Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS5432272 A
Publication typeGrant
Application numberUS 07/594,290
Publication dateJul 11, 1995
Filing dateOct 9, 1990
Priority dateOct 9, 1990
Fee statusPaid
Also published asUS6001983
Publication number07594290, 594290, US 5432272 A, US 5432272A, US-A-5432272, US5432272 A, US5432272A
InventorsSteven A. Benner
Original AssigneeBenner; Steven A.
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US 5432272 A
Abstract
The disclosure describes a method for incorporating into double stranded DNA and RNA base pairs composed of pairing units that fit the Watson-Crick geometry in that they involve a monocyclic six membered ring pairing with a fused bicyclic heterocyclic ring system composed of a five member ring fused with a six membered ring, with the orientation of the heterocycles with respect to each other and with respect to the backbone chain analogous to that found in DNA and RNA, but with a pattern of hydrogen bonds holding the base pair together different from that found in the AT and GC base pairs (a "non-standard base pair").
Images(5)
Previous page
Next page
Claims(7)
What is claimed is:
1. A method for incorporating into a DNA or RNA oligonucleotide chain at least one nucleotide unit bearing a heterocyclic base selected from the group consisting of the structural formulae of FIG. 4, wherein --R designates the point of attachment of the base to position 1 of a ribose or deoxyribose ring, X is either a nitrogen atom or a carbon atom bearing a substituent Z, Z is either a hydrogen, an unfunctionalized lower alkyl chain, or a lower alkyl chain bearing an amino, carboxyl, hydroxyl, thiol, aryl, indole, or imidazolyl group, Y is either N or CH, and each ring contains no more than three nitrogens consecutively bonded, that consists of synthesizing a template that is an oligonucleotide containing one or more nucleotide subunits bearing a heterocyclic base selected from the group consisting of the structural formulae of FIG. 4, dissolving this template in buffered aqueous solution, adding to the solution nucleoside triphosphates complementary to the nucleotide subunits in the template, adding to this solution a solution of a DNA or RNA polymerase, and incubating said mixture of the solutions such that an oligonucleotide chain complementary to the template and incorporating said at least one oligonucleotide unit bearing a heterocyclic base selected from the group consisting of the structural formulae of FIG. 4 is synthesized.
2. The method of claim 1 wherein said heterocyclic base is selected from the group consisting of 2,6-diaminopyrimidine, xanthine, 2,6-diaminopyrazine, 1-methyl-pyrazolo[4,3-d]pyrimidine-5,7(4H,6H)-dione, iso-guanine, and iso-cytosine.
3. The method of claim 1 wherein said polymerase is selected from the group consisting of the Klenow fragment of DNA polymerase I, T7 RNA polymerase, and AMV reverse transcriptase.
4. The method of claim 1 wherein said heterocyclic base is iso-cytosine incorporated opposite iso-guanine in a template.
5. The method of claim 1 wherein said heterocyclic base is iso-guanine incorporated opposite iso-cytosine in a template.
6. The method of claim 1 wherein said heterocyclic base is 2,6-diaminopyrimidine or 2,6-diaminopyrazine incorporated opposite 1-methyl-pyrazolo[4,3-d]pyrimidine-5,7(4H,6H)-dione or xanthine in a template.
7. The method of claim 1 wherein said heterocyclic base is 1-methyl-pyrazolo[4,3-d]pyrimidine-5,7(4H,6H)-dione or xanthine incorporated opposite either 2,6-diaminopyrimidine or 2,6-diaminopyrazine in a template.
Description
BACKGROUND OF THE INVENTION FIELD OF THE INVENTION

This invention pertains to increasing the number of building blocks that can be incorporated independently into oligonucleotides via DNA and RNA polymerases, and nucleoside analogs capable of forming non-standard Watson-Crick base pairs joined by patterns of hydrogen bonding different from those found in the adenine-thymine and cytosine-guanine base pairs.

SUMMARY OF THE INVENTION

The objective of this invention is to increase the number of independently replicatable building blocks that can be incorporated into DNA and RNA via template directed polymerization. The objective is accomplished by a method for incorporating into double stranded DNA and RNA base pairs composed of pairing units that fit the Watson-Crick geometry in that they involve a monocyclic six membered ring pairing with a fused bicyclic heterocyclic ring system composed of a five member ring fused with a six membered ring, with the orientation of the heterocycles with respect to each other and with respect to the backbone chain analogous to that found in DNA and RNA, but with a pattern of hydrogen bonds holding the base pair together different from that found in the AT and GC base pairs (a "non-standard base pair").

BRIEF DESCRIPTION OF FIGURES

FIG. 1: The two natural base pairs formed between the four natural bases

FIG. 2: General structure of four novel base pairs formed between eight novel bases disclosed here

FIG. 3: Novel base pair discussed by Zubay

FIG. 4: Generalized structures

FIG. 5: Templates used in the examples

DESCRIPTION OF THE PREFERRED EMBODIMENTS

Natural oligonucleotides bind to complementary oligonucleotides according to the well-known rules of base pairing first elaborated by Watson and Crick, where adenine (A) pairs with thymine (T) or uracil (U), and guanine (G) pairs with cytosine (C), with the complementary strands anti-parallel to one another. These pairing rules allow for the specific hybridization of an oligonucleotide with complementary oligonucleotides, making oligonucleotides valuable as probes in the laboratory, in diagnostic applications, as messages that can direct the synthesis of specific proteins, and in a wide range of other applications well known in the art. Further, the pairing is the basis by which enzymes are able to catalyze the synthesis of new oligonucleotides that are complementary to template nucleotides. In this synthesis, building blocks (normally the triphosphates of ribo or deoxyribo derivatives of A, T, U, C, or G) are directed by a template oligonucleotide to form a complementary oligonucleotide with the correct sequence. This process is the bases for replication of all forms of life, and also serves as the basis for all technologies for enzymatic synthesis and amplification of specific heterosequence nucleic acids by enzymes such as DNA and RNA polymerase, and in the polymerase chain reaction.

The Watson-Crick pairing rules can be understood chemically in terms of the arrangement of hydrogen bonding groups on the heterocyclic bases of the oligonucleotide, groups that can either be hydrogen bond donors or acceptors (FIG. 1). In the standard Watson-Crick geometry, a large purine base pairs with a small pyrimidine base; thus, the AT base pair is the same size as a GC base pair. This means that the rungs of the DNA ladder, formed from either AT or GC base pairs, all have the same length.

Further recognition between bases is determined by hydrogen bonds between the bases. Hydrogen bond donors are heteroatoms (nitrogen or oxygen in the natural bases) bearing a hydrogen; hydrogen bond acceptors are heteroatoms (nitrogen or oxygen in the natural bases) with a lone pair of electrons. In the geometry of the Watson-Crick base pair, a six membered ring (in natural oligonucleotides, a pyrimidine) is juxtaposed to a ring system composed of a fused six membered ring and a five membered ring (in natural oligonucleotides, a purine), with a middle hydrogen bond linking two ring atoms, and hydrogen bonds on either side joining functional groups appended to each of the rings, with donor groups paired with acceptor groups (FIG. 1).

Derivatized oligonucleotide building blocks, where a side chain has been appended to one of the nucleoside bases A, T, U, G, or C (the "normal" bases), have application because of their combination of Watson-Crick base pairing and special reactivity associated with the chemical properties of the side chain. For example, oligonucleotides containing a T to which is appended a side chain bearing a biotin residue can first bind to a complementary oligonucleotide, and the hybrid can then be isolated by virtue of the specific affinity of biotin to avidin (Langer, P. R.; Waldrop, A. A.; Ward, D. C. (1981) Proc. Nat. Acad. Sci. 78, 6633-6637), and finds application in diagnostic work. Oligonucleotides containing special functional groups (e.g., thiols or hydrazines) can be immobilized to solid supports more readily than those composed solely of the five "natural" bases.

Often, derivatized building blocks can be incorporated into oligonucleotides by enzymatic transcription of natural oligonucleotide templates in the presence of the triphosphate of the derivatized nucleoside, the substrate of the appropriate (DNA or RNA) polymerase. In this process, a natural nucleoside is placed in the template, and standard Watson-Crick base pairing is exploited to direct the incoming modified nucleoside opposite to it in the growing oligonucleotide chain.

However, the presently available base pairs are limited in that there are only two mutually exclusive hydrogen bonding patterns available in natural DNA. This means that should one wish to introduce a modified nucleoside based on one of the natural nucleosides into an oligonucleotide, it would be incorporated wherever the complementary natural nucleoside is found in the template. For many applications, this is undesirable.

Many of the limitations that arise from the existence of only four natural nucleoside bases, joined in only two types of base pairs via only two types of hydrogen bonding schemes, could be overcome were additional bases available that could be incorporated into oligonucleotides, where the additional bases presented patterns of hydrogen bond donating and accepting groups in a pattern different from those presented by the natural bases, and therefore could form base pairs exclusively with additional complementary bases. The purpose of this invention is to describe compositions of matter containing these additional bases, and methods for their incorporation into analogs of oligonucleotides.

In the naturally-occurring base pairs, the pyrimidines components present an acceptor-donor-acceptor (T) or a donor-acceptor-acceptor (C) pattern of hydrogen bonds to a purine on an opposite strand. This invention is based on the fact that bases with other patterns of hydrogen bond donating and accepting groups can fit the standard Watson-Crick geometry. For example, FIG. 2 discloses four base pairs that have still different patterns, an acceptor-acceptor-donor pattern for iso-C, and donor-acceptor-donor pattern for K. Bases, pairing schemes, and base pairs that have hydrogen bonding patterns different from those found in the AT and GC base pairs are here termed "non-standard". Although not found (so far) in Nature, the non-standard base pairs shown in FIG. 2) apparently can fit into the DNA ladder in a standard Watson-Crick duplex.

Further, the patterns of hydrogen bonds in these non-standard pyrimidines are different from each other, and different from those in the natural pyrimidines T and C. This suggested that in an enzyme-catalyzed polymerization, it might be possible for each non-standard pyrimidine to recognize uniquely its complementary purine with high fidelity. Thus, it should be possible to make copies of a DNA molecule containing all 12 bases simply by following an expanded set of Watson-Crick rules: A pairs with T, G pairs with C, iso-C pairs with iso-G, and K pairs with X, H pairs with J, and M pairs with N (FIG. 2). In other words, it should be possible to have a genetic alphabet with twelve bases instead of four.

Statements considering non-standard base pairs in a general way can, to our knowledge, be found only three times previously in the literature. Considering possible bases that might have been incorporated into nucleic acids in the first forms of life on the earth two to four billion years ago, Rich mentions the base pair between iso-G and iso-G (Rich, A. (1962), Horizons in Biochemistry, Kasha, M. and Pullman, B. editors, N.Y., Academic Press, 103-126) as a base pair that was conceivable, but rejected, by the earliest forms of life. However, Rich did not disclose nor make obvious the process disclosed here employing contemporary DNA and RNA polymerases as part of a process for incorporating the base pair between iso-G and iso-G into oligonucleotides. Saenger (Saenger, W. (1988) Principles of Nucleic Acid Structure New York, Springer-Verlag, pages 114-115) also mentions this base pair, but concludes, based on the fact that iso-G has a alternate tautomeric forms (vide infra), that it has no utility as part of an oligonucleotide that is to be copied.

Zubay (Zubay, G. (1988) The Roots of Modern Biochemistry, Kleinkauf, von Doehren, Jaenicke, Berlin, Walter de Gruyter & Co. 911-916) suggested that 2,4-diamino-5,6-dihydropyryimidine-1-riboside, with a donor-acceptor-donor pattern, might be able to pair with xanthosine (FIG. 3). In Zubay's suggested pyrimidine, however, the pyrimidine ring is not aromatic and therefore not planar. Although it has never been examined experimentally, we believe on these grounds that it would not participate well in "base stacking," the interaction (vide supra) that is important for the stability of a double helix. Further, Zubay's base incorporates the structural unit known as a "vinylogous enamine", a structural unit that is likely to be unstable in acidic solution. Thus, we doubt that it can be incorporated into an oligonucleotide by enzymatic transcription of a complementary oligonucleotide.

Zubay discloses neither experimental studies with his suggested base nor the potential utility of a new base pair that would arise were the new base a substrate for DNA and RNA polymerases present in the modern world. Further, the possibility of constructing additional base pairing schemes (such as the non-standard base pairs disclosed in FIG. 2) was explicitly denied. Zubay writes "We have searched for other purine-pyrimidine base pairs with different arrangements of hydrogen bonding groups that would satisfy the criterion of exclusive pairing. No additional pairs have been found. Thus except for modifications at non-hydrogen bonding sites the additional base pair described here may be unique. "This comment from a prominent figure in American biochemistry supports the notion that the invention disclosed here, where DNA and RNA polymerases can be used in a method to incorporate non-standard base pairs into oligonucleotides, is not obvious to one skilled in the art.

Should the additional base pairs disclosed in FIG. 2 be incorporated enzymatically into DNA and RNA, they could be useful for a variety of purposes. For example, RNA molecules prepared by transcription, although it is known to be a catalyst under special circumstances (a) Cech, T. R.; Bass, B. L. Ann. Rev. Biochem. 1986, 55, 599. (b) Szostak, J. W. Nature 1986, 332, 83. (c) Been, M. D.; Cech, T. R. Science 1988, 239, 1412), appear to have a much smaller catalytic potential then proteins because they lack building blocks bearing functional groups. Conversely, the limited functionality present on natural oligonucleotides constrains the chemist attempting to design catalytically active RNA molecules, in particular, RNA molecules that catalyze the template-directed polymerization of RNA.

Additional base pairs could relax these constraints, especially if their hydrogen bonding pattern differed from those in the AT and GC base pairs, as novel hydrogen bonding schemes would allow additional base pairs to be incorporated enzymatically at specific positions in an oligonucleotide molecule (Switzer, C. Y, Moroney, S. E. & Benner, S. A. J. Am. Chem. Soc., 1989, 111, 8322). If functionalized, such additional bases should also allow the incorporation by transcription of functional groups directly into RNA; the remaining unfunctionalized building blocks could then control secondary structure without introducing over-functionalization and attendant non-specific catalysis. Further, bases bearing functional groups at the position structurally analogous to the 5-position of the uridine ring should be substrates for most polymerases (Leary, J. L., Brigati, D. J. & Ward, D. C. Proc. Natl. Acad. Sci. 1983, 80, 4045). New base pairs should also find use in studies of the structure of biologically important RNA and DNA molecules (Chem, T. R., Churchill, M. E. A. Tullius, T. D. Kallenbach, N. R., Seemann, N. C. (1988) Biochem., 27, 6032) and protein-nucleic acid interactions. Several types of catalytic RNA molecules containing natural bases have been proposed as anti-viral agents, for use in agriculture, and in other areas. (Haseloff, J., Gerlach, W. L. Nature1988, 334, 585; Sarver, N., Cantin, E. M., Chang, P. S., Zaia, J. A., Ladne, P. A., Stephens, D. A., Rossi, J. J. Science, 1990, 247 1222-1225). Catalytic RNA molecules incorporating additional bases should be even more useful in certain of these applications. A segment of DNA or RNA containing the additional bases could be replicated only in the presence of triphosphates of the complementary additional bases, allowing the selective copying of DNA containing the additional bases in the presence of DNA containing normal bases, and vice versa. More speculatively, the extra letters in the nucleoside alphabet might eventually be used to expand the genetic code, increasing the number of amino acids that can be incorporated translationally into proteins Noren, C. J., Anthony-Cahill, S. J., Griffith, M. C. & Schultz, P. G. Science, 1989, 244, 182; J. D. Bain, J. C. G. Glabe, T. A. Dix, A. R. Chamberlain J. Am. Chem. Soc. 1989, 111, 8013-8014.

The process disclosed here involves the incubation of an oligonucleotide template containing one or more non-standard bases with either a DNA or RNA polymerase (Uhlenback, O. C. Nature, 1987, 328, 18) in the presence of triphosphates of the complementary nucleosides.

Experiments with iso-C and iso-G (FIG. 2) have shown that bases with novel hydrogen bonding schemes can be incorporated by DNA and RNA polymerases. Thus, this base pair fulfills the criteria outlined above. However, certain forms of iso-C were found to hydrolyze slowly to U under conditions of DNA synthesis, introducing into a template a base that pairs with A in the place of a base that pairs with iso-G. Further, iso-G exists to some extent in a minor tautomeric form that is complementary to U and T. Although the existence of a minor tautomeric form of iso-G has some advantages in certain circumstances (e.g., when one wishes to introduce iso-G into an oligonucleotide duplex opposite U or T), these problems complicate the selective incorporation of the iso-C/iso-G base pair in oligonucleotides also containing A and T. Therefore, the search for a preferred embodiment was directed towards base pairs in FIG. 2 where the non-standard base is joined to the sugar by a carbon-carbon bond, where chemical considerations suggested that hydrolysis and tautomeric equilibria might be less problematic.

