Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS5756325 A
Publication typeGrant
Application numberUS 08/709,982
Publication dateMay 26, 1998
Filing dateSep 9, 1996
Priority dateDec 9, 1993
Fee statusLapsed
Also published asCA2178729A1, CN1048254C, CN1117866C, CN1142829A, CN1215755A, DE733059T1, DE69425903D1, DE69425903T2, EP0733059A1, EP0733059A4, EP0733059B1, US5565350, US5871984, WO1995015972A1
Publication number08709982, 709982, US 5756325 A, US 5756325A, US-A-5756325, US5756325 A, US5756325A
InventorsEric B. Kmiec
Original AssigneeThomas Jefferson University
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Compounds and methods for site directed mutations in eukaryotic cells
US 5756325 A
The present invention concerns a polynucleotide having both ribonucleotides and deoxyribonucleotides in a first strand and solely deoxyribonucleotides in a second strand; wherein the strands are Watson-Crick paired and are linked by an oligonucleotide so that the polynucleotide has at most a single 3' and a single 5' end. These ends can be ligated so that the polynucleotide is a single continuous circular polymer. The polynucleotide can be used to induce specific alterations in targeted genes.
Previous page
Next page
I claim:
1. A mixed ribo-deoxyribonucleic acid having at most one 3' end and one 5' end, which nucleic acid further comprises:
a) at least one region of contiguous unpaired bases disposed so that the unpaired region separates the nucleic acid into a first strand and a second strand connected by said region of contiguous unpaired bases;
b) at least one region of Watson-Crick paired nucleic acid of at least 15 base pairs in length, in which bases of the first strand correspond to bases of the second strand, and in which;
c) the first strand comprises a region of at least three contiguous nucleotides comprised of a 2'-OMe ribose, which form a hybrid-duplex within the region of Watson-Crick paired nucleic acid.
2. The nucleic acid of claim 1, in which the second strand contains no nucleotides comprised of a 2'-OMe or 2'-O ribose and the first strand contains no nucleotides comprised of 2'-O ribose.
3. The nucleic acid of claim 1, which comprises between 15 and 50 base pairs of hybrid-duplex.
4. The nucleic acid of claim 1, in which the 5' and 3' ends are Watson-Crick paired to adjacent bases of a complementary strand in the region of Watson-Crick paired nucleic acid.
5. The nucleic acid of claim 4, which comprises between 15 and 50 base pairs of hybrid-duplex.
6. The nucleic acid of claim 5, in which the second strand comprises the 5' and 3' ends.
7. The nucleic acid of claim 6, in which the second strand contains no nucleotides comprised of a 2'-OMe or 2'-O ribose and the first strand contains no nucleotides comprised of 2'-O ribose.
8. The nucleic acid of claim 1, which further comprises a second region of contiguous unpaired bases disposed so that the unpaired region separates the nucleic acid into a first strand and a second strand connected by said second region of contiguous unpaired bases.
9. The nucleic acid of claim 8, in which the second strand contains no nucleotides comprised of a 2'-OMe or 2'-O ribose and the first strand contains no nucleotides comprised of 2'-O ribose.
10. The nucleic acid of claim 9, which comprises between 15 and 50 base pairs of hybrid-duplex.
11. The nucleic acid of claim 2, in which the first strand comprises two regions of nucleotides comprised of a 2'-OMe ribose that form two regions of hybrid-duplex, each hybrid-duplex region having at least 8 base pairs of length, and an interposed region of at least 4 base pairs of homo-duplex disposed between the hybrid duplex regions.
12. The nucleic acid of claim 11, in which the interposed region of homo-duplex consists of between 4 and 50 2'-deoxyribose base pairs.
13. The nucleic acid of claim 11, in which the interposed region of homo-duplex consists of between 30 and 1,000 2'-deoxyribose base pairs.
14. The nucleic acid of claim 13 in which the 5' and 3' ends are Watson-Crick paired to adjacent bases of a complementary strand in the region of Watson-Crick paired nucleic acid.
15. The nucleic acid of claim 9, in which the 5' and 3' ends are Watson-Crick paired to adjacent bases of a complementary strand in the region of Watson-Crick paired nucleic acid.
16. The nucleic acid of claim 15, which comprises between 15 and 50 base pairs of hybrid-duplex.
17. The nucleic acid of claim 16, in which the second strand comprises the 5' and 3' ends.
18. The nucleic acid of claim 2, in which the 5' and 3' ends are Watson-Crick paired to adjacent bases of a complementary strand in the region of Watson-Crick paired nucleic acid.
19. The nucleic acid of claim 18, which comprises between 15 and 50 base pairs of hybrid-duplex.
20. The nucleic acid of claim 19, in which the second strand comprises the 5' and 3' ends.
21. The nucleic acid of claim 12, in which the 5' and 3' ends are Watson-Crick paired to adjacent bases of a complementary strand in the region of Watson-Crick paired nucleic acid.
22. The nucleic acid of claim 21, which comprises between 15 and 50 base pairs of hybrid-duplex.
23. The nucleic acid of claim 22, in which the second strand comprises the 5' and 3' ends.
24. A method of introducing a predetermined alteration in a target sequence of the genome of a cultured cell, which cell contains a nucleus, which comprises the steps of:
a) providing the mixed ribo-deoxyribonucleic acid of claim 1, which further comprises two regions homologous with a target sequence and a heterologous region, disposed there between, encoding the alteration; and
b) maintaining said mixed ribo-deoxyribonucleic acid within the nucleus of the cultured cell,
whereby the alteration is introduced in the target sequence.
25. The method of claim 24, wherein the first strand of the mixed ribo-deoxyribonucleic acid, comprises two regions of contiguous nucleotides that form two regions of hybrid-duplex, each hybrid-duplex region having at least 4 base pairs of length, and an interposed region of at least 1 base pair of homo-duplex disposed between the hybrid duplex regions that comprises the heterologous region.
26. The method of claim 24, wherein the cell is other than a yeast or fungus.
27. The method of claim 26, which further comprises a step of introducing the mixed ribo-deoxyribonucleic acid into the nucleus by use of a liposome.
28. The method of claim 24, wherein the nucleus is a pronucleus of an ovum and the mixed ribo-deoxyribonucleic acid vector is introduced into the pronucleus by injection.
29. The method of claim 24, wherein the nucleus is a nucleus of an embryonic stem cell and the introduction is by use of a liposome or by electroporation.
30. A method of obtaining a cultured cell having altered characteristics which comprises the steps of:
a) providing the mixed ribo-deoxyribonucleic acid of claim 1 which further comprises two regions homologous with a target sequence and a heterologous region, disposed there between, encoding the alteration;
b) maintaining said mixed ribo-deoxyribonucleic acid within the nucleus of the cultured cell whereby the mixed nucleic acid and the target sequence recombine and the cell is altered; and
c) selecting an altered cell.
31. The method of claim 30, wherein the first strand of the mixed ribo-deoxyribonucleic acid, comprises two regions of contiguous nucleotides that form two regions of hybrid-duplex, each hybrid-duplex region having at least 4 base pairs of length, and an interposed region of at least 1 base pair of homo-duplex disposed between the hybrid duplex regions that comprises the heterologous region.
32. The method of claim 30, wherein the cell is a mammalian cell.
33. The method of claim 30, wherein the cell is other than a yeast or fungus.
34. A method of introducing a predetermined alteration in a target gene of the genome of a cultured cell, which cell contains a nucleus, which comprises the steps of: a) providing a mixed ribo-deoxyribonucleic acid comprising
i. a first and a second homologous region that are together from 20 to 60 nucleotides in length, which is homologous with the target gene; and
ii. a heterologous region, that is disposed between the first and second homologous regions and is from 1 to 20 nucleotides in length, which is heterologous with the target gene and which contains the predetermined alteration,
b) maintaining the mixed ribo-deoxyribonucleic acid vector within the nucleus of the cultured cell,
whereby the alteration is introduced in the target gene.
35. The method of claim 34, wherein the homologous regions comprise together between 20 and 60 2'-OMe ribonucleotides.
36. The method of claim 34, wherein the ribonucleotides of the mixed ribo-deoxyribonucleic acid are 2'-O-methylated.
37. The method of claim 34, wherein the heterologous region consists of deoxyribon nucleotides.
38. The method of claim 34, wherein the heterologous region is one nucleotide in length.
39. The method of claim 38, wherein the ribonucleotides of the mixed ribo-deoxyribonucleic acid are 2'-O-methylated.
40. The method of claim 34, wherein the alteration is an insertion or deletion in the target gene.
41. A mixed ribo-deoxyribonucleic acid for introducing a predetermined alteration into a target gene, which comprises:
a) a first and a second homologous region that are together from 20 to 60 nucleotides in length, which is homologous with the target gene; and
b) a heterologous region, that is disposed between the first and second homologous region and is from 1 to 20 nucleotides in length, which is heterologous with the target gene and which contains the predetermined alteration, wherein
the target gene is a gene of a cell having a nucleus.
42. The mixed ribo-deoxyribonucleic acid of claim 41, in which the first and second homologous regions together comprise between 20 and 60 2'-OMe ribonucleotides.
43. The mixed ribo-deoxyribonucleic acid of claim 41, in which the ribonucleotides of the mixed ribo-deoxyribonucleic acid are 2'-O-methylated.
44. The mixed ribo-deoxyribonucleic acid of claim 41, in which the heterologous region consists of deoxyribonucleotides.
45. The mixed ribo-deoxyribonucleic acid of claim 41, in which the heterologous region is one nucleotide in length.
46. The mixed ribo-deoxyribonucleic acid of claim 45, in which the ribonucleotides of the mixed ribo-deoxyribonucleic acid are 2'-O-methylated.
47. The mixed ribo-deoxyribonucleic acid of claim 41, in which the heterologous region contains an insertion or deletion of the target gene.
48. A mixed ribo-deoxyribonucleic acid having at most one 3' end and one 5' end, which nucleic acid further comprises:
a) at least one region of contiguous unpaired bases disposed so that the unpaired region separates the nucleic acid into a first strand and a second strand connected by said region of contiguous unpaired bases;
b) at least one region of Watson-Crick paired nucleic acid of at least 15 base pairs in length, in which bases of the first strand correspond to bases of the second strand; and, in which
c) the first strand comprises a region of at least nine ribonucleotides, which form a hybrid-duplex within the region of Watson-Crick paired nucleic acid.
49. The nucleic acid of claim 48, in which the 5' and 3' ends are Watson-Crick paired to adjacent bases of a complementary strand of Watson-Crick paired nucleic acid.
50. The nucleic acid of claim 48, in which the second strand comprises the 5' and 3' ends.
51. The nucleic acid of claim 48, which comprises at least nine contiguous base pairs of hybrid-duplex.
52. The nucleic acid of claim 48, in which the first strand comprises two regions of contiguous nucleotides that form two regions of hybrid-duplex, each hybrid-duplex region having at least 4 base pairs of length, and an interposed region of at least 1 base pair of homo-duplex disposed between the hybrid duplex regions.
53. A method of introducing a predetermined alteration in a target sequence of the genome of a cultured cell, which cell contains a nucleus, which comprises the steps of:
a) providing the mixed ribo-deoxyribonucleic acid of claim 48 which further comprises two regions homologous with a target sequence and a heterologous region, disposed there between, encoding the alteration; and
b) maintaining said mixed ribo-deoxyribonucleic acid within the nucleus of the cultured cell,
whereby the alteration is introduced in the target sequence.
54. The method of claim 53, wherein the first strand of the mixed ribo-deoxyribonucleic acid, comprises two regions of contiguous nucleotides that form two regions of hybrid-duplex, each hybrid-duplex region having at least 4 base pairs of length, and an interposed region of at least 1 base pair of homo-duplex disposed between the hybrid duplex regions that comprises the heterologous region.
55. The method of claim 53, wherein the cell is other than a yeast or fungus.
56. The method of claim 55, which further comprises a step of introducing the mixed ribo-deoxyribonucleic acid into the nucleus by use of a liposome.
57. The method of claim 53, wherein the nucleus is a pronucleus of an ovum and the mixed ribo-deoxyribonucleic acid vector is introduced into the pronucleus by injection.
58. The method of claim 53, wherein the nucleus is a nucleus of an embryonic stem cell and the introduction is by use of a liposome or by electroporation.
59. A method of obtaining a cultured cell population having altered characteristics which comprises the steps of:
a) providing the mixed ribo-deoxyribonucleic acid of claim 48 which further comprises two regions homologous with a target sequence and a heterologous region, disposed there between, encoding the alteration;
b) maintaining said mixed ribo-deoxyribonucleic acid within the nucleus of the cultured cell whereby the mixed nucleic acid and the target sequence recombine and the cell is altered; and
c) selecting an altered cell.
60. The method of claim 59, wherein the first strand of the mixed ribo-deoxyribonucleic acid, comprises two regions of contiguous nucleotides that form two regions of hybrid-duplex, each hybrid-duplex region having at least 4 base pairs of length, and an interposed region of at least 1 base pair of homo-duplex disposed between the hybrid duplex regions that comprises the heterologous region.
61. The method of claim 59, wherein the cell is a mammalian cell.
62. The method of claim 59, wherein the cell is other than a yeast or fungus.

