Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS5843721 A
Publication typeGrant
Application numberUS 08/887,518
Publication dateDec 1, 1998
Filing dateJul 3, 1997
Priority dateJul 3, 1997
Fee statusLapsed
Also published asCA2295999A1, CA2295999C, DE69840387D1, EP1012174A1, EP1012174A4, EP1012174B1, US5844073, US5854003, WO1999001471A1, WO1999001471A9
Publication number08887518, 887518, US 5843721 A, US 5843721A, US-A-5843721, US5843721 A, US5843721A
InventorsMike Rothe, Lin Wu
Original AssigneeTularik Inc.
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Nucleic acids encoding human NIK protein
US 5843721 A
The invention provides methods and compositions relating to a novel kinase, NIK, involved in NFκB activation. The polypeptides may be produced recombinantly from transformed host cells from the disclosed NIK encoding nucleic acids or purified from human cells. The invention provides isolated NIK hybridization probes and primers capable of specifically hybridizing with the disclosed NIK genes, NIK-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis, therapy and in the biopharmaceutical industry.
Previous page
Next page
What is claimed is:
1. A probe, vector or recombinant nucleic acid comprising the sequence set forth as SEQ ID NO: 1.
2. An isolated cell comprising the probe, vector or recombinant nucleic acid of claim 1.
3. A probe, vertor or recombinant nucleic acid comprising at least 24 consecutive nucleotides of SEQ ID NO: 1, which consecutive nucleotides comprise nucleotides 72-75 of the sequence set forth as SEQ ID NO:1.
4. An isolated cell comprising the probe, vector or recombinant nucleic acid of claim 3.
5. The probe, vector or recombinant nucleic acid of claim 3 comprising at least 96 consecutive nucleotides of SEQ ID NO:1, which consecutive nucleotides comprise nucleotides 72-75 of the sequence set forth as SEQ ID NO:1.
6. An isolated cell comprising the probe, vector or recombinant nucleic acid of claim 5.
7. A probe, vector or recombinant nucleic acid encoding a polypeptide comprising the amnino acid sequence set forth as SEQ ID NO:2.
8. An isolated cell conprising the probe, vector or recombinant nucleic acid of claim 7.
9. A method of making an isolated polypeptide comprising the amino acid sequence set forth as SEQ ID NO:2, said method comprising the steps of:
introducing the vector or recombinant nucleic acid of claim 7 into a host cell or cellular extract,
incubating said host cell or cellular extract under conditions whereby said polypeptide is expressed; and
isolating said polypeptide.
10. A probe, vector or recombinant nucleic acid encoding a polypeptide comprising at least 10 consecutive amino acid residues of the amino acid sequence set forth as SEQ ID NO:2, which consecutive amino acid residues comprise the amino acid residue 25 of SEQ ID NO:2.
11. An isolated cell comprising the probe, vector or recombinant nucleic acid of claim 10.
12. A method of making an isolated polypeptide comprising at least 10 consecutive amino acid residues of the amino acid sequence set forth as SEQ ID NO:2, which consecutive amino acid residues comprise the amino acid residue 25 of SEQ ID NO:2, said method comprising the steps of:
introducing the vector or recombinant nucleic acid of claim 10 into a host cell or cellular extract,
incubating said host cell or cellular extract under conditions whereby said polypeptide is expressed; and
isolating said polypeptide.
13. The probe, vector or recombinant nucleic acid according to claim 10, wherein said polypeptide has one or more activities selected from the group consisting of: kinase activity, kinase inhibitory activity, IκB kinase-α binding activity, IκB kinase-α binding inhibitory activity, IκB kinase-B binding activity, IκB kinase-β binding inhibitory activity, tumor necrosis factor receptor-associated factor 2 binding activity, tumor necrosis factor receptor-associated factor 2 binding inhibitory activity, IκB binding activity, IκB binding inhibitory activity, nuclear factor-κB activating activity and nuclear factor-κB inhibitory activity.
14. An isolated cell comprising the probe, vector or recombinant nucleic acid of claim 13.
15. A method of making an isolated polypeptide comprising at least 10 consecutive amino acid residues of the amino acid sequence set forth as SEQ ID NO:2, which consecutive amino acid residues comprise the amino acid residue 25 of SEQ ID NO:2, said method comprising the steps of:
introducing the vector or recombinant nucleic acid of claim 13 into a host cell or cellular extract,
incubating said host cell or cellular extract under conditions whereby said polypeptide is expressed; and
isolating said polypeptide.

The field of this invention is proteins involved in transcription factor activation.


Cytokines trigger changes in gene expression by modifying the activity of otherwise latent transcription factors (Hill and Treisman, 1995). Nuclear factor κB (NF-κB) is a prominent example of how such an external stimulus is converted into an active transcription factor (Verma et al., 1995). The NF-κB system is composed of homo- and heterodimers of members of the Rel family of related transcription factors that control the expression of numerous immune and inflammatory response genes as well as important viral genes (Lenardo and Baltimore, 1989; Baeuerle and Henkel, 1994). The activity of NF-κB transcription factors is regulated by their subcellular localization (Verma et al., 1995). In most cell types, NF-κB is present as a heterodimer comprising of a 50 kDa and a 65 kDa subunit. This heterodimer is sequestered in the cytoplasm in association with IκBα a member of the IκB family of inhibitory proteins (Finco and Baldwin, 1995; Thanos and Maniatis, 1995; Verma et al., 1995). IκBα masks the nuclear localization signal of NF-κB and thereby prevents NF-κB nuclear translocation. Conversion of NF-κB into an active transcription factor that translocates into the nucleus and binds to cognate DNA sequences requires the phosphorylation and subsequent ubiquitin-dependent degradation of IκBα in the 26s proteasome. Signal-induced phosphorylation of IκBα occurs at serines 32 and 36. Mutation of one or both of these serines renders IκBα resistant to ubiquitination and proteolytic degradation (Chen et al., 1995); DiDonato, 1996 #370, Roff, 1996 #397.

The pleiotropic cytokines tumor necrosis factor (TNF) and interleukin-1 (IL-1) are among the physiological inducers of IκB phosphorylation and subsequent NF-κB activation (Osborn et al., 1989; Beg et al., 1993). Although TNF and IL-1 initiate signaling cascades leading to NF-κB activation via distinct families of cell-surface receptors (Smith et al., 1994; Dinarello, 1996), both pathways utilize members of the TNF receptor-associated factor (TRAF) family of adaptor proteins as signal transducers (Rothe et al., 1995; Hsu et al., 1996; Cao et al., 1996b). TRAF proteins were originally found to associate directly with the cytoplasmic domains of several members of the TNF receptor family including the 75 kDa TNF receptor (TNFR2), CD40, CD30, and the lymphotoxin-β receptor (Rothe et al., 1994; Hu et al., 1994; Cheng et al., 1995; Mosialos et al., 1995; Song and Donner, 1995; Sato et al., 1995; Lee et al., 1996; Gedrich et al., 1996; Ansieau et al., 1996). In addition, TRAF proteins are recruited indirectly to the 55 kDa TNF receptor (TNFR1) by the adaptor protein TRADD (Hsu et al., 1996). Activation of NF-κB by TNF requires TRAF2 (Rothe et al., 1995; Hsu et al., 1996). TRAF5 has also been implicated in NF-κB activation by members of the TNF receptor family (Nakano et al., 1996); Ishida, 1996 #240. In contrast, TRAF6 participates in NF-κB activation by IL-1 (Cao et al., 1996b). Upon IL-1 treatment, TRAF6 associates with IRAK, a serine-threonine kinase that binds to the IL-1 receptor complex (Cao et al., 1996a); Huang, 1997 #400.

