Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS5437977 A
Publication typeGrant
Application numberUS 07/908,584
Publication dateAug 1, 1995
Filing dateMay 29, 1992
Priority dateApr 3, 1990
Fee statusPaid
Also published asCA2039517A1, CA2039517C, DE69123621D1, DE69123621T2, EP0450594A2, EP0450594A3, EP0450594B1
Publication number07908584, 908584, US 5437977 A, US 5437977A, US-A-5437977, US5437977 A, US5437977A
InventorsDavid Segev
Original AssigneeDavid Segev
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
DNA probe signal amplification
US 5437977 A
A method for amplifying a signal during the detection of target nucleic acid molecules utilizes a primary oligonucleotide probe that binds to a bridging nucleic acid molecule. The bridging molecule hybridizes to a first developer nucleic acid molecule. Each first developer molecule comprises: (a) a first branch having a sequence of at least two different nucleotides and at least six total nucleotides complementary to a sequence of a first branch of a second developer molecule; (b) a second branch comprising a sequence of at least two different nucleotides and at least six total nucleotides complementary to a sequence of a second branch of the second developer molecule; and (c) a detectable label. In the method, the bridging molecule binds to the primary probe and hybridizes to the first developer molecule; the bound first developer molecule hybridizes to the second developer molecule to form a developer chain; additional first and second developer molecules are added to the chain; and the labeled developer molecules in the developer chain are detected.
Previous page
Next page
I claim:
1. A method for detecting target nucleic acid molecules comprising the steps of:
a) hybridizing a first sequence of a primary oligonucleotide probe to the target nucleic acid molecules wherein the probe has a means for binding to a bridging oligonucleotide, the bridging oligonucleotide being capable of hybridizing to at least one self-complementary developer oligonucleotide;
b) exposing the probe to the bridging oligonucleotide and to a plurality of self-complementary developer oligonucleotides having at least three branches, each branch of the developer oligonucleotide having a sequence of at least six nucleotides; each developer oligonucleotide:
i) having the same structure as all other developer oligonucleotides; and
ii) optionally containing, a detectable label;
under conditions such that:
i) the bridging oligonucleotide binds to the primary probe and hybridizes to at least one developer oligonucleotide, and
ii) at least two additional developer oligonucleotides hybridize to the first developer oligonucleotide; and
iii) a plurality of other developer oligonucleotides hybridize to the hybridized additional developer oligonucleotide to form a branched developer oligonucleotide chain; and
c) detecting the branched developer oligonucleotide chain, thereby detecting the target nucleic acid molecules.
2. The method of claim 1 wherein each branch of the developer oligonucleotide comprises a sequence of at least six nucleotides that is identical in one direction and complementary in the opposite direction to the sequence of nucleotides in every other branch.
3. The method of claim 2 wherein the sequence consists of an inverted, complementary sequence.
4. The method of claim 1 wherein the developer oligonucleotide exhibit Cn symmetry if nucleotides not part of the inverted, complementary sequence are ignored, wherein C represents the developer oligonucleotide branches and "n" represents the number of branches.
5. The method of claim 1 wherein the bridging oligonucleotide is branched.
6. The method of claim 1 wherein the bridging oligonucleotide and the developer oligonucleotides are identical.
7. The method of claim 1 wherein the primary probe is branched.

This application is a continuation of Ser. No. 07/503,621 filed Apr. 3, 1990, now abandoned, and is incorporated herein by reference.

DNA probes are important tools in cell and molecular biology. Specific genes have been located in cDNA and genomic libraries, and have been localized to individual chromosomes through the use of such probes. In addition, labelled DNA probes have been used to detect pathogens such as viruses and bacteria in biological fluids and tissue samples.

A labelled DNA probe is typically an oligonucleotide conjugated to a label, such as a reporter molecule. The oligonucleotide may be synthetic or natural, and is complementary to a portion of the sequence of the target DNA molecule. The reporter molecule may be radioactive or non-radioactive. Non-radioactive reporter molecules are generally preferred for safety and environmental reasons. Some common non-radioactive reporter molecules are detectable enzymes, fluorescent molecules, and biotin. The probe may be attached to the label directly. Alternatively, the probe may be conjugated to a ligand and detected with a label that is bound to a receptor of the ligand. For example, the probe may be conjugated to biotin and detected through the use of avidin or streptavidin that is labelled with a reporter group or of a labelled antibody against biotin.

In order to detect very low levels of target DNA molecules, it is often necessary to increase the sensitivity of the assay. The sensitivity may be increased in two ways--target amplification and signal amplification.

Target amplification may be carried out by the so-called polymerase chain reaction (PCR) method of Cetus Corporation as described in U.S. Pat. No. 4,683,195. This method is based on the use of two oligonucleotides to prime DNA synthesis catalyzed by a polymerase. The two primers are complementary to sequences of opposite strands of double-stranded DNA. DNA synthesis occurs in each strand across a region spanned by the priming sites of the target DNA being amplified. By repeated cycles of denaturing the DNA strands, annealing nucleotide primers and initiating DNA synthesis with polymerase, an exponential increase of the target DNA is achieved. This method has been reviewed by Gyllensten in Biotechniques 7, 700-706 (1989).

Although PCR is effective in some cases, problems--such as excessive noise and false positives--exist. The deficiencies of the PCR method are discussed in the Gyllensten review.

A different approach to increasing sensitivity of nucleic acid assays using oligonucleotide probes is to amplify the signal. For example, Segev, European Patent Application 292,128, discloses oligonucleotide probes with increased sensitivity. Each probe has multiple branches for labelling.

Chiswell, U.S. Pat. No. 4,716,106, discloses assays using a primary oligonucleotide probe and a complementary secondary probe to which is attached multiple labelling groups. Schneider and Shenk, U.S. Pat. No. 4,882,269, discloses hybridization assays wherein a sequence of a primary probe hybridizes to the target nucleic acid molecule and a plurality of labelled secondary probes hybridize to different sequences of the primary probe. The primary and secondary probes covered by U.S. Pat. No. 4,882,269 constitute the AmpliProbe™ System of ImClone Systems Incorporated. Palva et al, U.S. Pat. No. 4,731,325, discloses hybridization assays wherein more than one probe binds to the target nucleic acid molecule.

In Urdea et al, U.S. Pat. No. 4,868,105, hybridization assays are disclosed wherein multiple primary probes bind to a target nucleic acid molecule. Labelled secondary probes hybridize to the primary probes.

The need for even greater signal amplification has led to suggestions and speculation that chains of labelled secondary oligonucleotide probes bound to a primary probe would lead to highly sensitive hybridization assays. For example, Urdea, European Patent Application 317,077, discloses hybridization assays for target nucleic acid molecules. One or more primary probes, called amplifier probes, hybridize to the target molecule. A secondary probe, called a multimer, hybridizes to the primary probe or probes. The secondary probe may be linear or branched. Sequences of the secondary probe hybridize to a multiplicity of labelled oligonucleotides. Urdea et al speculate that the secondary probes may also be bound to each other in a series. There is, however, no disclosure of how such a series of secondary probes may be formed. The series of secondary probes proposed by Urdea et al is impractical, since a number of oligonucleotides equal to the number of secondary probes in the series would have to be prepared.

Similarly, Collins, European Patent Application 204,510, discloses hybridization assays involving the use of a primary probe, called a receptor probe, a secondary probe, called an amplifier strand, and a labelled strand capable of hybridizing to the amplifier strand. The receptor probe hybridizes to the target nucleic acid molecule, and has a homopolymeric nucleotide tail. The amplifier strand contains a homopolymeric nucleotide strand capable of hybridizing to the tail of the receptor probe. The labelled strand contains a homopolymeric nucleotide strand capable of hybridizing to the amplifier strand. Collins further speculates that a second homopolymeric amplifier strand may be hybridized to the preceding amplifier strand, and a second labelled strand may be hybridized to the amplifier strand. This further step may be repeated to build a network of amplifier strands and label strands.