This is a continuation of application Ser. No. 08/353,657, filed Dec. 9, 1994, now U.S. Pat. No. 5,565,350 which is a Continuation-in-Part of patent application Ser. No. 08/164,303 now abandoned, filed Dec. 9, 1993, which is hereby incorporated by reference in its entirety.


The present invention concerns the field of molecular genetics. Particularly it concerns nucleic acid compounds and methods of their use to introduce specific genetic alterations into living cultured eukaryotic cells. More particularly it concerns substantially Watson-Crick paired, duplex nucleic acids wherein a portion of one strand of the duplex comprises a 2'-O or 2'-OMe ribose containing nucleotides and the remainder comprise deoxyribose nucleotides.



The field of the invention concerns nucleic acids. Nucleic acids are heteropolymers, i.e., polymers of non-identical subunits, which are linked by oriented phosphodiester bonds or their derivatives, into polymers.

Duplex nucleic acids are nucleic acids wherein each base of a first strand of the duplex corresponds to a base of a second strand of the duplex according to the scheme in which uracil or thymine and adenine correspond and cytosine and guanine correspond. Anti-parallel duplex strands having these correspondences are said to be Watson-Crick paired. Duplex nucleic acids can be of two major types, ribonucleic acids and deoxyribonucleic acids. Each ribonucleotide has an equivalent deoxyribonucleotide, e.g., adenosine and deoxyadenosine, cytidine and deoxycytidine, guanosine and deoxyguanosine, uridine and thymidine. As used in the field, a nucleic acid in which both ribonucleotides and deoxyribonucleotides are present in the same strand is termed a mixed or chimeric (hereinafter "chimeric") nucleic acid. A duplex nucleic acid in which deoxyribonucleotides and ribonucleotides correspond with each other is termed a hybrid-duplex. When two strands form a region of duplex nucleic acid for less than all of their bases, the resultant molecule is termed a heteroduplex.

Most often, the two strands of a duplex nucleic acid are not covalently bonded but are associated only by Watson-Crick pairing. However, the two strands of a duplex can be linked by an oligonucleotide to form a single polymer. The linking oligonucleotide is not Watson-Crick paired. The heteroduplex in which the first and second strands are portions of a single polymer is termed a "hairpin duplex" or a "stem and loop" structure. The former term will be used hereinafter.

As used herein chimerism is a property of a nucleic acid polymer and hybridism is a property of a duplex. For example, an mRNA and its template form a hybrid duplex though neither is chimeric, while, for example, the chimeric octanucleotides 5'd(TTTT)-r(CCCC)3' and 5'r(GGGG)-d(AAAA)3' will form a Watson-Crick duplex with each other but the resultant duplex is not a hybrid-duplex. A duplex nucleic acid which is not a hybrid-duplex is termed hereinafter a "homo-duplex". Unless specifically noted otherwise, a homo-duplex nucleic acid refers only to a deoxynucleotide containing duplex. Lastly, note that while those in the field refer to the formation of a Watson-Crick duplex as "hybridization," even where there is no hybrid-duplex nucleic acids.

Those interested in the study the structure of chimeric and/or hybrid duplex nucleic acids by X-ray diffraction and 2-dimensional NMR have synthesized chimeric nucleic acids and hybrid duplex nucleic acids for use in their studies. See, e.g., Salazar, M., et al., 1994, J.Mol.Biol. 241:440-55 and Egli, M., et al., 1993, Biochemistry 32:3221-37 (two stranded chimeric hybrid duplex of the form r3 d7 ·d10); Ban, C., et al., 1994, J.Mol.Biol. 236:275-85 (self complementary chimeric hybrid duplex of the form d5 rphd1 D4); Chou, S. H., 1991, Biochemistry 30:5248-57 (self-complementing and non-self-complementing chimeric hybrid duplexes of the form d4 r4 d4). The complementary strands of these duplex nucleic acids were not covalently bound to each other; they were associated only by Watson-Crick pairing.

A second group of scientists who have synthesized chimeric nucleic acids are those interested in the study and use of ribozymes, i.e., RNA molecules that are either self-cleaving or cleave other RNAs. Perreault, J. P., et al., 1990, Nature 344:565; Taylor, N. R., et al., 1992, Nucleic Acids Research 20:4559-65; Shimaya, T., 1993, Nucleic Acids Research 21:2605. These researches have found that chimeric ribozymes are active and are more resistant to nuclease digestion than RNA ribozymes. Chimeric ribozymes are self-complementary, i.e., the Watson-Crick paired strands are covalently linked. The compounds synthesized during the studies of chimeric ribozymes differ from the above-noted hybrid-duplex molecules, that were synthesized used for structural studies, in that chimeric ribozymes do not contain stable hybrid-duplexes. Thus, a chimeric ribozyme having DNA binding arms binds to its substrate and forms a hybrid duplex. Yang, J. H., et al., 1990, Biochemistry 29:11156-60. See also, Sawata, S., et al., 1993, Nucleic Acids Research 21:5656-60; Hendry, P., et al., 1992, Nucleic Acids Research 20:5737-41 Shimayama, T., 1993, Nucleic Acids Research 21:2605. The ribozyme catalyzes the cleavage of the RNA substrate and the hybrid-duplex is thus dissolved.


