Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS5877293 A
Publication typeGrant
Application numberUS 08/449,287
Publication dateMar 2, 1999
Filing dateMay 24, 1995
Priority dateJul 5, 1990
Fee statusLapsed
Also published asCA2065325A1, CA2065325C, DE69119211D1, DE69119211T2, EP0491031A1, EP0491031B1, WO1992001059A1
Publication number08449287, 449287, US 5877293 A, US 5877293A, US-A-5877293, US5877293 A, US5877293A
InventorsJohn Robert Adair, Mark William Bodmer, Andrew Mountain, Raymond John Owens
Original AssigneeCelltech Therapeutics Limited
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
CDR grafted anti-CEA antibodies and their production
US 5877293 A
Abstract
The present invention provides humanized antibody molecules (HAMs) having specificity for carcinoembryonic antigen (CEA) and having an antigen binding site wherein at least one of the complementarity determining regions (CDRs) of the variable domains is derived from the mouse monoclonal antibody A5B7 (A5B7 MAB) and the remaining immunoglobulin-derived parts of the HAM are derived from a human immunoglobulin. The HAMs may be chimeric humanized antibodies or CDR-grafted humanized antibodies and are preferably produced by recombinant DNA techniques. The HAMs are useful for in vivo diagnosis and therapy.
Images(31)
Previous page
Next page
Claims(9)
We claim:
1. An antibody molecule having specificity for carcinoembryonic antigen comprising a composite heavy chain and a complementary light chain, said composite heavy chain having a variable domain comprising the amino acid sequence of SEQ ID NO: 10.
2. An antibody molecule having specificity for carcinoembryonic antigen comprising a composite heavy chain and a complementary light chain, said composite heavy chain having a variable domain comprising the amino acid sequence of SEQ ID NO: 12.
3. An antibody molecule having specificity for carcinoembryonic antigen comprising a composite light chain and a complementary heavy chain, said composite light chain having a variable domain comprising the amino acid sequence of SEQ ID NO: 6.
4. An antibody molecule having specificity for carcinoembryonic antigen comprising a composite light chain and a complementary heavy chain, said composite light chain having a variable domain comprising the amino acid sequence of SEQ ID NO: 8.
5. An antibody molecule having specificity for carcinoembryonic antigen comprising a composite light chain and a composite heavy chain, said composite light chain having a variable domain comprising an amino acid sequence selected from SEQ ID NOs: 6 and 8 and said composite heavy chain having a variable domain comprising an amino acid sequence selected from SEQ ID NOs: 10 and 12.
6. The antibody molecule of claim 1, 2, 3, 4, or 5, wherein said antibody molecule is selected from the group consisting of a complete antibody molecule, Fab, Fab', (Fab')2, Fv, and a single chain antibody.
7. The antibody molecule of claim 1, 2, 3, 4, or 5, further wherein said molecule has an effector or reporter molecule attached thereto.
8. The antibody molecule of claim 1, 2, 3, or 4 wherein the complementary chain is a chimeric chain.
9. A therapeutic or diagnostic composition comprising the antibody molecule of claim 1, 2, 3, 4, or 5 in combination with a pharmaceutically acceptable excipient, diluent, or carrier.
Description

This is a continuation of application Ser. No. 08/154,389, filed Nov. 17, 1993, now abandoned, which is a continuation of Ser. No. 07/847,995, filed Apr. 21, 1992, now abandoned, which is a continuation of PCT/GB90/01108 filed Jul. 5, 1991.

FIELD OF THE INVENTION

The present invention relates to humanised antibody molecules (HAMs) having specificity for Carcinoembryonic Antigen (CEA) and to processes for their production using recombinant DNA technology.

The term "humanised antibody molecule" (HAM) is used to describe a molecule having an antigen binding site derived from an immunoglobulin from a non-human species, the remaining immunoglobulin-derived parts of the molecule being derived from a human immunoglobulin. The antigen binding site may comprise either complete variable domains fused onto human constant domains or only the complementarity determining regions (CDRs) grafted onto appropriate human framework regions in the variable domains. The abbreviation "MAb" is used to indicate a monoclonal antibody.

In the description, reference is made to publications by number, and these publications are listed in numerical order at the end of the description.

BACKGROUND OF THE INVENTION

Natural immunoglobulins have been known for many years, as have the various fragments thereof, such as the Fab, (Fab')2 and Fc fragments, which can be derived by enzymatic cleavage. Natural immunoglobulins comprise a generally Y-shaped molecule having an antigen-binding site towards the outer end of each upper arm. The remainder of the structure, and particularly the stem of the Y, mediates the effector functions associated with immunoglobulins.

Natural immunoglobulins have been used in assay, diagnosis and, to a more limited extent, therapy. However, such uses, especially in therapy, have been hindered by the polyclonal nature of natural immunoglobulins. A significant step towards the realisation of the potential of immunoglobulins as therapeutic agents was the discovery of procedures for the production of monoclonal antibodies of defined specificity (1). However, most MAbs are produced by hybridomas which are fusions of rodent spleen cells with rodent myeloma cells. The resultant MAbs are therefore essentially rodent proteins. There are very few reports of the production of human MAbs.

Since most available MAbs are of rodent origin, they are naturally antigenic in humans and thus can give rise to an undesirable immune response termed the HAMA (Human Anti-Mouse Antibody) response. Therefore, the use of rodent MAbs as therapeutic agents in humans is inherently limited by the fact that the human subject will mount an immunological response to the MAb and will either remove it entirely or at least reduce its effectiveness.

Therefore proposals have been made for making non-human MAbs less antigenic in humans. Such techniques can be generically termed "humanisation" techniques. These techniques generally involve the use of recombinant DNA technology to manipulate DNA sequences encoding the polypeptide chains of the antibody molecule.

Early methods for humanising MAbs related to production of chimeric antibodies in which an antigen binding site comprising the complete variable domains of one antibody are fused to constant domains derived from a second antibody. Methods for carrying out such chimerisation procedures are described in EP0120694 (Celltech Limited), EP0125023 (Genentech Inc.), EP-A-0171496 (Res. Dev. Corp. Japan), EP-A-0173494 (Stanford University), and EP-A-0194276 (Celltech Limited). The Celltech EP 0194276 application discloses a process for preparing an antibody molecule having the variable domains from a mouse MAb and the constant domains from a human immunoglobulin. It also describes the production of an antibody molecule comprising the variable domains of a mouse MAb, the CH1 and CL domains of a human immunoglobulin, and a non-immunoglobulin-derived protein in place of the Fc portion of the human immunoglobulin.

Subsequently a number of further patent applications have been published relating to chimeric antibodies, including tumour specific chimeric antibodies (e.g. WO 87/02671, Int. Gen. Eng. Inc.; EP 0256654, Centocor; EP 0266663, Int. Gen. Eng. Inc. & Oncogen; WO 89/00999, Int. Gen. Eng. Inc. and EP 0332424, Hybritech Inc.). The Genentech (EP0125023) and Hybritech (EP0332424) patent applications relate to anti-carcinoembryonic antigen (anti-CEA) chimeric antibodies.

Such humanised chimeric antibodies, however, still contain a significant proportion of non-human amino acid sequence, i.e. the complete variable domains. Thus such humanised antibodies may elicit some HAMA response, particularly if administered over a prolonged period Begent et al (ref. 2)!.

In an alternative approach, described in EP-A-02394000 (Winter), the complementarity determining regions (CDRs) of a mouse MAb have been grafted onto the framework regions of the variable domains of a human immunoglobulin by site directed mutagenesis using long oligonucleotides. Such CDR-grafted humanised antibodies are less likely to give rise to a HAMA response than humanised chimeric antibodies in view of the lower proportion of non-human amino acid sequence which they contain. There are 3 CDRs (CDR1, CDR2 and CDR3) in each of the heavy and light chain variable domains.

The earliest work on CDR-grafted humanised MAbs was carried out on MAbs recognising synthetic antigens, such as the NP or NIP antigens. However, recently examples in which a mouse MAb recognising lysozyme and a rat MAb recognising an antigen on human T cells respectively were humanised have been described by Verhoeyen et al (3) and Riechmann et al (4). The preparation of the CDR-grafted antibody to the antigen on human T cells is also described in WO 89/07452 (Medical Research Council). More recently Queen et al (5) have described the preparation of a humanised CDR-grafted antibody that binds to the interleukin 2 receptor.

It has been widely suggested that immunoglobulins, and in particular MAbs, could potentially be very useful in the diagnosis and treatment of cancer (6, 7). There has therefore been much activity in trying to produce immunoglobulins or MAbs directed against tumour-specific antigens. So far, over one hundred MAbs directed against a variety of human carcinomas have been used in various aspects of tumour diagnosis or treatment (8).

There have been a number of papers published concerning the production of chimeric monoclonal antibodies recognising cell surface antigens. For instance, Sahagan et al (9) disclose a genetically engineered murine/human chimeric antibody which retains specificity for a tumour-associated antigen. Also Nishimura et al (10) disclose a recombinant murine/human chimeric monoclonal antibody specific for common acute lymphocytic leukemia antigen.

We have now prepared humanised antibodies to carcinoembryonic antigen derived from the anti-CEA mouse MAb A5B7 (11).

Our copending International Patent Application PCT/GB 90/02017 relates to the CDR-grafting of antibodies in general and describes, among other things, that antibodies having specificity for cancer markers such as CEA, e.g. the A5B7 monoclonal antibody, have been successfully CDR-grafted according to the procedure described therein.

SUMMARY OF THE INVENTION

According to the present invention, there is provided a humanised antibody molecule (HAM) having specificity for carcinoembryonic antigen (CEA) and having an antigen binding site wherein at least one of the complementarity determining regions (CDRs) of the variable domain is derived from the mouse monoclonal antibody A5B7 (A5B7 MAb) and the remaining immunoglobulin-derived parts of the HAM are derived from a human immunoglobulin.

GENERAL DESCRIPTION OF THE INVENTION

The HAM may comprise a chimeric humanised antibody or a CDR-grafted humanised antibody. When the HAM comprises a CDR-grafted humanised antibody, the heavy and/or light chain variable domains may comprise only one or two A5B7 derived CDRs; though preferably all three heavy and light chain CDRs are derived from A5B7.