The homopolymeric nucleotide probes disclosed by Collins are deficient in that one has no control over the extent to which each such probe hybridizes to its complementary partner. For example, the second amplifier probe may hybridize so extensively with the first amplifier probe that there is an insufficient number of remaining single-stranded nucleotides to hybridize with a third amplifier strand. In addition, one is not able to maximize the stability of the series of amplifier strands by maximizing the hybridization of each amplifier strand to two additional amplifier strands.

A need continues to exist for hybridization assays wherein a primary probe hybridizes to a series of secondary probes wherein the above-mentioned deficiencies are corrected. One objective of the present invention is to provide such hybridization assays. Further objectives of the present invention are to provide hybridization assays having less noise, greater sensitivity, and higher signal/noise ratios, and greater speed than has been achievable with previously known methods. An additional objective is to provide for exponential signal amplification in DNA hybridization assays.


These and other objectives as will be apparent to those with ordinary skill in the art have been achieved by providing a method for amplifying a signal during the detection of target nucleic acid molecules comprising the steps of:

a) hybridizing a first sequence of a primary oligonucleotide probe to the target nucleic acid molecules wherein the primary probe has a means for binding to a bridging nucleic acid molecule, the bridging molecule being capable of hybridizing to at least one developer nucleic acid molecule;

b) exposing the primary probe to the bridging molecule and to a first developer molecule and a second developer molecule, each developer molecule comprising:

i) a first branch comprising a sequence of at least two different nucleotides and at least six total nucleotides complementary to a sequence of a first branch of the other developer molecule;

ii) a second branch comprising a sequence of at least two different nucleotides and at least six total nucleotides complementary to a sequence of a second branch of the other developer molecule; and

iii) a detectable label or a means of being converted into a developer molecule comprising a detectable label;

wherein the first developer molecule and the second developer molecule have structures that are the same or different; and

steps a and b being conducted under conditions such that:

i) the bridging molecule binds to the primary probe and hybridizes to the first developer molecule; and

ii) the bound first developer molecule hybridizes to the second developer molecule to form a developer chain; and

c) detecting the labeled developer molecule in the developer chain.

In a particularly efficient embodiment, the present invention provides a method for amplifying a signal during the detection of target nucleic acid molecules comprising the steps of:

a) hybridizing a first sequence of a primary oligonucleotide probe to the nucleic acid target molecules wherein the probe has a means for binding to a bridging molecule, the bridging molecule being capable of hybridizing to at least one self-complementary developer molecule;

b) exposing the probe to the bridging molecule and to a plurality of developer molecules having at least three branches, each branch of the developer molecule having a sequence of at least six nucleotides that is complementary to a sequence of at least one other branch of the same or of another developer molecule; each developer molecule:

i) being capable of hybridizing to at least three other developer molecules; and

ii) containing, or being capable of containing, a detectable label;

under conditions such that:

i) the bridging molecule binds to the primary probe and hybridizes to at least one developer molecule;

ii) at least two additional developer molecules hybridize to the first developer molecule; and

iii) a plurality of other developer molecules hybridize to the hybridized additional developer molecule to form a developer chain; and

c) detecting the labelled developer molecules in the developer chain.

The present invention further provides a method for detection in DNA hybridization assays. The method comprises a method for detecting the presence of a nucleic acid sequence comprising the steps of:

a) contacting the nucleic acid with a molecule that:

i) is not a complementary nucleic acid sequence; and

ii) binds specifically to the nucleic acid sequence; and

b) detecting the presence of the bound molecule.


Certain embodiments of the invention may be seen from the Figures.

In FIG. 1, a target polynucleotide molecule (2) is immobilized on solid surface (5). First sequence (10) of primary probe (15) hybridizes specifically to a sequence of target molecule (2). Primary probe (15) binds to bridging molecule (20) through means (30). Developer molecule (40) hybridizes to the bridging molecule (20) and to additional developer molecules (40). The developer molecules are detectable through label (45).

FIG. 2 is similar to FIG. 1, except that the means for binding primary probe (15) to bridging molecule (20) is a second sequence of the primary probe (50) that hybridizes to a sequence of the bridging molecule (20).

In the embodiment of FIG. 3, all the nucleotides of each developer molecule hybridize to the bridging molecule and at least one other developer molecule, or to at least two other developer molecules in the developer chain, except for the last developer molecule. In this embodiment, there is no gap between the developer molecules in the chain. The developer molecules may be ligated to form a concatamer 60.

In the embodiment shown in FIG. 4, the developer molecules are branched (70). Each branched developer molecule is capable of hybridizing to at least three other developer molecules, or to at least two other developer molecule and the bridging molecule.


The target nucleic acid molecules that can be detected in accordance with the present invention may be any nucleic acid molecule. The nucleic acid molecule may be DNA or RNA having any sequence of adenine (A), thymine (T), cytosine (C), and guanine (G), or, in the case of RNA, uracil (U). The nucleic acid may be single-stranded or double-stranded. There is no maximum limit to the length of the target nucleic acid molecule. The molecule should have at least six nucleotide bases.

The hybridization assays possible with the present invention may be conducted in solution, although it is preferable for the target nucleic acid molecule to be fixed to a solid surface. Immobilization of the target nucleic acid molecule facilitates detection by permitting separation of the nucleic acid molecule from non-immobilized components by a simple washing step. The immobilization of the target nucleic acid molecule may occur during any stage of the assay prior to detection. Any solid surface capable of fixing the target nucleic acid molecule may be used in the present invention. Some suitable solid supports include nitrocellulose, agarose beads, modified cellulose fibers, polypropylene, and the like. The solid surface may conveniently be the wall of the vessel in which the assay occurs.

The target nucleic acid sequence is bound to the solid support by methods known in the art. Such methods include covalent bonding and non-covalent bonding.

Examples of non-covalent bonding include hybridization of a nucleotide sequence of the target molecule complementary to that of a nucleotide sequence immobilized on the solid surface. Such immobilized sequences are often referred to as capture probes.

Alternatively, the target nucleic acid molecule may contain a ligand that binds specifically to a receptor on the solid surface. Any ligand-receptor combination that does not interfere with the hybridization of the target nucleic acid molecule to the primary probe is suitable. Some examples include, for example, biotin-avidin, thyroxine-thyroxine-binding globulin, carbohydrate-lectin, antibody-antigen and the like. Either member of such combinations may constitute the ligand or the receptor.

The Primary Probe

The primary probe is a branched or unbranched nucleic acid molecule having a first sequence of nucleotides capable of hybridizing to a sequence of the target molecule. The hybridization occurs under normal hybridizing conditions, such as, for example, temperatures between 15-60 degrees centigrade; pH between 6-. Preferably, the primary probe has a sequence that is complementary to at least six nucleotides of the target molecule.

The primary probe also has a means for binding a bridging molecule. The means for binding the primary probe to the bridging molecule, as shown in FIG. 2, which is referred to as X-Y (30) in FIG. 1, may be any of the ligand-receptor relationships mentioned above. Preferably, however, the primary probe (15) binds to the bridging molecule (20) by means of a second sequence (50) of the primary probe that is complementary to at least six contiguous nucleotides of the bridging molecule. The complementary sequences of the primary probe and of the bridging molecule are selected so that the target molecule does not interfere with the hybridization of the primary probe to the bridging molecule.

The length of the primary probe is not critical, as long as it stably hybridizes to the target molecule and binds to the bridging molecule under normal hybridization conditions. Preferably, the primary probe is not longer than necessary. For example, a linear primary probe is preferably an oligonucleotide having 12-100 nucleotide bases. The upper limit of nucleotides is not critical, but is determined by convenience, such as a shorter hybridization time.

