factor-binding protein-related protein 2, IGFBP-rP2, IGFBP-8, HBGF-0.8, Hcs24, and ecogenin) is a member of the CCN (CTGF/CYR61/NOV) family of modular proteins, named for the first family members identified, connective tissue growth factor, cysteine-rich (CYR61), and nephroblastoma overexpressed (NOV), but the family also includes the proteins ELM-1 (expressed in low-metastatic cells), WISP-3 (Wnt-1-induced secreted protein), and COP-1 (WISP-2). CCN proteins have been found to be secreted, extracellular matrix-associated proteins that regulate cellular processes such as adhesion, migration, mitogenesis, differentiation, survival, angiogenesis, atherosclerosis, chondrogenesis, wound healing, tumorigenesis, and vascular and fibrotic diseases like scleroderma (Lau and Lam, Exp. Cell Res., 1999, 248, 44-57).
  • [0016]
    Connective tissue growth factor is expressed in fibroblasts during normal differentiation processes that involve extracellular matrix (ECM) production and remodeling, such as embryogenesis and uterine decidualization following implantation. Connective tissue growth factor is also frequently overexpressed in fibrotic skin disorders such as systemic sclerosis, localized skin sclerosis, keloids, scar tissue, eosinophilic fasciitis, nodular fasciitis, and Dupuytren's contracture. Connective tissue growth factor mRNA or protein levels are elevated in fibrotic lesions of major organs and tissues including the liver, kidney, lung, cardiovascular system, pancreas, bowel, eye, and gingiva. In mammary, pancreatic and fibrohistiocytic tumors characterized by significant connective tissue involvement, connective tissue growth factor is overexpressed in the stromal compartment. In many cases, connective tissue growth factor expression is linked spatially and temporally to the profibrogenic cytokine transforming growth factor-beta (TGF-□) (Moussad and Brigstock, Mol. Genet. Metab., 2000, 71, 276-292).
  • [0017]
    Expansion of ECM with fibrosis occurs in many tissues as part of the end-organ complications of diabetes (i.e. diabetic nephropathy), and advanced glycosylation end products (AGE) are implicated as one causitive factor in diabetic tissue fibrosis. In addition to being a potent inducer of ECM synthesis and angiogenesis, connective tissue growth factor is increased in tissues from rodent models of diabetes. AGE treatment of primary cultures of CRL-2097 and CRL-1474 nonfetal human dermal fibroblasts resulted in an increase in steady state levels of connective tissue growth factor mRNA as well as protein levels in conditioned medium and cell-associated connective tissue growth factor, while other IGFBP-related proteins were not upregulated by AGE. Thus, AGE upregulates the profibrotic and proangiogenic protein connective tissue growth factor, which may play a role in diabetic complications (Twigg et al., Endocrinology, 2001, 142, 1760-1769).
  • [0018]
    Connective tissue growth factor has been associated with the development of diabetes-related conditions, including diabetic nephropathy. Diabetic nephropathy is a common complication in patients with either type 1 or type 2 diabetes mellitus and is recognized to cause severe morbidity and mortality. Structural hallmarks of advanced diabetic nephropathy are glomerulosclerosis and tubulointerstitial fibrosis leading to kidney failure. Current therapies include ACE inhibitors and angiotensin II receptor blockers, both of which are not justified for blanket use among all newly diagnosed patients since only 30-40% will develop progressive renal disease and the long term side effects of these drugs are unknown.
  • [0019]
    In addition to the need for safe and effective treatments for diabetes is a need for a reliable method to accurately predict, at early stages of disease, which diabetic patients will develop nephropathy and progress to kidney failure. Persistent microalbuminuria is regarded as a predictor of established vascular damage and an indicator of incipient nephropathy. Studies of renal biopsies from patients with type 1 diabetic nephropathy demonstrate an increase in expression of CTGF in renal tissue exhibiting microalbuminuria and nephropathy, relative to normal control tissues (Adler et al., Kidney Int., 2001, 60, 2330-2336), suggesting CTGF is not only a mediator of diabetic nephropathy, but could be used as a marker for the development of disease (Riser et al., Kidney Int., 2003, 64, 451-458).
  • [0020]
    Disclosed and claimed in U.S. Pat. No. 5,876,730 is a substantially pure or isolated polypeptide characterized as having an amino acid sequence corresponding to the carboxy terminal amino acids of a connective tissue growth factor (CTGF) protein, wherein the polypeptide has an amino acid sequence beginning at amino acid residue 247 or 248 from the N-terminus of connective tissue growth factor, an isolated polynucleotide sequence encoding the connective tissue growth factor polypeptide, a recombinant expression vector which contains said polynucleotide, a host cell containing said expression vector, and a pharmaceutical composition comprising a therapeutically effective amount of connective tissue growth factor polypeptide in a pharmaceutically acceptable carrier. Antisense oligonucleotides are generally disclosed (Brigstock and Harding, 1999).
  • [0021]
    Disclosed and claimed in U.S. Pat. Nos. 5,783,187; 5,585,270; 6,232,064; 6,150,101; 6,069,006 and PCT Publication WO 00/35936 are an isolated polynucleotide encoding the connective tissue growth factor polypeptide, expression vectors, host cells stably transformed or transfected with said vectors; an isolated polynucleotide comprising 5′ untranslated regulatory nucleotide sequences isolated from upstream of connective tissue growth factor, wherein said untranslated regulatory nucleotide sequences comprises a transcriptional and translational initiation region and wherein said sequence is a TGF-beta responsive element; an isolated nucleic acid construct comprising a non-coding regulatory sequence isolated upstream from a connective tissue growth factor (CTGF) gene, wherein said non-coding regulatory sequence is operably associated with a nucleic acid sequence which expresses a protein of interest or antisense RNA, wherein said nucleic acid sequence is heterologous to said non-coding sequence; and a fragment of connective tissue growth factor (CTGF) polypeptide having the ability to induce ECM synthesis, collagen synthesis and/or myofibroblast differentiation, comprising an amino acid sequence encoded by at least exon 2 or exon 3 of said polypeptide. Further claimed is a method for identifying a composition which affects TGF-beta-induced connective tissue growth factor expression, and a method of diagnosing a pathological state in a subject suspected of having a pathology selected from the group consisting of fibrotic disease and atherosclerosis, the method comprising obtaining a sample suspected of containing connective tissue growth factor, whereby detecting a difference in the level of connective tissue growth factor in the sample from the subject as compared to the level of connective tissue growth factor in the normal standard sample is diagnostic of a pathology characterized by a cell proliferative disorder associated with connective tissue growth factor in the subject. Further claimed is a method for ameliorating a cell proliferative disorder associated with connective tissue growth factor, comprising administering to a subject having said disorder, at the site of the disorder, a composition comprising a therapeutically effective amount of an antibody or fragment thereof that binds to connective tissue growth factor, wherein said antibody or fragment thereof does not bind to PDGF. Antisense oligonucleotides are generally disclosed (Grotendorst, 2000; Grotendorst and Bradham, 2001; Grotendorst and Bradham, 2000; Grotendorst and Bradham, 1996; Grotendorst and Bradham, 1998; Grotendorst and Bradham, 2000).
  • [0022]
    Disclosed and claimed in PCT Publication WO 99/66959 is a device for promoting neuronal regeneration, comprising a gene activated matrix comprising a biocompatible matrix and at least one neuronal therapeutic encoding agent having an operably linked promoter device, wherein the neuronal therapeutic encoding agent encodes an inhibitor of neuronal cell growth, and wherein the inhibitor of neuronal cell growth is selected from the group consisting of NFB42, TGF-beta, connective tissue growth factor (CTGF), and macrophage migration inhibitory factor (MIF), and wherein the neuronal therapeutic encoding agent is selected from the group consisting of a nucleic acid molecule, a vector, an antisense nucleic acid molecule and a ribozyme (Baird et al., 1999).
  • [0023]
    Disclosed and claimed in PCT Publication WO 00/27868 is a substantially pure connective tissue growth factor polypeptide or functional fragments thereof, an isolated polynucleotide sequence encoding said polypeptide, said polynucleotide sequence wherein T can also be U, a nucleic acid sequence complementary to said polynucleotide sequence, and fragments of said sequences that are at least 15 bases in length and that will hybridize to DNA which encodes the amino acid sequence of the connective tissue growth factor protein under moderate to highly stringent conditions. Further claimed is an expression vector including said polynucleotide, a host cell stably transformed with said vector, an antibody that binds to said polypeptide, and a method for producing said polypeptide. Further claimed is a method for inhibiting the expression of connective tissue growth factor in a cell comprising contacting the cell with a polynucleotide which binds to a target nucleic acid in the cell, wherein the polynucleotide inhibits the expression of connective tissue growth factor in the cell, wherein the polynucleotide is an antisense polynucleotide, as well as a kit for the detection of connective tissue growth factor expression comprising a carrier means being compartmentalized to receive one or more containers, comprising at least one container containing at least one antisense oligonucleotide that binds to connective tissue growth factor (Schmidt et al., 2000).
  • [0024]
    Disclosed and claimed in PCT Publication WO 00/13706 is a method for treating or preventing fibrosis, the method comprising administering to a subject in need an effective amount of an agent that modulates, regulates or inhibits the expression or activity of connective tissue growth factor or fragments thereof, and wherein the agent is an antibody, an antisense oligonucleotide, or a small molecule. The method is directed to treating kidney fibrosis and associated renal disorders, in particular, complications associated with diabetes and hypertension (Riser and Denichili, 2000).
  • [0025]
    Disclosed and claimed in PCT Publication WO 01/29217 is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from a group comprising NOV1, NOV2 (connective tissue growth factor), and NOV3, a mature form or variant of an amino acid sequence selected from said group, as well as a nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from said group as well as mature and variant forms or fragments of said polypeptides, and the complement of said nucleic acid molecule. Antisense oligonucleotides are generally disclosed (Prayaga et al., 2001).
  • [0026]
    A phosphorothioate antisense oligonucleotide, 16 nucleotides in length and targeted to the translation initiation start site, was used to inhibit expression of connective tissue growth factor and suppress proliferation and migration of bovine aorta vascular endothelial cells in culture (Shimo et al., J. Biochem. (Tokyo), 1998, 124, 130-140). This antisense oligonucleotide was also used to show that connective tissue growth factor induces apoptosis in MCF-7 human breast cancer cells and that TGF-beta-induced apoptosis is mediated, in part, by connective tissue growth factor (Hishikawa et al., J. Biol. Chem., 1999, 274, 37461-37466). The same antisense oligonucleotide was also found to inhibit the TGF-beta-mediated activation of caspase 3 and thus to inhibit induction of TGF-beta-mediated apoptosis in human aortic smooth muscle cells (HASC) (Hishikawa et al., Eur. J. Pharmacol., 1999, 385, 287-290). This antisense oligonucleotide was also used to block connective tissue growth factor expression and demonstrate that high blood pressure upregulates expression of connective tissue growth factor in mesangial cells, which in turn enhances ECM protein production and induces apoptosis, contributing to the remodeling of mesangium and ultimately glomerulosclerosis (Hishikawa et al., J. Biol. Chem., 2001, 276, 16797-16803).
  • [0027]
    Currently, there are no known therapeutic agents that effectively inhibit the synthesis of connective tissue growth factor and thus far. Consequently, there remains a long felt need for additional agents capable of effectively inhibiting connective tissue growth factor function, which for the treatment of diseases like diabetes, requires compounds that can be effectively delivered to the kidney.
  • [0028]
    Antisense technology is emerging as an effective means for reducing the expression of specific gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of connective tissue growth factor expression.
  • [0029]
    The present invention provides antisense compounds and methods for optimized kidney targeting as well as methods for preventing diseases and conditions associated with expression of selected target genes in the kidney. Further provided are compounds and methods for modulating blood glucose levels and for inhibiting the development of diabetic nephropathy. Also provided are compounds and methods for modulating SGLT2 and CTGF expression in kidney cells and tissues. Further identified herein are motifs and modifications to modulate tissue distribution and half-life of oligonucleotides.
  • SUMMARY OF THE INVENTION
  • [0030]
    The present invention is directed to antisense compounds that are optimized for modulating expression of target genes in the kidney. Provided are methods of enhancing antisense inhibition of expression of preselected cellular RNA targets in kidney cells and kidney tissue using antisense compounds of the invention. Also provided are methods of preventing or delaying the onset of a disease or condition in an animal, wherein said disease or condition is associated with expression of a preselected cellular RNA target, particularly SGLT2 or CTGF. Methods of lowering blood glucose levels in an animal and methods of delaying or preventing the onset of diabetic nephropathy also are set forth herein. Such methods comprise administering a therapeutically or prophylactically effective amount of one or more of the compounds of the invention to the animal in need of treatment. Provided herein are methods of enhancing antisense inhibition of expression of SGLT2 in kidney cells or kidney tissues, comprising contacting said cells or tissues with one or more of the compounds of the invention. Also provided are methods of enhancing antisense inhibition of expression of CTGF in kidney cells or kidney tissues, comprising contacting said cells or tissues with one or more of the compounds of the invention.
  • [0031]
    The invention includes a gapped oligomeric compound comprising a contiguous sequence of nucleosides linked by internucleoside linking groups comprising an internal region of β-D-deoxyribonucleosides linked by phosphorothioate internucleoside linkages and flanked on each side by external regions of 2′-sugar modified nucleosides. The oligomeric compound further comprises phosphorothioate internucleoside linkages at least between the two nucleosides located at the 5′ terminus, the two nucleosides located at the 3′ terminus and between the junctions located between each external region and the internal region; and wherein each of the external regions independently comprises at least one phosphodiester internucleoside linkage. Preferably, each of the external regions comprises at least two phosphodiester internucleoside linkages wherein the phosphodiester and phosphorothioate linkages can be alternating. The compound can include nucleosides with modified sugar moieties, wherein the 2′-sugar modified nucleosides comprises a 2′-substituent group, independently, selected from halo, amino, azido, O-allyl, O—C1-10 alkyl, OCF3, O—(CH2)2-O—CH3, O—(CH2)2SCH3, O—(CH2)2-O—N(Rm)(Rn) or O—CH2-C(═O)—N(Rm)(Rn), wherein each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted C1-C10 alkyl. In a preferred embodiment, the 2′-substituent group is, independently, fluoro, O—CH3, OCF3 or O—(CH2)2-O—CH3. Preferably, each external region of the compound is, independently from 3 to about 6 nucleosides in length, preferably about 3 to about 5 nucleosides in length; and the internal region is from about 7 to about 14 nucleosides in length, preferably about 7 to 12 nucleosides in length; with the overall length of the compound being about 12 to 30 nucleosides in length, preferably about 12 to 24 nucleosides in length.
  • [0032]
    The invention includes a gapped oligomeric compound having the formula:
    5′-Ms(Mj)nMs-(Ns)r-(Mj)mMsM-3′
    wherein, each M is a is a 2′-sugar modified nucleoside; each N is a β-D-deoxyribonucleoside; each s is a phosphorothioate internucleoside linkage; each j is, independently, a phosphorothioate or phosphodiester internucleoside linkage; n and m are each, independently, either 1, 2, 3, or 4; r is from about 6 to about 14; and wherein at least one j in each external region is a phosphodiester internucleoside linkage.
  • [0033]
    The invention further includes the modulation of pharmacokinetic and pharmacodynamic properties of an ASO comprising the use of the motifs of the instant invention. Preferably, the invention includes a method of altering the pharmacokinetic and pharmacodynamic properties of a fully phosphorothioate backbone MOE-gapmer, preferably a 5-10-5 MOE gapmer (e.g., compound 116847) by insertion of phosphodiester linkages into at least one of the wings of the MOE-gapmer. Pharmacokinetic and pharmacodynamic properties include, but are not limited to, tissue targeting, serum protein binding, and tissue and systemic half-life of the ASO. The invention includes the method of modulating relative targeting and/or activity of an ASO in liver, kidney, and/or fat by changing at least one phosphorothioate backbone linkage to a phosphodiester linkage in a compound with a fully phosphorothioate backbone. In a preferred embodiment, the backbone linkage that is changed is in the wing of a MOE-gapmer. The invention further includes the method of modulating relative serum protein binding by changing at least one phosphorothioate backbone linkage to a phosphodiester linkage in a compound with a fully phosphorothioate backbone. In a preferred embodiment, the backbone linkage that is changed is in the wing of a MOE-gapmer.
  • DETAILED DESCRIPTION OF THE INVENTION
  • [0000]
    A. Overview of the Invention
  • [0034]
    In accordance with the present invention, oligomeric compounds that efficiently modulate expression of target genes in the kidney are provided. The oligomeric compounds of the invention are chimeric oligonucleotides having mixed phosphorothioate and phosphodiester backbones, referred to herein as “mixed backbone compounds.” Preferably, the compounds of the invention have a central “gap” region consisting of at least 5 contiguous 2′-deoxy nucleosides flanked by two “wing” regions consisting of at least one 2′-O-methoxyethyl nucleoside in each region. The internucleoside linkages of the preferred compounds are phosphorothioate linkages in the central “gap” region and phosphodiester linkages in the two “wing” regions. In another embodiment, mixed backbone compounds have phosphodiester linkages in the “wing” regions except for one phosphodiester linkage at one or both of the extreme 5′ and 3′ ends of the oligonucleotide.
  • [0035]
    It is shown herein that mixed backbone compounds are efficiently delivered to the kidney and treatment with the mixed backbone compounds results in efficient modulation of target gene expression in the kidney without liver or kidney toxicity. It is further shown herein that treatment with mixed backbone compounds in mouse models of type 2 diabetes reduces blood glucose levels and the development of diabetic nephropathy. Data from two molecular targets are provided as illustrations of the invention.
  • [0036]
    The pharmacokinetics and in vivo activity of antisense oligonucleotideds (ASOs) targeting putative protein tyrosine phosphatase (PTEN) were characterized in mice and rats. All of the ASOs had the same nucleotide sequence and differed only by selected replacement of phosphorothioate with phosphodiester linkages (i.e., mixed backbone). Doses of 5 to 30 mg/kg (i.p. or s.c.) were administered twice per week for 2 and 4 weeks in mice and rats, respectively. Biodistribution and metabolism of the modified oligonucleotides were quantifed using capillary gel electrophoresis (CGE-UV). Quantitative RT-PCR was used to measure PTEN mRNA in liver, kidney, and fat tissues. Plasma protein binding of the oligonucleotides was conducted using an ultrafiltration method. Partial backbone modification in the 2′-MOE portions of the oligonucleotides did not reduce the metabolic stability of the oligonucleotide. Distribution of the partially modified ASO shifted somewhat more to kidney in rat but not mouse, with liver concentrations being somewhat reduced in both rodent species. This shift in distribution was shown to correlate with a decrease in plasma protein binding. Importantly, selected phosphodiester substitutions resulted in equivalent or better antisense activity in liver and fat even though total concentrations of drug was somewhat reduced in these tissues. In contrast, placement of only one phosphodiester in the -deoxy portion of the oligonucleotide significantly reduced stability and activity in liver and fat. Also, complete replacement of phosphorothioate in the 2′-MOE portion of the ASO significantly decreased the stability of the compound in tissue and resulted in a concomitant loss of antisense activity.
  • [0037]
    As used herein, the terms “target nucleic acid” and “nucleic acid molecule encoding the target gene” have been used for convenience to encompass DNA encoding the target gene, RNA (including pre-mRNA and mRNA or portions thereof) transcribed from such DNA, and also cDNA derived from such RNA. The hybridization of a compound of this invention with its target nucleic acid is generally referred to as “antisense”. Consequently, the preferred mechanism believed to be included in the practice of some preferred embodiments of the invention is referred to herein as “antisense inhibition.” Such antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
  • [0038]
    The present invention describes chemically modified antisense oligonucleotides that are optimized for targeting the kidney. As used herein, “optimize” means to modify in order to achieve maximum efficiency. In the context of the present invention, optimized antisense compounds are those that are efficiently delivered to the kidney and result in inhibition of target gene mRNA expression in the kidney while causing minimal toxicity.
  • [0039]
    The functions of DNA to be interfered with can include replication and transcription. Replication and transcription, for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise. The functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA. One preferred result of such interference with target nucleic acid function is modulation of the expression of target genes in the kidney. In the context of the present invention, “modulation” and “modulation of expression” mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • [0040]
    In the context of this invention, “hybridization” means the pairing of complementary strands of oligomeric compounds. In the present invention, the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Hybridization can occur under varying circumstances.
  • [0041]
    An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • [0042]
    In the present invention the phrase “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, “stringent conditions” under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • [0043]
    “Complementary,” as used herein, refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position. The oligonucleotide and the DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • [0044]
    It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure). It is preferred that the antisense compounds of the present invention comprise at least 70%, or at least 75%, or at least 80%, or at least 85% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 90% sequence complementarity and even more preferably comprise at least 95% or at least 99% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted. For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).
  • [0045]
    Percent homology, sequence identity or complementarity, can be determined by, for example, using the default settings of the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489). In some preferred embodiments, homology, sequence identity or complementarity, between the oligomeric compound and target is between about 50% to about 60%. In some embodiments, homology, sequence identity or complementarity, is between about 60% to about 70%. In preferred embodiments, homology, sequence identity or complementarity, is between about 70% and about 80%. In more preferred embodiments, homology, sequence identity or complementarity, is between about 80% and about 90%. In some preferred embodiments, homology, sequence identity or complementarity, is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100%.
  • [0000]
    B. Compounds of the Invention
  • [0046]
    The antisense compounds of the present invention include modified compounds in which a different base is present at one or more of the nucleotide positions in the compound. For example, if the first nucleotide is an adenosine, modified compounds may be produced which contain thymidine, guanosine or cytidine at this position. This may be done at any of the positions of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to inhibit expression of target gene mRNA.
  • [0047]
    In the context of this invention, the term “oligomeric compound” refers to a polymer or oligomer comprising a plurality of monomeric units. In the context of this invention, the term “oligonucleotide” refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
  • [0048]
    The antisense compounds in accordance with this invention preferably comprise from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 linked nucleosides). One of ordinary skill in the art will appreciate that the invention embodies compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleobases in length.
  • [0049]
    In one preferred embodiment, the antisense compounds of the invention are 10 to 50 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleobases in length.
  • [0050]
    In another preferred embodiment, the antisense compounds of the invention are 13 to 30 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleobases in length.
  • [0051]
    In another preferred embodiment, the antisense compounds of the invention are 15 to 25 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobases in length.
  • [0052]
    In another preferred embodiment, the antisense compounds of the invention are 18 to 22 nucleobases in length. One having ordinary skill in the art will appreciate that this embodies compounds of 18, 19, 20, 21 or 22 nucleobases in length.
  • [0053]
    Particularly preferred compounds are oligonucleotides from about 10 to about 50 nucleobases, preferably those comprising from about 13 to about 30 nucleobases, more preferably those comprising from about 15 to about 25, and most preferred from about 18 to about 22 nucleobases.