The A5B7 MAb is a mouse MAb of the type IgG1-Kappa raised against purified CEA which had been denatured by heating to 85░ C. for 35 minutes. The A5B7 MAb has been extensively studied at Charing Cross Hospital, London, UK (11). Immunohistochemical studies have demonstrated that the A5B7 MAb reacts with CEA producing tumours. Its distribution is within malignant glands in the cell cytoplasm, at the cell surface and in necrotic debris. However, it shows no significant cross-reactivity with a wide spectrum of normal human tissues. The molecular cloning and sequencing of the A5B7 heavy and light chain cDNAs is described hereinafter and the VL and VH cDNA and predicted amino acid sequences are given in FIG. 1.

Surprisingly it has been found that humanising the A5B7 MAb, in particular by CDR-grafting, does not substantially adversely affect its binding activity, and this produces a HAM which is extremely useful in both therapy and diagnosis of certain carcinomas.

Preferably, the HAM of the present invention is produced by recombinant DNA technology.

The HAM of the present invention may comprise: a complete antibody molecule, having full length heavy and light chains; a fragment thereof, such as the Fab, Fab', (Fab')2 or FV fragment; a single chain antibody fragment, e.g. a single chain FV; a light chain or heavy chain monomer or dimer; including fragments or analogues of any of these or any other molecule with the same specificity as the A5B7 antibody.

The HAM of the present invention may have attached to it an effector or reporter molecule. For instance, the HAM may have a macrocycle for chelating a heavy metal atom, or a toxin such as ricin, attached to it by a covalent bridging structure. Alternatively, the procedures of recombinant DNA technology may be used to produce a HAM in which the Fc fragment, CH3 or CH4 domain of a complete antibody molecule has been replaced by or has attached thereto by peptide linkage a functional non-immunoglobulin protein, such as an enzyme or toxin molecule.

The remaining non-A5B7, immunoglobulin derived parts of the HAM may be derived from any suitable human immunoglobulin. For instance, when the HAM is a CDR-grafted HAM, appropriate variable region framework sequences may be used having regard to class/type of the A5B7 donor antibody from which the antigen binding regions are derived. Preferably, the type of human framework used is of the same/similar class/type as the donor antibody (A5B7 is IgG1 Kappa). Advantageously, the framework is chosen to maximise/optimise homology with the donor antibody sequence particularly at positions spacially close or adjacent to the CDRs. Examples of human frameworks which may be used to construct CDR-grafted HAMs are LAY, POM, TUR, TEI, KOL, NEWM, REI and EU; for instance KOL and NEWM for the heavy chain and REI for the light chain and EU for both the heavy chain and the light chain. Preferably the LAY framework is used as the human framework for both heavy and light chain variable domains, in view of its high level of homology with A5B7.

Also human constant domains of the HAM may be selected having regard to the proposed function of the antibody, in particular the effector functions which may be required. For example, the constant domains may be human IgA, IgE, IgG or IgM domains. In particular, IgG human constant domains may be used especially of the IgG1 and IgG3 isotypes, when the HAM is intended for therapeutic purposes and antibody effector functions are required. Alternatively, IgG2 and IgG4 isotypes may be used when the HAM is intended for purposes for which antibody effector functions are not required e.g. for imaging, diagnostic or cytotoxic targeting purposes.

However, the remainder of the HAM need not comprise only protein sequences from human immunoglobulins. For instance, a gene may be constructed in which a DNA sequence encoding part of a human immunoglobulin chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule.

According to a second aspect of the present invention, there is provided a process for producing the HAM of the first aspect of the invention, which process comprises:

(a) producing in an expression vector an operon having a DNA sequence which encodes an antibody heavy or light chain comprising a variable domain wherein at least one of the CDRs of the variable domain is derived from the A5B7 MAb and the remaining immunoglobulin-derived parts of the antibody chain are derived from a human immunoglobulin;

(b) producing in an expression vector an operon having a DNA sequence which encodes a complementary antibody light or heavy chain comprising a variable domain wherein at least one of the CDRs of the variable domain is derived from the A5B7 MAb and the remaining immunoglobulin-derived parts of the antibody chain are derived from a human immunoglobulin;

(c) transfecting a host cell with the or each vector; and

(d) culturing the transfected cell line to produce the HAM.

The cell line may be transfected with two vectors, the first vector containing an operon encoding a light chain-derived polypeptide and the second vector containing an operon encoding a heavy chain-derived polypeptide. Preferably, the vectors are identical except in so far as the coding sequences and selectable markers are concerned so as to ensure as far as possible that each polypeptide chain is equally expressed.

Alternatively, a single vector may be used, the vector including the sequences encoding both light chain- and heavy chain-derived polypeptides.

Thus in further aspects the invention also includes DNA sequences coding for the heavy and light chains, cloning and expression vectors containing the DNA sequences, host cells transformed with the DNA sequences and processes for producing the heavy and/or light chains and antibody molecules comprising expressing the DNA sequences in the transformed host cells.

The general methods by which the vectors may be constructed, transfection methods and culture methods are well known per se. Such methods are shown, for instance, in references 12 and 13.

The DNA sequences which encode the A5B7 amino acid sequence may be obtained by methods well known in the art. For example, the A5B7 coding sequences may be obtained by genomic cloning, or cDNA cloning from the A5B7 hybridoma cell line. Positive clones may be screened using appropriate probes for the heavy and light chain genes in question. Also PCR cloning may be used.

DNA coding for human immunoglobulin sequences may be obtained in any appropriate way. For example, DNA sequences coding for preferred human acceptor frameworks such as LAY, POM, KOL, REI, EU, TUR, TEI and NEWM, are widely available to workers in the art.

The standard techniques of molecular biology may be used to prepare DNA sequences coding for the CDR-grafted products. Desired DNA sequences may be synthesised completely or in part using oligonucleotide synthesis techniques. Site-directed mutagenesis and polymerase chain reaction (PCR) techniques may be used as appropriate. For example, oligonucleotide directed synthesis as described by Jones et al (14) may be used. Also oligonucleotide directed mutagenesis of a pre-existing variable region as, for example, described by Verhoeyen et al (3) or Riechmann et al (4) may be used. Also enzymatic filling in of gapped oligonucleotides using T4 DNA polymerase as, for example, described by Queen et al (5) may be used.

Any suitable host cell/vector system may be used for expression of the DNA sequences coding for the chimeric CDR-grafted heavy and light chains. Bacterial e.g. E. coli, and other microbial systems may be used, in particular for expression of antibody fragments, e.g. FV, Fab and Fab' fragments, and single chain antibody fragments e.g. single chain FVs. Eucaryotic e.g. mammalian host cell expression systems may be used for production of larger CDR-grafted antibody products, including complete antibody molecules. Suitable mammalian host cells include CHO cells and myeloma or hybridoma cell lines.

The present invention also includes therapeutic and diagnostic compositions containing the HAM of the invention and uses of such compositions in therapy and diagnosis.

Such therapeutic and diagnostic compositions typically comprise a HAM according to the invention in combination with a pharmaceutically acceptable excipient diluent or carrier, e.g. for in vivo use. Therapeutic and diagnostic uses typically comprise administering an effective amount of a HAM according to the invention to a human subject.

In the HAM of the first aspect of the invention and the process of the second aspect of the invention the heavy and light chain variable domains of the HAM may comprise either the entire variable domains of the A5B7 MAb or may comprise framework regions of a human variable domain having grafted thereon one, some or all of the CDRs of the A5B7 MAb. Thus the HAM may comprise a chimeric humanised antibody or a CDR-grafted humanised antibody.

When the HAM is a CDR-grafted humanised antibody, in addition to the CDRs, specific variable region framework residues may correspond to non-human, i.e. the A5B7 mouse, residues. Preferably the CDR-grafted humanised antibodies of the present invention include CDR-grafted humanised antibodies as defined in our co-pending patent application, International Patent Application PCT/GB 90/02017. The disclosure of PCT/GB 90/02017 is incorporated herein by reference.

Preferably the CDRs of the light chain correspond to the Kabat CDRs at CDR1 (positions 24-34) and CDR2 (positions 50-56) and to the structural loop residues positions 91-96) or Kabat CDR residues (positions 89-97) in CDR3. In addition the light chain may have mouse residues at one or more of positions 1, 2 and/or 3, 46, 47, 49, 60, 70, 84, 85 and 87 and preferably has mouse residues at at least positions 46 and 47.

In addition to the CDRs, the HAM heavy chain preferably has mouse residues at positions 23 and/or 24 and 71 and/or 73. Additionally, the heavy chain may have mouse residues at one, some or all of positions 48 and/or 49, 69, 76 and/or 78, 80, 88 and/or 91 and 6. Preferably also, the CDRs of the heavy chain correspond to the Kabat CDR at CDR2 (positions 50-65), the structural loop residues at CDR3 (positions 95-100) and a composite of both the Kabat and structural loop residues at CDR1 (positions 24-35); for example, when the human variable region framework used is KOL. Alternatively, the CDRs of the heavy chain may comprise mouse residues at positions 26 to 35 for CDR1, positions 50 to 65 for CDR2 and positions 94 to 100 for CDR3; for example, when the human variable region framework used in EU. In addition EU has a particularly idiosyncratic J region between residues 103 to 113 and it may be useful to include the murine amino acids, or a consensus human J region or a suitable combination of both at residues 103 to 108 inclusive.

In a particularly preferred embodiment LAY human variable region frameworks are used for both the CDR-grafted heavy and light chains, in which case the light chain preferably comprises mouse A5B7 residues at positions 1, 2, 3, 4, 46 and 71, and especially also at positions 21, 47 and 73, of the variable domain frameworks. Similarly, the heavy chain preferably comprises mouse A5B7 residues at positions 1, 24, 48, 49, 72, 73, 76 and 93, and especially also at positions 82b and 86, of the variable domain frameworks. Also when the LAY human variable domain frameworks are used, the variable domains preferably comprises A5B7 mouse CDRs at residues 24 to 34 (CDR1) 50 to 56 (CDR2) and 89 to 97 (CDR3) for the light chain and at residues 26 to 35 (CDR1), 50 to 65 (CDR3) and 95 to 102 (CDR3) for the heavy chain.

