Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS5587458 A
Publication typeGrant
Application numberUS 08/061,092
Publication dateDec 24, 1996
Filing dateMay 14, 1993
Priority dateOct 7, 1991
Fee statusLapsed
Publication number061092, 08061092, US 5587458 A, US 5587458A, US-A-5587458, US5587458 A, US5587458A
InventorsC. Richter King, Philip G. Kasprzyk, Robert E. Bird
Original AssigneeAronex Pharmaceuticals, Inc.
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Anti-erbB-2 antibodies, combinations thereof, and therapeutic and diagnostic uses thereof
US 5587458 A
The present invention relates to novel antibodies, in particular monoclonal and single chain antibodies derived therefrom which specifically bind to erbB-2, as well as diagnostic and therapeutic uses thereof. The present invention also relates to a combination of at least two erbB-2 specific antibodies which are capable of preventing and treating human malignancies wherein the malignant cells overexpress gp185erbB-2. The monoclonal antibodies of the combination preferably recognize different epitopes of the gp185 expression product of erbB-2, therefore, the antibodies do not cross react with each other. Preferably, the combination will provide for synergistic decrease in the expression of the erbB-2 gene product.
Previous page
Next page
We claim:
1. A single chain antibody which binds to erbB-2 which comprises the variable heavy and light domains of a monoclonal antibody selected from the group consisting of e21 having ATCC Accession No. HB11602 and e23 having ATCC Accession No. HB11601.
2. The single chain antibody of claim 1 which comprises the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
3. An immunoconjugate comprising the single chain antibody of claim 1 bound to a cytotoxic moiety or a label.
4. An immunoconjugate comprising the single chain antibody of claim 2 bound to a cytotoxic moiety or a label.
5. The immunoconjugate of claim 3 or claim 4 wherein said label is selected from the group consisting of a fluorescent label, an enzymatic label, and a radiolabel.
6. A diagnostic composition suitable for in vitro assaying for gp185erbB-2 which comprises a diagnostically effective amount of at least one of the single chain antibodies according to claim 1, in a carrier.
7. A diagnostic composition suitable for in vitro assaying for gp185erbB-2 which comprises a diagnostically effective amount of the immunoconjugate of claim 3, in a carrier.
8. The diagnostic composition of claim 7, wherein the single chain antibody comprises the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
9. The diagnostic composition of claim 6, wherein the single chain antibody comprises the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
10. The diagnostic composition of claim 6, wherein the single chain antibody is fused to an enzyme or fragment or derivative thereof comprising enzymatic activity.
11. The diagnostic composition of claim 10, wherein the enzyme comprises horseradish peroxdase or alkaline phosphatase.
12. The diagnostic composition of claim 6, wherein the single chain antibody comprises the amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

The subject application is a continuation-in-part of U.S. Pat. Ser. No. 07/906,555, pending, filed on Jun. 30, 1992, which is itself a continuation-in-part of U.S. Pat. Ser. No. 07/772,270, filed on Oct. 7, 1991, abandoned. These applications are incorporated by reference in their entirety herein.


This invention relates to novel antibodies capable of specifically binding to the erbB-2, gp185erbB 2 gene product, and combinations thereof.

The invention further relates to the use of antibodies capable of binding to the erbB-2, and/or combinations thereof, for treating and/or preventing the formation of erbB-2 expressing tumors.

The invention also relates to the use of antibodies capable of binding to the erbB-2 gene product, and/or combinations thereof, for the immunological detection of erbB-2 expressing tumor cells in an analyte.

The invention further relates to conjugates comprising novel antibodies capable of binding to gp185erbB-2, and combinations thereof, wherein the antibody is bound to a cytotoxic moiety or a label which provides for the detection thereof, e.g., a fluorescent, enzymatic or radiolabel.

In particular, the invention relates to the use of monoclonal antibodies capable of specifically binding to gp185erbB-2, and/or combinations thereof, and/or single chain antibodies derived therefrom for the treatment and/or prevention of erbB-2 expressing tumors. Additionally, the invention relates to the use of specific monoclonal antibodies or single chain antibodies capable of specifically binding to gp185erbB-2 for the detection of erbB-2 expressing tumor cells.

In recent years, evidence has been accumulated that growth factors and their receptors may be involved in the process of malignant transformation. The erbB-2 gene product (also called HER2, neu or c-erbB-2) encodes a 185-kDa growth factor receptor which has been implicated in the malignancy of some human adenocarcinomas. Specifically, the erbB-2 protein, gp185erbB-2, is a receptor tyrosine kinase (Yarden et al, Ann. Rev. Biochem., (1988), 57, 443-478) which is homologous to the epidermal growth factor (EGF) receptor. (Coussens et al, Science, (1985), 230, 1132-1139; Yamamoto et al., Nature, (1986), 319, 230-234.) The rat homologue of the gene undergoes oncogenic activation through a single point mutation. (Bargmann et al, Cell, (1986), 45, 649-657.)

The erbB-2 protein, like other receptor proteins, is composed of extracellular, transmembrane and intracellular domains. The extracellular domain contains two cysteine-rich areas and is 44% homologous to the epidermal growth factor receptor (EGFR). The intracellular domain contains a tyrosine kinase which is 82% homologous to that of EGFR. Because of these similarities to EGFR and to other tyrosine kinase receptors, it has been suggested in the literature that the c-erbB-2 protein may function as a growth factor receptor.

Clinical and experimental evidence suggests a role for overexpression of the erbB-2 protein in the progression of human breast, ovarian, and non-small lung carcinoma. For example, amplification and/or overexpression of the erbB-2 gene have been shown in 20-30% of breast adenocarcinomas (King et al, Science, (1985), 229, 974-976; Slamon et al, Science, (1987), 235, 177-182; Slamon et al, Science, (1989), 244, 707-712; Yokota et al, Lancet, (1986), 1,765-767; King et al, Cancer Res., (1985), 49, 4185-4191), ovary adenocarcinomas (Slamon et al, Science, (1989), 244, 707-712), lung adenocarcinomas (Schneider et al, Cancer Res., (1989), 49, 4968-4971) and stomach adenocarcinomas (Park et al, Cancer Res., (1989), 49, 6605-6609). In breast carcinoma, a correlation has been observed between gene amplification and overexpression of erbB-2 protein and the aggressiveness of the malignancy (Slamon et al, Science, (1987), 237, 177-182; Slamon et al, Science, (1989), 244, 707-712). In cases of gene amplification, there is a resulting 50- to 100-fold increase in erbB-2 in RNA compared with normal cell levels (Kraus et al, EMBO J., (1987), 6, 605-610). The overexpression of erbB-2 has also been directly linked to the malignant conversion of cancer cells. (DiFiore et al, Science, (1986), 237, 178-182; Hudziak et al, Proc. Nat'l. Acad. Sci., (1987), 89, 7159-7163).

At least two lines of evidence suggest that erbB-2 overexpression may be involved in the pathogenesis of human neoplasia. First, as discussed supra, overexpression has been linked with poor prognosis in breast cancer, as well as ovarian cancer (Slamon et al, Science, (1989), 244, 707-712; Berchuk et al, Cancer Res., (1990), 50, 4087-4091), stomach cancer (Yonemura et al, Cancer Res., (1991), 51, 1004-1032) and lung cancer (Kern et al, Cancer Res., (1990), 50, 5184-5191). Second, artificial overexpression of erbB-2 induces a transformed phenotype in NIH 3T3 fibroblasts (DiFiore et al, Science, (1986), 237, 178-182; Hudziak et al, Proc. Nat'l. Acad. Sci., (1987), 84, 7159-7163), as well as in mammary epithelial cells (Pierce et al, Oncogene, (1991), 6, 1189-1194), suggesting that overexpression can not contribute directly to the development of the malignant phenotype.

Because of the extensive homology between the erbB-2 protein and the EGFR, it is widely assumed that the activation of growth signal transduction may proceed through similar mechanisms. One proposed mechanism involves receptor dimerization or oligomerization, which is thought to be an important step in the activation of EGFR intrinsic tyrosine kinase function (Yarden et al, Biochemistry, (1988), 27, 3114-3118; Schlessinger, Biochemistry, (1988), 27, 3119-3123). Interfering with receptor-receptor interactions has been evaluated as a potential therapeutic approach for the treatment of cancers associated with erbB-2 overexpression. In particular, such studies have involved the use of single monoclonal antibodies directed against the erbB-2 protein (Hudziak et al, Mol. Cell. Biol., (1989), 9, 1165-1172) and the related EGFR protein (Divgi et al, J. Nat'l. Cancer Inst., (1991), 83, 97-104) as potential therapeutic agents for the treatment of cancer.

The potential use of monoclonal antibodies for diagnosis and treatment of cancer has been studied extensively (Mellstadt, Curr. Opinion Immunol., (1990), 2, 708-713). Receptors for growth factors constitute a desirable target for this approach because their location on the cell membrane renders them accessible to antibody molecules. Moreover, antibodies directed to growth factor receptors can potentially block biological functions essential for cell proliferation.

Previous studies have demonstrated in animal systems the potential therapeutic effects of monoclonal antibodies against the EGFR (Matsui et al, Cancer Res., (1984), 44, 1002-1007; Aboud-Pirak et al, J. Nat'l. Cancer Inst., (1988), 80, 1605-1611). Also, different monoclonal antibodies to the erbB-2 receptor have been found to inhibit the proliferation of a human breast carcinoma cell line in human tissue culture (Hudziak et al, Mol. Cell. Biol., (1989), 9, 1165-1172), and an antibody directed to the rat erbB-2 protein, has been reported to inhibit the tumorigenicity of fibroblasts transformed by the mutant rat erbB-2 oncogene (Drebin et al, Proc. Nat'l. Acad. Sci., (1986), 83, 9126-9133; Drebin et al, Oncogene, (1988), 2, 387-399). Additionally, monoclonal antibodies which bind to erbB-2 have been used to study the biological function of the presumed receptor (McKenzie et al, Oncogene, (1989), 4, 543-548); Van Leenwen et al, Oncogene, (1990), 5,497,503; Fendly et al, Cancer Res. (1990), 50, 1550-1558).

While some monoclonal antibodies to the erbB-2 protein have shown promise as potential anticancer therapeutic agents, variable effects are observed dependent upon the particular monoclonal antibody. For example, Stancovski et al studied the in vivo effects of monoclonal antibodies on erbB-2 expressing tumors. Although some of the administered antibodies almost completely inhibited the growth in athymic mice of transfected murine fibroblasts that overexpress the erbB-2 protein, other antibodies were found to accelerate tumor growth or to result in intermediate responses (Stancovski et al, Proc. Nat'l. Acad. Sci., (1991), 88, 8691-8695). Based on the variable observed effects, Stancovski et al postulated that anti-erbB-2 antitumor antibodies may affect both receptor functioning and host-tumor interactions.

Recently, the construction and bacterial expression of a bifunctional single chain antibody-phosphatase fusion protein targeted to the human erbB-2 receptor was reported by Weis et al, Biotechnology, (1992), 10, 1128-1132. Wels et al, reported that this fusion protein exhibits sufficient binding affinity to cells expressing the erbB-2 receptor to permit the use thereof as an immunohistochemical reagent for the detection of erbB-2 antigen on cells or tissues.


One object of the invention is to provide novel antibodies, preferably monoclonal or single chain antibodies derived therefrom, capable of specifically binding to erbB-2 protein, gp185erbB-2, and which do not substantially bind to normal human cells which may be utilized for the treatment or prevention of erbB-2 expressing tumor cells, or for the immunological detection of erbB-2 expressing tumor cells.

Another object of the present invention is to provide a novel combination of antibodies comprising at least two different antibodies, preferably monoclonal or single chain antibodies which are capable of specifically binding to an extracellular domain of the erbB-2 protein, which antibodies are separately capable of treating and/or preventing the growth of human tumors associated by the overexpression of erbB-2, and wherein the combination results in greater cytotoxic activity than expected for the sum of the individual antibodies at the same overall antibody concentration.

Still another object of the invention is to provide novel therapeutic or diagnostic conjugates comprising anti-erbB-2 antibodies which are attached to a cytotoxic or detectable moiety.

Another object of the invention is to provide anti-tumor pharmaceutical compositions comprising an anti-tumor effective amount of the novel anti-erbB-2 specific antibodies or combinations thereof.

Another object of the invention is to provide immunodiagnostic compositions which comprise the novel anti-erbB-2 antibodies of the invention, preferably in combination with a moiety which provides for the detection thereof.

Still another object of the invention is to provide methods for the treatment and/or prevention of erbB-2 receptor overexpressing tumors comprising the administration of an anti-tumor effective amount of at least one of the disclosed anti-erbB-2 specific antibodies, or combination of erbB-2 specific antibodies. Preferably, such combinations of erbB-2 antibodies will exhibit better cytotoxic activity than would be expected for the sum of the cytotoxic activity of the individual antibodies at the same overall antibody concentration. Additionally, one or more of the administered antibodies may be conjugated to a cytotoxic moiety, e.g., an anti-tumor drug, toxin, or radionuclide.

Yet another object of the invention is to provide methods for the use of the disclosed erbB-2 binding antibodies and conjugates thereof for the immunological detection of erbB-2 expressing tumor cells.


FIG. 1A. Specificity of monoclonal antibodies e21 and e23. Subconfluent SK-Br-3 monolayers were metabolically labeled with 355S-Cys (spec. act. 1000 Ci/mmol). Total cell proteins were immunoprecipitated with 10 μg of the indicated antibodies. The immune complexes were recovered by Protein G Agarose (Genex, Gaithersburg, Md.) and analyzed by SDS-PAGE on an 8-16% Tris-Glycine gel. The gel was exposed to film at -70° C. overnight with an intensifying screen.

FIG. 1B. gp185erbB-2 overexpression in the gastric cell line N87 and a tumor from N87 mouse xenografts compared to high and low gp185erbB-2 overexpressers. Cells or tumor were lysed in sample buffer which contained 0.125 M Tris-HCl, 4% SDS, 0.002% bromophenol blue, and 15% glycerol. 5% β-mercaptoethanol was added after the protein concentration was determined. Samples (10 μg total protein) were boiled for 3 min, fractionated by SDS-PAGE on 8-16% Tris-Glycine gel and transferred to nitrocellulose. Detection of gp185erbB-2 was performed with a monoclonal antibody to the c-terminal portion of the protein.

FIG. 1C. Southern blot analysis of the erbB-2 gene in N87 (gastric), SK-Br-3 (breast), and SK-OV-3 (ovarian) cell lines and human placenta. DNA was extracted from cell lines and human placenta tissue using guanidine thiocyanate and cesium gradient centrifugation. DNA (15 μg) was cleaved with restriction enzyme HindIII, separated by electrophoresis on a 1% agarose gel, transferred to nitrocellulose, and probed with radioactive erbB-2 cDNA probe as previously described in King et al, Cancer Res. (1989), 49, 4185. The cDNA probe corresponds to the entire erbB-2 protein coding region.

FIG. 2. Effects of e21 and e23 on the growth of human N87 transferrin (10 μg/ml), 17-β-estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepes. PBS, e21, e23 or a combination of e21 and e23 at the indicated concentration were then added. The plates were grown at 37° C. in a 5% CO2 humidified atmosphere. After 7 days, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37° C. 90% of the media was then removed and the crystals solubilized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

FIG. 3A. Effects of treatment with e21, e23, a combination of e21 and e23, or PBS on the growth of N87 tumor xenografts in BNX mice. Tumor cells (5×106 /mouse) were subcutaneously injected into the flanks of BNX (beige, nude, xid) mice. Treatment begun on day 1 consisted of four trial groups (3 mice per group) each given 0.2 ml intraperitoneal injections twice a week of either PBS, 200 μg purified e21 (0), 200 μg purified e23, or a mixture of 100/μg purified e21 and 100 μg of purified e23 for three weeks. Tumor growth is reported as an average relative tumor volume, s.e.m. ±15%. Two repeats of the experiment gave the same results.

FIG. 3B. Effect of treatment after the formation of small tumors. Cells were injected using the same treatment protocol as above except for the fact the treatment was begun 4 days after cell injection instead of 1 day after. Animal care was in accordance with institutional guidelines.

FIG. 4A. Effect of antibody binding on erbB-2 protein turnover. Subconfluent N87 cell monolayers were pulse-labeled 1 h with 20 μCi 35 S-Cysteine and then chased with 5 mM Cys in the presence of e21 alone, e23 alone, or a 1:1 combination of e21 and e23 (10 μg/ml) for 24 h. Total cellular protein was immunoprecipitated as described in FIG. 1 using a monoclonal antibody directed against the c-terminus of gp185erbB-2 coupled to Sepharose and analyzed by SDS-PAGE. The gel was exposed to film at -70° C. overnight with an intensifying screen.

FIG. 4B. Measurement of tyrosine phosphorylation of gp185erbB-2 after incubation with antibody combination. Cells were plated as described in the Materials and Methods infra. After 1 h cells were processed as described infra. Proteins were then electroblotter onto nitrocellulose paper and incubated with anti-phosphotyrosine IgG (monoclonal; Upstate Biotechnology, Inc.) and immunodetected using 125 I-protein A. The gel was exposed to film at -70° C. overnight with an intersifying screen.

FIG. 5. Effects of e21 and e23 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with insulin (5 μg/ml), human transferrin (10 μg/ml), 17-β-estradiol (10 nM), sodium selenite (5 nM, and 10 mM Hepes. PBS, e21, e23 or a combination of e21 and e23 at the indicated concentration were then added. The plates were grown at 37° C. in a 5% CO2 humidified atmosphere. After 7 days, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37° C. 90% of the media was then removed and the crystals solubilized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

FIG. 6. Effects of e23 and e94 on the growth of human Calu-3 lung adenocarcinoma tumor cells in a monolayer MTT growth assay. A single cell suspension of 10,000 cells/well was plated in a chemically defined medium consisting of RPMI-1640 supplemented with insulin (5 μg/ml), human transferrin (10 μg/ml), 17-β-estradiol (10 nM), sodium selenite (5 nM), and 10 mM Hepes. PBS, e23, e94 or a combination of e21 and e23 at the indicated concentration were then added. The plates were grown at 37° C. in a 5% CO2 humidified atmosphere. After 7 days, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (0.1 mg) were added and allowed to incubate for 4 hours at 37° C. 90% of the media was then removed and the crystals solubilized in 0.175 ml DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. Results are the average of eight wells with standard deviations noted. Under the conditions used, the cell number is directly proportional to MTT reduction.

FIG. 7. [SEQ ID NO. 1] The cDNA sequence for the *single chain anti-erbB-2 antibody, containing heavy and light variable domains derived from e23 (e23(Fv)).

FIG. 8. [SEQ ID NO. 2] The cDNA sequence for the *single chain anti-erbB-2 antibody, containing heavy and light variable domains derived from e21 (e21(Fv)).

FIG. 9. Depicts the binding of SC(Fv) and immunotoxin to erbB-2. The ability of purified e23(Fv)(O) and e23(Fv)PE38KDEL () to inhibit the binding of I125 -labeled e23 Fab was measured using cells overexpressing erbB-2 N87 as the binding target. Also shown are e23 Fab (□) and intact antibody e23 (Δ).

FIG. 10. Depicts the cytotoxicity of e23(Fv)Pe40 on BT474 cells as shown by inhibition of protein synthesis. Results are shown as percentage of control cells to which no toxin was added, , e23(Fv) PE40 alone; ∘, e23(Fv)PE40 plus e23 (20 μg/ml); ▴, e23-LysPE40.

FIG. 11. Depicts schematically the e23(Fv)PE40 derivatives which were synthesized. VH, variable region of heavy chain; VL, variable region of light chain; L, linker; II, domain II of PE; Ib, domain Ib of PE; III, domain III of PE. Carboxyl-terminal amino acid sequences are shown in single letter code.

FIG. 12. Depicts the comparative cytotoxic activities of various e23(Fv)PE40 derivatives on BT474 cells, , e23(Fv)PE40; ∘, e23(Fv)PE38KDEL; e23(Fv)PE40KDEL; □, e23 (Fv)PE38.