An NF-κB-inducing kinase (NIK), a member of the MAP kinase kinase kinase (MAP3K) family, was identified as a TRAF2-interacting protein (Malinin et al., 1997). NIK activates NF-κB when overexpressed, and kinase-inactive mutants of NIK comprising its TRAF2-interacting C-terminal domain (NIK.sub.(624-947)) or lacking two crucial lysine residues in its kinase domain (NIK.sub.(KK429-430AA)) behave as dominant-negative inhibitors that suppress TNF-, IL-1-, and TRAF2-induced NF-κB activation (Malinin et al., 1997).

Here, we disclose a novel human NIK(NIK .sub.(Ala25), which also provides the foregoing functionalities yet deviates in terms of critical sequence and structural characteristics; in particular, a Pro-Ala substitution at position 25 imposes altered protein structure. We show that the NIK.sub.(Ala25) variant interacts with and cross-phosphorylates the IκB Kinases α and β, IKK-α and IKK-β (see Goeddel et al. and Rothe et al., copending applications T97-006 and T97-007, respectively, filed Jul. 1, 1997). IKK-α and IKK-β have sequence similarity to the conceptual translate of a previously identified open reading frame postulated to encode a serine-threonine kinase of unknown function (`Conserved Helix-loop-helix Ubiquitous Kinase` or CHUK, Connelly and Marcu, 1995; Mock et al., 1995). Catalytically inactive mutants of the IKKs suppress NF-κB activation induced by TNF and IL-1 stimulation as well as by TRAF and NIK overexpression; transiently expressed IKKs associate with the endogenous IκBα complex; and the IKKs phosphorylate IκBα on serines 32 and 36. As used herein, Ser32 and Ser36 of IκB refers collectively to the two serine residues which are part of the consensus sequence DSGL/IXSM/L (e.g. ser 32 and 36 in IκBα, ser 19 and 23 in IκBβ, and ser 157 and 161, or 18 and 22, depending on the usage of methionines, in IκBε, respectively. In addition, we disclose that NIK.sub.(Ala25) associates with other members of the TRAF family, including TRAF5 and TRAF6. Catalytically inactive mutants of NIK.sub.(Ala25) also inhibit TRAF5- and TRAF6-induced NF-κB activation, thus providing a unifying concept for NIK.sub.(Ala25) as a common mediator in the NF-κB signaling cascades triggered by TNF and IL-1 downstream of TRAFs.


The invention provides methods and compositions relating to isolated NIK polypeptides, related nucleic acids, polypeptide domains thereof having NIK-specific structure and activity and modulators of NIK function, particularly IKKκ/α kinase activity. NIK polypeptides can regulate NFκB activation and hence provide important regulators of cell function. The polypeptides may be produced recombinantly from transformed host cells from the subject NIK polypeptide encoding nucleic acids or purified from mammalian cells. The invention provides isolated NIK hybridization probes and primers capable of specifically hybridizing with the disclosed NIK gene, NIK-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis (e.g. genetic hybridization screens for NIK transcripts), therapy (e.g. NIK kinase inhibitors to inhibit TNF signal transduction) and in the biopharmaceutical industry (e.g. as immunogens, reagents for isolating other transcriptional regulators, reagents for screening chemical libraries for lead pharmacological agents, etc.).


The nucleotide sequence of a natural human cDNA encoding a human NIK polypeptide is shown as SEQ ID NO: 1, and the fall conceptual translate is shown as SEQ ID NO:2. This novel NIK cDNA sequence was cloned by PCR using primers designed from GenBank accesion number Y102565. The NIK polypeptides of the invention include incomplete translates of SEQ ID NO: 1 which translates and deletion mutants of SEQ ID NO:2 have human NIK-specific amino acid sequence, binding specificity or function and comprise Ala25. Preferred translates/deletion mutants comprise at least a 10 residue Ala25-containing domain of SEQ ID NO:2, preferably including residues 22-31, more preferably including residues 12-31, most preferably including residues 2-31. The subject domains provide NIK domain specific activity or function, such as NIK-specific kinase or kinase inhibitory activity, IKK-α/β (SEQ ID NO:3/4, respectively)-binding or binding inhibitory activity, TRAF1, 2, 3, 5 and/or 6 binding or binding inhibitory activity, IκB-binding or binding inhibitory activity, NFκB activating or inhibitory activity or antibody binding. Preferred domains phosphorylate at least one serine residue of IKK-α and/or β.

NIK-specific activity or finction may be determined by convenient in vitro, cell-based, or in vivo assays: e.g. in vitro binding assays, cell culture assays, in animals (e.g. gene therapy, transgenics, etc.), etc. Binding assays encompass any assay where the molecular interaction of an NIK polypeptide with a binding target is evaluated. The binding target may be a natural intracellular binding target such as an NIK substrate, a NIK regulating protein or other regulator that directly modulates NIK activity or its localization; or non-natural binding target such a specific immune protein such as an antibody, or an NIK specific agent such as those identified in screening assays such as described below. NIK-binding specificity may assayed by kinase activity or binding equilibrium constants (usually at least about 107 M-1, preferably at least about 108 M-1, more preferably at least about 109 M-1), by the ability of the subject polypeptide to function as negative mutants in NIK-expressing cells, to elicit NIK specific antibody in a heterologous host (e.g a rodent or rabbit), etc. In any event, the NIK binding specificity of the subject NIK polypeptides necessarily distinguishes that of the human NIK protein of Malinin et al. (1997).

The claimed NIK polypeptides are isolated or pure: an "isolated" polypeptide is unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, and more preferably at least about 5% by weight of the total polypeptide in a given sample and a pure polypeptide constitutes at least about 90%, and preferably at least about 99% by weight of the total polypeptide in a given sample. The NIK polypeptides and polypeptide domains may be synthesized, produced by recombinant technology, or purified from mammalian, preferably human cells. A wide variety of molecular and biochemical methods are available for biochemical synthesis, molecular expression and purification of the subject compositions, see e.g. Molecular Cloning, A Laboratory Manual (Sambrook, et al. Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et aL, Greene Publ. Assoc., Wiley-Interscience, NY) or that are otherwise known in the art.

The invention provides binding agents specific to the claimed NIK polypeptides, including substrates, agonists, antagonists, natural intracellular binding targets, etc., methods of identifying and making such agents, and their use in diagnosis, therapy and pharmaceutical development. For example, specific binding agents are useful in a variety of diagnostic and therapeutic applications, especially where disease or disease prognosis is associated with improper utilization of a pathway involving the subject proteins, e.g. NF-κB activation. Novel NIK-specific binding agents include NIK-specific receptors, such as somatically recombined polypeptide receptors like specific antibodies or T-cell antigen receptors (see, e.g Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory) and other natural intracellular binding agents identified with assays such as one-, two- and three-hybrid screens, non-natural intracellular binding agents identified in screens of chemical libraries such as described below, etc. Agents of particular interest modulate NIK function, e.g. NIK-dependent transcriptional activation. For example, a wide variety of inhibitors of NIK IKK-α/β kinase activity may be used to regulate signal transduction involving IκB. Exemplary NIK kinase inhibitors include known classes of serine/threonine kinase (e.g. PKC) inhibitors such as competitive inhibitors of ATP and substrate binding, antibiotics, NIK-derived peptide inhibitors, esp. dominant negative deletion mutants, etc., see Tables 1 and 2. NIK specificity and activity are readily quantified in high throughput kinase assays using panels of protein kinases (see cited references and Examples).