The residue designations given above and elsewhere in the present application are numbered according to the Kabat numbering (15).

BRIEF DESCRIPTION OF THE DRAWINGS

The present invention is now described, by way of illustration only, in the following examples which refer to the accompanying FIGS. 1-19, in which:

FIG. 1 shows the DNA sequences (SEQ ID NOS. 1 and 3) encoding the unprocessed variable regions of the A5B7 MAb obtained by sequencing cDNA clones together with the predicted amino acid sequence; (SEQ ID NOS. 2 and 4)

FIG. 2 is a schematic diagram of the construction by restriction and ligation of the chimeric heavy chain gene;

FIG. 3 is a schematic diagram of the construction by site-directed mutagenesis, restriction and ligation of the chimeric light chain gene;

FIG. 4 shows an ELISA analysis of COS-cell transfectant supernatants. The level of antigen-binding capacity in the supernatant of COS-cell transfectants was analysed as described later. Dilution curves were plotted out against the optical density of the colour change;

FIG. 5 shows plasmid diagrams for plasmids pBG7, pBG11, pBG14, pHMC19, pHMC20 and pHMC21;

FIG. 6 shows plasmid diagrams for plasmids pHMC29, pHMC30 and pHMC31;

FIG. 7 shows a SDS-PAGE gel of chimeric FAb' and chimeric DFM products under both reducing and non-reducing conditions;

FIG. 8 shows the DNA and protein sequences (SEQ ID NOS. 5 and 6) for the A5B7 grafted light chain, gL-1 variable domain;

FIG. 9 shows similar sequences (SEQ ID NOS. 7 and 8) for the A5B7 grafted light chain gL-2, variable domain;

FIG. 10 shows similar sequences (SEQ ID NOS. 9 and 10) for the A5B7 grafted heavy chain gH1, variable domain;

FIG. 11 shows similar sequences (SEQ ID NOS. 11 and 12) for the A5B7 grafted heavy chain-gH2, variable domain.

FIG. 12 shows plasmid diagrams for plasmids pMRR010, pMRR014, pAL43, pAL44, pAL45 and pAL46;

FIG. 13 is graphs showing the results of direct CEA binding ELISAs on supernatants from transient expression of chimeric/grafted hybrids and a chimeric/chimeric standard;

FIG. 14 shows similar graphs for grafted/grafted transfections as well as the chimeric/chimeric standard;

FIG. 15 shows plasmid diagrams of plasmids pMRR020, pAL45, pAL46, pAL49 and pAL50 indicating the derivation of the latter two plasmids;

FIG. 16 shows plasmid diagrams of various plasmids indicating the derivation of plasmids pHMC43, pHMC44, pAL53 and pAL54;

FIG. 17 shows plasmid diagrams for pACtac, pMMR28 and pMRR45;

FIG. 18 shows graphs of CEA binding ELISAs on E. coli supernatants containing A5B7 chimeric Fab', and

FIG. 19 shows similar graphs for A5B7 grafted Fab'.

DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION Example 1 Molecular Cloning and Sequencing of the A5B7 Heavy and Light Chain cDNAs

Polyadenylated RNA was isolated from the A5B7 hybridoma cell line using the guanidinium isothiocyanate/lithium chloride method (12). Double stranded cDNA was synthesised (16) and a cDNA library was constructed in plasmid pSP64 (17) vector using EcoRI linkers. Two screening probes were synthesised, complementary to mouse immunoglobulin heavy and light chain constant regions. The heavy chain probe was a 19 mer complementary to residues 115-133 in the CH1 domain of the mouse γ1 sequence (18). The light chain probe was a 20 mer complementary to residues 4658-4677 of the genomic mouse CK sequence (19). The probes were radio-labelled at the 5' terminus with γ32 P! ATP using T4 polynucleotide kinase (Amersham International) and used to screen the cDNA library.

Clones which contained the complete leader, variable and constant regions of both the heavy and light chains were isolated and designated as pBG1 and pBG2. Nucleotide sequence analysis was carried out according to the chain termination procedure (20).

The 950 base pair EcoRI insert in pBG1 was fully sequenced. The EcoRI insert in pBG2 was shown to comprise approximately 1700 base pairs by agarose gel electrophoresis. The variable domain and the 5' region of the CH1 domain were sequenced, as was the 3' end of the clone to confirm the presence of the correct mouse γ1 termination sequences. The DNA and predicted amino acid sequences for the unprocessed variable regions of pBG1 and pBG2 are shown in FIG. 1 and in SEQ ID NOS. 1-4.

With reference to FIG. 1. Panel A shows the sequence coding for the VL domain and the predicted amino acid sequence. Panel B shows the sequence (SEQ ID NOS. 1 and 2) coding for the VH domain together with the predicted amino acid sequence. (SEQ ID NOS. 3 and 4) The putative sites of cleavage of the signal peptide are indicated by arrows. Examination of the derived amino acid sequence revealed considerable homology with other characterised immunoglobulin genes, and enabled the extent of the leader, variable and constant domains to be accurately determined. In addition MAb A5B7 was confirmed to be an IgG1 K antibody.

Example 2 Preparation and Testing of Chimeric Antibody Products

A. Construction of Chimeric Mouse-Human Heavy Chain Genes

The construction of vectors containing the human constant region isotype series, pRB18(IgG1), pRB26(IgG2), pRB20 (IgG3) and pRB21 (IgG4) is described in published International Patent Application WO 89/01783. The A5B7 VH DNA sequence was isolated as a EcoRI-BanI fragment and was ligated to the following linking oligonucleotide to give an EcoRI-HindIII VH fragment (FIG. 2).

R1120 (SEQ ID NO: 13) 5' GCACCACTCTCACCGTGAGCTC

R1121 (SEQ ID NO: 14) GTGAGAGTGGCACTCGAGTCGA5'

This fragment was ligated to the human HindIII-BamHI containing fragments of the IgG1, 2, 3 & 4 genes cloned in pAT153 to give pBG3, 4, 5 & 6.

The chimeric heavy chain genes were isolated as EcoRI-BamHI fragments from the pAT IgG plasmids and cloned into pEE6 vector (21) cut with EcoRI & BclI, to give plasmids pBG 7,8,9 & 10. The pEE6 plasmid contains the strong promoter/enhancer and transcriptional control element from the human cytomegalovirus immediate early gene (hCMV-IE) inserted into a unique HindIII site upstream of the EcoRI site and is described in detail in published International Patent Application WO 89/01036. In addition, an SV40 origin of replication is provided by the SV40 early promoter fragment which drives as selectable marker gene, a guanine phosphoribosyl transferase gene (gpt) inserted into a unique BamHI site. The plasmid also contains an ampicillin-resistance gene allowing selection and propagation in bacterial hosts.

B. Construction of the Chimeric Mouse-Human Light Chain Gene

A HindIII restriction enzyme site was introduced into the mouse light chain cDNA clone, pBG1 by site-directed mutagenesis (23) using the following oligonucleotide: (SEQ ID NO: 15)

5' TTTGATTTCAAGCTTGGTGC 3'

Introduction of the HindIII site was verified by DNA sequencing. The A5B7 VL sequence was isolated as an EcoRI/HindIII fragment. It was combined with a HindIII/EcoRI fragment comprising the human Ck constant region and ligated into the unique EcoRI site of pEE6. (FIG. 3). The resulting plasmid pHMC19 also contained the neomycin-resistant gene (neo) under the control of the SV40 early promoter.

C. Transfections and ELISA Analysis of Antibody Production

The four chimeric heavy chain expression constructs described above were transfected together with chimeric light chain into COS-1 cells (24) for transient expression of chimeric products. The cells were left to incubate in DNA-DEAE dextran solution for six hours, then shocked for two minutes with 10% DMSO in HEPES-buffered saline. The cells were washed and incubated in medium containing 10% foetal calf serum for 72 hours.

Following incubation at 37░ C. for 72 hours the cell supernatants were analysed by ELISA for heavy and light chain production and binding of antigen.

The medium (500 μl per 105 cells) was removed for ELISA analysis.

To quantify assembled antibody production Microtitre plates were coated with 0.25 μg per well of sheep antibody reactive against human specific epitopes on the heavy or light chains. Supernatants or lysates from transfected COS cells were diluted 1:2 or 1:4 respectively in sample conjugate buffer containing 0.1M Tris-HCl pH 7.0, 0.1M sodium chloride, 0.02% Tween 20 and 0.2% casein. 100 μl of each diluted sample were added to each well and incubated for 1 hour at room temperature with gentle agitation. Following washing six times with wash buffer (phosphate buffered saline containing 0.2% Tween 20, pH 7.2), 100 μl of 1:5000 dilution of standard horseradish peroxidase--conjugated antibody reactive against human specific epitopes were added per well. The plates were incubated for 1 hour at room temperature, and then washed six times with wash buffer. 100 μl of substrate buffer containing 0.1 mg/ml tetramethylbenzidine (TMB), 0.1M sodium citrate, pH 6.0 and 0.005% H2 O2 were added to each well to generate a colour change. The reaction was terminated after 2-3 minutes by adjusting the solution to pH 1.0 with 1.5M sulphuric acid. The optical density was determined at 450 nm for each well by measurement in a Dynatech laboratories MR600 microplate reader. Standard curves were generated using known concentrations of the appropriate human immunoglobulins.

Antigen binding assays were performed in an analogous manner. Microtitre plates were coated with 0.25 μg per well of purified CEA. Following washing six times in wash buffer, samples from COS-cell transfections were added as previously, and the same subsequent procedures carried out, using goat anti-mouse or -human F(ab')2 linked to HRP as the second antibody.

Assembly assays, which detect the presence of associated polypeptide chains, demonstrated the formation of multimers containing at least one heavy and one light chain when both genes were co-transfected. Antigen binding analysis (see above) demonstrated that the chimeric heavy and chimeric light chain co-transfections generated an antibody molecule capable of recognising antigen. The antigen binding ELISA data from one experiment are presented in FIG. 4. These experiments demonstrate that chimerisation of the antibody molecule does not have a significant effect on its antigen recognition capability.