Much work was directed towards the pyridine nucleoside analog, 3-β-D-ribofuranosyl-(2,6-diaminopyridine). However, the presently preferred base pairs are those where the six-ring pyrimidine analog is joined to a ribose or deoxyribose ring via a carbon-carbon bond, and where the pyrimidine analog contains at least two nitrogens in the ring itself. Give an appropriate arrangements of hydrogen bond donating and accepting groups, many ring systems are appropriate (FIG. 4), including ring systems to which are appended functionalized and unfunctionalized side chains. Syntheses for many of these compounds are known in the prior art. (Bartolomew, D. G., Dea, P., Robins, R. K. Revenkar, G. R. (1975) Org. Chem., 40, 3708). However, there are several constraints on the ring system and its substituents. First, the ring systems must be aromatic so that they are capable of stacking with base above and below in the double helix. Second, substituent on the 6 position of the pyrimidine (or the analogous position of a pyrimidine analog) and the 8 position of the purine (or the analogous position of a purine analog) is preferably no larger than hydrogen.

The most preferred pyrimidine analog is 3-β-D-ribofuranosyl-(2,6-diaminopyrimidine), trivially designated here as K. Several complementary purines are presently preferred. For example, either xanthosine or 3β-D-ribofuranosyl-(1-methyl-pyrazolo[4,3-d]pyrimidine-5,7(4H,6H)-dione), also known as 7-methyl oxoformycin B, have been found to form base pairs with K when incorporated into DNA and RNA.

EXAMPLE 1 The K-P Base Pair

The pyrimidine 3β-D-ribofuranosyl-(2,6-diaminopyrimidine), trivially designated as K, presents a donor-acceptor-donor hydrogen bonding pattern to a complementary strand in a duplex structure. K as a deoxyriboside derivative suitable for automated DNA synthesis was synthesized from a known precursor by routes known in the prior art. C. K. Chu, U. Reichman, K. A. Watanable, J. J. Fox, J. Org. Chem. 1977, 42, 711. Two purine analogs were chosen to complement K. The first, xanthosine (X), is a natural base available commercially as both the nucleoside and nucleoside triphosphate. However, because of concerns that deoxyxanthosine might undergo depurination in some of the studies planned, another complementary base, 3-β-D-ribofuranosyl-(1-methyl-pyrazolo[4,3-d]pyrimidine-5,7(4H,6H)-dione) (B. G. Ugarkar, G. R. Revankar, R. K. Robins, J. Heterocycl. Chem., 21, 1965-1870 (1984)), also known as 7-methyl oxoformycin B, and trivially designated here as P, was prepared by routes known in the prior art. In P, the heterocyclic base is joined to the pentose ring by a carbon-carbon bond.

The K-P base pair has physical and chemical properties suitable as replicatable components of a genetic alphabet (J. A. Piccirilli, T. Krauch, S. E. Moroney, S. A. Benner, Nature, 343, 33-37 (1990). In a solution of a derivative of K in chloroform, a strong nuclear Overhauser enhancement (NOE) between the proton at C1' of the ribose ring and the proton at C4 of the heterocyclic ring suggested that K adopts the undesired syn conformation when alone in solution. However upon addition of a protected derivative of the complementary purine nucleoside P, this NOE largely disappeared. Further, when both K and its complement are present, the resonances assigned to the amine protons of K shift strongly downfield, as does the resonance of P assigned to the nitrogen flanked by the carbonyl groups. These facts together show that K and P form a standard Watson-Crick base pair in a solution of chloroform.

To determine the effect of a base pair between K and P on the stability of a DNA duplex, several oligonucleotides containing the K-P base pair were synthesized using an Applied Biosystems Oligonucleotide Synthesizer. Melting studies showed that duplexes containing a K-P base pair are only slightly less stable than duplexes containing only natural bases. Further, duplexes containing the new base pair are considerably more stable than those containing mismatches involving the new bases, which in turn had melting temperatures similar to duplexes containing mismatches of natural bases (Piccirilli et al., op. cit.). The stability of various mismatches was consistent with the presumed stability of "wobble" base pairs, which should be particularly important for the GT and AK mismatches. These results suggested that enzymatic incorporation of a new base selectively opposite its complement in a DNA template should be possible, provided that natural DNA and RNA polymerases accepted the new bases.

To demonstrate that xanthosine triphosphate could be incorporated enzymatically into an RNA oligonucleotide opposite a K in the template, a promoter-template including a promoter sequence of T7 RNA polymerase (Milligan, J. F., Groebe, D. R., Witherell, G. W., & Uhlenbeck, O. C. Nucleic Acids Res., 15, 8783 (1987), (17 bases) followed by a short olignucleotide segment (7 bases), the new base K, 1 additional base, and a final A was synthesized, together with a complementary 18 base primer (FIG. 5). Incorporation of K into the synthetic DNA templates was verified by digestion of samples of the template with snake venom phosphodiesterase, hydrolysis of the phosphate from the products with bacterial alkaline phosphatase, and analysis of the resulting nucleosides by HPLC (data not shown). Control templates containing T replacing K were also prepared by synthesis. Transcription of the primed templates could be detected most simply by the incorporation of radiolabled UMP (from a-labeled UTP) into a product RNA molecule 10 bases long (the "full length product").

When synthetic template 1 was incubated with labeled UTP and various other nucleoside triphosphates, full length products were observed in the presence of XTP. The efficiency of synthesis of full length product from templates with and without K was approximately the same, provided that the necessary complementary nucleoside triphosphates were all present in the incubation mixtures. In absence of XTP, a significant amount of full length product could be detected only in the presence of ATP, and this at somewhat low levels (ca. 24%, measured by scintillation counting of bands cut from the gel). Such a misincorporation presumably occurs via "wobble" base pairing, and is not infrequent even with natural bases when incorporation experiments are run in incubation mixtures that are missing one component. Coleman, J. E., Martin, C. T. & Muller, D. K. Biochemistry, 27, 3966 (1988).

To determine whether misincorporation of A was diminished by competition with X, experiments were performed with tritiated XTP (synthesized from tritiated GTP by Demijanov oxidation) Roy, K. B. & Miles, H. T. Nucleosides and Nucleotides, 2, 237 (1983) and γ-32 P-labeled GTP (which is incorporated, with the triphosphate intact, at the 5' end of the RNA product) together in an incubation mixture in varying ratios. Full length products from an incubation containing a 1:1 molar ratio of 3 H-XTP and unlabeled ATP were isolated by gel electrophoresis, the bands excised, and the relative amounts of 3 H and 32 P determined by scintillation counting. After correction for the specific activities of the starting nucleotides, the misincorporation of adenosine into the product at a XTP:ATP ratio of 1:1 was reduced to ca. 14%. Infidelity further decreases with increasing ratios of X:A, and most likely stems from errors made by the polymerase itself rather than from minor tautomers of the bases.

To demonstrate that xanthosine triphosphate could be incorporated into a DNA oligonucleotide opposite a K in the template, a set of primer-templates (FIG. 5) were prepared containing either K, C or T (the latter two serving as control templates). Incorporation of K into the synthetic DNA templates was again verified by digestion of samples of the template with snake venom phosphodiesterase, removal of the phosphate from the products by bacterial alkaline phosphatase, and analysis of the resulting nucleosides by HPLC. As before, the last base in the template was a unique A, permitting the detection of full length products most simply by autoradiography following the incorporation of α-32 P-TTP.

The synthetic primer-templates were incubated with the Klenow fragment of DNA polymerase I (Pol 1) Cobianchi, F. & Wilson, S. H. Meth. Enzymol., 152, 94 (1987) in the presence of various nucleoside triphosphates, and the products analyzed by gel electrophoresis. K in the template directed the incorporation of XTP into full length product. Upon electrophoresis, the product containing X migrates faster than the analogous products containing G or A, presumably because the xanthine heterocycle carries an additional negative charge under the conditions of the electrophoresis due to its low pKa (pKa =5.7). Direct evidence for the incorporation of xanthosine was obtained by digestion of the product oligonucleotide, kinasing, and electrophoretic analysis.

To measure the relative efficiency as templates of the oligonucleotides containing different bases, product bands from electrophoresis gels were excised and their radioactivity determined by liquid scintillation counting. Templates containing K were ca. 70% as efficient at directing the synthesis of full length product (in the presence of XTP) as those containing only natural bases.

The fidelity of incorporation of X opposite K was examined by incubating templates containing C, T and K with purine triphosphates separately and in competition (FIG. 5). As expected, the fidelity of incorporation was considerably higher with DNA polymerase than with T7 RNA polymerase. Essentially no G or A was incorporated by the Klenow fragment of DNA polymerase opposite K, and essentially no X was incorporated opposite T in the template. The only evidence of infidelity was a low level (ca. 5%) of X misincorporated opposite C in the template when GTP was missing from the incubation mixture. This misincorporation was not observed at all when GTP and XTP were present in a 1:1 ratio.

EXAMPLE 2 The isoC-isoG Base Pair

Protected d-iso-C suitable as a building block for the chemical synthesis of DNA was synthesized by direct extensions of standard methods. Watanabe, K. A.; Reichman, C. K.; Fox, J. J. Nucleic Acid Chemistry; Tipson, R. S.; Townsend, L. B., Eds.; John Wiley and Sons: New York 1978; Part 1, p 273. (b) Kimura, J.; Yagi, K.; Suzuki, H.; Mitsunobu, O. Bull. Soc. Chem. Jap. 1980, 53, 3670. N2 -benzoyl-5'-dimethoxytrityl-d-iso-C diisopropyl phosphoramidite, used directly in machine-DNA synthesis, was synthesisized from d-iso-C by the general procedure of Atkinson and Smith: Atkinson, T.; Smith, M. Oligonucleotide Synthesis: A Practical Approach; Gait, M. J. Ed.; IRL Press: Oxford 1985; pp 35-82. This was incorporated into two templates, and three other templates containing only natural bases were synthesized for use as standards and controls. An 8-mer primer was annealed to the appropriate templates (FIG. 5) to provide a double stranded binding site for the Klenow fragment of DNA polymerase I (E. coli), followed by a single stranded coding region containing d-iso-C flanked only by purine nucleotides. Alternatively, different templates (FIG. 5) were annealed to an 18-mer to give the double stranded promoter region required by T7 RNA polymerase, followed by a single stranded coding region containing d-iso-C. In all of the templates, a unique A at the end of the coding strand was included to direct the incorporation of radiolabelled T or U and ribo- and deoxyribo-iso-GTP's. Mantsch, H. H. et. al., Biochemistry 1975, 14, 5593. The reactions with the Klenow fragment were conducted by incubating template/primer, polymerase, and a mixture of the required dNTPs including (α-32 P)TTP. Following incubation, the products were analyzed by gel electrophoresis and autoradiography. With primed templates containing iso-C, full length product was obtained only with d-iso-GTP present in the incubation mixture. The presence of iso-G at the correct position in the product oligonucleotide was positively established by a "nearest neighbor" analysis, Sgaramella, V.; Khorana, H. G. J. Mol. Biol. 1972, 72, 427. and by the "minus" sequencing method. Sanger, F.; Coulson, A. R. J. Mol. Biol. 1975, 94, 441. As expected, in an incubation of a primed template containing T with dATP and the required dNTPs in the absence of d-iso-GTP, full length product was observed only to the extent anticipated by the fact that a small amount (15%) of dUTP was present in the template due to the deamination of iso-C (vide supra).

Infidelity between iso-G and T was anticipated due to the known existence of a minor "phenolic" tautomer of iso-G in addition to the major N1 -H tautomer (Sepiol, J., Kazimierczuk, Z., Shugar, D. Z. Naturforsch., 1976, 31c, 361; the possibility that this minor tautomer could form a Watson-Crick base pair with T was recognized on theoretical grounds. In fact, incubation of a primed template containing T in place of d-iso-C with the required dNTPs and d-iso-GTP did yield a significant amount of full length product. This result strongly suggests that polymerases synthesize a base pair between T and the "phenolic" tautomer of iso-G. This fact diminishes the value of the base pair between iso-G and iso-C for many (but not all applications.