  • [0054]
    Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
  • [0055]
    The specificity and sensitivity of antisense is also harnessed by those of skill in the art for therapeutic uses. Antisense compounds are employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds are useful therapeutic modalities that can be configured to be useful
  • [0000]
    in treatment regimes for the treatment of cells, tissues and animals, especially humans.
  • [0056]
    In one embodiment, the antisense compounds of the invention are targeted to genes expressed in the kidney that have been associated with a disease or disorder. Such diseases and/or disorders include, but are not limited to, metabolic diseases, such as type 1 or type 2 diabetes. Target genes include, but are not limited to, SGLT2 and connective tissue growth factor.
  • [0057]
    The antisense compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
  • [0000]
    C. Modifications
  • [0058]
    As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base sometimes referred to as a “nucleobase” or simply a “base”. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to either the 2′, 3′ or 5′ hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are generally preferred. In addition, linear compounds may have internal nucleobase complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3′ to 5′ phosphodiester linkage.
  • [0000]
    Chimeric Compounds
  • [0059]
    The present invention includes antisense compounds which are chimeric compounds. “Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit (i.e., a nucleotide). Antisense compounds of the present invention are chimeric oligonucleotides with a central “gap” region containing 2′-deoxy nucleosides flanked by two “wing” regions containing 2′-O-methoxyethyl nucleosides. The oligomeric compounds have a mixed backbone of phosphorothioate linkages in the central “gap” region and phosphodiester linkages in the flanking “wing” regions. Mixed backbone compounds of the invention may also contain one phosphorothioate linkage at one or both of the extreme 5′ or 3′ ends of the oligonucleotide.
  • [0060]
    Oligonucleotides such as these are also known in the art as “gapmers” or gapped oligonucleotides. In a gapmer that is 20 nucleotides in length, a gap or wing can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 nucleotides in length. In one embodiment, a 20-nucleotide gapmer is comprised of a gap 8 nucleotides in length, flanked on both the 5′ and 3′ sides by wings 6 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 10 nucleotides in length, flanked on both the 5′ and 3′ sides by wings 5 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 12 nucleotides in length flanked on both the 5′ and 3′ sides by wings 4 nucleotides in length. In a further embodiment, a 20-nucleotide gapmer is comprised of a gap 14 nucleotides in length flanked on both the 5′ and 3′ sides by wings 3 nucleotides in length. In another embodiment, a 20-nucleotide gapmer is comprised of a gap 16 nucleotides in length flanked on both the 5′ and 3′ sides by wings 2 nucleotides in length. In a further embodiment, a 20-nucleotide gapmer is comprised of a gap 18 nucleotides in length flanked on both the 5′ and 3′ ends by wings 1 nucleotide in length. Alternatively, the wings are of different lengths, for example, a 20-nucleotide gapmer may be comprised of a gap 10 nucleotides in length, flanked by a 6-nucleotide wing on one side (5′ or 3′) and a 4-nucleotide wing on the other side (5′ or 3′). Antisense oligonucleotides with greater than or less than 20 nucleotides are also contemplated. One of skill in the art can select an appropriate number of nucleotides for the gap and wing regions in accordance with the present invention.
  • [0061]
    Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
  • [0000]
    Natural and Modified Nucleobases
  • [0062]
    Antisense compounds of the invention may include nucleobase (often referred to in the art as heterocyclic base or simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine (1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3′,2′:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. and are presently preferred base substitutions, even more particularly when combined with 2′-O-methoxyethyl sugar modifications.
  • [0063]
    Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, which is commonly owned with the instant application and also herein incorporated by reference.
  • [0000]
    Conjugates
  • [0064]
    Another modification of the antisense compounds of the invention involves chemically linking to the antisense compound one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, the entire disclosures of which are incorporated herein by reference. Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety. Antisense compounds of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodo-benzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15, 1999) which is incorporated herein by reference in its entirety.
  • [0065]
    Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.
  • [0066]
    Oligomeric compounds used in the compositions of the present invention can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of oligomeric compounds to enhance properties such as for example nuclease stability. Included in stabilizing groups are cap structures. By “cap structure or terminal cap moiety” is meant chemical modifications, which have been incorporated at either terminus of oligonucleotides (see for example Wincott et al., WO 97/26270, incorporated by reference herein). These terminal modifications protect the oligomeric compounds having terminal nucleic acid molecules from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap) or at the 3′-terminus (3′-cap) or can be present on both termini. In non-limiting examples, the 5′-cap includes inverted abasic residue (moiety), 4′,5′-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4′-thio nucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3′,4′-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3′-3′-inverted nucleotide moiety; 3′-3′-inverted abasic moiety; 3′-2′-inverted nucleotide moiety; 3′-2′-inverted abasic moiety; 1,4-butanediol phosphate; 3′-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3′-phosphate; 3′-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety (for more details see Wincott et al., International PCT publication No. WO 97/26270, incorporated by reference herein).
  • [0067]
    Particularly preferred 3′-cap structures of the present invention include, for example 4′,5′-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4′-thio nucleotide, carbocyclic nucleotide; 5′-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3′,4′-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5′-5′-inverted nucleotide moiety; 5′-5′-inverted abasic moiety; 5′-phosphoramidate; 5′-phosphorothioate; 1,4-butanediol phosphate; 5′-amino; bridging and/or non-bridging 5′-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging methylphosphonate and 5′-mercapto moieties (for more details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925; incorporated by reference herein).
  • [0068]
    Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an oligomeric compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.
  • [0000]
    D. Formulations
  • [0069]
    The compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption. Representative United States patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756, each of which is herein incorporated by reference.
  • [0070]
    The antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • [0071]
    The term “pharmaceutically acceptable salts” refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0072]
    The present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.
  • [0073]
    The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • [0074]
    The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.
  • [0075]
    Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
  • [0076]
    Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0077]
    Formulations of the present invention include liposomal formulations. As used in the present invention, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
  • [0078]
    Liposomes also include “sterically stabilized” liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0079]
    The pharmaceutical formulations and compositions of the present invention may also include surfactants. The use of surfactants in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0080]
    In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs. Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety.
  • [0081]
    One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
  • [0082]
    Preferred formulations for topical administration include those in which the oligonucleotides of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
  • [0083]
    For topical or other administration, oligonucleotides of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, oligonucleotides may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
  • [0084]
    Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which oligonucleotides of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein in its entirety. Oral formulations for oligonucleotides and their preparation are described in detail in U.S. application Ser. Nos. 09/108,673 (filed Jul. 1, 1998), 09/315,298 (filed May 20, 1999) and 10/071,822, (filed Feb. 8, 2002; published as US2003-0027780), each of which is incorporated herein by reference in their entirety.
  • [0085]
    Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • [0086]
    Oligonucleotides may be formulated for delivery in vivo in an acceptable dosage form, e.g. as parenteral or non-parenteral formulations. Parenteral formulations include intravenous (IV), subcutaneous (SC), intraperitoneal (IP), intravitreal and intramuscular (IM) formulations, as well as formulations for delivery via pulmonary inhalation, intranasal administration, topical administration, etc. Non-parenteral formulations include formulations for delivery via the alimentary canal, e.g. oral administration, rectal administration, intrajejunal instillation, etc. Rectal administration includes administration as an enema or a suppository. Oral administration includes administration as a capsule, a gel capsule, a pill, an elixir, etc.
  • [0087]
    In some embodiments, an oligonucleotide may be administered to a subject via an oral route of administration. The subject may be an animal or a human (man). An animal subject may be a mammal, such as a mouse, a rat, a dog, a guinea pig, a monkey, a non-human primate, a cat or a pig. Non-human primates include monkeys and chimpanzees. A suitable animal subject may be an experimental animal, such as a mouse, rat, mouse, a rat, a dog, a monkey, a non-human primate, a cat or a pig.
  • [0088]
    In some embodiments, the subject may be a human. In certain embodiments, the subject may be a human patient in need of therapeutic treatment as discussed in more detail herein. In certain embodiments, the subject may be in need of modulation of expression of one or more genes as discussed in more detail herein. In some particular embodiments, the subject may be in need of inhibition of expression of one or more genes as discussed in more detail herein. In particular embodiments, the subject may be in need of modulation, i.e. inhibition or enhancement, of HIF1-beta in order to obtain therapeutic indications discussed in more detail herein.
  • [0089]
    In some embodiments, non-parenteral (e.g. oral) oligonucleotide formulations according to the present invention result in enhanced bioavailability of the oligonucleotide. In this context, the term “bioavailability” refers to a measurement of that portion of an administered drug which reaches the circulatory system (e.g. blood, especially blood plasma) when a particular mode of administration is used to deliver the drug. Enhanced bioavailability refers to a particular mode of administration's ability to deliver oligonucleotide to the peripheral blood plasma of a subject relative to another mode of administration. For example, when a non-parenteral mode of administration (e.g. an oral mode) is used to introduce the drug into a subject, the bioavailability for that mode of administration may be compared to a different mode of administration, e.g. an IV mode of administration. In some embodiments, the area under a compound's blood plasma concentration curve (AUC0) after non-parenteral (e.g. oral, rectal, intrajejunal) administration may be divided by the area under the drug's plasma concentration curve after intravenous (i.v.) administration (AUCiv) to provide a dimensionless quotient (relative bioavailability, RB) that represents fraction of compound absorbed via the non-parenteral route as compared to the IV route. A composition's bioavailability is said to be enhanced in comparison to another composition's bioavailability when the first composition's relative bioavailability (RB1) is greater than the second composition's relative bioavailability (RB2).
  • [0090]
    In general, bioavailability correlates with therapeutic efficacy when a compound's therapeutic efficacy is related to the blood concentration achieved, even if the drug's ultimate site of action is intracellular (van Berge-Henegouwen et al., Gastroenterol., 1977, 73, 300). Bioavailability studies have been used to determine the degree of intestinal absorption of a drug by measuring the change in peripheral blood levels of the drug after an oral dose (DiSanto, Chapter 76 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 1451-1458).
  • [0091]
    In general, an oral composition's bioavailability is said to be “enhanced” when its relative bioavailability is greater than the bioavailability of a composition substantially consisting of pure oligonucleotide, i.e. oligonucleotide in the absence of a penetration enhancer.
  • [0092]
    Organ bioavailability refers to the concentration of compound in an organ. Organ bioavailability may be measured in test subjects by a number of means, such as by whole-body radiography. Organ bioavailability may be modified, e.g. enhanced, by one or more modifications to the oligonucleotide, by use of one or more carrier compounds or excipients, etc. as discussed in more detail herein. In general, an increase in bioavailability will result in an increase in organ bioavailability.
  • [0093]
    Oral oligonucleotide compositions according to the present invention may comprise one or more “mucosal penetration enhancers,” also known as “absorption enhancers” or simply as “penetration enhancers.” Accordingly, some embodiments of the invention comprise at least one oligonucleotide in combination with at least one penetration enhancer. In general, a penetration enhancer is a substance that facilitates the transport of a drug across mucous membrane(s) associated with the desired mode of administration, e.g. intestinal epithelial membranes. Accordingly it is desirable to select one or more penetration enhancers that facilitate the uptake of an oligonucleotide, without interfering with the activity of the oligonucleotide, and in a such a manner the oligonucleotide can be introduced into the body of an animal without unacceptable side-effects such as toxicity, irritation or allergic response.
  • [0094]
    Embodiments of the present invention provide compositions comprising one or more pharmaceutically acceptable penetration enhancers, and methods of using such compositions, which result in the improved bioavailability of oligonucleotides administered via non-parenteral modes of administration. Heretofore, certain penetration enhancers have been used to improve the bioavailability of certain drugs. See Muranishi, Crit. Rev. Ther. Drug Carrier Systems, 1990, 7, 1 and Lee et al., Crit. Rev. Ther. Drug Carrier Systems, 1991, 8, 91. It has been found that the uptake and delivery of oligonucleotides, relatively complex molecules which are known to be difficult to administer to animals and man, can be greatly improved even when administered by non-parenteral means through the use of a number of different classes of penetration enhancers.
  • [0095]
    In some embodiments, compositions for non-parenteral administration include one or more modifications from naturally-occurring oligonucleotides (i.e. full-phosphodiester deoxyribosyl or full-phosphodiester ribosyl oligonucleotides). Such modifications may increase binding affinity, nuclease stability, cell or tissue permeability, tissue distribution, or other biological or pharmacokinetic property. Modifications may be made to the base, the linker, or the sugar, in general, as discussed in more detail herein with regards to oligonucleotide chemistry. In some embodiments of the invention, compositions for administration to a subject, and in particular oral compositions for administration to an animal or human subject, will comprise modified oligonucleotides having one or more modifications for enhancing affinity, stability, tissue distribution, or other biological property.
  • [0096]
    Suitable modified linkers include phosphorothioate linkers. In some embodiments according to the invention, the oligonucleotide has at least one phosphorothioate linker. Phosphorothioate linkers provide nuclease stability as well as plasma protein binding characteristics to the oligonucleotide. Nuclease stability is useful for increasing the in vivo lifetime of oligonucleotides, while plasma protein binding decreases the rate of first pass clearance of oligonucleotide via renal excretion. In some embodiments according to the present invention, the oligonucleotide has at least two phosphorothioate linkers. In some embodiments, wherein the oligonucleotide has exactly n nucleosides, the oligonucleotide has from one to n−1 phosphorothioate linkages. In some embodiments, wherein the oligonucleotide has exactly n nucleosides, the oligonucleotide has n−1 phosphorothioate linkages. In other embodiments wherein the oligonucleotide has exactly n nucleosides, and n is even, the oligonucleotide has from 1 to n/2 phosphorothioate linkages, or, when n is odd, from 1 to (n−1)/2 phosphorothioate linkages. In some embodiments, the oligonucleotide has alternating phosphodiester (PO) and phosphorothioate (PS) linkages. In other embodiments, the oligonucleotide has at least one stretch of two or more consecutive PO linkages and at least one stretch of two or more PS linkages. In other embodiments, the oligonucleotide has at least two stretches of PO linkages interrupted by at least on PS linkage.
  • [0097]
    In some embodiments, at least one of the nucleosides is modified on the ribosyl sugar unit by a modification that imparts nuclease stability, binding affinity or some other beneficial biological property to the sugar. In some cases, the sugar modification includes a 2′-modification, e.g. the 2′-OH of the ribosyl sugar is replaced or substituted. Suitable replacements for 2′-OH include 2′-F and 2′-arabino-F. Suitable substitutions for OH include 2′-O-alkyl, e.g. 2-O-methyl, and 2′-O-substituted alkyl, e.g. 2′-O-methoxyethyl, 2′-O-aminopropyl, etc. In some embodiments, the oligonucleotide contains at least one 2′-modification. In some embodiments, the oligonucleotide contains at least 2 2′-modifications. In some embodiments, the oligonucleotide has at least one 2′-modification at each of the termini (i.e. the 3′- and 5′-terminal nucleosides each have the same or different 2′-modifications). In some embodiments, the oligonucleotide has at least two sequential 2′-modifications at each end of the oligonucleotide. In some embodiments, oligonucleotides further comprise at least one deoxynucleoside. In particular embodiments, oligonucleotides comprise a stretch of deoxynucleosides such that the stretch is capable of activating RNase (e.g. RNase H) cleavage of an RNA to which the oligonucleotide is capable of hybridizing. In some embodiments, a stretch of deoxynucleosides capable of activating RNase-mediated cleavage of RNA comprises about 6 to about 16, e.g. about 8 to about 16 consecutive deoxynucleosides. In further embodiments, oligonucleotides are capable of eliciting cleaveage by dsRNAse enzymes.
  • [0098]
    Oral compositions for administration of non-parenteral oligonucleotide compositions of the present invention may be formulated in various dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas. The term “alimentary delivery” encompasses e.g. oral, rectal, endoscopic and sublingual/buccal administration. A common requirement for these modes of administration is absorption over some portion or all of the alimentary tract and a need for efficient mucosal penetration of the nucleic acid(s) so administered.
  • [0099]
    Delivery of a drug via the oral mucosa, as in the case of buccal and sublingual administration, has several desirable features, including, in many instances, a more rapid rise in plasma concentration of the drug than via oral delivery (Harvey, Chapter 35 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, page 711).
  • [0100]
    Endoscopy may be used for drug delivery directly to an interior portion of the alimentary tract. For example, endoscopic retrograde cystopancreatography (ERCP) takes advantage of extended gastroscopy and permits selective access to the biliary tract and the pancreatic duct (Hirahata et al., Gan To Kagaku Ryoho, 1992, 19(10 Suppl.), 1591). Pharmaceutical compositions, including liposomal formulations, can be delivered directly into portions of the alimentary canal, such as, e.g., the duodenum (Somogyi et al., Pharm. Res., 1995, 12, 149) or the gastric submucosa (Akamo et al., Japanese J. Cancer Res., 1994, 85, 652) via endoscopic means. Gastric lavage devices (Inoue et al., Artif. Organs, 1997, 21, 28) and percutaneous endoscopic feeding devices (Pennington et al., Ailment Pharmacol. Ther., 1995, 9, 471) can also be used for direct alimentary delivery of pharmaceutical compositions.
  • [0101]
    In some embodiments, oligonucleotide formulations may be administered through the anus into the rectum or lower intestine. Rectal suppositories, retention enemas or rectal catheters can be used for this purpose and may be preferred when patient compliance might otherwise be difficult to achieve (e.g., in pediatric and geriatric applications, or when the patient is vomiting or unconscious). Rectal administration can result in more prompt and higher blood levels than the oral route. (Harvey, Chapter 35 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, page 711). Because about 50% of the drug that is absorbed from the rectum will bypass the liver, administration by this route significantly reduces the potential for first-pass metabolism (Benet et al., Chapter 1 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996).
  • [0102]
    One advantageous method of non-parenteral administration of oligonucleotide compositions is oral delivery. Some embodiments employ various penetration enhancers in order to effect transport of oligonucleotides and other nucleic acids across mucosal and epithelial membranes. Penetration enhancers may be classified as belonging to one of five broad categories—surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Accordingly, some embodiments comprise oral oligonucleotide compositions comprising at least one member of the group consisting of surfactants, fatty acids, bile salts, chelating agents, and non-chelating surfactants. Further embodiments comprise oral oligonucleotide comprising at least one fatty acid, e.g. capric or lauric acid, or combinations or salts thereof. Other embodiments comprise methods of enhancing the oral bioavailability of an oligonucleotide, the method comprising co-administering the oligonucleotide and at least one penetration enhancer.
  • [0103]
    Other excipients that may be added to oral oligonucleotide compositions include surfactants (or “surface-active agents”), which are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the alimentary mucosa and other epithelial membranes is enhanced. In addition to bile salts and fatty acids, surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and perfluorohemical emulsions, such as FC-43 (Takahashi et al., J. Pharm. Phamacol., 1988, 40, 252).
  • [0104]
    Fatty acids and their derivatives which act as penetration enhancers and may be used in compositions of the present invention include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines and mono- and di-glycerides thereof and/or physiologically acceptable salts thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; El-Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651).
  • [0105]
    In some embodiments, oligonucleotide compositions for oral delivery comprise at least two discrete phases, which phases may comprise particles, capsules, gel-capsules, microspheres, etc. Each phase may contain one or more oligonucleotides, penetration enhancers, surfactants, bioadhesives, effervescent agents, or other adjuvant, excipient or diluent. In some embodiments, one phase comprises at least one oligonucleotide and at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer. In some embodiments, a first phase comprises at least one oligonucleotide and at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and substantially no oligonucleotide. In some embodiments, at least one phase is compounded with at least one degradation retardant, such as a coating or a matrix, which delays release of the contents of that phase. In some embodiments, a first phase comprises at least one oligonucleotide, at least one penetration enhancer, while a second phase comprises at least one penetration enhancer and a release-retardant. In particular embodiments, an oral oligonucleotide comprises a first phase comprising particles containing an oligonucleotide and a penetration enhancer, and a second phase comprising particles coated with a release-retarding agent and containing penetration enhancer.
  • [0106]
    A variety of bile salts also function as penetration enhancers to facilitate the uptake and bioavailability of drugs. The physiological roles of bile include the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996, pages 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus, the term “bile salt” includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (CDCA, sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579).
  • [0107]
    In some embodiments, penetration enhancers useful in some embodiments of present invention are mixtures of penetration enhancing compounds. One such penetration enhancer is a mixture of UDCA (and/or CDCA) with capric and/or lauric acids or salts thereof e.g. sodium. Such mixtures are useful for enhancing the delivery of biologically active substances across mucosal membranes, in particular intestinal mucosa. Other penetration enhancer mixtures comprise about 5-95% of bile acid or salt(s) UDCA and/or CDCA with 5-95% capric and/or lauric acid. Particular penetration enhancers are mixtures of the sodium salts of UDCA, capric acid and lauric acid in a ratio of about 1:2:2 respectively. Anther such penetration enhancer is a mixture of capric and lauric acid (or salts thereof) in a 0.01:1 to 1:0.01 ratio (mole basis). In particular embodiments capric acid and lauric acid are present in molar ratios of e.g. about 0.1:1 to about 1:0.1, in particular about 0.5:1 to about 1:0.5.
  • [0108]
    Other excipients include chelating agents, i.e. compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the alimentary and other mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315). Chelating agents of the invention include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1; Buur et al., J. Control Rel., 1990, 14, 43).
  • [0109]
    As used herein, non-chelating non-surfactant penetration enhancers may be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary and other mucosal membranes (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1). This class of penetration enhancers includes, but is not limited to, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621).
  • [0110]
    Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), can be used.
  • [0111]
    Some oral oligonucleotide compositions also incorporate carrier compounds in the formulation. As used herein, “carrier compound” or “carrier” can refer to a nucleic acid, or analog thereof, which may be inert (i.e., does not possess biological activity per se) or may be necessary for transport, recognition or pathway activation or mediation, or is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4′isothiocyano-stilbene-2,2′-disulfonic acid (Miyao et al., Antisense Res. Dev., 1995, 5, 115; Takakura et al., Antisense & Nucl. Acid Drug Dev., 1996, 6, 177).
  • [0112]
    A “pharmaceutical carrier” or “excipient” may be a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, EXPLOTAB); and wetting agents (e.g., sodium lauryl sulphate, etc.).
  • [0113]
    Oral oligonucleotide compositions may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the composition of present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention.