D. Immunoprecipitation of Antibody Molecules from Biosynthetically Labelled COS-Cell Transfectants

Following transfection, COS cells were allowed to recover for 24 hours in DMEM containing 10% foetal calf serum. The medium was then replaced with methionine-free DMEM, to which 35 S! methionine (NEN) had been added at 100 μCi/ml. The cells were metabolically labelled for 48 hours. Analysis of the assembly and secretion of antibody molecules was performed by immunoprecipitation using anti-human F(ab')2 bound to Protein A-Sepharose. Affinity-purified rabbit antibodies against human IgG F(ab')2 were used for immunoprecipitations, following coupling to Protein A--Sepharose. Secreted antibodies were analysed on a SDS-10% PAGE system under reducing and non-reducing conditions. The gel was treated with an autoradiography enhancer, dried and exposed to Fuji RX film.

The antiserum immunoprecipitated proteins with an apparent molecular weight of 55K and 28K, corresponding to the heavy and light immunoglobulin chains respectively. A comparison of immunoprecipitations analysed by reducing and non-reducing SDS-PAGE indicated that the heavy and light chains were assembled as the correct tetrameric molecule.

Example 3 Preparation and Comparison of Chimeric Whole Antibody and Fab' Products

Stable cell lines expressing chimeric whole antibody and Fab' products were established and chimeric whole antibody, Fab', F(ab')2, and synthetically cross-linked DFM (Di Fab' Maleimide) products were prepared and tested.

First of all, however, it was necessary to construct a DNA sequence coding for the chimeric Fab' and vectors for expression of this sequence.

A. Construction of Chimeric Mouse/Human Heavy Chain Gene and Vectors for Fab' Expression

The plasmid containing the A5B7 chimeric heavy chain, IgG4, (pBG10) was restricted with BstEll and Bglll. The larger vector fragment containing the hCMV promoter and A5B7 VH plus the 5' part of CH1 domain was isolated. The plasmid pJA115 (described in International Patent Application WO 89/01974) was restricted with BstE11 and Bglll. A fragment containing the 3' end of CH1 plus the IgG4 hinge containing a cys to ala change was isolated and ligated into the pBG10 vector.

The resulting vector, pBG14, contains the A5B7 Fd' heavy chain IgG4 (cys to ala).

The Assay procedures used in this and subsquent Examples were as follows:

Assembly ELISAs

The ELISA for measuring yields of whole antibodies used microwell plates coated with goat F(ab')2 IgG Fc. Humanised IgG bound following incubation with culture supernatant samples was revealed with horseradish peroxidase (HRP) conjugated murine anti-human kappa chain antibody. Concentrations of chimeric or CDR-grafted whole antibody in samples were interpolated from a calibration curve generated from serial dilutions of purified chimeric A5B7 IgG1.

The ELISA for measuring yields of Fab's used microwell plates coated with murine anti-human IgG Fd. Following incubation with samples bound humanised Fab' was revealed as in the whole antibody assembly ELISA. Concentrations of chimeric or CDR-grafted A5B7 Fab' in samples were interpolated from a calibration curve generated from serial dilutions of purified chimeric A5B7 Fab'.

CEA Binding Assays

The direct CEA binding ELISA used microwell plates coated with CEA. Following incubation with serial dilutions of culture supernatant sample-bound IgG or fragments was revealed as for the assembly ELISA. Binding versus dilution curves were normalised against antibody concentration as determined by the assembly assays.

The competition RIA for anti-CEA activity involved competition of a series of 125 I-labelled murine or chimeric A5B7 IgG1 with humanised IgG or fragments thereof from culture supernatant samples for binding to CEA coated beads. Binding activity was determined by measuring bead associated radioactivity. The assay was calibrated by competition with standard preparations of chimeric or murine A5B7 IgG1 and plotting % bound cpm versus antibody concentration. Interpolated apparent A5B7 concentration of unknowns was normalised by dividing by the assembly assay result to give a specific activity. Finally specific activity was expressed as % relative potency by comparison to that obtained from a positive control chimeric A5B7 culture supernatant produced during the same experiment.

The relative potency of purified murine and chimeric A5B7 Fab' and F(ab')2 fragments and murine IgG was investigated using the competition RIA. In addition, the direct binding ELISA was run in competition mode, by coincubation of the test specimen with murine A5B7 IgG1, for confirmation of relative potency.

Chimeric A5B7 Fab' was purified by ion-exchange chromatography on DEAE-sepharose followed by hydrophobic interaction chromatography on octyl-sepharose. Cross-linking was carried out by the standard one pot procedure using 1,6-bismaleimidohexane as cross-linker, with a 2.2 fold excess of Fab' to cross-linker at 0.9 mg/ml. Due to the small scale of the experiment purification was carried out by HPLC gel filtration (GF-250XL). This yielded an A5B7 chimeric DFM (Di Fab' maleimide) product.

B. Development of CHO Cell Lines expressing Chimeric A5B7 IgG1 and Chimeric IgG4 Fab' delta cys

Two types of CHO cell line, amplifiable and non-amplifiable, were developed expressing chimeric A5B7 IgG1 whole antibody and chimeric A5B7 IgG4 FAb' delta cys. The chimeric A5B7 IgG1 whole antibody was used as a standard for assay development and for comparison of chimeric and grafted in biodistribution and therapy studies in tumour-bearing mice.

Non-amplifiable cell lines

Non-amplifiable cell lines for chimeric whole antibody and Fab' were first constructed. Although such cell lines are relatively low yielding, they are more readily and rapidly prepared and were used for rapid generation of material for development of procedures for purification and for assays. pHMC19 (see Example 2) is a plasmid containing the chimeric A5B7 light chain 3' to the hCMV promoter. This plasmid was transfected into CHO-K1 cells with selection for neomycin resistance and spot assays performed on 30 transfectants with anti-human kappa antibody to identify the best producing clones. Assays with the same antibody on representative cell lines identified a stable cell line, designated HCN1.37, secreting the chimeric A5B7 light chain with a specific production rate of 1-2 μg/ml/106 cells. The cell line was retransfected with plasmids pBG7 and pBG14, as described previously, these plasmids carrying the heavy chain genes for chimeric A5B7 IgG1 and chimeric IgG4 Fab' delta cys respectively, in the pEE6hCMV gpt vector (see FIG. 5). Cell lines yielding approximately 16 mg/l chimeric IgG1 (designated HCN1.37/g1.1 and g1.7) and approximately 5 mg/l chimeric Fab' (designated HCN1.37/delta cys3) after purification were identified among these retransfectants by assembly and direct CEA binding assays. These cell lines were used to make test quantities of chimeric whole antibody and Fab'.

Amplifiable Cell Lines

Cell lines capable of amplification by the GS vector system and intended to give yields of chimeric A5B7 Fab' delta cys suitable for eventual manufacture were then constructed. The Cla1-EcoR1 fragment of pBG11 carrying the hCMV promoter and the chimeric A5B7 light chain gene was first cloned between the Cla1 and EcoR1 sites of pEE12 (22) to give plasmid pHMC20 (see FIG. 5). Plasmid pHMC30 (see FIG. 6) carrying the genes for both the chimeric light chain and chimeric IgG4 Fab' delta cys heavy chain was constructed by ligating the large Nae1-Fsp1 fragment of pHMC20 (carrying the light chain gene) to the EcoRV-Fsp1 fragment of pHMC28, a derivative of pBG14 in which the gpt gene has been removed from the BamHI site. pHMC30 is a double gene plasmid suitable for development of an amplifiable cell line, using the mouse myeloma cell line NSO as host cell line, expressing chimeric A5B7 Fab' since it contains the GS cDNA for selection of transfectants. Selection and amplification of transfectants in CHO cells requires expression of the GS minigene rather than the cDNA. A double gene plasmid suitable for development of an amplifiable CHO cell line was constructed by ligating the Mlu1-Fsp1 fragment of pHMC30, carrying both the chimeric light and heavy chain expression units, with the GS minigene containing fragment of pEE14 (25). The resulting plasmid, designated pHMC31 (see FIG. 6), was transfected into CHO-K1 cells with selection on 25 μM MSX. Specific production rates were determined on these transfectants, and seven chosen for amplification. The specific production rates for these seven transfectants before amplification were as follows (in units of μg/106 cells/24 hrs): HC3.36, 1.3; HC3.21, 0.65; HC3.33, 0.65; HC5.19, 0.14; HC5.24, 3.4; HC5.33, 3.7; HC5.39, 0.35. Selection for cells potentially with high copy number of the inserted plasmid sequences was achieved by increasing the MSX concentration to between 100 and 1000 μM, screening for surviving cell lines and measuring specific production rates. Specific copy number estimates were not done.

C. Purification of Chimeric ASB7 IgG1

Chimeric IgG1 was purified by a modification of the procedure described for B72.3 by Colcher et al (26). CHO cell supernatants were concentrated by spiral cartridge ultrafiltration, then purified by affinity chromatography on protein A Sepharose, with elution at pH3. Reducing and non-reducing SDS-PAGE showed the purified antibody to be fully assembled, with a purity of >95%.

D. Purification and Cross-linking of Chimeric A5B7 Fab'

Chimeric A5B7 Fab' was purified by ion-exchange chromatography DEAE-Sepharose following by hydrophobic interaction chromatography on octyl-Sepharose. CHO cell culture supernatant containing A5B7 Fab' was concentrated ten fold by ultrafiltration and diluted to the original volume with 10 mM tris pH 7.5 to reduce the conductivity to <4 mS. This material was then applied to a column of DEAE-Sepharose fast flow pre-equilibrated with 10 mM tris pH 7.5, and the flow through which contains the Fab' collected. The flow through from the DEAE-Sepharose column was then concentrated by ultrafiltration and made 2M in ammonium sulphate. Any precipitate was removed by centrifugation and the sample then applied to a column of octyl-Sepharose pre-equilibrated with 10 mM tris pH 7.5 containing 2M ammonium sulphate. The Fab' bound to the column and was washed with equilibration buffer and eluted by decreasing the ammonium sulphate concentration to 1M. The elute was then dialysed into 100 mM sodium acetate/citrate pH6 and concentrated by ultrafiltration.