In analogous experiments, T7 RNA polymerase was shown to accept the new base pair. Incubation of a template (FIG. 5) possessing the T7 promoter with the required NTPs yielded more full length product in the presence iso-GTP than in its absence. Sequencing of the RNA transcript positively established the presence of iso-G in the product at the expected position.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 6(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 13(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: nucleic acid(vi) ORIGINAL SOURCE: synthetic(x) PUBLICATION INFORMATION:(A) AUTHORS:Switzer, C. Y.Moroney , S. E.Benner, S. A.(B) TITLE: Enzymatic Incorporation of a New Base Pair intoDNA and RNA(C) JOURNAL: Journal of the American Chemical Society(D) VOLUME: 111(F) PAGES: 8322-8323 (G) DATE: 1989(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:AGTGGTCAAAATC13(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 13(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: nucleic acid(vi) ORIGINAL SOURCE: synthetic (x) PUBLICATION INFORMATION:(A) AUTHORS:Switzer, C. Y.Moroney , S. E.Benner, S. A.(B) TITLE: Enzymatic Incorporation of a New Base Pair intoDNA and RNA(C) JOURNAL: Journal of the American Chemical Society(D) VOLUME: 111(F) PAGES: 8322-8323 (G) DATE: 1989(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:AGCGGTCAAAATC13(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: nucleic acid(vi) ORIGINAL SOURCE: synthetic(x) PUBLICATION INFORMATION: (A) AUTHORS:Switzer, C. Y.Moroney , S. E.Benner, S. A.(B) TITLE: Enzymatic Incorporation of a New Base Pair intoDNA and RNA(C) JOURNAL: Journal of the American Chemical Society(D) VOLUME: 111(F) PAGES: 8322-8323(G) DATE: 1989(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:TAATACGACTCACTATAG18(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: nucleic acid(vi) ORIGINAL SOURCE: synthetic(x) PUBLICATION INFORMATION: (A) AUTHORS:Switzer, C. Y.Moroney , S. E.Benner, S. A.(B) TITLE: Enzymatic Incorporation of a New Base Pair intoDNA and RNA(C) JOURNAL: Journal of the American Chemical Society(D) VOLUME: 111(F) PAGES: 8322-8323(G) DATE: 1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:TAATACGACTCACTATAG18(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 18(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: nucleic acid(vi) ORIGINAL SOURCE: synthetic(x) PUBLICATION INFORMATION: (A) AUTHORS:Piccirilli, J. A.Krauch, T.Moroney , S. E.Benner, S. A.(B) TITLE: Extending the Genetic Alphabet: EnzymaticIncorporation of a New Base Pair into DNA and RNA(C) JOURNAL: Nature(D) VOLUME: 343(F) PAGES: 33-37 (G) DATE: 1990(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:TAATACGACTCACTATAG18(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE:(A) DESCRIPTION: nucleic acid(vi) ORIGINAL SOURCE: synthetic (x) PUBLICATION INFORMATION:(A) AUTHORS:Switzer, C. Y.Moroney , S. E.Benner, S. A.(B) TITLE: Enzymatic Incorporation of a New Base Pair intoDNA and RNA(C) JOURNAL: Journal of the American Chemical Society(D) VOLUME: 111(F) PAGES: 8322-8323 (G) DATE: 1989(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:AGCCCGGCGCTATAGTGAGTCGTATTA27
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4959463 *Sep 19, 1986Sep 25, 1990Genentech, Inc.Intermediates
US5047519 *Jun 12, 1987Sep 10, 1991E. I. Du Pont De Nemours And CompanyAlkynylamino-nucleotides
Non-Patent Citations
Reference
1 *Bain et al. (1989) J. Am. Chem. Soc. 111, 8013 8014.
2Bain et al. (1989) J. Am. Chem. Soc. 111, 8013-8014.
3 *Bartholomew et al. (1975) J. Org. Chem. 40, 3708 3713.
4Bartholomew et al. (1975) J. Org. Chem. 40, 3708-3713.
5 *Been et al. (1988) Science 239, 1412.
6 *Cech et al. (1986) Ann. Rev. Biochem. vol. 55, p. 599.
7 *Chen et al. (1988) Biochem 27, 6032.
8 *Chu et al. (1977) J. Org. Chem. 42, 711.
9 *Cobianchi et al. (1987) Meth. Enzymol. 152, 94.
10 *Coleman et al. (1988) Biochemistry, 27, 3966.
11 *Haseloff et al. (1988) Nature 334, 585.
12 *Kimura et al. (1980) Bull. Soc. Chem. Jap. 53, 3670.
13 *Langer et al. (1981) PNAS vol. 78, pp. 6633 6637.
14Langer et al. (1981) PNAS vol. 78, pp. 6633-6637.
15 *Leary et al. (1983) PNAS 80, 4045.
16 *Mantsch et al. (1975) Biochemistry 14, 5593.
17 *Milligan et al. (1987) Nucleic Acids Res. 15, 8783.
18 *Noren et al. (1989) Science 244, 182.
19 *Piscisilli et al. (1990) Nature 343, 33 37.
20Piscisilli et al. (1990) Nature 343, 33-37.
21 *Rich (1962) Horizons in Biochemistry, Kasha et al. editors, N.Y., Academic Press, 103 126.
22Rich (1962) Horizons in Biochemistry, Kasha et al. editors, N.Y., Academic Press, 103-126.
23 *Roy et al. (1983), Nucleosides and Nuclestides, 2, 237.
24 *Saenger (1985) Nucleic Acid Chemistry, Springer Verlag.
25Saenger (1985) Nucleic Acid Chemistry, Springer--Verlag.
26 *Sanger et al. (1975), J. Mol. Biol., 94, 441.
27 *Sarver et al. (1990) Science 247, 1222 1225.
28Sarver et al. (1990) Science 247, 1222-1225.
29 *Sgaramella et al. (1972), J. Mol. Biol., 72, 427.
30 *Switzer et al. (1989) J. Am. Chem. Soc. 111, 8322.
31 *Szostak (1986) Nature 332, 83.
32 *Ugarkar et al. (1984) Heterocyl. Chem. 21, 1865 1870.
33Ugarkar et al. (1984) Heterocyl. Chem. 21, 1865-1870.
34 *Uhlenbeck (1987), Nature 328, 18.
35 *Zubay (1988) The Roots of Modern Biochemistry, Kleinkauf et al. Berlin, Walter de Grumpton & Co., 911 916.
36Zubay (1988) The Roots of Modern Biochemistry, Kleinkauf et al. Berlin, Walter de Grumpton & Co., 911-916.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6001983 *Jan 17, 1995Dec 14, 1999Benner; Steven AlbertOligonucleotides with non-standard bases and methods for preparing same
US6037120 *Oct 12, 1995Mar 14, 2000Benner; Steven AlbertRecognition of oligonucleotides containing non-standard base pairs
US6111085 *Sep 13, 1996Aug 29, 2000Isis Pharmaceuticals, Inc.Carbamate-derivatized nucleosides and oligonucleosides
US6127121 *Apr 3, 1998Oct 3, 2000Epoch Pharmaceuticals, Inc.Oligonucleotides containing pyrazolo[3,4-D]pyrimidines for hybridization and mismatch discrimination
US6127124 *Jan 20, 1999Oct 3, 2000Isis Pharmaceuticals, Inc.Fluorescence based nuclease assay
US6147200 *Aug 19, 1999Nov 14, 2000Isis Pharmaceuticals, Inc.2'-O-acetamido modified monomers and oligomers
US6166188 *Aug 12, 1999Dec 26, 2000Isis Pharmaceuticals, Inc.Carbamate-derivatized nucleosides and oligonucleosides
US6225293Sep 2, 1998May 1, 2001Isis Pharmaceuticals, Inc.Methods and compounds for tracking the biodistribution of macromolecule-carrier combinations
US6300320Jan 5, 1999Oct 9, 2001Isis Pharmaceuticals, Inc.Modulation of c-jun using inhibitors of protein kinase C
US6316198Mar 18, 2000Nov 13, 2001Exiqon A/SDetection of mutations in genes by specific LNA primers
US6322987Oct 16, 2000Nov 27, 2001Isis Pharmaceuticals, Inc.Carbamate-derivatized nucleosides and oligonucleosides
US6335434Mar 24, 1999Jan 1, 2002Isis Pharmaceuticals, Inc.,Nucleosidic and non-nucleosidic folate conjugates
US6420549Aug 7, 1998Jul 16, 2002Isis Pharmaceuticals, Inc.Oligonucleotide analogs having modified dimers
US6444798 *May 13, 1996Sep 3, 2002Steven Albert BennerChimeras of sulfur-linked oligonucleotide analogs and DNA and RNA
US6485906Nov 1, 1999Nov 26, 2002Epoch Pharmaceuticals, Inc.Oligonucleotides containing pyrazolo[3,4-d]pyrimidines for hybridization and mismatch discrimination
US6528631Jun 16, 1998Mar 4, 2003Isis Pharmaceuticals, Inc.Oligonucleotide-folate conjugates
US6617106 *Mar 29, 2000Sep 9, 2003Steven Albert BennerMethods for preparing oligonucleotides containing non-standard nucleotides
US6656730Jun 15, 1999Dec 2, 2003Isis Pharmaceuticals, Inc.Oligonucleotides conjugated to protein-binding drugs
US6680172May 16, 2000Jan 20, 2004Regents Of The University Of MichiganTreatments and markers for cancers of the central nervous system
US6747014Dec 21, 2001Jun 8, 2004Isis Pharmaceuticals, Inc.Compositions and methods for non-parenteral delivery of oligonucleotides
US6762169Jun 15, 2000Jul 13, 2004Isis Pharmaceuticals, Inc.Ligand-conjugated oligomeric compounds
US6803198Aug 21, 2001Oct 12, 2004Isis Pharmaceuticals, Inc.Carbamate-derivatized nucleosides and oligonucleosides
US6841539May 20, 1999Jan 11, 2005Isis Pharmaceuticals, Inc.Compositions and methods for topical delivery of oligonucleotides
US6849723Jul 15, 2002Feb 1, 2005Isis Pharmaceuticals, Inc.Oligonucleotide analogs having modified dimers
US6861514Oct 9, 2001Mar 1, 2005Isis Pharmaceuticals, Inc.Nucleosidic and non-nucleosidic folate conjugates
US6867294Nov 12, 1999Mar 15, 2005Isis Pharmaceuticals, Inc.Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US6962906Feb 9, 2002Nov 8, 2005Active MotifOligonucleotide analogues, methods of synthesis and methods of use
US6977153Dec 31, 2002Dec 20, 2005Qiagen GmbhRolling circle amplification of RNA
US6977161Oct 15, 2001Dec 20, 2005Eragen Biosciences, Inc.Solid support assay systems and methods utilizing non-standard bases
US7002006Feb 12, 2003Feb 21, 2006Isis Pharmaceuticals, Inc.Protection of nucleosides
US7060809Sep 4, 2002Jun 13, 2006Exiqon A/SLNA compositions and uses thereof
US7115738Mar 13, 2001Oct 3, 2006Active MotifHydroxyproline/phosphono oligonucleotide analogues, methods of synthesis and methods of use
US7169557Nov 7, 2002Jan 30, 2007Applera CorporationUniversal nucleotides for nucleic acid analysis
US7169916Mar 31, 2003Jan 30, 2007Isis Pharmaceuticals, Inc.Chloral-free DCA in oligonucleotide synthesis
US7214783Jun 25, 2004May 8, 2007Applera CorporationUniversal bases for nucleic acid analyses, methods for using universal bases, and kits comprising universal bases
US7229767Sep 26, 2003Jun 12, 2007University Of DelawareGenomics applications for modified OLIGO nucleotides
US7276599Jun 2, 2004Oct 2, 2007Isis Pharmaceuticals, Inc.Oligonucleotide synthesis with alternative solvents
US7282333Oct 20, 2004Oct 16, 2007Promega CorporationMethods and compositions for nucleic acid analysis
US7297780Jan 6, 2004Nov 20, 2007Third Wave Technologies, Inc.Reactive functional groups for preparation of modified nucleic acid
US7321828Apr 28, 1998Jan 22, 2008Isis Pharmaceuticals, Inc.System of components for preparing oligonucleotides
US7374882Nov 11, 2001May 20, 2008RikenMethod for base sequencing and biologically active nucleic acids
US7399845Jan 27, 2007Jul 15, 2008Isis Pharmaceuticals, Inc.6-modified bicyclic nucleic acid analogs
US7422850May 18, 2001Sep 9, 2008Eragen Biosciences, Inc.Materials and methods for detection of nucleic acids
US7427675Aug 22, 2005Sep 23, 2008Isis Pharmaceuticals, Inc.Compounds and methods for the characterization of oligonucleotides
US7462451Apr 26, 2005Dec 9, 2008Third Wave Technologies, Inc.Compositions for modifying nucleic acids
US7468244Sep 27, 2002Dec 23, 2008University Of DelawarePolymorphism detection and separation
US7468431Jan 24, 2005Dec 23, 2008Isis Pharmaceuticals, Inc.Modulation of eIF4E-BP2 expression
US7476733Mar 25, 2005Jan 13, 2009The United States Of America As Represented By The Department Of Health And Human ServicesDevelopment of a real-time PCR assay for detection of pneumococcal DNA and diagnosis of pneumococccal disease
US7498136Mar 16, 2006Mar 3, 2009Eragen Biosciences, Inc.Methods for detecting multiple species and subspecies of Neisseria
US7514212Jan 17, 2004Apr 7, 2009Eragen Biosciences, Inc.Nucleic acid amplification using non-standard bases
US7517651Jul 14, 2006Apr 14, 2009Eragen Biosciences, Inc.Materials and methods for detection of nucleic acids
US7541147Oct 12, 2006Jun 2, 2009Eragen Biosciences, Inc.Materials and methods for detection of nucleic acids
US7547684May 10, 2007Jun 16, 2009Isis Pharmaceuticals, Inc.5′-modified bicyclic nucleic acid analogs
US7553619Jun 30, 2009Qiagen GmbhDetection method using dissociated rolling circle amplification
US7566535Mar 7, 2003Jul 28, 2009University Of DelawareEnhanced oligonucleotide-mediated nucleic acid sequence alteration
US7569686May 10, 2007Aug 4, 2009Isis Pharmaceuticals, Inc.Compounds and methods for synthesis of bicyclic nucleic acid analogs
US7575902Apr 27, 2007Aug 18, 2009Applied Biosystems, LlcUniversal bases for nucleic acid analyses, methods for using universal bases, and kits comprising universal bases
US7618776Nov 17, 2009Yale UniversityRolling circle replication reporter systems
US7666854Feb 23, 2010Isis Pharmaceuticals, Inc.Bis-modified bicyclic nucleic acid analogs
US7695902Apr 13, 2010Isis Pharmaceuticals, Inc.Oligoribonucleotides and ribonucleases for cleaving RNA
US7741457Jun 22, 2010Isis Pharmaceuticals, Inc.6-modified bicyclic nucleic acid analogs
US7745609Aug 22, 2006Jun 29, 2010Isis Pharmaceuticals, Inc.Antisense modulation of CD40 expression
US7749504Apr 11, 2007Jul 6, 2010Genentech, Inc.Anti-TAT188 antibodies
US7750131Jul 6, 2010Isis Pharmaceuticals, Inc.5′-modified bicyclic nucleic acid analogs
US7754450Jul 13, 2010Morphotek, Inc.Methods of generating high-production of antibodies from hybridomas created by in vitro immunization
US7759480Jul 20, 2010Isis Pharmaceuticals, Inc.Chloral-free DCA in oligonucleotide synthesis
US7786292Apr 30, 2007Aug 31, 2010Baltic Technology Development, Ltd.Antisense agents combining strongly bound base-modified oligonucleotide and artificial nuclease
US7794931Sep 14, 2010Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
US7803915Sep 8, 2004Sep 28, 2010Genentech, Inc.Antibody compositions for the diagnosis and treatment of tumor
US7807372Jun 4, 2008Oct 5, 2010Northwestern UniversityScreening sequence selectivity of oligonucleotide-binding molecules using nanoparticle based colorimetric assay
US7807652Nov 21, 2006Oct 5, 2010Isis Pharmaceuticals, Inc.Modulation of eIF4E-BP2 expression
US7812149Oct 12, 2010Isis Pharmaceuticals, Inc.2′-Fluoro substituted oligomeric compounds and compositions for use in gene modulations
US7820808Apr 1, 2004Oct 26, 2010Eragen Biosciences, Inc.Polymerase inhibitor and method of using same
US7875733Jan 25, 2011Isis Pharmaceuticals, Inc.Oligomeric compounds comprising 4′-thionucleosides for use in gene modulation
US7884086Feb 8, 2011Isis Pharmaceuticals, Inc.Conjugates for use in hepatocyte free uptake assays
US7888010Feb 15, 2011Asuragen, Inc.Methods and compositions involving microRNA
US7892796Nov 19, 2005Feb 22, 2011Eragen Biosciences, Inc.Solid support assay systems and methods utilizing non-standard bases
US7919245Aug 11, 2007Apr 5, 2011Asuragen, Inc.Methods and compositions involving microRNA
US7939259May 10, 2011Stratos Genomics, Inc.High throughput nucleic acid sequencing by expansion
US7939677May 10, 2011Isis Pharmaceuticals, Inc.Oligomeric compounds comprising 4′-thionucleosides for use in gene modulation
US7951785May 31, 2011California Institute Of TechnologyNFIA in glial fate determination, glioma therapy and astrocytoma treatment