  • [0114]
    Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
  • [0115]
    In another related embodiment, compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target. Alternatively, compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • [0000]
    E. Dosing
  • [0116]
    The formulation of therapeutic compositions and their subsequent administration (dosing) is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.0001 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.0001 μg to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • [0117]
    While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
  • EXAMPLES Example 1 Synthesis of Nucleoside Phosphoramidites
  • [0118]
    The following compounds, including amidites and their intermediates were prepared as described in U.S. Pat. No. 6,426,220 and published PCT WO 02/36743; 5′-O-Dimethoxytrityl-thymidine intermediate for 5-methyl dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-5-methylcytidine intermediate for 5-methyl-dC amidite, 5′-O-Dimethoxytrityl-2′-deoxy-N4-benzoyl-5-methylcytidine penultimate intermediate for 5-methyl dC amidite, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-deoxy-N4-benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (5-methyl dC amidite), 2′-Fluorodeoxyadenosine, 2′-Fluorodeoxyguanosine, 2′-Fluorouridine, 2′-Fluorodeoxycytidine, 2′-O-(2-Methoxyethyl) modified amidites, 2′-O-(2-methoxyethyl)-5-methyluridine intermediate, 5′-O-DMT-2′-O-(2-methoxyethyl)-5-methyluridine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-5-methyluridin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE T amidite), 5′-O-Dimethoxytrityl-2′-O-(2-methoxyethyl)-5-methylcytidine intermediate, 5′-O-dimethoxytrityl-2′-O-(2-methoxyethyl)-N4-benzoyl-5-methylcytidine penultimate intermediate, [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N4-benzoyl-5-methylcytidin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE 5-Me-C amidite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N6-benzoyladenosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE A amdite), [5′-O-(4,4′-Dimethoxytriphenylmethyl)-2′-O-(2-methoxyethyl)-N4-isobutyrylguanosin-3′-O-yl]-2-cyanoethyl-N,N-diisopropylphosphoramidite (MOE G amidite), 2′-O-(Aminooxyethyl) nucleoside amidites and 2′-O-(dimethylaminooxyethyl) nucleoside amidites, 2′-(Dimethylaminooxyethoxy) nucleoside amidites, 5′-O-tert-Butyldiphenylsilyl-O2-2′-anhydro-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-(2-hydroxyethyl)-5-methyluridine, 2′-O-([2-phthalimidoxy)ethyl]-5′-t-butyldiphenylsilyl-5-methyluridine, 5′-O-tert-butyldiphenylsilyl-2′-O-[(2-formadoximinooxy)ethyl]-5-methyluridine, 5′-O-tert-Butyldiphenylsilyl-2′-O-[N,N dimethylaminooxyethyl]-5-methyluridine, 2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(dimethylaminooxyethyl)-5-methyluridine, 5′-O-DMT-2′-O-(2-N,N-dimethylaminooxyethyl)-5-methyluridine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-(Aminooxyethoxy) nucleoside amidites, N2-isobutyryl-6-O-diphenylcarbamoyl-2′-O-(2-ethylacetyl)-5′-O-(4,4′-dimethoxytrityl)guanosine-3′-[(2-cyanoethyl)-N,N-diisopropylphosphoramidite], 2′-dimethylaminoethoxyethoxy (2′-DMAEOE) nucleoside amidites, 2′-O-[2(2-N,N-dimethylaminoethoxy)ethyl]-5-methyl uridine, 5′-O-dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine and 5′-O-Dimethoxytrityl-2′-O-[2(2-N,N-dimethylaminoethoxy)-ethyl)]-5-methyl uridine-3′-O-(cyanoethyl-N,N-diisopropyl)phosphoramidite.
  • Example 2 Oligonucleotide and Oligonucleoside Synthesis
  • [0119]
    The antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • [0000]
    Oligonucleotides
  • [0120]
    Unsubstituted and substituted phosphodiester (P═O) oligonucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with oxidation by iodine.
  • [0121]
    Phosphorothioates (P═S) are synthesized similar to phosphodiester oligonucleotides with the following exceptions: thiation was effected by utilizing a 10% w/v solution of 3,H-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the oxidation of the phosphite linkages. The thiation reaction step time was increased to 180 sec and preceded by the normal capping step. After cleavage from the CPG column and deblocking in concentrated ammonium hydroxide at 55° C. (12-16 hr), the oligonucleotides were recovered by precipitating with >3 volumes of ethanol from a 1 M NH4OAc solution. Phosphinate oligonucleotides are prepared as described in U.S. Pat. No. 5,508,270, herein incorporated by reference.
  • [0122]
    Alkyl phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 4,469,863, herein incorporated by reference.
  • [0123]
    3′-Deoxy-3′-methylene phosphonate oligonucleotides are prepared as described in U.S. Pat. No. 5,610,289 or 5,625,050, herein incorporated by reference.
  • [0124]
    Phosphoramidite oligonucleotides are prepared as described in U.S. Pat. No. 5,256,775 or U.S. Pat. No. 5,366,878, herein incorporated by reference.
  • [0125]
    Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
  • [0126]
    3′-Deoxy-3′-amino phosphoramidate oligonucleotides are prepared as described in U.S. Pat. No. 5,476,925, herein incorporated by reference.
  • [0127]
    Phosphotriester oligonucleotides are prepared as described in U.S. Pat. No. 5,023,243, herein incorporated by reference.
  • [0128]
    Borano phosphate oligonucleotides are prepared as described in U.S. Pat. Nos. 5,130,302 and 5,177,198, both herein incorporated by reference.
  • [0000]
    Oligonucleosides
  • [0129]
    Methylenemethylimino linked oligonucleosides, also identified as MMI linked oligonucleosides, methylenedimethylhydrazo linked oligonucleosides, also identified as MDH linked oligonucleosides, and methylenecarbonylamino linked oligonucleosides, also identified as amide-3 linked oligonucleosides, and methyleneaminocarbonyl linked oligonucleosides, also identified as amide-4 linked oligonucleosides, as well as mixed backbone compounds having, for instance, alternating MMI and P═O or P═S linkages are prepared as described in U.S. Pat. Nos. 5,378,825, 5,386,023, 5,489,677, 5,602,240 and 5,610,289, all of which are herein incorporated by reference.
  • [0130]
    Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564, herein incorporated by reference.
  • [0131]
    Ethylene oxide linked oligonucleosides are prepared as described in U.S. Pat. No. 5,223,618, herein incorporated by reference.
  • Example 3 RNA Synthesis
  • [0132]
    In general, RNA synthesis chemistry is based on the selective incorporation of various protecting groups at strategic intermediary reactions. Although one of ordinary skill in the art will understand the use of protecting groups in organic synthesis, a useful class of protecting groups includes silyl ethers. In particular bulky silyl ethers are used to protect the 5′-hydroxyl in combination with an acid-labile orthoester protecting group on the 2′-hydroxyl. This set of protecting groups is then used with standard solid-phase synthesis technology. It is important to lastly remove the acid labile orthoester protecting group after all other synthetic steps. Moreover, the early use of the silyl protecting groups during synthesis ensures facile removal when desired, without undesired deprotection of 2′ hydroxyl.
  • [0133]
    Following this procedure for the sequential protection of the 5′-hydroxyl in combination with protection of the 2′-hydroxyl by protecting groups that are differentially removed and are differentially chemically labile, RNA oligonucleotides were synthesized.
  • [0134]
    RNA oligonucleotides are synthesized in a stepwise fashion. Each nucleotide is added sequentially (3′- to 5′-direction) to a solid support-bound oligonucleotide. The first nucleoside at the 3′-end of the chain is covalently attached to a solid support. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are added, coupling the second base onto the 5′-end of the first nucleoside. The support is washed and any unreacted 5′-hydroxyl groups are capped with acetic anhydride to yield 5′-acetyl moieties. The linkage is then oxidized to the more stable and ultimately desired P(V) linkage. At the end of the nucleotide addition cycle, the 5′-silyl group is cleaved with fluoride. The cycle is repeated for each subsequent nucleotide.
  • [0135]
    Following synthesis, the methyl protecting groups on the phosphates are cleaved in 30 minutes utilizing 1 M disodium-2-carbamoyl-2-cyanoethylene-1,1-dithiolate trihydrate (S2Na2) in DMF. The deprotection solution is washed from the solid support-bound oligonucleotide using water. The support is then treated with 40% methylamine in water for 10 minutes at 55° C. This releases the RNA oligonucleotides into solution, deprotects the exocyclic amines, and modifies the 2′-groups. The oligonucleotides can be analyzed by anion exchange HPLC at this stage.
  • [0136]
    The 2′-orthoester groups are the last protecting groups to be removed. The ethylene glycol monoacetate orthoester protecting group developed by Dharmacon Research, Inc. (Lafayette, Colo.), is one example of a useful orthoester protecting group which, has the following important properties. It is stable to the conditions of nucleoside phosphoramidite synthesis and oligonucleotide synthesis. However, after oligonucleotide synthesis the oligonucleotide is treated with methylamine which not only cleaves the oligonucleotide from the solid support but also removes the acetyl groups from the orthoesters. The resulting 2-ethyl-hydroxyl substituents on the orthoester are less electron withdrawing than the acetylated precursor. As a result, the modified orthoester becomes more labile to acid-catalyzed hydrolysis. Specifically, the rate of cleavage is approximately 10 times faster after the acetyl groups are removed. Therefore, this orthoester possesses sufficient stability in order to be compatible with oligonucleotide synthesis and yet, when subsequently modified, permits deprotection to be carried out under relatively mild aqueous conditions compatible with the final RNA oligonucleotide product.
  • [0137]
    Additionally, methods of RNA synthesis are well known in the art (Scaringe, S. A. Ph.D. Thesis, University of Colorado, 1996; Scaringe, S. A., et al., J. Am. Chem. Soc., 1998, 120, 11820-11821; Matteucci, M. D. and Caruthers, M. H. J. Am. Chem. Soc., 1981, 103, 3185-3191; Beaucage, S. L. and Caruthers, M. H. Tetrahedron Lett., 1981, 22, 1859-1862; Dahl, B. J., et al., Acta Chem. Scand,. 1990, 44, 639-641; Reddy, M. P., et al., Tetrahedrom Lett., 1994, 25, 4311-4314; Wincott, F. et al., Nucleic Acids Res., 1995, 23, 2677-2684; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2301-2313; Griffin, B. E., et al., Tetrahedron, 1967, 23, 2315-2331).
  • [0138]
    RNA antisense compounds (RNA oligonucleotides) of the present invention can be synthesized by the methods herein or purchased from Dharmacon Research, Inc (Lafayette, Colo.). Once synthesized, complementary RNA antisense compounds can then be annealed by methods known in the art to form double stranded (duplexed) antisense compounds. For example, duplexes can be formed by combining 30 μl of each of the complementary strands of RNA oligonucleotides (50 μM RNA oligonucleotide solution) and 15 μl of 5× annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate) followed by heating for 1 minute at 90° C., then 1 hour at 37° C. The resulting duplexed antisense compounds can be used in kits, assays, screens, or other methods to investigate the role of a target nucleic acid, or for diagnostic or therapeutic purposes.
  • Example 4 Synthesis of Chimeric Compounds
  • [0139]
    Chimeric oligonucleotides, oligonucleosides or mixed oligonucleotides/oligonucleosides of the invention can be of several different types. These include a first type wherein the “gap” segment of linked nucleosides is positioned between 5′ and 3′ “wing” segments of linked nucleosides and a second “open end” type wherein the “gap” segment is located at either the 3′ or the 5′ terminus of the oligomeric compound. Oligonucleotides of the first type are also known in the art as “gapmers” or gapped oligonucleotides. Oligonucleotides of the second type are also known in the art as “hemimers” or “wingmers”.
  • [2′-O-Me]-[2′-deoxy]-[2′-O-Me] Chimeric Phosphorothioate Oligonucleotides
  • [0140]
    Chimeric oligonucleotides having 2′-O-alkyl phosphorothioate and 2′-deoxy phosphorothioate oligonucleotide segments are synthesized using an Applied Biosystems automated DNA synthesizer Model 394, as above. Oligonucleotides are synthesized using the automated synthesizer and 2′-deoxy-5′-dimethoxytrityl-3′-O-phosphoramidite for the DNA portion and 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite for 5′ and 3′ wings. The standard synthesis cycle is modified by incorporating coupling steps with increased reaction times for the 5′-dimethoxytrityl-2′-O-methyl-3′-O-phosphoramidite. The fully protected oligonucleotide is cleaved from the support and deprotected in concentrated ammonia (NH4OH) for 12-16 hr at 55° C. The deprotected oligo is then recovered by an appropriate method (precipitation, column chromatography, volume reduced in vacuo and analyzed spectrophotometrically for yield and for purity by capillary electrophoresis and by mass spectrometry.
  • [2′-O-(2-Methoxyethyl)]-[2′-deoxy]-[2′-O-(Methoxyethyl)] Chimeric Phosphorothioate Oligonucleotides
  • [0141]
    [2′-O-(2-methoxyethyl)]-[2′-deoxy]-[-2′-O-(methoxyethyl)] chimeric phosphorothioate oligonucleotides were prepared as per the procedure above for the 2′-O-methyl chimeric oligonucleotide, with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites.
  • [2′-O-(2-Methoxyethyl)Phosphodiester]-[2′-deoxy Phosphorothioate]-[2′-O-(2-Methoxyethyl)Phosphodiester] Chimeric Oligonucleotides
  • [0142]
    [2′-O-(2-methoxyethyl phosphodiester]-[2′-deoxy phosphorothioate]-[2′-O-(methoxyethyl)phosphodiester] chimeric oligonucleotides are prepared as per the above procedure for the 2′-O-methyl chimeric oligonucleotide with the substitution of 2′-O-(methoxyethyl) amidites for the 2′-O-methyl amidites, oxidation with iodine to generate the phosphodiester internucleotide linkages within the wing portions of the chimeric structures and sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) to generate the phosphorothioate internucleotide linkages for the center gap.
  • [0143]
    Other chimeric oligonucleotides, chimeric oligonucleosides and mixed chimeric oligonucleotides/oligonucleosides are synthesized according to U.S. Pat. No. 5,623,065, herein incorporated by reference.
  • Example 5 Oligonucleotide Isolation
  • [0144]
    After cleavage from the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55° C. for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation out of 1 M NH4OAc with >3 volumes of ethanol. Synthesized oligonucleotides were analyzed by electrospray mass spectroscopy (molecular weight determination) and by capillary gel electrophoresis and judged to be at least 70% full length material. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis was determined by the ratio of correct molecular weight relative to the −16 amu product (+/−32 +/−48). For some studies oligonucleotides were purified by HPLC, as described by Chiang et al., J. Biol. Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material.
  • Example 6 Oligonucleotide Synthesis 96 Well Plate Format
  • [0145]
    Oligonucleotides were synthesized via solid phase P(III) phosphoramidite chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages were afforded by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages were generated by sulfurization utilizing 3,H-1,2 benzodithiole-3-one 1,1 dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard base-protected beta-cyanoethyl-diiso-propyl phosphoramidites were purchased from commercial vendors (e.g. PE-Applied Biosystems, Foster City, Calif., or Pharmacia, Piscataway, N.J.). Non-standard nucleosides are synthesized as per standard or patented methods. They are utilized as base protected beta-cyanoethyldiisopropyl phosphoramidites.
  • [0146]
    Oligonucleotides were cleaved from support and deprotected with concentrated NH4OH at elevated temperature (55-60° C.) for 12-16 hours and the released product then dried in vacuo. The dried product was then re-suspended in sterile water to afford a master plate from which all analytical and test plate samples are then diluted utilizing robotic pipettors.
  • Example 7 Oligonucleotide Analysis 96-Well Plate Format
  • [0147]
    The concentration of oligonucleotide in each well was assessed by dilution of samples and UV absorption spectroscopy. The full-length integrity of the individual products was evaluated by capillary electrophoresis (CE) in either the 96-well format (Beckman P/ACE™ MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P/ACE™ 5000, ABI 270). Base and backbone composition was confirmed by mass analysis of the compounds utilizing electrospray-mass spectroscopy. All assay test plates were diluted from the master plate using single and multi-channel robotic pipettors. Plates were judged to be acceptable if at least 85% of the compounds on the plate were at least 85% full length.
  • Example 8 Cell Culture and Oligonucleotide Treatment
  • [0148]
    The effect of antisense compounds on target nucleic acid expression can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or RT-PCR.
  • [0000]
    T-24 Cells:
  • [0149]
    The human transitional cell bladder carcinoma cell line T-24 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). T-24 cells were routinely cultured in complete McCoy's 5A basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #353872) at a density of 7000 cells/well for use in RT-PCR analysis.
  • [0000]
    A549 Cells:
  • [0150]
    The human lung carcinoma cell line A549 was obtained from the American Type Culture Collection (ATCC) (Manassas, Va.). A549 cells were routinely cultured in DMEM basal media (Invitrogen Corporation, Carlsbad, Calif.) supplemented with 10% fetal calf serum (Invitrogen Corporation, Carlsbad, Calif.), penicillin 100 units per mL, and streptomycin 100 micrograms per mL (Invitrogen Corporation, Carlsbad, Calif.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence.
  • [0000]
    NHDF Cells:
  • [0151]
    Human neonatal dermal fibroblast (NHDF) were obtained from the Clonetics Corporation (Walkersville, Md.). NHDFs were routinely maintained in Fibroblast Growth Medium (Clonetics Corporation, Walkersville, Md.) supplemented as recommended by the supplier. Cells were maintained for up to 10 passages as recommended by the supplier.
  • [0000]
    HEK Cells:
  • [0152]
    Human embryonic keratinocytes (HEK) were obtained from the Clonetics Corporation (Walkersville, Md.). HEKs were routinely maintained in Keratinocyte Growth Medium (Clonetics Corporation, Walkersville, Md.) formulated as recommended by the supplier. Cells were routinely maintained for up to 10 passages as recommended by the supplier.
  • [0000]
    HK-2 Cells:
  • [0153]
    HK-2 (human kidney 2) is a proximal tubular cell (PTC) line derived from normal kidney cells immortalized by transduction with human papilloma virus 16 (HPV-16) E6/E7 genes (CRL-2190, American Type Culture Collection, Manassus, Va.). HK-2 cells were routinely cultured in Keratinocyte-Serum Free Medium (17005-042, Invitrogen Corporation, Carlsbad, Calif.) which includes 5 ng/ml recombinant epidermal growth factor and 0.05 mg/ml bovine pituitary extract. Cells were routinely passaged by trypsinization and split at a ratio of 1:4 when they reached 70-80% confluence. One day prior to transfection, cells were seeded into 96-well plates (Falcon-Primaria #353872, BD Biosciences, Bedford, Mass.) at a density of 10,000 cells/well.
  • [0000]
    b.END Cells:
  • [0154]
    The mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau at the Max Plank Institute (Bad Nauheim, Germany). b.END cells were routinely cultured in DMEM, high glucose (Gibco/Life Technologies, Gaithersburg, Md.) supplemented with 10% fetal calf serum (Gibco/Life Technologies, Gaithersburg, Md.). Cells were routinely passaged by trypsinization and dilution when they reached 90% confluence. Cells were seeded into 96-well plates (Falcon-Primaria #3872) at a density of 3000 cells/well for use in RT-PCR analysis.
  • [0000]
    Treatment with Antisense Compounds:
  • [0155]
    When cells reached 65-75% confluency, they were treated with oligonucleotide. For cells grown in 96-well plates, wells were washed once with 100 μL OPTI-MEM™-1 reduced-serum medium (Invitrogen Corporation, Carlsbad, Calif.) and then treated with 130 μL of OPTI-MEM™-1 containing 3.75 μg/mL LIPOFECTIN™ (Invitrogen Corporation, Carlsbad, Calif.) and the desired concentration of oligonucleotide. Cells are treated and data are obtained in triplicate. After 4-7 hours of treatment at 37° C., the medium was replaced with fresh medium. Cells were harvested 16-24 hours after oligonucleotide treatment.
  • [0156]
    For Northern blotting or other analysis, cells may be seeded onto 100 mm or other standard tissue culture plates and treated similarly, using appropriate volumes of medium and oligonucleotide.
  • [0157]
    The concentration of oligonucleotide used varies from cell line to cell line. To determine the optimal oligonucleotide concentration for a particular cell line, the cells are treated with a positive control oligonucleotide at a range of concentrations. For human cells the positive control oligonucleotide is selected from either ISIS 13920 (TCCGTCATCGCTCCTCAGGG; SEQ ID NO: 1) which is targeted to human H-ras, or ISIS 18078, (GTGCGCGCGAGCCCGAAATC; SEQ ID NO: 2) which is targeted to human Jun-N-terminal kinase-2 (JNK2). Both controls are 2′-O-methoxyethyl gapmers (2′-O-methoxyethyls shown in bold) with a phosphorothioate backbone. For mouse or rat cells the positive control oligonucleotide is ISIS 15770 (ATGCATTCTGCCCCCAAGGA; SEQ ID NO: 3), a 2′-O-methoxyethyl gapmer (2′-O-methoxyethyls shown in bold) with a phosphorothioate backbone which is targeted to both mouse and rat c-raf. The concentration of positive control oligonucleotide that results in 80% inhibition of c-H-ras (for ISIS 13920), JNK2 (for ISIS 18078) or c-raf (for ISIS 15770) mRNA is then utilized as the screening concentration for new oligonucleotides in subsequent experiments for that cell line. If 80% inhibition is not achieved, the lowest concentration of positive control oligonucleotide that results in 60% inhibition of c-H-ras, JNK2 or c-raf mRNA is then utilized as the oligonucleotide screening concentration in subsequent experiments for that cell line. If 60% inhibition is not achieved, that particular cell line is deemed as unsuitable for oligonucleotide transfection experiments. The concentrations of antisense oligonucleotides used herein are from 50 nM to 300 nM.
  • Example 9 Analysis of Oligonucleotide Inhibition of Target Gene Expression
  • [0158]
    Antisense modulation of target gene expression can be assayed in a variety of ways known in the art. For example, target gene mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR (RT-PCR). Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. The preferred method of RNA analysis of the present invention is the use of total cellular RNA as described in other examples herein. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently accomplished using the commercially available ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.
  • [0159]
    Protein levels of target genes can be quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA) or fluorescence-activated cell sorting (FACS). Antibodies directed to a target gene can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.
  • Example 10 RNA Isolation
  • [0000]
    Poly(A)+ mRNA Isolation
  • [0160]
    Poly(A)+ mRNA was isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for poly(A)+ mRNA isolation are routine in the art. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 μL cold PBS. 60 μL lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) was added to each well, the plate was gently agitated and then incubated at room temperature for five minutes. 55 μL of lysate was transferred to Oligo d(T) coated 96-well plates (AGCT Inc., Irvine Calif.). Plates were incubated for 60 minutes at room temperature, washed 3 times with 200 μL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate was blotted on paper towels to remove excess wash buffer and then air-dried for 5 minutes. 60 μL of elution buffer (5 mM Tris-HCl pH 7.6), preheated to 70° C., was added to each well, the plate was incubated on a 90° C. hot plate for 5 minutes, and the eluate was then transferred to a fresh 96-well plate.
  • [0161]
    Cells grown on 100 mm or other standard plates may be treated similarly, using appropriate volumes of all solutions.