The purified Fab' was cross-linked by firstly generating a free thiol at the hinge followed by cross-linking with 1,6-bismaleimidohexane. Partial reduction to generate a free thiol was achieved by incubation of the Fab' with 4.5 mM β-mercaptoethylamine for 30 minutes at 37░ C. The reducing agent was then removed by desalting on a column of Sephadex G-25 and the reduced Fab' immediately cross-linked by incubation with 1,6-bismaleimidohexane at a molar ratio of 1:2.2 bismaleimidohexane:Fab' with a Fab' concentration of 0.9 mg/ml. After overnight incubation at 37░ C. the cross-linked material was purified by HPLC gel filtration using a DuPont Zorbax GF-250XL column in 0.2M phosphate pH 7.0. The cross-linking yield was approximately 58%.

The purified Fab' and cross-linked di-Fab (DFM) were analysed by SDS-PAGE under both reducing and non-reducing conditions (FIG. 7). The purified Fab' ran as expected with a molecular weight of approximately 50 KDa under non-reducing conditions which reduced to Fd' and light chains at 25 KDa. The purified cross-linked di-Fab revealed the expected molecular weight for the non-reduced dimer of 100 KDa which reduced to cross-linked Fd' at approximately 50 KDa and light chain at approximately 25 KDa.

E. Antigen Binding Activity of Chimeric A5B7 IgG1, Fab' and DFM

The relative potencies of murine and chimeric IgGs and fragments were measured by the competition RIA. The results are given in Table 1. All the bivalent species--including the chimeric DFM--gave potency equivalent to that of murine A5B7 IgG. The murine Fab' rendered monovalent by alkylation, showed a tenfold reduced potency, as would be predicted by avidity considerations. The monovalent chimeric Fab', however, displayed an intermediate potency. Measurements of binding activity on the same samples using the direct binding ELISA in competition mode gave very similar results, with the chimeric Fab' again showing an intermediate potency. Since the chimeric Fab' was not alkylated its increased binding activity compared to the murine Fab' is likely to be due to some degree of antigen induced dimerisation.

              TABLE 1______________________________________Relative potencies of various A5B7 constructs by competitive RIAConstruct     % Relative Potency______________________________________Chimeric IgG  100Murine IgG    93 + 23Chimeric DFM  104 + 28Murine F(ab)2         97 + 22Chimeric Fab' 20 + 15Murine Fab'   8 + 5______________________________________
Example 4

Humanised, CDR-grafted versions of A5B7 were also prepared.

Construction and Expression of CDR-grafted A5B7 Genes

FIG. 1 shows the DNA and amino acid sequences (SEQ ID NOS: 1-4) of the VL and VH domains for A5B7. CDR-grafted VH and VL domains were designed substantially as described in International Patent Application No. PCT/GB 90/02017. The amino acid sequence of A5B7 VH (SEQ ID NO: 4) shows considerable homology to the consensus sequence of the human VH III subgroup, as defined by Kabat et al, (15), while the VL sequence (SEQ ID NO: 2) shows considerable homology to those of the human VII and III subgroups. The human framework sequences available within these subgroups are: LAY(VH :VL), POM(VH :VL), KOL (VH):REI(VL), KOL(VH):EU(VL), TUR(VH):REI(VL), TUR(VH):Eu(VL), TEI(VH):REI(VL), TEI(VH):EU(VL). Of these LAY was chosen as the human framework because it has the highest homology to A5B7 and also the potential advantage of matched VH and VL chains. CDR sequences and other residues potentially important for antigen binding were identified as described in International Patent Application No. PCT/GB 90/02017, and for each V domain two constructs were assembled. The first constructs, gL1 (SEQ ID NOS. 5 and 6) and gH1 (SEQ ID NOS. 9 and 10) contain murine sequences in the CDRs and at other positions predicted to be important for antigen binding and at which human and A5B7 sequences differ. The gL1 light chain (SEQ ID NOS. 5 and 6) has murine CDRs at residues 24-34 (CDR1), 50-56 (CDR2) and 89-97 (CDR3) and additional murine residues within the frameworks at residues 1, 2, 3, 4, 46 and 71. The gH1 heavy chain (SEQ ID NOS. 9 and 10) has murine CDRs at residues 26-35 (CDR1), 50-65 (CDR2) and 95-102 (CDR3) and additional murine residues within the frameworks at residues 1, 48, 49, 72, 73, 76 and 93.

The second constructs, gL2 (SEQ ID NOS. 7 and 8) and gH2 (SEQ ID NOS. 11 and 12) are more conservative, containing the murine sequences present in the first constructs together with three extra murine residues for VL and two for VH. For gL2 (SEQ ID NOS. 7 and 8) these residues (positions 21, 47 and 73 on the Kabat numbering system) are potentially involved in packing of the domain. For gH2 (SEQ ID NOS. 11 and 12) the extra murine residues are at positions (82b and 86) where LAY has amino acids which are unusual for human VH sequences and where A5B7 has residues of more common occurrence in human VH s.

FIGS. 8, 9, 10 and 11 show the DNA and amino acid sequences of gL1, gL2, gH1 and gH2 respectively (SEQ ID NOS. 1-12 respectively). In these Figures single letter underlining in the amino acid sequences indicate a residue in the framework region which has been changed to the corresponding murine residue. Also in these Figures solid single line underlining of the amino acid sequences indicates the CDR residues. These DNA sequences were assembled from oligonucleotides (indicated by double line underlining in the respective Figure) by the PCR overlap-assembly procedure, using a Polymerase Chain Reaction (PCR) procedure, using oligonucleotides of approximately 80 bases alternating on the sense and anti-sense strands. The oligonucleotides overlapped by 20 bases, such that annealing led to the formation of partially double stranded molecules. The gaps were filled in by Taq polymerase and the double stranded material amplified by PCR using short oligonucleotides corresponding to the sequence of the 5' end of each strand as amplifiers. The amplified fragments were digested with appropriate restriction enzymes to expose the restriction sites for cloning.

Amplified fragments of the appropriate size were digested with Hindlll and Apal for VH, and BstBl and Spll for VL to expose the cloning sites. The VH fragments were cloned into the expression vector pMRR014 and the VL fragments into pMRR010. pMRR010 and pMRR014 are hCMV expression vectors designed to accept humanised V regions so as to be readily expressed transiently in CHO or COS cells and then readily to be reconstructed to give a single vector capable of stable expression and gene amplification in NSO cells. This gave plasmids pAL43 (for gL1), pAL44 (gL2), pAL45 (gH1) and pAL46 (gH2) as shown in FIG. 12. These plasmids contain the full length CDR-grafted antibody genes (IgG1 for heavy chain, kappa for light chain) in a configuration suitable for expression in CHO cells. Clones containing the correct sequence were identified by DNA sequencing.

In order to assess the CEA binding activity of the grafted chains co-expression, experiments in a transient CHO cell system were first performed with chimeric partners. Thus pAL43 and pAL44 were co-transfected into the CHO L761 h cell line (27) together with the chimeric A5B7 heavy chain expression plasmid pBG7, while pAL45 and pAL46 were co-transfected with the light chain expression plasmid pBG11. Co-transfections of pBG7 and pHMC19 were also performed to provide a chimeric/chimeric standard against which to compare activity of the chimeric/grafted hybrids. FIG. 13 shows the results of direct CEA binding ELISAs on the crude supernatants resulting from these transfections, and indicates that all the grafted/chimeric hybrids show binding activity similar to that of the chimeric/chimeric standard. Considerable variation was observed between the various hybrids in the yields of antibody. This variation was also very apparent when grafted/grafted co-transfections were performed. Indeed, the yields observed for gL1/gH1 and gL2/gH1 were too low to permit reliable estimates of CEA binding activity. Both the gL1/gH2 and gL2/gH2 combinations, however, bound CEA at approximately 60% as well as the double chimeric antibody in the direct binding assay (see FIG. 14). Competition RIAs were also performed on the crude CHO cell supernatants for gL1/gH2 and gL2/gH2. The results, shown in Table 2, show that these grafted variants displayed approximately 42% and 47% respectively of the potency of the chimeric in these more stringent assays, with gL2/gH2 showing slightly greater potency than gL1/gH2.

              TABLE 2______________________________________Estimates of Anti-CEA Activity in Transfected CHO Cell Supernatants forGrafted Variants of A5B7 by Competition RIA          Undiluted            Specific                    relativeConstruct        activity                    potency______________________________________Chimeric A5B7    1.17    100 ▒ 6Grafted A5B7     0.49    42 ▒ 4gL1/qH2Grafted A5B7     0.55    47 ▒ 3gL2/gH2______________________________________
Example 5

Similarly CDR-grafted A5B7 Fab' genes were constructed and expressed.

A. Construction of CDR-grafted A5B7 Fab' Genes

pMRR020 is a pEE6 gpt expression plasmid with restriction sites such that coding sequences of the human IgG4 CH1 and delta cys (i.e. single cysteine variant) hinge domains (see FIG. 15). A fragment containing these two domains was isolated by performing a PCR reaction on pMRR020 using oligonucleotide R1053 as the forward primer and R2371 as the back primer as shown below.

R1053 (SEQ ID NO: 16) 5' GTCGACAGACTAACAGACTGTTCC 3'

R2371 (SEQ ID NO:17) 5' ATGATCAATGAATTCATCATGGGGCTGATGGGCACGGGGGACCATATTTGGACTC 3'

Use of the latter primer results also in the removal of the inconvenient Apa1 site in the hinge coding region. The PCR reaction produced a fragment of 320 bp, which was cloned into pAL45 and pAL46 to give pAL49 and pAL50 respectively (FIG. 15) carrying the full length CDR-grafted Fd delta cys genes. The CH1 and hinge domains and the cloning junction regions were sequenced to confirm the absence of secondary mutations.