US7955802Dec 13, 2007Jun 7, 2011Luminex CorporationSystems and methods for multiplex analysis of PCR in real time
US7960359Aug 10, 2007Jun 14, 2011Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US7964577Oct 16, 2006Jun 21, 2011Donald Carlton DTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
US7964579Aug 21, 2009Jun 21, 2011Isis Pharmaceuticals, Inc.Compositions and methods for topical delivery of oligonucleotides
US7994130Dec 11, 2007Aug 9, 2011University Of Utah Research FoundationCompositions and methods for treating ocular pathologic angiogenesis and vascular permeability
US8003320Aug 23, 2011Asuragen, Inc.Methods and compositions involving MicroRNA
US8017338Sep 13, 2011Life Technologies CorporationReversible di-nucleotide terminator sequencing
US8022046Sep 20, 2011Baxter International, Inc.Microsphere-based composition for preventing and/or reversing new-onset autoimmune diabetes
US8022193May 5, 2010Sep 20, 2011Isis Pharmaceuticals, Inc.6-modified bicyclic nucleic acid analogs
US8030467Oct 4, 2011Isis Pharmaceuticals, Inc.5′-modified bicyclic nucleic acid analogs
US8043834Oct 25, 2011Qiagen GmbhUniversal reagents for rolling circle amplification and methods of use
US8048998Jan 18, 2008Nov 1, 2011Exiqon A/SMediated cellular delivery of LNA oligonucleotides
US8053212 *Nov 8, 2011Steven Albert BennerNon-standard nucleoside analogs with reduced epimerization
US8058250Nov 15, 2011Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8067386Nov 19, 2008Nov 29, 2011Isis Pharmaceuticals, Inc.Modulation of eIF4E-BP2 expression
US8071562Dec 6, 2011Mirna Therapeutics, Inc.MiR-124 regulated genes and pathways as targets for therapeutic intervention
US8080534Feb 18, 2010Dec 20, 2011Phigenix, IncTargeting PAX2 for the treatment of breast cancer
US8088746Jan 3, 2012Isis Pharmaceuticals, Inc.Bis-modified bicyclic nucleic acid analogs
US8088904Aug 15, 2008Jan 3, 2012Isis Pharmaceuticals, Inc.Tetrahydropyran nucleic acid analogs
US8101743Nov 19, 2008Jan 24, 2012Isis Pharmaceuticals, Inc.Modulation of transthyretin expression
US8129515Jan 27, 2007Mar 6, 2012Isis Pharmaceuticals, Inc.Oligomeric compounds and compositions for the use in modulation of microRNAs
US8153602May 20, 1999Apr 10, 2012Isis Pharmaceuticals, Inc.Composition and methods for the pulmonary delivery of nucleic acids
US8153606Oct 2, 2009Apr 10, 2012Opko Curna, LlcTreatment of apolipoprotein-A1 related diseases by inhibition of natural antisense transcript to apolipoprotein-A1
US8173611Nov 14, 2005May 8, 2012Asuragen Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8188059May 7, 2007May 29, 2012Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of GCGR
US8188255May 29, 2012Exiqon A/SHuman microRNAs associated with cancer
US8198253Jul 18, 2007Jun 12, 2012Isis Pharmaceuticals, Inc.Compositions and their uses directed to HBXIP
US8206901Oct 30, 2003Jun 26, 2012Nuevolution A/SMethod for the synthesis of a bifunctional complex
US8217160Jul 20, 2006Jul 10, 2012Eragen Biosciences, Inc.Solid support assay systems and methods utilizing non-standard bases
US8252756Jun 8, 2006Aug 28, 2012Northwestern UniversityNucleic acid functionalized nanoparticles for therapeutic applications
US8258111May 8, 2009Sep 4, 2012The Johns Hopkins UniversityCompositions and methods related to miRNA modulation of neovascularization or angiogenesis
US8268980Sep 23, 2011Sep 18, 2012Isis Pharmaceuticals, Inc.5′-modified bicyclic nucleic acid analogs
US8278283Jul 1, 2008Oct 2, 2012Isis Pharmaceuticals, Inc.6-disubstituted or unsaturated bicyclic nucleic acid analogs
US8278425May 22, 2008Oct 2, 2012Isis Pharmaceuticals, Inc.N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
US8278426Jun 6, 2008Oct 2, 2012Isis Pharmaceuticals, Inc.Carbocyclic bicyclic nucleic acid analogs
US8288105Oct 16, 2012Luminex CorporationSystems and methods for multiplex analysis of PCR in real time
US8288354Dec 28, 2006Oct 16, 2012The Scripps Research InstituteNatural antisense and non-coding RNA transcripts as drug targets
US8293472Oct 23, 2012Luminex CorporationMethods for detection and typing of nucleic acids
US8293684Nov 29, 2007Oct 23, 2012ExiqonLocked nucleic acid reagents for labelling nucleic acids
US8309303Mar 27, 2006Nov 13, 2012Qiagen GmbhReverse transcription and amplification of RNA with simultaneous degradation of DNA
US8309519May 19, 2011Nov 13, 2012University Of Utah Research FoundationCompositions and methods for inhibiting vascular permeability
US8313901Dec 21, 2006Nov 20, 2012Yale UniversityMethods and compositions related to the modulation of riboswitches
US8313932Sep 17, 2010Nov 20, 2012Luminex CorporationPolymerase inhibitor and method of using same
US8318692Nov 27, 2012Donald Carlton DTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
US8324360Dec 4, 2012Stratos Genomics, Inc.High throughput nucleic acid sequencing by expansion
US8349565Mar 30, 2011Jan 8, 2013Stratos Genomics, Inc.High throughput nucleic acid sequencing by expansion
US8361714Sep 12, 2008Jan 29, 2013Asuragen, Inc.Micrornas differentially expressed in cervical cancer and uses thereof
US8362232Jan 29, 2013Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of SGLT2
US8372967May 7, 2007Feb 12, 2013Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of GCCR
US8377897Feb 19, 2013Isis Pharmaceuticals, Inc.Compositions and methods for non-parenteral delivery of oligonucleotides
US8389703 *Nov 2, 2011Mar 5, 2013Steven A. BennerRibonucleoside analogs with novel hydrogen bonding patterns
US8394780Mar 12, 2013Phigenix, Inc.Targeting PAX2 for the treatment of breast cancer
US8394947Mar 3, 2004Mar 12, 2013Isis Pharmaceuticals, Inc.Positionally modified siRNA constructs
US8426378Mar 19, 2009Apr 23, 2013Isis Pharmaceuticals, Inc.Oligomeric compounds comprising tricyclic nucelosides and methods for their use
US8431546Apr 30, 2013Phigenix, Inc.Targeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
US8440406May 14, 2013Luminex CorporationAmplification primers with non-standard bases for increased reaction specificity
US8440803May 14, 2013Isis Pharmaceuticals, Inc.Tetrahydropyran nucleic acid analogs
US8440810Feb 23, 2011May 14, 2013Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
US8445229May 21, 2013Morphotek, Inc.Methods of generating high-production of antibodies from hybridomas created by in vitro immunization
US8461101May 24, 2011Jun 11, 2013Phigenix, Inc.Targeting PAX2 for the treatment of breast cancer
US8465914Jun 18, 2013Asuragen, Inc.Method and compositions involving microRNA
US8501805Sep 23, 2009Aug 6, 2013Isis Pharmaceuticals, Inc.Substituted alpha-L-bicyclic nucleosides
US8507200Feb 11, 2008Aug 13, 2013Northwestern UniversityParticles for detecting intracellular targets
US8518671May 23, 2012Aug 27, 2013Luminex CorporationSolid support assay systems and methods utilizing non-standard bases
US8519117Mar 31, 2010Aug 27, 2013Luminex CorporationMaterials and methods for detection of nucleic acids
US8530640Feb 6, 2009Sep 10, 2013Isis Pharmaceuticals, Inc.Bicyclic cyclohexitol nucleic acid analogs
US8536320Feb 1, 2010Sep 17, 2013Isis Pharmaceuticals, Inc.Tetrahydropyran nucleic acid analogs
US8557767Aug 27, 2008Oct 15, 2013Uab Research FoundationSynthetic apolipoprotein E mimicking polypeptides and methods of use
US8563708Aug 10, 2007Oct 22, 2013Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8568766Feb 7, 2008Oct 29, 2013Gattadahalli M. AnantharamaiahPeptides and peptide mimetics to treat pathologies associated with eye disease
US8568971Sep 24, 2010Oct 29, 2013Asuragen, Inc.Methods and compositions involving microRNA
US8569474Mar 4, 2005Oct 29, 2013Isis Pharmaceuticals, Inc.Double stranded constructs comprising one or more short strands hybridized to a longer strand
US8604183Nov 4, 2003Dec 10, 2013Isis Pharmaceuticals, Inc.Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US8604192Sep 23, 2009Dec 10, 2013Isis Pharmaceuticals, Inc.Cyclohexenyl nucleic acids analogs
US8628914May 26, 2011Jan 14, 2014Qiagen Gaithersburg, Inc.Quantitative helicase assay
US8633149May 24, 2011Jan 21, 2014Phigenix, Inc.Targeting PAX2 for the treatment of breast cancer
US8642354Nov 11, 2010Feb 4, 2014Applied Biosystems, LlcFluid processing device for oligonucleotide synthesis and analysis
US8653021May 26, 2011Feb 18, 2014Phigenix, Inc.Targeting PAX2 for the treatment of breast cancer
US8673871May 7, 2007Mar 18, 2014Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression ApoB
US8691785Jan 7, 2013Apr 8, 2014Isis Pharmaceuticals, Inc.Compositions and methods for non-parenteral delivery of oligonucleotides
US8697860Jul 17, 2013Apr 15, 2014Isis Pharmaceuticals, Inc.Diagnosis and treatment of disease
US8703728Sep 8, 2004Apr 22, 2014Isis Pharmaceuticals, Inc.Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini
US8715938Aug 5, 2011May 6, 2014Life Technologies CorporationReversible di-nucleotide terminator sequencing
US8722583Apr 13, 2006May 13, 2014Nuevolution A/SMethod for selecting a chemical entity from a tagged library
US8735365Jan 13, 2011May 27, 2014Phigenix, Inc.Targeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
US8765709Aug 28, 2013Jul 1, 2014Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US8772474Dec 20, 2011Jul 8, 2014Alios Biopharma, Inc.Cyclic nucleotide analogs
US8778900Jan 24, 2005Jul 15, 2014Isis Pharmaceuticals, Inc.Modulation of eIF4E-BP1 expression
US8779118Jan 6, 2011Jul 15, 2014Isis Pharmaceuticals, Inc.Base modified bicyclic nucleosides and oligomeric compounds prepared therefrom
US8791053Sep 26, 2003Jul 29, 2014Mpm-Holding ApsSpatially encoded polymer matrix
US8791085May 28, 2010Jul 29, 2014Curna, Inc.Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US8791087Aug 20, 2010Jul 29, 2014Curna, Inc.Treatment of ‘C terminus of HSP70-interacting protein’ (CHIP)related diseases by inhibition of natural antisense transcript to CHIP
US8796437Apr 17, 2013Aug 5, 2014Isis Pharmaceuticals, Inc.Tetrahydropyran nucleic acid analogs
US8796443Sep 22, 2009Aug 5, 2014Rxi Pharmaceuticals CorporationReduced size self-delivering RNAi compounds
US8808984Jul 24, 2008Aug 19, 2014Neuvolution A/SMethod for synthesising templated molecules
US8815818Jul 17, 2009Aug 26, 2014Rxi Pharmaceuticals CorporationPhagocytic cell delivery of RNAI
US8846317Sep 18, 2012Sep 30, 2014Luminex CorporationSystems and methods for multiplex analysis of PCR in real time
US8846637Jun 2, 2011Sep 30, 2014Isis Pharmaceuticals, Inc.Substituted 2′-amino and 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
US8846639Apr 3, 2009Sep 30, 2014Isis Pharmaceutical, Inc.Oligomeric compounds comprising bicyclic nucleosides and having reduced toxicity
US8859515Jun 24, 2010Oct 14, 2014Curna, Inc.Treatment of tumor necrosis factor receptor 2 (TNFR2) related diseases by inhibition of natural antisense transcript to TNFR2
US8871469 *Aug 20, 2008Oct 28, 2014Steven Albert BennerSelf-avoiding molecular recognition systems in DNA priming
US8871737Sep 19, 2011Oct 28, 2014Alios Biopharma, Inc.Substituted nucleotide analogs
US8883752Oct 23, 2009Nov 11, 2014Isis Pharmaceuticals, Inc.5′ and 2′ BIS-substituted nucleosides and oligomeric compounds prepared therefrom
US8889350Mar 28, 2011Nov 18, 2014Swift Biosciences, Inc.Methods and compositions for isolating polynucleotides
US8895527May 21, 2010Nov 25, 2014Curna, Inc.Treatment of transcription factor E3 (TFE3) and insulin receptor substrate 2(IRS2) related diseases by inhibition of natural antisense transcript to TFE3
US8895528May 25, 2011Nov 25, 2014Curna, Inc.Treatment of atonal homolog 1 (ATOH1) related diseases by inhibition of natural antisense transcript to ATOH1
US8895712Oct 6, 2010Nov 25, 2014RikenArtificial base pair capable of forming specific base pair
US8912157Jan 6, 2011Dec 16, 2014Curna, Inc.Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US8916531Nov 20, 2008Dec 23, 2014Isis Pharmaceuticals, Inc.Modulation of CD40 expression
US8916538Mar 11, 2013Dec 23, 2014Vertex Pharmaceuticals IncorporatedSolid forms of a thiophosphoramidate nucleotide prodrug
US8921329Dec 3, 2009Dec 30, 2014Curna, Inc.Treatment of erythropoietin (EPO) related diseases by inhibition of natural antisense transcript to EPO
US8921330Jun 24, 2010Dec 30, 2014Curna, Inc.Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
US8921334Dec 29, 2010Dec 30, 2014Curna, Inc.Treatment of nuclear respiratory factor 1 (NRF1) related diseases by inhibition of natural antisense transcript to NRF1
US8927511Dec 2, 2009Jan 6, 2015Curna, Inc.Treatment of vascular endothelial growth factor (VEGF) related diseases by inhibition of natural antisense transcript to VEGF
US8932992Dec 9, 2008Jan 13, 2015Nuevolution A/STemplated molecules and methods for using such molecules
US8936913Sep 26, 2012Jan 20, 2015Luminex CorporationMethods for detection and typing of nucleic acids
US8940708Dec 23, 2010Jan 27, 2015Curna, Inc.Treatment of hepatocyte growth factor (HGF) related diseases by inhibition of natural antisense transcript to HGF
US8946177Nov 17, 2011Feb 3, 2015Mima Therapeutics, IncMethods and compositions involving miRNA and miRNA inhibitor molecules
US8946181Jan 4, 2011Feb 3, 2015Curna, Inc.Treatment of interferon regulatory factor 8 (IRF8) related diseases by inhibition of natural antisense transcript to IRF8
US8946182Jan 25, 2011Feb 3, 2015Curna, Inc.Treatment of RNASE H1 related diseases by inhibition of natural antisense transcript to RNASE H1
US8951981Jun 16, 2010Feb 10, 2015Curna, Inc.Treatment of paraoxonase 1 (PON1) related diseases by inhibition of natural antisense transcript to PON1
US8957037May 18, 2010Feb 17, 2015Curna, Inc.Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
US8957200Jun 6, 2011Feb 17, 2015Isis Pharmaceuticals, Inc.Bicyclic nucleosides and oligomeric compounds prepared therefrom
US8962585Dec 29, 2010Feb 24, 2015Curna, Inc.Treatment of tumor protein 63 (p63) related diseases by inhibition of natural antisense transcript to p63
US8962586Feb 21, 2011Feb 24, 2015Curna, Inc.Treatment of pyrroline-5-carboxylate reductase 1 (PYCR1) related diseases by inhibition of natural antisense transcript to PYCR1
US8969047Jul 24, 2013Mar 3, 2015Luminex CorporationSolid support assay systems and methods utilizing non-standard bases
US8969316Oct 26, 2012Mar 3, 2015Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of DGAT2
US8980856Apr 1, 2011Mar 17, 2015Curna, Inc.Treatment of colony-stimulating factor 3 (CSF3) related diseases by inhibition of natural antisense transcript to CSF3
US8980857May 14, 2011Mar 17, 2015Curna, Inc.Treatment of PAR4 related diseases by inhibition of natural antisense transcript to PAR4
US8980858May 25, 2011Mar 17, 2015Curna, Inc.Treatment of methionine sulfoxide reductase a (MSRA) related diseases by inhibition of natural antisense transcript to MSRA
US8980860Jul 13, 2011Mar 17, 2015Curna, Inc.Treatment of discs large homolog (DLG) related diseases by inhibition of natural antisense transcript to DLG