  • [0000]
    Total RNA Isolation
  • [0162]
    Total RNA was isolated using an RNEASY 96™ kit and buffers purchased from Qiagen Inc. (Valencia, Calif.) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, growth medium was removed from the cells and each well was washed with 200 μL cold PBS. 150 μL Buffer RLT was added to each well and the plate vigorously agitated for 20 seconds. 150 μL of 70% ethanol was then added to each well and the contents mixed by pipetting three times up and down. The samples were then transferred to the RNEASY 96™ well plate attached to a QIAVAC™ manifold fitted with a waste collection tray and attached to a vacuum source. Vacuum was applied for 1 minute. 500 μL of Buffer RW1 was added to each well of the RNEASY 96™ plate and incubated for 15 minutes and the vacuum was again applied for 1 minute. An additional 500 μL of Buffer RW1 was added to each well of the RNEASY 96™ plate and the vacuum was applied for 2 minutes. 1 mL of Buffer RPE was then added to each well of the RNEASY 96™ plate and the vacuum applied for a period of 90 seconds. The Buffer RPE wash was then repeated and the vacuum was applied for an additional 3 minutes. The plate was then removed from the QIAVAC™ manifold and blotted dry on paper towels. The plate was then re-attached to the QIAVAC™ manifold fitted with a collection tube rack containing 1.2 mL collection tubes. RNA was then eluted by pipetting 140 μL of RNAse free water into each well, incubating 1 minute, and then applying the vacuum for 3 minutes.
  • [0163]
    The repetitive pipetting and elution steps may be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia Calif.). Essentially, after lysing of the cells on the culture plate, the plate is transferred to the robot deck where the pipetting, DNase treatment and elution steps are carried out.
  • Example 11 Real-time Quantitative PCR Analysis of Target Gene mRNA Levels
  • [0164]
    Quantitation of target gene mRNA levels was accomplished by real-time quantitative PCR using the ABI PRISM™ 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. This is a closed-tube, non-gel-based, fluorescence detection system which allows high-throughput quantitation of polymerase chain reaction (PCR) products in real-time. As opposed to standard PCR in which amplification products are quantitated after the PCR is completed, products in real-time quantitative PCR are quantitated as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that anneals specifically between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (e.g., FAM or JOE, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 5′ end of the probe and a quencher dye (e.g., TAMRA, obtained from either PE-Applied Biosystems, Foster City, Calif., Operon Technologies Inc., Alameda, Calif. or Integrated DNA Technologies Inc., Coralville, Iowa) is attached to the 3′ end of the probe. When the probe and dyes are intact, reporter dye emission is quenched by the proximity of the 3′ quencher dye. During amplification, annealing of the probe to the target sequence creates a substrate that can be cleaved by the 5′-exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and hence from the quencher moiety) and a sequence-specific fluorescent signal is generated. With each cycle, additional reporter dye molecules are cleaved from their respective probes, and the fluorescence intensity is monitored at regular intervals by laser optics built into the ABI PRISM™ Sequence Detection System. In each assay, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantitate the percent inhibition after antisense oligonucleotide treatment of test samples.
  • [0165]
    Prior to quantitative PCR analysis, primer-probe sets specific to the target gene being measured are evaluated for their ability to be “multiplexed” with a GAPDH amplification reaction. In multiplexing, both the target gene and the internal standard gene GAPDH are amplified concurrently in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only (“single-plexing”), or both (multiplexing). Following PCR amplification, standard curves of GAPDH and target mRNA signal as a function of dilution are generated from both the single-plexed and multiplexed samples. If both the slope and correlation coefficient of the GAPDH and target signals generated from the multiplexed samples fall within 10% of their corresponding values generated from the single-plexed samples, the primer-probe set specific for that target is deemed multiplexable. Other methods of PCR are also known in the art.
  • [0166]
    PCR reagents were obtained from Invitrogen Corporation, (Carlsbad, Calif.). RT-PCR reactions were carried out by adding 20 μL PCR cocktail (2.5×PCR buffer minus MgCl2, 6.6 mM MgCl2, 375 μM each of dATP, dCTP, dCTP and dGTP, 375 nM each of forward primer and reverse primer, 125 nM of probe, 4 Units RNAse inhibitor, 1.25 Units PLATINUM® Taq, 5 Units MuLV reverse transcriptase, and 2.5×ROX dye) to 96-well plates containing 30 μL total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48° C. Following a 10 minute incubation at 95° C. to activate the PLATINUM® Taq, 40 cycles of a two-step PCR protocol were carried out: 95° C. for 15 seconds (denaturation) followed by 60° C. for 1.5 minutes (annealing/extension).
  • [0167]
    Gene target quantities obtained by real time RT-PCR are normalized using either the expression level of GAPDH, a gene whose expression is constant, or by quantifying total RNA using RiboGreen™ (Molecular Probes, Inc. Eugene, Oreg.). GAPDH expression is quantified by real time RT-PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RiboGreen™ RNA quantification reagent (Molecular Probes, Inc. Eugene, Oreg.). Methods of RNA quantification by RiboGreen™ are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374).
  • [0168]
    In this assay, 170 μL of RiboGreen™ working reagent (RiboGreen™ reagent diluted 1:350 in 10 mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 μL purified, cellular RNA. The plate is read in a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.
  • Example 12 Northern Blot Analysis of Target Gene mRNA Levels
  • [0169]
    For in vivo studies, total RNA was prepared from procured tissues of sacrificed mice by homogenization in GITC buffer (Invitrogen, Carlsbad, Calif.) containing 2-mercaptoethanol (Sigma-Aldrich, St. Louis, Mo.) following manufacturer's recommended protocols followed by ultracentrifugation through a CsCl cushion. For cell culture studies, eighteen hours after antisense treatment, cell monolayers were washed twice with cold PBS and lysed in 1 mL RNAZOL™ (TEL-TEST “B” Inc., Friendswood, Tex.). Total RNA was prepared following manufacturer's recommended protocols.
  • [0170]
    Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND™-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer. RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER™ UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then probed using RapidHYB™ hybridization solution (Amersham Pharmacia Biotech, Piscataway, N.J.) using manufacturer's recommendations for stringent conditions.
  • [0171]
    Hybridized membranes were visualized and quantitated using a PHOSPHORIMAGER™ and IMAGEQUANT™ Software V3.3 (Molecular Dynamics, Sunnyvale, Calif.). Data was normalized to GAPDH levels in untreated controls.
  • Example 13 Design of Chemically Modified Antisense Compounds for Optimized Kidney Targeting
  • [0172]
    A series of chemically modified antisense compounds were designed using the sequence of ISIS 145733 (SEQ ID NO: 4), ISIS 145742 (SEQ ID NO: 5) or ISIS 145746 (SEQ ID NO: 6). Modifications were made to the internucleoside linkages such that the oligonucleotides consisted of either full phosphorothioate backbones or mixed phosphorothioate and phosphodiester backbones (mixed backbone compounds). Modified antisense compounds also contained sugar moiety substitutions at the 2′ position, comprising a 2′-methoxyethyl (2′-MOE) or a 2′-0-dimethylaminoethoxyethyl (2′-DMAEOE). Further modifications included nucleobase substitutions, wherein the unmodified cytosine nucleobase was used in place of the modified 5-methylcytosine at one position in the antisense compound. The compounds are shown in Table 1.
  • [0173]
    ISIS 145733 (SEQ ID NO: 4), ISIS 145742 (SEQ ID NO: 5) and ISIS 145746 (SEQ ID NO: 6) are chimeric oligonucleotides having 2′-MOE wings and a deoxy gap with phosphorothioate linkages throughout the oligonucleotide. ISIS 257016 (SEQ ID NO: 4), ISIS 341699 (SEQ ID NO: 5) and ISIS 351642 (SEQ ID NO: 6) are chimeric oligonucleotides having 2′-MOE wings and a deoxy gap, with phosphodiester linkages in the wings and phosphorothioate linkages in the gap. ISIS 351641 (SEQ ID NO: 4), ISIS 360886 (SEQ ID NO: 4) and ISIS 360887 (SEQ ID NO: 4) are chimeric oligonucleotides having 2′-MOE wings and a deoxy gap, with phosphorothioate linkages in the gap and phosphodiester linkages in the wings, except for one phosphorothioate linkage in the wing(s) at either the extreme 5′ end (ISIS 360886), the extreme 3′ end (ISIS 360887) or both of the extreme 5′ and 3′ ends (ISIS 351641).
  • [0174]
    ISIS 323294 (SEQ ID NO: 4) consists of 2′-MOE nucleotides at positions 1, 2, 3, 4, 17 and 19, 2′-nucleotides at positions 5, 16, 18 and 20 and 2′-deoxynucleotides at positions 6 through 15 with phosphorothioate linkages throughout the oligonucleotide. ISIS 323295 (SEQ ID NO: 4) consists of 2′-MOE nucleotides at positions 1, 2, 3, 4, 17 and 19, 2′-DMAEOE nucleotides at positions 5, 16, 18 and 20 and 2′-deoxynucleotides at positions 6 through 15, wherein the first and last 4 internucleoside linkages are phosphodiester and the central internucleotide linkages are phosphorothioate.
  • [0175]
    The nucleotides in the 3′ most positions in ISIS 251017 and 257018 are cytosine residues (indicated by an asterisk in Table 4). All other cytosine residues of the oligonucleotides listed above are 5-methylcytosines. The compounds are shown in Table 1. Phosphodiester (P═O) internucleotide linkages are indicated by an “o” between nucleotide positions. Phosphorothioate (P═S) internucleoside linkages are indicated by an “s” between nucleotide positions. 2′-MOE nucleotides are underscored and 2′-DMAEOE nucleotides are emboldened. All compounds in Table 1 target the coding region of murine SGLT2 (provided herein as SEQ ID NO: 7).
    TABLE 1
    Chemical modifications of antisense compounds
    targeting SGLT2
    SEQ ID
    ISIS # Sequence NO
    145733 GsAsAsGsTsAsGsCsCsAsCsCsAsAsCsTsGsTs 4
    GsC
    257016 GoAoAoGoTsAsGsCsCsAsCsCsAsAsCsToGoTo 4
    GoC
    257017 GsAsAsGsTsAsGsCsCsAsCsCsAsAsCsTsGsTs 4
    GsC*
    257018 GoAoAoGoTsAsGsCsCsAsCsCsAsAsCsToGoTo 4
    GoC*
    145742 GsAsGsAsAsCsAsTsAsTsCsCsAsCsCsGsAsGs 5
    AsT
    341699 GoAoGoAoAsCsAsTsAsTsCsCsAsCsCsGoAoGo 5
    AoT
    145746 CsTsGsCsAsCsAsGsTsGsTsCsTsGsTsGsTsAs 6
    CsA
    351642 CoToGoCoAsCsAsGsTsGsTsCsTsGsTsGoToAo 6
    CoA
    351641 GsAoAoGoTsAsGsCsCsAsCsCsAsAsCsToGoTo 4
    GsC
    360886 GsAoAoGoTsAsGsCsCsAsCsCsAsAsCsToGoTo 4
    GoC
    360887 GoAoAoGoTsAsGsCsCsAsCsCsAsAsCsToGoTo 4
    GsC
    323294 GsAsAsGsTsAsGsCsCsAsCsCsAsAsCsTsGsTs 4
    GsC
    323295 GoAoAoGoTsAsGsCsCsAsCsCsAsAsCsToGoTo 4
    GoC
  • Example 14 Antisense Inhibition of SGLT2 in Murine Kidney Comparison of Various Oligonucleotide Chemistries
  • [0176]
    In accordance with the present invention, modified SGLT2 antisense compounds were investigated for their activity in vivo. ISIS 29837 (TCGATCTCCTTTTATGCCCG, SEQ ID NO: 8) served as a control compound and is a chimeric oligonucleotide (“gapmer”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings”. The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. The internucleoside (backbone) linkages are phosphorothioate (P═S) throughout the oligonucleotide. All cytidine residues are 5-methylcytidines.
  • [0177]
    Male 6-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 145733, ISIS 257016, ISIS 323294, ISIS 323295 or ISIS 29837 at a dose of 25 mg/kg twice per week for two weeks. Saline-injected animals served as controls. Each treatment group contained four animals. The mice were sacrificed 2 days following administration of the fourth and final dose of oligonucleotide or saline.
  • [0178]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to the ubiquitously expressed mouse cyclophilin A gene.
  • [0179]
    Probes and primers to mouse SGLT2 were designed to hybridize to a mouse SGLT2 sequence, using published sequence information (incorporated herein as SEQ ID NO: 7). For mouse SGLT2 the PCR primers were:
    forward primer:
    CTCGTCTCATACCCGAGTTCTTCT (SEQ ID NO: 9)
    reverse primer:
    AATGATGGCGAAATAGAGGTAGTGTAC (SEQ ID NO: 10)

    and the PCR probe was: FAM-TGCGACCCTCAGCGTGCCC-TAMRA (SEQ ID NO: 11) where FAM is the fluorescent dye and TAMRA is the quencher dye. For mouse cyclophilin A the PCR primers were:
    forward primer: TCGCCGCTTGCTGCA (SEQ ID NO: 12)
    reverse primer: ATCGGCCGTGATGTCGA (SEQ ID NO: 13) and the PCR probe was: 5′ JOE-CCATGGTCAACCCCACCGTGTTC-3′ (SEQ ID NO: 14) where JOE is the fluorescent reporter dye and TAMRA is the quencher dye.
  • [0180]
    The data are expressed as percent change (“−” indicates a decrease) relative to saline treated animals and are shown in Table 2.
    TABLE 2
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    modified SGLT2 antisense compounds
    Percent change in SGLT2 expression
    relative to saline
    ISIS ISIS ISIS ISIS ISIS
    145733 257016 323294 323295 29837
    −44 −82 −40 −31 −23
  • [0181]
    These data illustrate that antisense compounds of different chemistries inhibit the expression of SGLT2 mRNA in mouse kidney. Greatest inhibition of SGLT2 is observed in kidneys from mice treated with ISIS 257016, which is a mixed backbone antisense compound.
  • [0182]
    Mice were further evaluated for total body weight, liver weight and spleen weight. Significant changes in spleen, liver or body weight can indicate that a particular compound causes toxic effects. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 3.
    TABLE 3
    Effects of antisense compounds on total body weight,
    liver weight and spleen weight in mice
    Percent change in weight
    145733 257016 323294 323295 29837
    Total Body 0 0 −1 −3 0
    Liver +1 +1 +9 +4 +12
    Spleen +4 +1 +19 +8 +1
  • [0183]
    All changes in body weight and organ weight were within the margin of error of the experiment. No significant changes in body weight were observed during the treatment or at study termination. No significant changes in liver or spleen weights were observed.
  • [0184]
    Toxic effects of compounds administered in vivo can also be assessed by measuring the levels of enzymes and proteins associated with disease or injury of the liver or kidney. Elevations in the levels of the serum transaminases aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are often indicators of liver disease or injury. Serum total bilirubin is an indicator of liver and biliary function, and albumin and blood urea nitrogen (BUN) are indicators of renal function. Glucose and triglyceride levels are sometimes altered due to toxicity of a treatment. Serum glucose also depends in part upon the activity of SGLT2.
  • [0185]
    In accordance with the present invention, the levels of ALT, AST, total bilirubin, albumin, BUN, glucose and triglyceride were measured in mice treated with the compounds of the invention. Serum was analyzed by LabCorp Testing Facility (San Diego, Calif.). The results are expressed as units measured and are shown in Table 4.
    TABLE 4
    Effects of antisense compounds targeting SGLT2 on liver and kidney function in mice
    Treatment
    Normal and units measured
    Serum indicator Range Saline 145733 257016 323294 323295 29837
    BUN 15-40 27 29 33 29 30 30
    mg/dL
    Albumin 2.5-4.0 3 3 3 3 3 3
    g/dL
    Bilirubin mg/dL 0.1-1.0 0.1 0.1 0.1 0.1 0.1 0.1
    AST  30-300 124 83 129 174 89 114
    IU/L
    ALT  30-200 33 26 47 61 32 31
    IU/L
    Triglycerides  25-100* 179 154 157 160 209 198
    mg/dL
    Glucose  80-150* 242 270 222 284 271 235
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0186]
    The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range for most mice as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0187]
    Mice injected with ISIS 145733, ISIS 257016, ISIS 323294 and ISIS 323295 were also evaluated histologically following routine procedures. Liver, spleen, kidney, intestine, pancreas, lung, skin, heart and muscle samples were procured, fixed in 10% neutral-buffered formalin and processed for staining with hematoxylin and eosin, to visualize nuclei and cytoplasm, or with the anti-oligonucleotide IgG1 antibody 2E1-B5 (Berkeley Antibody Company, Berkeley, Calif.) to assess oligonucleotide staining patterns. Hematoxylin and eosin staining in most tissues exhibited no significant difference between saline- and oligonucleotide-treated animals. Heart sections from animals treated with ISIS 323294 and ISIS 323295 showed a high amount of inflammation relative to hearts from saline-treated mice. 2E1-B5 antibody was recognized using an isospecific anti-IgG2 horse-radish peroxidase-conjugated secondary antibody (Zymed, San Francisco, Calif.) and immunostaining was developed with 3,3′-diaminobenzidene (DAKO, Carpenteria, Calif.). 2E1-B5 staining was performed in duplicate and showed that none of the chemistries significantly stained the liver, while staining was observed in the kidney proximal tubules.
  • [0188]
    The results illustrated in this example demonstrate that antisense compounds of different chemistries are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. The mixed backbone compound, ISIS 257016, is particularly efficient at reducing target mRNA levels in the kidney.
  • Example 15 Antisense Inhibition of SGLT2 mRNA Expression In Vivo Dose Response Study Comparing Mixed Backbone and Full Phosphorothioate Backbone Compounds
  • [0189]
    ISIS 145733 and ISIS 257016 were selected for a dose response study in mice to further evaluate the effectiveness of mixed backbone antisense compounds for kidney targeting. Male 8-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 145733 or ISIS 257016 at doses of 6.25, 12.5, 25 or 50 mg/kg twice per week for two weeks. Saline-injected animals served as controls. A total of 4 animals were injected per group. The mice were sacrificed 2 days following administration of the fourth and final dose of oligonucleotide or saline.
  • [0190]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin as described in Example 14. The data are expressed as percent change (“+” indicates an increase, “−” indicates a decrease) relative to saline treated animals and are illustrated in Table 5.
    TABLE 5
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    antisense compounds with varying chemistries
    Percent change in
    SGLT2 expression
    relative to saline
    Dose of oligonucleotide ISIS ISIS
    mg/kg 145733 257016
    6.25 −3 −58
    12.5 −7 −68
    25 −37 −68
    50 −34 −77
  • [0191]
    These results illustrate that the compounds of the invention, both full phosphorothioate and mixed backbone oligonucleotides, inhibit the expression of SGLT2 in vivo in a dose-dependent manner. However, treatment with the mixed backbone oligonucleotide, ISIS 257016, resulted in the greatest reduction of target mRNA levels.
  • [0192]
    The levels of SGLT2 expression were also evaluated by Northern blot analysis of both pooled and individual RNA samples, to validate the target reduction observed by real-time PCR. Total RNA was prepared from procured tissues of sacrificed mice by homogenization in GITC buffer (Invitrogen, Carlsbad, Calif.) containing 2-mercaptoethanol (Sigma-Aldrich, St. Louis, Mo.) following manufacturer's recommended protocols followed by ultracentrifugation through a CsCl cushion. Twenty micrograms of total RNA was fractionated by electrophoresis through 1.2% agarose gels containing 1.1% formaldehyde using a MOPS buffer system (AMRESCO, Inc. Solon, Ohio). RNA was transferred from the gel to HYBOND™-N+ nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) by overnight capillary transfer. RNA transfer was confirmed by UV visualization. Membranes were fixed by UV cross-linking using a STRATALINKER™ UV Crosslinker 2400 (Stratagene, Inc, La Jolla, Calif.) and then probed using RapidHYB™ hybridization solution (Amersham Pharmacia Biotech, Piscataway, N.J.) using manufacturer's recommendations for stringent conditions.
  • [0193]
    To detect mouse SGLT2, a mouse SGLT2 specific template was prepared by PCR using the forward primer 5′-ATGGAGCAACACGTAGAGGCAGGCT-3′ (SEQ ID NO: 15) and the reverse primer 5′-GAGTGCCGCCAGCCCTCCTGTCACA-3′ (SEQ ID NO: 16) and gel purified. The probe was prepared by asymmetric PCR with the purified template and the reverse primer incorporating 32P CTP to label the probe. Following hybridization blots were exposed overnight to phosphorimager screens (Molecular Dynamics, Amersham) and quantitated. To normalize for variations in loading and transfer efficiency membranes were stripped and probed for mouse glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA (Clontech, Palo Alto, Calif.).
  • [0194]
    For pooled sample analysis, equal amounts of RNA isolated from the kidneys of mice in the same treatment was combined for a total of 20 μg, and the pooled sample was subjected to Northern blot analysis. The results of the pooled sample analysis are shown in Table 6 and are normalized to saline controls (“+” indicates an increase, “−” indicates a decrease).
    TABLE 6
    Northern Analysis of SGLT2 message in pooled kidney RNA samples
    Percent change in
    SGLT2 expression
    Dose of relative to saline
    oligonucleotide ISIS ISIS
    mg/kg 145733 257016
    6.25 +21 −57
    12.5 +7 −50
    25 −35 −75
    50 −35 −82
  • [0195]
    These results demonstrate that, as determined by Northern blot analysis of pooled samples, ISIS 257016 inhibits SGLT2 expression inhibits SGLT2 expression at all doses of antisense compound in a dose-dependent manner, whereas ISIS 145733 inhibits SLGT2 expression at the two highest doses of antisense compound.
  • [0196]
    Target levels in kidney RNA samples from individual mice were also measured by Northern blot analysis. Equal amounts of RNA were individually subjected to Northern blot analysis to determine the level of SGLT2. Target level measurements for each treatment group were then averaged. The results are shown in Table 7 and are normalized to saline controls (“−” indicates a decrease).
    TABLE 7
    Northern Analysis of SGLT2 message in individually measured
    RNA samples
    Percent change in
    SGLT2 expression
    Dose of relative to saline
    oligonucleotide ISIS
    mg/kg ISIS 145733 257016
    6.25 −34 −66
    12.5 −38 −68
    25 −39 −74
    50 −59 −82
  • [0197]
    These results again show that treatment with mixed backbone compound ISIS 257016 results in greater inhibition of SGLT2 mRNA expression in the kidney relative to treatment with a full phosphorothioate backbone compound.
  • [0198]
    Treated mice were further evaluated at the end of the treatment period for total body, liver and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 8.
    TABLE 8
    Effects of modified antisense compounds on total
    body weight, liver weight and spleen weight in mice
    Percent change in weight
    ISIS ISIS
    Dose of 145733 257016
    oligonucleotide Total Total
    mg/kg Body Liver Spleen Body Liver Spleen
    6.25 −4 −10 −12 −1 −3 +1
    12.5 −6 −2 −7 −3 −13 −9
    25 1 −1 +10 1 −8 +8
    50 −1 +6 +10 −3 −9 +12
  • [0199]
    These data demonstrate that no significant changes in total body, liver or spleen weights are observed following treatment with ISIS 145733 or ISIS 257016 at 4 different doses. No changes in total body weight were observed during the treatment period, or at study termination.