The Bridging Molecule

The bridging molecule is a linear or branched nucleic acid molecule that binds to the primary probe and to at least one developer molecule. The binding of the bridging molecule to the primary probe occurs by means (30) of FIG. 1. Preferably, the bridging molecule has a sequence that hybridizes to the second sequence (50) of the primary probe as shown in FIG. 2.

The bridging molecule hybridizes to the developer molecules under approximately the same conditions that the primary probe hybridizes to the target molecule. These conditions have been discussed above.

Preferably, the bridging molecule has a sequence of nucleotides complementary to at least six contiguous nucleotides of the developer molecule. The length of the bridging molecule is not critical, as long as it binds to the primary probe and hybridizes to at least one developer molecule under normal nucleic acid hybridization conditions. For example, a linear bridging molecule is preferably an oligonucleotide having 12-100 nucleotides bases. The bridging molecule may be linear or branched.

The Developer Molecule

The developer molecule is linear or branched and may be self-complementary. For the purpose of this specification, the term "self-complementary" means that each developer molecule is capable of hybridizing to all other developer molecules under normal nucleic acid hybridizing conditions, such as the conditions discussed above.

Each developer molecule is made up of branches, each of which comprises a nucleotide sequence that is complementary to that of other developer molecules. A linear developer molecule is considered to have two branches. A branched developer molecule has more than two branches.

Each developer molecule is capable of hybridizing to at least two other developer molecules or to the bridging molecule and at least one other developer molecule through complementary sequences. The complementary sequences of each developer molecule comprise at least six contiguous nucleotide bases. Preferably, the same sequence that binds a developer molecule to other developer molecules also binds the developer molecule to the bridging molecule.

Chains of developer molecules form under hybridizing conditions. Since each developer molecule is labelled, the extent of amplification resulting from the presently described method increases as the number of developer molecules in the chain increases. There is no limit to the number of developer molecules in the chain. There may be 100 developer molecules, 1,000 developer molecules, 10,000 developer molecules, and even more.

In each chain of developer molecules, each developer molecule hybridizes to at least two other developer molecules. The last molecule in a chain of developer molecules hybridizes only to the previous developer molecule.

Labelling the Developer Molecules

The developer molecule is labelled in accordance with methods known in the art. Such methods have been described, for example, by Leary et al, Proc. Natl. Acad. Sci. USA (1983) 80:4045; Renz and Kurz, Nucl. Acids Res. (1984) 12:3435; Richardson and Gumport, Nucl. Acids Res. (1983) 11:6167; Smith et al, Nucl. Acids Res. (1985) 13:2399; Meinkoth and Wahl, Anal. Biochem. (1984) 138:267.

The label may be radioactive. Some examples of useful radioactive labels include 32 P, 125 I, 131 I, and 3 H. Use of radioactive labels have been described in U.K. 2,034,323, U.S. Pat. No. 4,358,535, and U.S. Pat. No. 4,302,204.

Some examples of non-radioactive labels include enzymes, chromophors, atoms and molecules detectable by electron microscopy, and metal ions detectable by their magnetic properties.

Some useful enzymatic labels include enzymes that cause a detectable change in a substrate. Some useful enzymes and their substrates include, for example, horseradish peroxidase (pyrogallol and o-phenylenediamine), beta-galactosidase (fluorescein beta-D-galactopyranoside), and alkaline phosphatase (5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium). The use of enzymatic labels have been described in U.K. 2,019,404, EP 63,879, and by Rotman, Proc. Natl. Acad. Sci., 47, 1981-1991 (1961).

Useful chromofores include, for example, fluorescent, chemiluminescent, and bioluminescent molecules, as well as dyes. Some specific chromofores useful in the present invention include, for example, fluorescein, rhodamine, Texas red, phycoerythrin, umbelliferone, luminol.

The labels may be conjugated to the developer molecule by methods that are well known in the art. The labels may be directly attached to the developer molecules through a functional group on the developer molecule. The developer molecule either contains or can be caused to contain such a functional group. Some examples of suitable functional groups include, for example, amino, carboxyl, sulfhydryl, maleimide, isocyanate, isothiocyanate.

The label may also be conjugated to the developer molecules by means of a ligand attached to the developer molecule by a method described above and a receptor for that ligand attached to the label. Any of the ligand-receptor combinations described above is suitable. The biotin-avidin combination is preferred.

A method for labelling the developer molecules in a way that avoids the requirement for immobilizing the target nucleic acid molecule to a solid support and removing non-immobilized components involves the use of two molecules that can be detected when brought within a certain distance of each other. Such labels will be detectable if, for example, non-radiative energy transfer occurs between them. If the energy absorbed from one of the labels by the other is re-emitted at a different wavelength, the labels can be detected. Such absorption and re-emission occurs when the two labels are within a specific proximity to each other. For example, approximately 10%-90%, preferably approximately 25%-75%, and more preferably approximately 40%-60% of the developer molecules are conjugated to a chemiluminescent catalyst. The remainder of the developer molecules are conjugated to an absorber/emitter moiety. The developer molecules containing the chemiluminescent catalyst and the developer molecules containing the absorber/emitted moiety hybridize to each other so that the chemiluminescent catalyst and the absorber/emitter moiety are sufficiently close in proximity to permit non-radiative energy transfer. The distance between the chemiluminescent catalyst and the absorber/emitter moiety is generally within approximately 100 angstroms or less of each other. In the presence of agents effective for inducing light emission from the chemiluminescent catalyst, a measurable amount of light will be absorbed by the absorber/emitter moiety at a wavelength that can be detected. The absorber/emitter moiety may be a phosphorescent or fluorescent agent. Some examples of suitable chemiluminescent catalysts include peroxidase and luciferase, both of which catalyze the luminol oxidation. Suitable absorber/emitter moieties for the luminol chemiluminescent reaction include free base porphyrins such as uroporphyrin and tetracarboxyphenylporphyrin, metalloporphyrins containing such metals as magnesium or zinc, tetraphenylcarboxyporphyrins, perylene, anthracene, 7-methyldibenzo(a,h)pyrene, and other polycyclic aromatics having conjugated ring systems of sufficient size to produce strong absorbance in the region of luminol chemiluminescence (between 400 and 450 nm). The use of energy transfer labelling of this type is disclosed in European Patent Application 70,685. Related methods are disclosed in U.S. Pat. No. 4,868,103 and 4,822,733.

The present invention further provides a method for labelling DNA probes that has not previously been described. The method is based on the existence of molecules that recognize specific DNA sequences even though the molecules do not contain complementary DNA sequences. The binding may occur by any means other than the hybridization of a complementary DNA sequence, for example by intercalation.

For example, the well known drugs distamycin A and netropsin, and the dye Hoechst 33258, bind selectively to double-stranded DNA that is A-T rich. Preferably, the A-T region comprises AATT, ATTT, or AAATTT. Similarly, the known drugs actinomycin D and chromomycin bind specifically to double-stranded DNA that is G-C rich. The binding of these drugs to DNA has been described by Scott et al, Biochemistry 27, 7940-7951 (1988) and Gao et al, Biochemistry 28, 751-762 (1989). Hoechst 33258 is described by Teng et al, Nucl. Acids Res. 16, 2671-2690 (1988). DNA site-specific peptides and proteins are also known and may be used in the present invention.

In accordance with the present method, site-specific DNA binding compounds are attached to the developer molecules by methods described above. These compounds are detected on the basis of differences in properties of the bound compounds relative to unbound compounds. Such differences include, for example, spectral differences such as UV, NMR, circular dichroism, and others.