US8980865Dec 20, 2012Mar 17, 2015Alios Biopharma, Inc.Substituted nucleotide analogs
US8987225Nov 17, 2011Mar 24, 2015Curna, Inc.Treatment of NANOG related diseases by inhibition of natural antisense transcript to NANOG
US8987435Oct 23, 2009Mar 24, 2015Isis Pharmaceuticals, Inc.Oligomeric compounds and methods
US8993528Mar 21, 2013Mar 31, 2015Isis Pharmaceuticals, Inc.Oligomeric compounds comprising tricyclic nucelosides and methods for their use
US8993533Oct 5, 2011Mar 31, 2015Curna, Inc.Treatment of sialidase 4 (NEU4) related diseases by inhibition of natural antisense transcript to NEU4
US8993738Apr 26, 2011Mar 31, 2015Isis Pharmaceuticals, Inc.Modified nucleosides, analogs thereof and oligomeric compounds prepared therefrom
US8999947Aug 20, 2012Apr 7, 2015Northwestern UniversityNucleic acid functionalized nanoparticles for therapeutic applications
US9005906Jun 25, 2014Apr 14, 2015Isis Pharmaceuticals, Inc.Tetrahydropyran nucleic acid analogs
US9012139May 7, 2010Apr 21, 2015Curna, Inc.Treatment of dystrophin family related diseases by inhibition of natural antisense transcript to DMD family
US9012421Aug 5, 2010Apr 21, 2015Isis Pharmaceuticals, Inc.Bicyclic cyclohexose nucleic acid analogs
US9012427Mar 12, 2013Apr 21, 2015Alios Biopharma, Inc.Pharmaceutical combinations comprising a thionucleotide analog
US9023822Aug 25, 2010May 5, 2015Curna, Inc.Treatment of 'IQ motif containing GTPase activating protein' (IQGAP) related diseases by inhibition of natural antisense transcript to IQGAP
US9029335Oct 9, 2013May 12, 2015Isis Pharmaceuticals, Inc.Substituted 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
US9040678Aug 2, 2012May 26, 2015Illumina, Inc.Functionalization and purification of molecules by reversible group exchange
US9044493Aug 11, 2010Jun 2, 2015Curna, Inc.Treatment of Adiponectin related diseases by inhibition of natural antisense transcript to an Adiponectin
US9044494Apr 8, 2011Jun 2, 2015Curna, Inc.Treatment of fibroblast growth factor 21 (FGF21) related diseases by inhibition of natural antisense transcript to FGF21
US9045754May 7, 2007Jun 2, 2015Isis Pharmaceuticals, Inc.Short antisense compounds with gapmer configuration
US9051571Apr 16, 2014Jun 9, 2015Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US9061044Feb 20, 2014Jun 23, 2015Isis Pharmaceuticals, Inc.Modulation of transthyretin expression
US9068183Dec 23, 2010Jun 30, 2015Curna, Inc.Treatment of uncoupling protein 2 (UCP2) related diseases by inhibition of natural antisense transcript to UCP2
US9068219Aug 13, 2014Jun 30, 2015Asuragen, Inc.Methods and compositions involving miRNA and miRNA inhibitor molecules
US9073960Dec 20, 2012Jul 7, 2015Alios Biopharma, Inc.Substituted nucleosides, nucleotides and analogs thereof
US9074210Feb 12, 2010Jul 7, 2015Curna, Inc.Treatment of brain derived neurotrophic factor (BDNF) related diseases by inhibition of natural antisense transcript to BDNF
US9074211Nov 19, 2009Jul 7, 2015Rxi Pharmaceuticals CorporationInhibition of MAP4K4 through RNAI
US9080171Mar 24, 2011Jul 14, 2015RXi Parmaceuticals CorporationReduced size self-delivering RNAi compounds
US9080215Jan 7, 2013Jul 14, 2015Asuragen, Inc.MicroRNAs differentially expressed in cervical cancer and uses thereof
US9089588Jan 13, 2011Jul 28, 2015Curna, Inc.Treatment of sirtuin (SIRT) related diseases by inhibition of natural antisense transcript to a sirtuin (SIRT)
US9096636Nov 4, 2003Aug 4, 2015Isis Pharmaceuticals, Inc.Chimeric oligomeric compounds and their use in gene modulation
US9096895Feb 2, 2010Aug 4, 2015Exiqon A/SMethod for quantification of small RNA species
US9096951Jul 8, 2011Aug 4, 2015Nuevolution A/SMethod for producing second-generation library
US9109248Apr 25, 2012Aug 18, 2015Nuevolution A/SMethod for the synthesis of a bifunctional complex
US9121110Dec 19, 2003Sep 1, 2015Nuevolution A/SQuasirandom structure and function guided synthesis methods
US9127272Jan 18, 2012Sep 8, 2015Isis Pharmaceuticals, Inc.Oligomeric compounds and compositions for the use in modulation of target nucleic acids
US9127276May 1, 2014Sep 8, 2015Isis Pharmaceuticals, Inc.Conjugated antisense compounds and their use
US9133456Jun 5, 2014Sep 15, 2015Curna, Inc.Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
US9139554Oct 9, 2009Sep 22, 2015Tekmira Pharmaceuticals CorporationAmino lipids and methods for the delivery of nucleic acids
US9139827Nov 24, 2009Sep 22, 2015Northwestern UniversityPolyvalent RNA-nanoparticle compositions
US9145558Feb 27, 2015Sep 29, 2015Isis Pharmaceuticals, Inc.Compositions and methods for modulating HBV expression
US9150606Feb 9, 2005Oct 6, 2015Isis Pharmaceuticals, Inc.Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
US9155754May 6, 2010Oct 13, 2015Curna, Inc.Treatment of ABCA1 gene related diseases by inhibition of a natural antisense transcript to ABCA1
US9156873Apr 26, 2011Oct 13, 2015Isis Pharmaceuticals, Inc.Modified 5′ diphosphate nucleosides and oligomeric compounds prepared therefrom
US9163239Dec 30, 2014Oct 20, 2015Isis Pharmaceuticals, Inc.Compositions and methods for modulating apolipoprotein C-III expression
US9163285Dec 24, 2013Oct 20, 2015Curna, Inc.Treatment of tristetraproline (TTP) related diseases by inhibition of natural antisense transcript to TTP
US9173895Dec 15, 2010Nov 3, 2015Curna, Inc.Treatment of membrane bound transcription factor peptidase, site 1 (MBTPS1) related diseases by inhibition of natural antisense transcript to MBTPS1
US9175289May 15, 2014Nov 3, 2015Rxi Pharmaceuticals CorporationReduced size self-delivering RNAi compounds
US9181549Dec 30, 2014Nov 10, 2015Isis Pharmaceuticals, Inc.Conjugated antisense compounds and their use
US9181550Dec 31, 2014Nov 10, 2015Isis Pharmaceuticals, Inc.Compositions and methods for modulating apolipoprotein (a) expression
US9193991Sep 29, 2014Nov 24, 2015Luminex CorporationSystems and methods for multiplex analysis of PCR in real time
US9200277Jan 11, 2011Dec 1, 2015Curna, Inc.Treatment of sex hormone binding globulin (SHBG) related diseases by inhibition of natural antisense transcript to SHBG
US9205102Dec 4, 2014Dec 8, 2015The University Of British ColumbiaMethod for treatment of castration-resistant prostate cancer
US9212392Sep 25, 2013Dec 15, 2015Exact Sciences CorporationNormalization of polymerase activity
US9221864Mar 20, 2013Dec 29, 2015Isis Pharmaceuticals, Inc.Tricyclic nucleic acid analogs
US9222088Oct 20, 2011Dec 29, 2015Curna, Inc.Treatment of alpha-L-iduronidase (IDUA) related diseases by inhibition of natural antisense transcript to IDUA
US9234199Aug 5, 2010Jan 12, 2016Curna, Inc.Treatment of insulin gene (INS) related diseases by inhibition of natural antisense transcript to an insulin gene (INS)
US9243291Dec 3, 2012Jan 26, 2016Isis Pharmaceuticals, Inc.Methods of predicting toxicity
US9249455Apr 16, 2009Feb 2, 2016Luminex CorporationMethods for detection and quantification of small RNA
US9249458Oct 27, 2014Feb 2, 2016Steven Albert BennerSelf-avoiding molecular recognition systems in DNA priming
US9267136Nov 6, 2014Feb 23, 2016Curna, Inc.Treatment of pancreatic developmental gene related diseases by inhibition of natural antisense transcript to a pancreatic developmental gene
US9273949May 13, 2013Mar 1, 2016Vanderbilt UniversityBackscattering interferometric methods
US9278990Oct 21, 2014Mar 8, 2016Alios Biopharma, Inc.Substituted nucleotide analogs
US9284600Dec 6, 2013Mar 15, 2016Neuvolution A/SMethod for the synthesis of a bifunctional complex
US9290534Apr 3, 2009Mar 22, 2016Ionis Pharmaceuticals, Inc.Oligomeric compounds having at least one neutrally linked terminal bicyclic nucleoside
US9290766Apr 25, 2015Mar 22, 2016Curna, Inc.Treatment of adiponectin (ADIPOQ) related diseases by inhibition of natural antisense transcript to an adiponectin (ADIPOQ)
US9290816Nov 19, 2013Mar 22, 2016Firefly Bioworks Inc.Nucleic acid detection and quantification by post-hybridization labeling and universal encoding
US9310361Apr 8, 2011Apr 12, 2016Massachusetts Institute Of TechnologyMultifunctional encoded particles for high-throughput analysis
US9321799Feb 20, 2015Apr 26, 2016Ionis Pharmaceuticals, Inc.Modified nucleosides, analogs thereof and oligomeric compounds prepared therefrom
US20030059789 *Feb 9, 2002Mar 27, 2003Vladimir EfimovOligonucleotide analogues, methods of synthesis and methods of use
US20030109476 *Aug 7, 2002Jun 12, 2003Kmiec Eric B.Compositions and methods for the prevention and treatment of Huntington's disease
US20030119040 *Nov 7, 2002Jun 26, 2003Rosenblum Barnett B.Universal nucleotides for nucleic acid analysis
US20030180746 *Sep 27, 2002Sep 25, 2003Kmiec Eric B.Polymorphism detection and separation
US20030190646 *Dec 2, 2002Oct 9, 2003Wenz Hans MichaelMethods for detecting target nucleic acids using coupled ligation and amplification
US20030194705 *Mar 1, 2002Oct 16, 2003Schroth Gary P.Methods of using unnatural nucleobases for decoding
US20030207451 *Mar 7, 2003Nov 6, 2003Kmiec Eric B.Methods, compositions, and kits for enhancing oligonucleotide-mediated nucleic acid sequence alteration using compositions comprising a histone deacetylase inhibitor, lambda phage beta protein, or hydroxyurea
US20030224377 *Sep 4, 2002Dec 4, 2003Jesper WengelNovel LNA compositions and uses thereof
US20040014644 *Feb 7, 2003Jan 22, 2004Vladimir EfimovOligonucleotide analogues and methods of use for modulating gene expression
US20040092470 *Jun 18, 2003May 13, 2004Leonard Sherry A.Dry powder oligonucleotide formualtion, preparation and its uses
US20040096880 *Aug 7, 2003May 20, 2004Kmiec Eric B.Compositions and methods for the treatment of diseases exhibiting protein misassembly and aggregation
US20040106108 *Oct 15, 2001Jun 3, 2004Eragen Biosciences, Inc.Solid support assay systems and methods utilizing non-standard bases
US20040115665 *Nov 11, 2001Jun 17, 2004Yoshihide HayashizakiMethod for base sequencing and biologically active nucleic acids
US20040126770 *Dec 31, 2002Jul 1, 2004Gyanendra KumarRolling circle amplification of RNA
US20040158055 *Feb 12, 2003Aug 12, 2004Quanlai SongProtection of nucleosides
US20040166514 *Nov 19, 2003Aug 26, 2004Singulex, Inc.Detection of target molecules through interaction with probes
US20040214288 *Nov 14, 2003Oct 28, 2004Luigi GrassoMethods of generating high-production of antibodies from hybridomas created by in vitro immunization
US20040219565 *Oct 21, 2003Nov 4, 2004Sakari KauppinenOligonucleotides useful for detecting and analyzing nucleic acids of interest
US20040219576 *Jan 6, 2004Nov 4, 2004Third Wave Technologies, Inc.Reactive functional groups
US20040248103 *Jun 4, 2003Dec 9, 2004Feaver William JohnProximity-mediated rolling circle amplification
US20050026192 *Jun 2, 2004Feb 3, 2005Isis Pharmaceuticals, Inc.Oligonucleotide synthesis with alternative solvents
US20050032053 *Apr 25, 2003Feb 10, 2005Sampson Jeffrey R.Nucleic acid molecules with reduced secondary structure
US20050032055 *Apr 25, 2003Feb 10, 2005Sampson Jeffrey R.Methods of making nucleic acid molecules with reduced secondary structure
US20050037396 *Jun 25, 2004Feb 17, 2005Applera CorporationUniversal bases for nucleic acid analyses, methods for using universal bases, and kits comprising universal bases
US20050053951 *Sep 22, 2003Mar 10, 2005Breaker Ronald R.Riboswitches, methods for their use, and compositions for use with riboswitches
US20050059066 *Sep 8, 2004Mar 17, 2005Swayze Eric E.Gapped oligomeric compounds having linked bicyclic sugar moieties at the termini
US20050074771 *Jul 25, 2003Apr 7, 2005Isis Pharmaceuticals, Inc.Carbamate-derivatized nucleosides and oligonucleosides
US20050084894 *Oct 20, 2004Apr 21, 2005Promega CorporationMethods and compositions for nucleic acid analysis
US20050089889 *Jun 18, 2004Apr 28, 2005Ramsing Niels B.Probes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same
US20050096287 *Jun 25, 2004May 5, 2005Mehta Rahul C.Compositions and methods for topical delivery of oligonucleotides
US20050100921 *Sep 26, 2003May 12, 2005Kmiec Eric B.Genomics applications for modified OLIGO nucleotides
US20050164205 *Nov 19, 2003Jul 28, 2005Singulex, Inc.Charge and mass tags for detection and analysis
US20050181400 *Jan 24, 2005Aug 18, 2005Monia Brett P.Modulation of eIF4E-BP1 expression
US20050239089 *Jun 4, 2004Oct 27, 2005Johnson Martin DMobility cassettes
US20050260755 *Apr 6, 2005Nov 24, 2005Isis Pharmaceuticals, Inc.Sequential delivery of oligomeric compounds
US20050277138 *Apr 26, 2005Dec 15, 2005Third Wave Technologies, Inc.Reactive functional groups
US20060003333 *Nov 19, 2003Jan 5, 2006Singulex, Inc.Preparation of defined highly labeled probes
US20060078936 *Nov 19, 2005Apr 13, 2006Eragen Biosciences, Inc.Solid support assay systems and methods utilizing non-standard bases
US20060121470 *Jul 30, 2003Jun 8, 2006Henrik PedersenMulti-step synthesis of templated molecules
US20060127369 *Sep 26, 2003Jun 15, 2006Carlsberg A/SSpatially encoded polymer matrix
US20060147924 *Sep 11, 2003Jul 6, 2006Ramsing Neils BPopulation of nucleic acids including a subpopulation of lna oligomers
US20060153745 *Mar 29, 2005Jul 13, 2006Applera CorporationFluid processing device for oligonucleotide synthesis and analysis
US20060166227 *Jul 22, 2005Jul 27, 2006Stephen KingsmoreProtein expression profiling
US20060166238 *Dec 21, 2005Jul 27, 2006Ramsing Niels BProbes, libraries and kits for analysis of mixtures of nucleic acids and methods for constructing the same
US20060234266 *Mar 16, 2006Oct 19, 2006Eragen Biosciences, Inc.Methods for detecting multiple species and subspecies of Neisseria
US20060252091 *Jul 14, 2006Nov 9, 2006Eragen Biosciences, Inc.Materials and methods for detection of nucleic acids
US20060257902 *Mar 27, 2006Nov 16, 2006Ambion, Inc.Methods and compositions for depleting abundant RNA transcripts
US20060263794 *Mar 23, 2006Nov 23, 2006Applera CorporationMethods for detecting target nucleic acids using coupled ligation and amplification
US20060281102 *Feb 9, 2006Dec 14, 2006Puskas Robert SMethods for detecting genetic haplotypes by interaction with probes
US20060292603 *Apr 13, 2006Dec 28, 2006Gouliaev Alex HMethod for selecting a chemical entity from a tagged library
US20070031885 *Oct 12, 2006Feb 8, 2007Eragen Biosciences, Inc.Materials and methods for detection of nucleic acids
US20070059686 *Jul 28, 2006Mar 15, 2007Eragen Biosciences, Inc.Materials and methods for the detection of severe acute respiratory syndrome virus (SARS)
US20070065840 *Mar 23, 2006Mar 22, 2007Irena NaguibnevaNovel oligonucleotide compositions and probe sequences useful for detection and analysis of microRNAS and their target mRNAS
US20070087361 *Jul 20, 2006Apr 19, 2007Eragen Biosciences, Inc.Solid support assay systems and methods utilizing non-standard bases