Preferred inhibitors include natural compounds such as staurosporine (Omura S, et al. J Antibiot (Tokyo) 1995 July;48(7):535-48), produced by a marine organism, and synthetic compounds such as PD 153035, which also potently inhibits the EGF receptor protein kinase (Fry DW et al. Science 1994 Aug. 19;265(5175):1093-5). Members of the tyrphostin family of synthetic protein kinase inhibitors are also useful; these include compounds which are pure ATP competitors, compounds which are pure substrate competitors, and compounds which are mixed competitors: compete with both ATP and substrate (Levitzki A and Gazit A, Science 1995 Mar. 24;267(5205):1782-8). Additional NIK inhibitors include peptide-based substrate competitors endogenously made by the mammalian cell, e.g. PKI (protein kinase inhibitor, Seasholtz A.F. et al., Proc Natl Acad Sci USA 1995 Feb. 28;92(5):173-8 ), or proteins inhibiting cdc kinases (Correa-Bordes J and Nurse P, Cell 1995 Dec. 15;83(6):1001-9). Additional small peptide based substrate competitive kinase inhibitors and allosteric inhibitors (inhibitory mechanisms independent of ATP or substrate competition) are readily generated by established methods (Hvalby O et al. Proc Natl Acad Sci USA 1994 May 24;91(11):4761-5; Baija P, et al., Cell Immunol 1994 January153(1):28-38; Villar-Palasi C, Biochim Biophys Acta 1994 Dec. 30;1224(3):384-8; Liu W. Z., et al., Biochemistry 1994 Aug. 23;33(33):10120-6).

              TABLE I______________________________________Selected Small Molecule NIK Kinase InhibitorsInhibitors  Citations______________________________________HA-1001       1. Hagiwara, M,. et al. Mol. Pharmacol. 32:7       (1987)Chelerythrine2       2. Herbert, J. M., et al. Biochem Biophys Res       Com 172:993 (1990)Staurosporin3,4,5       3. Schachtele, C., et al. Biochem Biophys Res       Com 151:542 (1988)Calphostin C6,7,8,9       4. Tamaoki, T., et al. Biochem Biophys Res       Com 135:397 (1986)K-252b10       5. Tischler, A. S., et al. J. Neurochemistry       55:1159 (1990)PCK 19-3611       6. Bruns, R. F., et al. Biochem Biophys Res       Com 176:288 (1991)Iso-H712       7. Kobayashi, E., et al. Biochem Biophys Res       Com 159:548 (1989)PKC 19-31   8. Tamaoki, T., et al Adv 2nd Mass       Phosphoprotein Res 24:497 (1990)H-713,3,14       9. Tamaoki, T., et al. Biotechnology 8:732       (1990)H-8915 10. Yasuzawa, T. J. Antibiotics 39:172 (1986)KT572016       11. House, C., et al. Science 238:1726 (1987)cAMP-depPKinhib17       12. Quick, J., et al. Biochem. Biophys. Res.       Com. 167:657 (1992)A-318  13. Bouli, N. M. and Davis, M. Brain Res.       525:198 (1990)HA100419,20       14. Takahashi, I., et al. J. Pharmacol. Exp.       Ther. 255:1218 (1990)K-252a16,5       15. Chijiwa, T., et al. J. Biol. Chem.       265:5267 (1990)KT582316       16. Kase, H., et al. Biochem. Biophys. Res.       Com. 142:436 (1987)ML-921 17. Cheng, H. C., et al. J. Biol. Chem. 261:989       (1986)KT592622       18. Inagaki, M., et al. Mol. Pharmacol. 29:577       (1986)       19. Asano, T. and Hidaka, H. J Pharmaco. Exp       Ther 231:141 (1984)       20. Hidaka, H., et al. Biochemistry 23:5036       (1984)       21. Nagatsu, T., et al. Biochem Biophys Res       Com 143:1045 (1987)       22. Nakanishi, S., et al. Mol. Pharmacol. 37:482       (1990)______________________________________

              TABLE II______________________________________Selected Peptidyl NIK Kinase Inhibitors______________________________________hIKKα, residues 2-398            NIK, residues 624-947hIKKα, residues 279-547            NIK, residues 1-645, Ala429, Ala430hIκBβ, residues 5-381            TRAF2, residues 225-501hIκBβ, residues 301-641            TRAF6, residues 218-512______________________________________

Accordingly, the invention provides methods for modulating signal transduction involving IκB in a cell comprising the step of modulating NIK kinase activity, e.g. by contacting the cell with a serine/threonine kinase inhibitor. The cell may reside in culture or in situ, i.e. within the natural host. Preferred inhibitors are orally active in mammalian hosts. For diagnostic uses, the inhibitors or other NIK binding agents are frequently labeled, such as with fluorescent, radioactive, chemiluminescent, or other easily detectable molecules, either conjugated directly to the binding agent or conjugated to a probe specific for the binding agent.

The amino acid sequences of the disclosed NIK polypeptides are used to back-translate NIK polypeptide-encoding nucleic acids optimized for selected expression systems Holler et al. (1993) Gene 136, 323-328; Martin et al. (1995) Gene 154, 150-166) or used to generate degenerate oligonucleotide primers and probes for use in the isolation of natural NIK-encoding nucleic acid sequences ("GCG" software, Genetics Computer Group, Inc, Madison Wis.). NIK-encoding nucleic acids used in NIK-expression vectors and incorporated into recombinant host cells, e.g. for expression and screening, transgenic animals, e.g. for functional studies such as the efficacy of candidate drugs for disease associated with NIK-modulated cell function, etc.

The invention also provides nucleic acid hybridization probes and replication/amplification primers having a NIK cDNA specific sequence comprising SEQ ID NO: 1, bases 72-75, and sufficient to effect specific hybridization thereto (i.e. specifically hybridize with SEQ ID NO: 1 in the presence of the NIK cDNA described by Malinin et al. (1997). Such primers or probes are at least 12, preferably at least 24, more preferably at least 36 and most preferably at least 96 bases in length. Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formamide in 5×SSPE (0.18M NaCl, 0.01M NaPO4, pH7.7, 0.001M EDTA) buffer at a temperature of 42° C. and remaining bound when subject to washing at 42° C. with 0.2×SSPE; preferably hybridizing in a buffer comprising 50% formamide in 5×SSPE buffer at a temperature of 42° C. and remaining bound when subject to washing at 42° C. with 0.2×SSPE buffer at 42° C. NIK nucleic acids can also be distinguished using alignment algorithms, such as BLASTX (Altschul et al. (1990) Basic Local Alignment Search Tool, J Mol Biol 215, 403-410).

The subject nucleic acids are of synthetic/non-natural sequences and/or are isolated, i.e. unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, preferably at least about 5% by weight of total nucleic acid present in a given fraction, and usually recombinant, meaning they comprise a non-natural sequence or a natural sequence joined to nucleotide(s) other than that which it is joined to on a natural chromosome. Recombinant nucleic acids comprising the nucleotide sequence of SEQ ID NO:1, or fragments thereof comprising SEQ ID NO:1, bases 72-75, contain such sequence or fragment at a terminus, immediately flanked by (i.e. contiguous with) a sequence other than that which it is joined to on a natural chromosome, or flanked by a native flanking region fewer than 10 kb, preferably fewer than 2 kb, which is at a terminus or is immediately flanked by a sequence other than that which it is joined to on a natural chromosome. While the nucleic acids are usually RNA or DNA, it is often advantageous to use nucleic acids comprising other bases or nucleotide analogs to provide modified stability, etc.