FIG. 13. Depicts results of therapy of tumors formed in mice by human gastric cell line N87. Tumors were established by injection of 5×106 N87 cells subcutaneously on the backs of BNX mice. Therapy was initiated 7 days following injection of cells. Treatments were twice daily injections in the tail vein with 2 μg of e23(Fv)PE38KDEL(), LysPE38KDEL(∘), or e23Fab(Δ) or with phosphate-buffered saline (□). Measurements were conducted externally with calipers.


One object of the invention is to provide novel antibodies capable of specifically binding to the erbB-2 protein, and do not substantially bind to human cells which antibodies may be used for the treatment and/or prevention of erbB-2 expressing tumors, or the detection of erbB-2 expressing tumor cells. In particular, the invention is directed to novel murine monoclonal antibodies capable of specifically binding to erbB-2 protein, gp185erbB-2, and single chain antibodies containing variable heavy and light domains derived therefrom. More particularly, the invention is directed to novel monoclonal antibodies designated e23, e21 and e94, and single chain antibodies containing variable heavy and light domains derived therefrom, the synthesis of which is set forth infra.1

Another object of the invention is to provide novel combinations of at least two different antibodies capable of binding to the erbB-2 receptor, wherein the antibodies are separately capable of treating and/or preventing the expression of erbB-2 expressing tumor cells. Preferably, these antibody combinations will exhibit greater (synergistic) cytotoxic activity than would be expected for the sum of the individual antibodies if administered separately at the same overall antibody concentration. The present inventors have unexpectedly discovered that the combination of at least two different anti-erbB-2 antibodies may provide for greater cytotoxicity than would be expected for the same overall concentration of each individual antibody if administered separately.

Preferably, at least two of these antibodies will recognize distinct erbB-2 epitopes and will not cross react with the other. However, the present inventors do not want to be restricted thereby, but rather intend to embrace any combination of anti-erbB-2 antibodies, which provides for synergistic cytotoxic activity. In the preferred embodiment, the antibody combinations will comprise e23 and e21 or e23 and e94.

The erbB-2 antibodies which are suitable for use in such combinations may include monoclonal antibodies capable of binding to erbB-2, recombinant erbB-2 antibodies, chimeric erbB-2 antibodies which comprise constant and variable domains derived from different species, such as murine-human chimeric antibodies (wherein the constant domain is human and the variable domain is of murine origin), humanized forms of such antibodies, single chain antibodies capable of binding to the erbB-2 protein, and fragments or analogues of erbB-2 monoclonal antibodies which are capable of binding to the erbB-2 protein, and which antibody combinations exhibit synergistic cytotoxic activity. Additionally, the invention further embraces the use of bispecific antibodies, in particular bispecific antibodies comprising the fusion of two different erbB-2 binding single chain antibodies, preferably each of such single chain antibodies binding to a distinct erbB-2 epitope.

Such erbB-2 antibodies will be made by conventional methods. For example, erbB-2 monoclonal antibodies may be obtained through genetic recombination or via Kohler-Milstein fusion techniques. Methods for making antibodies by recombinant methods are well known in the art and include, e.g., the methods disclosed by Cabilly et al, U.S. Pat. No. 4,816,567 and Boss et al, U.S. Pat. No. 4,816,347.

Hybridoma cell lines which secrete e23 and e21 were both deposited on Apr. 4, 1994 at the American Type Tissue Collection in Rockville, Md. and been respectively designated ATCC Accession Nos. HBl1601 and HBl1602. Both of these cell lines were deposited in accordance with the Budapest Treaty. All restrictions as to the availability of these cell lines will be irrevocably removed upon issuance of a patent in this application, or any other application which claims benefit to this application or to which this application claims benefit.

Methods for making single chain antibodies having binding specificity to a predetermined antigen are also known and are disclosed, e.g., in U.S. Pat. No. 4,946,778 to Ladner et al, U.S. Pat. No. 4,704,692 to Ladner, and U.S. Pat. No. 4,939,666 to Hardman. Methods for making single chain antibody fusions are disclosed in Chaudhary et al, Proc. Nat'l. Acad, Sci., (1990), 87, 1066-1070.

As discussed supra, the claimed antibody combinations will provide for the treatment and/or prevention of cancers associated by the overexpression of erbB-2 protein. Preferably, the first and second antibodies will be combined such that the resultant ratio of the first to second antibody is effective for decreasing the expression of the erbB-2 protein, since the expression of this protein is implicated in the prognosis of some cancer types. More preferably, the combination of antibodies will provide for enhanced decrease of erbB-2 protein expression relative to the same concentration of the individual antibodies contained therein. A convenient method for assaying the expression of the erbB-2 gene product comprises studying the effect of antibody binding on erbB-2 protein turnover (the results of which are depicted in FIG. 4). However, any method which provides for the quantitation of erbB-2 expression, e.g., Northern analysis, should be applicable. The decrease in the expression of the erbB-2 gene product is believed to result from the administered antibody or antibodies decreasing the half-life of the erbB-2 protein in the cell.

Antibody combinations which exhibit synergistic activity will be selected on the basis of those antibodies which in combination reduce erbB-2 receptor expression greater than any of the individual antibodies at the same overall antibody concentration. The relative ratios of the respective antibodies which are contained in the subject antibody combinations will vary dependent upon the number of different antibodies, their epitopic specificity, isotype, binding affinity, etc. An example of a suitable ratio of the first and second antibodies (assuming that the combination comprises two different erbB-2 antibodies) comprises a ratio of from about 1:2 to about 2:1. Preferably, the ratio will be about 1:1.

However, the invention is not restricted to any particular antibody ratio, but rather embraces any combination of at least two different erbB-2 specific antibodies which provide for reduced erbB-2 receptor expression, and preferably provides for a synergistic reduction in erbB-2 receptor expression and inhibition of erbB-2 expressing tumor cells as a result of the selected combination of erbB-2 antibodies.

As discussed supra, another object of the invention is to provide novel methods and compositions for the treatment and/or prevention of erbB-2 expressing tumor cells comprising the administration of a therapeutically effective amount of at least one of the subject novel erbB-2 monoclonal antibodies or single chain antibodies of the invention, namely e21, e23, e94 (the preparation of which is disclosed in the following examples), single chain antibodies containing variable heavy and light domains derived therein, and antibodies having the identifying characteristics thereof. Identifying characteristics are intended to include those properties which affect the immuno-binding of the particular anti-erbB-2 antibody, in particular epitopic specificity.

These antibodies may be administered by themselves, or these antibodies may be attached to cytotoxic moieties, which include e.g., radioactive materials, anti-cancer drugs (e.g., daunomyocin, adriamycin, chlorambucil), anti-metabolites (e.g., methotrexate), inhibitors of protein synthesis (e.g., diptheria toxin, Pseudomonas exotoxin, ricin, abrin, etc.), and agents which bind DNA (such as alkylating agents). In a preferred embodiment, the subject erbB-2 specific antibodies will be attached to a Pseudomonas exotoxin A variant which lacks the N-terminal domain (domain I) which is responsible for the binding of the exotoxin to its corresponding cell receptor. A particularly preferred Pseudomonas exotoxin A variant is PE40, the sequence of which is disclosed e.g., in Hwang et al, Cell, (1987), 48, 129-136 and Siegall et al, J. Biol. Chem., (1989), 264, 14256-14261 which references are incorporated by reference herein. Thereby, the subject anti-erbB-2 antibody Pseudomonas A exotoxin conjugates only comprise the binding function of the erbB-2 antibodies, and do not exhibit non-specific binding attributable to the exotoxin. In a more preferred embodiment, the Pseudomonas exotoxin A variants which are attached to the subject erbB-2 antibodies will also comprise a deletion of amino acids 365-380 (which eliminates a disulfide bond) and/or the deletion of the five C-terminal amino acids and the substitution of a tetrapeptide, KDEL, therefor. Such Pseudomonas exotoxin A variants are known in the literature, and are described e.g., in Brinkmann et al, Proc. Nat'l. Acad. Sci., (1991), 88, 8616-8620; Hwang et al, Cell, (1987), 48, 129-136; Seetharam et al, J. Biol. Chem, (1991), 266, 17376-17381; and Siegall et al, J. Biol. Chem., (1989), 264, 14256-14261, which references are incorporated by reference in their entirety.

Preferably, the antibody which is administered will comprise e23, its corresponding single chain antibodies, humanized antibodies derived from e23, chimeric antibodies, (containing the variable sequences therefrom and human constant domain sequences) or therapeutic diagnostic conjugates thereof since this antibody has been found to bind to erbB-2 expressing tumor cells with high affinity, and to not substantially bind to normal human tissues. This is advantageous both for diagnostic and therapeutic applications since it avoids false positives (if the antibodies are utilized diagnostically to assay for cancers associated with overexpression of gp185erbB-2) and also avoids cytotoxicity to normal human cells when the antibodies are used therapeutically since this antibody does not substantially bind to normal human cells.

Avidin-biotin immunoperoxidase binding assays with e23 and a number of different normal tissues have established that e23 only reacts with the membrane of simple, stratified, and squamous epithelial cells in normal human tissues. (These assays and the results thereof are described infra). This narrow range of reactivity with normal human cells is unexpected given that the erbB-2 receptor is known to be comprised on a large number of normal human tissues. It is known e.g., that erbB-2 is expressed throughout the intestinal, respiratory, urinary and reproductive tracts, as well as the skin of fetal and adult specimens (Press et al, Oncogene, (1990), 5, 953-962). More particularly, the erbB-2 receptor is expressed in normal uterine endometrial tissues (Brumm et al, Virhous Archiv. A Pathol. Anat., (1990), 417,477-484; normal breast tissues (Tsutsumi et al, Hum Pathol, (1990), 21, 750-758; Potter et al, Histopathology, (1989), 15,351-362) and kidney tissues (Potter et al, Int. J. Cancer, (1989), 44,969-974).

It has been suggested in the literature that the erbB-2 receptor may be expressed in a different form on the surface of cancer tissues than normal cells. Accordingly, the low reactivity observed with e23 and normal human tissues may be attributable to it binding an erbB-2 epitope which is selectively expressed on erbB-2 receptor expressing tumor cells.

The subject antibodies or antibody combinations will be administered to cancer patients having cancers associated by overexpression of erbB-2 protein by standard routes of administration, e.g., intraperitoneally via intravenous, or intramuscular routes. The effective dosage of the antibodies will vary dependent e.g., upon the particular antibody or antibody combination which is administered, whether or not the antibody or antibodies are conjugated to a therapeutic effective moiety, the particular therapeutic moiety (e.g., a toxin, radioactive moiety, or alkylating agent), and the condition of the patient being treated.

Preferably, the effective concentration at the target tumor site will be at least 1 μg/ml, and will not exceed 10 μg/ml. In general, in order to achieve the desired concentration of the antibody or antibodies at the tumor site the antibody or antibody combination will be administered at a dose ranging from about 0.1 mg/kg to about 10 mg/kg of body weight.

As noted supra, the subject anti-erbB-2 antibodies may be administered in unmodified form, or one or more of the subject antibodies may be administered on the form of immunotoxins. Methods for the construction of immunotoxins are well known in the art. Generally, such techniques involve direct covalent attachment or the complexation of an antibody to a therapeutic moiety, e.g., an anti-cancer pharmaceutical agent, a cytotoxin, a radioactive compound (e.g., isotopes of boron and rhenium); agents which bind DNA, such as alkylating agents, anti-cancer compounds (e.g., daunomycin, adriamycin, chlorambucil); anti-metabolites (e.g., methotrexate); and inhibitors of protein synthesis (e.g., diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aueroginosa, ricin A chain, abrin A chain, modaccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolacca americana proteins (PAPI, PAPII, and PAP-S), Momordica charantia inhibitor, curcin, crotin, Sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocoin, phenomycin and enomycin. Alternatively, the subject antibodies may be attached to a desired therapeutic-moiety using known bifunctional protein coupling agents. Examples of such coupling reagents are SPDP, IT, bifunctional derivatives of imidoesters such as dimethyl adipimidate HCl, active esters such as disuccinimidyl suberate, glutaraldehyde, bis-azido compounds, bis-diazonium compounds and diisocyanates of bis-active fluorine compounds. Preferably, the attachment of the antibody to a therapeutic moiety will be effected in a manner which minimizes loss of antibody binding function.

If the administered erbB-2 antibody or antibodies comprises a single chain antibody, the antibody will preferably be attached to a therapeutic moiety since such antibodies lack the Fc effector portion of the antibody. In such cases, attachment will be effected by expressing a DNA fusion of the subject single chain erbB-2 antibody coding sequences and a DNA sequence which encodes for a polypeptide exhibiting therapeutic activity. Generally, such therapeutic moieties will comprise polypeptide toxins or active variants thereof. The construction of such single chain antibody-toxin fusions is exemplified infra in the examples. Moreover, methods for expressing single chain antibody-therapeutic moiety DNA fusions are disclosed in U.S. Pat. No. 5,132,405 by Huston et al. In the preferred embodiment the subject anti-erbB-2 single chain antibodies will be fused to variants of the Pseudornonas exotoxin A which lack the N-terminal binding domain, and which may be further modified to eliminate disulfide bond formation (e.g., by deletion of amino acids 365-380) and/or which comprise deletions of the five C-terminal amino acids and the substitution of a tetrapeptide, KDEL, therefor. Such Pseudomonas exotoxin A variants are known in the literature as discussed supra.

The administration of the subject anti-erbB-2 antibodies in combination with a discrete therapeutic moiety, e.g., a cis-platinum type compound is further envisioned since it has been reported that a monoclonal antibody directed to erbB-2 enhances the cytotoxicity of cis-diamminedichloroplatinum against human breast and ovarian tumor cell lines. (Hancock et al, Cancer Res., (1991 ), 51, 4575-4580).

For parenteral administration the subject antibodies or antibody combinations may be formulated in a unit dosage injectable form (solution, suspension, emulsion) in association with a pharmaceutically acceptable parenteral vehicle. Examples of such vehicles are water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Nonaqueous vehicles such as mixed oils and ethyl oleate may also be used. Liposomes may also be used as carriers. The vehicles may contain minor amounts of additives that enhance isotonicity and chemical stability, e.g., buffers and preservatives. The subject antibodies and antibody combinations will typically be formulated in such vehicles at concentrations of about 1 μg/1 ml to 10 μgl/ml.

As noted, a preferred embodiment of the invention will comprise administration of a therapeutically effective amount of a combination of at least two different anti-erbB-2 antibodies. The present inventors have found that combinations of anti-erbB-2 antibodies may provide for synergistic cytotoxic activity. In the most preferred embodiments, the combination of antibodies will comprise e21 and e23, or e23 and e94. However, the invention is not restricted to such combinations, but rather embraces any combination of erbB-2 antibodies which provides for enhanced cytotoxic activity then the equivalent overall concentration of the individual antibodies contained in the combination.

Preferably, the different antibodies will bind to different erbB-2 epitopes and will not cross-react with each other. Although the present inventors do not want to be limited to any theoretical reasoning, a possible mechanism by which the down regulation and protection and/or killing of human cancer cells overexpressing erbB-2 is achieved by the present invention is that the antibodies act by constraining the erbB-2 gene product, gp185erbB-2 into an activated conformation thus mimicking an agonist ligand.

The results disclosed herein demonstrate that a combination of erbB-2 receptor binding antibodies leads to different and more potent anti-tumor activities than single antibodies. More specifically, the results indicate that combination antibody therapy is a useful strategy for treatment of malignancies associated by overexpression of 185erbB-2. This approach may be particularly important in the treatment of cancers such as gastric cancer which respond poorly to currently available chemotherapies.

As discussed supra, another object of the invention relates to the use of the novel erbB-2 monoclonal and single chain antibodies of the invention as diagnostic agents for assaying for the presence of gp185erbB-2 overexpressing tumor cells in analytes, e.g., blood serum and tumor biopsies.

The use of anti-erbB-2 specific monoclonal antibodies as diagnostic agents for detecting erbB-2 cancer cells is known in the art, as disclosed e.g. in U.S. Pat. No. 4,938,948 to Ring et al., and WO 89/06692 by Hudziak et al, published on Jul. 27, 1989. The gp185erbB-2 binding antibodies of the invention should be particularly suitable as diagnostic agents given their high binding affinity to the erbB-2 receptor. It is especially envisioned that e23 and single chain antibodies derived therefrom should be advantageous diagnostic agents, given the narrow range of binding of this antibody to normal human tissues. Thus, the use of e23 and its corresponding single chain antibody should reduce the likelihood of false positive binding results. This is a particular concern with assays which measure erbB-2 receptor expression since this protein is known to be comprised in detectable amounts on a large number of different normal human tissues.

Essentially, a sample suspected of containing erbB-2 expressing cancer cells will be incubated with the subject antibody or antibodies for a sufficient time to permit immune reactions to occur. Those skilled in the art will recognize that there are many variations in these basic procedures. These variations include, for example, RIA, ELISA, precipitation, agglutination, complement fixation and immunofluorescence. Preferably, the subject antibodies will be labelled to permit the detection of antibody-erbB-2 immunocomplexes.

The labels that are used in making labeled versions of the antibodies include moieties that may be detected directly, such as radiolabels and fluorochromes, as well as moieties, such as enzymes, that must be reacted or derivatized to be detected. The radiolabel can be detected by any of the currently available counting procedures. The preferred isotope labels are 99 Tc, 14 C, 131 I, 125 I, 3 H, 32 P and 35 S. The enzyme label can be detected by any of the currently utilized calorimetric, spectrophotometric, fluorospectrophotometric or gasometric techniques. The enzyme is combined with the antibody with bridging molecules such as carbodiimides, periodate, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. Examples are perioxidase, alkaline phosphatase, β-glucuronidase, β-D-glucosidase, urease, glucose oxidase plus peroxidase, galactose oxidase plus peroxidase and acid phosphatase. Fluorescent materials which may be used include, for example, fluorescein and its derivatives, rhodamine and its derivatives, auramine, dansyl, umbelliferone, luciferia, 2,3-dihydrophthalazinediones, horseradish peroxidase, alkaline phosphatase, lysozyme, and glucose-6-phosphate dehydrogenase. The antibodies may be tagged with such labels by known methods. For instance, coupling agents such as aldehydes, carbodiimides, dimaleimide, imidates, succinimides, bis-diazotized benzadine and the like may be used to tag the antibodies with the above-described fluorescent, chemiluminescent, and enzyme labels. Various labeling techniques are described in Morrison, Methods in Enzymology, (1974), 32B, 103; Syvanen et al., J. Biol. Chem., (1973), 284, 3762; and Bolton and Hunter, Biochem J., (1973), 133, 529.

The antibodies and labeled antibodies may be used in a variety of immunoimaging or immunoassay procedures to detect the presence of cancer in a patient or monitor the status of such cancer in a patient already diagnosed to have it. When used to monitor the status of a cancer, a quantitative immunoassay procedure must be used. If such monitoring assays are carried out periodically and the results compared, a determination may be made regarding whether the patient's tumor burden has increased or decreased. Common assay techniques that may be used include direct and indirect assays. If the sample includes cancer cells, the labeled antibody will bind to those cells. After washing the tissue or cells to remove unbound labeled antibody, the tissue sample is read for the presence of labeled immune complexes. In indirect assays the tissue or cell sample is incubated with unlabeled monoclonal antibody. The sample is then treated with a labeled antibody against the monoclonal antibody (e.g., a labeled antimurine antibody), washed, and read for the presence of ternary complexes.

For diagnostic use the antibodies will typically be distributed in kit form. These kits will typically comprise: the antibody in labeled or unlabeled form in suitable containers, reagents for the incubations for an indirect assay, and substrates or derivatizing agents depending on the nature of the label. gp185erbB-2 controls and instructions may also be included.

The following examples are offered to more fully illustrate the invention, but are not to be construed as limiting the scope thereof.