US20070105099 *Jan 17, 2004May 10, 2007Eragen Biosciences, Inc.Nucleic acid amplification using non-standard bases
US20070117144 *Dec 21, 2006May 24, 2007Sakari KauppinenOligonucleotides useful for detecting and analyzing nucleic acids of interest
US20070122839 *Jan 29, 2007May 31, 2007Brow Mary AMethods and compositions for nucleic acid analysis
US20070123703 *Jan 29, 2007May 31, 2007Isis Pharmaceuticals, Inc.Chloral-free dca in oligonucleotide synthesis
US20070190564 *Jan 25, 2007Aug 16, 2007Rosenblum Barnett BUniversal nucleotides for nucleic acid analysis
US20070249049 *Jan 27, 2007Oct 25, 2007Swayze Eric E6-modified bicyclic nucleic acid analogs
US20070264694 *Apr 9, 2007Nov 15, 2007Eragen Biosciences, Inc.Use of non-standard bases and proximity effects for gene assembly and conversion of non-standard bases to standard bases during dna synthesis
US20070287831 *May 10, 2007Dec 13, 2007Isis Pharmaceuticals, Inc5'-modified bicyclic nucleic acid analogs
US20080026951 *Aug 11, 2007Jan 31, 2008David BrownMethods and Compositions Involving microRNA
US20080050744 *Aug 10, 2007Feb 28, 2008David BrownMethods and compositions involving mirna and mirna inhibitor molecules
US20080050842 *Oct 20, 2006Feb 28, 2008Golovlev Valeri VMethod of visualization and quanitification of biopolymer molecules immobilized on solid support
US20080063682 *Mar 23, 2007Mar 13, 2008Johanne CashmanPharmaceutical compositions and methods relating to inhibiting fibrous adhesions or inflammatory disease using low sulphate fucans
US20080131878 *Dec 5, 2006Jun 5, 2008Asuragen, Inc.Compositions and Methods for the Detection of Small RNA
US20080153097 *Nov 15, 2007Jun 26, 2008Eragen Biosciences, Inc.Methods and kits for detecting jak2 nucleic acid
US20080160529 *Oct 28, 2007Jul 3, 2008Promega CorporationMethods and Compositions for Nucleic Acid Analysis
US20080182245 *Aug 11, 2007Jul 31, 2008David BrownMethods and Compositions Involving MicroRNA
US20080274458 *May 1, 2007Nov 6, 2008Latham Gary JNucleic acid quantitation methods
US20080274462 *Apr 27, 2007Nov 6, 2008Applera CorporationUniversal bases for nucleic acid analyses, methods for using universal bases, and kits comprising universal bases
US20080299568 *Apr 23, 2008Dec 4, 2008Scott JohnsonMaterials and methods for detection of hepatitis c virus
US20080305481 *Dec 13, 2007Dec 11, 2008Luminex CorporationSystems and methods for multiplex analysis of pcr in real time
US20080305957 *Sep 17, 2004Dec 11, 2008Thomas ThistedMethod for Obtaining Structural Information Concerning an Encoded Molecule and Method for Selecting Compounds
US20080311669 *Jun 4, 2008Dec 18, 2008Northwestern UniversityScreening sequence selectivity of oligonucleotide-binding molecules using nanoparticle based colorimetric assay
US20090023594 *Nov 29, 2007Jan 22, 2009Exiqon A/SReagents for labelling nucleic acids and uses thereof
US20090029478 *Jan 10, 2007Jan 29, 2009Singulex, Inc.Detection of target molecules through interaction with probes
US20090035777 *Jun 19, 2008Feb 5, 2009Mark Stamatios KokorisHigh throughput nucleic acid sequencing by expansion
US20090053718 *Jul 28, 2008Feb 26, 2009Irena NaguibnevaNOVEL OLIGONUCLEOTIDE COMPOSITIONS AND PROBE SEQUENCES USEFUL FOR DETECTION AND ANALYSIS OF microRNAs AND THEIR TARGET mRNAs
US20090087434 *Sep 19, 2008Apr 2, 2009Anderson David JNfia in glial fate determination, glioma therapy and astrocytoma treatment
US20090088982 *Jul 31, 2004Apr 2, 2009Fukushima Noelle HCo-detection of single polypeptide and polynucleotide molecules
US20090092981 *Aug 15, 2008Apr 9, 2009Swayze Eric ETetrahydropyran nucleic acid analogs
US20090130666 *May 30, 2006May 21, 2009Applera CorporationCytometric system including nucleic acid sequence amplification, and method
US20090137504 *Dec 21, 2007May 28, 2009Soren Morgenthaler EchwaldMicrorna target site blocking oligos and uses thereof
US20090156792 *Dec 9, 2008Jun 18, 2009Seth Punit PBis-modified bicyclic nucleic acid analogs
US20090163434 *Apr 30, 2008Jun 25, 2009Bader Andreas GmiR-20 Regulated Genes and Pathways as Targets for Therapeutic Intervention
US20090171078 *Nov 20, 2008Jul 2, 2009Applied Biosystems Inc.Method of sequencing nucleic acids using elaborated nucleotide phosphorotiolate compounds
US20090176723 *Nov 14, 2005Jul 9, 2009David BrownMethods and compositions involving miRNA and miRNA inhibitor molecules
US20090186015 *Oct 17, 2008Jul 23, 2009Latham Gary JMicrornas differentially expressed in lung diseases and uses thereof
US20090186348 *Sep 12, 2008Jul 23, 2009Asuragen, Inc.Micrornas differentially expressed in cervical cancer and uses thereof
US20090192302 *Jul 30, 2009Isis Pharmaceuticals, Inc.5'-modified bicyclic nucleic acid analogs
US20090209625 *May 23, 2007Aug 20, 2009Sanjay BhanotModulation of chrebp expression
US20090226926 *May 1, 2009Sep 10, 2009Marshall David JMaterials and methods for detection of nucleic acids
US20090239211 *Feb 17, 2005Sep 24, 2009Nuevolution A/SMethod For Enrichment Involving Elimination By Mismatch Hybridisation
US20090239815 *Oct 19, 2007Sep 24, 2009Thomas LitmanNovel human microRNAs associated with cancer
US20090258925 *Dec 28, 2006Oct 15, 2009Claes WahlestedtNatural antisense and non-coding rna transcripts as drug targets
US20090258928 *Apr 8, 2009Oct 15, 2009Asuragen, Inc.Methods and compositions for diagnosing and modulating human papillomavirus (hpv)
US20090263797 *Nov 20, 2008Oct 22, 2009Applied Biosystems Inc.Reversible di-nucleotide terminator sequencing
US20090264300 *Dec 1, 2006Oct 22, 2009Nuevolution A/SEnzymatic encoding methods for efficient synthesis of large libraries
US20090274696 *Apr 29, 2009Nov 5, 2009WyethMethods for treating inflammation
US20090275039 *Nov 5, 2009Moser Michael JMethods for detection and quantification of small rna
US20090280188 *Jun 25, 2007Nov 12, 2009Northwestern UniversityAsymmetric functionalizated nanoparticles and methods of use
US20090281167 *Nov 12, 2009Jikui ShenCompositions and methods related to mirna modulation of neovascularization or angiogenesis
US20090292006 *May 7, 2007Nov 26, 2009Sanjay BhanotCompounds and methods for modulating expression of dgat2
US20090305253 *Dec 21, 2006Dec 10, 2009Breaker Ronald RMethods and Compositions Related to the Modulation of Riboswitches
US20090306179 *May 7, 2007Dec 10, 2009Isis Pharmaceuticals Inc.Compounds and methods for modulating expression of gcgr
US20090306357 *May 7, 2007Dec 10, 2009Sanjay BhanotCompounds and methods for modulating expression of gccr
US20090326041 *May 7, 2007Dec 31, 2009Isis Pharmaceuticals, Inc.Compounds and methods for modulating expression of sglt2
US20090326042 *May 7, 2007Dec 31, 2009Isis Pharmaceuticals, IncCompounds and methods for modulating expression of crp
US20090326049 *Dec 31, 2009Alexander AristarkhovBlocking oligos for inhibition of microrna and sirna activity and uses thereof
US20100015708 *Jan 21, 2010Mdrna, Inc.Ribonucleic acids with non-standard bases and uses thereof
US20100035968 *Jan 18, 2008Feb 11, 2010Exiqon A/SMediated cellular delivery of lna oligonucleotides
US20100041742 *Feb 18, 2010Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
US20100099858 *Sep 25, 2007Apr 22, 2010Mirkin Chad AMaximizing Oligonucleotide Loading on Gold Nanoparticle
US20100113284 *Apr 3, 2009May 6, 2010Alexander AristarkhovSmall interfering rna (sirna) target site blocking oligos and uses thereof
US20100121045 *Jan 14, 2010May 13, 2010Seth Punit PBis-modified bicyclic nucleic acid analogs
US20100137440 *Sep 11, 2007Jun 3, 2010Yale UniversityLysine riboswitches, structure-based compound design with lysine riboswitches, and methods and compositions for use of and with lysine riboswitches
US20100167290 *Feb 27, 2008Jul 1, 2010Robert ElghanianMolecule attachment to nanoparticles
US20100178604 *Nov 25, 2009Jul 15, 2010Samsung Electronics Co., Ltd.Electrophotographic toner and method of preparing the same
US20100184074 *Feb 8, 2010Jul 22, 2010Life Technologies CorporationUniversal nucleotides for nucleic acid analysis
US20100184159 *Jan 22, 2010Jul 22, 2010Applied Biosystems, LlcCompositions, Methods, and Kits for Selective Amplification of Nucleic Acids
US20100184966 *Jul 22, 2010Isis Pharmaceuticals, Inc.5'-modified bicyclic nucleic acid analogs
US20100216979 *May 5, 2010Aug 26, 2010Isis Pharmaceuticals, Inc.6-modified bicyclic nucleic acid analogs
US20100221702 *Sep 2, 2010Eragen Biosciences, Inc.Methods for detection and typing of nucleic acids
US20100221821 *May 29, 2008Sep 2, 2010Yale UniversityMethods and compositions related to riboswitches that control alternative splicing and rna processing
US20100228017 *Jan 7, 2008Sep 9, 2010Meyer Jr Rich BOligonucleotides containing pyrazolo[3,4-d] pyrimidines for hybridization and mismatch discrimination
US20100261175 *Jun 12, 2008Oct 14, 2010Exiqon A/SUse of short oligonucleotides for reagent redundancy experiments in rna functional analysis
US20100286082 *May 29, 2008Nov 11, 2010Yale UniversityRiboswitches and methods and compositions for use of and with riboswitches
US20100291570 *Mar 31, 2010Nov 18, 2010Marshall David JMaterials and methods for detection of nucleic acids
US20110053881 *Jul 1, 2008Mar 3, 2011Seth Punit P6-Disubstituted Or Unsaturated Bicyclic Nucleic Acid Analogs
US20110077390 *Feb 6, 2009Mar 31, 2011Isis Pharmaceuticals, Inc.Bicyclic cyclohexitol nucleic acid analogs
US20110087015 *Sep 10, 2004Apr 14, 2011RikenNucleoside and nucleotide having an unnatural base and use thereof
US20110092570 *Mar 19, 2009Apr 21, 2011Swayze Eric EOligomeric compounds comprising tricyclic nucelosides and methods for their use
US20110097764 *Apr 28, 2011Scott JohnsonAmplification primers with non-standard bases for increased reaction specificity
US20110104295 *May 5, 2011Arc Medical Devices, Inc.Pharmaceutical compositions and methods relating to inhibiting fibrous adhesions or inflammatory disease using low sulphate fucans
US20110104678 *May 5, 2011Michael James MoserPolymerase inhibitor and method of using same
US20110112170 *Apr 3, 2009May 12, 2011Isis Pharmaceuticals, Inc.Oligomeric compounds comprising bicyclic nucleosides and having reduced toxicity
US20110124524 *May 26, 2011Life Technologies CorporationFluid Processing Device for Oligonucleotide Synthesis and Analysis
US20110129832 *Oct 27, 2010Jun 2, 2011Swift Biosciences, Inc.Polynucleotide Primers and Probes
US20110130441 *Apr 3, 2009Jun 2, 2011Isis Pharmaceuticals, Inc.Oligomeric compounds having at least one neutrally linked terminal bicyclic nucleosides
US20110150854 *Jun 23, 2011Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
US20110152213 *Jun 23, 2011Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
US20110166205 *Sep 23, 2009Jul 7, 2011Seth Punit PSubstituted alpha-l-bicyclic nucleosides
US20110172294 *Sep 23, 2009Jul 14, 2011Seth Punit PCyclohexenyl nucleic acids analogs
US20110223161 *Sep 15, 2011Phigenix, Inc.Targeting pax2 for the treatment of breast cancer
US20110237787 *Sep 29, 2011Stratos Genomics, Inc.High throughput nucleic acid sequencing by expansion
US20140057269 *Jul 24, 2013Feb 27, 2014Luminex CorporationMaterials and Methods for Detection of Nucleic Acids
CN102124020B *Aug 19, 2009Apr 29, 2015史蒂文ˇ埃尔伯特ˇ奔纳Self-avoiding molecular recognition systems in DNA amplification
EP1072679A2 *Jul 19, 2000Jan 31, 2001Agilent Technologies Inc.Method of producing nucleic acid molecules with reduced secondary structure
EP1959012A2Dec 29, 2005Aug 20, 2008Exiqon A/SNovel oligonucleotide compositions and probe sequences useful for detection and analysis of microRNAs and their target mRNAs
EP2003207A2Jan 4, 2001Dec 17, 2008Isis Pharmaceuticals, Inc.Antisense inhibition of PTP1B expression
EP2090665A2Oct 19, 2007Aug 19, 2009Exiqon A/SNovel human microRNAs associated with cancer
EP2096170A1Sep 19, 2006Sep 2, 2009Johnson & Johnson Pharmaceutical Research & Development, L.L.C.Modulation of glucagon receptor expression
EP2133434A1Jun 12, 2008Dec 16, 2009Institut National de la Santé et de la Recherche Médicale (INSERM)Method for the detection of target nucleic acid
EP2147981A1Jul 25, 2008Jan 27, 2010Biotype AGKit and method for evaluating detection properties in amplification reactions
EP2174945A1Jul 30, 2002Apr 14, 2010Genzyme CorporationAntisense modulation of apolipoprotein B expression
EP2186897A1Mar 14, 2003May 19, 2010Nuevolution A/SAn improved method for synthesising templated molecules
EP2213291A1Jan 4, 2001Aug 4, 2010Isis Pharmaceuticals, Inc.Antisense inhibition of PTP1B expression
EP2218727A1Jun 2, 2004Aug 18, 2010Isis Pharmaceuticals, Inc.Modulation of C-reactive protein expression
EP2221376A2Jun 19, 2002Aug 25, 2010Isis Pharmaceuticals, Inc.Antisense modulation of superoxide dismutase 1, soluble expression
EP2233494A1Sep 22, 2003Sep 29, 2010Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
EP2239327A2Aug 11, 2006Oct 13, 2010Synthetic Genomics, Inc.Method for in vitro recombination
EP2241572A2Jun 3, 2004Oct 20, 2010Eli Lilly And CompanyModulation of survivin expression
EP2246443A1May 13, 2002Nov 3, 2010Isis Pharmaceuticals, Inc.Antisense modulation of PTP1B expression
EP2253706A2Nov 17, 2004Nov 24, 2010Isis Pharmaceuticals, Inc.Antisense modulation of kinesin-like 1 expression
EP2256200A2Sep 17, 2004Dec 1, 2010ISIS Pharmaceuticals, Inc.Modulation of eIF4E expression
EP2256201A2Sep 17, 2004Dec 1, 2010ISIS Pharmaceuticals, Inc.Modulation of eIF4E expression
EP2261371A2Dec 19, 2003Dec 15, 2010QIAGEN GmbHNucleic acid amplification
EP2266997A1Jun 2, 2004Dec 29, 2010Isis Pharmaceuticals, Inc.Modulation of C-reactive protein expression
EP2270024A1Jun 19, 2002Jan 5, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of superoxide dismutase 1, soluble expression
EP2270230A2Oct 7, 2002Jan 5, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of insulin-like growth factor binding protein 5 expression
EP2270231A2Oct 7, 2002Jan 5, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of insulin-like growth factor binding protein 5 expression
EP2272857A1Apr 28, 2004Jan 12, 2011ISIS Pharmaceuticals, Inc.Modulation of glucagon receptor expression
EP2272958A1Sep 25, 2003Jan 12, 2011ISIS Pharmaceuticals, Inc.Modulation of forkhead box O1A expression
EP2272985A1Aug 5, 2002Jan 12, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of apolipoprotein (A) expression
EP2280019A1Jul 15, 2002Feb 2, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of C-reactive protein expression
EP2281869A2Mar 19, 2004Feb 9, 2011ISIS Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 1 expression
EP2281885A1Aug 26, 2004Feb 9, 2011Ophthotech CorporationCombination therapy for the treatment of ocular neovascular disorders
EP2284267A2Aug 18, 2004Feb 16, 2011Isis Pharmaceuticals, Inc.Modulation of diacylglycerol acyltransferase 2 expression