  • [0200]
    In addition to the indicators of toxicity listed in Example 14, creatinine levels are also used to evaluate renal function. In accordance with the present invention, the levels of ALT, AST, total bilirubin, creatinine, BUN, glucose and triglyceride were measured in mice treated with the compounds of the invention. Serum was analyzed by LabCorp Testing Facility (San Diego, Calif.). The results are expressed as units measured and are shown in Table 9.
    TABLE 9
    Effects of modified antisense compounds targeting
    SGLT2 on liver and kidney function in mice
    Units measured per
    treatment and dose
    Normal 145733 145733 257016 257016
    Serum indicator Range Saline 25 mg/kg 50 mg/kg 25 mg/kg 50 mg/kg
    BUN 15-40 24 24 25 26 26
    mg/dL
    Creatinine 0.0-1.0 0.1 0.1 0.1 0.1 0.1
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.1 0.1 0.1 0.1 0.1
    AST  30-300 77 65 96 133 141
    IU/L
    ALT  30-200 24 18 22 34 35
    IU/L
    Triglycerides  25-100* 165 169 230 130 111
    mg/dL
    Glucose  80-150* 236 280 256 244 248
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0201]
    The ALT levels in animals treated with either 25 mg/kg or 50 mg/kg of ISIS 145733 are slightly below the normal range, as is the ALT level for saline treated mice. Otherwise, the levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0202]
    Mice injected with ISIS 145733 and ISIS 257016 at doses from 6.25 to 50 mg/kg also were evaluated histologically following routine procedures. Liver and kidney samples were procured, fixed in 10% neutral-buffered formalin and processed for staining with hematoxylin and eosin or with the anti-oligonucleotide IgG1 antibody 2E1-B5 (Berkeley Antibody Company, Berkeley, Calif.) as described in other examples herein. Hematoxylin and eosin staining exhibited no significant difference between saline- and oligonucleotide-treated animals. 2E1 staining showed no detectable oligonucleotide in the liver, while staining was observed in the kidney proximal tubules. Staining intensity lessened concomitantly with a decrease in oligonucleotide dose.
  • [0203]
    The results illustrated in this example demonstrate that antisense compounds of different chemistries are delivered to the kidney, reduce SGLT2 expression in vivo in a dose-dependent manner, and that treatment with these compounds does not result in liver or kidney toxicity. The results further demonstrate that mixed backbone compound ISIS 257016 is particularly effective at reducing target mRNA levels in the kidney.
  • Example 16 Antisense Inhibition of SGLT2 mRNA Expression In Vivo A Second Dose Response Study Comparing Mixed Backbone and Full Phosphorothioate Backbones
  • [0204]
    ISIS 145733 and ISIS 257016 were selected for a dose response study in mice using two identical and two lower doses with respect to the doses used in Example 15.
  • [0205]
    Male 8-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 145733 or ISIS 257016 at doses of 1, 5, 25 or 50 mg/kg twice per week for two weeks. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the fourth and final dose of oligonucleotide or saline.
  • [0206]
    Mice were evaluated for SGLT2 levels in kidney and liver. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 10.
    TABLE 10
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    antisense compounds with varying chemistries
    Percent change
    in SGLT2 expression
    relative to saline
    Dose of Kidney Liver
    oligonucleotide ISIS ISIS ISIS ISIS
    mg/kg 145733 257016 145733 257016
    1 +2 −46 −19 +13
    5 −15 −64 −39 +1
    25 −34 −74 −21 −5
    50 −40 −76 −59 −12
  • [0207]
    These results illustrate that the compounds of the invention, both full phosphorothioate and mixed backbone oligonucleotides, can inhibit the expression of kidney SGLT2 in a dose-dependent manner. Greater inhibition is observed in kidneys from mice treated with ISIS 257016, a mixed backbone antisense compound. SGLT2 is not highly expressed in liver, therefore target levels are low before treatment and therefore more difficult to accurately measure. ISIS 145733 and ISIS 257016 lowered liver SGLT2 expression, with 145733 having a greater effect in liver than the mixed backbone ISIS 257016.
  • [0208]
    Treated mice were further evaluated for liver and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 11.
    TABLE 11
    Effects of antisense compounds on total body weight,
    liver weight and spleen weight in mice
    Percent change in weight
    ISIS ISIS
    Dose of 145733 257016
    oligonucleotide Total Total
    mg/kg Body Liver Spleen Body Liver Spleen
    1 0 −6 +10 −2 −8 +13
    5 +3 +1 +10 −3 −9 +5
    25 −1 +2 −4 +2 +2 +12
    50 −1 +13 +35 −2 −6 +15
  • [0209]
    No significant change was observed in total body weight at timepoints throughout or at the termination of the study. All changes in liver and spleen weight were within the margin of error for the data and are therefore not significant.
  • [0210]
    In addition to the other serum markers described herein, cholesterol levels can be used as a measure of toxicity. In accordance with the present invention, the levels of ALT, AST, total bilirubin, albumin, creatinine, BUN, triglyceride, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown for ISIS 145733 in Table 12 and for ISIS 257016 in Table 13.
    TABLE 12
    Effect of the full phosphorothioate antisense compound
    ISIS 145733 on indicators of liver and kidney function
    Units measured per
    Normal dose of ISIS 145733
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg 50 mg/kg
    BUN 15-40 27 31 31 30 25
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.3 0.2 0.1 0.3 0.1
    AST  30-300 92 91 45 133 56
    IU/L
    ALT  30-200 35 27 26 37 31
    IU/L
    Albumin 2.5-4.0 3 3 3 3 3
    g/dL
    Triglycerides  25-100* 136 188 183 153 224
    mg/dL
    Cholesterol  70-125 122 116 117 120 132
    mg/dL
    Glucose  80-150* 208 202 173 170 161
    mg/dL
  • [0211]
    TABLE 13
    Effect of the mixed backbone antisense compound ISIS
    257016 on indicators of liver and kidney function
    Units measured per
    Normal dose of ISIS 257016
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg 50 mg/kg
    BUN 15-40 27 23 29 25 28
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.3 0.2 0.2 0.2 0.2
    AST  30-300 92 74 73 99 138
    IU/L
    ALT  30-200 35 34 34 46 48
    IU/L
    Albumin 2.5-4.0 3 3 3 3 3
    g/dL
    Triglycerides  25-100* 136 271 233 225 136
    mg/dL
    Cholesterol  70-125 122 116 124 144 137
    mg/dL
    Glucose  80-150* 208 180 178 154 182
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0212]
    Cholesterol levels of animals treated with either 25 or 50 mg/kg of ISIS 257016 were slightly above the normal range; however; they are not significantly greater than saline control animals given the margin of error for the experiment. The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0213]
    Mice injected ISIS 145733 and ISIS 257016 at 1-50 mg/kg also were evaluated histologically following routine procedures. Liver and kidney samples were procured, fixed in 10% neutral-buffered formalin and processed for staining with hematoxylin and eosin or with the anti-oligonucleotide IgG1 antibody 2E1-B5 (Berkeley Antibody Company, Berkeley, Calif.). Hematoxylin and eosin staining in most tissues exhibited no significant difference between saline- and 145733-treated animals, with the exception of slight inflammatory cell infiltration in the liver tissue. Livers from mice treated with ISIS 257016 showed evidence of nuclear 20 degradation and mitosis at 50 mg/kg and slight mitosis at 25 mg/kg. Kidneys from mice treated with ISIS 257016 exhibited no significant differences compared to saline-treated kidneys. Staining with the 2E1 antibody showed weak staining in liver and kidneys from animals treated with ISIS 145733, whereas staining was strong in liver and kidney from animals treated with ISIS 257016. Kidney 2E1 staining appears in a punctate pattern.
  • [0214]
    The results illustrated in this example demonstrate that antisense compounds of different chemistries are delivered to the kidney, reduce SGLT2 expression in vivo in a dose-dependent manner, and that treatment with these compounds does not result in liver or kidney toxicity. The results further demonstrate that mixed backbone compound ISIS 257016 is particularly effective, even at low doses, at reducing target mRNA levels in the kidney.
  • Example 17 Dose Response Study Comparing Mixed Backbone and Full Phosphorothioate Backbones A Second SGLT2 Antisense Sequence
  • [0215]
    A second mixed backbone SGLT2 oligonucleotide, ISIS 341699 (SEQ ID NO: 5), and control phosphorothioate SGLT2 oligonucleotide, ISIS 145742 (SEQ ID NO: 5), were selected for a dose response study in mice. For comparison, ISIS 257016 (mixed backbone) also was included in this study.
  • [0216]
    Male 8-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 341699, ISIS 145742 or ISIS 257016 twice per week for two weeks with the doses shown in Table 14. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the fourth and final dose of oligonucleotide or saline.
  • [0217]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 14.
    TABLE 14
    Antisense inhibition of SGLT2 mRNA expression in vivo by mixed
    backbone and full phosphorothioate oligonucleotides (expressed as
    percent change in SGLT2 mRNA expression relative to saline)
    Dose of
    oligonucleotide ISIS ISIS ISIS
    mg/kg 145742 341699 257016
    0.2 −18.9
    1  −1.8 −50.5
    5  −0.6 −10.9 −56.7
    25 −24.9 −23.9
    50 −32.6
  • [0218]
    These results illustrate that the compounds of the invention, both full phosphorothioate and mixed backbone oligonucleotides, can inhibit the expression of kidney SGLT2 in a dose-dependent manner. However, lower doses of the mixed backbone compound are required to inhibit SGLT2 expression in kidneys from treated mice.
  • [0219]
    Treated mice were further evaluated for liver and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 15 and Table 16.
    TABLE 15
    Effects of antisense compounds on total body weight of mice
    (expressed as percent change in body weight)
    Dose of
    oligonucleotide ISIS ISIS ISIS
    mg/kg 145742 341699 257016
    0.2 +7.9
    1 +5.7 +5.8
    5 +5.0 +5.8 +3.2
    25 +2.0 +2.5
    50 +7.2
  • [0220]
    TABLE 16
    Effects of antisense compounds on liver weight and spleen weight
    of mice (expressed as percent change in organ weight)
    Dose of Liver Spleen
    oligonucleotide ISIS ISIS ISIS ISIS ISIS ISIS
    mg/kg 145742 341699 257016 145742 341699 257016
    0.2 −6.0 −4.7
    1 +2.3 +14.9 −4.2 +1.4
    5 +7.1 +2.2 +7.0 +10.6 −2.8 −7.6
    25 +7.2 +5.8 +0.8 −0.2
    50 +12.1 +9.4
  • [0221]
    No significant change was observed in total body weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0222]
    Levels of BUN, creatinine, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown for ISIS 145742 in Table 17, ISIS 341699 in Table 18 and ISIS 257016 in Table 19.
    TABLE 17
    Effect of the full phosphorothioate antisense compound
    ISIS 145742 on indicators of liver and kidney function
    Units measured per
    Normal dose of ISIS 145742
    Serum indicator Range Saline 5 mg/kg 25 mg/kg 50 mg/kg
    BUN 15-40 20 21.3 25.5 20.8
    mg/dL
    Creatinine 0.0-1.0 0.1 0.2 0.2 0.2
    mg/L
    AST  30-300 113 75.3 83.5 145.3
    IU/L
    ALT  30-200 35.5 29.8 40.3 47.5
    IU/L
    Albumin 2.5-4.0 3.0 3.0 2.9 2.9
    g/dL
    Triglycerides  25-100* 223.8 176.5 192 176.8
    mg/dL
    Cholesterol  70-125 129 119.5 119.5 113.5
    mg/dL
    Glucose  80-150* 176.5 196.5 192 194.8
    mg/dL
  • [0223]
    TABLE 18
    Effect of mixed backbone antisense compound ISIS
    341699 on indicators of liver and kidney function
    Units measured per
    Normal dose of ISIS 341699
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg
    BUN 15-40 20 20 21.8 22
    mg/dL
    Creatinine 0.0-1.0 0.1 0.2 0.2 0.2
    mg/L
    AST  30-300 113 78.2 119 64.8
    IU/L
    ALT  30-200 35.5 36.2 37.3 33.0
    IU/L
    Albumin 2.5-4.0 3.0 3.3 3.1 3.2
    g/dL
    Triglycerides  25-100* 223.8 206.4 186.8 183.5
    mg/dL
    Cholesterol  70-125 129 135 124 120.8
    mg/dL
    Glucose  80-150* 176.5 203.2 171.5 197
    mg/dL
  • [0224]
    TABLE 19
    Effect of mixed backbone antisense compound ISIS 257016 on
    indicators of liver and kidney function
    Units measured per
    Serum dose of ISIS 257016
    indicator Normal Range Saline 0.2 mg/kg 1 mg/kg 5 mg/kg
    BUN 15-40 20 21.8 26.3 20.5
    mg/dL
    Creatinine 0.0-1.0 0.1 0.2 0.2 0.2
    mg/L
    AST  30-300 113 123.8 85.3 69.5
    IU/L
    ALT  30-200 35.5 36.8 44 43
    IU/L
    Albumin 2.5-4.0 3.0 3.1 3.4 3.1
    g/dL
    Triglycerides  25-100* 223.8 138.8 268.3 212.8
    mg/dL
    Cholesterol  70-125 129 128 152 135.3
    mg/dL
    Glucose  80-150* 176.5 208.8 212.3 164.5
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0225]
    In some oligonucleotide-treated animals cholesterol levels were above the normal range; however, this elevation is not significant since saline-treated animals also exhibited cholesterol above the normal range. The levels of the remaining routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0226]
    Mice injected with ISIS 145742, ISIS 341699 and ISIS 257016 at 0.2-50 mg/kg were also evaluated histologically following routine procedures. Liver and kidney samples were procured, fixed in 10% neutral-buffered formalin and processed for staining with hematoxylin and eosin or with the anti-oligonucleotide IgG1 antibody 2E1-B5, as described in other examples herein.
  • [0227]
    Hematoxylin and eosin staining in both liver and kidney tissues exhibited no significant difference between saline- and antisense oligonucleotide-treated animals. Staining with the 2E1 antibody showed high background in sinusoidal tissues of liver from the saline-injected animals, therefore making it difficult to interpret positive staining in the oligonucleotide-treated livers. Kidney samples from saline-injected animals and animals treated with 0.2 mg/kg ISIS 257016 showed no positive oligonucleotide staining; however, the remainder of the oligonucleotide-treated animals demonstrated high levels of staining in the proximal tubules, which increased with dose.
  • [0228]
    The results illustrated in this example demonstrate that antisense compounds of different chemistries are delivered to the kidney, reduce SGLT2 expression in vivo in a dose-dependent manner, and that treatment with these compounds does not result in liver or kidney toxicity. The results further demonstrate that mixed backbone compounds ISIS 341699 and ISIS 257016 are particularly effective at reducing target mRNA levels in the kidney.
  • Example 18 Dose Response Study Comparing Mixed Backbone and Full Phosphorothioate Backbones A Third SGLT2 Antisense Sequence
  • [0229]
    A third mixed backbone SGLT2 oligonucleotide, ISIS 351642 (SEQ ID NO: 6), and control phosphorothioate SGLT2 oligonucleotide, ISIS 145746 (SEQ ID NO: 6), were selected for a dose response study in mice.
  • [0230]
    Male 7-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 145746 or ISIS 351642 twice per week for two weeks with the doses shown in Table 20. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the fourth and final dose of oligonucleotide or saline.
  • [0231]
    Mice were evaluated of SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 20.
    TABLE 20
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    mixed backbone and full phosphorothioate oligonucleotides
    (expressed as percent change in SGLT2 mRNA expression
    relative to saline)
    Dose of
    oligonucleotide ISIS ISIS
    mg/kg 145746 351642
    1 −26.7
    5  −5.8 −35.1
    25 −10.5 −44.3
    50 −35.6 −31.8
  • [0232]
    These illustrate that the compounds of the invention, both full phosphorothioate and mixed backbone oligonucleotides, can inhibit the expression of kidney SGLT2 in a dose-dependent manner. At doses of 5 and 25 mg/kg, greater inhibition is observed in kidneys from mice treated with ISIS 351463, suggesting the mixed backbone antisense compound is a more efficient inhibitor of target mRNA expression in the kidney.
  • [0233]
    Treated mice were further evaluated for body weight, liver weight and spleen weight. The data are expressed as present change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 21.
    TABLE 21
    Effects of antisense compounds on total body weight, liver weight
    and spleen weight of mice
    Percent change in weight
    ISIS ISIS
    Dose of 145746 351642
    oligonucleotide Total Total
    mg/kg Body Liver Spleen Body Liver Spleen
    1 +6.9 −8.2 +0.8
    5 +3.6 −5.7 +6.5 +4.6 −0.6 −7.9
    25 +5.4 −2.0 +3.7 +4.7 −10.6 +1.1
    50 +12.1 −8.4 +10.0 +7.4 −3.0 +1.3
  • [0234]
    No significant change was observed in total body weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0235]
    Levels of BUN, creatinine, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown for ISIS 145746 in Table 22 and ISIS 351642 in Table 23.
    TABLE 22
    Effect of the full phosphorothioate antisense compound ISIS 145746
    on indicators of liver and kidney function
    Units measured per
    dose of ISIS 145746
    Serum indicator Normal Range Saline 1 mg/kg 5 mg/kg 25 mg/kg 50 mg/kg
    Creatinine 0.0-1.0 0.1 0.2 0.2 0.1
    mg/L
    AST  30-300 129 60 84 155
    IU/L
    ALT  30-200 30 28 26 77
    IU/L
    Albumin 2.5-4.0 2.8 2.9 2.8 2.9
    g/dL
    Triglycerides  25-100* 298 268 259 236
    mg/dL
    Cholesterol  70-125 116 118 108 106
    mg/dL
    Glucose  80-150* 163 162 181 179
    mg/dL
  • [0236]
    TABLE 23
    Effect of mixed backbone antisense compound ISIS 351642 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 351642
    Serum indicator Normal Range Saline 1 mg/kg 5 mg/kg 25 mg/kg 50 mg/kg
    Creatinine 0.0-1.0 0.1 0.1 0.1 0.2 0.2
    mg/L
    AST  30-300 129 132 75 131 160
    IU/L
    ALT  30-200 30 31 28 29 31
    IU/L
    Albumin 2.5-4.0 2.8 2.9 3.0 2.7 2.8
    g/dL
    Triglycerides  25-100* 298 238 287 240 233
    mg/dL
    Cholesterol  70-125 116 117 122 106 113
    mg/dL
    Glucose  80-150* 163 195 175 164 171
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0237]
    The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0238]
    The results illustrated in this example demonstrate that antisense compounds of different chemistries are delivered to the kidney, reduce SGLT2 expression in vivo in a dose-dependent manner, and that treatment with these compounds does not result in liver or kidney toxicity. The results further suggest that mixed backbone compound ISIS 351642 is more effective than full phosphorothioate oligonucleotides at reducing target mRNA levels in the kidney, particularly at low doses.
  • Example 19 Comparison of a Standard Mixed Backbone Compound and a Mixed Backbone Compound with Phosphorothioate Linkages at the Extreme 5′ and 3′ Ends A Single Dose Study
  • [0239]
    In accordance with the present invention, ISIS 257016 and ISIS 351641 were analyzed for their ability to inhibit SGLT2 expression in vivo. ISIS 257016 is a standard mixed backbone compound having 2′-MOE wings and a deoxy gap, with phosphodiester linkages in the wings and phosphorothioate linkages in the gap. ISIS 351641 differs from the standard mixed backbone compounds by having one phosphorothioate linkage at each of the extreme 5′ and 3′ ends of the wings.
  • [0240]
    Male 8-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given a single intraperitoneal injection of ISIS 257016 or ISIS 351641 at a dose of 1, 5, 25, or 50 mg/kg. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the single dose of oligonucleotide or saline.
  • [0241]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 24.
    TABLE 24
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    mixed backbone oligonucleotides (expressed as percent
    change in SGLT2 mRNA expression relative to saline)
    Dose of
    oligonucleotide ISIS ISIS
    mg/kg 257016 351641
    1 −21.5 −14.0
    5 −26.4 −19.3
    25 −24.2 −12.5
    50 −36.3 −22.0
  • [0242]
    These results illustrate that mixed backbone compounds of the invention, with either complete phosphodiester linkages in the wings, or with the extreme 5′ and 3′ ends substituted with phosphorothioate linkages, inhibit the expression of kidney SGLT2 in a dose-dependent manner. However, greater inhibition is observed in kidneys from mice treated with ISIS 257016, which contains all phosphodiester linkages in the wings.
  • [0243]
    Treated mice were further evaluated for body weight and liver and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 25.
    TABLE 25
    Effects of antisense compounds on total body weight, liver weight
    and spleen weight of mice
    Percent change in weight
    ISIS ISIS
    Dose of 257016 351641
    oligonucleotide Total Total
    mg/kg Body Liver Spleen Body Liver Spleen
    1 −0.9 +1.2 −1.6 +2.8 +3.0 −0.1
    5 −5.1 +5.4 +20.1 +4.0 +2.1 +9.7
    25 −1.1 +3.5 +3.8 −0.7 +9.3 +5.9
    50 −2.5 −2.3 +7.8 +0.9 −0.7 +10.2
  • [0244]
    No significant change was observed in total body weight, liver weight or spleen weight at time points throughout or at the termination of the study.
  • [0245]
    Levels of creatinine, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown for ISIS 257016 in Table 26 and for ISIS 351641 in Table 27.
    TABLE 26
    Effect of mixed backbone antisense compound ISIS 257016 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 257016
    Serum indicator Normal Range Saline 1 mg/kg 5 mg/kg 25 mg/kg 50 mg/kg
    Creatinine 0.0-1.0 0.0 0.0 0.0 0.0 0.2
    mg/L
    AST  30-300 141 62 77 89 88
    IU/L
    ALT  30-200 30 29 28 27 33
    IU/L
    Albumin 2.5-4.0 2.9 2.8 2.8 3.0 2.9
    g/dL
    Triglycerides  25-100* 213 253 255 347 245
    mg/dL
    Cholesterol  70-125 118 111 116 125 120
    mg/dL
    Glucose  80-150* 155 186 172 174 169
    mg/dL
  • [0246]
    TABLE 27
    Effect of mixed backbone antisense compound ISIS 351641 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 351641
    Serum indicator Normal Range Saline 1 mg/kg 5 mg/kg 25 mg/kg 50 mg/kg
    Creatinine 0.0-1.0 0.0 0.2 0.1 0.1 0.2
    mg/L
    AST  30-300 141 75 117 68 98
    IU/L
    ALT  30-200 30 25 33 30 27
    IU/L
    Albumin 2.5-4.0 2.9 2.9 2.9 2.9 2.9
    g/dL
    Triglycerides  25-100* 213 271 280 296 271
    mg/dL
    Cholesterol  70-125 118 120 126 112 117
    mg/dL
    Glucose  80-150* 155 162 171 189 175
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0247]
    The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0248]
    The results illustrated in this example demonstrate that mixed backbone compounds of varying chemistries are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. The results further indicate that mixed backbone compounds with wings composed completely of phosphodiester linkages are more efficient inhibitors of target mRNA.