The subject nucleic acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, etc.; use in detecting the presence of NIK genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional NIK homologs and structural analogs. In diagnosis, NIK hybridization probes find use in identifying wild-type and mutant NIK alleles in clinical and laboratory samples. Mutant alleles are used to generate allele-specific oligonucleotide (ASO) probes for high-throughput clinical diagnoses. In therapy, therapeutic NIK nucleic acids are used to modulate cellular expression or intracellular concentration or availability of active NIK.

The invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of a NIK modulatable cellular function. Generally, these screening methods involve assaying for compounds which modulate NIK interaction with a natural NIK binding target such as IKKα and/or β, TRAF1, 2, 3, 5 or 6, etc. A wide variety of assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc. The methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. Identified reagents find use in the pharmaceutical industries for animal and human trials; for example, the reagents may be derivatized and rescreened in in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.

In vitro binding assays employ a mixture of components including an NIK polypeptide, which may be part of a fusion product with another peptide or polypeptide, e.g. a tag for detection or anchoring, etc. The assay mixtures comprise a natural intracellular NIK binding target. In a particular embodiment, the binding target is a a IKKα and/or β-derived substrate of NIK kinase activity. Such substrates comprise a NIK-phosphoylatable IKKα and/or β serine residue and at least 5, preferably at least 10, and more preferably at least 20 naturally occurring immediately flanking residues on each side. While native full-length binding targets may be used, it is frequently preferred to use portions (e.g. peptides) thereof so long as the portion provides binding affinity and avidity to the subject NIK polypeptide conveniently measurable in the assay. The assay mixture also comprises a candidate pharmacological agent. Candidate agents encompass numerous chemical classes, though typically they are organic compounds; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds. A variety of other reagents may also be included in the mixture. These include reagents like ATP or ATP analogs (for kinase assays), salts, buffers, neutral proteins, e.g. albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used.

The resultant mixture is incubated under conditions whereby, but for the presence of the candidate pharmacological agent, the NIK polypeptide specifically binds the cellular binding target, portion or analog with a reference binding affinity. The mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding. Incubation periods are likewise selected for optimal binding but also minimized to facilitate rapid, high-throughput screening.

After incubation, the agent-biased binding between the NIK polypeptide and one or more binding targets is detected by any convenient way. For NIK kinase assays, `binding` is generally detected by a change in the phosphorylation of a NIK substrate. In this embodiment, kinase activity may quantified by the transfer to the substrate of a labeled phosphate, where the label may provide for direct detection as radioactivity, luminescence, optical or electron density, etc. or indirect detection such as an epitope tag, etc. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiative emissions, nonradiative energy transfers, etc. or indirectly detected with antibody conjugates, etc.

A difference in the binding affinity of the NIK polypeptide to the target in the absence of the agent as compared with the binding affinity in the presence of the agent indicates that the agent modulates the binding of the NIK polypeptide to the NIK binding target. Analogously, in the cell-based assay also described below, a difference in NIK-dependent transcriptional activation in the presence and absence of an agent indicates the agent modulates NIK function. A difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.


Ansieau, S., et al. (1996). Proc. Natl. Acad. Sci. USA 93, 14053-14058.

Baeuerle, P. A., and Henkel, T. (1994). Annu. Rev. Immunol. 12, 141-179.

Beg, A. A., et al. (1993). Mol. Cell. Biol. 13, 3301-3310.

Cao, Z., Henzel, W. J., and Gao, X. (1996a). Science 271, 1128-1131.

Cao, Z., et al. (1996b). Nature 383, 443-446.

Chen, Z., et al.. (1995). Genes Dev. 9, 1586-1597.

Cheng, G., et al. (1995). Science 267, 1494-1498.

Connelly, M. A., and Marcu, K. B. (1995). Cell. Mol. Biol. Res. 41, 537-549.

Dinarello, C. A. (1996) Blood 87, 2095-2147.

Fields, S., and Song, O.-k. (1989). Nature 340, 245-246.

Finco, T. S., and Baldwin, A. S. (1995). Immunity 3, 263-272.

Gedrich, R. W., et al. (1996). J. Biol. Chem. 271, 12852-12858.

Hill, C. S., and Treisman, R. (1995). Cell 80, 199-211.

Hsu, H., Shu, H.-B., Pan, M.-P., and Goeddel, D. V. (1996). Cell 84, 299-308.

Hu, H. M., et al. (1994). J. Biol. Chem. 269, 30069-30072.

Lee, S. Y., et al. (1996). Proc. Natl. Acad. Sci. USA 93, 9699-9703.

Lenardo, M., and Baltimore, D. (1989). Cell 58, 227-229.

Malinin, N. L., et al. (1997). Nature 385, 540-544.

Mock et al. (1995). Genomics 27, 348-351.

Mosialos, G., et al. (1995). Cell 80, 389-399.

Nakano, H., et al. (1996). J. Biol. Chem. 271, 14661-14664.

Osborn, L., Kunkel, S., and Nabel, G. J. (1989) Proc Natl Aca Sci USA 86,2336-2340.

Rothe, M., Sarma, V., Dixit, V. M., and Goeddel, D. V. (1995) Science 269, 1424-1427.

Rothe, M., Wong, S. C., Henzel, W. J., and Goeddel, D. V. (1994). Cell 78, 681-692.

Sato, T., Irie, S., and Reed, J. C. (1995). FEBS Lett. 358, 113-118.

Schindler, U., and Baichwal, V. R. (1994). Mol. Cell. Biol. 14, 5820-5831.

Smith, C. A., Farrah, T., and Goodwin, R. G. (1994). Cell 76, 959-962.

Song, H. Y., and Donner, D. B. (1995). Biochem. J. 809, 825-829.

Thanos, D., and Maniatis, T. (1995). Cell 80, 529-532.

Verma, I. M., et al. (1995). Genes Dev. 9, 2723-2735.

The following experimental section and examples are offered by way of illustration and not by way of limitation.


1. Protocol for at NIK-IKK-β phosphorylation assay.

A. Reagents:

Neutralite Avidin: 20 μg/ml in PBS.

kinase: 10-8 -10-5 M NIK kinase domain deletion mutant (SEQ ID NO:2, residues 2-644) at 20 μg/ml in PBS.

substrate: 10-7 -10-4 M biotinylated IKK-β (SEQ ID NO:4) substrate at 40 μg/ml in PBS.

Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.

Assay Buffer: 100 mM KCl, 10 mM MgCl2, 1 mM MnCl2, 20 mM HEPES pH 7.4, 0.25 mM EDTA, 1% glycerol, 0.5% NP-40, 50 mM BME, 1 mg/ml BSA, cocktail of protease inhibitors.

32 P!γ-ATP 10×stock: 2×10-5 M cold ATP with 100 μCi 32 P!γ-ATP. Place in the 4° C. microfridge during screening.

Protease inhibitor cocktail (1000×): 10 mg Trypsin Inhibitor (BMB #109894), 10 mg Aprotinin (BMB #236624), 25 mg Benzamidine (Sigma #B-6506), 25 mg Leupeptin (BMB #1017128), 10 mg APMSF (BMB #917575), and 2 mM NaVo3 (Sigma #S-6508) in 10 ml of PBS.

B. Preparation of assay plates:

Coat with 120 μl of stock N Avidin per well overnight at 4° C.

Wash 2 times with 200 μl PBS.

Block with 150 μl of blocking buffer.

Wash 2 times with 200 μl PBS.

C. Assay:

Add 40 μl assay buffer/well.