EP2292259A2Nov 13, 2003Mar 9, 2011MUSC Foundation For Research DevelopmentComplement receptor 2 targeted complement modulators
EP2298829A1May 31, 2006Mar 23, 2011École Polytechnique Fédérale De LausanneTriblock copolymers for cytoplasmic delivery of gene-based drugs
EP2314594A1Jan 27, 2007Apr 27, 2011Isis Pharmaceuticals, Inc.6-modified bicyclic nucleic acid analogs
EP2316968A1Aug 5, 2002May 4, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of apolipoprotein (A) expression
EP2322535A2Sep 22, 2003May 18, 2011Yale UniversityRiboswitches, methods for their use, and compositions for use with riboswitches
EP2325315A1Oct 27, 2006May 25, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of huntingtin gene
EP2327709A2Apr 28, 2004Jun 1, 2011ISIS Pharmaceuticals, Inc.Modulation of glucagon receptor expression
EP2329830A2Jan 4, 2001Jun 8, 2011ISIS Pharmaceuticals, Inc.Antisense inhibition of PTP1B expression
EP2332951A2Jan 27, 2007Jun 15, 2011ISIS Pharmaceuticals, Inc.6-modified bicyclic nucleic acid analogs
EP2332955A2Jul 15, 2002Jun 15, 2011ISIS Pharmaceuticals, Inc.Antisense modulation of acyl CoA cholesterol acyltransferase-2 expression
EP2336145A1Jul 30, 2002Jun 22, 2011Genzyme CorporationAntisense modulation of apolipoprotein B expression
EP2336315A2Dec 1, 2006Jun 22, 2011Nuevolution A/SEnzymatic encoding methods for efficient synthesis of large libraries
EP2336317A1Jun 14, 2004Jun 22, 2011Alnylam Europe AGDouble-stranded ribonucleic acid with increased effectiveness in an organism
EP2336318A1Nov 13, 2003Jun 22, 2011Genzyme CorporationAntisense modulation of apolipoprotein B expression
EP2336319A1Nov 13, 2003Jun 22, 2011Genzyme CorporationAntisense modulation of apolipoprotein B expression
EP2338991A2Aug 29, 2006Jun 29, 2011Regulus Therapeutics, IncMethods for use in modulating MIR-122a
EP2341057A2Sep 14, 1998Jul 6, 2011Exiqon A/SOligonucleotide Analogues
EP2341058A2Sep 14, 1998Jul 6, 2011Exiqon A/SOligonucleotide Analogues
EP2341140A1Dec 1, 2006Jul 6, 2011Nuevolution A/SEnzymatic encoding methods for efficient synthesis of large libraries
EP2348124A2Oct 30, 2003Jul 27, 2011Nuevolution A/SSynthesis of a bifunctional complex
EP2348125A2Oct 30, 2003Jul 27, 2011Nuevolution A/SMethod for the synthesis of a bifunctional complex
EP2363134A1Nov 7, 2006Sep 7, 2011Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor V Leiden mutant gene
EP2363480A2Jan 20, 2005Sep 7, 2011Isis Pharmaceuticals, Inc.Modulation of glucocorticoid receptor expression
EP2363503A1Nov 21, 2003Sep 7, 2011ISIS Pharmaceuticals, Inc.Modulation of HIF1A and HIF2A expression
EP2365094A1May 13, 2002Sep 14, 2011Isis Pharmaceuticals, Inc.Antisense modulation of PTP1B expression
EP2368988A1Sep 19, 2006Sep 28, 2011Isis Pharmaceuticals, Inc.Modulation of Glucocorticoid Receptor Expression
EP2382997A1Sep 15, 2005Nov 2, 2011Alnylam PharmaceuticalsCompositions and methods for inhibiting expression of anti-apoptotic genes
EP2388318A1Dec 9, 2002Nov 23, 2011Isis Pharmaceuticals, Inc.Antisense modulation of connective tissue growth factor expression
EP2388326A1Sep 19, 2006Nov 23, 2011Isis Pharmaceuticals, Inc.Modulation of glucagon receptor expression
EP2388327A1Jan 27, 2007Nov 23, 2011Isis Pharmaceuticals, Inc.Oligomeric compounds and compositions for the use in modulation of micrornas
EP2388328A1Jan 27, 2007Nov 23, 2011Isis Pharmaceuticals, Inc.Oligomeric compounds and compositions for the use in modulation of micrornas
EP2392583A1May 18, 2007Dec 7, 2011Alnylam Europe AG.RNAi modulation of Aha and therapeutic uses thereof
EP2392645A1Oct 16, 2006Dec 7, 2011MUSC Foundation For Research DevelopmentTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
EP2392646A1Oct 16, 2006Dec 7, 2011MUSC Foundation For Research DevelopmentTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
EP2392647A1Oct 16, 2006Dec 7, 2011MUSC Foundation For Research DevelopmentTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
EP2395076A1Oct 16, 2006Dec 14, 2011MUSC Foundation For Research DevelopmentTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
EP2402435A2Oct 16, 2006Jan 4, 2012MUSC Foundation For Research DevelopmentTargeting PAX2 for the induction of DEFB1-mediated tumor immunity and cancer therapy
EP2410049A1Feb 26, 2003Jan 25, 2012Third Wave Technologies, Inc.RNA detection enzymes
EP2410332A1Nov 21, 2003Jan 25, 2012The University Of UtahMethod for identifying purinergic modulators of the olfactory system
EP2426218A1May 29, 2008Mar 7, 2012Yale UniversityRiboswitches and methods and compositions for use of and with riboswitches
EP2426219A1May 29, 2008Mar 7, 2012Yale UniversityRiboswitches and methods and compositions for use of and with riboswitches
EP2441449A1Apr 15, 2004Apr 18, 2012Isis Pharmaceuticals, Inc.Modulation of apolipoprotein C-III expression
EP2444482A1Nov 3, 2004Apr 25, 2012Isis Pharmaceuticals, Inc.Modulation of SGLT2 expression
EP2447274A2Oct 23, 2009May 2, 2012Isis Pharmaceuticals, Inc.Oligomeric compounds and methods
EP2458011A1Sep 29, 2006May 30, 2012Life Technologies CorporationCompositions, methods, and kits for amplifying nucleic acids
EP2468865A1Sep 30, 2004Jun 27, 2012Isis Pharmaceuticals, Inc.Antisense oligonucleotide modulation of stat3 expression
EP2471925A1Mar 22, 2008Jul 4, 2012Yale UniversityMethods and compositions related to riboswitches that control alternative splicing
EP2489746A1Jun 6, 2006Aug 22, 2012Luminex CorporationMethods for detection and typing of nucleic acids
EP2492282A1Feb 27, 2004Aug 29, 2012Isis Pharmaceuticals, Inc.Modulation of growth hormone receptor expression and insulin-like growth factor expression
EP2527444A2Sep 30, 2004Nov 28, 2012Isis Pharmaceuticals, Inc.Antisense oligonucleotide modulation of stat3 expression
EP2530157A2Jul 30, 2004Dec 5, 2012Regulus Therapeutics, IncOligomeric compounds and compositions for use in modulation of small non-coding rnas
EP2540734A2Apr 5, 2005Jan 2, 2013Alnylam Pharmaceuticals, Inc.Process and reagents for oligonucleotide synthesis and purification
EP2584051A1May 21, 2007Apr 24, 2013Alnylam Pharmaceuticals Inc.Compositions and methods for inhibiting expressions of IKK-B gene
EP2617828A1Dec 10, 2008Jul 24, 2013Alnylam Pharmaceuticals Inc.Compositions and methods for inhibiting expression of factor VII gene
EP2623104A1Mar 19, 2010Aug 7, 2013Alios Biopharma, Inc.Substituted nucleoside and nucleotide analogs
EP2634266A1May 21, 2010Sep 4, 2013Asuragen, INC.Mirna biomarkers of prostate disease
EP2690175A2Sep 2, 2009Jan 29, 2014Alnylam PharmaceuticalsCompositions and methods for combined inhibition of mutant EGFR gene and IL-6 expression
EP2700720A2Mar 15, 2005Feb 26, 2014Isis Pharmaceuticals, Inc.Compositions and methods for optimizing cleavage of RNA by RNASE H
EP2708608A1Jan 11, 2012Mar 19, 2014Seegene, Inc.Detection of target nucleic acid sequences by pto cleavage and extension assay
EP2712926A2Mar 5, 2009Apr 2, 2014Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of Eg5 and VEGF genes
EP2743265A1Oct 9, 2009Jun 18, 2014Tekmira Pharmaceuticals CorporationImproved amino lipids and methods for the delivery of nucleic acids
EP2756845A1Apr 5, 2010Jul 23, 2014Dicerna Pharmaceuticals, Inc.Methods and compositions for the specific inhibition of KRAS by asymmetric double-stranded RNA
EP2770065A1Feb 24, 2014Aug 27, 2014Seegene, Inc.Detection of nucleotide variation on target nucleic acid sequence
EP2775300A2Aug 27, 2010Sep 10, 2014Asuragen, INC.miRNA Biomarkers of Lung Disease
EP2810643A2Aug 13, 2010Dec 10, 2014Alnylam Pharmaceuticals Inc.Lipid formulated compositions and mehods for inhibiting expression of a gene from the ebola virus
EP2826863A1May 30, 2008Jan 21, 2015Northwestern UniversityNucleic acid functionalized nanoparticles for therapeutic applications
EP2826868A1Jan 11, 2012Jan 21, 2015Seegene, Inc.Detection of target nucleic acid sequences by pto cleavage and extension assay
EP2848688A1Dec 10, 2008Mar 18, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of factor VII gene
EP2857526A1Dec 13, 2007Apr 8, 2015Luminex CorporationSystems and methods for multiplex analysis of PCR in real time
EP2905336A1Mar 25, 2008Aug 12, 2015Alnylam Pharmaceuticals Inc.Compositions and methods for inhibiting expression of a gene from the ebola
EP2913341A1Dec 21, 2007Sep 2, 2015University of Utah Research FoundationMethod of detecting ocular diseases and pathologic conditions and treatment of same
EP2937418A1Oct 20, 2009Oct 28, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of transthyretin
EP2952587A1Jun 19, 2008Dec 9, 2015Stratos Genomics Inc.High throughput nucleic acid sequencing by expansion
EP2957636A2Jan 13, 2011Dec 23, 2015CuRNA, Inc.Treatment of sirtuin (sirt) related diseases by inhibition of natural antisense transcript to a sirtuin (sirt)
EP2963116A2Mar 3, 2010Jan 6, 2016CuRNA, Inc.Treatment of sirtuin 1 (sirt1) related diseases by inhibition of natural antisense transcript to sirt 1
EP2982753A1Apr 20, 2009Feb 10, 2016Baxter International IncMicrosphere-based composition for preventing and/or reversing new-onset autoimmune diabetes
EP2987864A1Jan 29, 2010Feb 24, 2016Stratos Genomics Inc.High throughput nucleic acid sequencing by expansion and related methods
EP3002007A1Apr 15, 2004Apr 6, 2016Ionis Pharmaceuticals, Inc.Modulation of apolipoprotein c-iii expression
EP3002297A2Nov 29, 2010Apr 6, 2016F. Hoffmann-La Roche AGAntibodies for treating and diagnosing tumors expressing slc34a2 (tat211)
EP3009150A1Feb 12, 2010Apr 20, 2016CuRNA, Inc.Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
WO2000018781A1Sep 23, 1999Apr 6, 2000Isis Pharmaceuticals, Inc.Antisense modulation of survivin expression
WO2002044195A2 *Nov 28, 2001Jun 6, 2002RikenMethod for base sequencing and biologically active nucleic acids
WO2002044195A3 *Nov 28, 2001Mar 27, 2003Dnaform KkMethod for base sequencing and biologically active nucleic acids
WO2002072790A2Mar 14, 2002Sep 19, 2002Myriad Genetics, IncTsg101-gag interaction and use thereof
WO2003020739A2Sep 4, 2002Mar 13, 2003Exiqon A/SNovel lna compositions and uses thereof
WO2003070904A2Feb 19, 2003Aug 28, 2003Isis Pharmaceuticals, Inc.Human rnase iii and compositions and uses thereof
WO2003074544A1 *Feb 27, 2003Sep 12, 2003Applera CorporationMethods of using unnatural nucleobases for decoding
WO2003078630A1Mar 20, 2003Sep 25, 2003Biostratum AbINHIBITION OF THE β3 SUBUNIT OF L-TYPE CA2+ CHANNELS
WO2004044138A2Nov 4, 2003May 27, 2004Isis Pharmaceuticals, Inc.Chimeric oligomeric compounds and their use in gene modulation
WO2004045520A2Nov 13, 2003Jun 3, 2004Musc Foundation For Research DevelopmentComplement receptor 2 targeted complement modulators
WO2004072284A1Feb 11, 2004Aug 26, 2004Antisense Therapeutics LtdModulation of insulin like growth factor i receptor expression
WO2005014782A2Jun 14, 2004Feb 17, 2005Alnylam Europe Ag.,Double-stranded ribonucleic acid with increased effectiveness in an organism
WO2005035548A1Oct 11, 2004Apr 21, 2005Meditech Research LimitedThe moduilation of hyaluronan synthesis and degradation in the treatment of disease
WO2005083124A1Sep 30, 2004Sep 9, 2005Isis Pharmaceuticals, Inc.Antisense oligonucleotide modulation of stat3 expression
WO2006110314A2Mar 27, 2006Oct 19, 2006Ambion, Inc.Methods and compositions for depleting abundant rna transcripts
WO2007008300A2May 31, 2006Jan 18, 2007ECOLE POLYTECHNIQUE FéDéRALE DE LAUSANNETriblock copolymers for cytoplasmic delivery of gene-based drugs
WO2007115168A2Mar 30, 2007Oct 11, 2007Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of eg5 gene
WO2008098248A2Feb 11, 2008Aug 14, 2008Northwestern UniversityParticles for detecting intracellular targets
WO2010021702A1Aug 19, 2009Feb 25, 2010Steven Albert BennerSelf-avoiding molecular recognition systems in dna amplification
WO2010042281A2Aug 25, 2009Apr 15, 2010Excaliard PharmaceuticalsAntisense oligonucleotides directed against connective tissue growth factor and uses thereof
WO2010065787A2Dec 3, 2009Jun 10, 2010Curna, Inc.Treatment of tumor suppressor gene related diseases by inhibition of natural antisense transcript to the gene
WO2010065792A2Dec 3, 2009Jun 10, 2010Curna, Inc.Treatment of erythropoietin (epo) related diseases by inhibition of natural antisense transcript to epo
WO2010068816A1Dec 10, 2009Jun 17, 2010Alnylam Pharmaceuticals, Inc.Gnaq targeted dsrna compositions and methods for inhibiting expression
WO2010088273A1Jan 27, 2010Aug 5, 2010Qiagen GaithersburgThermophilic helicase dependent amplification technology with endpoint homogenous fluorescent detection
WO2010088537A2Jan 29, 2010Aug 5, 2010Alnylam Pharmaceuticals, Inc.Improved lipid formulation
WO2010090969A1Feb 1, 2010Aug 12, 2010Isis Pharmaceuticals, Inc.Tetrahydropyran nucleic acid analogs
WO2010091308A2Feb 5, 2010Aug 12, 2010Isis Pharmaceuticals, Inc.Oligomeric compounds and methods
WO2010093904A2Feb 12, 2010Aug 19, 2010Curna, Inc.Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
WO2010093906A2Feb 12, 2010Aug 19, 2010Curna, Inc.Treatment of glial cell derived neurotrophic factor (gdnf) related diseases by inhibition of natural antisense transcript to gdnf
WO2010099341A1Feb 25, 2010Sep 2, 2010Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of mig-12 gene
WO2010105209A1Mar 12, 2010Sep 16, 2010Alnylam Pharmaceuticals, Inc.LIPID FORMULATED COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 AND VEGF GENES
WO2010107733A2Mar 16, 2010Sep 23, 2010Curna, Inc.Treatment of nuclear factor (erythroid-derived 2)-like 2 (nrf2) related diseases by inhibition of natural antisense transcript to nrf2
WO2010107740A2Mar 16, 2010Sep 23, 2010Curna, Inc.Treatment of delta-like 1 homolog (dlk1) related diseases by inhibition of natural antisense transcript to dlk1
WO2010129746A2May 6, 2010Nov 11, 2010Curna, Inc.Treatment of tristetraproline (ttp) related diseases by inhibition of natural antisense transcript to ttp
WO2010132665A1May 13, 2010Nov 18, 2010Yale UniversityGemm riboswitches, structure-based compound design with gemm riboswitches, and methods and compositions for use of and with gemm riboswitches
WO2010135329A2May 18, 2010Nov 25, 2010Curna, Inc.Treatment of reprogramming factor related diseases by inhibition of natural antisense transcript to a reprogramming factor
WO2010138806A2May 28, 2010Dec 2, 2010Curna, Inc.Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
WO2010148050A2Jun 16, 2010Dec 23, 2010Curna, Inc.Treatment of collagen gene related diseases by inhibition of natural antisense transcript to a collagen gene
WO2010148065A2Jun 16, 2010Dec 23, 2010Curna, Inc.Treatment of paraoxonase 1 (pon1) related diseases by inhibition of natural antisense transcript to pon1
WO2010151671A2Jun 24, 2010Dec 29, 2010Curna, Inc.Treatment of tumor necrosis factor receptor 2 (tnfr2) related diseases by inhibition of natural antisense transcript to tnfr2