  • Example 20 Effects of Modified Antisense Compounds on SGLT2 mRNA Expression In Vivo Two and Three Dose Protocols
  • [0249]
    In accordance with the present invention, mixed backbone compound ISIS 257016 was analyzed for its ability to inhibit SGLT2 expression in vivo when administered in either two or three doses. ISIS 353003 (CCTTCCCTGAAGGTTCCTCC; SEQ ID NO: 17), a mixed backbone oligonucleotide which targets human PTP1B, was used as a control.
  • [0250]
    Male 8-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given two or three intraperitoneal injections of ISIS 257016 or ISIS 353003 at three day intervals. ISIS 257016 was administered at doses of 1, 5 or 25 mg/kg and ISIS 353003 was administered at a dose of 25 mg/kg. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0251]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 28.
    TABLE 28
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    two doses or three doses of mixed backbone oligonucleotides
    (expressed as percent change in SGLT2 mRNA
    expression relative to saline control)
    Oligonucleotide Three
    (dose in mg/kg) Two Doses Doses
    ISIS 257016 (1 mg/kg) −43.2 −39.1
    ISIS 257016 (5 mg/kg) −39.7 −42.9
    ISIS 257016 (25 mg/kg) −53.8 −65.5
    ISIS 353003 (25 mg/kg)  −8.0  −6.9
  • [0252]
    These results illustrate that the mixed backbone compounds of the invention efficiently inhibit the expression of kidney SGLT2 in a dose-dependent manner. Furthermore, inhibition increases with the number of doses administered.
  • [0253]
    Treated mice were further evaluated for body weight, kidney weight, liver weight and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 29 and Table 30.
    TABLE 29
    Effects of antisense compounds on total body weight of mice
    (expressed as percent change in body weight)
    Oligonucleotide Two Three
    (dose in mg/kg) Doses Doses
    ISIS 257016 (1 mg/kg) −1.1 0
    ISIS 257016 (5 mg/kg) +1.3 +0.8
    ISIS 257016 (25 mg/kg) +0.1 +1.3
    ISIS 353003 (25 mg/kg) −0.8 +0.8
  • [0254]
    TABLE 30
    Effects of antisense compounds on total kidney weight, liver weight and
    spleen weight of mice
    Oligo- Percent change in weight
    nucleotide Two Doses Three Doses
    (dose in mg/kg) Kidney Liver Spleen Kidney Liver Spleen
    ISIS 257016 −0.5 −2.2 −4.3 −5.6 −3.8 −5.9
    (1 mg/kg)
    ISIS 257016 −5.4 +2.5 +7.4 −6.6 −7.1 −9.0
    (5 mg/kg)
    ISIS 257016 −7.9 −1.1 +4.2 −8.6 −8.8 −1.2
    (25 mg/kg)
    ISIS 353003 −5.5 +1.2 −2.7 −0.2 −4.0 +6.5
    (25 mg/kg)
  • [0255]
    No significant change was observed in total body weight, kidney weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0256]
    Levels of BUN, creatinine, bilirubin, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown for the two dose protocol in Table 31 and for the three dose protocol in Table 32.
    TABLE 31
    Effect of mixed backbone antisense compound ISIS 257016
    administered according to the two dose protocol on indicators
    of liver and kidney function
    Units measured per
    dose of ISIS 257016
    Serum indicator Normal Range Saline 1 mg/kg 5 mg/kg 25 mg/kg ISIS 353003
    BUN 15-40 32 34 29 25 28
    mg/dL
    Creatinine 0.0-1.0 0.1 0.1 0.2 0.1 0.1
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.1 0.1 0.1 0.1 0.1
    AST  30-300 54 119 156 116 154
    IU/L
    ALT  30-200 27 36 45 30 36
    IU/L
    Albumin 2.5-4.0 2.7 3.2 3.1 3.0 2.8
    g/dL
    Triglycerides  25-100* 221 263 234 264 278
    mg/dL
    Cholesterol  70-125 113 118 117 125 125
    mg/dL
    Glucose  80-150* 170 157 177 163 152
    mg/dL
  • [0257]
    TABLE 32
    Effect of mixed backbone antisense compound ISIS 257016
    administered according to the three dose protocol on indicators
    of liver and kidney function
    Units measured per
    dose of ISIS 257016
    Serum indicator Normal Range Saline 1 mg/kg 5 mg/kg 25 mg/kg ISIS 353003
    BUN 15-40 30 32 30 27 27
    mg/dL
    Creatinine 0.0-1.0 0.1 0.1 0.2 0.1 0.1
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.1 0.1 0.1 0.1 0.1
    AST  30-300 126 83 81 59 57
    IU/L
    ALT  30-200 35 30 57 27 24
    IU/L
    Albumin 2.5-4.0 3.0 2.8 2.8 2.7 2.8
    g/dL
    Triglycerides  25-100* 223 236 202 153 188
    mg/dL
    Cholesterol  70-125 112 113 114 116 106
    mg/dL
    Glucose  80-150* 152 169 161 181 192
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0258]
    The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0259]
    Mice injected with ISIS 257016 and control animals were also evaluated histologically following routine procedures. Liver and kidney samples were procured, fixed in 10% neutral-buffered formalin and processed for staining with hematoxylin and eosin. Hematoxylin and eosin staining exhibited no significant difference between saline- and oligonucleotide-treated animals. All tissue samples exhibited normal kidney and liver morphology.
  • [0260]
    The results illustrated in this example demonstrate that mixed backbone compounds are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. The results further indicate that inhibition of target mRNA expression in the kidney increases with the number of doses administered.
  • Example 21 Effects of Mixed Backbone Antisense Compounds on SGLT2 mRNA Expression In Vivo Two to Five Day Consecutive Daily Dosing Protocols
  • [0261]
    In accordance with the present invention, mixed backbone compound ISIS 257016 (SEQ ID NO: 4) was analyzed for its ability to inhibit SGLT2 expression in vivo when administered in two to five doses (consecutive daily doses). ISIS 353003 (SEQ ID NO: 17), a mixed backbone oligonucleotide which targets human PTP1B, was used as a control.
  • [0262]
    Male 9-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given two, three, four or five intraperitoneal injections of ISIS 257016 or ISIS 353003 once a day for the treatment period. ISIS 257016 was administered at doses of 2.5 or 25 mg/kg and ISIS 353003 was administered at a dose of 25 mg/kg. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0263]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 33.
    TABLE 33
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    mixed backbone oligonucleotide (expressed as percent change
    in SGLT2 mRNA expression relative to saline control)
    Oligonucleotide Three Five
    (dose in mg/kg) Two Doses Doses Four Doses Doses
    ISIS 257016 (2.5 mg/kg) −14.2 −35.4 −25.3 −42.0
    ISIS 257016 (25 mg/kg) −12.5 −32.9 −39.1 −68.9
    ISIS 353003 (25 mg/kg) −4.5 −9.6 +0.5 −11.3
  • [0264]
    These results illustrate that the mixed backbone compounds of the invention efficiently inhibit the expression of kidney SGLT2 and inhibition increases with the number of doses administered.
  • [0265]
    Treated mice were further evaluated for body weight, kidney weight, liver weight and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Tables 34-37.
    TABLE 34
    Effects of antisense compounds on total body weight of mice
    (expressed as percent change in body weight)
    Oligonucleotide Two Three Four Five
    (dose in mg/kg) Doses Doses Doses Doses
    ISIS 257016 (2.5 mg/kg) +2.7 +2.7 +3.2 +1.5
    ISIS 257016 (25 mg/kg) +2.0 +2.0 +3.1 −0.7
    ISIS 353003 (25 mg/kg) +0.6 +0.8 +2.5 +1.3
  • [0266]
    TABLE 35
    Effects of antisense compounds on total kidney weight
    (expressed as percent change in kidney weight)
    Oligonucleotide Two Three Four Five
    (dose in mg/kg) Doses Doses Doses Doses
    ISIS 257016 (2.5 mg/kg) +8.2 −1.4 +8.9 +1.5
    ISIS 257016 (25 mg/kg) +11.5 +3.6 +2.7 −7.7
    ISIS 353003 (25 mg/kg) +5.3 −3.6 +4.9 +7.1
  • [0267]
    TABLE 36
    Effects of antisense compounds on total liver weight
    (expressed as percent change in liver weight)
    Oligonucleotide Two Three Four Five
    (dose in mg/kg) Doses Doses Doses Doses
    ISIS 257016 (2.5 mg/kg) +9.2 +7.5 +4.8 +4.8
    ISIS 257016 (25 mg/kg) +11.8 +5.2 +0.6 −8.0
    ISIS 353003 (25 mg/kg) +7.4 −3.4 +12.9 +9.5
  • [0268]
    TABLE 37
    Effects of antisense compounds on total spleen weight
    (expressed as percent change in spleen weight)
    Oligonucleotide Two Three Four Five
    (dose in mg/kg) Doses Doses Doses Doses
    ISIS 257016 (2.5 mg/kg) +22.2 +10.1 +15.3 +10.7
    ISIS 257016 (25 mg/kg) +13.3 +5.1 +6.7 +4.5
    ISIS 353003 (25 mg/kg) +7.3 +1.4 +19.8 +8.6
  • [0269]
    No significant change was observed in total body weight, kidney weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0270]
    Levels of creatinine, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown in Tables 38-41.
    TABLE 38
    Effect of mixed backbone antisense compound ISIS 257016
    administered as two consecutive daily doses on indicators of
    liver and kidney function
    Units measured per
    dose of oligonucleotide
    ISIS ISIS ISIS
    Serum Normal 257016 257016 353003
    indicator Range Saline 2.5 mg/kg 25 mg/kg 25 mg/kg
    Creatinine 0.0-1.0  0.2 0.1 0.1 0.2
    mg/L
    AST 30-300 160 132 75 131
    IU/L
    ALT 30-200 31 31 28 29
    IU/L
    Albumin 2.5-4.0  2.8 2.9 3.0 2.7
    g/dL
    Triglycerides  25-100* 233 238 287 240
    mg/dL
    Cholesterol 70-125 113 117 122 106
    mg/dL
    Glucose  80-150* 171 195 175 164
    mg/dL
  • [0271]
    TABLE 39
    Effect of mixed backbone antisense compound ISIS 257016
    administered as three consecutive daily doses on indicators of
    liver and kidney function
    Units measured per
    dose of oligonucleotide
    ISIS ISIS ISIS
    Serum Normal 257016 257016 353003
    indicator Range Saline 2.5 mg/kg 25 mg/kg 25 mg/kg
    Creatinine 0.0-1.0  0.1 0.2 0.2 0.1
    mg/L
    AST 30-300 199 60 84 155
    IU/L
    ALT 30-200 29 28 26 77
    IU/L
    Albumin 2.5-4.0  2.8 2.9 2.8 2.9
    g/dL
    Triglycerides  25-100* 289 268 259 236
    mg/dL
    Cholesterol 70-125 111 118 108 106
    mg/dL
    Glucose  80-150* 204 162 181 179
    mg/dL
  • [0272]
    TABLE 40
    Effect of mixed backbone antisense compound ISIS 257016
    administered as four consecutive daily doses on indicators of
    liver and kidney function
    Units measured per
    dose of oligonucleotide
    ISIS ISIS ISIS
    Serum Normal 257016 257016 353003
    indicator Range Saline 2.5 mg/kg 25 mg/kg 25 mg/kg
    Creatinine 0.0-1.0  0.1 0.1 0.1 0.2
    mg/L
    AST 30-300 199 92 120 144
    IU/L
    ALT 30-200 29 30 30 36
    IU/L
    Albumin 2.5-4.0  2.8 3.0 2.8 3.0
    g/dL
    Triglycerides  25-100* 289 252 269 294
    mg/dL
    Cholesterol 70-125 111 126 115 120
    mg/dL
    Glucose  80-150* 204 173 198 192
    mg/dL
  • [0273]
    TABLE 41
    Effect of mixed backbone antisense compound ISIS 257016
    administered as five consecutive daily doses on indicators of
    liver and kidney function
    Units measured per
    dose of oligonucleotide
    ISIS ISIS ISIS
    Serum Normal 257016 257016 353003
    indicator Range Saline 2.5 mg/kg 25 mg/kg 25 mg/kg
    Creatinine 0.0-1.0  0.1 0.1 0.1 0.1
    mg/L
    AST 30-300 129 121 125 97
    IU/L
    ALT 30-200 30 30 33 29
    IU/L
    Albumin 2.5-4.0  2.8 2.9 2.8 2.9
    g/dL
    Triglycerides  25-100* 298 298 285 277
    mg/dL
    Cholesterol 70-125 116 126 122 126
    mg/dL
    Glucose  80-150* 163 177 204 185
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0274]
    The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0275]
    The results illustrated in this example demonstrate that mixed backbone compounds are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. The results further indicate that inhibition of target mRNA expression in the kidney increases with the number of doses administered.
  • Example 22 Comparison of a Standard Mixed Backbone Compound and Mixed Backbone Compounds with Phosphorothioate Linkages at Either or Both of the Extreme 5′ and 3′ Ends A Four Dose Protocol
  • [0276]
    In accordance with the present invention, ISIS 257016 (SEQ ID NO: 4), ISIS 351641 (SEQ ID NO: 4), ISIS 360886 (SEQ ID NO: 4) and ISIS 360887 (SEQ ID NO: 4) were analyzed for their ability to inhibit SGLT2 expression in vivo. ISIS 257016 is a standard mixed backbone compound having 2′-MOE wings and a deoxy gap, with phosphodiester linkages in the wings and phosphorothioate linkages in the gap. ISIS 351641 differs from the standard mixed backbone compounds by having one phosphorothioate linkage at each of the extreme 5′ and 3′ ends of the wings. ISIS 360886 and ISIS 360887 are mixed backbone compounds with one phosphorothioate linkage at the extreme 5′ end or extreme 3′ end, respectively.
  • [0277]
    Male 7-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 257016, ISIS 351641, ISIS 360886 or ISIS 360887 twice a week for two weeks at doses of 1.56, 6.25 or 25 mg/kg. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0278]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 42.
    TABLE 42
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    mixed backbone oligonucleotides (expressed as percent
    change in SGLT2 mRNA expression relative to saline)
    Dose of
    oligonucleotide ISIS ISIS ISIS ISIS
    mg/kg 257016 351641 360886 360887
    1.56 −39.1 −4.2 −12.7 −9.7
    6.25 −52.8 −4.87 −19.7 −7.3
    25 −57.8 −11.0 −29.0 −4.9
  • [0279]
    These results illustrate that mixed backbone compounds of the invention, with either complete phosphodiester linkages in the wings, or with the extreme 5′ and 3′ ends substituted with phosphorothioate linkages, can inhibit the expression of kidney SGLT2 in a dose-dependent manner. With the exception of ISIS 360887, inhibition of target mRNA was dose-dependent. Although all mixed backbone compounds inhibited SGLT2 expression, greater inhibition is observed in kidneys from mice treated with ISIS 257016, which is a mixed backbone compound that contains all phosphodiester linkages in the wings.
  • [0280]
    Treated mice were further evaluated for body weight, kidney weight, liver weight and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 43.
    TABLE 43
    Effects of antisense compounds on total body weight, kidney weight,
    liver weight and spleen weight of mice (expressed as percent
    change in weight)
    Dose Body Kidney Liver Spleen
    Oligonucleotide mg/kg weight weight weight weight
    ISIS 257016 1.56 +11.6 −3.5 −4.2 −2.4
    ISIS 257016 6.25 +7.9 −3.0 +3.8 −1.3
    ISIS 257016 25 +11.7 −4.1 +1.4 +8.9
    ISIS 351641 1.56 +7.9 −0.9 −5.4 +9.4
    ISIS 351641 6.25 +11.1 +1.3 −2.2 +13.4
    ISIS 351641 25 +7.4 −2.1 −0.5 −1.4
    ISIS 360886 1.56 +7.6 −1.0 −13.7 −5.0
    ISIS 360886 6.25 +8.9 −3.7 −16.6 +1.2
    ISIS 360886 25 +11.1 −5.5 −11.6 +0.8
    ISIS 360887 1.56 +8.5 +1.0 −10.4 −0.4
    ISIS 360887 6.25 +7.5 −1.8 −8.4 +1.1
    ISIS 360887 25 +9.8 +2.2 −9.0 +11.8
  • [0281]
    No significant change was observed in total body weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0282]
    Levels of BUN, creatinine, bilirubin, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown in Tables 44-47.
    TABLE 44
    Effect of mixed backbone antisense compound ISIS 257016 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 257016
    Serum Normal 1.56
    indicator Range Saline mg/kg 6.25 mg/kg 25 mg/kg
    BUN 15-40  23 21 26 22
    mg/dL
    Creatinine 0.0-1.0  0.2 0.2 0.2 0.2
    mg/L
    Bilirubin 0.1-1.0  0.2 0.2 0.2 0.1
    mg/dL
    AST 30-300 75 61 83 71
    IU/L
    ALT 30-200 30 30 33 39
    IU/L
    Albumin 2.5-4.0  2.8 2.9 2.9 2.7
    g/dL
    Triglycerides  25-100* 208 210 243 150
    mg/dL
    Cholesterol 70-125 116 125 130 135
    mg/dL
    Glucose  80-150* 207 184 184 215
    mg/dL
  • [0283]
    TABLE 45
    Effect of mixed backbone antisense compound ISIS 351641 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 351641
    Normal 1.56 6.25
    Serum indicator Range Saline mg/kg mg/kg 25 mg/kg
    BUN 15-40  23 23 25 22
    mg/dL
    Creatinine 0.0-1.0  0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0  0.2 0.1 0.2 0.1
    AST 30-300 75 61 67 54
    IU/L
    ALT 30-200 30 32 31 30
    IU/L
    Albumin 2.5-4.0  2.8 2.7 2.7 2.8
    g/dL
    Triglycerides  25-100* 208 169 176 185
    mg/dL
    Cholesterol 70-125 116 110 115 107
    mg/dL
    Glucose  80-150* 207 205 199 208
    mg/dL
  • [0284]
    TABLE 46
    Effect of mixed backbone antisense compound ISIS 360886 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 360886
    Normal 1.56 6.25
    Serum indicator Range Saline mg/kg mg/kg 25 mg/kg
    BUN 15-40  23 21 23 24
    mg/dL
    Creatinine 0.0-1.0  0.2 0.1 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0  0.2 0.2 0.2 0.1
    AST 30-300 75 56 77 73
    IU/L
    ALT 30-200 30 26 27 28
    IU/L
    Albumin 2.5-4.0  2.8 2.7 2.7 2.7
    g/dL
    Triglycerides  25-100* 208 164 181 169
    mg/dL
    Cholesterol 70-125 116 105 108 108
    mg/dL
    Glucose  80-150* 207 189 202 200
    mg/dL
  • [0285]
    TABLE 47
    Effect of mixed backbone antisense compound ISIS 360887 on
    indicators of liver and kidney function
    Units measured per
    dose of ISIS 360887
    Normal 1.56 6.25
    Serum indicator Range Saline mg/kg mg/kg 25 mg/kg
    BUN 15-40  23 23 22 23
    mg/dL
    Creatinine 0.0-1.0  0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0  0.2 0.2 0.1 0.2
    AST 30-300 75 142 83 108
    IU/L
    ALT 30-200 30 40 39 34
    IU/L
    Albumin 2.5-4.0  2.8 2.7 2.7 2.7
    g/dL
    Triglycerides  25-100* 208 136 157 200
    mg/dL
    Cholesterol 70-125 116 109 107 110
    mg/dL
    Glucose  80-150* 207 199 201 187
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0286]
    Cholesterol levels of mice treated with either 6.25 or 25 mg/kg were slightly elevated; however, these levels are not significantly greater than the cholesterol levels observed in saline-treated control animals. Otherwise, the levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0287]
    Saline- and oligonucleotide-injected animals also were evaluated histologically following routine procedures. Liver and kidney samples were procured, fixed in 10% neutral-buffered formalin and processed for staining with hematoxylin and eosin. Hematoxylin and eosin staining exhibited no significant difference between control and oligonucleotide-treated animals.
  • [0288]
    The results illustrated in this example demonstrate that mixed backbone compounds are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. The results further indicate that mixed backbone compounds with complete phosphodiester linkages in the wings are more effective modulators of target mRNA expression in the kidney than mixed backbone compounds with a phosphorothioate linkage at one or both of the extreme 5′ and 3′ ends.
  • Example 23 Comparison of a Standard Mixed Backbone Compound and Mixed Backbone Compounds with Phosphorothioate Linkages at Either or Both of the Extreme 5′ and 3′ Ends An Eight Dose Protocol
  • [0289]
    A second study of SGLT2 antisense oligonucleotides ISIS 257016, ISIS 351641, ISIS 360886 and ISIS 360887 was undertaken in which mice received eight doses over a four week period. As described previously, ISIS 257016 is a standard mixed backbone compound having 2′-MOE wings and a deoxy gap, with phosphodiester linkages in the wings and phosphorothioate linkages in the gap. ISIS 351641 differs from the standard mixed backbone compounds by having one phosphorothioate linkage at each of the extreme 5′ and 3′ ends of the wings. ISIS 360886 and ISIS 360887 are mixed backbone compounds with one phosphorothioate linkage at the extreme 5′ end and extreme 3′ end, respectively.
  • [0290]
    Male 8-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 257016, ISIS 351641, ISIS 360886 or ISIS 360887 twice a week for four weeks at doses of 1, 5 or 25 mg/kg. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0291]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 48.
    TABLE 48
    Antisense inhibition of SGLT2 mRNA expression in vivo by
    mixed backbone oligonucleotides (expressed as percent
    change in SGLT2 mRNA expression relative to saline)
    Dose of
    oligonucleotide ISIS ISIS ISIS ISIS
    mg/kg 257016 351641 360886 360887
    1 −53 −14 −24 −23
    5 −64 −23 −30 −26
    25 −68 −37 −50 −40
  • [0292]
    These results illustrate that mixed backbone compounds of the invention, with either complete phosphodiester linkages in the wings, or with the extreme 5′ and 3′ ends substituted with phosphorothioate linkages, can inhibit the expression of kidney SGLT2 in a dose-dependent manner. However, greater inhibition is observed in kidneys from mice treated with ISIS 257016, which contains all phosphodiester linkages in the wings.
  • [0293]
    Treated mice were further evaluated for body weight and liver and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 49.