Those skilled in the art of molecular biology recognize that on frequent occasions it is desired not merely to introduce a new polynucleic acid sequence, i.e, a new gene, into a targeted eukaryotic cell, but rather to alter a defined, pre-existing gene in the targeted cell. The targeted cell can be used in culture or it can be used to construct a transgenic animal.

A wide variety of techniques have been developed to introduce DNA into cultured eukaryotic cells. These techniques include calcium phosphate precipitation and DEAE-dextran mediated endocytosis, electroporation, liposome mediated fusion and transduction with replication incompetent viruses. However, while such techniques can quite often introduce functional genes into the eukaryotic cell, these techniques do not readily accomplish an alteration (mutation) in a specific existing gene. After introduction the exogenous DNA is isolated at a random position in the cell's genome by illegitimate recombination, rather than at a specific position by homologous recombination.

To date there is no generally satisfactory scheme for introducing a site-directed or site-specific genetic alteration (mutagenesis) in a higher eukaryote, i.e, in mammalian or avian cells. Although homologous recombination can be obtained in higher eukaryotic cells by introduction of very long (>1 kb) nucleic acids, these techniques require the application of elaborate selection techniques because the rate of illegitimate recombination in higher eukaryotes greatly exceeds that of homologous recombination. Thomas, K. R. & Capecchi, M. R., 1987, Cell 52:503. See, also, Valancius, V. & Smithies O., 1991, Mol. Cell. Biol. 11:4389 (comparison homologous recombination of linearized and supercoiled plasmids in eukaryotic cells).

One approach to achieving a predominantly site-directed mutagenesis has been the introduction of single stranded oligodeoxynucleotides directly into the cell. This techniques has been successfully employed in the yeast Saccharomyces cerevisiae, in which homologous recombination is significantly more active than it is in higher eukaryotes. Moerschell, R. P., et al., 1988, Proc.Natl.Acad.Sci. 85:524-28; Yamamoto, T., et al., 1992, Yeast 8:935-48. However, to date there have been no reports of the successful transformation of mammalian or avian cells by single stranded oligonucleotides.

A relationship between the structure of the target DNA and the rate of homologous recombination in mammalian can be inferred by studies that show that regions of alternating purine and pyrimidine bases, i.e., d(TG)30 ·d(AC)30 !, display an entranced rate of recombination. These effects were demonstrated in studies of non-replicating plasmids in cultured mammalian cells. Wahls, W. P., et al., 1990, Mol. Cell. Biol. 10:785-93. These experiments were not extended to show recombination between an exogenous nucleic acid and the genome of the cell.

Attempts have been made to use RecA, a protein that promotes homologous recombination in the bacteria, E. coli, to promote homologous recombination in eukaryotic cells. However, these attempts have not been clearly successful. For example U.S. Pat. No. 4,950,599 to W. Bertling discloses a very low rate of site-directed mutation and no enhancement in the rate of homologous recombination by use of RecA in eukaryotic cells. Patent publications WO 93/22443 to D. Zarling and E. Sena, and publication 94/04032 to D. C. Gruenert and K. Kunzelmann both purport to correct a genetic defect in a cultured cell line related to cystic fibrosis. These publications disclose primarily experimental data that demonstrate the principle rather than data concerning examples of operative methods. Thus, to introduce polynucleotide/RecA complexes access to the nucleus, Zarling and Gruenert employ cells that were membrane-permeabilized, although such cells are incapable of further growth. Moreover, even when RecA-promoted homologous recombination was asserted to have taken place in intact cells, these publications provide no quantitative estimates of its frequency. Thus, the use of prokaryotic recA has not been convincingly shown to result in a rate homologous recombination in any viable eukaryotic cell significantly greater than the spontaneous rate of homologous recombination.


The present invention concerns single covalently linked duplex oligonucleotides that are homologous with a gene of interest having both deoxyribonucleotides and ribonucleotides. In order to effect a genetic change there are within the region of homology one or more non-corresponding (hereinafter "heterologous" or "mutator") base pairs. The normal, constitutive cellular processes of homologous recombination cause the mutator nucleotides to be inserted into the targeted genomic site. The duplex oligonucleotides of the invention (hereinafter "chimeric vectors") can be used to alter specifically a gene of interest by introducing into the gene the heterologous base pairs. The heterologous base pairs can be base pairs different from the gene of interest, or base pairs in addition to those present in the gene of interest (an insertion), or, lastly, the heterologous base pairs can be the absence of base-pairs found in the gene of interest (a deletion). The present invention is based, in part, on the discovery that the inclusion of a region of between about 15 and 50 base pairs of hybrid-duplex nucleic acid in the vector causes a greatly increased rate of alteration of the gene of interest. When the region of the heterologous base pairs is between 1 and 50 base pairs, the heterologous base pairs can be present in the vectors of the invention as either a homo-or a hybrid-duplex. When the heterologous base pairs are greater than 50 base pairs in length it is preferred that they be present as a homo-duplex.

The vector can be introduced into the target cell by any method known to allow for the introduction of nucleic acids into eukaryotic cells. Without limitation as to theory, the chimeric vector is believed to be engaged by the recombination/repair mechanisms of the target cell and to direct a the alteration of the target gene by gene conversion or by homologous recombination.


FIGS. 1A and 1B shows the schematic representation of two chimeric vectors. The following are particularly labeled: 1, a first strand; 2, a second strand; 3, a heterologous region; 4, a homologous region; 5, a linker; 6, a ligation site. ##STR1##

FIG. 1A is a ligated chimeric vector in the R-D-R form.

FIG. 1B is a hairpin chimeric vector in the R-D-R form having a single 3' and 5' end.



The present invention encompasses duplex nucleic acids that contain both deoxyribose and ribose containing bases. Thus they contain regions of both DNA and RNA and are termed therefore termed "chimeric vectors." The 2'-O of the ribonucleotides of the chimeric vector can be methylated. Any phosphodiester can be substituted by a phosphorothiodiester or methyphosphonodiester.

The chimeric vectors of the invention are a single nucleic acid polymer. Accordingly; the chimeric vectors of the invention must contain at least one region of between at least 1 base and more usually 3 or 4 bases that are not Watson-Crick paired. These unpaired regions serve as linkers between the two strands of Watson-Crick paired bases. In contrast to other chimeric nucleotides that have been synthesized having regions of unpaired nucleotides chimeric vectors have no enzymatic activity i.e., they do not catalyze chemical reactions or themselves undergo chemical reaction in the absence of an biological energy source such as ATP.

The bases of the linkers in the preferred embodiment are deoxyribonucleotides. A chimeric vector having two linkers can be constructed so that the 3' and 5' ends of the polymer are Watson-Crick paired to adjacent nucleotides of the complementary strand. They can then be readily ligated so that the chimeric vector forms a single continuous circular nucleic acid polymer.

Substantially all the remaining bases of the chimeric vector are Watson-Crick paired. As used herein the statement that bases are Watson-Crick paired or that they form a duplex nucleic acid is to be understood to mean that under the proper conditions of temperature and salt they are capable of forming base pairs or a duplex nucleic acid. It is to be understood that under some conditions of low salt and/or elevated temperature the Watson-Crick base pairs may cease to be thermodynamically stable such that the duplex nucleic acid melts-out or denatures. It is also to be understood that a one or two base pair mismatch does not effect the operability of the invention.

The chimeric vectors of the present invention are intended for the purpose of specifically introducing alterations (a mutation) into a target gene. The genetic site of the alteration is determined by selecting a portion of the chimeric vector to have the same sequence as (to be homologous with) the sequence of the target site, hereinafter termed a homologous region. The area of differences between the sequence of the chimeric vector and the target gene are termed the heterologous region. Note that the chimeric vector is heterologous to the target gene, but is not a hybrid-duplex in this region of the vector. According to the preferred embodiment of the invention there are two homologous regions in each chimeric vector flanking the interposed heterologous region, all three regions being present in a single continuous duplex nucleic acid. Further according to the invention each homologous region contains a portion of hybrid-duplex nucleic acid. The portion of each hybrid-duplex can be at least 4 base pairs and preferably is 8 base pairs and more preferably about 20 to 30 base pairs. The function of the chimeric vector is not affected by a dinucleotide base pair of homo-duplex within a region of hybrid duplex, placed to allow ligation of the 3' and 5' ends to each other. The total length of the two homologous regions can be at least 20 base pairs and preferably is between 40 and 60 base pairs.

According to the invention, a region of homo-duplex nucleic acid can be disposed between the hybrid-duplex/homologous regions of the vector. The interposed homo-duplex can contain the heterologous region. When the heterologous region is less than about 50 base pairs and preferably less than about 20 base pairs, the presence of a interposed homo-duplex region is optional. When the heterologous region exceeds about 20 base pairs, an interposed homo-duplex that contains the heterologous region is preferred.


The chimeric vectors of the invention can be synthesized by any method. The chimeric vectors can most readily be synthesized by modification of the techniques used in the solid phase synthesis of DNA. Reviewed Caruthers, M. H., 1985, Science 230:281-85; Itakura, K., et al., 1984, Ann.Rev.Biochem. 53:523-56. Modifications to permit the synthesis of RNA and of chimeric nucleic acids are disclosed in Scaringe, S. A., et al., 1990, Nucleic Acids Research 18:5433-41; Usman, N., et al., 1992, Nucleic Acids Research 20:6695-99; and Swiderski, P. M., et al., 1994, Anal. Biochem 216:83-88, which are hereby incorporated by reference in their entirety. Recent advances concerning the synthesis of chimeric nucleic acids are reviewed in Usman, N. & Cedergren, R., 1992, Trends Bioch. Sci. 17:334-9.