The following materials and methods were used in Examples 1-5.


Monoclonal Antibodies. Mice were immunized using a membrane preparation of N/erbB-2 cells (NIH/3T3 cells engineered to overexpress the human erbB-2 protein). Following tests of polyclonal antibody response using immunoprecipitation, three fusions were conducted using the myeloma cells line Ag8.653 and standard techniques. These fusions produced approximately 1500 hybridoma clones which were each screened using enzyme-linked immunosorbent assay. Membranes isolated from N/erbB-2 cells were bound to polystyrene plates, and culture medium was added to allow antibody-antigen interaction. Immunoglobulin binding was detected using a biotinylated goat antimouse antibody, streptavidin horseradish peroxidase, and o-phenylenediamine hydrochloride. Positive reacting hybridomas were picked and counter-screened using membranes from wild-type NIH/3T3 membranes. The molecular specificity was confirmed by immunoprecipitation analysis. Five hybridomas were picked with anti-erbB-2-specific reactivity and cloned by limiting dilution; three of these were designated as e21, e23 and e94. Ascites was prepared by administering injections of 106 hybridoma cells to pristane-primed mice. Antibodies were isolated in large amounts from ascites fluid and purified by high-performance liquid chromatography with a Gammabind Ultra column (Genex, Gaithersburg, Md.). SDS-PAGE2 was run under nonreducing conditions using Coomassie blue staining with a single band at Mr 180,000 observed, indicating a >98% purified preparation. From 1 ml of ascites approximately 8-15 mg of antibody were routinely purified.

Cells Lines and Tissue Culture.

The human gastric tumor cell line used in these studies, N87, has been previously described in the literature and was routinely subcultured in RPMI 1640 supplemented with 10% fetal bovine serum. The cell lines SK-Br-3, MDA-MB-468, and MDA-MB-231 (breast) and SK-OV-3 (ovarian) were routinely subcultured in improved minimal essential medium (IMEM) supplemented with 5% fetal bovine serum. Cultures were maintained in humidified incubators at 37° C. in an atmosphere of 5% CO2 and 95% air. Cells were tested for Mycoplasma using a ribosomal RNA hybridization method (GenProbe, San Diego, Calif.).

Growth Inhibition Assays.

A single cell suspension of 10,000 cells/well was plated in a serum-free defined media of RPMI 1640 containing bovine serum insulin (5/μg/ml final concentration) was then added. The plates were incubated for 5-7 days in a CO2 incubator with humidity at 37° C. Cell viability was monitored by one of two different methods. The first, the MTT assay (Mossman et al, J, Immun. Meth., (1983), 65, 55-63), is based on the ability of live cells to reduce a tetrazolium-based compound, MTT, to a purplish colored formazan product that can be measured spectrophotometrically. After 7 days, 50 μl of MTT reagent (0.1 mg) were added and allowed to incubate for 4 h at 37° C. Ninety % of the media was then removed, and the crystals were solubilized in 0.175 ml dimethyl sulfoxide with absorbance measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. The second method involves the cell number measurement in monolayer cultures by crystal violet staining (Sibler et al, Anal. Biochem., (1989), 182, 16-18). Cells were plated as above and after 7 days cells were fixed by the addition of 20 μl of a 11% glutaraldehyde solution. After being shaken on a Bellco Orbital Shaker for 15 min the plates were washed three times with deionized water. Plates were then air-dried and stained by the addition of 100 μl of a 0.1% solution of crystal violet dissolved in 200 mM borate, pH 6.0. After being shaken for 20 min at room temperature, excess dye was removed by extensive washing with deionized water, and the plates were air-dried prior to solubilization in 100 μl of 10% acetic acid. Absorbance was measured at 590 nm in the microplate reader.

Antibody Specificity.

Subconfluent SK-Br-3 monolayers were metabolically labeled with [135 S]Cys (specific activity, 1000 Ci/mmol). Total cell proteins were immunoprecipitated with 10 μl of the indicated antibodies. The immune complexes were recovered by protein G-Agarose (Genex) and analyzed by SDS-PAGE on an 8-16% Tris-glycine gel. The gel was exposed to film at -70° C. overnight with an intensifying screen.

Western Blots.

Cells or tumors were lysed in sample buffer which contained 0.125 M Tris-HCl, 4% SDS, 0.002% bromophenol blue, and 15% glycerol. Five % α-mercaptoethanol was added after the protein concentration was determined. Samples (10 μg total protein) were boiled for 3 min, fractionated by SDS-PAGE on 8-16% Tris-Glycine gel (Novex, Encinitas, Calif.), and transferred to nitrocellulose. Detection of gp185erbB-2 was performed with a monoclonal antibody (E2-4001; Molecular Oncology, Inc. to the COOH-terminal portion of the protein.

Southern Blots.

DNA was extracted from cell lines and human placenta tissue using guanidine thiocyanate and cesium gradient centrifugation. DNA (15 μg) was cleaved with restriction enzyme HindIII, separated by electrophoresis on a 1% agarose gel, transferred to nitrocellulose, and probed with a radioactive erbB-2 cDNA prove as previously described (King et al, Cancer Res., (1989), 49, 4185-4191). The cDNA probe corresponds to the entire erbB-2 protein coding region.

In Vivo Antitumor Assay.

Tumor cells (5×106 /mouse) were injected s.c. into the flanks of BNX (beige, nude, xid) mice. The day after cell inoculation treatment was begun which consisted of four trial groups (3 mice/group), each given 0.2-ml i.p. treatment injections twice a week. Tumor growth was monitored at least once a week and reported as an average relative tumor volume. The effect of treatment after the formation of small tumors was also carried out. Cells were injected using the same treatment protocol as above except that the treatment was begun 4 days after cell injection instead of 1 day after. Animal care was in accordance with institutional guidelines. Statistical analysis was carried out using a SAS Computer Package (SAS Institute, Cary, N.C.).

gp185erbB-2 Stability Assay.

Subconfluent N87 cell monolayers were pulse-labeled 1 h with 20 μCi[35 S]cysteine and then chased with 5 mM Cys in the presence of antibody for 24 h. Total cellular protein was immunoprecipitated as described above using a monoclonal antibody directed against the COOH terminus of gp185erbB-2 coupled to Sepharose and analyzed by SDS-PAGE. The gel was exposed to film at -70° C. overnight with an intensifying screen.

Tyrosine Phosphorylation.

Cells were plated as in the protein stability assay. After 1 h, cells were processed, and proteins were extracted in sample buffer for electrophoresis as the antibody specificity experiment. Following electrophoresis in the proteins were electroblotted onto nitrocellulose paper and incubated with anti-phosphyotyrosine IgG (monoclonal; Upstate Biotechnology, Inc.) and immunodetected using 125 I-protein A. The gel was exposed to film at -70° C. overnight with an intensifying screen.

EXAMPLE 1 Preparation of Antibodies and Immunological Characterization Thereof

The procedure described in the Materials and Methods Supra was used to produce three monoclonal antibodies which were designated e21; e23; and e94.

In particular, monoclonal antibodies directed against the extracellular domain of gp185erbB-2 were tested for specific reaction to N/erbB-2 cell membranes in an ELISA assay. Two of these designated e21 and e23 after screening in growth assays exhibited the highest biological activity and were subjected to further testing.

Both antibodies specifically immunoprecipitated a single 35 S-labeled protein of MW 185,000 from SK-Br-3 cells, a breast cancer cell line which overexpresses gp185erbB-2 protein, (Kraus et al, EMBO J., (1987), 6, 605) as shown in FIG. 1A. No immunoprecipitation was detected in cells which do not overexpress the gp185erbB-2 protein (e.g., MDA-MB-468, data not shown).

Because the erbB-2 oncogene is overexpressed frequently in at least 20% of stomach cancer, which have a poor clinical course, the effect of these antibodies on cell proliferation was studied on a gastric cell line, N87, which overexpresses gp185erbB-2 at levels commensurate with SK-Br-3. An immunoblot of the N87 cell line and a nude mouse tumor xenograft from N87 is shown in FIG. 1B compared to the breast cell lines SK-Br-3 (high level of gp185erbB-2 overexpression) and MDA-MB-231 (low level of gp185erbB-2 overexpression). The levels of erbB-2 gene amplification in N87 as shown in FIG. 1C surpassed those found in the well characterized SK-Br-3 and SK-OV-3 cell lines (Kraus et al, EMBO J., (1987), 6, 605).

EXAMPLE 2 Effect of Antibodies on Tumor Growth In Vitro

A dose response analysis of the effects of the antibodies on N87 cell proliferation is shown in FIG. 2. Antibodies e21 or e23 administered individually had no effect on the monolayer growth of cells up to a concentration of 10/μg /ml (6 μM). Administration of a 1:1 combination of e21 and e23, however, markedly affected cell proliferation at doses as low as 1 μg/ml. Fab fragments prepared from both antibodies also had no effect on cell growth alone or in combination (data not shown). In analogous experiments with three other gastric cell lines displaying little or no overexpression by immunoblot analysis, no inhibition of growth even at the highest dose was observed with the antibody combination or the antibodies alone.

EXAMPLE 3 Preventive Combination Antibody Therapy

The efficacy of combination antibody therapy was tested on the growth of N87 tumor xenografts. One inoculation of five million N87 cells were injected subcutaneously into nude mice produced rapidly growing tumors with a short latency. Tumor growth at the injection site was easily quantitated. As shown in FIG. 3A, the N87 cells did not form tumors in the animals treated twice a week for three weeks with a total of 200 μg of antibodies per injection with the combination of e21 and e23. In sharp contrast they were potently tumorigenic in animals treated with the single antibodies or PBS and the tumor grew to over 1 cm3 in tumor volume over the period measured. In contrast to in vitro experiments, each monoclonal antibody alone may have limited activity to partially restrict the rate of tumor growth. However, the activity exhibited by the combination far exceeded the cumulative effect expected from the combination.

To determine if the combined therapy with e21 and e23 was able to eradicate established tumors, an experiment was performed in which tumors were allowed to grow to measurable sizes prior to antibody treatment. The results are illustrated in FIG. 3B. In animal groups randomized so that the starting size of the tumors was near the same volume (100 mm3), the tumors continued to grow when the animals were given single antibody treatment of e21 or e23 (200 μg/injection, 2 injection/week, 3 weeks, 6 mice). In contrast, in the animals given two antibody combination treatment of e21 and e23, results shown are the average of 6 animals, tumors completely regressed after 11 days (4 treatments of 200 μg of total antibody). This is the first reported observation of tumor xenograft regression induced by a combination of different anti-erbB-2 monoclonal antibodies. Previous studies have shown that two anti-neu antibodies can inhibit the growth of tumors by murine cells transformed by the mutationally activated neu oncogene (Drebin et al, Oncogene, (1988), 2, 273). The activation of the murine neu oncogene is accomplished by point mutation as evidenced by qualitative interference in the structure and function of the neu gene, whereas the human erbB-2 oncogene is activated by overexpression of erbB-2, a quantitative interference of the apparently normal protein which results in tumor formation.

Since the mechanisms for tumor growth are so different between murine and human, it was unexpected that similar mechanisms of neutralization of the genes involved would be effective. This effect is also seen with the inhibition of leukemic tumor cell growth using anti-transferrin monoclonal antibodies (White et al, Cancer Res., (1990), 50, 6295).

EXAMPLE 4 Antiproliferative Effects of Antibody Combination

To investigate the molecular basis for the antiproliferative effects of e21 and e23, we measured the rate of gp185erbB-2 turnover in the presence or absence of antibodies. N87 cells were pulse-labeled with 35 S-Cys and then chased for various times in the presence of single antibody or the e21/e23 combination. The results of a 24 h chase are shown in FIG. 4A. The antibody gp185erbB-2 combination induced rapid degradation of gp185erbB-2 while the individual antibody treatment had little or no effect. Thus, the antiproliferative effect of e21/e23 treatment might likely be explained by their ability to increase the turnover of gp185erbB-2.

EXAMPLE 5 Autophosphorylation Activity of Antibody Combination

To test whether the subject antibodies result in increased gp185erbB-2 autophosphorylation, anti-phosphyotyrosine immunoblots were effected using N87 cells. Cells were plated as described in the Materials and Methods. After 1 h, cells were processed, and proteins were extracted in sample buffer for electrophoresis when evaluating antibody specificity. Following electrophoresis the proteins were electroblotted onto nitrocellulose paper and incubated with anti-phosphyotyrosine IgG (monoclonal; Upstate Biotechnology, Inc.) and immunodetected using 125 I-protein A. The gel was exposed to film at -70° C. overnight with an intensifying screen.

As shown in FIG. 4B, increases in the tyrosine phosphorylation of gp185erbB-2 from N87 cells were observed after 15 min and 1 h after the addition of the single antibodies or the antibodies in combination. (The same results were observed at 30 min and 2 h; data not shown). This suggests that activation of tyrosine activity may be necessary but is probably not essential for growth inhibition.

EXAMPLE 6 Combination Antibody Treatment Effect the Growth of Calu-3 Cells

In order to demonstrate that the effect of combination of anti-erbB-2 antibodies e21 and e23 is not limited to effect on the N87 gastric cancer cell line, we investigated the human lung adenocarcinoma cell line Calu-3. This cell line overexpresses the gp185erbB-2 protein as determined by immunoblot analysis (data not shown). In experiments very similar to that described above, the combination of e21 and e23 show dramatic inhibition of cell growth as measured in an MTT assay (FIG. 5). In this experiment, a single cell suspension of 10,000 cells/well was plated in a chemically defined media consisting of RPMI-1640 supplemented with insulin, human transferrin, 17-estradiol. sodium selenite, and Hepes buffer. PBS, e21, e23 or a combination of e21 and e23 were then added. The cells were allowed to grow at 37° C. in a 5% CO2 humidified atmosphere. After 7 days, MTT reagent was added and allowed to incubate for 4 hours at 37° C. 90% of the media was then removed and the crystals solubilized in DMSO. Optical densities were measured at 540 nm in a Molecular Devices Vmax kinetic microplate reader. A dose response analysis of the effects of antibody treatment is shown in FIG. 5. These results indicate that combination antibody therapy is not limited in effectiveness to N87 cells or gastric cancer cells. It also indicates that combination antibody therapy may have effectiveness in the treatment of adenocarcinoma of the lung.

EXAMPLE 7 Effectiveness of other Combinations of Antibodies in Inhibiting Cell Growth

In order to determine if e21 and e23 are unique in their ability to combine to cause growth inhibition, we investigated the combination of e94 and e23 on the growth of Calu-3 cells in vitro. e94 is another monoclonal antibody developed by the present inventors which specifically binds to the erbB-2 protein. An MTT assay of cell growth was conducted as described in EXAMPLE 6. As shown in FIG. 6, the combination of antibodies inhibits cell growth and the individual antibodies do not. This indicates that the ability to combine antibodies to produce a more profound growth inhibition is not limited to a particular antibody combination.

EXAMPLE 8 Generation of a single chain (Fv) from mAb e23

Poly A RNA was extracted from e23 producing hybridoma cells using oligo dT affinity chromatography (In vitrogen). cDNA was prepared using random primer (N6) (Boerhinger Mannheim). The immunoglobulin light and heavy chain clones were isolated using PCR and the primers: light chain, [SEQ ID NO. 3] 5' CAC GTC GAC ATT CAG CTG ACC CAC TCT CCA and [SEQ ID NO. 4] GAT GGA TCC AGT TGG TGC AGC ATC3'; heavy chain [SEQ ID NO. 5] 5'C GGA ATT TCA GGT TCT GCA GIA GTC WGG3' and [SEQ ID NO. 6] 5' AGC GGA TCC AGG GGC CAG TGG ATA GAC3' [G,A,C,T stand for standard nucleotides; I for inosine, W for A or T]. The products of the PCR reaction were cloned into puc18. Linkage into a SC(Fv) was by PCR giving the individual light and heavy cDNA clones and 4 oligonucleotides [SEQ ID NOS. 7-10 ]

5'- cgagatgagtccagctgacccagtctc

5'- gaagatttaccagaaccagaggtagaaccttttatttccagcttgga

5'- ctggttctggtaaatcttctgaaggtaaaggtgtgcagctgcaggag

5'- cgagtgcaagcttaggagacggtgaccgt.

The light and heavy chain coding regions were joined by a synthetic linker GSTSGSGKSSEGKG specified by overlapping oligonucleotides as described. The intact scFv coding region was inserted in frame with an E. coli OMPA leader sequence under direction of the lambda PL promoter. Induction of protein and bacterial lysis and refolding was as previously described (Pantaliano et al, Biochem., (1991), 30, 117-125). scFv was purified as a single peak from CM chromatography and judged to be >70% by SDS gel electrophoresis. This scFv will be referred to herein as e23(Fv).

EXAMPLE 9 Generation of a scFv from mAb e21

Poly A RNA was extracted from e21 producing hybridoma cells using oligo dT affinity chromatography (In vitrogen). cDNA was prepared using random primer (N6) (Boerhinger Mannheim). The immunoglobulin light and heavy chain clones were isolated using PCR and the primers: light chain, [SEQ ID NO. 3] 5' CAC GTC GAC ATT CAG CTG ACC CAC TCT CCA and [SEQ ID NO. 4] GAT GGA TCC AGT TGG TGC AGC ATC3'; heavy chain [SEQ ID NO. 5] 5'C GGA ATT TCA GGT TCT GCA GIA GTC WGG3' and [SEQ ID NO. 6] 5' AGC GGA TCC AGG GGC CAG TGG ATA GAC3'[G,A,C,T stand for standard nucleotides; I for inosine, W for A or T]. The products of the PCR reaction were cloned into pUC18. Linkage into a scFv was by PCR giving the individual light and heavy cDNA clones and 4 oligonucleotides [SEQ ID NOS. 7-10] 5'- cgagatgagtccagctgacccagtctc

5'- gaagatttaccagaaccagaggtagaaccttttatttccagcttgga

5'- ctggttctggtaaatcttctgaaggtaaaggtgtgcagctgcaggag

5'- cgagtgcaagcttaggagacggtgaccgt.

The light and heavy chain coding regions were joined by a synthetic linker [SEQ ID NO. 11] GSTSGSGKSSEGKG specified by overlapping oligonucleotides as described. The intact scFv coding region was inserted in frame with an E. coli OMPA leader sequence under direction of the lambda PL promoter. Induction of protein and bacterial lysis and refolding was as previously described (Pantaliano et al, Biochem., (1991), 30, 117-125). scFv was purified as a single peak from CM chromatography and judged to be >70% by SDS gel electrophoresis. This scFv will be referred to herein as e21(Fv).

EXAMPLE 10 Construction of Single-Chain Immunotoxin with Anti-erbB2 Antibody e23

Single-chain immunotoxins made by the fusion of the antigen-binding region (Fv) and PE40 can retain the binding affinity of the native antibody and are often more active than the respective chemical conjugates (Chaudhary et al, Proc. Nat'l. Acad. of Sci., (1990), 87, 1066-1070; Batra et al, Mol. Cell Biol. (1991 ), 11, 2200-2205. ) For this reason, we selected antibody e23 for construction of a first-generation recombinant immunotoxin. The construction of the subject e23 antibody derived single chain antibody immunotoxins is also described in Butra et al, Proc Natl Acad Sci, (1992), Vol. 89, pp. 5867-5871, which is incorporated by reference in its entirety herein.

First, an intact sc(Fv) for coding region designated e23(Fv) was generated as described supra. The sequence of the single-chain protein is shown in (FIG. 7). To verify the binding activity of the purified e23(Fv) protein we conducted competition binding using 125 I-labeled e23 Fab (see FIG. 9). The overall structure of our first recombinant immunotoxin is the amino-terminal e23 sc(Fv) domain joined to the translocation (II) and ADP-ribosylating (III) domains of PE. The assembled gene is under control of a bacteriophage T7 promoter. The resulting plasmid, pJB23-40, expresses the variable region of the light chain of e23, a 14-amino acid linker peptide, the variable region of the heavy chain of e23, and amino acids 253-613 of PE. The chimeric protein was expressed in E. coli and purified. The resulting protein was >70% pure as judged by SDS/PAGE (data not shown).

