Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS5556774 A
Publication typeGrant
Application numberUS 08/401,232
Publication dateSep 17, 1996
Filing dateMar 14, 1995
Priority dateMar 15, 1994
Fee statusLapsed
Also published asDE4408700C1
Publication number08401232, 401232, US 5556774 A, US 5556774A, US-A-5556774, US5556774 A, US5556774A
InventorsAlbrecht Wiedenmann, Renata Filkorn
Original AssigneeWiedenmann; Albrecht, Filkorn; Renata
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Selective detection of viable and infectious cryptosporidium oocysts with the help of the polymerase chain reaction (PCR)
US 5556774 A
Abstract
With the help of PCR it is possible to detect parasites of the genus Cryptosporidium by amplifying specific gene sequences. The disadvantage of this method is that it does not allow a statement about whether the detected gene sequences have been derived from viable and infectious parasites or from dead organisms or even from free DNA which has been released from organisms which have already disintegrated. However, by the combination of PCR with other known methods, i.e. an in vitro excystation assay and the removing or the destruction of nucleic acids which might be present in a sample material outside of Cryptosporidium oocysts before excystation this problem can be solved. Due to this combination the result of a PCR for Cryptosporidium allows a judgement on the infectivity of the examined material which would not be possible without this combination. Thus the fundamental advantages of PCR (high sensitivity and specificity, objective results, possibility of processing several samples in parallel) become available for applications in the field of environmental and food hygiene where it is essential to be able to answer the question whether a sample material is infectious or not.
Images(4)
Previous page
Next page
Claims(2)
We claim:
1. A method for the detection of infectious Cryptosporidium oocysts using the polymerase chain reaction (PCR) comprising:
a) isolating oocysts from a sample material to form a Cryptosporidium oocyst suspension;
b) adding to said Cryptosporidium oocyst suspension substances or combinations of substances selected from the group consisting of HCL, human or animal gall acids or their salts, or enzymes derived from pancreatic secretions, which simulate in vitro the physiological environment of a human or animal digestive system provoking active excystation of viable and infectious sporozoites;
c) releasing nucleic acids from only said sporozoites;
d) performing PCR amplification of nucleic acids of only actively excysted sporozoites;
e) detecting PCR products as a means of detecting Infectious Cryptosporidium oocysts.
2. The method according to claim 1 comprising destroying or removing Cryptosporidium nucleic acids which may be present outside of the oocyst prior to excystation.
Description
LITERATURE

Davis, L. G.; M.D. Dibner and J. F. Battey: Basic Methods in Molecular Biology. Elsevier, N.Y. (1986).

Filkorn, R.; A. Wiedenmann and K. Botzenhart: Selective Detection of Viable Cryptosporidium Oocysts by PCR. Zentralblatt far Hygiene und Umweltmedizin, Gustav Fischer Verlag Stuttgart, 195 (1994) 489-494.

Johnson, D. W.; N. J. Pieniazek and J. B. Rose: DNA Probe Hybridization and PCR Detection of Cryptosporidium compared to Immunofluorescence Assay. Wat. Sci. Tech. Vol. 27, No. 3-4, (1993) 77-84.

Laxer, M. A.; B. K. Timblin and R. J. Patel: DNA sequences for the specific detection of Cryptosporidium parvum by the polymerase chain reaction. Am. J. Trop. Med. Hyg. 42 (1990) 688-694.

Wagner, C. and P. Kimmig: Vitalitatstest fur Cryptosporidium parvum. Methode und praktische Anwendung. In: Bericht des 4. Hohenheimer Seminars: "Aktuelle Zoonosen", Deutsche Veterinarmedizinische Gesellschaft, Giessen (1992) 189-203.

DETAILED DESCRIPTION

1. Field of the invention

Microbiological detection method applicable in environmental and food hygiene.

2. Description of the Prior Art

For the detection of Cryptosporidium specific sequences of the nucleic acids of these parasites can be amplified using the polymerase chain reaction (PCR). Amplifiable sequences of these nucleic acids can be made available for PCR by breaking up the Cryptosporidium oocysts and the sporozoites inside them by various chemical, biochemical or physical methods (for example by application of NaOCI, proteinase K, freeze and thaw etc.) in order to release the nucleic acids (Johnson et al., 1993; Laxer et al., 1990).

The methods which have been previously described so far have the disadvantage that they can also lead to the detection of nucleic acids inside of dead or inactivated Cryptosporidium oocysts as well as to the detection of free nucleic acids of organisms which have already disintegrated beforehand. In this case a positive PCR signal cannot be used to judge whether the sample material which has been examined can cause infectious diseases or not (Filkorn et al., 1994). However, in microbiological food control and especially in the control of disinfected or differently treated drinking water a judgement on infectivity is essential.

SUMMARY OF THE INVENTION

Technical problem:

With the help of PCR it is possible to detect parasites of the genus Cryptosporidium by amplifying specific parts of their nucleic acids. The disadvantage of this method is that it does not allow a statement about whether the detected gene sequences have been derived from viable and infectious parasites or from dead organisms or even from free DNA which has been released from organisms which have already been disintegrated.