B. Development of CHO Cell Lines Expressing CDR-grafted A5B7 IgG1 Whole Antibody and CDR-grafted A5B7 IqG4 Fab' delta cys genes

To make stable cell lines expressing CDR-grafted IgG1 whole antibody and CDR-grafted Fab' the gL1 and gL2 genes were first isolated as Cla1-EcoR1 fragments from pAL43 and pAL44 and cloned into the vector pMRR017, a derivative of pEE14 with a useful poly-linker inserted at the BamHI site to give plasmids pHMC36 and pHMC37 respectively (see FIG. 16). The gH1(IgG1), gH2(IgG1), gH1(Fd delta cys) and gH2(Fd delta cys) genes were isolated as Hindlll-BamH1 fragments from pAL45, 46, 49 and 50 respectively and cloned along with an EcoR1-Hindlll fragment carrying the SV40 polyA and hCMV promoter between the EcoR1 and BamH1 sites of pHMC36 to give plasmids pHMC43 (gL1-gH1), pHMC44(gL1-gH2), pAL53 (gL1-gH1Fd delta cys) and pAL54 (gL1-gH2Fd delta cys). These GS double gene expression plasmids (see FIG. 16) were transfected into CHO-K1 cells to give CDR-grafted IgG1 whole antibody and CDR-grafted Fab' producing cell lines substantially as described in previous Examples.

Example 6 Production of A5B7 antibody fragments in E. coli

Chimeric and CDR-grafted A5B7 Fab' fragments (the gL1gH2 CDR-grafted variant was used) were also expressed in an E. coli secretion system, this being the preferred expression host for large scale production of antibody fragments.

For expression/secretion in E. coli the natural signal sequences of the A5B7 heavy and light chains were first replaced with the signal sequence of the E. coli outer membrane protein ompA (Movva et al, 28). A 92 base pair fragment encoding the ompA signal sequence and including the ompA translation initiation region was assembled from oligonucleotides and cloned into the phagemid vector pSK+ (from Stratagene Cloning Systems) between the Xhol and Hindlll sites. The DNA and amino acid sequence (SEQ ID NOS. 18, 19, and 20) of the 92 base pair fragment were as follows: ##STR1##

A clone shown by DNA sequencing to carry the above sequence in pSK+ was designated pSKompA.

For the chimeric A5B7 light chain a 650 base pair Sac1-EcoR1 fragment encoding most of VL and all of C kappa was isolated from pHMC19. A precise fusion of the chimeric Light chain to the ompA signal sequence was made by ligating this Sac1-EcoR1 fragment into pSKompA digested with Hindlll and EcoR1 together with a 54 base pair Hindlll-Sacl fragment assembled from oligonucleotides and comprising the DNA sequence encoding the 3' region of the ompA signal sequence and the 5' region of A5B7 VL. The sequence of the 51 base pair fragment was as follows:

(SEQ ID NO: 21) 5' AGCTCAAACTGTTCTCTCCCAGTCTCCAGCAATCCTGTCTGCATCTC 3'

(SEQ ID NO: 22) 3' GTTTGACAAGAGAGGGTCAGAGGTCGTTAGGACAGACGTAGAGGTCC 5'

A clone containing the correct sequence was identified by DNA sequencing and designated pSKompA-cLc.

For the chimeric A5B7 heavy chain a 580 base pair Ava11-EcoR1 fragment encoding most of VH and all of the CH1 and (delta cys) hinge domains was isolated from pBG14. A precise fusion of the chimeric heavy chain to the ompA signal sequence was made by ligating the Ava11-EcoR1 fragment into pSKompA digested with Hindlll and EcoR1 together with a 120 base pair fragment assembled from oligonucleotides and comprising the DNA sequence encoding the 3' end of the ompA signal sequence and the 5' region of VH. The sequence of the 120 base pair fragment was as follows: ##STR2##

A clone containing the correct sequence was identified by DNA sequencing and designated pSKompA-cFd.

For expression of the chimeric Fab' the ompA-cLc fusion was then removed from pSKompA-cLc on a Xho1-EcoR1 fragment and cloned into the expression vector pACtac digested with Sa11 and partially with EcoR1 (see FIG. 17). pACtac was constructed by replacing the Ampr selectable marker and pUC18-derived replication functions of the expression plasmid, pTTQ9 (Amersham International) with the Cmr selectable marker and replication functions of pACYC184 (Chang & Cohen, 1978, J. Bacteriol. 134: 1141-1156). (Partial EcoR1 digestion was required because pACtac contains a second EcoR1 site, in the Cmr gene.) A plasmid with ompA-cLc inserted adjacent to the tac promoter was identified by restriction mapping and DNA sequencing and designated pMRR024.

The ompA-cFd fragment was removed from pSKompA-cFd as a Xho1-Sma1 fragment and cloned into pSP73 (Promega Corporation) digested with Sal1 and Pvu11, to give a plasmid designated pMRR027. The ompA-cFd fusion was then removed from pMRR027 as an EcoR1 fragment, which was cloned into pMRR024 partially digested with EcoR1. A clone carrying ompA-cFd oriented for transcription from the tac promoter (along with ompA-cLc) was identified by restriction mapping and DNA sequencing and designated pMRR028.

pMRR028 was transformed into E. coli strain W3110 (ATCC strain 27325). Strain W3110 (pMRR028) was grown in a 1.5 L fermenter in medium containing chloramphenicol to maintain selection for retention of the plasmid. At a culture O.D 600 nm of 10 expression of the A5B7 Fab' genes from the tac promoter was induced by adding the inducer IPTG to a final concentration of 1 mM. Direct CEA binding assays were performed on crude culture supernatant samples taken from this culture at time points 0, 3, 4, 5, 6, 7 and 8 hours after induction. The results of these assays, together with that of a chimeric A5B7 Fab' standard made and purified from mammalian cells are shown in FIG. 18. They demonstrate the accumulation of active chimeric A5B7 Fab' in the E. coli culture medium. SDS-PAGE analysis on the same crude culture medium samples revealed proteins with mobility of the size expected for Fab' heavy and light chains. N-terminal protein sequencing on these proteins revealed the N-terminal amino acid sequences of mature A5B7 heavy and light chains, showing that the ompA signal sequence had been accurately cleaved from both. Estimates (by OD 280 nM measurements and by SDS-PAGE) for the chimeric Fab' in the E. coli culture medium were performed: the results suggested yields in excess of 30 mg/L after purification.

For the CDR-grafted A5B7 Fab' light chain a 620 base pair Hph1-EcoR1 fragment encoding most of VL for the gL1 variant and all of C kappa was isolated from pAL43. A precise fusion of the grafted light chain to the ompA signal sequence was made by ligating the Hph-EcoR1 fragment into pSKompA digested with Hindlll and EcoR1 together with a 62 base pair fragment assembled from oligonucleotides and encoding the 3' end of the ompA signal sequence and the 5' end of the CDR-grafted VL. The sequence of the synthetic fragment was as follows: (SEQ ID NOS. 25 and 26)

AGCTCAGACTGTACTCACTCAGAGTCCAAGTAGTCTCAGTGTAAGTGTAGGTGATAGGGTAAGTCTGACATGAGTGAGTCTCAGGTTCATCAGAGTCACATTCACATCCACTATCCCAT

A clone carrying the correct sequence was identified by DNA sequencing and designated pMRR034.

For the CDR-grafted A5B7 Fab' heavy chain gene a 720 base pair Pvu11-EcoR1 fragment encoding most of VH for the gH2 variant and all of CH1 and the (delta cys) hinge domains was isolated from pAL50. A precise fusion of this grafted H chain to the ompA signal sequence was made by ligating this Pvu11-EcoR1 fragment into pSKompA digested with Hindlll and EcoR1 together with a very short fragment assembled from oligonucleotides and encoding the 3' end of the ompA signal and the 5' end of the CDR-grafted VH. The sequence of the short adaptor fragment was as follows:

(SEQ ID NO:27) 5' AGCTGAGGTGCAG 3'

3' CTCCACGTC 5'

A clone containing the correct sequence was identified by DNA sequencing and designated pMRR037.

For expression of CDR-grafted Fab' the ompA-gL1 fusion was taken from pMRR034 as a Xho1-EcoR1 fragment and cloned into pACtac digested with Sall and partially with EcoR1. A clone carrying ompA-gL1 adjacent to the tac promoter was identified by restriction mapping and DNA sequencing and designated pmRR038. The ompA-gH2 fusion was then taken from pMRR037 as a Xho1-Sma1 fragment and cloned into pSP73 doubly digested with Pvu11 and EcoR1 to give a plasmid designated pMRR041. The ompA-gH2 fusion was then removed from pMRR041 as an EcoR1 fragment and cloned into pMRR038 partially digested with EcoR1. A clone carrying the ompA-gH2 fusion oriented for transcription from the tac promoter (along with ompA-gL1) was identified by restriction mapping and DNA sequencing and designated pMRR045.

pMRR045 was transformed into E. coli strain W3110 and the W3110 (pMRR045) strain resulting was grown in a 1.5 L fermenter. Expression of the CDR-grafted Fab' genes was induced as described above for the chimeric Fab' genes. Crude culture supernatant samples from this culture at time points 1, 4, 5, 6, 11 and 22 hours after induction were used in direct CEA binding assays and yield estimates. The results of the CEA binding assays are given in FIG. 19 and show the accumulation of material active in antigen binding. SDS-PAGE analysis of these supernatant samples demonstrated the presence of proteins of the size expected, and suggested yields in excess of 30 mg/L.

REFERENCES

1. Kohler & Milstein, Nature, 265, 495-497, 1975.

2. Begent et al, Br. J. Cancer, 62: 487 (1990).

3. Verhoeyen et al, Science, 239, 1534-1536, 1988.

4. Riechmann et al, Nature, 332, 323-324, 1988.

5. Queen et al, Proc. Natl. Acad. Sci., USA, 86: 10029-10033, 1989 and WO 90/07861.

6. Ehrlich, P., Collected Studies on Immunity, 2, John Wiley & Sons, New York, 1906.

7. Levy & Miller, Annm. Rev. Med., 34, 107-116, 1983.

8. Schlom & Weeks, Important Advances in Oncology, 170-192, Wippincott, Philadelphia, 1985.

9. Sahagan et al, J. Immunol., 137, 3, 1066-1074. 1986

10. Nishimura et al, Cancer Res., 47 999-1005, 1987.

11. Harwood et al, Br. J. Cancer, 54, 75-82, 1986.

12. Maniatis et al, Molecular Cloning, Cold Spring Harbor, N.Y., 1982.

13. Primrose and Old, Principles of Gene Manipulation, Blackwell, Oxford, 1980.

14. Jones et al, Nature, 54, 75-82, 1986.

15. Kabat et al, (1987), Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA, and Wu, T. T., and Kabat, E. A., J. Exp. Med., 132, 211-250, 1970.