Cytotoxicity of e23(Fv)PE40.

e23(Fv)PE40 was tested on BT474 breast cancer cells and was found to inhibit protein synthesis in a dose-dependent manner with an ID50 of 1.5 ng/ml (FIG. 10, Table 1). The cytotoxic activity was blocked by competition with excess native e23, demonstrating the specificity of e23(Fv)PE40 for erbB-2-containing cells (FIG. 10). Another anti-erbB-2 monoclonal antibody, e21, which binds to a different site, had no effect on the toxicity of e23(Fv)PE40 (data not shown). In the same experiment, e23-LysPE40, a chemical conjugate comprising e23 chemically conjugated to PE40, had an ID50 of 12 ng/ml (FIG. 10, Table 1). The activity of e23(Fv)PE40 was assayed on several cell lines expressing erbB-2 and compared with that of the chemical conjugate, e23-Lys40 (Table 1). On all four target cells, e23(Fv)PE40 was active and the ID50 values on a molar basis were 2- to 3-fold lower than those of e23-LysPEA0. Both molecules had very little activity on KB cells, showing their specificity for erbB-2-expressing cells.

Derivatives of e23(Fv)PE40.

It is known that when the five carboxy terminal amino acids of the Pseudomonas exotoxin variant PE40 are replaced by KDEL that this results in molecules that have 3- to 10-fold higher cytotoxic activities See Maram et al, J. Biol. Chem., (1991), 266, 17376-17381. Also, deleting part of domain Ib of PE, specifically amino acids 365-380, thereby deleting a disulfide bond, does not result in any loss of activity of several fusion proteins including TGFα-PE40, anti-Tac(Fv)-PE40, and B3(Fv)PE40, Brinkmann et al, Proc. Nat'l. Acad. Sci., (1991), 88, 8616-8620; Siegall et al, J. Biol. Chem., (1989), 264, 14256-14261 . Since mixed disulfide bonds can form during the renaturation of recombinant proteins, we thought it would be helpful to delete this region. To explore the possibility of making a much more active derivative of e23(Fv)PE40, we made three new constructions: (i) e23(Fv)PE40KDEL, where the five carboxyl terminal amino acids of PE40 are replaced by KDEL; (ii) e23(Fv)PE38, in which amino acids 365-380 have been deleted from e23(Fv)PE40 but the carboxyl terminus is not altered; and (iii) e23(Fv)PE38KDEL, where the five C-terminal amino acids are replaced by KDEL in e23(Fv)PE38. These derivatives are diagramed in FIG. 11. The chimeric proteins were also purified to >70% purity and tested for cytotoxic activity on target cells. As shown in FIG. 12, all of the new derivatives inhibited the protein synthesis of BT474 cells in a dose-dependent manner, with e23(Fv)PE38KDEL being the most active. Table 2 summarizes the ID50 values of the e23(Fv)PE40 derivatives on various cell lines. On all three target cell lines, e23(Fv)PE38KDEL, was found to be the most active. e23(Fv)PE38KDEL was 6- to 10-fold more active than e23(Fv)PE40 (Table 2). None of the proteins had any cytotoxicity on KB cells, a cell line that does not overexpress erbB-2. In the presence of excess e23, the cytotoxic activity of all derivatives was abolished (data not shown). The binding activity of e23(Fv)PE38KDEL was monitored in a competition binding assay. As shown in FIG. 9, e23(Fv)PE38KDEL was able to compete with homologous e23 Fab for binding, but a higher concentration was required than for e23(Fv). This result is consistent with either a lower overall affinity of e23(Fv)PE38KDEL or the purified protein being a mixture of active and inactive species. Current purification methods for e23(Fv)PE38KDEL do not allow us to separate forms on the basis of binding activity. To verify the binding activity of the e23(Fv), we conducted a similar competition binding assay and found that e23 Fab binds with slightly lower affinity than intact antibody and monomeric Fab produced from e23 (FIG. 9).

Growth Inhibition of Human Tumors in a Nude Mouse Model.

The selective toxicity of the e23(Fv)PE38KDEL to cells overexpressing erbB-2 encouraged us to attempt to treat human tumor cells growing in nude mice. The human gastric cancer cell line N87 has been shown to overexpress erbB-2 protein at high levels as a result of gene amplification, and N87 cells grow well as a subcutaneous tumor in immunocomprised mice Kaspyrzyk et al, Cancer Res., (1992), 52, 2771-2776. Injections of 5×106 cells on day 0 were followed by six intravenous treatments over 3 days, starting on day 10. Immunotoxin treatment inhibited growth of established tumors (FIG. 13). No animal deaths were observed at doses of 2 μg. Equivalent amounts of either e23 Fab, e23 SC(Fv) (data not shown), or LysPE38KDEL had no effect on tumor growth. Nonspecific toxicity was assayed by monitoring the animal weight; no weight loss was observed at doses of 2 μg.

              TABLE 1______________________________________Comparison of activity of e23(Fv)PE40and chemical conjugates on various human cells linesID50 ng/ml (pM)                              RelativeCells  e23(Fv)PE40  e23-LysPE40    activity*______________________________________BT474  1.5     (23)     12     (63)    0.37N87    3.5     (54)     24     (126)   0.43SK-OV-3  22.0    (338)    180    (947)   0.36SK-Br-3  32.0    (492)    180    (947)   0.52A431   170.0   (2615)   >500   (>2631) NC______________________________________ *Ratio of ID50 (pM) of e23(Fv)PE40 to ID50 of e23LysPE40 on the same cell line. NC, not calculated.

              TABLE 2______________________________________Activity of e23(Fv)PE40 and derivativeson various human cell linesProtein      BT474    N87     SK-OV-3 KB______________________________________e23(Fv)PE40  3        8       80      >500e23(Fv)PE40KDEL        1.6      3.8     22      >500e23(Fv)PE40KDEL        3.6      3.7     62      >500e23(Fv)PE38KDEL        0.18     1.2     5       >500______________________________________

Based upon the above results, it is expected that the subject erbB-2 immunotoxins, most particularly e23(Fv)PE38KDEL should be suitable for treatment of cancers associated by the overexpression of gp185erbB-2 which occurs, e.g., in about 30% of adenocarcinomas of the breast, stomach, lung and ovary. Direct evidence supporting this conclusion is provided by the results showing inhibition of tumor growth in nude mice.


The following experiment analyzes the expression of the antigen recognized by murine monoclonal antibody e23 on a panel of normal human tissues, using cryostat-cut frozen tissue sections and the avidin-biotin immunoperoxidase technique. These studies were conducted at the highest concentration of antibody that does not show non-specific binding. This allows for the detection of all levels of cross-reactivity in different tissues. In addition, fixation analyses to establish the best combination of antigenic showing intensity and morphological preservation was performed.


Source of the tissues

Histologically normal adult human tissues were obtained from surgical pathology and autopsy specimens. Fresh tissues were embedded in cryomolds of OCT compound (Miles Laboratories, Inc., Naperville, Ill.), frozen, and stored at -70° C. until needed. All tissues were used as frozen tissue sections from IMPATH's frozen tissue bank, and were well-preserved histologically.


e23 was used at a concentration of 1.0 mg/ml, and was used diluted in phosphate buffered saline (PBS, NACl-8.54 gms and NaPo4 -1.46 gms per liter, pH=7.2-7.4) (DIFCO Laboratories, Detroit, Mich.) containing 2% bovine serum albumin (BSA). e23 was received on wet ice and stored at 4° C.

Purified mouse IgG1 (Coulter Immunology, Hialeah, Fla.), was used as the negative control, diluted in 2% BSA/PBS to the same working concentration as Antibody e23.

Biotinylated horse anti-mouse IgG (heavy + light chains specific) affinity purified antibodies (1:200 dilution in PBS) (Vector Laboratories, Inc., Burlingame, Calif.) were used as a secondary antibody.

Avidin-biotin-peroxidase complexes (1:50 dilution in PBS) (Vector Laboratories, Inc., Burlingame, Calif.) were used as the labeling reagent.


Immunoperoxidase Techniques: Immunohistochemical studies were performed using the Avidin-Biotin Immunoperoxidase technique. To assure that tissue sections adhere, slides were coated with 0.005% Poly-L-Lysine solution in deionized water (Sigma Chemical Co., St. Louis, Mo.). Frozen sections were cryostat-cut (4-8 microns thick), air dried and fixed in 95% ethanol, then bathed in PBS.

Endogenous peroxidase activity was blocked with a 10 minute 0.3% hydrogen peroxide incubation.

To reduce endogenous biotin content, all tissues were washed several times in PBS, then incubated with a solution of avidin (Vector Labs) for 15 minutes at room temperature, washed in PBS, incubated with a solution of biotin (Vector Labs) for 15 minutes at room temperature, and washed in PBS.

Tissue sections were then incubated for 10 minutes with suppressor serum. Suppressor serum consisted of normal horse serum (NHS) (Jackson ImmunoResearch Labs, West Grove, Pa.) diluted to 5% with PBS containing 2% BSA.

Tissue sections were incubated with the primary antibody for 30 minutes at room temperature. Sections were then washed, incubated with biotinylated horse anti-mouse IgG antibodies for 20 minutes, washed in PBS, incubated with avidin-biotin-peroxidase complexes for 20 minutes, then washed in PBS.

The peroxidase reaction was performed by incubating tissue sections for 2-5 minutes with 3,3-diaminobenzidine-tetrahydrochloride (DAB) (Sigma Chemical Co., St. Louis, Mo.). Tissue sections were thoroughly washed, counterstained with Harris hematoxylin, alehydrated through graded alcohols and xylenes, and mounted with permaslip (Alba Scientific, St. Louis, Mo.).

Tissues that demonstrated high levels of background staining with the negative control antibody were repeated, utilizing more extensive washing and avidin-biotin blocking.


erbB-2 positive human breast carcinoma (92-31-626) was used as positive control for Antibody e23; erbB-2 negative human breast carcinoma (92-31-625) was used as the negative control tissue for e23. Both control tissues were supplied by Oncologix, Inc. Negative controls consisted of substitution of the primary antibody with purified mouse IgG 1, used at the same working concentration as test antibody e23.


The purpose of the fixation analysis is to establish the conditions which provide the optimal combination of antigenie staining intensity and morphological preservation. Frozen tissues used in our studies are fixed after they have been sectioned, and fixatives are only used in subsequent studies if the staining intensity is better than in unfixed sections. For this study, positive control tissue fixed with four fixative reagents were compared to unfixed tissue. These fixatives included 10% neutral buffered formalin, acetone (2°-8° C.), methyl/acetone (1:1 V/V; 2°-8° C.) and 95% ethanol. Fixation in 95% ethanol gave optimal results for e23.


The purpose of the titration analysis is to determine the highest concentration of the antibody that can be used for the study without non-specific binding. This allows for detection of all levels of cross-reactivity in different tissues. This analysis showed a concentration of 10.0/μg /ml to be optimal.


All aspects of the study were conducted in adherence to the FDA Good Laboratory Practices regulations.

The results of this analysis are set forth on the following pages.

______________________________________RESULTS OF SPECIFICITY ANALYSISAntibody e23Summary of Reactivity on Normal Tissues       Tested     Range of       Positive/Total                  Reactivity (0 to 3+)______________________________________Neg. Control Tissue-         0            0Breast CarcinomaPos. Control Tissue-         90-100% of the                      3+Breast Carcinoma         tumor cellsAdrenal:Cortex        0/3          0Medulla       0/3          0Bladder:      3/3          +/- to 3+Bone Marrow:  0/3          0Peripheral Blood Cells:         0/3          0Brain:Neuroglia     0/1          0Neurons       0/1          0Brain Cerebellum:Neuroglia     0/4          0Neurons       0/4          0Brain Cortex:Neuroglia     0/2          0Neurons       0/2          0Breast:Acini         3/3          1+ to 3+Ducts         3/3          1+ to 3+Cervix:Endocervix    3/3          2+ to 3+Exocervix     3/3          1 + F to 3+Esophagus:Squamous epithelium         2/3          1+ to 3+Glands        2/21    3+Eye:          0/3          0Heart:        0/3          0Kidney:Glomerulus    0/3          0Tubules       0/3          0Collecting Tubules         0/3          0Large Intestine:         3/3          +/-Liver:Hepatocytes   0/3          0Bile ducts    0/3          0Kupffer cells 0/3          0Lung:Bronchial cells         3/3          2+Alveolar cells         3/3          1+ to 2+Lymph Node:   0/3          0Muscle, skeletal:         0/3          0Ovary:        0/3*         0 *Mesothelial cells reactive (2-3+) in 1 of 3 specimens; ovary negative.

Pancreas:Endo. Cells   0/3          0Exo. Cells    0/3          0Ducts         0/3          0Parathyroid:  0/3          0Parotid Gland:         3/3          1+ to 2+Pituitary:    0/3          0Prostate:     3/3*         1+ to 2+ *Stromal cells (fibroblasts) are reactive (2-3+) in 3 of 3 specimens.

Skin:Epidermis     3/3          1+Adnexa        3/3          1+Small intestine:         3/3          1+ to 3+Spinal Cord:Neuropil      0/3          0Neurons       0/3          0Spleen:       0/3          0Stomach:      3/3          1 + FSkeletal muscle:         0/3          0Thymus:       0/2          0Testis:Germinal cells         0/3          0Stromal cells 0/3          0Thyroid:      0/3          0Tonsil:       0/3          0Uterus:Endometrium   2/22    1+ to 2+Myometrium    0/3          0Stromal cells 0/3          0______________________________________ 1 Glands not seen in 1 of 3 specimens. 2 Endometrium not seen in 1 of 3 specimens.

Murine monoclonal antibody e23 was supplied by Oncologix, Inc. to IMPATH for analysis of immunoreactivity with a selected panel of normal human tissues. Antibody e23 is of the IgG 1 subclass and was supplied at a concentration of 1.0 mg/ml. Fixation analysis indicated that the optimal fixative for Antibody e23 was 95% ethanol. Using 95% ethanol as the fixative of choice, a titration analysis was run using the positive control tissue, human breast carcinoma (92-31-626), supplied by Oncologix, Inc. The purpose of the titration analysis is to determine the highest concentration of the antibody that can be used for the study without non-specific binding. This allows for detection of all, including low, levels of cross-reactivity of the antibody in different tissues. Since the components that give rise to non-specific binding are not tissue specific, the titration analysis is done on the positive control tissue. Titration analysis with e23 indicated that the optimal working concentration for the antibody was 10.0 μg/ml in IMPATH's test system.

e23 was found to have a very restricted pattern of reactivity. Positive reactivity was observed in tissues of simple, stratified and squamous epithelial origin. e23 showed positive reactivity with cells of the bladder, breast, cervix, esophagus, large and small intestines, bronchial and alveolar cells of the lung, parotid gland, prostate, skin and endometrium of the uterus. The reactivity with e23 was restricted to the membrane of these epithelial cells; the intensity of reactivity varied from equivocal to strong.

All cells of lymphoid origin including bone marrow, peripheral blood, lymph node, spleen, and tonsil were unreactive with the test antibody.

Immunoreactivity was also not seen in cells of neuroectodermal origin including those in the brain, spinal cord, and peripheral nerve. Mesenchymal elements such as skeletal and smooth muscle cells, endothelial cells, as well as polymorphonuclear inflammatory cells were negative with antibody e23. Stromal cells of possible mesenchymal origin present in the prostate were reactive with antibody e23.

In summary, the reactivity observed with antibody e23 was restricted to the membrane of simple, stratified, and squamous epithelial cells in normal human tissues. Thus, given its minimal reactivity with normal tissues, e23 and its corresponding single chain antibodies, or humanized antibodies derived therefrom, and antibodies having the immunobinding characteristics thereof should be well suited for use as a diagnostic or therapeutic agent for patients exhibiting cancers associated by gp185erbB-2 overexpression which include certain highly malignant tumors, such as adenocarcinoma of the stomach, lung, breast and ovary.

The reactivity of e23 and e21 was then compared for a number of primate tissues. The results of this comparison are set forth on the following page. The results therein clearly demonstrate that e23 exhibits substantially lower reactivity with normal primate tissues than e21. Given its lower reactivity with normal tissues, it is expected that e23 should function as a better diagnostic and/or therapeutic agent than e21. In particular, it is expected that e23 should provide for fewer false positive diagnoses and lesser adverse reactions to normal human tissues.

______________________________________Comparison of e23 and e21 Antibodies      e23      e21______________________________________Western Blot -          -Immunoprecipitation        +          +ELISA        +          +Immunohistochemistry        -          +Formalin FixedImmunohistochemistry        +          +FrozenCynomolgus and        luminal edge                   epithelial cells, membraneBaboon Esophagus        cells of   Periferal nerve cells        epithelium,        membraneCynomolgus and        delicate   ductal epithelium 3+Baboon Breast        fibroblast keratinocytes (skin)        staining   fibroblasts 2+                   perineurium 2+                   endothelim 1-2+                   endoneurium 1+Cynomolgus brain        cerebellum -                   cerebellum - no staining        no staining                   cortex - arachnoid 2+dura 2+      cortex -        no stainingCynomolgus bladder        +/-        +, Membrane______________________________________