Add 40 μl biotinylated substrate (2-200 pmoles/40 ul in assay buffer)

Add 40 μl kinase (0.1-10 pmoles/40 ul in assay buffer)

Add 10 μl compound or extract.

Add 10 μl 32 P!γ-ATP 10×stock.

Shake at 25° C. for 15 minutes.

Incubate additional 45 minutes at 25° C.

Stop the reaction by washing 4 times with 200 μl PBS.

Add 150 μl scintillation cocktail.

Count in Topcount.

D. Controls for all assays (located on each plate):

a. Non-specific binding

b. cold ATP at 80% inhibition.

2. Protocol for high throughput NIKI-TRAF2 binding assay.

A. Reagents:

Neutralite Avidin: 20 μg/ml in PBS.

Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.

Assay Buffer: 100 mM KCl, 20 mM HEPES pH 7.6, 1 MM MgCl2, 1% glycerol, 0.5% NP-40, 50 mM β-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors.

33 P NIK polypeptide 10×stock: 10-8 -10-6 M "cold" NIK supplemented with 200,000-250,000 cpm of labeled NIK (Beckinan counter). Place in the 4° C. microfridge during screening.

Protease inhibitor cocktail (1000×): 10 mg Trypsin Inhibitor (BMB #109894), 10 mg Aprotinin (BMB #236624), 25 mg Benzamidine (Sigma #B-6506), 25 mg Leupeptin (B3MB #1017128), 10 mg APMSF (BMB #917575), and 2 mM NaVO3 (Sigma #S-6508) in 10 ml of PBS.

TRAF2: 10-7 ×105 M biotinylated TRAF2 in PBS.

B. Preparation of assay plates:

Coat with 120 μl of stock N-Avidin per well overnight at 4° C.

Wash 2 times with 200 μl PBS.

Block with 150 μl of blocking buffer.

Wash 2 times with 200 μl PBS.

C. Assay:

Add 40 μl assay buffer/well.

Add 10 μl compound or extract.

Add 10 μl 33 P-NIK (20-25,000 cpm/0.1-10 pmoles/well=10-9 -10-7 M final conc).

Shake at 25° C. for 15 minutes.

Incubate additional 45 minutes at 25° C.

Add 40 μM biotinylated TRAF2 (0.1-10 pmoles/40 μl in assay buffer)

Incubate 1 hour at room temperature.

Stop the reaction by washing 4 times with 200 μM PBS.

Add 150 μM scintillation cocktail.

Count in Topcount.

D. Controls for all assays (located on each plate):

a. Non-specific binding

b. Soluble (non-biotinylated TRAF2) at 80% inhibition.

3. Protocol for high throughput IμB-complex formation assay.

A. Reagents:

Neutralite Avidin: 20 μg/ml in PBS.

Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature.

Assay Buffer: 100 mM KCl, 20 mM HEPES pH 7.6, 1 mM MgCl2, 1% glycerol, 0.5% NP-40, 50 mM β-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors.

33 P NIK polypeptide 10×stock: 10-8 -10-6 M "cold" NIK supplemented with 200,000-250,000 cpm of labeled NIK (Beckman counter). Place in the 4° C. microfridge during screening.

Protease inhibitor cocktail (1000×): 10 mg Trypsin Inhibitor (BMB #109894), 10 mg Aprotinin (BMB #236624), 25 mg Benzamidine (Sigma #B-6506), 25 mg Leupeptin (BMB #1017128), 10 mg APMSF (BMB #917575), and 2 mM NaVO3 (Sigma #S-6508) in 10 ml of PBS.

IκB: 107 -105 M biotinylated IκB in PBS.

IKK-β: 10-7 105 M in PBS.

B. Preparation of assay plates:

Coat with 120 μl of stock N-Avidin per well overnight at 4° C.

Wash 2 times with 200 μl PBS.

Block with 150 μl of blocking buffer.

Wash 2 times with 200 μl PBS.

C. Assay:

Add 40 μl assay buffer/well.

Add 10 μl compound or extract.

Add 10 μl 33 P-NIK (20-25,000 cpm/0.1-10 pmoles/well=10-9 -10-7 M final conc).

Shake at 25° C. for 15 minutes.

Incubate additional 45 minutes at 25° C.

Add 20 μM IKK-β(0.1-10 pmoles/20 ul in assay buffer)

Add 20 μM biotinylated IκB (0.1-10 pmoles/20 ul in assay buffer)

Incubate 1 hour at room temperature.

Stop the reaction by washing 4 times with 200 μM PBS.

Add 150 μM scintillation cocktail.

Count in Topcount.

D. Controls for all assays (located on each plate):

a. Non-specific binding

b. Soluble (non-biotinylated IκB) at 80% inhibition.