Chimeric vectors having a homo-duplex region interposed between two hybrid-duplex regions can be constructed using semisynthetic techniques. Two synthetic chimeric polynucleic acids having a hairpin conformation are to be constructed. The free 5' and 3' ends of the two chimeric nucleic acids are constructed with an overlap staggered ends complementary to the overlap of two different restriction enzyme digest products. A homo-duplex region is provided having the complementary restriction enzyme digested ends. The addition of a restriction enzyme sites to the ends of a cloned DNA fragment can be accomplished by techniques well understood by those skilled in the art, e.g., without limitation, PCR amplification with extended primers or the blunt end ligation of linkers containing the restriction site. The two chimeric nucleotides and the homo-duplex region can be ligated by conventional enzymatic techniques. The product, having chimeric oligonucleotides ligated at both ends can be separated from the incompletely reacted substrates by electrophoresis in 6% polyacrylamide gel in Tris Borate EDTA buffer under non-denaturing conditions. The linear capped molecules are constrained and are electrophoresed more slowly under these conditions.

Chimeric vectors containing only naturally occurring nucleotides can be used for the present invention. The chimeric vectors having regions of hybrid-duplex of about 20 ribonucleotides are found, in vitro, to be resistant to RNAse H. Resistance to enzymatic degradation can be obtained by the replacement of the ribonucleotides with 2'-O methylated ribonucleotides. Additionally or alternatively the phosphodiester bonds of the nucleic acid can be replaced by phosphorothiodiesters. Shimayama, T. et al., 1993, Nucleic Acids Research 21:2605. Arabinose containing nucleotides can also be used. As used herein the term nucleic acid is intended to encompass nucleic acids having these modifications.


The chimeric vectors of the present invention can be used to introduce a mutation in a specific location in the genome of a target cell. The specific location of the target location is defined by its nucleic sequence hereinafter the target sequence. According to the invention a chimeric vector is constructed wherein the homology regions are identical to the target sequence, except for the presence of some regions of hybrid-duplex. The change to be introduced is encoded by the heterologous region. The change may be change in one or more bases of the sequence or the addition of one or more bases. When the change in the target sequence is the addition of less than about 20 bases the invention may be practiced using one or two regions of hybrid duplex. When the change in the target sequence is the addition of more than about 50 bases it is preferred that the heterologous region be contained within a homo-duplex region.

The practice of the invention requires that the chimeric vector be introduced into the nucleus of the target cell. Any method which causes such introduction can be used. Such methods include electroporation, DEAE-dextran, Ca PO4 precipitation, liposome mediated fusion (LIPOFECTIN), and direct injection. Electroporation is particularly suitable.

In one embodiment of the invention the chimeric vector can be used to construct transgenic animals. The chimeric vector can be introduced into the pronucleus of a ovum by direct injection, according to the method described Brinster, R. L. et al., 1989, PROC.NATL.ACAD.SCI 86:7087; see also U.S. Pat. No. 4,873,191 to T. E. Wagner and P. C. Hoppe, which are hereby incorporated by reference in their entirety. Alternatively, the chimeric vector can be introduced into an embryonic stem cell, chimeric animals can be produced by aggregation of the embryonic stem cell with normal blastocyst cells, and transgenic animals can be recovered as offspring of the chimeric animals, according to the method of Capecchi, M. R., 1989, Science 244:1288, which is hereby incorporated by reference in its entirety.

Using electroporation, as many as 1 cell per 10,000 treated cells can be specifically mutated at the target sequence (hereinafter "transformed"). The practice of the invention, thus, includes the use of a method to select the transformed cells from among the larger number of unmutated cells. In one embodiment the transformation of the cells confers a growth advantage. Non-limiting examples of such growth advantages include drug-resistance, alterations in growth regulation, and alterations in the capacity to utilize metabolites. In an alternative embodiment the method of selection can be negative selection whereby the transformed cells are rendered incapable of growth under the selecting conditions and the non-transformed cells are removed by exposure to conditions which selectively destroy proliferating cells.

Alternatively, the transformed cells may have an altered cell-surface antigenic phenotype that can be detected by immunofluorescence and selection can be performed by a Fluorescence Activated Cell Sorter.

When the method of introducing the chimeric vector into the cell is direct injection, as for example when constructing transgenic animals by pronuclear injection, the rate of transformation can be greater than 1 per 10,000 cells. The need for selection is thereby considerably reduced.

Typically useful amounts of a chimeric vector are between 10 and 1000 ng of chimeric vector per million cultured cells to be transformed by electroporation.


Example 1: In Vivo Activity in Ustilago Fungus

Wild-type Ustilago has a functioning ura-3 gene whose product is part of the uracil biosynthetic pathway. When wild-type Ustilago is grown on 5'-fluororotic acid (5FOA)-media the cells die due to incorporation of the acid into the pathway. If the ura-3 gene is mutated so that ura-3 mRNA is not produced, the cells survive on the 5FOA media.

The sequence of the endogenous ura-3 gene is known in the art. In one set of experiments, base 358 of the sequence was changed from a thymidine to an adenine which mutation results in a dysfunctional protein.

A chimeric vector was synthesized as follows: Vector for mutation at base 358: (358 RNA Vector)


The 358 vector adopts hairpin conformations. Underlined bases indicate ribonucleic acid residues. The bolded letter indicates the mutator (heterologous region). The italicized "T"'s indicate the unpaired bases.

A vector having the same sequence but containing no ribonucleic acids was also constructed for use as a control. In the vector thymidine was substituted for uracil.

The control vector for mutation at base 358: (DNA 358 Vector) 5' TGCCGATCGGCAACTTTTGTTGCCGATCGGCAAATTT 3' (SEQ ID: 2) also adopts a hairpin conformation. Again, the bolded residue is the mutator.

An in vivo transformation experiment was carried out in which U. maydis cells (107) were made into protoplasts with a recovery of 106 cells in a 50 μl transformation buffer solution following methods well known in the art and transfected with different amounts of the chimeric vectors or homogeneous (DNA alone) vector were mixed with the protoplasts at 37° C. The cells were then plated on selective media and the number of surviving colonies (transformants) were counted. The results are presented in tabular form below:

______________________________________Transfection             Number ofAmount         Vector - 358                    Surviving(μg)        Type      Colonies______________________________________0.1            DNA       00.1            chimeric  130.25           DNA       10.25           chimeric  490.75           DNA       120.75           chimeric  1311.0            DNA       191.0            chimeric  573______________________________________

These data show that transfection of cells with the RNA 358 Vector increases the survival of the cells at a much greater rate than transfection with the corresponding DNA vector.

Example 2: The Transformation of NIH 3T3 Cells.

NIH 3T3 cells are human cells that have a benign (controlled) growth characteristics. Malignant (uncontrolled) growth characteristics are conferred by the single point mutation in the oncogene H-ras that replaces Gly12 by Thr. Thus, the mutation G→T12 leads to a readily selectable alteration in the growth characteristics. Taparowsky, E., et al., 1982, Nature 300:762; Sukumar S., et al., 1983, Nature 306:658.

Chimeric vectors were constructed to direct the G→T12 mutation having the following sequence:


The sequence is presented in the conventional single letter code with the additional features the RNA (underlined), unpaired bases are italicized, and the mutator base is bold. Note that after circularization the chimeric vector is divided into two substantially complementary strands by the two trithymidinyl sequences and that all the ribose containing nucleotides are present in only one of the two strands.

Two forms of the chimeric vector were synthesized using respectively one ("R") and two ("R-D-R") regions of hybrid duplex flanking four deoxyribose residues. The R-D-R form is shown above, SEQ ID: 3, the R form is identical except that bases 6-9 ("CGAC") were deoxynucleotides. Note that the 5' and 3' termini are deoxynucleotides. The allows the chimeric vectors to be circularized after synthesis by use of the same DNA ligase procedures as are commonly employed in recombinant DNA. After ligation, the circularization chimeric vectors were isolated from the substrate by two iterations of preparative electrophoresis in D600 gel (AT Biochem, Malvern, PA).

Control vectors were: 1) the same sequence lacking hybrid-duplex (data shown, "homo-duplex"); 2) the unpaired DNA (data shown "sDNA") having the sequence 5'- GCCCACACCGACGGCGCCACCAC-3' (SEQ ID 4); 3) the chimeric vector having no heterologous region and hence no mutator nucleotide (data not shown).

The experiment was conducted by transforming NIH 3T3 cells (1×106 cells) using an electroporation procedure. After electroporation, the cells were plated at a seeding density of 4×103 cells/cm2 and allowed to grow for 14 days in culture. Transformants were visualized by staining foci-forming cells with crystal violet. As a positive control, the plasmid pT24 that encodes the T12 form of H ras was employed. This control was used to determine the level of illegitimate recombination in the transfected NIH 3T3 cells. The experiment was repeated five times and a summary of the results are presented in tabular form below. In addition to the results presented below the control experiments that used a chimeric vector having no mutator codon showed no transformed foci of NIH 3T3 cells.