The problem consists in modifying the detection method in a way that a positive PCR signal occurs only in those cases when in fact viable and infectious organisms are present in the sample material.

Solution of the problem:

The solution of the problem consists in a not yet described combination of PCR with other known methods. To the sample material or to the oocysts isolated from such a material there are added substances which simulate the physiological environment in the human or animal digestive system, for example HCI, human or animal gall acids or their salts or components of the pancreas secretion. This causes the viable infectious organisms (Cryptosporidium sporozoites) to actively penetrate the oocyst wall. This means that in vitro there happens an active excystation just like it would happen in a natural infection of the intestines (Wagner and Kimmig, 1992). The free sporozoites can now be separated from the remaining oocyst material, for example by immunomagnetic methods, and then be submitted to PCR, or they are broken up by a method that leaves the remaining inactive or dead oocysts intact and releases the nucleic acids from only the actively excysted sporozoites for the following PCR detection. Such methods can be, for example, heating, treatment with proteolytic enzymes and so on. If there is a possibility that in the sample material which has to be examined or in an extract of that sample material, which contains the oocysts, nucleic acids of Cryptosporidium can already occur outside of oocysts before the excystation protocol is performed, then these nucleic acids are destroyed or removed before excystation, for example by addition of a DNAse (Davis et al., 1986)

FIELD OF APPLICATION

The method is applicable for the selective detection of viable and infectious Cryptosporidium oocysts in environmental and food samples, especially for their detection in drinking water and other water samples where a knowledge of the presence of infectious Cryptosporidium oocysts is essential.

DESCRIPTION OF THE PREFERRED EMBODIMENT

Starting point for the detection method is the sample material or an extract of the sample material which contains the Cryptosporidium oocysts and which is referred to as "Cryptosporidium suspension" in the following explanations.

Example for the removing of nucleic acids which occur outside of oocysts in a Cryptosporidium suspension:

Per 10 μl of the Cryptosporidium suspension there are added 1 μl DNase l (Pharmacia) and 1 μl 10x enzyme buffer. The mix is incubated 2 hours at 37 C.

Example for an in vitro excystation:

The Cryptosporidium suspension is mixed 1:1 with a solution of 1.5% taurocholate, sodium salt (Merck) in normal saline and incubated 4 hours at 37 C.

Example for a way to release nucleic acids from sporozoites without destroying oocysts with intact oocyst walls:

The Cryptosporidium suspension is put into a "safe-lock-cup" (Eppendorf) and boiled at 95 C. for 15 minutes.

Example of a PCR reaction:

One can use, for example, the primers described by Laxer et al. 1990: ##STR1##

The PCR-mix may be composed like that: 10 μl 10 PCR-buffer (100 mM Tris-CI, pH 8,3; 500 mM KCl; 15 mM MgCl2; 0,01% gelatine); 16 82 l dNTP-mix (1.25 mM each dATP, dGTP, dCTP, and dTTP); 1 μl primer 1 (100 pmol); 1 μl primer 2 (100 pmol); 2 μl DMSO (Sigma); 0.5 μl Taq-polymerase (Perkin Elmer) and 59.5 μl H2 O per 10 μl Cryptosporidium suspension.

The PCR cycles may look for example like that:

______________________________________Part 1:Denaturing         (3 minutes at 94 C.)Primer annealing   (5 minutes at 45 C.)Prolongation       (1 minute at 72 C.)Part 1 is performed once.Part 2:Denaturing         (1 minute at 94 C.)Primer annealing   (2 minutes at 57 C.)Prolongation       (1 minute at 72 C.)Part 2 is performed 30 times.______________________________________

The last elongation step is extended to 5 minutes.

At the end of part 2 a 10 μl aliquot is taken from the reaction cup and used to perform a second PCR in the same way as the first one.

Detection of PCR products:

The PCR products may be detected for example by gel electrophoreses in a gel with 30% agarose and a ethidium bromide concentration of 5 μg/ml. As a marker one can use for example a Promega pGEM-DNA-marker. If the primers described by Laxer have been applied the amplified gene sequence has a length of 452 bp.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 2(2) INFORMATION FOR SEQ ID NO: 1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 26 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: genomic DNA(iii) HYPOTHETICAL: no(iv) ANTI-SENSE: no(vi) ORIGINAL SOURCE:(A) ORGANISM: Cryptosporidium parvum(B) STRAIN: no name mentioned(C) INDIVIDUAL ISOLATE: purified from human and bovinefeces(D) DEVELOPMENTAL STAGE: oocyst(G) CELL TYPE: Protozoan parasite(vii) IMMEDIATE SOURCE: synthesized by Pharmacia(viii) POSITION IN GENOME:(A) CHROMOSOME/SEGMENT: Cryptosporidium parvum DNAsegment A(B) MAP POSITION: base 444-469(C) UNITS: nucleotide number of a 1054-base segmentdescribed by Laxer et al.(seepublicationinformationbelow)(ix) FEATURE:(D) OTHER INFORMATION: primer 1 for PCR(x) PUBLICATION INFORMATION:(A) AUTHORS: Laxer, Marc A.; Timblin, Barbara K.;Patel, Rubina J.(B) TITLE: DNA sequences for the specific detection ofCryptosporidium parvum by the polymerase chainreaction(C) JOURNAL: American Journal of Tropical Medicine andHygiene(D) VOLUME: 45(E) ISSUE: (6)(F) PAGES: 688-694(G) DATE: 1991(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:CCGAGTTTGATCCAAAAAGTTACGAA26(2) INFORMATION FOR SEQ ID NO: 2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 26 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: genomic DNA(iii) HYPOTHETICAL: no(iv) ANTI-SENSE: yes(vi) ORIGINAL SOURCE:(A) ORGANISM: Cryptosporidium parvum(B) STRAIN: no name mentioned(C) INDIVIDUAL ISOLATE: purified from human and bovinefeces(D) DEVELOPMENTAL STAGE: oocyst(G) CELL TYPE: Protozoan parasite(vii) IMMEDIATE SOURCE: synthesized by Pharmacia(viii) POSITION IN GENOME:(A) CHROMOSOME/SEGMENT: Cryptosporidium parvum DNAsegment A(B) MAP POSITION: base 870-895(C) UNITS: nucleotide number of a 1054-base DNA segmentdescribed by Laxer et al.(seepublicationinformationbelow)(ix) FEATURE:(D) OTHER INFORMATION: primer 2 for PCR(x) PUBLICATION INFORMATION:(A) AUTHORS: Laxer, Marc A.; Timblin, Barbara K.;Patel, Rubina J.(B) TITLE: DNA sequences for the specific detection ofCryptosporidium parvum by the polymerase chainreaction(C) JOURNAL: American Journal of Tropical Medicine andHygiene(D) VOLUME: 45(E) ISSUE: (6)(F) PAGES: 688-694(G) DATE: 1991(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:TAGCTCCTCATATGCCTTATTGAGTA26__________________________________________________________________________
Non-Patent Citations
Reference
1 *C. E. Chrisp and M. LeGendre, Folia Parasitologica 41:97 100.
2C. E. Chrisp and M. LeGendre, Folia Parasitologica 41:97-100.
3 *Johnson et al. Wat. Sci. Tech. 27: 77 84.
4Johnson et al. Wat. Sci. Tech. 27: 77-84.
5 *Laxer et al., Am. J. Trop. Med. Hyg 45: 688 694.
6Laxer et al., Am. J. Trop. Med. Hyg 45: 688-694.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6146838 *Mar 18, 1997Nov 14, 2000Igen International, Inc.Detecting water-borne parasites using electrochemiluminescence
US6153411 *Oct 30, 1998Nov 28, 2000American Water Works Company, Inc.Simple, sensitive, quantitative process for aqueous samples; concentrating organisms present using separation technique, amplifying target nucleic acid using primers of defined nucleotide sequence, detecting amplified nucleic acid acid
US6395517Jul 18, 2000May 28, 2002American Water Works Company, Inc.Methods and kits for detection of cryptosporidium parvum
US6514697 *Jun 6, 2000Feb 4, 2003The Regents Of The University Of CaliforniaMethods for detection of Crytosporidium species and isolates and for diagnosis of Cryptosporidium infections
US7081527Sep 11, 2001Jul 25, 2006Gen-Probe IncorporatedCompositions, methods and kits for determining the presence of Cryptosporidium parvum organisms in a test sample
US7585631Jul 25, 2006Sep 8, 2009Gen-Probe Incorporatedfor determining the presence of Cryptosporidium organisms in a test sample
US8008017Sep 8, 2009Aug 30, 2011Gen-Probe IncorporatedCompositions and methods for detecting the presence of cryptosporidium organisms in a test sample
US8105779Jul 14, 2011Jan 31, 2012Cunningham Melissa MCompositions and methods for detecting the presence of Cryptosporidium parvum in a test sample
EP2025762A2Jan 17, 2007Feb 18, 2009Health Research Inc.Heteroduplex tracking assay
WO2001094631A1 *May 14, 2001Dec 13, 2001Univ CaliforniaMethods for detection of cryptosporidium species and isolates and for diagnosis of cryptosporidiuminfections
WO2007084568A2Jan 17, 2007Jul 26, 2007Health Research IncHeteroduplex tracking assay
Classifications
U.S. Classification435/91.2, 536/24.3, 536/24.32, 435/6.15
International ClassificationC12Q1/68
Cooperative ClassificationC12Q1/6893
European ClassificationC12Q1/68M10D
Legal Events
DateCodeEventDescription
Nov 4, 2008FPExpired due to failure to pay maintenance fee
Effective date: 20080917
Sep 17, 2008LAPSLapse for failure to pay maintenance fees
Mar 24, 2008REMIMaintenance fee reminder mailed
Mar 12, 2004FPAYFee payment
Year of fee payment: 8
Mar 15, 2000FPAYFee payment
Year of fee payment: 4