All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 4(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 3156 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:ATGGCAGTGATGGAAATGGCCTGCCCAGGTGCCCCTGGCTCAGCAGTGGGGCAGCAGAAG60GAACTCCCCAAAGCCAAGGAGAAGACGCCGCCACTGGGGAAGAAACAGAGCTCCGTCTAC120AAGCTTGAGGCCGTGGAGAAGAGCCCTGTGTTCTGCGGAAAGTGGGAGATCCTGAATGAC180GTGATTACCAAGGGCACAGCCAAGGAAGGCTCCGAGGCAGGGCCAGCTGCCATCTCTATC240ATCGCCCAGGCTGAGTGTGAGAATAGCCAAGAGTTCAGCCCCACCTTTTCAGAACGCATT300TTCATCGCTGGGTCCAAACAGTACAGCCAGTCCGAGAGTCTTGATCAGATCCCCAACAAT360GTGGCCCATGCTACAGAGGGCAAAATGGCCCGTGTGTGTTGGAAGGGAAAGCGTCGCAGC420AAAGCCCGGAAGAAACGGAAGAAGAAGAGCTCAAAGTCCCTGGCTCATGCAGGAGTGGCC480TTGGCCAAACCCCTCCCCAGGACCCCTGAGCAGGAGAGCTGCACCATCCCAGTGCAGGAG540GATGAGTCTCCACTCGGCGCCCCATATGTTAGAAACACCCCGCAGTTCACCAAGCCTCTG600AAGGAACCAGGCCTTGGGCAACTCTGTTTTAAGCAGCTTGGCGAGGGCCTACGGCCGGCT660CTGCCTCGATCAGAACTCCACAAACTGATCAGCCCCTTGCAATGTCTGAACCACGTGTGG720AAACTGCACCACCCCCAGGACGGAGGCCCCCTGCCCCTGCCCACGCACCCCTTCCCCTAT780AGCAGACTGCCTCATCCCTTCCCATTCCACCCTCTCCAGCCCTGGAAACCTCACCCTCTG840GAGTCCTTCCTGGGCAAACTGGCCTGTGTAGACAGCCAGAAACCCTTGCCTGACCCACAC900CTGAGCAAACTGGCCTGTGTAGACAGTCCAAAGCCCCTGCCTGGCCCACACCTGGAGCCC960AGCTGCCTGTCTCGTGGTGCCCATGAGAAGTTTTCTGTGGAGGAATACCTAGTGCATGCT1020CTGCAAGGCAGCGTGAGCTCAAGCCAGGCCCACAGCCTGACCAGCCTGGCCAAGACCTGG1080GCAGCACGGGGCTCCAGATCCCGGGAGCCCAGCCCCAAAACTGAGGACAACGAGGGTGTC1140CTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCC1200ACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAG1260CAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAG1320CTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAGCTGTGAGA1380GAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTG1440GTCAAGGAGCAGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTG1500GAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCATGGGGACGTCAAAGCTGACAAC1560GTGCTCCTGTCCAGCGATGGGAGCCACGCAGCCCTCTGTGACTTTGGCCATGCTGTGTGT1620CTTCAACCTGATGGCCTGGGAAAGTCCTTGCTCACAGGGGACTACATCCCTGGCACAGAG1680ACCCACATGGCTCCGGAGGTGGTGCTGGGCAGGAGCTGCGACGCCAAGGTGGATGTCTGG1740AGCAGCTGCTGTATGATGCTGCACATGCTCAACGGCTGCCACCCCTGGACTCAGTTCTTC1800CGAGGGCCGCTCTGCCTCAAGATTGCCAGCGAGCCTCCGCCTGTGAGGGAGATCCCACCC1860TCCTGCGCCCCTCTCACAGCCCAGGCCATCCAAGAGGGGCTGAGGAAAGAGCCCATCCAC1920CGCGTGTCTGCAGCGGAGCTGGGAGGGAAGGTGAACCGGGCACTACAGCAAGTGGGAGGT1980CTGAAGAGCCCTTGGAGGGGAGAATATAAAGAACCAAGACATCCACCGCCAAATCAAGCC2040AATTACCACCAGACCCTCCATGCCCAGCCGAGAGAGCTTTCGCCAAGGGCCCCAGGGCCC2100CGGCCAGCTGAGGAGACAACAGGCAGAGCCCCTAAGCTCCAGCCTCCTCTCCCACCAGAG2160CCCCCAGAGCCAAACAAGTCTCCTCCCTTGACTTTGAGCAAGGAGGAGTCTGGGATGTGG2220GAACCCTTACCTCTGTCCTCCCTGGAGCCAGCCCCTGCCAGAAACCCCAGCTCACCAGAG2280CGGAAAGCAACCGTCCCGGAGCAGGAACTGCAGCAGCTGGAAATAGAATTATTCCTCAAC2340AGCCTGTCCCAGCCATTTTCTCTGGAGGAGCAGGAGCAAATTCTCTCGTGCCTCAGCATC2400GACAGCCTCTCCCTGTCGGATGACAGTGAGAAGAACCCATCAAAGGCCTCTCAAAGCTCG2460CGGGACACCCTGAGCTCAGGCGTACACTCCTGGAGCAGCCAGGCCGAGGCTCGAAGCTCC2520AGCTGGAACATGGTGCTGGCCCGGGGGCGGCCCACCGACACCCCAAGCTATTTCAATGGT2580GTGAAAGTCCAAATACAGTCTCTTAATGGTGAACACCTGCACATCCGGGAGTTCCACCGG2640GTCAAAGTGGGAGACATCGCCACTGGCATCAGCAGCCAGATCCCAGCTGCAGCCTTCAGC2700TTGGTCACCAAAGACGGGCAGCCTGTTCGCTACGACATGGAGGTGCCAGACTCGGGCATC2760GACCTGCAGTGCACACTGGCCCCTGATGGCAGCTTCGCCTGGAGCTGGAGGGTCAAGCAT2820GGCCAGCTGGAGAACAGGCCCTAACCCTGCCCTCCACCGCCGGCTCCACACTGCCGGAAA2880GCAGCCTTCCTGCTCGGTGCACGATGCTGCCCTGAAAACACAGGCTCAGCCGTTCCCAGG2940GGATTGCCAGCCCCCCGGCTCACAGTGGGAACCAGGGCCTCGCAGCAGCAAGGTGGGGGC3000AAGCAGAATGCCTCCCAGGATTTCACACCTGAGCCCTGCCCCACCCTGCTGAAAAAACAT3060CCGCCACGTGAAGAGACAGAAGGAGGATGGCAGGAGTTACCTGGGGAAACAAAACAGGGA3120TCTTTTTCTGCCCCTGCTCCAGTCGAGTTGGCCTGA3156(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 947 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaValMetGluMetAlaCysProGlyAlaProGlySerAlaVal151015GlyGlnGlnLysGluLeuProLysAlaLysGluLysThrProProLeu202530GlyLysLysGlnSerSerValTyrLysLeuGluAlaValGluLysSer354045ProValPheCysGlyLysTrpGluIleLeuAsnAspValIleThrLys505560GlyThrAlaLysGluGlySerGluAlaGlyProAlaAlaIleSerIle65707580IleAlaGlnAlaGluCysGluAsnSerGlnGluPheSerProThrPhe859095SerGluArgIlePheIleAlaGlySerLysGlnTyrSerGlnSerGlu100105110SerLeuAspGlnIleProAsnAsnValAlaHisAlaThrGluGlyLys115120125MetAlaArgValCysTrpLysGlyLysArgArgSerLysAlaArgLys130135140LysArgLysLysLysSerSerLysSerLeuAlaHisAlaGlyValAla145150155160LeuAlaLysProLeuProArgThrProGluGlnGluSerCysThrIle165170175ProValGlnGluAspGluSerProLeuGlyAlaProTyrValArgAsn180185190ThrProGlnPheThrLysProLeuLysGluProGlyLeuGlyGlnLeu195200205CysPheLysGlnLeuGlyGluGlyLeuArgProAlaLeuProArgSer210215220GluLeuHisLysLeuIleSerProLeuGlnCysLeuAsnHisValTrp225230235240LysLeuHisHisProGlnAspGlyGlyProLeuProLeuProThrHis245250255ProPheProTyrSerArgLeuProHisProPheProPheHisProLeu260265270GlnProTrpLysProHisProLeuGluSerPheLeuGlyLysLeuAla275280285CysValAspSerGlnLysProLeuProAspProHisLeuSerLysLeu290295300AlaCysValAspSerProLysProLeuProGlyProHisLeuGluPro305310315320SerCysLeuSerArgGlyAlaHisGluLysPheSerValGluGluTyr325330335LeuValHisAlaLeuGlnGlySerValSerSerSerGlnAlaHisSer340345350LeuThrSerLeuAlaLysThrTrpAlaAlaArgGlySerArgSerArg355360365GluProSerProLysThrGluAspAsnGluGlyValLeuLeuThrGlu370375380LysLeuLysProValAspTyrGluTyrArgGluGluValHisTrpAla385390395400ThrHisGlnLeuArgLeuGlyArgGlySerPheGlyGluValHisArg405410415MetGluAspLysGlnThrGlyPheGlnCysAlaValLysLysValArg420425430LeuGluValPheArgAlaGluGluLeuMetAlaCysAlaGlyLeuThr435440445SerProArgIleValProLeuTyrGlyAlaValArgGluGlyProTrp450455460ValAsnIlePheMetGluLeuLeuGluGlyGlySerLeuGlyGlnLeu465470475480ValLysGluGlnGlyCysLeuProGluAspArgAlaLeuTyrTyrLeu485490495GlyGlnAlaLeuGluGlyLeuGluTyrLeuHisSerArgArgIleLeu500505510HisGlyAspValLysAlaAspAsnValLeuLeuSerSerAspGlySer515520525HisAlaAlaLeuCysAspPheGlyHisAlaValCysLeuGlnProAsp530535540GlyLeuGlyLysSerLeuLeuThrGlyAspTyrIleProGlyThrGlu545550555560ThrHisMetAlaProGluValValLeuGlyArgSerCysAspAlaLys565570575ValAspValTrpSerSerCysCysMetMetLeuHisMetLeuAsnGly580585590CysHisProTrpThrGlnPhePheArgGlyProLeuCysLeuLysIle595600605AlaSerGluProProProValArgGluIleProProSerCysAlaPro610615620LeuThrAlaGlnAlaIleGlnGluGlyLeuArgLysGluProIleHis625630635640ArgValSerAlaAlaGluLeuGlyGlyLysValAsnArgAlaLeuGln645650655GlnValGlyGlyLeuLysSerProTrpArgGlyGluTyrLysGluPro660665670ArgHisProProProAsnGlnAlaAsnTyrHisGlnThrLeuHisAla675680685GlnProArgGluLeuSerProArgAlaProGlyProArgProAlaGlu690695700GluThrThrGlyArgAlaProLysLeuGlnProProLeuProProGlu705710715720ProProGluProAsnLysSerProProLeuThrLeuSerLysGluGlu725730735SerGlyMetTrpGluProLeuProLeuSerSerLeuGluProAlaPro740745750AlaArgAsnProSerSerProGluArgLysAlaThrValProGluGln755760765GluLeuGlnGlnLeuGluIleGluLeuPheLeuAsnSerLeuSerGln770775780ProPheSerLeuGluGluGlnGluGlnIleLeuSerCysLeuSerIle785790795800AspSerLeuSerLeuSerAspAspSerGluLysAsnProSerLysAla805810815SerGlnSerSerArgAspThrLeuSerSerGlyValHisSerTrpSer820825830SerGlnAlaGluAlaArgSerSerSerTrpAsnMetValLeuAlaArg835840845GlyArgProThrAspThrProSerTyrPheAsnGlyValLysValGln850855860IleGlnSerLeuAsnGlyGluHisLeuHisIleArgGluPheHisArg865870875880ValLysValGlyAspIleAlaThrGlyIleSerSerGlnIleProAla885890895AlaAlaPheSerLeuValThrLysAspGlyGlnProValArgTyrAsp900905910MetGluValProAspSerGlyIleAspLeuGlnCysThrLeuAlaPro915920925AspGlySerPheAlaTrpSerTrpArgValLysHisGlyGlnLeuGlu930935940AsnArgPro945(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 745 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:MetGluArgProProGlyLeuArgProGlyAlaGlyGlyProTrpGlu151015MetArgGluArgLeuGlyThrGlyGlyPheGlyAsnValCysLeuTyr202530GlnHisArgGluLeuAspLeuLysIleAlaIleLysSerCysArgLeu354045GluLeuSerThrLysAsnArgGluArgTrpCysHisGluIleGlnIle505560MetLysLysLeuAsnHisAlaAsnValValLysAlaCysAspValPro65707580GluGluLeuAsnIleLeuIleHisAspValProLeuLeuAlaMetGlu859095TyrCysSerGlyGlyAspLeuArgLysLeuLeuAsnLysProGluAsn100105110CysCysGlyLeuLysGluSerGlnIleLeuSerLeuLeuSerAspIle115120125GlySerGlyIleArgTyrLeuHisGluAsnLysIleIleHisArgAsp130135140LeuLysProGluAsnIleValLeuGlnAspValGlyGlyLysIleIle145150155160HisLysIleIleAspLeuGlyTyrAlaLysAspValAspGlnGlySer165170175LeuCysThrSerPheValGlyThrLeuGlnTyrLeuAlaProGluLeu180185190PheGluAsnLysProTyrThrAlaThrValAspTyrTrpSerPheGly195200205ThrMetValPheGluCysIleAlaGlyTyrArgProPheLeuHisHis210215220LeuGlnProPheThrTrpHisGluLysIleLysLysLysAspProLys225230235240CysIlePheAlaCysGluGluMetSerGlyGluValArgPheSerSer245250255HisLeuProGlnProAsnSerLeuCysSerLeuIleValGluProMet260265270GluAsnTrpLeuGlnLeuMetLeuAsnTrpAspProGlnGlnArgGly275280285GlyProValAspLeuThrLeuLysGlnProArgCysPheValLeuMet290295300AspHisIleLeuAsnLeuLysIleValHisIleLeuAsnMetThrSer305310315320AlaLysIleIleSerPheLeuLeuProProAspGluSerLeuHisSer325330335LeuGlnSerArgIleGluArgGluThrGlyIleAsnThrGlySerGln340345350GluLeuLeuSerGluThrGlyIleSerLeuAspProArgLysProAla355360365SerGlnCysValLeuAspGlyValArgGlyCysAspSerTyrMetVal370375380TyrLeuPheAspLysSerLysThrValTyrGluGlyProPheAlaSer385390395400ArgSerLeuSerAspCysValAsnTyrIleValGlnAspSerLysIle405410415GlnLeuProIleIleGlnLeuArgLysValTrpAlaGluAlaValHis420425430TyrValSerGlyLeuLysGluAspTyrSerArgLeuPheGlnGlyGln435440445ArgAlaAlaMetLeuSerLeuLeuArgTyrAsnAlaAsnLeuThrLys450455460MetLysAsnThrLeuIleSerAlaSerGlnGlnLeuLysAlaLysLeu465470475480GluPhePheHisLysSerIleGlnLeuAspLeuGluArgTyrSerGlu485490495GlnMetThrTyrGlyIleSerSerGluLysMetLeuLysAlaTrpLys500505510GluMetGluGluLysAlaIleHisTyrAlaGluValGlyValIleGly515520525TyrLeuGluAspGlnIleMetSerLeuHisAlaGluIleMetGluLeu530535540GlnLysSerProTyrGlyArgArgGlnGlyAspLeuMetGluSerLeu545550555560GluGlnArgAlaIleAspLeuTyrLysGlnLeuLysHisArgProSer565570575AspHisSerTyrSerAspSerThrGluMetValLysIleIleValHis580585590ThrValGlnSerGlnAspArgValLeuLysGluArgPheGlyHisLeu595600605SerLysLeuLeuGlyCysLysGlnLysIleIleAspLeuLeuProLys610615620ValGluValAlaLeuSerAsnIleLysGluAlaAspAsnThrValMet625630635640PheMetGlnGlyLysArgGlnLysGluIleTrpHisLeuLeuLysIle645650655AlaCysThrGlnSerSerAlaArgSerLeuValGlySerSerLeuGlu660665670GlyAlaValThrProGlnAlaTyrAlaTrpLeuAlaProAspLeuAla675680685GluHisAspHisSerLeuSerCysValValThrProGlnAspGlyGlu690695700ThrSerAlaGlnMetIleGluGluAsnLeuAsnCysLeuGlyHisLeu705710715720SerThrIleIleHisGluAlaAsnGluGluGlnGlyAsnSerMetMet725730735AsnLeuAspTrpSerTrpLeuThrGlu740745(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 756 