______________________________________                     Transformants         Amt Transfected                     per 106 cellsVector Type   (per 106 cells)                     (14 days)______________________________________pT24 (positive         10       μg  57control)sDNA          1        μg  2sDNA          10       μg  13homo-duplex   1        μg  0homo-duplex   10       μg  2chimeric      50       ng     R-D-R    R                         19       12chimeric      200      ng     55       43chimeric      1        μg  139      103______________________________________

These results show that the chimeric vectors introduced a specific mutation by homologous recombination so as to transform mammalian cells. The rate of transformation in this experiment was greater than the rate of transformation by illegitimate recombination that was observed by transfection with pT24 positive control vector, which contained an entire mutated H-ras gene. Thus, by use of chimeric vectors a rate of homologous recombination in a mammalian cell was achieved that was greater than the rate of illegitimate recombination.

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4503151 *Nov 22, 1982Mar 5, 1985Research CorporationRecombinant cDNA construction method and hybrid nucleotides useful in cloning
US4873191 *Aug 18, 1986Oct 10, 1989Ohio UniversityGenetic transformation of zygotes
US4882279 *Oct 25, 1985Nov 21, 1989Phillips Petroleum CompanySite selective genomic modification of yeast of the genus pichia
US4950599 *Jan 29, 1987Aug 21, 1990Wolf BertlingMethod for exchanging homologous DNA sequences in a cell using polyoma encapsulated DNA fragments
US5013830 *Feb 12, 1990May 7, 1991Ajinomoto Co., Inc.Compounds for the cleavage at a specific position of RNA, oligomers employed for the formation of said compounds, and starting materials for the synthesis of said oligomers
US5589369 *May 31, 1994Dec 31, 1996Cell Genesys Inc.Cells homozygous for disrupted target loci
WO1993022443A1 *Apr 23, 1993Nov 11, 1993Sri InternationalIn vivo homologous sequence targeting in eukaryotic cells
WO1994004032A1 *Aug 20, 1993Mar 3, 1994The Regents Of The University Of CaliforniaComposition and method for altering dna sequences by homologous recombination
WO1994023028A2 *Mar 30, 1994Oct 13, 1994Hybridon, Inc.Modified oligonucleotides having improved anti-influenza activity
Non-Patent Citations
1Ban et al., "A Single 2'-Hydroxyl Group Converts B-DNA to A-DNA", J Mol Biol 236:275-285 (1994).
2 *Ban et al., A Single 2 Hydroxyl Group Converts B DNA to A DNA , J Mol Biol 236:275 285 (1994).
3Brinster et al., "Targeted Correction of a Major Histocompatibility Class II Ea Gene by DNA Microinjected into Mouse Eggs", PNAS USA 86:7087 (1989).
4 *Brinster et al., Targeted Correction of a Major Histocompatibility Class II E a Gene by DNA Microinjected into Mouse Eggs , PNAS USA 86:7087 (1989).
5Capecchi, "Altering the Genome by Homologous Recombination", Science 244:1288 (1989).
6 *Capecchi, Altering the Genome by Homologous Recombination , Science 244:1288 (1989).
7Caruthers, "Gene Synthesis Machines: DNA Chemistry and Its Uses", Science 230:281-285 (1985).
8 *Caruthers, Gene Synthesis Machines: DNA Chemistry and Its Uses , Science 230:281 285 (1985).
9Chou, "High-Resolution NMR Studies of Chimeric DNA-RNA-DNA Duplexes, Heteronomous Base Pairing, and Continuous Base Stacking at Junctions", Biochemistry 30:5248-5257 (1991).
10 *Chou, High Resolution NMR Studies of Chimeric DNA RNA DNA Duplexes, Heteronomous Base Pairing, and Continuous Base Stacking at Junctions , Biochemistry 30:5248 5257 (1991).
11Egli et al., "Conformational Influence of the Ribose 2'-Hydroxyl Group: Crystal Structures of DNA-RNA Chimeric Duplexes", Biochemistry 32:3221-3227 (1993).
12 *Egli et al., Conformational Influence of the Ribose 2 Hydroxyl Group: Crystal Structures of DNA RNA Chimeric Duplexes , Biochemistry 32:3221 3227 (1993).
13Hendry et al., "A Ribozyme with DNA in the Hybridising Arms Displays Enhanced Cleavage Ability", Nuc Acids Res 20:5737-5741 (1992).
14 *Hendry et al., A Ribozyme with DNA in the Hybridising Arms Displays Enhanced Cleavage Ability , Nuc Acids Res 20:5737 5741 (1992).
15 *Hug et al. Liposomes for the transformation of eukaryotic cells. Biochimica et aBiophysica Acts vol. 1097, pp. 1 17, 1991.
16Hug et al. Liposomes for the transformation of eukaryotic cells. Biochimica et aBiophysica Acts vol. 1097, pp. 1-17, 1991.
17Lesnik et al., "Oligodeoxynucleotides Containing 2'-O-Modified Adenosine: Synthesis and Effect on Stability of DNA:RNA Duplexes", Biochemistry 32:7832-7838 (1993).
18 *Lesnik et al., Oligodeoxynucleotides Containing 2 O Modified Adenosine: Synthesis and Effect on Stability of DNA:RNA Duplexes , Biochemistry 32:7832 7838 (1993).
19Moerschell et al., "Transformation of Yeast with Synthetic Oligonucleotides", PNAS USA 85:524-528 (1988).
20 *Moerschell et al., Transformation of Yeast with Synthetic Oligonucleotides , PNAS USA 85:524 528 (1988).
21Monia et al., "Evaluation of 2'-Modified Oligonucleotides Containing 2'-Deoxy Gaps as Antisense Inhibitors of Gene Expression", J Biol Chem 268:19, 14514-14522 (1993).
22Monia et al., "Selective Inhibition of Mutant Ha-ras mRNA Expression by Antisense Oligonucleotides", J. Biol Chem 267:28, 19954-19962 (1992).
23 *Monia et al., Evaluation of 2 Modified Oligonucleotides Containing 2 Deoxy Gaps as Antisense Inhibitors of Gene Expression , J Biol Chem 268:19, 14514 14522 (1993).
24 *Monia et al., Selective Inhibition of Mutant Ha ras mRNA Expression by Antisense Oligonucleotides , J. Biol Chem 267:28, 19954 19962 (1992).
25Perreault et al., "Mixed Deoxyribooligonucleotides with Catalytic Activity", Nature 344:565 (1990).
26 *Perreault et al., Mixed Deoxyribooligonucleotides with Catalytic Activity , Nature 344:565 (1990).
27 *Potter et al. Enhancer dependent expression of human kappa immunoglobulin genes intorduced into mouse pre B lymphocytes by electroporation. Proc. Natl. Acad. Sci. USA vol. 81, pp. 7161 7165, 1984.
28Potter et al. Enhancer-dependent expression of human kappa immunoglobulin genes intorduced into mouse pre-B lymphocytes by electroporation. Proc. Natl. Acad. Sci. USA vol. 81, pp. 7161-7165, 1984.
29Roberts, R.W., & Crothers, D.M., "Stability and Properties of Double and Triple Helices: Dramatic Effects of RNA or DNA Backbone Composition", Science 258:5087,1463-1466 (1992).
30 *Roberts, R.W., & Crothers, D.M., Stability and Properties of Double and Triple Helices: Dramatic Effects of RNA or DNA Backbone Composition , Science 258:5087,1463 1466 (1992).
31Salazar et al., "The Solution Structure of the r(gcg)d(TATACCC):d(GGGTATACGC) Ozaki Fragment Contains Two Distinct Duplex Morphologies Connected by a Junction", J Mol Biol 241:440-455 (1994).
32 *Salazar et al., The Solution Structure of the r(gcg)d(TATACCC):d(GGGTATACGC) Ozaki Fragment Contains Two Distinct Duplex Morphologies Connected by a Junction , J Mol Biol 241:440 455 (1994).
33Sawata et al., "Enhancement of the Cleavage Rates of DNA-Armed Hammerhead Ribozymes by Various Divalent Metal Ions", Nuc Acids Res 21:5656-5660 (1993).
34 *Sawata et al., Enhancement of the Cleavage Rates of DNA Armed Hammerhead Ribozymes by Various Divalent Metal Ions , Nuc Acids Res 21:5656 5660 (1993).
35Scaringe et al., "Chemical Synthesis of Biologically Active Oligonucleotides Using β-Cyanoethyl Protected Ribonucleoside Phosphoraidites", Nuc Acids Res 18:5433-5441 (1990).
36 *Scaringe et al., Chemical Synthesis of Biologically Active Oligonucleotides Using Cyanoethyl Protected Ribonucleoside Phosphoraidites , Nuc Acids Res 18:5433 5441 (1990).
37Shimayama, "Nuclease-Resistant Chimeric Ribozomes Containing Deoxyribonucleotides and Phosphorothioate Linkages", Nuc Acids Res 20:4559-4565 (1992).