The developer molecules may be multiply labelled. Methods for attaching multiple labels to nucleic acid molecules such as those used as developer molecules herein are known in the art. For example, multiple labelling may be achieved by means of branched linker molecules as described by Segev in EP 292,128. The description and examples of branched linker molecules described by Segev in EP 292,128 is incorporated herein by reference.

Structure of Probes

The present invention utilizes three types of probes. A primary probe hybridizes specifically to the target molecule. A secondary probe, referred to herein as a bridging molecule, binds to the primary probe and hybridizes to a tertiary probe, referred to herein as a developer molecule. The developer molecules may be self-complementary.

The relationship of the probes to each other are important. The formula for the three types of linear probes may be represented as follows:

Primary probe:

Zz --Aa --Zz --X                            I

Zz --Aa --Zz --Bb                      II

Bridging molecule:

Yi --Zz --Cc                                III

 z z--B'b --Zz --Cc --Zz           IV

Developer Molecule:

Zz --C'c --Zz --C"c --Zz          V

In the Formulae above, "Z" represents a nucleotide sequence that may or may not be present. Each nucleotide sequence represented by "Z" is independent of all the other nucleotide sequences represented by "Z". "z" may represent 0-100. Preferably, "z" represents 0.

Referring now to the drawings, the primary probe (15) may be represented by Formula I. "A" represents the first sequence of the primary oligonucleotide probe (10). The sequence represented by "A" contains a nucleotide sequence that is complementary to a sequence of the target molecule (2). The number of nucleotides in the sequence is represented by "a". "a" represents an integer between 6-100, preferably between 8-30, and more preferably between 10-26.

"X" represents a group that is part of the means for binding the primary probe to the bridging molecule (20). "X" may, for example, represent a ligand capable of binding to a receptor ("Y") on bridging molecule (20). Preferably, however, "X" represents a second sequence of the primary probe that is complementary to a sequence of the bridging molecule. This second sequence of the primary probe is shown as (50) in FIG. 2, and as "B" in Formula II. The number of nucleotides in sequence "B" is represented by "b". "b" represents an integer between 6-100, preferably between 8-26, and more preferably between 12-24.

The bridging molecule (20) may be represented by Formula III. "Y" in Formula III represents part of the means for binding the primary probe to the bridging molecule. "Y" may, for example, be a receptor for ligand "X" of the primary probe. Preferably, however, "Y" represents a sequence of nucleotides, "B'", that is capable of hybridizing to the second sequence of the primary probe (50), which is represented by "B" in Formula II. The number of nucleotides in sequence "B'" is represented by "b", which has been defined above.

"C" in Formula III and IV represents a nucleotide sequence that hybridizes to a sequence in a developer molecule (40). The number of nucleotides in sequence "C" is represented by "c". "c" represents an integer that has the same definitions as "b" defined above.

The developer molecule (40) is shown in Formula V. "C'" represents the sequence in the developer molecule that hybridizes to sequence "C" in Formulae III and IV. The number of nucleotides in sequence "C'" is represented by "c", which has been defined above. "C"" is a sequence in the developer molecule that is complementary to at least one sequence in at least one other developer molecule, and may be complementary to sequence "C"". The number of nucleotides in "C"" is "c", which has been defined above. "C" and "C"" may represent the same or different sequences. Preferably, "C" and "C"" represent the same sequence. When "C" and "C"" do not represent the same sequence, they each hybridize to a different sequence of the developer molecule. Both of these sequences are represented by "C'", even though they are not necessarily the same sequence.

It is advantageous for "B" and "B'", "C" and "C'", and "C'" and "C"" to hybridize selectively to each other. Therefore, none of these sequences should be complementary to a sequence of the target molecule containing a significant number of nucleotides.

Self Complementary Developer Molecules

In one embodiment of the invention, the developer molecules are self-complementary. Important advantages occur when the sequence of the branches of the developer molecule are chosen carefully. The sequences of the developer molecules that hybridize to each other, C' and C" in Formula V, should hybridize uniquely so that it is possible to predict how many nucleotides in a hybridized developer molecule participate in hybridization. As mentioned above, it is preferable for all of the nucleotides of the developer molecule to be hybridized.

In addition, it is preferable for the hybridizing sequence of each branch to contain at least two of the four possible different nucleotides, preferably at least three different nucleotides and more preferably all four possible nucleotides (or hybridizable analogs thereof). Preferably, each of the four nucleotides or analogs thereof constitute at least 5%, preferably at least 10%, and more preferably at least 15% of the total number of nucleotides in a complementary sequence (i.e., A, B, B', C, C', and C" in Formula I-V).

It is advantageous to minimize the number of different developer molecules required for an assay. In order to achieve this minimum number of developer molecules, it is preferable for each branch of each developer molecule to hybridize to many branches of other developer molecules. Most preferably, every branch of every developer molecule hybridizes to every branch of every other developer molecule. This result is achieved by providing a branch having a nucleotide sequence with two portions. Each portion is the inverted complement of the other portion. If the sequence were double-stranded, the two portions would be palindromic. An example of a suitable inverted complementary sequence is shown in Formula VI:

(Zz)CCAAG(Zz)CTTGG(Zz)                      (VI)

wherein Z and z are as defined above. Any such inverted, complementary sequence is suitable.

An advantage of an inverted, complementary sequence such as that exemplified in Formula VI above is that it is uniquely self-complementary. The nucleotides involved in hybridization are known precisely.

If a developer molecule consists of branches comprising an inverted complementary sequence, each branch will hybridize to a branch of another developer molecule having the same sequence as itself under suitable conditions. Such developer molecules are referred to herein as self-complementary developer molecules. Each such developer molecule can have the same structure as all the other developer molecules, minimizing thereby the number of branches and developer molecules that must be prepared.

Each branch comprising an inverted complementary sequence in a developer molecule may be the same or different. There may be as many different sequences as there are branches in a developer molecule, as long as each branch comprises a sequence that is an inverted complement. It is also possible for some of such branches to be the same and some to be different. To minimize both the number of oligonucleotides that must be prepared and the time required for hybridization, it is preferred for each developer molecule to consist of identical branches. An example of a developer molecule having two different inverted complementary branches is shown as Formula VI':

CGCATGCGATGATCAT                                           VI'

It is desirable to prevent complementary branches in the same developer molecule from hybridizing to each other. This result can be achieved by preparing molecules having the proper symmetry. For example, a developer molecule having two branches, each of which comprising the inverted, complementary sequence shown above as Formula VI when z represents 0, may have the structure shown in either Formula VI A or VI B:

CCAAGCTTGGCCAAGCTTGG                                       VI A

CCAAGCTTGGGGTTCGAACC                                       VI B

In Formula VI A, the ten nucleotides that constitute one branch of the molecule can fold back and hybridize to the ten nucleotides of the other branch. Such internal hybridization of branches is undesirable.

Internal hybridization of branches is not possible in the structure of Formula VI B. Therefore, the structure of Formula VIB is preferred.

It is possible to predict which of the two possible structures of a linear oligonucleotide having two branches, each of which comprises an inverted complementary sequence, will not lead to internal hybridization of the branches. The molecule that avoids the internal hybridization is capable of assuming a conformation that has a two-fold axis of symmetry, i.e., C2 symmetry. For example, Formula VI B has C2 symmetry.

In general, it is preferable that the developer molecule have Cn symmetry, wherein "n" represents the number of branches. When the developer molecule is branched, n is at least 3. In developer molecules having Cn symmetry, each branch is capable of hybridizing to every branch of other developer molecules, but is incapable of hybridizing to the branches of the same developer molecule.

In addition to the nucleotides shown in Formula VI A and VI B, each branch may have additional nucleotides, as shown by Zz in Formula VI when z does not represent 0. The presence of such additional nucleotides would destroy the formal Cn symmetry. What is important is that the symmetry relationship be retained for that part of each branch that constitutes the inverted, complementary sequence. The nucleotide sequences represented by Z may be ignored for determining the preferred symmetry of the developer molecule.