    TABLE 49
    Effects of antisense compounds on total body weight,
    liver weight and spleen weight of mice
    (expressed as percent change in weight)
    Dose Body Liver Spleen
    Oligonucleotide mg/kg weight weight weight
    ISIS 257016 1 +11.8 −6.9 −10.1
    ISIS 257016 5 +8.4 −4.3 +4.4
    ISIS 257016 25 +5.4 −2.1 +12.5
    ISIS 351641 1 +12.3 −2.8 −2.9
    ISIS 351641 5 +9.2 −8.7 −5.5
    ISIS 351641 25 +9.4 −0.8 +3.3
    ISIS 360886 1 +9.2 −5.2 −4.5
    ISIS 360886 5 +10.3 −2.7 +15.1
    ISIS 360886 25 +9.4 −2.1 −11.4
    ISIS 360887 1 +10.0 −7.0 −1.5
    ISIS 360887 5 +12.6 −3.2 +4.0
    ISIS 360887 25 +11.8 −7.6 +14.7
  • [0294]
    No significant change was observed in total body weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0295]
    Levels of BUN, creatinine, bilirubin, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown in Tables 50-53.
    TABLE 50
    Effect of mixed backbone antisense compound ISIS 257016 on
    indicators of liver and kidney function
    Units measured per
    Normal dose of ISIS 257016
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg
    BUN 15-40  27 31 29 23
    mg/dL
    Creatinine 0.0-1.0  0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0  0.2 0.2 0.2 0.2
    AST 30-300 60 58 82 119
    IU/L
    ALT 30-200 22 27 35 66
    IU/L
    Albumin 2.5-4.0  2.7 2.8 2.7 2.6
    g/dL
    Triglycerides  25-100* 178 263 187 99
    mg/dL
    Cholesterol 70-125 123 142 138 162
    mg/dL
    Glucose  80-150* 193 201 201 185
    mg/dL
  • [0296]
    TABLE 51
    Effect of mixed backbone antisense compound ISIS 351641 on indicators
    of liver and kidney function
    Units measured per
    Normal dose of ISIS 351641
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg
    BUN 15-40 27 27 26 28
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.2 0.1 0 0.1
    AST  30-300 60 48 49 50
    IU/L
    ALT  30-200 22 23 23 20
    IU/L
    Albumin 2.5-4.0 2.7 2.8 2.8 2.7
    g/dL
    Triglycerides  25-100* 178 165 197 222
    mg/dL
    Cholesterol  70-125 123 118 120 118
    mg/dL
    Glucose  80-150* 193 192 200 197
    mg/dL
  • [0297]
    TABLE 52
    Effect of mixed backbone antisense compound ISIS 360886 on indicators
    of liver and kidney function
    Units measured per
    Normal dose of ISIS 360886
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg
    BUN 15-40 27 27 26 27
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.2 0 0.1 0.1
    AST  30-300 60 52 71 90
    IU/L
    ALT  30-200 22 23 23 29
    IU/L
    Albumin 2.5-4.0 2.7 2.8 2.8 2.8
    g/dL
    Triglycerides  25-100* 178 230 250 227
    mg/dL
    Cholesterol  70-125 123 122 129 133
    mg/dL
    Glucose  80-150* 193 187 182 185
    mg/dL
  • [0298]
    TABLE 53
    Effect of mixed backbone antisense compound ISIS 360887 on indicators
    of liver and kidney function
    Units measured per
    Normal dose of ISIS 360887
    Serum indicator Range Saline 1 mg/kg 5 mg/kg 25 mg/kg
    BUN 15-40 27 25 24 23
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.1
    mg/L
    Bilirubin mg/dL 0.1-1.0 0.2 0.2 0.2 0.2
    AST  30-300 60 60 44 92
    IU/L
    ALT  30-200 22 24 22 31
    IU/L
    Albumin 2.5-4.0 2.7 2.7 2.5 2.7
    g/dL
    Triglycerides  25-100* 178 240 262 171
    mg/dL
    Cholesterol  70-125 123 121 129 134
    mg/dL
    Glucose  80-150* 193 189 186 181
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0299]
    The levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0300]
    The results illustrated in this example demonstrate that mixed backbone compounds are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. Furthermore, the eight dose protocol resulted in greater inhibition of target mRNA levels in the kidney than observed for the four dose protocol shown in Example 22.
  • Example 24 Antisense Inhibition of SGLT2 in a Murine Model of Type 2 Diabetes Comparison of Full Phosphorothioate and Mixed Backbone Oligonucleotides
  • [0301]
    The Animal Models of Diabetic Complications Consortium (AMDCC) has developed protocols for the induction of diabetes in a number of animal models. The genetic C57BLKS/J Lepdb/Lepdb model has been approved by the AMDCC as an appropriate model system for studies of diabetic nephropathy associated with type 2 diabetes.
  • [0302]
    Leptin is a hormone produced by fat that regulates appetite. Deficiencies in this hormone in both humans and non-human animals lead to obesity. Lepdb/Lepdb mice have a mutation in the leptin receptor gene which results in obesity and hyperglycemia. As such, these mice are a useful model for the investigation of obesity and diabetes and treatments designed to treat these conditions. In accordance with the present invention, oligomeric compounds of the present invention were tested in the Lepdb/Lepdb model of type 2 diabetes.
  • [0303]
    Male Lepdb/Lepdb mice were given intraperitoneal injections of either ISIS 257016, which has a mixed backbone, or ISIS 145733, which has a phosphorothioate backbone, twice a week for four weeks at doses of 12.5, 25 or 37.5 mg/kg. Saline-injected animals served as controls. Each treatment group contained 6 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0304]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 54.
    TABLE 54
    Antisense inhibition of SGLT2 mRNA expression in db/db mice
    (expressed as percent change in SGLT2 mRNA
    expression relative to saline)
    Dose of
    oligonucleotide ISIS ISIS
    mg/kg 145733 257016
    12.5 −48 −72
    25 −71 −72
    37.5 −64 −72
  • [0305]
    These results illustrate that both mixed backbone compound ISIS 257016 and full phosphorothioate compound ISIS 145733 effectively inhibit the expression of kidney SGLT2. However, greater inhibition is observed in kidneys from mice treated with ISIS 257016, particularly at the lowest dose of 12.5 mg/kg.
  • [0306]
    Treated mice were further evaluated for body weight and liver and spleen weight. The data are expressed as weight in grams. The results are presented in Table 55.
    TABLE 55
    Effects of antisense compounds on total body weight, liver weight
    and spleen weight of db/db mice (in grams)
    Dose Body Kidney Liver Spleen
    Oligonucleotide mg/kg weight weight weight weight
    Saline 35 0.32 1.5 0.09
    ISIS 145733 12.5 34 0.32 1.9 0.12
    ISIS 145733 25 37 0.37 2.1 0.15
    ISIS 145733 37.5 38 0.35 2.3 0.14
    ISIS 257016 12.5 34 0.31 1.6 0.09
    ISIS 257016 25 36 0.31 1.7 0.08
    ISIS 257016 37.5 34 0.35 1.8 0.11
  • [0307]
    No significant change was observed in total body weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0308]
    Levels of AST, ALT, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown in Table 56 and Table 57.
    TABLE 56
    Effect of full phosphorothioate backbone compound ISIS 145733 on
    indicators of toxicity
    Units measured per
    Serum Normal dose of ISIS 145733
    indicator Range Saline 12.5 mg/kg 25 mg/kg 37.5 mg/kg
    AST 30-300  61 72 80 93
    IU/L
    ALT 30-200  63 87 101 120
    IU/L
    Triglycerides 25-100* 245 216 243 204
    mg/dL
    Cholesterol 70-125* 182 196 211 224
    mg/dL
    Glucose 80-150* 611 452 391 351
    mg/dL
  • [0309]
    TABLE 57
    Effect of mixed backbone antisense compound ISIS 257016 on
    indicators of toxicity
    Units measured per
    Serum Normal dose of ISIS 257016
    indicator Range Saline 12.5 mg/kg 25 mg/kg 37.5 mg/kg
    AST 30-300  61 120 144 175
    IU/L
    ALT 30-200  63 123 142 154
    IU/L
    Triglycerides 25-100* 245 167 188 183
    mg/dL
    Cholesterol 70-125* 182 248 264 265
    mg/dL
    Glucose 80-150* 611 281 320 326
    mg/dL

    *Triglyceride, cholesterol and glucose levels are routinely higher in the Lepdb/Lepdb strain of mice than in other strains of mice.
  • [0310]
    The levels of routine clinical indicators of liver injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect hepatic function. Given the genetic defect of the Lepdb/Lepdb mice and the diabetic phenotype exhibited by these mice, it is expected that triglyceride, cholesterol and glucose levels will exceed the normal range. Importantly, treatment with either of the SGLT2 antisense compounds resulted in a significant decrease in blood glucose levels, with ISIS 25016, the mixed backbone compound, achieving greater levels of target mRNA inhibition. Treatment with ISIS 257016 also resulted in a significant decrease in serum triglyceride levels.
  • [0311]
    The results illustrated in this example demonstrate that mixed backbone compounds are effectively delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or other toxicity. Furthermore, these results indicate that mixed backbone compounds targeted to SGLT2 efficiently decrease blood glucose levels and serum triglyceride levels in a mouse model of type 2 diabetes.
  • Example 25 Antisense Inhibition of SGLT2 in a Murine Model of Type 2 Diabetes Low Dose Comparison of Full Phosphorothioate and Mixed Backbone Oligonucleotides
  • [0312]
    Since treatment with ISIS 257016 resulted in significant reduction in SGLT2 expression levels even at the lowest dose of 12.5 mg/kg, a second dose-response study was conducted using a lower dose range of 1.56, 3.12 and 6.25 mg/kg. Male Lepdb/Lepdb mice were given intraperitoneal injections of either mixed backbone compound ISIS 257016 or full phosphorothioate compound ISIS 145733 twice a week for four weeks at doses of 1.56, 3.12 or 6.25 mg/kg. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0313]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 58.
    TABLE 58
    Antisense inhibition of SGLT2 mRNA expression in db/db mice
    (expressed as percent change in SGLT2 mRNA expression
    relative to saline)
    Dose of
    oligonucleotide ISIS ISIS
    mg/kg 145733 257016
    1.56 −13 −75
    3.12 −14 −83
    6.25 −12 −80
  • [0314]
    These results illustrate that mixed backbone compound ISIS 257016 is a more effective inhibitor of SGLT2 mRNA expression in the kidney, particularly at low doses of oligonucleotide.
  • [0315]
    Levels of glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 59.
    TABLE 59
    Blood glucose levels in db/db mice treated with SGLT2 antisense
    compounds (expressed as percent change in blood glucose
    relative to saline)
    Dose of
    oligonucleotide ISIS ISIS
    mg/kg 145733 257016
    1.56 −5 −41
    3.12 −7 −37
    6.25 −14 −40
  • [0316]
    The results demonstrate that treatment with mixed backbone compound ISIS 257016 results in a significant decrease in blood glucose levels and that mixed backbone compounds are more effective at lowering blood glucose levels than full phosphorothioate antisense compounds.
  • [0317]
    Antisense inhibition of SGLT2 by ISIS 257016 was further evaluated using a dose range of 0.39, 0.78 and 1.56 mg/kg. As described above, male Lepdb/Lepdb mice were given intraperitoneal injections of mixed backbone compound ISIS 257016 twice a week for four weeks. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0318]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. Blood glucose levels also were determined. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 60.
    TABLE 60
    Antisense inhibition of SGLT2 mRNA expression and blood glucose
    levels in db/db mice (expressed as percent change in SGLT2 mRNA
    expression or blood glucose levels relative to saline)
    Dose of
    oligonucleotide SGLT2 Blood
    mg/kg mRNA glucose
    0.39 −66 −16
    0.78 −68 −21
    1.56 −82 −21
  • [0319]
    These results further demonstrate the effectiveness of mixed backbone compounds at inhibiting SGLT2 expression in the kidney and lowering blood glucose levels when administered at very low doses of oligonucleotide.
  • [0320]
    Mice treated with the compounds of the invention also were evaluated for liver and kidney toxicity, organ and body weights and tissue histology. These studies demonstrated no significant level of toxicity or change in body or organ weight, indicating that mixed backbone compounds are effective in vivo without toxicity to the animal.
  • [0321]
    The results illustrated in this example demonstrate that mixed backbone compounds are effectively delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds lowers blood glucose levels in diabetic animals.
  • Example 26 Antisense Inhibition of SGLT2 in a Murine Model of Obesity and Diabetes Using Mixed Backbone Compounds
  • [0322]
    Leptin is a hormone produced by fat that regulates appetite. Deficiencies in this hormone in both humans and non-human animals leads to obesity. C57Bl/6J-Lep ob/ob mice have a mutation in the leptin gene which results in obesity and hyperglycemia. As such, these mice are a useful model for the investigation of obesity and diabetes and treatments designed to treat these conditions. In accordance with the present invention, the oligomeric compounds of the invention were tested in the ob/ob model of obesity and diabetes.
  • [0323]
    Male C57Bl/6J-Lep ob/ob mice (Jackson Laboratory, Bar Harbor, Me.) were subcutaneously injected with ISIS 257016 at a dose of 25 mg/kg two times per week for 4 weeks. Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0324]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to cyclophilin. Blood glucose levels also were determined. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 61.
    TABLE 61
    Antisense inhibition of SGLT2 mRNA expression and blood glucose
    levels in db/db mice (expressed as percent change in SGLT2 mRNA
    expression or blood glucose levels relative to saline)
    Dose of
    oligonucleotide SGLT2 Blood
    mg/kg mRNA glucose
    25 −83 −39
  • [0325]
    The results demonstrate that treatment with a mixed backbone SGLT2 antisense compound results in a significant decrease in SGLT2 mRNA expression in the kidney of diabetic mice. Importantly, blood glucose levels also are significantly decreased in treated animals.
  • Example 27 Comparison of Mixed Backbone Compounds 16 to 20 Nucleobases in Length
  • [0326]
    In accordance with the present invention, mixed backbone compounds with less than 20 nucleobases were evaluated for their ability to inhibit SGLT2 expression in the kidney. Four compounds were synthesized based on the sequence of ISIS 257016 (SEQ ID NO: 4). ISIS 366847, ISIS 366848, ISIS 366849 and ISIS 366850 are comprised of the 5′-most 19, 18, 17 and 16 nucleobases, respectively, of ISIS 257016. ISIS 257016 has 2′-MOE wings of five nucleobases each and a deoxy gap of 10 nucleobases. ISIS 366847, ISIS 366848, ISIS 366849 and ISIS 366850 have a 10 nucleobases gap, a five nucleobase 2′-MOE wing at the 5′ end, but contain a shortened 3′ wing of 1 to 4 nucleobases.
  • [0327]
    Male 6-week old Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given intraperitoneal injections of ISIS 257016, ISIS 366847, ISIS 366848, ISIS 366849 or ISIS 366850 twice a week for two weeks at doses of 0.14, 0.7 or 3.5 micromoles per kilogram (μM/kg). Saline-injected animals served as controls. Each treatment group contained 4 mice. The mice were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0328]
    Mice were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 62.
    TABLE 62
    Antisense inhibition of SGLT2 mRNA expression in vivo by mixed
    backbone oligonucleotides (expressed as percent change relative
    to saline control)
    Dose of
    oligonucleotide ISIS ISIS ISIS ISIS ISIS
    μM/kg 257016 366847 366848 366849 366850
    0.14 −53 −55 −58 −57 −49
    0.7 −56 −63 −59 −61 −57
    3.5 −70 −64 −72 −69 −69
  • [0329]
    These results illustrate that mixed backbone compounds of the invention, containing 16 to 20 nucleobases, are effective inhibitors of SGLT2 expression in the kidney.
  • [0330]
    Treated mice were further evaluated for body weight, kidney weight, liver weight and spleen weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 63.
    TABLE 63
    Effects of antisense compounds on total body weight, kidney weight, liver
    weight and spleen weight of mice (expressed as percent change in weight)
    Dose Body Kidney Liver Spleen
    Oligonucleotide □M/kg weight weight weight weight
    ISIS 257016 0.14 +9.0 −4.5 −6.1 −8.3
    ISIS 257016 0.7 +11.1 −5.3 +4.1 −3.7
    ISIS 257016 3.5 +10.2 −3.6 +3.7 +11.9
    ISIS 366847 0.14 +15.0 −0.5 +0.2 −6.9
    ISIS 366847 0.7 +12.7 +1.2 +6.8 −4.9
    ISIS 366847 3.5 +10.3 +3.6 +3.8 +2.9
    ISIS 366848 0.17 +8.5 −7.1 −7.9 −2.4
    ISIS 366848 0.7 +7.7 +6.4 +5.9 +3.8
    ISIS 366848 3.5 +10.8 +3.0 +4.6 +9.3
    ISIS 366849 0.14 +6.9 −3.3 −2.6 −7.2
    ISIS 366849 0.7 +7.4 +0.1 −4.3 −2.2
    ISIS 366849 3.5 +8.4 −2.9 −5.2 −3.9
    ISIS 366850 0.14 +11.1 −3.8 −4.6 +2.0
    ISIS 366850 0.7 +4.8 −0.8 −1.7 +0.9
    ISIS 366850 3.5 11.2 −6.0 +4.5 +9.8
  • [0331]
    No significant change was observed in total body weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0332]
    Levels of BUN, creatinine, bilirubin, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in mice treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown in Tables 64-68.
    TABLE 64
    Effect of mixed backbone antisense compound ISIS 257016 on
    indicators of liver and kidney function
    Units measured per
    Serum Normal dose of ISIS 257016
    indicator Range Saline 0.14 μM/kg 0.7 μM/kg 3.5 μM/kg
    BUN 15-40 31 32 32 31
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin 0.1-1.0 0.2 0.1 0.1 0.1
    mg/dL
    AST  30-300 82 68 85 117
    IU/L
    ALT  30-200 22 24 26 32
    IU/L
    Albumin 2.5-4.0 3.0 3.2 3.1 3.1
    g/dL
    Triglycerides  25-100* 225 266 308 225
    mg/dL
    Cholesterol  70-125 123 128 128 147
    mg/dL
    Glucose  80-150* 181 195 187 183
    mg/dL
  • [0333]
    TABLE 65
    Effect of mixed backbone antisense compound ISIS 366847 on
    indicators of liver and kidney function
    Units measured per
    Serum Normal dose of ISIS 366847
    indicator Range Saline 0.14 μM/kg 0.7 μM/kg 3.5 μM/kg
    BUN 15-40 31 29 32 29
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin 0.1-1.0 0.2 0.1 0 0.1
    mg/dL
    AST  30-300 82 53 69 131
    IU/L
    ALT  30-200 22 23 28 50
    IU/L
    Albumin 2.5-4.0 3.0 3.1 3.2 3.0
    g/dL
    Triglycerides  25-100* 225 289 308 184
    mg/dL
    Cholesterol  70-125 123 122 132 145
    mg/dL
    Glucose  80-150* 181 173 193 181
    mg/dL
  • [0334]
    TABLE 66
    Effect of mixed backbone antisense compound ISIS 366848
    on indicators of liver and kidney function
    Units measured per
    Serum Normal dose of ISIS 366848
    indicator Range Saline 0.14 μM/kg 0.7 μM/kg 3.5 μM/kg
    BUN 15-40 31 31 29 32
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin 0.1-1.0 0.2 0.1 0.1 0.1
    mg/dL
    AST  30-300 82 82 105 123
    IU/L
    ALT  30-200 22 23 34 46
    IU/L
    Albumin 2.5-4.0 3.0 3.1 3.1 3.0
    g/dL
    Triglycerides  25-100* 225 320 374 246
    mg/dL
    Cholesterol  70-125 123 132 142 147
    mg/dL
    Glucose  80-150* 181 200 187 190
    mg/dL
  • [0335]
    TABLE 67
    Effect of mixed backbone antisense compound ISIS 366849
    on indicators of liver and kidney function
    Units measured per
    Serum Normal dose of ISIS 366849
    indicator Range Saline 0.14 μM/kg 0.7 μM/kg 3.5 μM/kg
    BUN 15-40 31 25 30 33
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin 0.1-1.0 0.2 0.1 0.1 0.1
    mg/dL
    AST  30-300 82 98 90 92
    IU/L
    ALT  30-200 22 26 24 33
    IU/L
    Albumin 2.5-4.0 3.0 3.0 3.0 3.0
    g/dL
    Triglycerides  25-100* 225 354 308 240
    mg/dL
    Cholesterol  70-125 123 133 129 150
    mg/dL
    Glucose  80-150* 181 170 173 192
    mg/dL
  • [0336]
    TABLE 68
    Effect of mixed backbone antisense compound ISIS 366850
    on indicators of liver and kidney function
    Units measured per
    Serum Normal dose of ISIS 366850
    indicator Range Saline 0.14 μM/kg 0.7 μM/kg 3.5 μM/kg
    BUN 15-40 31 26 25 23
    mg/dL
    Creatinine 0.0-1.0 0.2 0.2 0.2 0.2
    mg/L
    Bilirubin 0.1-1.0 0.2 0.1 0.1 0
    mg/dL
    AST  30-300 82 83 69 108
    IU/L
    ALT  30-200 22 21 27 38
    IU/L
    Albumin 2.5-4.0 3.0 3.0 3.0 3.0
    g/dL
    Triglycerides  25-100* 225 320 380 271
    mg/dL
    Cholesterol  70-125 123 127 131 164
    mg/dL
    Glucose  80-150* 181 192 187 179
    mg/dL

    *Triglyceride and glucose levels are routinely higher in the Balb/c strain of mice than in other strains of mice.
  • [0337]
    Some oligonucleotide treated animals exhibited elevated levels of cholesterol; however, saline control animals also demonstrated cholesterol levels at the high end of the normal range. Thus, the slightly elevated cholesterol levels do not appear to be significant. Otherwise, the levels of routine clinical indicators of liver and kidney injury and disease are within normal ranges and are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function. Triglyceride and glucose levels, while outside the normal range as is common in the Balb/c strain, are not significantly elevated relative to saline-treated animals.
  • [0338]
    The results illustrated in this example demonstrate that mixed backbone compounds of 16 to 20 nucleobases are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity.
  • Example 28 Antisense Inhibition of SGLT2 in Sprague Dawley Rats
  • [0339]
    In accordance with the present invention, 7-week old Sprague Dawley rats (purchased from Charles River Labs, Wilmington, Mass.) were treated with SGLT2 mixed backbone compound ISIS 257016 (SEQ ID NO: 4) or SGLT2 full phosphorothioate compound ISIS 145733 (SEQ ID NO: 4). Rats were injected i.p. twice a week for three weeks with 10 mg/kg of oligonucleotide. Saline-injected animals served as controls. The rats were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0340]
    Rats were evaluated for SGLT2 levels in kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 69.
    TABLE 69
    Antisense inhibition of SGLT2 mRNA expression in Sprague Dawley
    rats (expressed as percent change in SGLT2 mRNA expression
    relative to saline)
    % Change
    Treatment in mRNA
    Saline 0
    ISIS 257016 −83.9
    ISIS 145733 −38.5
  • [0341]
    These results illustrate that both full phosphorothioate and mixed backbone compounds inhibit SGLT2 expression in the kidney of rats. However, the mixed backbone compound is a more effective inhibitor of SGLT2.