38 *Shimayama, Nuclease Resistant Chimeric Ribozomes Containing Deoxyribonucleotides and Phosphorothioate Linkages , Nuc Acids Res 20:4559 4565 (1992).
39Shimizu et al., "Effects of 5-Methyl Substitution in 2'-O-Methyloligo-(Pyrimidine)Nucleotides on Triple-Helix Formation", Bio & Med Chem Ltrs 4:8, 1029-1032 (1994).
40Shimizu et al., "Oligo(2'-O-methyl)ribonucleotides--Effective probes for duplex DNA", FEBS Letters 302:2, 155-158 (1992).
41 *Shimizu et al., Effects of 5 Methyl Substitution in 2 O Methyloligo (Pyrimidine)Nucleotides on Triple Helix Formation , Bio & Med Chem Ltrs 4:8, 1029 1032 (1994).
42 *Shimizu et al., Oligo(2 O methyl)ribonucleotides Effective probes for duplex DNA , FEBS Letters 302:2, 155 158 (1992).
43Sukamar et al., "Induction of Mammary Carcinomas in Rats by Nitroso-Methylurea Involves Malignant Activation of H-ras-1 Locus by Single Point Mutations", Nature 306:658 (1983).
44 *Sukamar et al., Induction of Mammary Carcinomas in Rats by Nitroso Methylurea Involves Malignant Activation of H ras 1 Locus by Single Point Mutations , Nature 306:658 (1983).
45Swiderski et al., "Polystyrene Reverse-Phase Ion-Pair Chromatography of Chimeric Ribozomes", Annal Biochem 216:83-88 (1994).
46 *Swiderski et al., Polystyrene Reverse Phase Ion Pair Chromatography of Chimeric Ribozomes , Annal Biochem 216:83 88 (1994).
47Taparowski et al., "Activation of the T24 Bladder Carcinoma Transforming Gene is Linked to a Single Amino Acid Change", Nature 300:762 (1982).
48 *Taparowski et al., Activation of the T24 Bladder Carcinoma Transforming Gene is Linked to a Single Amino Acid Change , Nature 300:762 (1982).
49Taylor et al., "Chimeric DNA-RNA Hammerhead Ribozymes Have Enhanced in vitro Catalytic Efficiency and Increased Stability in vivo", Nuc Acids Res 20:4559-4565 (1992).
50 *Taylor et al., Chimeric DNA RNA Hammerhead Ribozymes Have Enhanced in vitro Catalytic Efficiency and Increased Stability in vivo , Nuc Acids Res 20:4559 4565 (1992).
51Thomas and Capecchi, "Site-Directed Mutagenesis by Gene Targeting in Mouse Embryo-Derived Stem Cells", Cell 52:503 (1987).
52 *Thomas and Capecchi, Site Directed Mutagenesis by Gene Targeting in Mouse Embryo Derived Stem Cells , Cell 52:503 (1987).
53Usman and Cedergen, "Exploiting the Chemical Synthesis of RNA", Trends Bioch Sci 17:334-339 (1992).
54 *Usman and Cedergen, Exploiting the Chemical Synthesis of RNA , Trends Bioch Sci 17:334 339 (1992).
55Usman et al., "Large Scale Chemical Synthesis, Purification and Cystallization of RNA-DNA Chimeras", Nuc Acids Res 20:6695-6699 (1992).
56 *Usman et al., Large Scale Chemical Synthesis, Purification and Cystallization of RNA DNA Chimeras , Nuc Acids Res 20:6695 6699 (1992).
57Valencius and Smithies, "Double-Strand Gap Repair in a Mammalian Gene Targeting Reaction", Mol Cell Biol 11:4389 (1991).
58 *Valencius and Smithies, Double Strand Gap Repair in a Mammalian Gene Targeting Reaction , Mol Cell Biol 11:4389 (1991).
59Wahls et al., "The Z-DNA Motif d(TG)30 Promotes Reception of Information during Gene Conversion Events while Stimulating Homologous Recombination in Human Cells in Culture", Mol Cell Biol 10:785-793 (1990).
60 *Wahls et al., The Z DNA Motif d(TG) 30 Promotes Reception of Information during Gene Conversion Events while Stimulating Homologous Recombination in Human Cells in Culture , Mol Cell Biol 10:785 793 (1990).
61Yamamoto et al., "Parameters Affecting the Frequencies of Transformation and Co-Transformation with Synthetic Oligonucleotides in Yeast", Yeast 8:935-948 (1992).
62 *Yamamoto et al., Parameters Affecting the Frequencies of Transformation and Co Transformation with Synthetic Oligonucleotides in Yeast , Yeast 8:935 948 (1992).
63Yang et al., "Mixed DNA/RNA Polymers Are Cleaved by the Hammerhead Ribozyme", Biochemistry 29:11156-11160 (1990).
64 *Yang et al., Mixed DNA/RNA Polymers Are Cleaved by the Hammerhead Ribozyme , Biochemistry 29:11156 11160 (1990).
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6479292Aug 25, 2000Nov 12, 2002Valigen (Us), Inc.Genetic alteration in plants using single-stranded oligodeoxynucleotide vectors
US6656700Apr 6, 2001Dec 2, 2003Amersham PlcIsoforms of human pregnancy-associated protein-E
US6686188May 25, 2001Feb 3, 2004Amersham PlcPolynucleotide encoding a human myosin-like polypeptide expressed predominantly in heart and muscle
US6870075Oct 10, 2000Mar 22, 2005Valigen (Us), Inc.Methods of making non-transgenic herbicide resistant plants
US7060500Nov 12, 2002Jun 13, 2006Metz Richard ASingle-stranded oligodeoxynucleotide mutational vectors
US7074983Nov 16, 2001Jul 11, 2006Kirin Beer Kabushiki KaishaTransgenic bovine comprising human immunoglobulin loci and producing human immunoglobulin
US7102055Dec 6, 1999Sep 5, 2006Pioneer Hi-Bred International, Inc.Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US7229767Sep 26, 2003Jun 12, 2007University Of DelawareGenomics applications for modified OLIGO nucleotides
US7253334Dec 21, 2001Aug 7, 2007Aurox, LlcMethods for cloning non-human mammals using reprogrammed donor chromatin or donor cells
US7361508May 16, 2003Apr 22, 2008Pioneer Hi-Bred International, Inc.Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US7405079May 7, 2003Jul 29, 2008Pioneer Hi-Bred International, Inc.Compositions and methods to reduce the complexity of transgene integration into the genome of a plant
US7414170May 19, 2003Aug 19, 2008Kirin Beer Kabushiki KaishaTransgenic bovines capable of human antibody production
US7420099Apr 21, 2005Sep 2, 2008Kirin Holdings Kabushiki KaishaTransgenic animals and uses thereof
US7429690Nov 10, 2003Sep 30, 2008Kirin Holdings Kabushiki KaishaTransgenic bovines having reduced prion protein production
US7462766May 4, 2006Dec 9, 2008Pioneer Hi-Bred International, Inc.Compositions comprising non-identical recombination sites
US7468244Sep 27, 2002Dec 23, 2008University Of DelawarePolymorphism detection and separation
US7491534Apr 30, 2003Feb 17, 2009Kirin Holdings Kabushiki KaishaMethods for altering cell fate to generate T-cells specific for an antigen of interest
US7491867Dec 1, 2005Feb 17, 2009Kyowa Hakko Kirin Co., Ltd.Expression of xenogenous (human) immunoglobulins in cloned, transgenic ungulates
US7566535Mar 7, 2003Jul 28, 2009University Of DelawareEnhanced oligonucleotide-mediated nucleic acid sequence alteration
US7572634May 7, 2003Aug 11, 2009Pioneer Hi-Bred International, Inc.Compositions and methods for locating preferred integration sites within the genome of a plant
US7736895Aug 2, 2004Jun 15, 2010Kyowa Hakko Kirin Co., Ltd.Methods for altering cell fate
US7772459Feb 20, 2003Aug 10, 2010Bellweather FarmsTransgenic production in saliva
US7803981Jun 20, 2007Sep 28, 2010Kyowa Hakko Kirin Co., Ltd.Transgenic ungulates capable of human antibody production
US7807863Sep 5, 2008Oct 5, 2010Kyowa Hakko Kirin Co., Ltd.Transgenic bovine having reduced prion protein activity and uses thereof
US7820878May 5, 2008Oct 26, 2010Kyowa Hakko Kirin Co., Ltd.Production of ungulates, preferably bovines that produce human immunoglobulins
US7820880Nov 6, 2008Oct 26, 2010Pioneer Hi-Bred Int'l. Inc.Compositions and methods to stack multiple nucleotide sequences of interest in the genome of a plant
US7928285Jun 25, 2008Apr 19, 2011Kyowa Hakko Kirin Co., Ltd.Method of producing xenogenous antibodies using a bovine
US8029579Jun 27, 2007Oct 4, 2011COH Inc.Fatty acid blends and uses therefor
US8143504Oct 22, 2010Mar 27, 2012Pioneer Hi-Bred International, Inc.Compositions and methods for genetic modification of plants
US8268622Jan 10, 2007Sep 18, 2012Cibus Us LlcEPSPS mutants
US8329980Jul 12, 2010Dec 11, 2012Erickson Jeffrey PTransgenic production in bovine saliva
US8361173Sep 7, 2011Jan 29, 2013Nucelis Inc.Fatty acid blends and uses therefor