Although the branches in a developer molecule having inverted, complementary sequences and Cn symmetry as defined above cannot hybridize to other branches in the same developer molecule, each half of the inverted, complementary sequence can hybridize to the other half, either in the same branch or in another branch of the same molecule. An example of a branch in a three-branched developer molecule hybridizing to itself is shown in Formula VII: ##STR1##

The problem of internal hybridization may be avoided by taking advantage of the fact that the undesirable intra-branch hybridization involves half the number of nucleotides as the desired hybridization between two branches from different developer molecules. In the example shown in Formula VII, the undesirable hybridization of a branch within a developer molecule involves five nucleotides. The desirable hybridization between two branches from different developer molecules would involve ten nucleotides. Therefore, the stringency of the hybridization conditions is selected so that five nucleotides will not stably hybridize, while ten nucleotides will stably hybridize. The desired stringency be determined by those having ordinary skill in the art. For example, at temperatures between 22 and 30 degrees centigrade, five nucleotides will not stably hybridize, but ten nucleotides will stably hybridize.

It should be understood that two nucleotide sequences are considered to hybridize to each other or to be complementary to each other if they are sufficiently complementary to each other to hybridize under normal conditions. Normal conditions of hybridization have been described above. Preferably, the nucleotide sequences that hybridize to each other (i.e, A and a sequence of the target molecule, B and B', C and C', and C' and C") are perfectly complementary. There may, however, be exceptions to complementarity in hybridizing sequences, as is well known. The longer the hybridizing sequences, the more exceptions may occur without forfeiting the ability to hybridize under normal conditions.

Moreover, although ranges of values for the number of complementary nucleotides in hybridizing sequences, i.e. a, b, and c, in Formula I-V, have been given, these ranges are not critical. The minimum number of nucleotides in a complementary sequence is the number that stably hybridizes under normal hybridizing conditions as described above. The stringency of the conditions generally increases as the number of complementary nucleotides increases. The minimum number of complementary sequences is typically 6, preferably 12, and more preferably 16.

There is no necessary upper limit to the number of complementary nucleotides capable of hybridizing to each other. The upper limit is, rather, governed by practical considerations, such as cost and time required for hybridization. Therefore, in the present invention, the maximum number of nucleotides in a sequence that hybridizes to another sequence typically does not exceed 100, preferably 40, and more preferably 24.

It is possible to design a developer molecule having a sequence that hybridizes to the target nucleic acid molecule. In such a case, the first developer molecule, which hybridizes to the target nucleic acid molecule, is considered the primary probe, and the second developer molecule or molecules, which hybridize to the primary probe, is considered to be the bridging molecule.

In order to maximize the efficiency of the presently described method and the stability of the complex of nucleic acid molecules formed, it is preferable for all of the nucleotides of the bridging molecule to hybridize either to the second segment of the primary probe or to at least one developer molecule, so that there are no unhybridized nucleotides in the hybridized bridging molecule. Moreover, it is further preferred for 30%-70%, preferably 40%-60%, and more preferably 45%-55% of the nucleotides of a linear bridging molecule to hybridize to the primary probe and the remaining 70%-30%, preferably 60%-40%, and more preferably 55%-45% of the nucleotides of the bridging molecule to hybridize to at least one developer molecule.

Similarly, it is preferable for all of the nucleotides of the developer molecule to hybridize to the bridging molecule and at least one other developer molecule, or to at least two other developer molecules in the developer chain, except for the last developer molecule in the developer chain, which may hybridize to as few as one other developer molecule, so that all of the nucleotides of the developer molecule are hybridized. Further, it is preferable for 30%-70%, preferably 40%-60%, and more preferably 45%-55% of the nucleotides of each linear developer molecule in the developer chain to hybridize to the bridging molecule or to at least one additional developer molecule, and the remaining 70%-30%, preferably 60%-40%, and more preferably 55%-45% of the nucleotides of each developer molecule, except for the last developer molecule in the chain, to hybridize to at least one additional developer molecule.

When all of the nucleotides of the bridging molecule (20) hybridize either to all of the nucleotides of the second segment (50) of the primary probe (15) or to all of the nucleotides of at least one developer molecule (40), there will be no nucleotides of the bridging molecule that are not hybridized. Under such circumstances, one end of the second sequence of the primary probe (50) will be adjacent to an end of a first developer molecule (52) with no gap between them, as shown in FIG. 2. The end of the second segment of the primary probe may be ligated to the adjacent end of the developer molecule, as shown in FIG. 3.

When all of the nucleotides of each developer molecule hybridize either to the bridging molecule and at least one other developer molecule, or to at least two other developer molecules in the developer chain, except for the last developer molecule in the developer chain, which may hybridize to as few as one other developer molecule, there will be no gaps between the bridging molecule (20) and an end of the second developer molecule (54) in the developer chain or between the ends of the developer molecules in the developer chain. Thus, an end of the first developer molecule (52) will be adjacent to an end of the third developer molecule (56), as shown in FIG. 2. The other end of the third developer molecule will be adjacent to an end of the fifth developer molecule, and so on. Similarly, an end of the second developer molecule will be adjacent to an end of the fourth developer molecule. The other end of the fourth developer molecule will be adjacent to an end of the sixth developer molecule. Under such conditions, the adjacent ends of the bridging molecule and the developer molecules may all be ligated to each other.

In view of the above, it is possible to ligate the primary probe, the bridging molecule and the developer molecules in the developer chain together to form a concatamer. Such a concatamer is shown as (60) in FIG. 3. The number of developer molecule units in the concatamer may be as large as 100, 1,000, 10,000, and even more. In view of the label on each developer molecule, the amplification of the signal is significant.

For maximum stability, one strand of ligated developer chain is ligated to the primary probe and the other strand of ligated developer chain is ligated to the bridging molecule. Such a structure is shown in FIG. 3. In addition, if the target nucleic acid molecule is linear and if the sequence of the target nucleic acid molecule that hybridizes to the primary probe occurs at an end of the target nucleic acid molecule, the target nucleic acid molecule may be hybridized to the bridging molecule.

The ligations described above may be accomplished with a suitable enzyme. Some suitable enzymes include, for example, ligase.

Branched Probes and Molecules

The primary probe, bridging molecule and developer molecule may be linear or branched. A molecule is considered to be linear for the purposes of this specification if it has two branches and to be branched if it has three or more branches. Each branch comprises a sequence that is capable of hybridizing to a sequence in a branch of the target molecule or of a primary probe, bridging molecule or developer molecule. The branches of branched probes and molecules in accordance with the invention need not be different from the branches of linear probes and molecules.

Linear oligonucleotides as well as the individual branches of branched oligonucleotides may be synthesized by methods known in the art. For example, the automated phosphoramidite method of Warner et al, DNA 3, 401 (1984) may be used.

Branched molecules containing DNA sequences may suitably be prepared by methods known in the art. For example, branched molecules may be prepared by joining the branches through a linker group. The linker group may comprise a multifunctional molecule that is capable of binding to oligonucleotides, preferably to the 5' or 3' end of the oligonucleotides. Suitable multifunctional groups are described in Segev, European patent application 292,128. The linker group may also be a group attached to one or more of the nucleotides in the oligonucleotide.

Branched nucleic acid molecules for use in the present invention may be prepared in accordance with Urdea et al, EP 317,077. For example, the Urdea et al application discloses comb structures in FIG. 3-1 and at page 8, line 38 et seq; fork structures in FIG. 3-2 and at page 10, line 7 et seq; multiple fork and forked comb structures in FIGS. 3-3 and 3-4, respectively, and at page 10, line 26 et seq; and multiple comb structures in FIG. 3-5, and at page 10, line 30 et seq. The synthesis of such branched structures is described in Example 2B.