WO2010151674A2Jun 24, 2010Dec 29, 2010Curna, Inc.Treatment of down syndrome gene related diseases by inhibition of natural antisense transcript to a down syndrome gene
WO2011017516A2Aug 5, 2010Feb 10, 2011Curna, Inc.Treatment of insulin gene (ins) related diseases by inhibition of natural antisense transcript to an insulin gene (ins)
WO2011017521A2Aug 5, 2010Feb 10, 2011Isis Pharmaceuticals, Inc.Bicyclic cyclohexose nucleic acid analogs
WO2011022420A1Aug 17, 2010Feb 24, 2011Yale UniversityMethylation biomarkers and methods of use
WO2011028950A1Sep 2, 2010Mar 10, 2011Genentech, Inc.Mutant smoothened and methods of using the same
WO2011043385A1Oct 6, 2010Apr 14, 2011RikenArtificial base pair capable of forming specific base pair
WO2011050194A1Oct 21, 2010Apr 28, 2011Genentech, Inc.Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
WO2011056215A1Nov 3, 2010May 12, 2011Landers James PVersatile, visible method for detecting polymeric analytes
WO2011056687A2Oct 27, 2010May 12, 2011Swift Biosciences, Inc.Polynucleotide primers and probes
WO2011063403A1Nov 23, 2010May 26, 2011Swift Biosciences, Inc.Devices to extend single stranded target molecules
WO2011066503A2Nov 29, 2010Jun 3, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
WO2011079261A2Dec 23, 2010Jun 30, 2011Curna, Inc.Treatment of hepatocyte growth factor (hgf) related diseases by inhibition of natural antisense transcript to hgf
WO2011079263A2Dec 23, 2010Jun 30, 2011Curna, Inc.Treatment of uncoupling protein 2 (ucp2) related diseases by inhibition of natural antisense transcript to ucp2
WO2011082409A2Jan 4, 2011Jul 7, 2011Curna, Inc.Treatment of interferon regulatory factor 8 (irf8) related diseases by inhibition of natural antisense transcript to irf8
WO2011084455A2Dec 15, 2010Jul 14, 2011Opko Curna, Llc.Treatment of membrane bound transcription factor peptidase, site 1 (mbtps1) related diseases by inhibition of natural antisense transcript to mbtps1
WO2011085102A1Jan 6, 2011Jul 14, 2011Isis Pharmaceuticals, Inc.Base modified bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2011085347A2Jan 11, 2011Jul 14, 2011Opko Curna, LlcTreatment of sex hormone binding globulin (shbg) related diseases by inhibition of natural antisense transcript to shbg
WO2011088076A2Jan 12, 2011Jul 21, 2011Yale UniversityStructured rna motifs and compounds and methods for their use
WO2011090740A2Dec 29, 2010Jul 28, 2011Opko Curna, LlcTreatment of nuclear respiratory factor 1 (nrf1) related diseases by inhibition of natural antisense transcript to nrf1
WO2011090741A2Dec 29, 2010Jul 28, 2011Opko Curna, LlcTREATMENT OF TUMOR PROTEIN 63 (p63) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO p63
WO2011097407A1Feb 3, 2011Aug 11, 2011Ico Therapeutics Inc.Dosing regimens for treating and preventing ocular disorders using c-raf antisense
WO2011103528A2Feb 21, 2011Aug 25, 2011Opko Curna LlcTreatment of pyrroline-5-carboxylate reductase 1 (pycr1) related diseases by inhibition of natural antisense transcript to pycr1
WO2011105900A2Feb 23, 2011Sep 1, 2011Academisch Ziekenhuis Bij De Universiteit Van AmsterdamAntagonists of complement component 8-alpha (c8-alpha) and uses thereof
WO2011105901A2Feb 23, 2011Sep 1, 2011Academisch Ziekenhuis Bij De Universiteit Van AmsterdamAntagonists of complement component 9 (c9) and uses thereof
WO2011105902A2Feb 23, 2011Sep 1, 2011Academisch Ziekenhuis Bij De Universiteit Van AmsterdamAntagonists of complement component 8-beta (c8-beta) and uses thereof
WO2011106297A2Feb 22, 2011Sep 1, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
WO2011112516A1Mar 7, 2011Sep 15, 2011Ico Therapeutics Inc.Treating and preventing hepatitis c virus infection using c-raf kinase antisense oligonucleotides
WO2011113054A2Mar 14, 2011Sep 15, 2011Aurasense LlcCrosslinked polynucleotide structure
WO2011115817A1Mar 10, 2011Sep 22, 2011Isis Pharmaceuticals, Inc.Methods of preparing 2'-o-substituted purine nucleosides
WO2011115818A1Mar 10, 2011Sep 22, 2011Isis Pharmaceuticals, Inc.5'-substituted bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2011127933A1Apr 16, 2011Oct 20, 2011Nuevolution A/SBi-functional complexes and methods for making and using such complexes
WO2011133695A2Apr 20, 2011Oct 27, 2011Swift Biosciences, Inc.Materials and methods for nucleic acid fractionation by solid phase entrapment and enzyme-mediated detachment
WO2011133868A2Apr 22, 2011Oct 27, 2011Alnylam Pharmaceuticals, Inc.Conformationally restricted dinucleotide monomers and oligonucleotides
WO2011133876A2Apr 22, 2011Oct 27, 2011Alnylam Pharmaceuticals, Inc.Oligonucleotides comprising acyclic and abasic nucleosides and analogs
WO2011139695A2Apr 26, 2011Nov 10, 2011Isis Pharmaceuticals, Inc.Modified 5' diphosphate nucleosides and oligomeric compounds prepared therefrom
WO2011139699A2Apr 26, 2011Nov 10, 2011Isis Pharmaceuticals, Inc.5' modified nucleosides and oligomeric compounds prepared therefrom
WO2011139702A2Apr 26, 2011Nov 10, 2011Isis Pharmaceuticals, Inc.Modified nucleosides and oligomeric compounds prepared therefrom
WO2011139911A2Apr 29, 2011Nov 10, 2011Isis Pharmaceuticals, Inc.Lipid formulated single stranded rna
WO2011139985A1May 2, 2011Nov 10, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
WO2011150226A1May 26, 2011Dec 1, 2011Landers James PMethod for detecting nucleic acids based on aggregate formation
WO2011150227A1May 26, 2011Dec 1, 2011Qiagen Gaithersburg, Inc.Quantitative helicase assay
WO2011156202A1Jun 2, 2011Dec 15, 2011Isis Pharmaceuticals, Inc.Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2011156278A1Jun 6, 2011Dec 15, 2011Isis Pharmaceuticals, Inc.Bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2011163466A1Jun 23, 2011Dec 29, 2011The United States Of America, As Represented By The Secretary, Department Of Health And Human ServicesRegulation of skin pigmentation by neuregulin-1 (nrg-1)
WO2012003330A2Jun 30, 2011Jan 5, 2012Stratos Genomics, IncMultiplexed identification of nucleic acid sequences
WO2012021554A1Aug 9, 2011Feb 16, 2012Yale UniversityCyclic di-gmp-ii riboswitches, motifs, and compounds, and methods for their use
WO2012047956A2Oct 5, 2011Apr 12, 2012Opko Curna LlcTreatment of sialidase 4 (neu4) related diseases by inhibition of natural antisense transcript to neu4
WO2012047968A2Oct 5, 2011Apr 12, 2012Genentech, Inc.Mutant smoothened and methods of using the same
WO2012054723A2Oct 20, 2011Apr 26, 2012Opko Curna LlcTreatment of alpha-l-iduronidase (idua) related diseases by inhibition of natural antisense transcript to idua
WO2012058647A1Oct 28, 2011May 3, 2012Life Technologies CorporationChemically-enhanced primer compositions, methods and kits
WO2012061832A1Nov 7, 2011May 10, 2012Illumina, Inc.Linking sequence reads using paired code tags
WO2012064824A1Nov 9, 2011May 18, 2012Alnylam Pharmaceuticals, Inc.Lipid formulated compositions and methods for inhibiting expression of eg5 and vegf genes
WO2012078209A1Jun 16, 2011Jun 14, 2012The United States Of America, As Represented By The Secretary, Department Of Health And Human ServicesDiagnosis and treatment of adrenocortical tumors using human microrna-483
WO2012079046A2Dec 9, 2011Jun 14, 2012Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of klf-1 and bcl11a genes
WO2012096523A2Jan 11, 2012Jul 19, 2012Seegene, Inc.Detection of target nucleic acid sequences by pto cleavage and extension assay
WO2012103545A1Jan 30, 2012Aug 2, 2012Illumina, Inc.Oligonucleotide replacement for di-tagged and directional libraries
WO2012106509A1Feb 2, 2012Aug 9, 2012The Trustees Of Princeton UniversitySirtuin modulators as virus production modulators
WO2012109395A1Feb 8, 2012Aug 16, 2012Isis Pharmaceuticals, Inc.Oligomeric compounds comprising bicyclic nucleotides and uses thereof
WO2012149154A1Apr 26, 2012Nov 1, 2012Swift Biosciences, Inc.Polynucleotide primers and probes
WO2012151268A1May 2, 2012Nov 8, 2012University Of Virginia Patent FoundationMethod and system for high throughput optical and label free detection of analytes
WO2012151289A2May 2, 2012Nov 8, 2012University Of Virginia Patent FoundationMethod and system to detect aggregate formation on a substrate
WO2012170347A1Jun 4, 2012Dec 13, 2012Isis Pharmaceuticals, Inc.Bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2012170771A1Jun 8, 2012Dec 13, 2012Curna, Inc.Treatment of frataxin (fxn) related diseases by inhibition of natural antisense transcript to fxn
WO2013003350A2Jun 26, 2012Jan 3, 2013Eisai R&D Management Co., Ltd.Microrna biomarkers indicative of alzheimer's disease
WO2013022966A1Aug 8, 2012Feb 14, 2013Isis Pharmaceuticals, Inc.Linkage modified gapped oligomeric compounds and uses thereof
WO2013022967A1Aug 8, 2012Feb 14, 2013Isis Pharmaceuticals, Inc.Gapped oligomeric compounds comprising 5'-modified deoxyribonucleosides in the gap and uses thereof
WO2013022984A1Aug 8, 2012Feb 14, 2013Isis Pharmaceuticals, Inc.Selective antisense compounds and uses thereof
WO2013033223A1Aug 29, 2012Mar 7, 2013Isis Pharmaceuticals, Inc.Methods and compounds useful in conditions related to repeat expansion
WO2013036668A1Sep 6, 2012Mar 14, 2013Gen-Probe IncorporatedCircularized templates for sequencing
WO2013036685A1Sep 6, 2012Mar 14, 2013Gen-Probe IncorporatedClosed nucleic acid structures
WO2013040548A2Sep 17, 2012Mar 21, 2013Yale UniversityFluoride-responsive riboswitchs, fluoride transporters, and methods of use
WO2013055865A1Oct 11, 2012Apr 18, 2013The Brigham And Women's Hospital, Inc.Micrornas in neurodegenerative disorders
WO2013138374A2Mar 12, 2013Sep 19, 2013Curna, Inc.Treatment of brain derived neurotrophic factor (bdnf) related diseases by inhibition of natural antisense transcript to bdnf
WO2013154798A1Mar 20, 2013Oct 17, 2013Isis Pharmaceuticals, Inc.Tricyclic nucleic acid analogs
WO2013154799A1Mar 20, 2013Oct 17, 2013Isis Pharmaceuticals, Inc.Tricyclic nucleosides and oligomeric compounds prepared therefrom
WO2013155204A2Apr 10, 2013Oct 17, 2013Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the alas1 gene
WO2013159091A2Apr 22, 2013Oct 24, 2013Aptamir Therapeutics, Inc.Mirna modulators of thermogenesis
WO2013170963A2May 16, 2013Nov 21, 2013Noxxon Pharma AgEnzymatic synthesis of l-nucleic acids
WO2013184209A1Mar 14, 2013Dec 12, 2013Ludwig Institute For Cancer Research Ltd.Mif for use in methods of treating subjects with a neurodegenerative disorder
WO2014022852A1Aug 5, 2013Feb 6, 2014Aptamir Therapeutics, Inc.Cell-specific delivery of mirna modulators for the treatment of obesity and related disorders
WO2014071358A2Nov 5, 2013May 8, 2014Foundation Medicine, Inc.Novel ntrk1 fusion molecules and uses thereof
WO2014079903A1Nov 20, 2013May 30, 2014University College CorkPhosphonucleosides useful in the treatment of viral disorders
WO2014130922A1Feb 24, 2014Aug 28, 2014Trustees Of Boston UniversityCompositions and methods for treating fungal infections
WO2014142850A1Mar 13, 2013Sep 18, 2014Illumina, Inc.Methods and compositions for nucleic acid sequencing
WO2014190137A1May 22, 2014Nov 27, 2014Alnylam Pharmaceuticals, Inc.SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF
WO2014190157A1May 22, 2014Nov 27, 2014Alnylam Pharmaceuticals, Inc.Tmprss6 compositions and methods of use thereof
WO2015050990A1Oct 1, 2014Apr 9, 2015Alnylam Pharmaceuticals, Inc.Compositions and methods for inhibiting expression of the lect2 gene
WO2015054451A1Oct 9, 2014Apr 16, 2015The United States Of America As Represented By The Secretary Department Of Health And Human ServicesDetection of hepatitis delta virus (hdv) for the diagnosis and treatment of sjögren's syndrome and lymphoma
WO2015107425A2Jan 16, 2015Jul 23, 2015Wave Life Sciences Pte. Ltd.Chiral design
WO2015120075A2Feb 4, 2015Aug 13, 2015Genentech, Inc.Mutant smoothened and methods of using the same
WO2015123264A1Feb 11, 2015Aug 20, 2015Alnylam Pharmaceuticals, Inc.Ketohexokinase (khk) irna compositions and methods of use thereof
WO2015164693A1Apr 24, 2015Oct 29, 2015Isis Pharmaceuticals, Inc.Oligomeric compounds comprising alpha-beta-constrained nucleic acid
WO2015168172A1Apr 28, 2015Nov 5, 2015Isis Pharmaceuticals, Inc.Linkage modified oligomeric compounds
WO2015175510A1May 12, 2015Nov 19, 2015Alnylam Pharmaceuticals, Inc.Methods and compositions for treating a serpinc1-associated disorder
WO2015179724A1May 22, 2015Nov 26, 2015Alnylam Pharmaceuticals, Inc.Angiotensinogen (agt) irna compositions and methods of use thereof
WO2015186037A1May 29, 2015Dec 10, 2015Novartis AgPulmonary hypertension biomarker
WO2015190922A1Jun 10, 2015Dec 17, 2015Erasmus University Medical Center RotterdamAntisense oligonucleotides useful in treatment of pompe disease
WO2016014409A1Jul 20, 2015Jan 28, 2016Illumina, Inc.Polynucleotide enrichment using crispr-cas systems
WO2016027162A2Aug 19, 2015Feb 25, 2016Tataa Biocenter AbMethods and compositions for nucleic acid detection
WO2016028995A1Aug 20, 2015Feb 25, 2016Northwestern UniversityBiocompatible infinite coordination polymer nanoparticle-nucleic acid conjugates for antisense gene regulation
WO2016033424A1Aug 28, 2015Mar 3, 2016Genzyme CorporationMethods for the prevention and treatment of major adverse cardiovascular events using compounds that modulate apolipoprotein b
WO2016040589A1Sep 10, 2015Mar 17, 2016Alnylam Pharmaceuticals, Inc.Polynucleotide agents targeting complement component c5 and methods of use thereof
WO2016049512A1Sep 25, 2015Mar 31, 2016University Of MassachusettsRna-modulating agents
Classifications
U.S. Classification536/25.3, 435/91.51, 435/91.1, 536/25.33, 435/91.41
International ClassificationC12P19/34, C07H21/00, C12N15/10
Cooperative ClassificationC12N15/102, C07H21/00, C12P19/34
European ClassificationC07H21/00, C12P19/34, C12N15/10B
Legal Events
DateCodeEventDescription
Jan 4, 1999FPAYFee payment
Year of fee payment: 4
Jan 4, 2003FPAYFee payment
Year of fee payment: 8
Jan 29, 2003REMIMaintenance fee reminder mailed
Aug 5, 2003ASAssignment
Owner name: SILICON VALLEY BANK, CALIFORNIA
Free format text: SECURITY INTEREST;ASSIGNOR:ERAGEN BIOSCIENCES INC;REEL/FRAME:014344/0019
Effective date: 20030711
Oct 4, 2006FPAYFee payment
Year of fee payment: 12
Nov 14, 2007ASAssignment
Owner name: ERAGEN BIOSCIENCES, INC., WISCONSIN
Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:SILICON VALLEY BANK;REEL/FRAME:020105/0614
Effective date: 20071018
Jul 6, 2011ASAssignment
Owner name: ERAGEN BIOSCIENCES, INC., MONTANA
Free format text: RELEASE BY SECURED PARTY;ASSIGNOR:SILICON VALLEY BANK;REEL/FRAME:026561/0542
Effective date: 20110705
Jul 24, 2012ASAssignment
Owner name: BENNER, STEVEN, FLORIDA
Free format text: RELEASE TO NUCLEIC ACIDS LICENSING BY ERAGEN AND LUMINEX OF ALL RIGHTS;ASSIGNOR:LUMINEX CORPORATION, ON BEHALF OF ITSELF AND ERAGEN BIOSCIENCES INC.;REEL/FRAME:028622/0447
Effective date: 20120719