16. Gubler and Hoffman, Gene, 25, 263-269, 1983.

17. Melton et al, Nucl. Acids Res., 12, 7035-7056, 1984.

18. Honjo et al, Cell, 18, 559-568, 1979.

19. Max et al, J. Biol. Chem., 256, 5116-5120, 1981.

20. Sanger et al, PNAS, 74, 5463-5467, 1977.

21. Stephens and Cockett, Nucl. Acids Res., 17, 7110, 1989

22. Krawinkel and Rabbits, EMBO J., 1, 403-407, 1982.

23. Kramer et al, Nucl. Acids Res., 12, 9441-9446, 1984.

24. Whittle et al, Prot. Eng., 1, 6, 499-505, 1987.

25. Bebbington, C. R., "Expression of Antibody Genes in Non-Lymphoid Mammalian Cells", Methods, 2: 136-145, 1991.

26. Colcher et al, (1989), Cancer Res., 49, 1738-1745.

27. Cockett et al, Nucl. Acids. Res., 19, 319-325. 1991

28. Movva et al, J. Bio. Chem., 255, 27-29, 1980.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 27(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 387 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: A5B7 light chain Vl domain(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..387(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:ATGGATTTTCAAGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCTTCA48MetAspPheGlnValGlnIlePheSerPheLeuLeuIleSerAlaSer151015GTCATAATGTCCAGAGGACAAACTGTTCTCTCCCAGTCTCCAGCAATC96ValIleMetSerArgGlyGlnThrValLeuSerGlnSerProAlaIle202530CTGTCTGCATCTCCAGGGGAGAAGGTCACAATGACTTGCAGGGCCAGC144LeuSerAlaSerProGlyGluLysValThrMetThrCysArgAlaSer354045TCAAGTGTAACTTACATTCACTGGTACCAGCAGAAGCCAGGATCCTCC192SerSerValThrTyrIleHisTrpTyrGlnGlnLysProGlySerSer505560CCCAAATCCTGGATTTATGCCACATCCAACCTGGCTTCTGGAGTCCCT240ProLysSerTrpIleTyrAlaThrSerAsnLeuAlaSerGlyValPro65707580GCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATC288AlaArgPheSerGlySerGlySerGlyThrSerTyrSerLeuThrIle859095AGCAGAGTGGAGGCTGAAGATGCTGCCACTTATTACTGCCAACATTGG336SerArgValGluAlaGluAspAlaAlaThrTyrTyrCysGlnHisTrp100105110AGTAGTAAACCACCGACGTTCGGGGGAGGCACCAAGCTGGAAATCAAA384SerSerLysProProThrPheGlyGlyGlyThrLysLeuGluIleLys115120125CGG387Arg(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 129 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAspPheGlnValGlnIlePheSerPheLeuLeuIleSerAlaSer151015ValIleMetSerArgGlyGlnThrValLeuSerGlnSerProAlaIle202530LeuSerAlaSerProGlyGluLysValThrMetThrCysArgAlaSer354045SerSerValThrTyrIleHisTrpTyrGlnGlnLysProGlySerSer505560ProLysSerTrpIleTyrAlaThrSerAsnLeuAlaSerGlyValPro65707580AlaArgPheSerGlySerGlySerGlyThrSerTyrSerLeuThrIle859095SerArgValGluAlaGluAspAlaAlaThrTyrTyrCysGlnHisTrp100105110SerSerLysProProThrPheGlyGlyGlyThrLysLeuGluIleLys115120125Arg(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 420 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: A5B7 heavy chain Vh domain(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..420(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:ATGAAGTTGTGGCTGAACTGGATTTTCCTTGTAACACTTTTAAATGGT48MetLysLeuTrpLeuAsnTrpIlePheLeuValThrLeuLeuAsnGly151015ATCCAGTGTGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAG96IleGlnCysGluValLysLeuValGluSerGlyGlyGlyLeuValGln202530CCTGGGGGTTCTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTC144ProGlyGlySerLeuArgLeuSerCysAlaThrSerGlyPheThrPhe354045ACTGATTACTACATGAACTGGGTCCGCCAGCCTCCAGGAAAGGCACTT192ThrAspTyrTyrMetAsnTrpValArgGlnProProGlyLysAlaLeu505560GAGTGGTTGGGTTTTATTGGAAACAAAGCTAATGGTTACACAACAGAG240GluTrpLeuGlyPheIleGlyAsnLysAlaAsnGlyTyrThrThrGlu65707580TACAGTGCATCTGTGAAGGGTCGGTTCACCATCTCCAGAGATAAATCC288TyrSerAlaSerValLysGlyArgPheThrIleSerArgAspLysSer859095CAAAGCATCCTCTATCTTCAAATGAACACCCTGAGAGCTGAGGACAGT336GlnSerIleLeuTyrLeuGlnMetAsnThrLeuArgAlaGluAspSer100105110GCCACTTATTACTGTACAAGAGATAGGGGGCTACGGTTCTACTTTGAC384AlaThrTyrTyrCysThrArgAspArgGlyLeuArgPheTyrPheAsp115120125TACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA420TyrTrpGlyGlnGlyThrThrLeuThrValSerSer130135140(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 140 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetLysLeuTrpLeuAsnTrpIlePheLeuValThrLeuLeuAsnGly151015IleGlnCysGluValLysLeuValGluSerGlyGlyGlyLeuValGln202530ProGlyGlySerLeuArgLeuSerCysAlaThrSerGlyPheThrPhe354045ThrAspTyrTyrMetAsnTrpValArgGlnProProGlyLysAlaLeu505560GluTrpLeuGlyPheIleGlyAsnLysAlaAsnGlyTyrThrThrGlu65707580TyrSerAlaSerValLysGlyArgPheThrIleSerArgAspLysSer859095GlnSerIleLeuTyrLeuGlnMetAsnThrLeuArgAlaGluAspSer100105110AlaThrTyrTyrCysThrArgAspArgGlyLeuArgPheTyrPheAsp115120125TyrTrpGlyGlnGlyThrThrLeuThrValSerSer130135140(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 411 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: gL1-A5B7 variable region(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 22..405(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GGACTGTTCGAAGCCGCCACCATGTCTGTCCCCACCCAAGTCCTCGGACTC51MetSerValProThrGlnValLeuGlyLeu1510CTGCTGCTGTGGCTTACAGATGCCAGATGTCAGACTGTACTCACTCAG99LeuLeuLeuTrpLeuThrAspAlaArgCysGlnThrValLeuThrGln152025AGTCCAAGTAGTCTCAGTGTAAGTGTAGGTGATAGGGTAACTATCACT147SerProSerSerLeuSerValSerValGlyAspArgValThrIleThr303540TGTAGGGCCAGTAGTAGTGTAACTTATATCCATTGGTATCAGCAGAAA195CysArgAlaSerSerSerValThrTyrIleHisTrpTyrGlnGlnLys455055CCAGGTCTCGCCCCAAAAAGTCTCATCTATGCCACTAGTAACCTCGCC243ProGlyLeuAlaProLysSerLeuIleTyrAlaThrSerAsnLeuAla606570AGTGGTGTACCATCTAGATTCAGTGGTAGCGGTAGTGGTACTGATTAT291SerGlyValProSerArgPheSerGlySerGlySerGlyThrAspTyr75808590ACTTTCACTATCAGTAGTCTCCAGCCAGAAGATATCGCCACTTACTAT339ThrPheThrIleSerSerLeuGlnProGluAspIleAlaThrTyrTyr95100105TGCCAGCATTGGAGTAGTAAACCACCAACTTTCGGTCAGGGTACTAAA387CysGlnHisTrpSerSerLysProProThrPheGlyGlnGlyThrLys110115120GTAGAAGTAAAACGTACGGGCCGG411ValGluValLysArgThr125(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 128 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetSerValProThrGlnValLeuGlyLeuLeuLeuLeuTrpLeuThr151015AspAlaArgCysGlnThrValLeuThrGlnSerProSerSerLeuSer202530ValSerValGlyAspArgValThrIleThrCysArgAlaSerSerSer354045ValThrTyrIleHisTrpTyrGlnGlnLysProGlyLeuAlaProLys505560SerLeuIleTyrAlaThrSerAsnLeuAlaSerGlyValProSerArg65707580PheSerGlySerGlySerGlyThrAspTyrThrPheThrIleSerSer859095LeuGlnProGluAspIleAlaThrTyrTyrCysGlnHisTrpSerSer100105110LysProProThrPheGlyGlnGlyThrLysValGluValLysArgThr115120125(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 411 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: gL2-A5B7 variable region(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 22..405(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:GGACTGTTCGAAGCCGCCACCATGTCTGTCCCCACCCAAGTCCTCGGACTC51MetSerValProThrGlnValLeuGlyLeu1510CTGCTGCTGTGGCTTACAGATGCCAGATGTCAGACTGTACTCACTCAG99LeuLeuLeuTrpLeuThrAspAlaArgCysGlnThrValLeuThrGln152025AGTCCAAGTAGTCTCAGTGTAAGTGTAGGTGATAGGGTAACTATGACT147SerProSerSerLeuSerValSerValGlyAspArgValThrMetThr303540TGTAGGGCCAGTAGTAGTGTAACTTATATCCATTGGTATCAGCAGAAA195CysArgAlaSerSerSerValThrTyrIleHisTrpTyrGlnGlnLys455055CCAGGTCTCGCCCCAAAAAGTTGGATCTATGCCACTAGTAACCTCGCC243ProGlyLeuAlaProLysSerTrpIleTyrAlaThrSerAsnLeuAla606570AGTGGTGTACCATCTAGATTCAGTGGTAGCGGTAGTGGTACTGATTAT291SerGlyValProSerArgPheSerGlySerGlySerGlyThrAspTyr75808590ACTCTCACTATCAGTAGTCTCCAGCCAGAAGATATCGCCACTTACTAT339ThrLeuThrIleSerSerLeuGlnProGluAspIleAlaThrTyrTyr95100105TGCCAGCATTGGAGTAGTAAACCACCAACTTTCGGTCAGGGTACTAAA387CysGlnHisTrpSerSerLysProProThrPheGlyGlnGlyThrLys110115120GTAGAAGTAAAACGTACGGGCCGG411ValGluValLysArgThr125(2) INFORMATION FOR SEQ ID NO:8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 128 