When a developer molecule is branched, each branch should be capable of hybridizing to at least one branch of another developer molecule. Preferably, no branch of a developer molecule is capable of hybridizing internally to another branch of the same molecule.

For example, a developer molecule having three branches, each of which comprises the inverted, complementary sequence shown above as Formula VI, may have the structure shown in Formula VIII: ##STR2## wherein 13 -- represents a linking group. In Formula VIII, there is a three-fold axis of symmetry, i.e., C3 symmetry. Therefore, none of the branches can internally hybridize to another branch in the same molecule.

The bridging molecule may also be branched. One branch (B' in Formula II) of the bridging molecule hybridizes to the second sequence of the primary probe (B in Formula I). The remaining branches preferably comprise inverted, complementary sequences identical to those used in the developer molecules. More preferably, the second sequence of the primary probe comprises the same inverted, complementary sequence as occurs in each branch of the developer molecule. In such as case, the bridging molecule will be identical to the developer molecule, further minimizing the number of different molecules required to be prepared for the assays of the present invention.

The primary probe may also be branched. The first sequence of the primary probe is complementary to a sequence of the target molecule. The second sequence of the primary probe, which hybridizes to the bridging molecule, may appear on multiple branches.

The total number of branches in the primary probe, the bridging molecule and the developer molecule is at least two. Preferably, there are three or more branches. The upper limit of the number of branches is that necessary to prevent excessive steric hindrance. Normally, there will not be more than 5 branches, preferably not more than 3 branches.

Preferably, there are 3-5 branches in the developer molecules, and/or the bridging molecules, and/or the primary probe. It is most important for the developer molecule to be branched, since there are more developer molecules than bridging molecules or primary probes. The presence of branched developer molecules leads to exponential signal amplification of (Q-1)r, wherein "Q" represents the number of self-complementary branches and "r" represents the number of developer molecules in a chain following hybridization.

Pairs of Non-self-hybridizable Developer Molecules

Instead of self-complementary branched developer molecules, it is possible to use a pair of linear or branched developer molecules. Each member of the pair has a different structure that is not self-complementary. Each branch of one member of such a pair hybridizes to at least one branch of the other member of the pair. Preferably, the sequence of each branch in each member of the pair is identical. So that each branch of one member of the pair hybridizes to each branch of the other member of the pair.

It is also preferable for the branches of such branched developer molecules to hybridize uniquely to its complementary partner. Unique hybridization for the purposes of this specification means that when a sequence hybridizes to its complementary partner, the same number of nucleotides hybridizes each time. For example, a branch consisting of homopolymeric oligonucleotides, i.e. poly-A, can hybridize to its complementary partner, i.e. poly-T, in almost as many ways as there are nucleotides in the oligonucleotide. Such unpredictability is disadvantageous. Preferably, therefore, the sequence of each branch contains at least two different nucleotides, preferably at least three different nucleotides, and more preferably all four nucleotides.

In order to avoid the hybridization of half of each such sequence to the other half, it is preferable if the branches contain no sequences that constitute inverted complements. Except as indicated above, the branches of the pair of non-self-complementary developer molecules are similar to the branches of the self-complementary developer molecules described earlier, and may be prepared the same way.

An example of a pair of non-self-complementary developer molecules useful in this embodiment of the invention is illustrated in Formula IX and X: ##STR3##


The present invention is useful in a large variety of known hybridization procedures. An assay, according to the present invention, involves at least the following steps:

i) hybridizing a target nucleic acid molecule to a first sequence of a primary probe;

ii) binding the primary probe to a bridging molecule, preferably through a second sequence of the primary probe that is complementary to a nucleotide sequence on the bridging molecule;

iii) hybridizing the bridging molecule to at least one labelled developer molecule;

iv) hybridizing at least one additional labelled developer molecule, forming thereby a chain of labelled developer molecules; and

v) detecting the labelled developer molecules.

The assay may, for example, occur in a liquid phase. Preferably, the target nucleic acid molecule is immobilized on a solid surface. Immobilization may occur by covalently attaching the target nucleic acid molecule to the solid support, as described ,for example, by Albarella et al, EP 144,914; Dattagupta et al, EP 130,523; or Yabusalu et al, WO 85/02628. The target nucleic acid molecule may also be immobilized on the solid support by non-covalent means. for example, the target nucleic acid molecule may be bound to the solid support by means of a ligand-receptor interaction. A sandwich hybridization method wherein the target nucleic acid molecule hybridizes to an immobilized nucleotide sequence in a way that does not interfere with hybridizing the target to the primary probe is also possible.

Immobilizing the target nucleic acid molecule may occur before hybridizing the primary probe to the target nucleic acid molecule. Alternatively, the target nucleic acid molecule may be immobilized after binding the target nucleic acid molecule to the primary probe, to the bridging molecule or to the developer molecules. The immobilization step may also occur simultaneously with any of these steps. The advantage of immobilizing the target nucleic acid molecule is that the unhybridized labelled molecules may be separated from the immobilized complex prior to detection, thereby reducing the background and increasing the signal-noise ratio.