US8470568Nov 22, 2010Jun 25, 2013Nucelis Inc.Methods and compositions for producing squalene using yeast
US8536420Aug 1, 2008Sep 17, 2013Pioneer Hi-Bred International, Inc.Compositions and methods for genetic modification of plants
US8735158Feb 28, 2008May 27, 2014Pioneer Hi-Bred International, Inc.Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US9222098Aug 12, 2003Dec 29, 2015Christopher L. BaszczynskiCompositions for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US20030084473 *Aug 9, 2002May 1, 2003ValigenNon-transgenic herbicide resistant plants
US20030207327 *Sep 27, 2002Nov 6, 2003Kmiec Eric B.Coisogenic eukaryotic cell collections
US20030207451 *Mar 7, 2003Nov 6, 2003Kmiec Eric B.Methods, compositions, and kits for enhancing oligonucleotide-mediated nucleic acid sequence alteration using compositions comprising a histone deacetylase inhibitor, lambda phage beta protein, or hydroxyurea
US20030226160 *May 7, 2003Dec 4, 2003Pioneer Hi-Bred International, Inc.Compositions and methods for locating preferred integration sites within the genome of a plant
US20040003435 *May 16, 2003Jan 1, 2004Pioneer Hi-Bred International, Inc.Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US20040023392 *Nov 12, 2002Feb 5, 2004Valigen (Us), Inc.Single-stranded oligodeoxynucleotide mutational vectors
US20040063134 *Sep 30, 2003Apr 1, 2004Yizhong GuNovel isoforms of human pregnancy-associated protein-E
US20040063922 *Jul 21, 2003Apr 1, 2004Conrad Charles A.Methods and compositions for catalytic DNA exchange in a sequence specific manner
US20040068380 *Sep 15, 2003Apr 8, 2004Shannon Mark E.Human gtp-rho binding protein 2
US20040068760 *May 19, 2003Apr 8, 2004Robl James M.Transgenic ungulates capable of human antibody production
US20040072288 *Apr 30, 2003Apr 15, 2004Philippe CollasMethods for altering cell fate to generate T-cells specific for an antigen of interest
US20040083500 *Aug 12, 2003Apr 29, 2004Pioneer Hi-Bred International, Inc.Compositions and methods to stack multiple nucleotide sequences of interest in the genome of a plant
US20040110708 *Jul 7, 2003Jun 10, 2004Gamper Howard B.Binary hybrid mutational vectors
US20040137589 *Nov 26, 2003Jul 15, 2004Yizhong GuHuman myosin-like polypeptide expressed predominantly in heart and muscle
US20040175722 *Oct 7, 2003Sep 9, 2004Kmiec Eric B.Methods and compositions for reducing screening in oligonucleotide-directed nucleic acid sequence alteration
US20050014258 *Aug 2, 2004Jan 20, 2005Philippe CollasMethods for altering cell fate
US20050097627 *Nov 10, 2003May 5, 2005Robl James M.Transgenic ungulates having reduced prion protein activity and uses thereof
US20050100921 *Sep 26, 2003May 12, 2005Kmiec Eric B.Genomics applications for modified OLIGO nucleotides
US20050177899 *Feb 4, 2005Aug 11, 2005Beetham Peter R.Non-transgenic herbicide resistant plants
US20050183145 *Dec 14, 2004Aug 18, 2005Goldsby Richard A.Production of ungulates, preferably bovines that produce human immunoglobulins
US20060041945 *Apr 21, 2005Feb 23, 2006Hematech, LlcTransgenic animals and uses thereof
US20060117394 *Dec 1, 2005Jun 1, 2006Hematech, LlcExpression of xenogenous (human) imunoglobulins in cloned, transgenic ungulates
US20060117395 *Dec 1, 2005Jun 1, 2006Hematech, LlcExpression of xenogenous (human) immunoglobulins in cloned, transgenic ungulates
US20060195937 *May 4, 2006Aug 31, 2006Pioneer Hi-Bred International, Inc.Compositions and methods for genetic modification of plants
US20060212952 *May 24, 2006Sep 21, 2006Philippe CollasMethods for cloning mammals using reprogrammed donor chromatin or donor cells
US20070011752 *May 1, 2006Jan 11, 2007American Integrated Biologics, Inc.Production of human proteins in transgenic animal saliva
US20070072815 *May 3, 2005Mar 29, 2007Kmiec Eric BMethods and kits to increase the efficiency of oligonucleotide-directed nucleic acid sequence alteration
US20080040821 *Jun 20, 2007Feb 14, 2008Robl James MTransgenic ungulates capable of human antibody production
US20080209595 *Feb 28, 2008Aug 28, 2008Pioneer Hi-Bred International, Inc.Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US20080256668 *Nov 16, 2007Oct 16, 2008Beetham Peter RNon-Transgenic Herbicide Resistant Plants
US20080320617 *Aug 1, 2008Dec 25, 2008Pioneer Hi-Bred International, Inc.Compositions and methods for genetic modification of plants
US20090093059 *Nov 6, 2008Apr 9, 2009Pioneer Hi-Bred International, Inc.Compositions and methods to stack multiple nucleotide sequences of interest in the genome of a plant
US20090165154 *Sep 5, 2008Jun 25, 2009Robl James MTransgenic ungulates having reduced prion protein activity and uses thereof
US20090205064 *Oct 3, 2008Aug 13, 2009Christian SchopkeMutated Acetohydroxyacid Synthase Genes in Brassica
US20090276866 *May 5, 2008Nov 5, 2009Goldsby Richard AProduction of ungulates, preferably bovines that produce human immunoglobulins
US20090298150 *May 22, 2009Dec 3, 2009Walker Keith AProduction of squalene using yeast
US20090307802 *Jan 10, 2007Dec 10, 2009Gocal Greg F WEPSPS Mutants
US20100058651 *Jun 27, 2007Mar 11, 2010Cibus LlcFatty acid blends and uses therefor
US20100281549 *Jul 12, 2010Nov 4, 2010Erickson Jeffrey PTransgenic Production In Saliva
US20110023352 *Dec 27, 2007Feb 3, 2011Knuth Mark EAlkylester fatty acid blends and uses therefor
US20110124072 *Nov 22, 2010May 26, 2011Cibus Oils, LlcMethods and compositions for producing squalene using yeast
DE112009003708T5Dec 8, 2009Sep 13, 2012Basf Plant Science GmbhDesaturasen und Verfahren zur Herstellung mehrfach ungesättigter Fettsäuren in transgenenOrganismen
EP2003205A2Dec 28, 2004Dec 17, 2008Pioneer Hi-Bred International, Inc.Improved grain quality through altered expression of seed proteins
EP2039769A2Sep 13, 2001Mar 25, 2009Pioneer Hi-Bred International, Inc.Antimicrobial peptides and methods of use
EP2112223A2Nov 7, 2006Oct 28, 2009Pioneer Hi-Bred International Inc.DOF (DNA binding with one finger) sequences and method of use
EP2135504A1Oct 10, 2000Dec 23, 2009Valigen (US), Inc.Non-transgenic herbicide resistant plants
EP2177605A1Oct 4, 2007Apr 21, 2010BASF Plant Science GmbHMethod for producing polyunsaturated fatty acids in transgenic non-human organisms
EP2182056A1Oct 4, 2007May 5, 2010BASF Plant Science GmbHMethod for producing polyunsaturated fatty acids in transgenic non-human organisms
EP2251349A1Apr 18, 2007Nov 17, 2010Pioneer Hi-Bred International, Inc.Isolated polynucleotide molecules corresponding to mutant and wild-type alleles of the maize D9 gene and methods of use
EP2261361A2May 15, 2006Dec 15, 2010Pioneer Hi-Bred International Inc.Methods for improving crop plant architecture and yield
EP2261362A2May 15, 2006Dec 15, 2010Pioneer Hi-Bred International Inc.Methods for improving crop plant architecture and yield
EP2294914A2Oct 10, 2000Mar 16, 2011Valigen (US), Inc.Non-transgenic herbicide resistant plants
EP2338905A2Feb 23, 2005Jun 29, 2011North Carolina State UniversityAlteration of tobacco alkaloid content through modification of specific cytochrome p450 genes
EP2426204A1Sep 2, 2010Mar 7, 2012Ludwig-Maximilians-Universität MünchenSpontaneous nodule organogenesis in plants
EP2465340A1Jan 10, 2007Jun 20, 2012Cibus Europe B.V.EPSPS mutants
EP2465341A1Jan 10, 2007Jun 20, 2012Cibus Europe B.V.EPSPS Mutants
EP2561749A1Apr 3, 2008Feb 27, 2013BASF Plant Science GmbHAHAS mutants
EP2561750A1Apr 3, 2008Feb 27, 2013BASF Plant Science GmbHAHAS mutants
EP2570024A1Apr 3, 2008Mar 20, 2013BASF Plant Science GmbHAHAS mutants
EP2573177A1Nov 12, 2008Mar 27, 2013North Carolina State UniversityAlteration of tobacco alkaloid content through modification of specific cytochrome P450 genes
EP2574233A1Apr 3, 2008Apr 3, 2013BASF Plant Science GmbHAHAS mutants