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4704692 *Sep 2, 1986Nov 3, 1987Ladner Robert CComputer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides
US4867973 *Sep 13, 1984Sep 19, 1989Cytogen CorporationAntibody-therapeutic agent conjugates
US4939666 *Sep 2, 1987Jul 3, 1990Genex CorporationIncremental macromolecule construction methods
US4946778 *Jan 19, 1989Aug 7, 1990Genex CorporationSingle polypeptide chain binding molecules
GB2197323A * Title not available
Non-Patent Citations
1 *Batra et al. Proc. Natl. Acad. Sci. 89:5867 5871 (1992).
2Batra et al. Proc. Natl. Acad. Sci. 89:5867-5871 (1992).
3 *Dillman Ann. Internal Med. 111:592 603 (1989).
4Dillman Ann. Internal Med. 111:592-603 (1989).
5 *Drebin et al. Oncogene 2:273 277 (1988).
6Drebin et al. Oncogene 2:273-277 (1988).
7 *Dykins et al. J. Pathology 163:105 110 (1991).
8Dykins et al. J. Pathology 163:105-110 (1991).
9 *Fendly et al. Can. Res. 50:1550 1558 (1990).
10Fendly et al. Can. Res. 50:1550-1558 (1990).
11 *Harris et al. TIBTECH 11:42 46 (1993).
12Harris et al. TIBTECH 11:42-46 (1993).
13 *Hird et al. Genes and Cancer, by Wiley & Sons, ed. D. Carney et al. (1990) Chapter 17.
14 *Langton et al. Cancer Res. 51(10):2593 2598 (1991).
15Langton et al. Cancer Res. 51(10):2593-2598 (1991).
16 *Lenz et al. Gene 87:213 218 (1990).
17Lenz et al. Gene 87:213-218 (1990).
18 *Lipponen et al. Eur.Urol. 20:238 242 (1991).
19Lipponen et al. Eur.Urol. 20:238-242 (1991).
20 *Osband et al. Immunotherapy 11(6):193 195(1990).
21Osband et al. Immunotherapy 11(6):193-195(1990).
22 *Paik et al. J. Clin. Oncology 8(1):103 112 (1990).
23Paik et al. J. Clin. Oncology 8(1):103-112 (1990).
24 *Riechmann et al. Nature 332:323 327 (1988).
25Riechmann et al. Nature 332:323-327 (1988).
26 *Shepard et al. J. Clin. Imm. 11(3):117 127 (1991).
27Shepard et al. J. Clin. Imm. 11(3):117-127 (1991).
28 *Waldman Science 252:1657 1662 (1991).
29Waldman Science 252:1657-1662 (1991).
30 *Ware et al. Human Pathology 2(3):254 258 (1991).
31Ware et al. Human Pathology 2(3):254-258 (1991).
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US5753204 *Jun 5, 1995May 19, 1998Chiron CorporationBiosynthetic binding proteins for immunotargeting
US5837846 *Jun 5, 1995Nov 17, 1998Creative Biomolecules, Inc.Biosynthetic binding proteins for immuno-targeting
US5877305 *Dec 12, 1994Mar 2, 1999Chiron CorporationDNA encoding biosynthetic binding protein for cancer marker
US6018417 *Jan 12, 1998Jan 25, 2000Asahi Kogaku Kogyo Kabushiki KaishaReal image finder
US6197517May 21, 1999Mar 6, 2001Rosetta Inpharmatics, Inc.Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6200803Sep 2, 1999Mar 13, 2001Rosetta Inpharmatics, Inc.Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6221597May 21, 1999Apr 24, 2001Rosetta Inpharmatics, Inc.Essential genes of yeast as targets for antifungal agents, herbicides, insecticides and anti-proliferative drugs
US6267958 *Mar 14, 1996Jul 31, 2001Genentech, Inc.Protein formulation
US6685940Mar 14, 2001Feb 3, 2004Genentech, Inc.Protein formulation
US6821515Aug 25, 2000Nov 23, 2004Genentech, Inc.Protein formulation
US6869962Jun 11, 2003Mar 22, 2005Agouron Pharmaceuticals, Inc.Benzofused heterozryl amide derivatives of thienopyridines useful as therapeutic agents, pharmaceutical compositions including the same, and methods for their use
US6949245Jun 23, 2000Sep 27, 2005Genentech, Inc.Humanized anti-ErbB2 antibodies and treatment with anti-ErbB2 antibodies
US6995171Jun 20, 2002Feb 7, 2006Agouron Pharmaceuticals, Inc.Bicyclic pyrimidine and pyrimidine derivatives useful as anticancer agents
US7037498Jan 4, 2002May 2, 2006Abgenix, Inc.Antibodies to insulin-like growth factor I receptor
US7041292Jun 23, 2000May 9, 2006Genentech, Inc.Treating prostate cancer with anti-ErbB2 antibodies
US7045528Mar 9, 2004May 16, 2006Agouron Pharmaceuticals, Inc.Benzofused heterozryl amide derivatives of thienopyridines useful as therapeutic agents, pharmaceutical compositions including the same, and methods for their use
US7053107Dec 15, 2003May 30, 2006Agouron Pharmaceuticals, Inc.Indazole compounds and pharmaceutical compositions for inhibiting protein kinases, and methods for their use
US7060268May 2, 2003Jun 13, 2006Genentech, Inc.Protein formulation
US7138497Jun 21, 2001Nov 21, 2006Chiron CorporationBiosynthetic binding proteins for immuno-targeting
US7208500Aug 26, 2004Apr 24, 2007Agouron Pharmaceuticals, Inc.Thienopyridine-phenylacetamides and their derivatives useful as new anti-angiogenic agents
US7226592Oct 9, 2003Jun 5, 2007Merck Patent GmbhBispecific anti-Erb-B antibodies and their use in tumor therapy
US7244232 *Apr 24, 2002Jul 17, 2007Biomed Solutions, LlcProcess for identifying cancerous and/or metastatic cells of a living organism
US7288251Nov 8, 2002Oct 30, 2007Abgenix, Inc.Antibodies to CD40
US7326414Mar 13, 2006Feb 5, 2008Warner-Lambert Company LlcAntibodies to M-CSF
US7338660Aug 25, 2005Mar 4, 2008Abgenix, Inc.Methods of treating cancer and enhancing immune responses with antibodies that bind CD40
US7371376Nov 2, 2000May 13, 2008Genentech, Inc.Anti-ErbB2 antibodies
US7402660 *Aug 1, 2001Jul 22, 2008The Johns Hopkins UniversityEndothelial cell expression patterns
US7449184Jun 15, 2005Nov 11, 2008Genentech, Inc.Fixed dosing of HER antibodies
US7485302May 5, 2006Feb 3, 2009Genentech, Inc.Treatment with anti-ErbB2 antibodies and chemotherapeutic agents
US7498030Sep 9, 2005Mar 3, 2009Genetech, Inc.Treatment with anti-ErbB2 antibodies and anti-hormonal compounds
US7498142 *Jan 31, 2006Mar 3, 2009Yeda Research And Development Co., Ltd.Methods of identifying combinations of antibodies with an improved anti-tumor activity and compositions and methods using the antibodies
US7498420Aug 3, 2004Mar 3, 2009Amgen Fremont Inc.Antibodies to c-Met
US7501122Sep 9, 2005Mar 10, 2009Genentech, Inc.Treatment with anti-ErbB2 antibody combinations
US7527791Mar 31, 2005May 5, 2009Genentech, Inc.Humanized anti-TGF-beta antibodies
US7537762Sep 6, 2006May 26, 2009Amgen Fremont, Inc.Human monoclonal antibodies to activin receptor-like kinase-1
US7537931May 5, 2006May 26, 2009Genentech, Inc.Humanized anti-ERBB2 antibodies and treatment with anti-ERBB2 antibodies
US7563442Aug 26, 2005Jul 21, 2009Abgenix, Inc.Antibodies to CD40 and methods of treating cancer and enhancing immune responses
US7592430Sep 9, 2004Sep 22, 2009Amgen FremontAntibodies to M-CSF
US7612178Nov 3, 2009Biogen Idec Ma IncAnti-IGF-1R antibodies and uses thereof
US7618626Jul 15, 2005Nov 17, 2009Pfizer IncCombination treatment for non-hematologic malignancies
US7618631Jun 16, 2005Nov 17, 2009Genentech, Inc.Treatment with anti-ErbB2 antibodies and EGFR-targeted drugs
US7618633Nov 17, 2009Amgen Fremont Inc.Antibodies that bind CD40 and methods of treating cancer and enhancing immune responses
US7625759Jan 22, 2007Dec 1, 2009Genentech, Inc.Method for using BOC/CDO to modulate hedgehog signaling
US7626012Dec 1, 2009Amgen Fremont Inc.Nucleic acid molecules which encode antibodies that bind CD40
US7638125Oct 9, 2003Dec 29, 2009Merck Patent GmbhPharmaceutical compositions directed to Erb-B1 receptors
US7671072Nov 15, 2004Mar 2, 2010Pfizer Inc.Aminopyrazole derivatives as GSK-3 inhibitors
US7682609May 26, 2006Mar 23, 2010Genentech, Inc.Protein formulation
US7700742Jun 2, 2005Apr 20, 2010Amgen FremontAntibodies to insulin-like growth factor I receptor
US7728113Aug 20, 2007Jun 1, 2010Amgen Fremont Inc.Methods of treating arthritic conditions with antibodies to M-CSF
US7740846Jun 22, 2010Genentech, Inc.Inhibitors of angiopoietin-like 4 protein, combinations, and their use
US7754211Oct 13, 2004Jul 13, 2010Research Development FoundationImmunotoxins directed against c-erbB-2(HER-2/neu) related surface antigens
US7815907Oct 19, 2010Amgen Fremont Inc.Antibodies to insulin-like growth factor I receptor
US7846441Dec 10, 1998Dec 7, 2010Genentech, Inc.Treatment with anti-ErbB2 antibodies
US7858643Aug 26, 2005Dec 28, 2010Agouron Pharmaceuticals, Inc.Enantiomerically pure aminoheteroaryl compounds as protein kinase inhibitors
US7862817Jan 27, 2005Jan 4, 2011Genentech, Inc.Humanized anti-ErbB2 antibodies and treatment with anti-ErbB2 antibodies
US7892549Feb 3, 2003Feb 22, 2011Genentech, Inc.Treatment with anti-ErbB2 antibodies
US7914785Mar 29, 2011Bergen Teknologieverforing AsB-cell depleting agents, like anti-CD20 antibodies or fragments thereof for the treatment of chronic fatigue syndrome
US7923011Apr 12, 2011Genentech, Inc.Antibodies to lymphotoxin-alpha
US7939072Jan 21, 2009May 10, 2011Yeda Research And Development Co. Ltd.Anti-EGFR antibodies with an improved anti-tumor activity and compositions and articles of manufacture comprising same
US7981418 *Mar 1, 2008Jul 19, 2011Genentech, Inc.Predicting response to a HER inhibitor
US7982012Mar 10, 2009Jul 19, 2011Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of cytomegalovirus
US7982024Jul 19, 2011Amgen Fremont Inc.Antibodies to insulin-like growth factor I receptor
US7993834Nov 19, 2007Aug 9, 2011Genentech, Inc.Detection of ErbB2 gene amplification to increase the likelihood of the effectiveness of ErbB2 antibody breast cancer therapy
US8012482Apr 14, 2009Sep 6, 2011Genentech, Inc.Humanized anti-TGF-beta antibodies
US8038998Nov 10, 2005Oct 18, 2011Ivan BergsteinMethods of cancer therapy targeted against a cancer stemline
US8057796Nov 12, 2008Nov 15, 2011Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of influenza
US8075892Jul 20, 2007Dec 13, 2011Genentech, Inc.Treatment with anti-ErbB2 antibodies
US8076066Dec 13, 2011Genentech, Inc.Gene detection assay for improving the likelihood of an effective response to a HER2 antibody cancer therapy
US8080646Mar 12, 2009Dec 20, 2011Amgen Fremont, Inc.Human monoclonal antibodies to activin receptor-like kinase-1
US8084200Mar 11, 2009Dec 27, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
US8093216 *Aug 26, 2002Jan 10, 2012Oregon Health & Science UniversityMethod of treating cancer by inhibition of p95HER-2 production
US8114402Mar 17, 2010Feb 14, 2012Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of influenza
US8147829Sep 14, 2009Apr 3, 2012Biogen Idec Ma Inc.Anti-IGR-1R antibodies and uses thereof
US8158584Apr 17, 2012Acceleron Pharma, Inc.Pharmaceutical preparations comprising an ALK1-Fc fusion protein
US8163280Apr 24, 2012Amgen Fremont Inc.Antibodies to c-Met
US8188249Mar 29, 2010May 29, 2012Amgen Fremont Inc.Nucleic acid molecules encoding antibodies to M-CSF
US8211434Nov 23, 2009Jul 3, 2012Allergan, Inc.KLK-13 antibody inhibitor for treating dry eye
US8216807Jul 10, 2012Genentech, Inc.Antibodies to lymphotoxin-α
US8236315Jan 23, 2009Aug 7, 2012Glenmark Pharmaceuticals, S.A.Humanized antibodies specific for von Willebrand factor
US8268309Sep 18, 2012Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of cytomegalovirus
US8309087May 9, 2011Nov 13, 2012Genentech, Inc.Treatment with anti-ErbB2 antibodies
US8343928Jul 7, 2006Jan 1, 2013Seattle Genetics, Inc.Monomethylvaline compounds having phenylalanine side-chain replacements at the C-terminus
US8388971Mar 5, 2013Amgen Fremont Inc.Antibodies that bind CD40 and methods of treating cancer and enhancing immune responses
US8404234Oct 9, 2008Mar 26, 2013Genentech, Inc.Fixed dosing of HER antibodies
US8410250Apr 2, 2013Genentech, Inc.Anti-FGFR3 antibodies and methods using same
US8425908Jul 18, 2011Apr 23, 2013Genentech, Inc.Treatment with anti-ErbB2 antibodies
US8435754Nov 1, 2011May 7, 2013Genetech, Inc.Method of diagnosing the presence of a tumor in a mammal by assessing CDO expression levels
US8440402Dec 12, 2011May 14, 2013Genentech, Inc.Gene detection assay for improving the likelihood of an effective response to a HER2 antibody cancer therapy
US8455428Nov 2, 2007Jun 4, 2013Acceleron Pharma, Inc.ALK1 receptor and ligand antagonist and uses thereof
US8460671Aug 23, 2011Jun 11, 2013Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of influenza
US8491905Jun 28, 2012Jul 23, 2013Allergan, Inc.KLK-13 antibody inhibitor for treating dry eye
US8541552Feb 11, 2011Sep 24, 2013Genetech, Inc.Antibodies to lymphotoxin-α
US8562985Apr 24, 2012Oct 22, 2013Amgen Fremont Inc.Antibodies to c-Met
US8591897Apr 6, 2006Nov 26, 2013Genentech, Inc.Anti-ERBB2 antibody adjuvant therapy
US8592152Oct 14, 2011Nov 26, 2013Genentech, Inc.Gene detection assay for improving the likelihood of an effective response to an EGFR antagonist cancer therapy
US8597654Aug 8, 2011Dec 3, 2013Genentech, Inc.Adjuvant therapy with an anti-ERBB2 antibody conjugated to a maytansiniod
US8597942Sep 23, 2011Dec 3, 2013Ibio, Inc.System for expression of genes in plants
US8604185Jun 21, 2010Dec 10, 2013Genentech, Inc.Inhibitors of angiopoietin-like 4 protein, combinations, and their use
US8609101Apr 23, 2010Dec 17, 2013Theraclone Sciences, Inc.Granulocyte-macrophage colony-stimulating factor (GM-CSF) neutralizing antibodies
US8642031May 15, 2009Feb 4, 2014Acceleron Pharma, Inc.Antagonists of BMP9, BMP10, ALK1 and other ALK1 ligands, and uses thereof
US8642036Aug 2, 2004Feb 4, 2014Genentech, Inc.Treatment with anti-ErbB2 antibodies
US8642037Jun 27, 2011Feb 4, 2014Amgen Fremont Inc.Antibodies to insulin-like growth factor I receptor
US8642740Jul 6, 2012Feb 4, 2014Genentech, Inc.Antibodies to lymphotoxin-alpha
US8679492Feb 23, 2010Mar 25, 2014Glenmark Pharmaceuticals S.A.Humanized antibodies that bind to CD19 and their uses
US8691232Jan 21, 2011Apr 8, 2014Genentech, Inc.Extending time to disease progression or survival in cancer patients
US8710189Oct 16, 2012Apr 29, 2014Genentech, Inc.Anti-FGFR3 antibodies and methods using same
US8715665Apr 11, 2008May 6, 2014The General Hospital CorporationMethods for treating cancer resistant to ErbB therapeutics
US8715945Aug 6, 2008May 6, 2014Ivan BergsteinMethods of cancer diagnosis and therapy targeted against a cancer stem line
US8771685Dec 22, 2010Jul 8, 2014F. Hoffmann-La Roche AgAnti-BV8 antibodies and uses thereof
US8771966Dec 3, 2012Jul 8, 2014Genentech, Inc.Immuno-PET imaging of antibodies and immunoconjugates and uses therefor
US8785632Jun 29, 2012Jul 22, 2014Agouron Pharmaceuticals, Inc.Enantiomerically pure aminoheteroaryl compounds as protein kinase inhibitors
US8821869Oct 17, 2013Sep 2, 2014Amgen Fremont Inc.Treatment methods using c-Met antibodies
US8821874Jul 22, 2013Sep 2, 2014Allergan, Inc.KLK-13 antibody inhibitor for treating dry eye
US8822651Aug 28, 2012Sep 2, 2014Theraclone Sciences, Inc.Human rhinovirus (HRV) antibodies
US8846325Aug 6, 2008Sep 30, 2014Ivan BergsteinMethods of cancer diagnosis and therapy targeted against a cancer stem line
US8852594Jun 1, 2012Oct 7, 2014Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of cytomegalovirus infections
US8858948May 20, 2010Oct 14, 2014Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of influenza
US8871720Jul 7, 2006Oct 28, 2014Seattle Genetics, Inc.Monomethylvaline compounds having phenylalanine carboxy modifications at the C-terminus
US8883149Aug 19, 2009Nov 11, 2014Yeda Research And Development Co. Ltd.Antibody combinations and use of same for treating cancer
US8883975Aug 25, 2011Nov 11, 2014Hoffmann-La Roche, Inc.Antibodies against IL-18R1 and uses thereof
US8889364May 13, 2010Nov 18, 2014The Chancellor, Masters And Scholars Of The University Of OxfordClinical diagnosis of hepatic fibrosis using a novel panel of low abundant human plasma protein biomarkers
US8900590Aug 12, 2011Dec 2, 2014Theraclone Sciences, Inc.Anti-hemagglutinin antibody compositions and methods of use thereof
US8900820Dec 22, 2011Dec 2, 2014Nuclea Biotechnologies, Inc.Gene and protein expression profiles associated with the therapeutic efficacy of EGFR-TK inhibitors
US8916160Feb 14, 2012Dec 23, 2014Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of influenza
US8940302Oct 9, 2012Jan 27, 2015Genentech, Inc.Predicting response to a HER inhibitor
US8951791Dec 2, 2013Feb 10, 2015Ibio, Inc.System for expression of genes in plants
US8969526Mar 27, 2012Mar 3, 2015Roche Glycart AgAntibody Fc variants
US9000132Jul 31, 2013Apr 7, 2015Diadexus, Inc.Lipoprotein-associated phospholipase A2 antibody compositions and methods of use
US9012162Sep 7, 2007Apr 21, 2015The Chancellor, Masters And Scholars Of The University Of OxfordClinical diagnosis of hepatic fibrosis using a novel panel of human serum protein biomarkers
US9040047May 16, 2012May 26, 2015Yeda Research And Development Co. Ltd.Combinations of anti ErbB antibodies for the treatment of cancer
US9056910Apr 30, 2013Jun 16, 2015Genentech, Inc.Anti-PMEL17 antibodies and immunoconjugates
US9120858Jul 20, 2012Sep 1, 2015The Research Foundation Of State University Of New YorkAntibodies to the B12-transcobalamin receptor