  • [0342]
    Treated rats were further evaluated for body weight, kidney weight, liver weight and spleen weight. For body weight, the data are expressed as percent change in body weight (“+” indicates an increase, “−” indicates a decrease). For organ weights, the results are expressed as percent of saline control normalized to body weight. The results are presented in Table 70 and Table 71.
    TABLE 70
    Effects of antisense compounds on total body weight of rats (expressed
    as percent change in weight)
    Body
    Treatment weight
    Saline +60.7
    ISIS 257016 −58.4
    ISIS 145733 +57.1
  • [0343]
    TABLE 71
    Effects of antisense compounds on total kidney weight, liver weight and
    spleen weight of rats (expressed as percent of saline control normalized
    to body weight)
    Kidney Liver Spleen
    Treatment weight weight weight
    ISIS 257016 99.3 93.4 105.8
    ISIS 145733 107.2 105.2 123.4
  • [0344]
    No significant change was observed in total body weight, kidney weight, liver weight or spleen weight at timepoints throughout or at the termination of the study.
  • [0345]
    Levels of BUN, creatinine, bilirubin, AST, ALT, albumin, triglycerides, cholesterol and glucose were measured in rats treated with the compounds of the invention. Plasma samples were analyzed using the Olympus AU400e automated chemistry analyzer (Olympus America, Irving, Tex.). The results, expressed as units measured, are shown in Table 72.
    TABLE 72
    Effect of mixed backbone antisense compound ISIS 257016 and
    full phosphorothioate compound ISIS 145733 on indicators of liver
    and kidney function (expressed as units measured)
    ISIS ISIS
    Serum Indicator Saline 257016 145733
    BUN 19 19 17
    mg/dL
    Creatinine 0.3 0.4 0.2
    mg/L
    Bilirubin mg/dL 0.1 0.1 0.1
    AST 157 105 105
    IU/L
    ALT 65 44 36
    IU/L
    Albumin 3.7 3.8 3.6
    g/dL
    Triglycerides 42 47 53
    mg/dL
    Cholesterol 68 66 54
    mg/dL
    Glucose 189 173 180
    mg/dL
  • [0346]
    The levels of routine clinical indicators of liver and kidney injury and disease are not significantly changed relative to saline-treated animals, demonstrating that the compounds of the invention do not significantly affect renal or hepatic function in rats.
  • [0347]
    The results illustrated in this example demonstrate that both full phosphorothioate and mixed backbone compounds are delivered to the kidney, reduce SGLT2 expression in vivo, and that treatment with these compounds does not result in liver or kidney toxicity. The results further indicate that mixed backbone compounds are more effective inhibitors of SGLT2 expression in vivo.
  • Example 29 Antisense Inhibition of Connective Tissue Growth Factor in a Murine Model of Type 2 Diabetes Comparison of Full Phosphorothioate and Mixed Backbone Oligonucleotides
  • [0348]
    Three month old C57BLKS/J Lepdb/Lepdb and age-matched control C57BLKS/J mice were treated twice a week for six weeks with control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC; SEQ ID NO: 18), or CTGF antisense oligonucleotides ISIS 124212 (CCACAAGCTGTCCAGTCTAA; SEQ ID NO: 19) or ISIS 334157 (CCACAAGCTGTCCAGTCTAA; SEQ ID NO: 19). ISIS 124212, ISIS 334517 and ISIS 141923 are chimeric oligonucleotides (“gapmers”) 20 nucleotides in length, composed of a central “gap” region consisting of ten 2′-deoxynucleotides, which is flanked on both sides (5′ and 3′ directions) by five-nucleotide “wings”. The wings are composed of 2′-methoxyethyl (2′-MOE) nucleotides. ISIS 124212 and ISIS 141923 have phosphorothioate (P═S) internucleoside (backbone) linkages throughout the oligonucleotide. ISIS 334517 has a mixed backbone with phosphorothioate linkages in the central gap region and phosphodiester linkages in the wings. All cytidine residues in each oligonucleotide are 5-methylcytidines.
  • [0349]
    Oligonucleotides were delivered subcutaneously at a dose of 10 mg/kg or 25 mg/kg. Saline-injected animals served as controls. Blood and urine chemistries were analyzed prior to treatment, at three weeks, and post-treatment.
  • [0350]
    After the treatment period, mice are sacrificed and CTGF mRNA levels were evaluated in the kidney. Target levels were determined by quantitative real-time PCR as described in other examples herein. For mouse CTGF, the PCR primers were:
    Forward primer:
    GCTCAGGGTAAGGTCCGATTC (SEQ ID NO: 26)
    Reverse primer:
    GCCCCCCACCCCAAA (SEQ ID NO: 27)
  • [0351]
    The PCR probe was: FAM-TCATAATCAAAGAAGCAGCAAGCACTTCC-TAMRA (SEQ ID NO: 28), where FAM is the fluorescent dye and TAMRA is the quencher dye. The results are illustrated in Table 73.
    TABLE 73
    Antisense inhibition of CTGF mRNA in Lepdb/Lepdb kidney (shown
    as percent of saline-injected control mice)
    Percent expression of
    CTGF mRNA after
    treatment with
    oligonucleotide at the
    concentrations shown:
    Oligonucleotide Saline 10 mg/kg 25 mg/kg
    141923 100 82
    124212 100 110 71
    334157 100  83 53
  • [0352]
    Treatment with ISIS 334157 resulted in a significant decrease in CTGF expression at a dose of 25 mg/kg. ISIS 124212 also inhibited expression CTGF at the same dose. These results demonstrate that mixed backbone compounds inhibit expression of target mRNA in the kidney.
  • [0353]
    To assess distribution of CTGF antisense oligonucleotides in Lepdb/Lepdb kidney, 2E1 staining was performed as described in other examples herein. The results demonstrated that ISIS 124212 and ISIS 334157 exhibit a similar pattern of distribution in the inner and outer cortex.
  • [0354]
    To evaluate whether antisense inhibition of CTGF using mixed backbone compounds alters the development of diabetic nephropathy, levels of collagen 1A and collagen IV (□2) were determined. Collagen synthesis is a prerequisite for the development of kidney fibrosis characteristic of diabetic nephorpathy. Collagen 1A and collagen IV (□2) target mRNA levels were determined by quantitative real-time PCR as described by other examples herein.
  • [0355]
    Probes and primers to mouse collagen 1A and collagen IV (□2) were designed to hybridize to mouse collagen 1A and collagen IV (□2) sequences using published sequence information. For mouse collagen 1A, the PCR primers were:
    Forward primer:
    TGGATTCCCGTTCGAGTACG (SEQ ID NO: 20)
    Reverse primer:
    TCAGCTGGATAGCGACATCG (SEQ ID NO: 21)

    The PCR probe was: FAM-AAGCGAGGGCTCCGACCCGA-TAMRA (SEQ ID NO: 22) FAM is the fluorescent dye and TAMRA is the quencher dye.
  • [0356]
    For mouse collagen IV, the PCR primers were:
    Forward primer:
    AGACCAACAAGCAAGTGAGTGC (SEQ ID NO: 23)
    Reverse primer:
    CTAGCATGTGAGCCACATTCATCC (SEQ ID NO: 24)
  • [0357]
    The PCR probe was: FAM-CTGCTGAGGGCACGCTGAGCT-TAMRA (SEQ ID NO: 25) FAM is the fluorescent dye and TAMRA is the quencher dye.
    TABLE 74
    Inhibition of collagen 1A mRNA expression in Lepdb/Lepdb mice
    treated with CTGF antisense oligonucleotide (shown as percent of
    saline-injected control mice)
    Percent expression
    of collagen 1A mRNA
    after treatment
    with CTGF antisense
    oligonucleotide at the
    concentrations shown:
    Oligonucleotide Saline 10 mg/kg 25 mg/kg
    141923 100 145
    124212 100 60 65
    334157 100 78 75
  • [0358]
    TABLE 75
    Inhibition of collagen IV mRNA expression in Lepdb/Lepdb mice
    treated with CTGF antisense oligonucleotide (shown as percent of
    saline-injected control mice)
    Percent expression of collagen
    IV mRNA after treatment
    with CTGF antisense
    oligonucleotide
    at the concentrations shown:
    Oligonucleotide Saline 10 mg/kg 25 mg/kg
    141923 100 72
    124212 100 50 40
    334157 100 37 24
  • [0359]
    Treatment with either ISIS 124212 or ISIS 334157 led to a significant reduction in mRNA expression of both collagen 1A and collagen IV in Lepdb/Lepdb mice, relative to both saline-injected control mice and mice treated with control oligonucleotide. These results indicate that treatment with CTGF antisense oligonucleotides, including mixed backbone compounds, inhibits development of nephropathy associated with type 2 diabetes.
  • [0360]
    Toxic effects of compounds administered in vivo can be assessed by measuring the levels of enzymes and proteins associated with disease or injury of the liver or kidney. Elevations in the levels of the serum transaminases aspartate aminotransferase (AST) and alanine aminotransferase (ALT) are often indicators of liver disease or injury. To assess the physiological effects resulting from inhibition of target mRNA, the Lepdb/Lepdb mice were further evaluated at the end of the treatment period for AST and ALT. Serum was analyzed by LabCorp Testing Facility (San Diego, Calif.). The levels of AST and ALT were within normal ranges and were not significantly changed relative to saline-treated animals, demonstrating that the mixed backbone and full phosphorothioate antisense compounds of the invention do not significantly affect hepatic function.
  • [0361]
    These results illustrate that both full phosphorothioate backbone and mixed backbone compounds are effectively delivered to the kidney, reduce CTGF expression in vivo without toxicity and that these compounds inhibit the development of diabetic nephropathy in diabetic animals.
  • Example 30 Design of Chemically Modified Antisense Compounds for Optimized Kidney Targeting
  • [0362]
    A series of chemically modified antisense compounds were designed using the sequence of ISIS 116847 (SEQ ID NO: 29), ISIS 331424 (SEQ ID NO: 30), ISIS 342351 (SEQ ID NO: 31), ISIS 331425 (SEQ ID NO: 32), or ISIS 335252 (SEQ ID NO: 33). Modifications were made to the internucleoside linkages such that the oligonucleotides consisted of either full phosphorothioate backbones or mixed phosphorothioate and phosphodiester backbones (mixed backbone compounds). Modified antisense compounds also contained sugar moiety substitutions at the 2′ position, comprising a 2′-methoxyethyl (2′-MOE). Some of the oligonucleotides contain further modifications including nucleobase substitutions, wherein the unmodified cytosine nucleobase was used in place of the modified 5-methylcytosine at one position in the antisense compound. The compounds are shown in Table 1.
  • [0363]
    ISIS 116847 (SEQ ID NO: 29) is chimeric oligonucleotides having 2′-MOE wings and a deoxy gap with phosphorothioate linkages throughout the oligonucleotide. ISIS 33525 (SEQ ID NO: 33) is a chimeric oligonucleotide having 2′-MOE wings and a deoxy gap, with phosphodiester linkages in the wings and phosphorothioate linkages in the gap.
    TABLE 76
    Chemical modifications of antisense compounds
    targeting PTEN
    SEQ ID
    ISIS # Sequence NO
    116847 CsTsGsCsTs agcctctgga sTsTsTsGsA 29
    331424 CsTsGsCsTs agcctoctgga sTsTsTsGsA 30
    342351 CsTsGoCsTs agcctctgga sTsToTsGsA 31
    331425 CsToGsCoTs agcctctgga sToTsToGsA 32
    335252 CoToGoCoTs agcctctgga sToToToGoA 33
  • Example 31 Comparison of a Standard Phosphorothioate Compound and a Mixed Backbone Compound with Phosphodiester Linkages Inserted in the Gap and Wings A Single Dose Study
  • [0364]
    In accordance with the present invention, ISIS 116847, ISIS 331424, ISIS 331425, and ISIS 335252 were analyzed for their ability to inhibit PTEN expression in vivo.
  • [0365]
    Male Balb/c mice (Charles River Laboratories, Wilmington, Mass.) were given single intrapertoneal injections of ISIS 116847, ISIS 331424, ISIS 331425, or ISIS 335252 at a dose of 25 mg/kg twice per week for two weeks. Saline-injected animals served as controls. The mice were sacrificed 2 days following administration of the fourth and final dose of oligonucleotide or saline.
  • [0366]
    Mice were evaluated for PTEN mRNA levels in liver, kidney and fat tissues. Target levels were determined by quantitative real-time PCR as described by other examples herein. PCR results were normalized to the ubiquitously expressed mouse cyclophilin A gene.
  • [0367]
    The data are expressed as percent change (“−” indicates a decrease) relative to saline treated animals and are shown in Table 2.
    TABLE 77
    Antisense inhibition of PTEN mRNA expression in vivo by modified
    PTEN antisense compounds in liver
    Percent change in PTEN expression
    relative to saline, p < 0.05
    ISIS ISIS ISIS ISIS
    116847 331424 331425 335252
    −80 −38 −65 −43
  • [0368]
    These data illustrate that antisense compounds of different chemistries inhibit the expression of PTEN mRNA in mouse liver. Greatest inhibition of PTEN is observed in livers from mice treated with ISIS 116847 and ISIS 331425, which are mixed backbone antisense compounds.
    TABLE 78
    Antisense inhibition of PTEN mRNA expression in vivo by modified
    PTEN antisense compounds in fat tissues
    Percent change in PTEN expression
    relative to saline, p < 0.05
    ISIS ISIS ISIS ISIS
    116847 331424 331425 335252
    −39 −10 −45 −30
  • [0369]
    These data illustrate that antisense compounds of different chemistries inhibit the expression of PTEN mRNA in mouse fat tissues. Greatest inhibition of PTEN is observed in livers from mice treated with ISIS 331425 and ISIS 116847, which are mixed backbone antisense compounds.
  • [0370]
    Mice were further evaluated for total body weight, liver weight and spleen weight. Significant changes in spleen, liver or body weight. The data are expressed as percent change in body or organ weight (“+” indicates an increase, “−” indicates a decrease). The results are presented in Table 79.
    TABLE 79
    Effects of antisense compounds on liver weight and spleen weight in mice
    Percent change in weight
    ISIS ISIS ISIS ISIS
    116847 331424 331425 335252
    25 5 25 5 25 5 5
    mg/kg mg/kg mg/kg mg/kg mg/kg mg/kg 25 mg/kg mg/kg
    Liver +28 +9 +10 +7 +5 −10 +5 −9
    Spleen +12 −2 +8 +9 +6 −12 −2 0
  • [0371]
    All changes in organ weight were within the margin of error of the experiment. No significant change was observed in liver weight or spleen weight at timepoints throughout or at the termination of the study.
    TABLE 80
    Biodistribution of compounds in mice
    Accumulation of different ASOs in tissues
    ug ASO/g tissue
    ISIS ISIS ISIS ISIS
    116847 331424 331425 335252
    Liver 102 38 65 3
    Kidney 90 80 100 5
    Fat 19 18 18 0
  • Example 32 Antisense Inhibition of PTEN in rats
  • [0372]
    In accordance with the present invention, male Sprague Dawley rats (purchased from Charles River Labs, Wilmington, Mass.) were treated with PTEN mixed backbone compound ISIS 116847 (SEQ ID NO: 29). Rats were given intraperitoneal injections twice a week for four weeks with 30 mg/kg of oligonucleotide. Saline-injected animals served as controls. The rats were sacrificed 2 days following administration of the final dose of oligonucleotide or saline.
  • [0373]
    Rats were evaluated for PTEN levels in liver and adipose tissue. Target levels were determined by quantitative real-time PCR as described in other examples herein. PCR results were normalized to cyclophilin. The data are expressed as percent change relative to saline treated animals (“+” indicates an increase, “−” indicates a decrease) and are illustrated in Table 80.
    TABLE 81
    Antisense inhibition of PTEN mRNA expression in Sprague Dawley
    rats (expressed as percent change in PTEN mRNA expression
    relative to saline)
    % Change in
    % Change in mRNA mRNA in adipose
    Treatment in liver tissue
    Saline 0 0
    ISIS 116847 −46 −33
    ISIS 342351 −88 −43
    ISIS 331425 −65 −47
  • [0374]
    These results illustrate that both full phosphorothioate and mixed backbone compounds inhibit PTEN expression in both the liver and adipose tissue of rats. However, the mixed backbone compounds are more effective inhibitor of PTEN.
  • [0375]
    Rats were further evaluated for metabolites in kidney. Rats were given intraperitoneal injections twice a week for four weeks with 30 mg/kg of oligonucleotide. The rats were sacrificed one day following administration of the final dose of oligonucleotide. The results are presented in Table 81.
    TABLE 82
    Effects of antisense compounds on metabolites in kidney
    Parent Oligonucleotide Total Oligonucleotide
    Concentrations (μg/g) Concentrations (μg/g) % FL
    ISIS 116847 1100 1400 68
    ISIS 342351 2100 2900 67
    ISIS 331425 1200 1800 66
  • [0376]
    The percent FL (parent oligonucleotide concentrations/total oligonucleotide concentrations) for all of the oligonucleotides are in similar extent.
  • [0377]
    A comparison experiment was conducted to study the total oligonucleotide concentrations of several modifications to an antisense oligonucleotide modulating PTEN in rats. Rats were given intraperitoneal injections twice a week for four weeks with 30 mg/kg of oligonucleotide. The rats were sacrificed one day following administration of the final dose of oligonucleotide. The results are presented in Table 82.
    TABLE 83
    Effects of antisense compounds on total oligonucleotide
    concentration of rats
    Total
    Oligonucleotide
    Concentrations
    (μg/g)
    Kidney Liver
    ISIS 116847 1450 900
    ISIS 342351 1750 600
    ISIS 331425 2950 500
  • [0378]
    Rats were also evaluated for the percentage of plasma protein binding. A concentration of 2 μM antisense oligonucleotides was used in rat plasma. The results are presented in Table 83.
    TABLE 84
    Effects of antisense compounds on plasma protein binding in rats
    Rat plasma protein binding
    (% bound)
    ISIS 116847 97.1 ± 0.2
    ISIS 342351 96.6 ± 0.1
    ISIS 331425 95.5 ± 0.3
    ISIS 335352 88.8 ± 2.0
  • [0379]
    All of the cited references including patents and patent applications, as well as Genbank numbers, are herein incorporated by reference in their entirety.
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US6284538 *May 24, 2000Sep 4, 2001Isis Pharmaceuticals, Inc.Antisense inhibition of PTEN expression
US6965025 *Dec 10, 2001Nov 15, 2005Isis Pharmaceuticals, Inc.Antisense modulation of connective tissue growth factor expression
US7507810 *Oct 11, 2006Mar 24, 2009Isis Pharmaceuticals, Inc.Compositions and their uses directed to IL-4R alpha
US20020137708 *Jul 30, 2001Sep 26, 2002Bennett C. FrankAntisense modulation of survivin expression
US20050032693 *Mar 26, 2004Feb 10, 2005Genentech, Inc.Novel polypeptides, their nucleic acids, and methods for their use in angiogenesis and vascularization
US20050130923 *Sep 20, 2004Jun 16, 2005Balkrishen Bhat4'-thionucleosides and oligomeric compounds
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US8084436Dec 27, 2011Isis Pharmaceuticals, Inc.Modulation of SGLT2 expression
US8143230May 7, 2007Mar 27, 2012Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of PCSK9
US8188059May 7, 2007May 29, 2012Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of GCGR
US8252762Aug 25, 2009Aug 28, 2012Excaliard Pharmaceuticals, Inc.Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
US8258105Sep 4, 2012Isis Pharmaceuticals, Inc.Antisense oligonucleotides optimized for kidney targeting
US8372967May 7, 2007Feb 12, 2013Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of GCCR
US8673871May 7, 2007Mar 18, 2014Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression ApoB
US8772260Aug 13, 2012Jul 8, 2014Isis Pharmaceuticals, IncMethods for inhibiting expression of connective tissue growth factor
US8946172Aug 26, 2009Feb 3, 2015Excaliard Pharmaceuticals, Inc.Method for reducing scarring during wound healing using antisense compounds directed to CTGF
US8969316Oct 26, 2012Mar 3, 2015Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of DGAT2
US9045754May 7, 2007Jun 2, 2015Isis Pharmaceuticals, Inc.Short antisense compounds with gapmer configuration
US9096851Jun 25, 2012Aug 4, 2015Excaliard Pharmaceuticals, Inc.Antisense oligonucleotides directed against connective tissue growth factor and uses thereof
US9150864 *Nov 8, 2011Oct 6, 2015Isis Pharmaceuticals, Inc.Methods for modulating factor 12 expression
US9173894Feb 2, 2012Nov 3, 2015Excaliard Pharamaceuticals, Inc.Method of treating keloids or hypertrophic scars using antisense compounds targeting connective tissue growth factor (CTGF)
US20050191653 *Nov 2, 2004Sep 1, 2005Freier Susan M.Modulation of SGLT2 expression
US20100130595 *Aug 25, 2009May 27, 2010Dean Nicholas MAntisense oligonucleotides directed against connective tissue growth factor and uses thereof
US20100324122 *Jun 24, 2008Dec 23, 2010Isis Pharmaceuticals, Inc.Modulation of sglt2 expression
US20130331434 *Nov 8, 2011Dec 12, 2013Isis Pharmaceuticals, Inc.Methods for modulating factor 12 expression
US20160138014 *Oct 11, 2013May 19, 2016Isis Pharmaceuticals, Inc.Antisense compounds and uses thereof
WO2007143316A3 *May 7, 2007Jun 26, 2008Isis Pharmaceutical IncCompounds and methods for modulating expression of sglt2
WO2015027652A1 *Dec 31, 2013Mar 5, 2015Kindee(Su Zhou)Medical Technology Ltd.A novel antidiabetic drug
Classifications
U.S. Classification514/44.00A, 536/23.1
International ClassificationC12Q1/68, C07H21/04, C07H, A61K48/00, C07H21/02, C07H21/00, A61P3/00, A61P3/10, A61K31/7088, A61K31/70, C12N15/11, C12N15/113
Cooperative ClassificationC07H21/02, C12N15/111, C12N2310/11, C12N2310/321, C07H21/04, C12N2310/3341, C12N2310/341, C12N2310/315, C12N2310/346, A61K31/70, C12N15/1136, C12N15/1138, C12N2500/40, C12N2320/32
European ClassificationC07H21/04, C12N15/11M, A61K31/70, C12N15/113E, C12N15/113C
Legal Events
DateCodeEventDescription
Apr 26, 2007ASAssignment
Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SIWKOWSKI, ANDREW M.;WANCEWICZ, EDWARD;LEEDOM, THOMAS A.;AND OTHERS;REEL/FRAME:019218/0592;SIGNING DATES FROM 20070414 TO 20070426
Owner name: ISIS PHARMACEUTICALS, INC., CALIFORNIA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SIWKOWSKI, ANDREW M.;WANCEWICZ, EDWARD;LEEDOM, THOMAS A.;AND OTHERS;SIGNING DATES FROM 20070414 TO 20070426;REEL/FRAME:019218/0592