EP2666781A1May 4, 2010Nov 27, 2013Pioneer Hi-Bred International, Inc.Yield enhancement in plants by modulation of AP2 transcription factor
EP2669380A1Dec 8, 2009Dec 4, 2013BASF Plant Science GmbHDesaturases and process for the production of polyunsaturated fatty acids in transgenic organisms
EP2679687A2Jun 27, 2007Jan 1, 2014Nucelis Inc.Fatty acid blends and uses therefor
EP2730587A2Jan 30, 2007May 14, 2014Pioneer Hi-Bred International, Inc.Genes for enhancing nitrogen utilization efficiency in crop plants
EP2733212A1Sep 24, 2009May 21, 2014BASF Agrochemical Products, B.V.Herbicide-resistant AHAS-mutants and methods of use
EP2821490A2Oct 28, 2009Jan 7, 2015Pioneer Hi-Bred International Inc.Manipulation of glutamine synthetases (GS) to improve nitrogen use efficiency and grain yield in higher plants
EP2923563A2Jan 10, 2007Sep 30, 2015Cibus Europe B.V.EPSPS mutants
WO2001024615A1 *Oct 10, 2000Apr 12, 2001Valigen (Us), Inc.Non-transgenic herbicide resistant plants
WO2001094610A2 *Jun 5, 2001Dec 13, 2001Thomas Jefferson UniversityBinary hybrid mutational vectors
WO2001094610A3 *Jun 5, 2001Apr 4, 2002Richard J BartlettBinary hybrid mutational vectors
WO2007059077A2Nov 14, 2006May 24, 2007E.I.Du Pont De Nemours And CompanyCompositions and methods for altering alpha- and beta-tocotrienol content
WO2007079161A2Dec 28, 2006Jul 12, 2007Pioneer Hi-Bred International, Inc.Udp-xylose synthases (uxs) polynucleotides, polypeptides, and uses thereof
WO2008145629A2May 26, 2008Dec 4, 2008Cropdesign N.V.Yield enhancement in plants by modulation of maize alfins
WO2009046334A1Oct 3, 2008Apr 9, 2009Cibus LlcMutated acetohydroxyacid synthase genes in brassica
WO2009067580A2Nov 20, 2008May 28, 2009Pioneer Hi-Bred International, Inc.Maize ethylene signaling genes and modulation of same for improved stress tolerance in plants
WO2010065867A1Dec 4, 2009Jun 10, 2010Pioneer Hi-Bred International, Inc.Methods and compositions for enhanced yield by targeted expression of knotted1
WO2010083328A2Jan 14, 2010Jul 22, 2010The Salk Institute For Biological StudiesMethods for screening and compounds that protect against amyloid diseases
WO2010101818A1Mar 1, 2010Sep 10, 2010Pioneer Hi-Bred International, Inc.Nac transcriptional activators involved in abiotic stress tolerance
WO2010120862A1Apr 14, 2010Oct 21, 2010Pioneer Hi-Bred International, Inc.Modulation of acc synthase improves plant yield under low nitrogen conditions
WO2011011273A1Jul 16, 2010Jan 27, 2011Pioneer Hi-Bred International, Inc.The use of dimerization domain component stacks to modulate plant architecture
WO2011017492A2Aug 5, 2010Feb 10, 2011Pioneer Hi-Bred International, Inc.Novel eto1 genes and use of same for reduced ethylene and improved stress tolerance in plants
WO2011041796A1Oct 4, 2010Apr 7, 2011Pioneer Hi-Bred International, Inc.Down-regulation of acc synthase for improved plant performance
WO2011063350A2Nov 22, 2010May 26, 2011Cibus Oils, LlcMethods and compositions for producing squalene using yeast
WO2011082304A1Dec 30, 2010Jul 7, 2011Pioneer Hi-Bred International, Inc.Engineering plant resistance to diseases caused by pathogens
WO2011085062A1Jan 6, 2011Jul 14, 2011Pioneer Hi-Bred International, Inc.Identification of diurnal rhythms in photosynthetic and non-photosynthetic tissues from zea mays and use in improving crop plants
WO2011094199A1Jan 25, 2011Aug 4, 2011Pioneer Hi-Bred International, Inc.Polynucleotide and polypeptide sequences associated with herbicide tolerance
WO2011094205A1Jan 25, 2011Aug 4, 2011Pioneer Hi-Bred International, Inc.Hppd-inhibitor herbicide tolerance
WO2011139431A1Mar 30, 2011Nov 10, 2011Pioneer Hi-Bred International, Inc.Maize acc synthase 3 gene and protein and uses thereof
WO2012021785A1Aug 12, 2011Feb 16, 2012Pioneer Hi-Bred International, Inc.Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
WO2012028673A1Sep 1, 2011Mar 8, 2012Ludwig-Maximilians-Universitaet MuenchenSpontaneous organogenesis in plants
WO2012148835A1Apr 23, 2012Nov 1, 2012Pioneer Hi-Bred International, Inc.Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance
WO2012174139A2Jun 13, 2012Dec 20, 2012Synthon Biopharmaceuticals B.V.Compositions and methods for making and b ioc ont aining auxotrophic transgenic plants
WO2013009935A2Jul 12, 2012Jan 17, 2013Two Blades FoundationLate blight resistance genes
WO2013066805A1Oct 29, 2012May 10, 2013Pioneer Hi-Bred International, Inc.Improving plant drought tolerance, nitrogen use efficiency and yield
WO2013138309A1Mar 12, 2013Sep 19, 2013Pioneer Hi-Bred International, Inc.Genetic reduction of male fertility in plants
WO2013138358A1Mar 12, 2013Sep 19, 2013Pioneer Hi-Bred International, Inc.Genetic reduction of male fertility in plants
WO2013177400A1May 23, 2013Nov 28, 2013Iowa State University Research Foundation, Inc.Arabidopsis nonhost resistance gene(s) and use thereof to engineer disease resistant plants
WO2014027021A1Aug 14, 2013Feb 20, 2014Vib VzwMeans and methods for altering the lignin pathway in plants
WO2014100525A2Dec 20, 2013Jun 26, 2014Pioneer Hi-Bred International, Inc.Compositions and methods for auxin-analog conjugation
WO2014143996A2Mar 14, 2014Sep 18, 2014Pioneer Hi-Bred International, Inc.Compositions and methods of use of acc oxidase polynucleotides and polypeptides
WO2014147249A1Mar 21, 2014Sep 25, 2014Vib VzwMeans and methods for the reduction of photorespiration in crops
WO2014152507A2Mar 14, 2014Sep 25, 2014Pioneer Hi-Bred International, Inc.Modulation of acc deaminase expression
WO2014160122A1Mar 13, 2014Oct 2, 2014Pioneer Hi-Bred International, Inc.Maize stress related transcription factor 18 and uses thereof
WO2014164014A1Mar 3, 2014Oct 9, 2014Pioneer Hi-Bred International, Inc.Genes for improving nutrient uptake and abiotic stress tolerance in plants
WO2014164074A1Mar 4, 2014Oct 9, 2014Pioneer Hi-Bred International, Inc.Enhanced nitrate uptake and nitrate translocation by over-expressing maize functional low-affinity nitrate transporters in transgenic maize
WO2014164116A1Mar 5, 2014Oct 9, 2014Pioneer Hi-Bred International, Inc.Functional expression of bacterial major facilitator superfamily (sfm) gene in maize to improve agronomic traits and grain yield
WO2014164961A2Mar 12, 2014Oct 9, 2014Pioneer Hi-Bred International, Inc.Manipulation of dominant male sterility
WO2015006105A1Jul 1, 2014Jan 15, 2015Board Of Trustees Of Michigan State UniversityTransgenic plants produced with a k-domain, and methods and expression cassettes related thereto
WO2015116680A1Jan 28, 2015Aug 6, 2015Two Blades FoundationPlants with enhanced resistance to phytophthora
WO2015171603A1May 5, 2015Nov 12, 2015Two Blades FoundationMethods for producing plants with enhanced resistance to oomycete pathogens
WO2016005449A1Jul 8, 2015Jan 14, 2016Vib VzwMeans and methods to increase plant yield
WO2016100309A1Dec 15, 2015Jun 23, 2016Pioneer Hi-Bred International, Inc.Restoration of male fertility in wheat
WO2016182881A1May 6, 2016Nov 17, 2016Two Blades FoundationLate blight resistance gene from solanum americanum and methods of use
WO2017062790A1Oct 7, 2016Apr 13, 2017Two Blades FoundationCold shock protein receptors and methods of use
U.S. Classification435/463, 536/23.1, 536/25.3, 435/320.1
International ClassificationC12N1/19, C12N1/21, C12N15/80, C07H21/02, C07H21/00, C12N5/10, C07H21/04, C12N15/09, C12N15/90, C07K14/82, A01K67/027
Cooperative ClassificationC12N15/80, C12N15/907, A01K2217/05, C07H21/00, C07K14/82, A01K67/0275
European ClassificationC07H21/00, C12N15/80, C07K14/82, C12N15/90B4, A01K67/027M
Legal Events
Jul 13, 2001FPAYFee payment
Year of fee payment: 4
Nov 21, 2005FPAYFee payment
Year of fee payment: 8
Dec 28, 2009REMIMaintenance fee reminder mailed
May 26, 2010LAPSLapse for failure to pay maintenance fees
Jul 13, 2010FPExpired due to failure to pay maintenance fee
Effective date: 20100526