US9161977Feb 7, 2013Oct 20, 2015F. Hoffmann-La Roche AgAnti-FGFR3 antibodies and methods using same
US9175089Mar 29, 2013Nov 3, 2015Genentech, Inc.Anti-LGR5 antibodies and immunoconjugates
US9180189Dec 16, 2005Nov 10, 2015Genentech, Inc.Treating a mammal with a formulation comprising an antibody which binds IgE
US9221915Oct 26, 2011Dec 29, 2015Pfizer Inc.Human monoclonal antibodies to activin receptor-like kinase-1
US9234041Dec 19, 2013Jan 12, 2016Pfizer Inc.Antibodies to insulin-like growth factor I receptor
US20020081299 *May 4, 2001Jun 27, 2002Wei-Qiang GaoHair cell disorders
US20020141993 *Mar 26, 2002Oct 3, 2002Genentech, Inc.Apo-2 ligand-anti-Her-2 antibody synergism
US20020168375 *Jun 21, 2001Nov 14, 2002Chiron CorporationBiosynthetic binding proteins for immuno-targeting
US20030059863 *Aug 26, 2002Mar 27, 2003Clinton Gail M.N-terminally truncated HER-2/neu protein as a cancer prognostic indicator
US20030086924 *Oct 10, 2002May 8, 2003Genentech, Inc.Treatment with anti-ErbB2 antibodies
US20030170234 *Apr 4, 2003Sep 11, 2003Genentech, Inc.Treatment with anti-ErbB2 antibodies
US20030202972 *May 2, 2003Oct 30, 2003Genentech, Inc.Protein formulation
US20030211100 *Nov 8, 2002Nov 13, 2003Vahe BedianAntibodies to CD40
US20040009965 *Jun 11, 2003Jan 15, 2004Agouron Pharmaceuticals, Inc.Benzofused heterozryl amide derivatives of thienopyridines useful as therapeutic agents, pharmaceutical compositions including the same, and methods for their use
US20040013667 *Jun 27, 2003Jan 22, 2004Genentech, Inc.Treatment with anti-ErbB2 antibodies
US20040086503 *Jan 4, 2002May 6, 2004Cohen Bruce D.Antibodies to insulin-like growth factor I receptor
US20040186126 *Mar 9, 2004Sep 23, 2004Agouron Pharmaceuticals, Inc.Benzofused heterozryl amide derivatives of thienopyridines useful as therapeutic agents, pharmaceutical compositions including the same, and methods for their use
US20040186160 *Dec 12, 2003Sep 23, 2004Sugen, Inc.Hexahydro-cyclohepta-pyrrole oxindole as potent kinase inhibitors
US20040192735 *Dec 15, 2003Sep 30, 2004Agouron Pharmaceuticals, Inc.Indazole compounds and pharmaceutical compositions for inhibiting protein kinases, and methods for their use
US20040224988 *Apr 1, 2004Nov 11, 2004Agouron Pharmaceuticals, Inc.Dosage forms and methods of treatment using VEGFR inhibitors
US20040235068 *Sep 4, 2002Nov 25, 2004Levinson Arthur D.Methods for the identification of polypeptide antigens associated with disorders involving aberrant cell proliferation and compositions useful for the treatment of such disorders
US20040258685 *Nov 21, 2003Dec 23, 2004Genentech, Inc.Therapy of non-malignant diseases or disorders with anti-ErbB2 antibodies
US20050002928 *Aug 2, 2004Jan 6, 2005Genentech, Inc.Treatment with anti-ErbB2 antibodies
US20050054019 *Aug 3, 2004Mar 10, 2005Michaud Neil R.Antibodies to c-Met
US20050070508 *Aug 23, 2004Mar 31, 2005Agouron Pharmaceuticals, Inc.Napthalene carboxamides and their derivatives useful as new anti-angiogenic agents
US20050090509 *Aug 26, 2004Apr 28, 2005Agouron Pharmaceuticals,Inc.Thienopyridine-phenylacetamides and their derivatives useful as new anti-angiogenic agents
US20050163774 *Oct 13, 2004Jul 28, 2005Research Development FoundationImmunotoxins directed against c-erbB-2(HER-2/neu) related surface antigens
US20050221270 *Apr 24, 2002Oct 6, 2005Connelly Patrick RProcess for identifying and treating cells types within a living organism
US20050222163 *Mar 30, 2005Oct 6, 2005Pfizer IncCombinations of signal transduction inhibitors
US20050244408 *Jun 2, 2005Nov 3, 2005Cohen Bruce DAntibodies to insulin-like growth factor I receptor
US20050244417 *Jun 15, 2005Nov 3, 2005Genentech, Inc.Apo-2 ligand-anti-Her-2 antibody synergism
US20050276802 *Mar 31, 2005Dec 15, 2005Genentech, Inc.Humanized anti-TGF-beta antibodies
US20050281812 *Jun 2, 2005Dec 22, 2005Pfizer IncAntibodies to insulin-like growth factor I receptor
US20060002920 *Oct 9, 2003Jan 5, 2006Hans-Georg KreyschPharmaceutical compositions directed to erb-b1 receptors
US20060002930 *Apr 15, 2005Jan 5, 2006Genentech, Inc.Treatment of disorders
US20060018910 *Jul 15, 2005Jan 26, 2006Pfizer IncCombination treatment for non-hematologic malignancies
US20060046991 *Aug 26, 2005Mar 2, 2006Agouron Pharmaceuticals, Inc.Enantiomerically pure aminoheteroaryl compounds as protein kinase inhibitors
US20060083682 *Nov 10, 2005Apr 20, 2006Stemline Therapeutics, Inc.Novel methods of cancer therapy targeted against a cancer stemline
US20060083739 *Sep 23, 2005Apr 20, 2006Sliwkowski Mark XTreating prostate cancer with anti-ErbB2 antibodies
US20060093600 *Aug 25, 2005May 4, 2006Abgenix, Inc.Antibodies to CD40
US20060093607 *Jul 19, 2005May 4, 2006Genentech, Inc.Inhibitors of angiopoietin-like 4 protein, combinations, and their use
US20060107555 *Nov 9, 2004May 25, 2006Curtis Marc DUniversal snow plow adapter
US20060128724 *Aug 26, 2005Jun 15, 2006Agouron Pharmaceuticals, Inc.Pyrazole-substituted aminoheteroaryl compounds as protein kinase inhibitors
US20060147444 *Oct 10, 2003Jul 6, 2006Huston James SBiosynthetic binding proteins for immuno-targeting
US20060160858 *Dec 16, 2005Jul 20, 2006Agouron Pharmaceuticals Inc.Indazole compounds and pharmaceutical compositions for inhibiting protein kinases, and methods for their use
US20060165685 *Oct 9, 2003Jul 27, 2006Hans-Georg KreyschBispecific anti-erb-b antibodies and their use in tumor therapy
US20060177446 *Nov 29, 2005Aug 10, 2006Genentech, Inc.Polypeptides that bind an anti-tissue factor antibody and uses thereof
US20060177448 *Feb 9, 2006Aug 10, 2006Genentech, Inc.Inhibiting HER2 shedding with matrix metalloprotease antagonists
US20060178374 *Aug 26, 2005Aug 10, 2006Agouron Pharmaceuticals, Inc.Aminoheteroaryl compounds as protein kinase inhibitors
US20060275305 *Apr 6, 2006Dec 7, 2006Bryant John LHERCEPTIN adjuvant therapy
US20070009433 *Apr 13, 2006Jan 11, 2007Millennium Pharmaceuticals, Inc.14094, a novel human trypsin family member and uses thereof
US20070026001 *Sep 29, 2006Feb 1, 2007Genentech, Inc.APO-2 ligand-anti-her-2 antibody synergism
US20070026002 *Sep 28, 2006Feb 1, 2007Genentech, Inc.Inhibitors of angiopoietin-like 4 protein, combinations, and their use
US20070031931 *Oct 6, 2006Feb 8, 2007Chiron CorporationBiosynthetic binding proteins for immuno-targeting
US20070036803 *Oct 18, 2006Feb 15, 2007Ivan BergsteinNovel methods of cancer diagnosis and therapy targeted against a cancer stem line
US20070036804 *Oct 18, 2006Feb 15, 2007Ivan BergsteinNovel methods of cancer diagnosis and therapy targeted against a cancer stem line
US20070065444 *Sep 6, 2006Mar 22, 2007Amgen Fremont Inc.Human monoclonal antibodies to activin receptor-like kinase-1
US20070161089 *Nov 6, 2006Jul 12, 2007Genentech, Inc.Method of Producing Pan-Specific Antibodies
US20070178102 *Jan 31, 2006Aug 2, 2007Yeda Research And Development Co. Ltd.Methods of identifying combinations of antibodies with an improved anti-tumor activity and compositions and methods using the antibodies
US20070190051 *Aug 26, 2005Aug 16, 2007Abgenix, Inc.Antibodies to CD40
US20070237774 *Jan 22, 2007Oct 11, 2007Genentech, Inc.Method for using BOC/CDO to Modulate Hedgehog Signaling
US20070243194 *Mar 28, 2007Oct 18, 2007Biogen Idec Ma Inc.Anti-IGF-1R antibodies and uses thereof
US20070276010 *Nov 15, 2004Nov 29, 2007Benbow John WAminopyrazole Derivatives as Gsk-3 Inhibitors
US20070276208 *Jul 16, 2007Nov 29, 2007Biomed Solutions, LlcProcess for identifying and treating specified cell types
US20070292419 *Jul 20, 2007Dec 20, 2007Genentech, Inc.Treatment with anti-erbb2 antibodies
US20080075719 *Sep 26, 2007Mar 27, 2008Genentech, Inc.Method for Augmenting B Cell Depletion
US20080085526 *Sep 7, 2007Apr 10, 2008United Therapeutics CorporationClinical diagnosis of hepatic fibrosis using a novel panel of human serum protein biomarkers
US20080160026 *Oct 25, 2007Jul 3, 2008Genentech, Inc.Apo-2 ligand-anti-her-2 antibody synergism
US20080171344 *Dec 21, 2007Jul 17, 2008Kapsner Kenneth PMethods, Kits and Materials for Diagnosing Disease States by Measuring Isoforms or Proforms of Myeloperoxidase
US20080175844 *Nov 2, 2007Jul 24, 2008Acceleron Pharma, Inc.ALK1 receptor and ligand antagonist and uses thereof
US20080206777 *Feb 27, 2008Aug 28, 2008Nuclea Biomarkers, LlcGene and protein expression profiles associated with the therapeutic efficacy of EGFR-TK inhibitors
US20080241146 *Oct 25, 2007Oct 2, 2008Genentech, Inc.Apo-2 ligand-anti-Her-2 antibody synergism
US20090092614 *Aug 28, 2008Apr 9, 2009Biogen Idec Ma Inc.Anti-IGF-1R Antibodies and Uses Thereof
US20090111756 *Jul 7, 2006Apr 30, 2009Seattle Genectics, Inc.Monomethylvaline Compounds Having Phenylalanine Carboxy Modifications at the C-Terminus
US20090130105 *Aug 28, 2008May 21, 2009Biogen Idec Ma Inc.Compositions that bind multiple epitopes of igf-1r
US20090130715 *Sep 22, 2008May 21, 2009Abgenix, Inc.Antibodies to CD40
US20090155288 *Jan 21, 2009Jun 18, 2009Yeda Research And Development Co. Ltd.Methods of identifying combinations of antibodies with an improved anti-tumor activity and compositions and methods using the antibodies
US20090169563 *Sep 25, 2007Jul 2, 2009Abgenix, Inc.Antibodies to CD40
US20090186034 *Jul 23, 2009Genetech, Inc.Gene expression markers for inflammatory bowel disease
US20090226433 *Nov 12, 2008Sep 10, 2009Spaltudaq Corp.Compositions and methods for the therapy and diagnosis of influenza
US20090232804 *Jan 23, 2009Sep 17, 2009Glenmark Pharmaceuticals, S.A.,Humanized antibodies specific for von willebrand factor
US20090291088 *Apr 10, 2009Nov 26, 2009Biogen Idec Ma Inc.Therapeutic combinations of anti-igf-1r antibodies and other compounds
US20090324613 *Mar 10, 2009Dec 31, 2009Spaltudaq CorporationCompositions and Methods for the Therapy and Diagnosis of Cytomegalovirus
US20100029675 *Feb 4, 2010Hwang Soo-InPyrimidine-2, 4-diamine JAK2 Kinase inhibiting anti-inflammation use
US20100034816 *Dec 21, 2007Feb 11, 2010Novelix Therapeutics GmbhTreatment of Diabetes by at Least One Epidermal Growth Factor Receptor Specific Antibody or a Derivative Thereof
US20100040629 *Jan 26, 2009Feb 18, 2010Abgenix, Inc.Antibodies to c-Met
US20100098694 *Oct 9, 2009Apr 22, 2010Amgen Fremont Inc.Antibodies to cd40
US20100098710 *Sep 14, 2009Apr 22, 2010Biogen Idec Ma Inc.Anti-IGF-1R Antibodies and Uses Thereof
US20100119526 *Jan 28, 2008May 13, 2010Bioinvent International AbDLL4 Signaling Inhibitors and Uses Thereof
US20100204221 *Feb 8, 2010Aug 12, 2010Hariprasad VankayalapatiPyrrolopyrimidinyl axl kinase inhibitors
US20100215651 *Feb 23, 2010Aug 26, 2010Glenmark Pharmaceuticals S.A.Humanized antibodies that bind to CD19 and their uses
US20100247531 *Sep 30, 2010Genentech, Inc.Anti-fgfr3 antibodies and methods using same
US20100247545 *Sep 30, 2010Amgen Fremont Inc.Antibodies to m-csf
US20100255004 *Apr 11, 2008Oct 7, 2010Dana Farber Cancer InstituteReceptor tyrosine kinase profiling
US20100291075 *Nov 18, 2010Theraclone Sciences, Inc.Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) Neutralizing Antibodies
US20100291114 *Mar 24, 2010Nov 18, 2010Genentech, Inc.Crystal structures and methods using same
US20100291602 *May 13, 2010Nov 18, 2010University Of OxfordClinical diagnosis of hepatic fibrosis using a novel panel of low abundant human plasma protein biomarkers
US20100324061 *Sep 1, 2010Dec 23, 2010Agouron Pharmaceuticals, Inc.Enantiomerically pure aminoheteroaryl compounds as protein kinase inhibitors
US20110014207 *Sep 25, 2009Jan 20, 2011Pfizer Inc.Combination treatment for non-hematologic malignancies
US20110033476 *Jun 7, 2010Feb 10, 2011Theraclone Sciences Inc.Compositions and methods for the therapy and diagnosis of influenza
US20110129464 *Dec 16, 2010Jun 2, 2011Genentech, Inc.Humanized anti-erbb2 antibodies and treatment with anti-erbb2 antibodies
US20110142836 *Jun 16, 2011Olav MellaB-cell depleting agents for the treatment of chronic fatigue syndrome
US20110171206 *Aug 19, 2009Jul 14, 2011Yeda Research And Development Co., Ltd. At The Weizmann Institute Of ScienceAntibody combinations and use of same for treating cancer
US20110183437 *Jul 28, 2011Yeda Research And Development Co. Ltd.Methods of identifying combinations of antibodies with an improved anti-tumor activity and compositions and methods using the antibodies
US20110223169 *Nov 23, 2009Sep 15, 2011Stern Michael EIl-17 antibody inhibitor for treating dry eye
US20110223170 *Nov 23, 2009Sep 15, 2011Allergan, IncKlk-13 antibody inhibitor for treating dry eye
EP1992643A2Jun 19, 2002Nov 19, 2008Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP1995321A2Jul 18, 2006Nov 26, 2008Genentech, Inc.Gene disruptions, compositions and methods relating thereto
EP2000148A1Jun 19, 2002Dec 10, 2008Genentech, Inc.Compositions and methods for the diagnosis and treatment of prostate cancer
EP2000482A1Jun 19, 2002Dec 10, 2008Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2000545A1Jun 19, 2002Dec 10, 2008Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2002714A1Nov 16, 2006Dec 17, 2008Genentech, Inc.Novel gene disruptions, compositions and methods relating thereto
EP2011886A2Apr 10, 2003Jan 7, 2009Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2050335A1Feb 9, 2007Apr 22, 2009Genentech, Inc.Gene disruptions, compositions and methods relating thereto
EP2052742A1Jun 14, 2001Apr 29, 2009Biogen Idec Inc.Treatment of B-cell associated diseases such as malignancies and autoimmune diseases using a cold anti-CD20 antibody/radiolabeled anti-CD22 antibody combination
EP2062916A2Apr 6, 2004May 27, 2009Genentech, Inc.Therapy of autoimmune disease in a patient with an inadequate response to a TNF-Alpha inhibitor
EP2067472A1Dec 30, 2002Jun 10, 2009Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2077281A1Jan 2, 2008Jul 8, 2009Bergen Teknologioverforing ASAnti-CD20 antibodies or fragments thereof for the treatment of chronic fatigue syndrome
EP2082645A1Apr 18, 2007Jul 29, 2009Genentech, Inc.Novel gene disruptions, compositions and methods relating thereto
EP2112167A2Jun 23, 2000Oct 28, 2009Genentech, Inc.Humanized ANTI-ERBB2 antibodies and treatment with ANTI-ERBB2 antibodies
EP2143438A1Sep 11, 2002Jan 13, 2010Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2151244A1Sep 11, 2002Feb 10, 2010Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2153843A1Sep 11, 2002Feb 17, 2010Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
EP2161283A1Nov 16, 2004Mar 10, 2010Genentech, Inc.Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin
EP2186402A1May 18, 2006May 19, 2010Genentech, Inc.Knock-out animal models for novel genes and methods of use
EP2194067A2Dec 20, 2001Jun 9, 2010Pfizer Inc.Antibodies to insulin-like growth factor I receptor (IGF-IR)
EP2230517A1Jan 9, 2006Sep 22, 2010Diadexus, Inc.OVR110 antibody compositions and methods of use
EP2233149A1Oct 16, 2008Sep 29, 2010ZymoGenetics, Inc.Combination of BLYS inhibition and anti-CD20 agents for treatment of autoimmune disease
EP2258700A1Apr 26, 2007Dec 8, 2010Pfizer Products Inc.Cycloalkylamino acid derivatives and pharmaceutical compositions thereof
EP2260858A2Nov 5, 2004Dec 15, 2010Seattle Genetics, Inc.Monomethylvaline compounds capable of conjugation to ligands
EP2261367A2Nov 26, 2008Dec 15, 2010Genentech, Inc.Gene expression markers for inflammatory bowel disease
EP2263691A1Jul 11, 2003Dec 22, 2010Genentech, Inc.Treatment of cancer with the recombinant humanized monoclonal anti-erbb2 antibody 2C4 (rhuMAb 2C4)
EP2277908A2Jun 2, 2004Jan 26, 2011Genentech, Inc.IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof
EP2283866A2Jun 23, 2000Feb 16, 2011Genentech, Inc.Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
EP2283867A2Jun 23, 2000Feb 16, 2011Genentech, Inc.Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
EP2286844A2May 31, 2005Feb 23, 2011Genentech, Inc.Antibody-drug conjugates and methods
EP2289942A2Apr 9, 2003Mar 2, 2011Genentech, Inc.Anti-HER2 antibody variants
EP2292233A2Nov 9, 2000Mar 9, 2011OSI Pharmaceuticals, Inc.Pharmaceutical uses of N-(3-Ethynylphenyl)-6,7-bis(2-methoxyethoxy)-4-quinazolinamine
EP2292251A1Apr 18, 2002Mar 9, 2011Merck Patent GmbHCombination therapy using anti-angiogenic agents and TNF-alpha
EP2295073A1Nov 16, 2004Mar 16, 2011Genentech, Inc.Antibody against CD22 for the treatment of tumour of hematopoietic origin
EP2301568A1Nov 16, 2004Mar 30, 2011Genentech, Inc.Antibody against IRTA2 for the treatment of tumour of hematopoietic origin
EP2314318A1Jan 31, 2002Apr 27, 2011Biogen Idec Inc.CD80 antibody for use in combination with chemotherapeutics to treat B cell malignancies