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4302204 *Jul 2, 1979Nov 24, 1981The Board Of Trustees Of Leland Stanford Junior UniversityTransfer and detection of nucleic acids
US4683195 *Feb 7, 1986Jul 28, 1987Cetus CorporationProcess for amplifying, detecting, and/or-cloning nucleic acid sequences
US4716106 *Feb 28, 1985Dec 29, 1987Amersham International PlcDetecting polynucleotide sequences
US4724202 *Dec 12, 1983Feb 9, 1988Molecular Diagnostics, Inc.Use of non-hybridizable nucleic acids for the detection of nucleic acid hybridization
US4731325 *Jan 24, 1985Mar 15, 1988Orion-YhtymaArrays of alternating nucleic acid fragments for hybridization arrays
US4762780 *Jan 5, 1987Aug 9, 1988The Regents Of The University Of CaliforniaMethod and composition for screening and diagnosing "HCMV"
US4868105 *Dec 11, 1985Sep 19, 1989Chiron CorporationSolution phase nucleic acid sandwich assay
US4882669 *Dec 9, 1987Nov 21, 1989Canon Kabushiki KaishaMulti computer fail safe control apparatus
DE3420925A1 *Jun 5, 1984Dec 5, 1985Boehringer Mannheim GmbhMethod and reagent for detecting a nucleic acid sequence
EP0204510A2 *May 29, 1986Dec 10, 1986Amoco CorporationAmplification of hybridization signals by employing complementary DNA strands
EP0245206A1 *Apr 30, 1987Nov 11, 1987IntraCel CorporationAnalytical method for detecting and measuring specifically sequenced nucleic acid
EP0292128A1 *Apr 28, 1988Nov 23, 1988Tamir Biotechnology LtdImproved DNA probes
EP0317077A1 *Oct 17, 1988May 14, 1989Chiron CorporationNucleic acid multimers and amplified nucleic acid hybridization assays using same
Non-Patent Citations
1 *Horn et al., Nucleic Acids Research 17, 6959 6967 (1989).
2Horn et al., Nucleic Acids Research 17, 6959-6967 (1989).
3 *Teng et al., Nucleic Acids Research 16, 2671 2690.
4Teng et al., Nucleic Acids Research 16, 2671-2690.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US5561043 *Jan 31, 1994Oct 1, 1996Trustees Of Boston UniversitySelf-assembling multimeric nucleic acid constructs
US5656739 *Jun 7, 1995Aug 12, 1997Cubicciotti; Roger S.Nucleotide-directed assembly of bimolecular and multimolecular drugs and devices
US5843650 *May 1, 1995Dec 1, 1998Segev; DavidNucleic acid detection and amplification by chemical linkage of oligonucleotides
US5853993 *Oct 21, 1996Dec 29, 1998Hewlett-Packard CompanySignal enhancement method and kit
US5902724 *Jul 11, 1997May 11, 1999Tm Technologies, Inc.Signal amplification method
US5955590 *Jul 15, 1996Sep 21, 1999Worcester Foundation For Biomedical ResearchConjugates of minor groove DNA binders with antisense oligonucleotides
US6020132 *Dec 18, 1997Feb 1, 2000Roche Diagnostics GmbhMethod of analysis using signal amplification
US6103474 *Oct 30, 1998Aug 15, 2000Agilent Technologies Inc.Hybridization assay signal enhancement
US6110682 *Nov 30, 1998Aug 29, 2000Agilent Technologies Inc.Signal enhancement method and kit
US6120995 *Aug 7, 1997Sep 19, 2000Thomas Jefferson UniversityCompositions that specifically bind to colorectal cancer cells and methods of using the same
US6187536Feb 18, 1998Feb 13, 2001Thomas Jefferson UniversityMethods of identifying and detecting pancreatic cancer
US6214549 *Oct 8, 1996Apr 10, 2001Roche Diagnostics GmbhMethod of detecting a substance to be analyzed
US6245513Apr 16, 1999Jun 12, 2001Tm Technologies, Inc.Signal amplification method
US6261846 *Apr 15, 1999Jul 17, 2001Sanko Junyaku Co. Ltd.Gene amplifying method
US6306657 *Sep 25, 1996Oct 23, 2001Kalyx Biosciences, Inc.Polynucleotide probe and kit for amplifying signal detection in hybridization assays
US6503714Nov 16, 2000Jan 7, 2003Roche Diagnostics GmbhMethod of detecting a substance to be analyzed
US6767704Mar 27, 2001Jul 27, 2004Thomas Jefferson UniversityMethods of screening and diagnosing esophageal cancer by determining guanylin cyclase C expression
US7060814 *May 28, 2001Jun 13, 2006Sanko Junyaku Co., Ltd.Probe for constructing probe-polymer method of constructing probe-polymer and utilization thereof
US7122310Oct 5, 2001Oct 17, 2006Sanko Junyaku Co., Ltd.Methods of constructing self-assembly of probes and method of detecting the same
US7135333Aug 28, 2000Nov 14, 2006Thomas Jefferson UniversityCompositions that specifically bind to colorectal cancer cells and methods of using the same
US7306915 *Mar 21, 2005Dec 11, 2007Sysmex CorporationProbe set for detection of target substance and detection method using the same
US7316902Sep 5, 2003Jan 8, 2008Thomas Jefferson UniversityCompositions that specifically bind to colorectal cancer cells and methods of using the same
US7439016Jun 15, 2000Oct 21, 2008Digene CorporationDetection of nucleic acids by type-specific hybrid capture method
US7569341Nov 7, 1997Aug 4, 2009Trustees Of Boston UniversityNucleic acid directed immobilization arrays and methods of assembly
US7601497Nov 7, 2005Oct 13, 2009Qiagen Gaithersburg, Inc.Detection of nucleic acids by target-specific hybrid capture method
US7645571Jun 15, 2001Jan 12, 2010Qiagen Gaithersburg, Inc.Detection of nucleic acids by type-specific hybrid capture method
US7745124 *Apr 28, 2005Jun 29, 2010Eisai R&D Management Co., Ltd.Hybridization method
US7829276Sep 18, 2001Nov 9, 2010Thomas Jefferson UniversityMethods of using CRCA-1 as a stomach and esophageal cancer marker
US7829691Oct 19, 2008Nov 9, 2010Qiagen Gaithersburg, Inc.Detection of nucleic acids by type specific hybrid capture method
US7854933Jun 14, 2004Dec 21, 2010Thmoas Jefferson UniversityCompositions and methods for identifying and targeting cancer cells of alimentary canal origin
US7867708 *Sep 8, 2005Jan 11, 2011Eisai R&D Management Co., Ltd.Method of forming signal probe-polymer
US7879546Mar 2, 2007Feb 1, 2011Qiagen Gaithersburg Inc.Assessment of human papilloma virus-related disease
US8067007Dec 6, 2010Nov 29, 2011Thomas Jefferson UniversityCompositions and methods for identifying and targeting cancer cells of alimentary canal origin
US8067165Aug 10, 2009Nov 29, 2011Applied Biosystems, LlcBinary probe and clamp composition and methods for target hybridization detection
US8288520Oct 26, 2009Oct 16, 2012Qiagen Gaithersburg, Inc.Fast results hybrid capture assay and system
US8389219Nov 19, 2009Mar 5, 2013Qiagen Gaithersburg, Inc.Detection of nucleic acids by type-specific hybrid capture method
US8450058 *Aug 11, 2008May 28, 2013Eisai R&D Management Co., Ltd.Method of detecting target substance
US8524453Feb 9, 2007Sep 3, 2013The Brigham And Woman's Hospital, Inc.Lectin complement pathway assays and related compositions and methods
US8557973Oct 14, 2010Oct 15, 2013Qiagen Gaithersburg, Inc.Detection of nucleic acids by target-specific hybrid capture method
US8722583Apr 13, 2006May 13, 2014Nuevolution A/SMethod for selecting a chemical entity from a tagged library
US8735564Sep 14, 2012May 27, 2014Qiagen Gaithersburg, Inc.Fast results hybrid capture assay and system
US8877436Oct 26, 2009Nov 4, 2014Qiagen Gaithersburg, Inc.Fast results hybrid capture assay on an automated platform
US8901287Oct 9, 2009Dec 2, 2014Qiagen Gaithersburg, Inc.Detection of nucleic acids by target-specific hybrid capture method
US8906612 *Aug 25, 2011Dec 9, 2014Pacific Biosciences Of California, Inc.Scaffold-based polymerase enzyme substrates
US8932992Dec 9, 2008Jan 13, 2015Nuevolution A/STemplated molecules and methods for using such molecules
US8946168Oct 20, 2011Feb 3, 2015Thomas Jefferson UniversityCompositions and methods for identifying and targeting cancer cells of alimentary canal origin
US9096951Jul 8, 2011Aug 4, 2015Nuevolution A/SMethod for producing second-generation library
US9115410Mar 15, 2013Aug 25, 2015Qiagen Gaithersburg, Inc.Detection of nucleic acids by target-specific hybrid capture method