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetSerTrpSerProSerLeuThrThrGlnThrCysGlyAlaTrpGlu151015MetLysGluArgLeuGlyThrGlyGlyPheGlyAsnValIleArgTrp202530HisAsnGlnGluThrGlyGluGlnIleAlaIleLysGlnCysArgGln354045GluLeuSerProArgAsnArgGluArgTrpCysLeuGluIleGlnIle505560MetArgArgLeuThrHisProAsnValValAlaAlaArgAspValPro65707580GluGlyMetGlnAsnLeuAlaProAsnAspLeuProLeuLeuAlaMet859095GluTyrCysGlnGlyGlyAspLeuArgLysTyrLeuAsnGlnPheGlu100105110AsnCysCysGlyLeuArgGluGlyAlaIleLeuThrLeuLeuSerAsp115120125IleAlaSerAlaLeuArgTyrLeuHisGluAsnArgIleIleHisArg130135140AspLeuLysProGluAsnIleValLeuGlnGlnGlyGluGlnArgLeu145150155160IleHisLysIleIleAspLeuGlyTyrAlaLysGluLeuAspGlnGly165170175SerLeuCysThrSerPheValGlyThrLeuGlnTyrLeuAlaProGlu180185190LeuLeuGluGlnGlnLysTyrThrValThrValAspTyrTrpSerPhe195200205GlyThrLeuAlaPheGluCysIleThrGlyPheArgProPheLeuPro210215220AsnTrpGlnProValGlnTrpHisSerLysValArgGlnLysSerGlu225230235240ValAspIleValValSerGluAspLeuAsnGlyThrValLysPheSer245250255SerSerLeuProTyrProAsnAsnLeuAsnSerValLeuAlaGluArg260265270LeuGluLysTrpLeuGlnLeuMetLeuMetTrpHisProArgGlnArg275280285GlyThrAspProThrTyrGlyProAsnGlyCysPheLysAlaLeuAsp290295300AspIleLeuAsnLeuLysLeuValHisIleLeuAsnMetValThrGly305310315320ThrIleHisThrTyrProValThrGluAspGluSerLeuGlnSerLeu325330335LysAlaArgIleGlnGlnAspThrGlyIleProGluGluAspGlnGlu340345350LeuLeuGlnGluAlaGlyLeuAlaLeuIleProAspLysProAlaThr355360365GlnCysIleSerAspGlyLysLeuAsnGluGlyHisThrLeuAspMet370375380AspLeuValPheLeuPheAspAsnSerLysIleThrTyrGluThrGln385390395400IleSerProArgProGlnProGluSerValSerCysIleLeuGlnGlu405410415ProLysArgAsnLeuAlaPhePheGlnLeuArgLysValTrpGlyGln420425430ValTrpHisSerIleGlnThrLeuLysGluAspCysAsnArgLeuGln435440445GlnGlyGlnArgAlaAlaMetMetAsnLeuLeuArgAsnAsnSerCys450455460LeuSerLysMetLysAsnSerMetAlaSerMetSerGlnGlnLeuLys465470475480AlaLysLeuAspPhePheLysThrSerIleGlnIleAspLeuGluLys485490495TyrSerGluGlnThrGluPheGlyIleThrSerAspLysLeuLeuLeu500505510AlaTrpArgGluMetGluGlnAlaValGluLeuCysGlyArgGluAsn515520525GluValLysLeuLeuValGluArgMetMetAlaLeuGlnThrAspIle530535540ValAspLeuGlnArgSerProMetGlyArgLysGlnGlyGlyThrLeu545550555560AspAspLeuGluGluGlnAlaArgGluLeuTyrArgArgLeuArgGlu565570575LysProArgAspGlnArgThrGluGlyAspSerGlnGluMetValArg580585590LeuLeuLeuGlnAlaIleGlnSerPheGluLysLysValArgValIle595600605TyrThrGlnLeuSerLysThrValValCysLysGlnLysAlaLeuGlu610615620LeuLeuProLysValGluGluValValSerLeuMetAsnGluAspGlu625630635640LysThrValValArgLeuGlnGluLysArgGlnLysGluLeuTrpAsn645650655LeuLeuLysIleAlaCysSerLysValArgGlyProValSerGlySer660665670ProAspSerMetAsnAlaSerArgLeuSerGlnProGlyGlnLeuMet675680685SerGlnProSerThrAlaSerAsnSerLeuProGluProAlaLysLys690695700SerGluGluLeuValAlaGluAlaHisAsnLeuCysThrLeuLeuGlu705710715720AsnAlaIleGlnAspThrValArgGluGlnAspGlnSerPheThrAla725730735LeuAspTrpSerTrpLeuGlnThrGluGluGluGluHisSerCysLeu740745750GluGlnAlaSer755__________________________________________________________________________
Non-Patent Citations
1 *Malinin et al, Nature, Feb. 6, 1997, vol. 385: pp. 540 544.
2Malinin et al, Nature, Feb. 6, 1997, vol. 385: pp. 540-544.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6087169 *Jul 29, 1998Jul 11, 2000Smithkline Beecham PlcHKABY60: polynucleotide encoding a helix-loop-helix ubiquitous kinase family polypeptide
US6242253 *Oct 8, 1998Jun 5, 2001Regents Of The University Of CaliforniaNucleotide sequence of enzyme which phosphorylates a ikb protein that inhibits the activity of the nf-kb transcription factor; probes; vectors; host cells; antisense agents; antiinflammatory agents; immunosuppressants
US6316239 *May 24, 2000Nov 13, 2001Smithkline Beecham PlcHKABY60 kinase family polypeptides
US6468755Aug 10, 2000Oct 22, 2002Joslin Diabetes Center, Inc.Method for identifying compounds for treatment of insulin resistance
US6630312Feb 2, 2001Oct 7, 2003Joslin Diabetes Center, Inc.Method for identifying compounds for treatment of insulin resistance
US6689575Feb 28, 2001Feb 10, 2004The Regents Of The University Of CaliforniaIκB kinase, subunits thereof, and methods of using same
US7285654 *Jan 8, 2003Oct 23, 2007Signal PharmaceuticalsStimulus-inducible protein kinase complex and methods of use therefor
US7314615Dec 17, 2003Jan 1, 2008The Regents Of The University Of CaliforniaIκB Kinase-β (IKKβ) binding antibodies and methods of using same
US7485456 *Apr 1, 1997Feb 3, 2009Yeda Research And Development Co. Ltd.Drug screening for a molecule capable of binding to NIK (nuclear factor kappa B inducing kinase); DNA sequence encoding a protein capable of binding to a tumor necrosis factor receptor-associated factor (TRAF) molecule, TRAF-binding proteins, isoforms, analogs, fragments and derivatives; gene expression
US8034340Nov 30, 2004Oct 11, 2011Yeda Research And Development Ltd.Method for treating an immune disorder by decreasing NIK-SIVA complex formation
US8236507Feb 3, 2009Aug 7, 2012Yeda Research And Development Co., Ltd.Modulators of TNF receptor associated factor (TRAF), their preparation and use
US8330026Apr 15, 2003Dec 11, 2012Yeda Research and Development Co., Ltd., Weizmann Institute of ScienceDerivatives of the NF-κB inducing enzyme, their preparation and use
WO2005051423A2 *Nov 30, 2004Jun 9, 2005Yeda Res & DevMethods and agents for immune modulation and methods for identifying immune modulators
U.S. Classification435/69.2, 435/325, 536/23.1, 536/23.5, 536/24.31, 435/243, 435/69.1, 435/410, 435/320.1
International ClassificationC12N5/10, A61K38/00, C12N15/09, C07K7/08, G01N33/53, C07K7/06, C12P21/02, C12N15/12, G01N33/15, C12N9/12, C07K14/47, G01N33/566
Cooperative ClassificationC12N9/1205, A61K38/00
European ClassificationC12N9/12C
Legal Events
Jan 18, 2011FPExpired due to failure to pay maintenance fee
Effective date: 20101201
Dec 1, 2010LAPSLapse for failure to pay maintenance fees
Jul 5, 2010REMIMaintenance fee reminder mailed
May 5, 2006FPAYFee payment
Year of fee payment: 8
Oct 18, 2005ASAssignment
Effective date: 20050617
Jun 7, 2005ASAssignment
Effective date: 20040813
Free format text: MERGER;ASSIGNOR:TULARIK INC.;REEL/FRAME:016309/0003
Effective date: 20040813
May 10, 2002FPAYFee payment
Year of fee payment: 4
Jul 3, 1997ASAssignment
Effective date: 19970703