EP2325208A1Dec 14, 2006May 25, 2011Genentech, Inc.Polyubiquitin antibodies
EP2335725A1Mar 29, 2004Jun 22, 2011Genentech, Inc.High concentration antibody and protein formulations
EP2335733A1Jan 18, 2007Jun 22, 2011Merck Patent GmbHSpecific therapy using integrin ligands for treating cancer
EP2338518A1Jan 18, 2007Jun 29, 2011Merck Patent GmbHSpecific therapy using integrin ligands for treating cancer
EP2343086A2Nov 8, 2002Jul 13, 2011Pfizer Products Inc.Antibodies to CD40
EP2361931A1Jul 19, 2005Aug 31, 2011Genentech, Inc.Inhibitors of angiopoietin-like 4 protein, combinations, and their use
EP2371388A2Oct 19, 2005Oct 5, 2011Genentech, Inc.Antibody formulations
EP2372363A1Sep 19, 2006Oct 5, 2011OSI Pharmaceuticals, Inc.Biological markers predictive of anti-cancer response to insulin-like growth factor-1
EP2389946A1Mar 22, 2007Nov 30, 2011Novartis AGAnti-tumor cell antigen antibody therapeutics
EP2389947A1Mar 22, 2007Nov 30, 2011Novartis AGAnti-tumor cell antigen antibody therapeutics
EP2389948A1Mar 22, 2007Nov 30, 2011Novartis AGAnti-tumor cell antigen antibody therapeutics
EP2389949A1Mar 22, 2007Nov 30, 2011Novartis AGAnti-tumor cell antigen antibody therapeutics
EP2389950A1Mar 22, 2007Nov 30, 2011Novartis AGAnti-tumor cell antigen antibody therapeutics
EP2389951A1Mar 22, 2007Nov 30, 2011Novartis AGAnti-tumor cell antigen antibody therapeutics
EP2399605A1Feb 21, 2006Dec 28, 2011Genentech, Inc.Extending time to disease progression or survival in cancer patients
EP2402373A2Jan 4, 2007Jan 4, 2012Genentech, Inc.Anti-EphB4 Antibodies and Methods Using Same
EP2420250A1Aug 13, 2010Feb 22, 2012Universitätsklinikum MünsterAnti-Syndecan-4 antibodies
EP2423332A1Aug 23, 2007Feb 29, 2012Oncotherapy Science, Inc.Prognostic markers and therapeutic targets for lung cancer
EP2423333A1Aug 23, 2007Feb 29, 2012Oncotherapy Science, Inc.Prognostic markers and therapeutic targets for lung cancer
EP2426150A1Jun 28, 2007Mar 7, 2012Novo Nordisk A/SAnti-NKG2A antibodies and uses thereof
EP2436781A1Feb 22, 2008Apr 4, 2012Genentech, Inc.Methods for detecting inflammatory bowel disease
EP2441464A1Jan 17, 2008Apr 18, 2012Merck Patent GmbHSpecific therapy and medicament using integrin ligands for treating cancer
EP2444099A1Mar 31, 2006Apr 25, 2012Agensys, Inc.Antibodies and related molecules that bind to 161P2F10B proteins
EP2444419A1Apr 13, 2006Apr 25, 2012Pfizer IncP-Cadherin antibodies
EP2444420A1Apr 13, 2006Apr 25, 2012Pfizer IncP-Cadherin antibodies
EP2444421A1Apr 13, 2006Apr 25, 2012Pfizer IncP-Cadherin antibodies
EP2446904A2May 29, 2007May 2, 2012Genentech, Inc.Anti-CD22 antibodies, their immunoconjugates and uses thereof
EP2447282A2May 29, 2007May 2, 2012Genentech, Inc.Anti-CD22 Antibodies, their Immunoconjugates and uses thereof
EP2447283A2Sep 6, 2006May 2, 2012Amgen Fremont Inc.Human monoclonal antibodies to activin receptor-like kinase-1 (ALK-1)
EP2450050A1Nov 20, 2007May 9, 2012Genentech, Inc.IL-17A/F heterodimeric polypeptides and therapeutic uses thereof
EP2468772A2Mar 16, 2007Jun 27, 2012Genentech, Inc.Antibodies to EGFL7 and methods for their use
EP2468776A2Feb 8, 2008Jun 27, 2012Genentech, Inc.Anti-Robo4 antibodies and uses therefor
EP2469282A1Sep 7, 2007Jun 27, 2012University of OxfordClinical diagnosis of hepatic fibrosis using a novel panel of human serum protein biomarkers
EP2469283A1Sep 7, 2007Jun 27, 2012University of OxfordClinical diagnosis of hepatic fibrosis using human serum APOL1 as biomarker.
EP2474557A2Jul 15, 2008Jul 11, 2012Genentech, Inc.Anti-CD79b antibodies and immunoconjugates and methods of use
EP2476667A2Feb 26, 2004Jul 18, 2012Sugen, Inc.Aminoheteroaryl compounds as protein kinase inhibitors
EP2478912A1Nov 5, 2004Jul 25, 2012Seattle Genetics, Inc.Auristatin conjugates with anti-HER2 or anti-CD22 antibodies and their use in therapy
EP2486933A1Nov 5, 2004Aug 15, 2012Seattle Genetics, Inc.Monomethylvaline compounds conjugated with antibodies
EP2500030A2Nov 4, 2006Sep 19, 2012Genentech, Inc.Use of complement pathway inhibitors to treat ocular diseases
EP2502937A2Jul 15, 2008Sep 26, 2012Genentech, Inc.Anti-CD 79b Antibodies And Immunoconjugates And Methods Of Use
EP2551672A1Sep 20, 2007Jan 30, 2013Nestec S.A.Antibody-based arrays for detecting multiple signal transducers in rare circulating cells
EP2578225A1Jul 17, 2008Apr 10, 2013Merck Patent GmbHSpecific Therapy and Medicament Using Integrin Ligands for Treating Cancer
EP2584049A2Jul 19, 2010Apr 24, 2013Genentech, Inc.Gene expression markers for Crohn's disease
EP2592156A2Jun 4, 2008May 15, 2013Genentech, Inc.Gene expression markers of tumor resistance to HER2 inhibitor treatment
EP2602623A2Feb 24, 2009Jun 12, 2013Nestec S.A.Mehtod for the detection of intracellular truncated receptors
EP2614839A2Jan 22, 2007Jul 17, 2013Genentech, Inc.Method for using BOC/CDO to modulate hedgehog signaling
EP2618146A2Feb 24, 2009Jul 24, 2013Nestec S.A.Drug selection for breast cancer therapy using antibody-based arrays
EP2623516A2Nov 30, 2006Aug 7, 2013Genentech, Inc.Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R
EP2628753A1Jan 23, 2009Aug 21, 2013Novo Nordisk A/SHumanized anti-human NKG2A monoclonal antibody
EP2641618A2Jul 15, 2008Sep 25, 2013Genentech, Inc.Humanized anti-CD79B antibodies and immunoconjugates and methods of use
EP2657253A2Jan 14, 2009Oct 30, 2013Genentech, Inc.Anti-CD79b antibodies and immunoconjugates and methods of use
EP2679600A1Mar 24, 2010Jan 1, 2014Genentech, Inc.Anti-FGFR3 antibodies and methods using same
EP2722051A1Jul 7, 2006Apr 23, 2014Seattle Genetics, Inc.Monomethylvaline compounds having phenylalanine side-chain modifications at the C-terminus
EP2727936A1Nov 21, 2007May 7, 2014Bristol-Myers Squibb CompanyTargeted therapeutics based on engineered proteins for tyrosine kinases receptors, including IGF-IR
EP2757160A2Jul 19, 2010Jul 23, 2014Genentech, Inc.Gene expression markers for Crohn's disease
EP2769993A1Dec 15, 2008Aug 27, 2014Novo Nordisk A/SAntibodies against human NKG2D and uses thereof
EP2784084A1Jun 2, 2004Oct 1, 2014Genentech, Inc.IL-17 A/F heterologous polypeptides and therapeutics uses thereof
EP2796468A2Dec 20, 2001Oct 29, 2014Pfizer IncAntibodies to insulin-like growth factor I receptor
EP2799448A1May 21, 2009Nov 5, 2014Bristol-Myers Squibb CompanyMultivalent fibronectin based scaffold domain proteins
EP2799876A2May 13, 2010Nov 5, 2014The Chancellors, Masters and Scholars of the University of OxfordClinical diagnosis of hepatic fibrosis using a novel panel of low abundant human plasma protein biomarkers
EP2803367A1Jun 23, 2000Nov 19, 2014ImmunoGen, Inc.Methods of treatment using anti-ERBB antibody-maytansinoid conjugates
EP2845866A1Oct 26, 2007Mar 11, 2015Genentech, Inc.Antibodies and immunoconjugates and uses therefor
EP2851091A1Apr 11, 2008Mar 25, 2015Dana-Farber Cancer Institute, Inc.Methods for treating cancer resistant to ERBB therapeutics
EP2851372A1Dec 1, 2008Mar 25, 2015Genentech, Inc.Anti-VEGF antibodies
EP2857516A1Mar 20, 2001Apr 8, 2015Genentech, Inc.Multivalent antibodies and uses therefor
EP2899541A1Feb 29, 2008Jul 29, 2015Genentech, Inc.Predicting response to a HER dimerisation inhbitor based on low HER3 expression
EP2926830A2Aug 31, 2011Oct 7, 2015Theraclone Sciences, Inc.Human immunodeficiency virus (HIV)-neutralizing antibodies
EP2960253A1Sep 6, 2006Dec 30, 2015Amgen Fremont Inc.Human monoclonal antibodies to activin receptor-like kinase-1
EP2962697A1Nov 27, 2007Jan 6, 2016diaDexus, Inc.Ovr110 antibody compositions and methods of use
EP2977063A1Jun 23, 2000Jan 27, 2016Genentech, Inc.Methods of treatment using anti-ErbB antibody-maytansinoid conjugates
WO2005097832A2Mar 31, 2005Oct 20, 2005Genentech IncHumanized anti-tgf-beta antibodies
WO2006007398A1Jun 15, 2005Jan 19, 2006Genentech IncTherapy of platinum-resistant cancer
WO2006074418A2Jan 9, 2006Jul 13, 2006Diadexus IncOvr110 antibody compositions and methods of use
WO2007035744A1Sep 19, 2006Mar 29, 2007Osi Pharm IncBiological markers predictive of anti-cancer response to insulin-like growth factor-1 receptor kinase inhibitors
WO2007084670A2Jan 18, 2007Jul 26, 2007Merck Patent GmbhSpecific therapy using integrin ligands for treating cancer
WO2007132308A1Apr 30, 2007Nov 22, 2007Pfizer Prod IncTriazolopyrazine derivatives useful as anti-cancer agents
WO2008087025A2Jan 17, 2008Jul 24, 2008Merck Patent GmbhSpecific therapy and medicament using integrin ligands for treating cancer
WO2009028158A1Aug 21, 2008Mar 5, 2009Oncotherapy Science IncDkk1 oncogene as therapeutic target for cancer and a diagnosing marker
WO2009028521A1Aug 20, 2008Mar 5, 2009Hidewaki NakagawaPkib and naaladl2 for target genes of prostate cancer therapy and diagnosis
WO2009028580A1Aug 21, 2008Mar 5, 2009Oncotherapy Science IncEbi3, dlx5, nptx1 and cdkn3 for target genes of lung cancer therapy and diagnosis
WO2009032145A1 *Aug 28, 2008Mar 12, 2009Biogen Idec IncAnti-igf-1r antibodies and uses thereof
WO2009033094A2Sep 5, 2008Mar 12, 2009Agensys IncAntibodies and related molecules that bind to 24p4c12 proteins
WO2009046123A2Oct 1, 2008Apr 9, 2009Genentech IncNlrr-1 antagonists and uses thereof
WO2009102421A2Feb 10, 2009Aug 20, 2009Squibb Bristol Myers CoTargeted therapeutics based on engineered proteins that bind egfr
WO2010077634A1Dec 8, 2009Jul 8, 2010Genentech, Inc.Anti-pd-l1 antibodies and their use to enhance t-cell function
WO2010080528A1Dec 17, 2009Jul 15, 2010Genentech, Inc.Hepatitis c virus combination therapy
WO2010090764A1Feb 8, 2010Aug 12, 2010Supergen, Inc.Pyrrolopyrimidinyl axl kinase inhibitors
WO2010098866A1Feb 26, 2010Sep 2, 2010Supergen, Inc.Cyclopentathiophene/cyclohexathiophene dna methyltransferase inhibitors
WO2010099137A2Feb 24, 2010Sep 2, 2010Osi Pharmaceuticals, Inc.In situ methods for monitoring the emt status of tumor cells in vivo
WO2010099138A2Feb 24, 2010Sep 2, 2010Osi Pharmaceuticals, Inc.Methods for the identification of agents that inhibit mesenchymal-like tumor cells or their formation
WO2010099139A2Feb 24, 2010Sep 2, 2010Osi Pharmaceuticals, Inc.Combination anti-cancer therapy
WO2010099363A1Feb 26, 2010Sep 2, 2010Osi Pharmaceuticals, Inc.Methods for the identification of agents that inhibit mesenchymal-like tumor cells or their formation
WO2010099364A2Feb 26, 2010Sep 2, 2010Osi Pharmaceuticals, Inc.Methods for the identification of agents that inhibit mesenchymal-like tumor cells or their formation
WO2010108127A1Mar 19, 2010Sep 23, 2010Genentech, Inc.Bispecific anti-her antibodies
WO2010111367A1Mar 24, 2010Sep 30, 2010Genentech, Inc.Anti-fgfr3 antibodies and methods using same
WO2010118243A2Apr 8, 2010Oct 14, 2010Genentech, Inc.Use of il-27 antagonists to treat lupus
WO2010120561A1Mar 31, 2010Oct 21, 2010Genentech, Inc.Anti-fcrh5 antibodies and immunoconjugates and methods of use
WO2010136168A2May 25, 2010Dec 2, 2010Merck Patent GmbhContinuous administration of integrin ligands for treating cancer
WO2010136569A1May 28, 2010Dec 2, 2010F. Hoffmann-La Roche AgModulators for her2 signaling in her2 expressing patients with gastric cancer
WO2011005715A1Jul 2, 2010Jan 13, 2011Genentech, Inc.Diagnosis and treatment of autoimmune demyelinating diseases
WO2011008990A1Jul 15, 2010Jan 20, 2011Prometheus Laboratories Inc.Drug selection for gastric cancer therapy using antibody-based arrays
WO2011011339A1Jul 19, 2010Jan 27, 2011Genentech, Inc.Gene expression markers for crohn's disease
WO2011014457A1Jul 26, 2010Feb 3, 2011Genentech, Inc.Combination treatments
WO2011019620A1Aug 6, 2010Feb 17, 2011Genentech, Inc.Antibodies with enhanced adcc function
WO2011019622A1Aug 6, 2010Feb 17, 2011Genentech, Inc.Cell culture methods to make antibodies with enhanced adcc function
WO2011019679A1Aug 10, 2010Feb 17, 2011Allergan, Inc.Ccr2 inhibitors for treating conditions of the eye
WO2011027249A2Aug 11, 2010Mar 10, 2011Pfizer Inc.Benzimidazole derivatives
WO2011028950A1Sep 2, 2010Mar 10, 2011Genentech, Inc.Mutant smoothened and methods of using the same
WO2011050069A1Oct 20, 2010Apr 28, 2011Prometheus Laboratories Inc.Proximity-mediated assays for detecting oncogenic fusion proteins
WO2011050188A1Oct 21, 2010Apr 28, 2011Genentech, Inc.Anti-hepsin antibodies and methods using same
WO2011050194A1Oct 21, 2010Apr 28, 2011Genentech, Inc.Methods and compositions for modulating hepsin activation of macrophage-stimulating protein
WO2011056494A1Oct 25, 2010May 12, 2011Genentech, Inc.Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations
WO2011056497A1Oct 25, 2010May 12, 2011Genentech, Inc.Activin receptor type iib compositions and methods of use
WO2011056502A1Oct 25, 2010May 12, 2011Genentech, Inc.Bone morphogenetic protein receptor type ii compositions and methods of use
WO2011056983A1Nov 4, 2010May 12, 2011Genentech, Inc.Zirconium-radiolabeled, cysteine engineered antibody conjugates
WO2011056997A1Nov 4, 2010May 12, 2011Fabrus LlcMethods for affinity maturation-based antibody optimization
WO2011057120A1Nov 5, 2010May 12, 2011Genentech, Inc.Methods and composition for secretion of heterologous polypeptides
WO2011066503A2Nov 29, 2010Jun 3, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
WO2011071577A1Sep 15, 2010Jun 16, 2011Genentech, Inc.Anti-vegf-c antibodies and methods using same
WO2011079185A1Dec 22, 2010Jun 30, 2011Genentech, Inc.Anti-bv8 antibodies and uses thereof
WO2011082187A1Dec 28, 2010Jul 7, 2011Genentech, Inc.Methods for modulating a pdgf-aa mediated biological response
WO2011084750A1Dec 20, 2010Jul 14, 2011Genentech, Inc.Antibody formulation
WO2011098971A1Feb 10, 2011Aug 18, 2011Pfizer Inc.Salts and polymorphs of 8-fluoro-2-{4-[(methylamino}methyl]phenyl}-1,3,4,5-tetrahydro-6h-azepino[5,4,3-cd]indol-6-one
WO2011103242A1Feb 17, 2011Aug 25, 2011Genentech, Inc.Neuregulin antagonists and use thereof in treating cancer
WO2011106297A2Feb 22, 2011Sep 1, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
WO2011109572A2Mar 3, 2011Sep 9, 2011OSI Pharmaceuticals, LLCBiological markers predictive of anti-cancer response to insulin-like growth factor-1 receptor kinase inhibitors
WO2011109584A2Mar 3, 2011Sep 9, 2011OSI Pharmaceuticals, LLCBiological markers predictive of anti-cancer response to insulin-like growth factor-1 receptor kinase inhibitors
WO2011119661A1Mar 23, 2011Sep 29, 2011Genentech, Inc.Anti-lrp6 antibodies
WO2011133931A1Apr 22, 2011Oct 27, 2011Genentech, Inc.Use of il-27 antagonists for treating inflammatory bowel disease
WO2011139985A1May 2, 2011Nov 10, 2011Genentech, Inc.Compositions and methods for the diagnosis and treatment of tumor
WO2011146568A1May 18, 2011Nov 24, 2011Genentech, Inc.Predicting response to a her inhibitor
WO2011147834A1May 24, 2011Dec 1, 2011Roche Glycart AgAntibodies against cd19 and uses thereof
WO2011153346A1Jun 2, 2011Dec 8, 2011Genentech, Inc.Immuno-pet imaging of antibodies and immunoconjugates and uses therefor
WO2011156328A1Jun 7, 2011Dec 15, 2011Genentech, Inc.Cysteine engineered antibodies and conjugates
WO2011161119A1Jun 21, 2011Dec 29, 2011F. Hoffmann-La Roche AgAntibodies against insulin-like growth factor i receptor and uses thereof
WO2011161189A1Jun 22, 2011Dec 29, 2011F. Hoffmann-La Roche AgAnti-hepsin antibodies and methods of use
WO2012006503A1Jul 8, 2011Jan 12, 2012F. Hoffmann-La Roche AgAnti-neuropilin antibodies and methods of use
WO2012007137A1Jul 8, 2011Jan 19, 2012Merck Patent GmbhPeptide for use in the treatment of breast cancer and/or bone metastases
WO2012010582A1Jul 19, 2011Jan 26, 2012Roche Glycart AgAnti-cxcr5 antibodies and methods of use
WO2012017003A1Aug 3, 2011Feb 9, 2012F. Hoffmann-La Roche AgAnti-mhc antibody anti-viral cytokine fusion protein
WO2012018771A1Aug 2, 2011Feb 9, 2012F. Hoffmann-La Roche AgChronic lymphocytic leukemia (cll) biomarkers
WO2012020006A2Aug 9, 2011Feb 16, 2012Roche Glycart AgAnti-fap antibodies and methods of use
WO2012020038A1Aug 10, 2011Feb 16, 2012Roche Glycart AgAnti-tenascin-c a2 antibodies and methods of use
WO2012020072A1Aug 11, 2011Feb 16, 2012Westfälische Wilhelms-Universität MuensterAnti-syndecan-4 antibodies
WO2012025536A1Aug 23, 2011Mar 1, 2012F. Hoffmann-La Roche AgAntibodies against il-18r1 and uses thereof
WO2012031027A1Aug 31, 2011Mar 8, 2012Genentech, Inc.Biomarkers and methods of treatment
WO2012033953A1Sep 8, 2011Mar 15, 2012Halozyme, Inc.Methods for assessing and identifying or evolving conditionally active therapeutic proteins
WO2012047968A2Oct 5, 2011Apr 12, 2012Curis, Inc.Mutant smoothened and methods of using the same
WO2012052948A1Oct 19, 2011Apr 26, 2012Pfizer Inc.Pyridine- 2- derivatives as smoothened receptor modulators
WO2012064836A1Nov 9, 2011May 18, 2012F. Hoffmann-La Roche AgMethods and compositions for neural disease immunotherapy