US9121110 *Dec 19, 2003Sep 1, 2015Nuevolution A/SQuasirandom structure and function guided synthesis methods
US9221759Jan 13, 2011Dec 29, 2015Rutgers, The State University Of New JerseyFluorophore chelated lanthanide luminescent probes with improved quantum efficiency
US9376727May 24, 2011Jun 28, 2016Qiagen Gaithersburg, Inc.Fast results hybrid capture assay and associated strategically truncated probes
US9410146Sep 14, 2010Aug 9, 2016Qiagen Gaithersburg Inc.Compositions and methods for recovery of nucleic acids or proteins from tissue samples fixed in cytology media
US9422593May 18, 2011Aug 23, 2016Qiagen Gaithresburg, IncMethods and compositions for sequence-specific purification and multiplex analysis of nucleic acids
US9429576Oct 22, 2014Aug 30, 2016Thomas Jefferson UniversityCompositions and methods for identifying and targeting cancer cells of alimentary canal origin
US9574189Dec 1, 2006Feb 21, 2017Nuevolution A/SEnzymatic encoding methods for efficient synthesis of large libraries
US20020012931 *Mar 27, 2001Jan 31, 2002Waldman Scott A.High specificity marker detection
US20020155456 *Aug 27, 2001Oct 24, 2002Sithian PandianMethod of amplification for increasing the sensitivity of detecting nucleic acid-probe target hybrids
US20030008294 *May 28, 2001Jan 9, 2003Mitsugu UsuiProbe for constructing probe polymer method of constructing probe polymer and utilization thereof
US20030087262 *Oct 5, 2001May 8, 2003Mitsugu UsuiMethods of constructing self-assembly of probes and method of detecting the same
US20030118595 *Nov 7, 1997Jun 26, 2003Christof M. NiemeyerSupramolecular bioconjugates
US20030170656 *Jun 18, 2002Sep 11, 2003Chiron CorporationMethod of screening for factors that modulate gene expression
US20040005552 *Feb 27, 2001Jan 8, 2004Tm Technologies, Inc.Signal amplification method
US20040029142 *Feb 11, 2003Feb 12, 2004Schon Eric A.Concatenation-based nucleic acid detection compositions and methods
US20040224355 *Jun 14, 2004Nov 11, 2004Thomas Jefferson UniversityCompositions and methods for identifying and targeting cancer cells of alimentary canal origin
US20050100895 *Sep 18, 2001May 12, 2005Waldman Scott A.Compositions and methods for identifying and targeting stomach and esophageal cancer cells
US20050130139 *Sep 27, 2002Jun 16, 2005Mitsugu UsuiMethod f amplifying dna chip signals
US20050176014 *Jul 16, 2003Aug 11, 2005Roche Molecular Systems, IncFluorescent hybridization probes with reduced background
US20050208556 *Mar 21, 2005Sep 22, 2005Sysmex CorporationProbe set for detection of target substance and detection method using the same
US20060292603 *Apr 13, 2006Dec 28, 2006Gouliaev Alex HMethod for selecting a chemical entity from a tagged library
US20070048759 *Jun 12, 2006Mar 1, 2007Dan LuoDetection of target molecules with labeled nucleic acid detection molecules
US20070154884 *Mar 2, 2007Jul 5, 2007Lorincz Attila TAssessment of human papilloma virus-related disease
US20070275388 *May 25, 2006Nov 29, 2007Daniel RyanDendrimers that possess a single target annealing site and uses thereof
US20080193983 *Dec 19, 2003Aug 14, 2008Nuevolution A/SQuasirandom Structure and Function Guided Synthesis Methods
US20080199968 *Sep 8, 2005Aug 21, 2008Eisai Co., Ltd.Method of Forming Signal Probe-Polymer
US20080248963 *Apr 28, 2005Oct 9, 2008Eisai R&D Management Co., Ltd.Hybridization Method
US20090162851 *Oct 19, 2008Jun 25, 2009Digene CorporationDetection of nucleic acids by type specific hybrid capture method
US20090264300 *Dec 1, 2006Oct 22, 2009Nuevolution A/SEnzymatic encoding methods for efficient synthesis of large libraries
US20090305306 *Feb 9, 2007Dec 10, 2009Th Brigham And Women's Hospital, IncLectin Complement Pathway Assays and Related Compositions and Methods
US20100036104 *Oct 9, 2009Feb 11, 2010Qiagen Gaithersburg Inc.Detection of nucleic acids by target-specific hybrid capture method
US20100092985 *Oct 14, 2009Apr 15, 2010Samsung Electronics Co., Ltd.Solid support with enhanced density of signal material, kit containing the same and method of detecting target material using the same
US20100105060 *Oct 26, 2009Apr 29, 2010Qiagen Gaithersburg Inc.Fast results hybrid capture assay on an automated platform
US20100105572 *Dec 1, 2008Apr 29, 2010Kris Richard MHigh throughput assay system
US20100151592 *Aug 11, 2008Jun 17, 2010Mitsugu UsuiMethod of detecting target substance
US20100159463 *Oct 26, 2009Jun 24, 2010Qiagen Gaithersburg Inc.Fast results hybrid capture assay and system
US20100216147 *Jan 27, 2010Aug 26, 2010Qiagen Gaithersburg, Inc.Sequence-specific large volume sample preparation method and assay
US20100255558 *May 5, 2009Oct 7, 2010Trustees Of Boston UniversitySupramolecular bioconjugates
US20100256007 *Oct 17, 2008Oct 7, 2010Mitsugu UsuiNucleic acid probe, and method of forming probe-polymer
US20100291557 *Aug 10, 2009Nov 18, 2010Life Technologies CorporationBinary probe and clamp composition and methods for target hybridization detection
US20100311039 *Apr 30, 2010Dec 9, 2010Qiagen Gaithersburg Inc.Non-target amplification method for detection of rna splice-forms in a sample
US20100316998 *Jun 15, 2009Dec 16, 2010Massachusetts Institute Of TechnologyMethods and compositions for empirical selection of drugs or other molecules
US20110003288 *Nov 19, 2009Jan 6, 2011Qiagen Gaithersburg Inc.Detection of nucleic acids by type-specific hybrid capture method
US20110097708 *Dec 22, 2010Apr 28, 2011Qiagen Gaithersburg Inc.Assessment of human papilloma virus-related disease
US20110104050 *Dec 6, 2010May 5, 2011Thomas Jefferson UniversityCompositions and Methods for Identifying and Targeting Cancer Cells of Alimentary Canal Origin
US20120077189 *Aug 25, 2011Mar 29, 2012Pacific Biosciences Of California, Inc.Scaffold-based polymerase enzyme substrates
EP1002877A2 *Nov 3, 1999May 24, 2000Sanko Junyaku Co., Ltd.Gene amplifying method
EP1002877A3 *Nov 3, 1999Feb 20, 2002Sanko Junyaku Co., Ltd.Gene amplifying method
EP1005573A1 *Jul 29, 1998Jun 7, 2000Polyprobe, Inc.Dendritic nucleic acids exhibiting maximal self-assembly
EP1005573A4 *Jul 29, 1998Nov 10, 2004Polyprobe IncDendritic nucleic acids exhibiting maximal self-assembly
EP1188841A1 *Mar 28, 2001Mar 20, 2002Sanko Junyaku Co., Ltd.Probe for constructing probe polymer, method of constructing probe polymer and utilization thereof
EP1188841A4 *Mar 28, 2001Jan 5, 2005Sanko Junyaku KkProbe for constructing probe polymer, method of constructing probe polymer and utilization thereof
EP2050826A2Oct 13, 2008Apr 22, 2009Roche Diagnostics GmbHReagents and methods for detecting neisseria gonorrhoeae
EP2110439A1May 4, 2005Oct 21, 2009F. Hoffmann-Roche AGSENP1 as a marker for cancer
EP2230320A1Mar 27, 2001Sep 22, 2010Thomas Jefferson UniversityCompositions and methods for identifying and targeting cancer cells of alimentary canal origin
EP2949762A1Mar 27, 2001Dec 2, 2015Thomas Jefferson UniversityCompositions for treating and imaging stomachal and oesophageal cancer cells
WO1996034984A1 *Apr 30, 1996Nov 7, 1996Bio-Rad Laboratories Inc.Nucleic acid detection and amplification by chemical linkage of oligonucleotides
WO2003029441A1 *Sep 27, 2002Apr 10, 2003Sanko Junyaku Co., Ltd.Method of amplifying dna chip signals
WO2004092412A2Mar 30, 2004Oct 28, 2004Roche Diagnostics GmbhCompositions and methods for detecting certain flaviviruses, including members of the japanese encephalitis virus serogroup
U.S. Classification435/6.12
International ClassificationC12Q1/68, C12N15/09
Cooperative ClassificationC12Q1/6813, C12Q1/682
European ClassificationC12Q1/68B, C12Q1/68B2D
Legal Events
Jan 29, 1999FPAYFee payment
Year of fee payment: 4
Jan 31, 2003FPAYFee payment
Year of fee payment: 8
Feb 1, 2007FPAYFee payment
Year of fee payment: 12