WO2012071436A1Nov 22, 2011May 31, 2012Genentech, Inc.Method of treating autoimmune inflammatory disorders using il-23r loss-of-function mutants
WO2012075333A2Dec 1, 2011Jun 7, 2012Prometheus Laboratories Inc.Her2delta16 peptides
WO2012085064A1Dec 21, 2011Jun 28, 2012F. Hoffmann-La Roche AgDetection of a posttranslationally modified polypeptide by a bi-valent binding agent
WO2012085069A2Dec 21, 2011Jun 28, 2012F. Hoffmann-La Roche AgDetection of a polypeptide dimer by a bivalent binding agent
WO2012085111A1Dec 21, 2011Jun 28, 2012F. Hoffmann-La Roche AgPolypeptide-polynucleotide-complex and its use in targeted effector moiety delivery
WO2012085113A1Dec 21, 2011Jun 28, 2012F. Hoffmann-La Roche AgBinding agent
WO2012087962A2Dec 19, 2011Jun 28, 2012F. Hoffmann-La Roche AgAnti-mesothelin antibodies and immunoconjugates
WO2012088313A1Dec 21, 2011Jun 28, 2012F. Hoffmann-La Roche AgAnti-pcsk9 antibodies and methods of use
WO2012088337A1Dec 21, 2011Jun 28, 2012Prometheus Laboratories Inc.Drug selection for malignant cancer therapy using antibody-based arrays
WO2012092539A2Dec 30, 2011Jul 5, 2012Takeda Pharmaceutical Company LimitedAntibodies to dll4 and uses thereof
WO2012107416A2Feb 7, 2012Aug 16, 2012Roche Glycart AgImproved immunotherapy
WO2012107417A1Feb 7, 2012Aug 16, 2012Roche Glycart AgMutant interleukin-2 polypeptides
WO2012116040A1Feb 22, 2012Aug 30, 2012OSI Pharmaceuticals, LLCBiological markers predictive of anti-cancer response to insulin-like growth factor-1 receptor kinase inhibitors in hepatocellular carcinoma
WO2012119989A2Mar 5, 2012Sep 13, 2012Oryzon Genomics, S.A.Methods and antibodies for the diagnosis and treatment of cancer
WO2012125614A1Mar 13, 2012Sep 20, 2012Theraclone Sciences, Inc.Compositions and methods for the therapy and diagnosis of influenza
WO2012130831A1Mar 27, 2012Oct 4, 2012Roche Glycart AgAntibody fc variants
WO2012138975A1Apr 6, 2012Oct 11, 2012Genentech, Inc.Anti-fgfr4 antibodies and methods of use
WO2012142164A1Apr 11, 2012Oct 18, 2012The United States Of America, As Represented By The Secretary, Department Of Health & Human ServicesHuman monoclonal antibodies that bind insulin-like growth factor (igf) i and ii
WO2012143379A1Apr 18, 2012Oct 26, 2012Roche Glycart AgMethod and constructs for the ph dependent passage of the blood-brain-barrier
WO2012145183A2Apr 9, 2012Oct 26, 2012Pfizer Inc.Combinations of anti-4-1bb antibodies and adcc-inducing antibodies for the treatment of cancer
WO2012146628A1Apr 26, 2012Nov 1, 2012Roche Glycart AgNovel immunoconjugates
WO2012155019A1May 11, 2012Nov 15, 2012Genentech, Inc.Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
WO2012158704A1May 15, 2012Nov 22, 2012F. Hoffmann-La Roche AgFgfr1 agonists and methods of use
WO2012171996A1Jun 14, 2012Dec 20, 2012F. Hoffmann-La Roche AgAnti-human epo receptor antibodies and methods of use
WO2013003680A1Jun 29, 2012Jan 3, 2013Genentech, Inc.Anti-c-met antibody formulations
WO2013008171A1Jul 9, 2012Jan 17, 2013Glenmark Pharmaceuticals S.A.Antibodies that bind to ox40 and their uses
WO2013015821A1Sep 19, 2011Jan 31, 2013The Research Foundation Of State University Of New YorkAntibodies to the b12-transcobalamin receptor
WO2013025853A1Aug 16, 2012Feb 21, 2013Genentech, Inc.Neuregulin antibodies and uses thereof
WO2013026831A1Aug 21, 2012Feb 28, 2013Roche Glycart AgBispecific antigen binding molecules
WO2013026832A1Aug 21, 2012Feb 28, 2013Roche Glycart AgAnti-mcsp antibodies
WO2013026833A1Aug 21, 2012Feb 28, 2013Roche Glycart AgBispecific t cell activating antigen binding molecules
WO2013026837A1Aug 21, 2012Feb 28, 2013Roche Glycart AgBispecific t cell activating antigen binding molecules
WO2013033069A1Aug 28, 2012Mar 7, 2013Theraclone Sciences, Inc.Human rhinovirus (hrv) antibodies
WO2013033623A1Aug 31, 2012Mar 7, 2013Nestec S.A.Profiling of signal pathway proteins to determine therapeutic efficacy
WO2013040433A1Sep 14, 2012Mar 21, 2013Genentech, Inc.Methods of promoting differentiation
WO2013042006A1Sep 10, 2012Mar 28, 2013Pfizer Inc.Pyrrolopyrimidine and purine derivatives
WO2013043715A1Sep 19, 2012Mar 28, 2013Genentech, Inc.Combination treatments comprising c-met antagonists and b-raf antagonists
WO2013050725A1Oct 4, 2011Apr 11, 2013King's College LondonIge anti -hmw-maa antibody
WO2013052155A1Apr 6, 2012Apr 11, 2013Genentech, Inc.Methods of treating liver conditions using notch2 antagonists
WO2013056148A2Oct 12, 2012Apr 18, 2013Genentech, Inc.Methods of using scd1 antagonists
WO2013059531A1Oct 19, 2012Apr 25, 2013Genentech, Inc.Anti-gcgr antibodies and uses thereof
WO2013068902A1Nov 2, 2012May 16, 2013Pfizer Inc.Methods of treating inflammatory disorders using anti-m-csf antibodies
WO2013078170A1Nov 20, 2012May 30, 2013Genentech, Inc.Purification of anti-c-met antibodies
WO2013078377A1Nov 21, 2012May 30, 2013Igenica, Inc.Anti-cd98 antibodies and methods of use thereof
WO2013081645A2Nov 29, 2012Jun 6, 2013Genentech, Inc.Erbb3 mutations in cancer
WO2013082249A2Nov 29, 2012Jun 6, 2013Genentech, Inc.Compositions and methods for prostate cancer analysis
WO2013083497A1Dec 3, 2012Jun 13, 2013F. Hoffmann-La Roche AgAntibody formulation
WO2013083810A1Dec 7, 2012Jun 13, 2013F. Hoffmann-La Roche AgIdentification of non-responders to her2 inhibitors
WO2013091903A1Feb 16, 2012Jun 27, 2013Novo Nordisk A/SAnti-crac channel antibodies
WO2013092723A1Dec 19, 2012Jun 27, 2013F. Hoffmann-La Roche AgExpression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2013092743A2Dec 19, 2012Jun 27, 2013F. Hoffmann-La Roche AgExpression vector element combinations, novel production cell generation methods and their use for the recombinant production of polypeptides
WO2013096791A1Dec 21, 2012Jun 27, 2013Genentech, Inc.Process for making high concentration protein formulations
WO2013101771A2Dec 21, 2012Jul 4, 2013Genentech, Inc.Compositions and method for treating autoimmune diseases
WO2013106489A1Jan 9, 2013Jul 18, 2013The Scripps Research InstituteHumanized antibodies with ultralong cdr3s
WO2013109819A1Jan 18, 2013Jul 25, 2013Genentech, Inc.Anti-lrp5 antibodies and methods of use
WO2013109856A2Jan 18, 2013Jul 25, 2013Genentech, Inc.Methods of using fgf19 modulators
WO2013113641A1Jan 28, 2013Aug 8, 2013Roche Glycart AgUse of nkp46 as a predictive biomarker for cancer treatment with adcc- enhanced antibodies
WO2013116287A1Jan 30, 2013Aug 8, 2013Genentech, Inc.Anti-ig-e m1' antibodies and methods using same
WO2013120056A1Feb 11, 2013Aug 15, 2013Genentech, Inc.R-spondin translocations and methods using the same
WO2013120929A1Feb 14, 2013Aug 22, 2013F. Hoffmann-La Roche AgFc-receptor based affinity chromatography
WO2013127465A1Mar 2, 2012Sep 6, 2013Roche Glycart AgPredicitive biomarker for cancer treatment with adcc enhanced antibodies
WO2013134743A1Mar 8, 2013Sep 12, 2013Halozyme, Inc.Conditionally active anti-epidermal growth factor receptor antibodies and methods of use thereof
WO2013148315A1Mar 15, 2013Oct 3, 2013Genentech, Inc.Diagnosis and treatments relating to her3 inhibitors
WO2013149159A1Mar 29, 2013Oct 3, 2013Genentech, Inc.Anti-lgr5 antibodies and immunoconjugates
WO2013165940A1Apr 30, 2013Nov 7, 2013Genentech, Inc.Anti-pmel17 antibodies and immunoconjugates
WO2013170191A1May 10, 2013Nov 14, 2013Genentech, Inc.Methods of using antagonists of nad biosynthesis from nicotinamide
WO2013183032A2Jun 7, 2013Dec 12, 2013Glenmark Pharmaceuticals S.A.Anti-trka antibodies with enhanced inhibitory properties and derivatives thereof
WO2014001324A1Jun 25, 2013Jan 3, 2014Hoffmann-La Roche AgMethod for selection and production of tailor-made highly selective and multi-specific targeting entities containing at least two different binding entities and uses thereof
WO2014001326A1Jun 25, 2013Jan 3, 2014F. Hoffmann-La Roche AgMethod for the selection and production of tailor-made, selective and multi-specific therapeutic molecules comprising at least two different targeting entities and uses thereof
WO2014006118A1Jul 4, 2013Jan 9, 2014F. Hoffmann-La Roche AgAnti-theophylline antibodies and methods of use
WO2014006123A1Jul 4, 2013Jan 9, 2014F. Hoffmann-La Roche AgAnti-biotin antibodies and methods of use
WO2014006124A1Jul 4, 2013Jan 9, 2014F. Hoffmann-La Roche AgCovalently linked antigen-antibody conjugates
WO2014008391A1Jul 3, 2013Jan 9, 2014Genentech, Inc.Expression and secretion system
WO2014011518A1Jul 8, 2013Jan 16, 2014Genentech, Inc.Immunoconjugates comprising anti-cd22 antibodies
WO2014011519A1Jul 8, 2013Jan 16, 2014Genentech, Inc.Immunoconjugates comprising anti-cd79b antibodies
WO2014011520A1Jul 8, 2013Jan 16, 2014Genentech, Inc.Immunoconjugates comprising anti-cd22 antibodies
WO2014011521A1Jul 8, 2013Jan 16, 2014Genentech, Inc.Immunoconjugates comprising anti - cd79b antibodies
WO2014023673A1Aug 5, 2013Feb 13, 2014Roche Glycart AgInterleukin-10 fusion proteins and uses thereof
WO2014023679A1Aug 5, 2013Feb 13, 2014Roche Glycart AgComposition comprising two antibodies engineered to have reduced and increased effector function
WO2014023709A1Aug 6, 2013Feb 13, 2014Roche Glycart AgAsgpr antibodies and uses thereof
WO2014059028A1Oct 9, 2013Apr 17, 2014Igenica, Inc.Anti-c16orf54 antibodies and methods of use thereof
WO2014072306A1Nov 6, 2013May 15, 2014F. Hoffmann-La Roche AgHer3 antigen binding proteins binding to the beta-hairpin of her3
WO2014078268A2Nov 12, 2013May 22, 2014Genentech, Inc.Anti-hemagglutinin antibodies and methods of use
WO2014083178A1Nov 29, 2013Jun 5, 2014F. Hoffmann-La Roche AgIdentification of patients in need of pd-l1 inhibitor cotherapy
WO2014106602A1Dec 23, 2013Jul 10, 2014Glenmark Pharmaceuticals S.A.Antibodies that bind to tl1a and their uses
WO2014114595A1Jan 20, 2014Jul 31, 2014Roche Glycart AgPredictive biomarker for cancer treatment with adcc-enhanced antibodies
WO2014116749A1Jan 22, 2014Jul 31, 2014Genentech, Inc.Anti-hcv antibodies and methods of using thereof
WO2014128235A1Feb 21, 2014Aug 28, 2014F. Hoffmann-La Roche AgMethods of treating cancer and preventing drug resistance
WO2014131694A1Feb 21, 2014Sep 4, 2014Roche Glycart AgBispecific t cell activating antigen binding molecules
WO2014131711A1Feb 24, 2014Sep 4, 2014Roche Glycart AgBispecific t cell activating antigen binding molecules
WO2014131712A1Feb 24, 2014Sep 4, 2014Roche Glycart AgBispecific t cell activating antigen binding molecules
WO2014131715A1Feb 24, 2014Sep 4, 2014Roche Glycart AgAnti-mcsp antibodies
WO2014138364A2Mar 6, 2014Sep 12, 2014Genentech, Inc.Methods of treating and preventing cancer drug resistance
WO2014144850A1Mar 14, 2014Sep 18, 2014Genentech, Inc.Methods of treating cancer and preventing cancer drug resistance
WO2014144865A2Mar 14, 2014Sep 18, 2014Genentech, Inc.Anti-crth2 antibodies and methods of use
WO2014145098A1Mar 14, 2014Sep 18, 2014Genentech, Inc.Cell culture compositions with antioxidants and methods for polypeptide production
WO2014150877A2Mar 12, 2014Sep 25, 2014Ac Immune S.A.Anti-tau antibodies and methods of use
WO2014151006A2Mar 12, 2014Sep 25, 2014Genentech, Inc.Biomarkers and methods of treating pd-1 and pd-l1 related conditions
WO2014151866A1Mar 13, 2014Sep 25, 2014Genentech, Inc.Compositions and methods for diagnosis and treatment of hepatic cancers
WO2014152358A2Mar 14, 2014Sep 25, 2014Genentech, Inc.Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use
WO2014153030A2Mar 14, 2014Sep 25, 2014Genentech, Inc.Methods of treating cancer and preventing cancer drug resistance
WO2014159835A1Mar 13, 2014Oct 2, 2014Genentech, Inc.Anti-b7-h4 antibodies and immunoconjugates
WO2014188377A2May 22, 2014Nov 27, 2014Nestec S.A.Pathway specific assays for predicting irritable bowel syndrome diagnosis
WO2015010100A2Jul 18, 2014Jan 22, 2015Fabrus, Inc.Humanized antibodies with ultralong complementarity determining regions
WO2015017146A2Jul 18, 2014Feb 5, 2015Fabrus, Inc.Antibodies with ultralong complementarity determining regions
WO2015023596A1Aug 11, 2014Feb 19, 2015Genentech, Inc.Compositions and method for treating complement-associated conditions
WO2015038984A2Sep 12, 2014Mar 19, 2015Halozyme, Inc.Modified anti-epidermal growth factor receptor antibodies and methods of use thereof
WO2015042108A1Sep 17, 2014Mar 26, 2015Genentech, Inc.Methods of using anti-lgr5 antibodies
WO2015048520A1Sep 26, 2014Apr 2, 2015Genentech, Inc.Anti-pdl1 antibody formulations
WO2015054670A1Oct 10, 2014Apr 16, 2015Genentech, Inc.Nsp4 inhibitors and methods of use
WO2015058132A2Oct 17, 2014Apr 23, 2015Genentech, Inc.Anti-rspo antibodies and methods of use
WO2015075011A1Nov 18, 2014May 28, 2015F. Hoffmann-La Roche AgANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE
WO2015075598A1Nov 10, 2014May 28, 2015Pfizer Inc.2,6-substituted purine derivatives and their use in the treatment of proliferative disorders
WO2015089344A1Dec 12, 2014Jun 18, 2015Genentech, Inc.Anti-cd33 antibodies and immunoconjugates
WO2015091656A1Dec 17, 2014Jun 25, 2015F. Hoffmann-La Roche AgHUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE
WO2015095410A1Dec 17, 2014Jun 25, 2015Genentech, Inc.Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody
WO2015095418A1Dec 17, 2014Jun 25, 2015Genentech, Inc.Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies
WO2015095423A2Dec 17, 2014Jun 25, 2015Genentech, Inc.Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists
WO2015101586A1Dec 29, 2014Jul 9, 2015F. Hoffmann-La Roche AgBispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles
WO2015101587A1Dec 29, 2014Jul 9, 2015F. Hoffmann-La Roche AgCovalently linked helicar-anti-helicar antibody conjugates and uses thereof
WO2015101588A1Dec 29, 2014Jul 9, 2015F. Hoffmann-La Roche AgMonovalent blood brain barrier shuttle modules
WO2015101589A1Dec 29, 2014Jul 9, 2015F. Hoffmann-La Roche AgCovalently linked polypeptide toxin-antibody conjugates
WO2015112909A1Jan 23, 2015Jul 30, 2015Genentech, Inc.Methods of using anti-steap1 antibodies and immunoconjugates
WO2015116902A1Jan 30, 2015Aug 6, 2015Genentech, Inc.G-protein coupled receptors in hedgehog signaling
WO2015120075A2Feb 4, 2015Aug 13, 2015Genentech, Inc.Mutant smoothened and methods of using the same
WO2015120233A1Feb 6, 2015Aug 13, 2015Genentech, Inc.Methods of treating alzheimer's disease
WO2015120280A1Feb 6, 2015Aug 13, 2015Genentech, Inc.Methods of treating alzheimer's disease
WO2015127405A2Feb 23, 2015Aug 27, 2015Genentech, Inc.Anti-il-13/il-17 bispecific antibodies and uses thereof
WO2015139046A1Mar 16, 2015Sep 17, 2015Genentech, Inc.Methods and compositions for secretion of heterologous polypeptides
WO2015140591A1Mar 21, 2014Sep 24, 2015Nordlandssykehuset HfAnti-cd14 antibodies and uses thereof
WO2015148531A1Mar 24, 2015Oct 1, 2015Genentech, Inc.Cancer treatment with c-met antagonists and correlation of the latter with hgf expression
WO2015153513A1Mar 30, 2015Oct 8, 2015Genentech, Inc.Anti-ox40 antibodies and methods of use
WO2015153514A1Mar 30, 2015Oct 8, 2015Genentech, Inc.Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists
WO2015155624A1Mar 27, 2015Oct 15, 2015Pfizer Inc.Dihydropyrrolopyrimidine derivatives
WO2015164615A1Apr 23, 2015Oct 29, 2015University Of OsloAnti-gluten antibodies and uses thereof
WO2015166373A1Apr 17, 2015Nov 5, 2015Pfizer Inc.Cycloalkyl-linked diheterocycle derivatives
WO2015179658A2May 21, 2015Nov 26, 2015Genentech, Inc.Anti-gpc3 antibodies and immunoconjugates
WO2015179835A2May 22, 2015Nov 26, 2015Genentech, Inc.Mit biomarkers and methods using the same
WO2015191715A1Jun 10, 2015Dec 17, 2015Genentech, Inc.Anti-lgr5 antibodies and uses thereof
WO2015191986A1Jun 12, 2015Dec 17, 2015Genentech, Inc.Methods of treating and preventing cancer drug resistance
WO2016001789A1Jun 19, 2015Jan 7, 2016Pfizer Inc.Pyrimidine derivatives as pi3k inhibitors for use in the treatment of cancer
WO2016004370A1Jul 2, 2015Jan 7, 2016Genentech, Inc.Polypeptide expression systems
WO2016007235A1May 29, 2015Jan 14, 2016Genentech, Inc.Anti-pd-l1 antibodies and diagnostic uses thereof
WO2016007775A1Jul 9, 2015Jan 14, 2016Genentech, Inc.Notch pathway inhibition
U.S. Classification530/387.3, 436/512, 530/391.3, 530/389.7, 436/501, 530/388.22, 530/391.7, 530/387.7
International ClassificationC07K16/32, A61K38/00
Cooperative ClassificationA61K38/00, C07K16/32
European ClassificationC07K16/32
Legal Events
Jul 23, 1996ASAssignment
Effective date: 19960612
Jun 21, 2000FPAYFee payment
Year of fee payment: 4
Jun 28, 2004SULPSurcharge for late payment
Year of fee payment: 7
Jun 28, 2004FPAYFee payment
Year of fee payment: 8
Jun 30, 2008REMIMaintenance fee reminder mailed
Dec 24, 2008LAPSLapse for failure to pay maintenance fees
Feb 10, 2009FPExpired due to failure to pay maintenance fee
Effective date: 20081224