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:MetSerValProThrGlnValLeuGlyLeuLeuLeuLeuTrpLeuThr151015AspAlaArgCysGlnThrValLeuThrGlnSerProSerSerLeuSer202530ValSerValGlyAspArgValThrMetThrCysArgAlaSerSerSer354045ValThrTyrIleHisTrpTyrGlnGlnLysProGlyLeuAlaProLys505560SerTrpIleTyrAlaThrSerAsnLeuAlaSerGlyValProSerArg65707580PheSerGlySerGlySerGlyThrAspTyrThrLeuThrIleSerSer859095LeuGlnProGluAspIleAlaThrTyrTyrCysGlnHisTrpSerSer100105110LysProProThrPheGlyGlnGlyThrLysValGluValLysArgThr115120125(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 464 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: gH1-A5B7 variable region(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 22..459(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:GCGCGCAAGCTTGCCGCCACCATGGAATGGAGCTGGGTCTTTCTCTTCTTC51MetGluTrpSerTrpValPheLeuPhePhe1510CTGTCAGTAACTACAGGAGTCCATTCTGAGGTGCAGCTGCTGGAGTCT99LeuSerValThrThrGlyValHisSerGluValGlnLeuLeuGluSer152025GGAGGAGGACTGGTGCAGCCTGGAGGATCTCTGAGACTGTCTTGTGCA147GlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysAla303540ACATCTGGATTCACCTTCACAGACTACTACATGAATTGGGTGAGACAG195ThrSerGlyPheThrPheThrAspTyrTyrMetAsnTrpValArgGln455055GCACCTGGAAAGGGACTCGAGTGGCTGGGCTTCATCGGAAATAAGGCA243AlaProGlyLysGlyLeuGluTrpLeuGlyPheIleGlyAsnLysAla606570AATGGATACACAACAGAGTACTCTGCATCTGTGAAGGGAAGATTCACA291AsnGlyTyrThrThrGluTyrSerAlaSerValLysGlyArgPheThr75808590ATTTCCAGAGACAAGAGCAAGTCCACACTGTACCTGCAGATGAATGGA339IleSerArgAspLysSerLysSerThrLeuTyrLeuGlnMetAsnGly95100105CTGCAGGCAGAGGTGTCTGCAATTTACTACTGTACAAGAGACAGAGGA387LeuGlnAlaGluValSerAlaIleTyrTyrCysThrArgAspArgGly110115120CTGAGATTCTACTTCGACTACTGGGGACAGGGAACACTGGTGACAGTG435LeuArgPheTyrPheAspTyrTrpGlyGlnGlyThrLeuValThrVal125130135TCTTCTGCCTCAACGAAGGGCCCGCGCGC464SerSerAlaSerThrLysGlyPro140145(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 146 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:MetGluTrpSerTrpValPheLeuPhePheLeuSerValThrThrGly151015ValHisSerGluValGlnLeuLeuGluSerGlyGlyGlyLeuValGln202530ProGlyGlySerLeuArgLeuSerCysAlaThrSerGlyPheThrPhe354045ThrAspTyrTyrMetAsnTrpValArgGlnAlaProGlyLysGlyLeu505560GluTrpLeuGlyPheIleGlyAsnLysAlaAsnGlyTyrThrThrGlu65707580TyrSerAlaSerValLysGlyArgPheThrIleSerArgAspLysSer859095LysSerThrLeuTyrLeuGlnMetAsnGlyLeuGlnAlaGluValSer100105110AlaIleTyrTyrCysThrArgAspArgGlyLeuArgPheTyrPheAsp115120125TyrTrpGlyGlnGlyThrLeuValThrValSerSerAlaSerThrLys130135140GlyPro145(2) INFORMATION FOR SEQ ID NO:11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 464 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: gH2-A5B7 variable region(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 22..459(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:GCGCGCAAGCTTGCCGCCACCATGGAATGGAGCTGGGTCTTTCTCTTCTTC51MetGluTrpSerTrpValPheLeuPhePhe1510CTGTCAGTAACTACAGGAGTCCATTCTGAGGTGCAGCTGCTGGAGTCT99LeuSerValThrThrGlyValHisSerGluValGlnLeuLeuGluSer152025GGAGGAGGACTGGTGCAGCCTGGAGGATCTCTGAGACTGTCTTGTGCA147GlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysAla303540ACATCTGGATTCACCTTCACAGACTACTACATGAATTGGGTGAGACAG195ThrSerGlyPheThrPheThrAspTyrTyrMetAsnTrpValArgGln455055GCACCTGGAAAGGGACTCGAGTGGCTGGGCTTCATCGGAAATAAGGCA243AlaProGlyLysGlyLeuGluTrpLeuGlyPheIleGlyAsnLysAla606570AATGGATACACAACAGAGTACTCTGCATCTGTGAAGGGAAGATTCACA291AsnGlyTyrThrThrGluTyrSerAlaSerValLysGlyArgPheThr75808590ATTTCCAGAGACAAGAGCAAGTCCACACTGTACCTGCAGATGAATACA339IleSerArgAspLysSerLysSerThrLeuTyrLeuGlnMetAsnThr95100105CTGCAGGCAGAGGACTCTGCAATTTACTACTGTACAAGAGACAGAGGA387LeuGlnAlaGluAspSerAlaIleTyrTyrCysThrArgAspArgGly110115120CTGAGATTCTACTTCGACTACTGGGGACAGGGAACACTGGTGACAGTG435LeuArgPheTyrPheAspTyrTrpGlyGlnGlyThrLeuValThrVal125130135TCTTCTGCCTCAACGAAGGGCCCGCGCGC464SerSerAlaSerThrLysGlyPro140145(2) INFORMATION FOR SEQ ID NO:12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 146 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:MetGluTrpSerTrpValPheLeuPhePheLeuSerValThrThrGly151015ValHisSerGluValGlnLeuLeuGluSerGlyGlyGlyLeuValGln202530ProGlyGlySerLeuArgLeuSerCysAlaThrSerGlyPheThrPhe354045ThrAspTyrTyrMetAsnTrpValArgGlnAlaProGlyLysGlyLeu505560GluTrpLeuGlyPheIleGlyAsnLysAlaAsnGlyTyrThrThrGlu65707580TyrSerAlaSerValLysGlyArgPheThrIleSerArgAspLysSer859095LysSerThrLeuTyrLeuGlnMetAsnThrLeuGlnAlaGluAspSer100105110AlaIleTyrTyrCysThrArgAspArgGlyLeuArgPheTyrPheAsp115120125TyrTrpGlyGlnGlyThrLeuValThrValSerSerAlaSerThrLys130135140GlyPro145(2) INFORMATION FOR SEQ ID NO:13:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: R1120(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:GCACCACTCTCACCGTGAGCTC22(2) INFORMATION FOR SEQ ID NO:14:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 22 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(iv) ANTI-SENSE: YES(vii) IMMEDIATE SOURCE:(B) CLONE: R1121(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:AGCTGAGCTCACGGTGAGAGTG22(2) INFORMATION FOR SEQ ID NO:15:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 20 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:TTTGATTTCAAGCTTGGTGC20(2) INFORMATION FOR SEQ ID NO:16:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 24 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: R1053(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:GTCGACAGACTAACAGACTGTTCC24(2) INFORMATION FOR SEQ ID NO:17:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 54 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(vii) IMMEDIATE SOURCE:(B) CLONE: R2371(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:ATGATCAATGAATTCATCATGGGGCTGATGGGCACGGGGACCATATTTGGACTC54(2) INFORMATION FOR SEQ ID NO:18:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 87 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:TCGAGTTCTAGATAACGAGGCGTAAAAAATGAAAAAGACAGCTATCGCGATTGCAGTGGC60ACTGGCTGGTTTCGCTACCGTAGCGCA87(2) INFORMATION FOR SEQ ID NO:19:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 87 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(iv) ANTI-SENSE: YES(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:AGCTTGCGCTACGGTAGCGAAACCAGCCAGTGCCACTGCAATCGCGATAGCTGTCTTTTT60CATTTTTTACGCCTCGTTATCTAGAAC87(2) INFORMATION FOR SEQ ID NO:20:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 21 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:MetLysLysThrAlaIleAlaIleAlaValAlaLeuAlaGlyPheAla151015ThrValAlaGlnAla20(2) INFORMATION FOR SEQ ID NO:21:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 46 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:AGCTCAAACTGTTCTCTCCCAGTCTCCAGCAATCTGTCTGCATCTC46(2) INFORMATION FOR SEQ ID NO:22:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 47 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(iv) ANTI-SENSE: YES(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:CCTGGAGATGCAGACAGGATTGCTGGAGACTGGGAGAGAACAGTTTG47(2) INFORMATION FOR SEQ ID NO:23:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 112 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:AGCTGAGGTGAAGCTTGTGGAGTCTGGAGGAGGGTTGGTACAGCCTGGGGGTTCTCTGAG60ACTCTCCTGTGCAACTTCTGGGTTCACCTTCACTGATTACTACATGAACTGG112(2) INFORMATION FOR SEQ ID NO:24:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 112 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(iv) ANTI-SENSE: YES(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:GGACCCAGTTCATGTAGTAATCAGTGAAGGTGAACCCAGAAGTTGCACAGGAGAGTCTCA60GAGAACCCCCAGGCTGTACCAAGCCTCCTCCAGACTCCACAAGCTTCACCTC112(2) INFORMATION FOR SEQ ID NO:25:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 62 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:AGCTCAGACTGTACTCACTCAGAGTCCAAGTAGTCTCAGTGTAAGTGTAGGTGATAGGGT60AA62(2) INFORMATION FOR SEQ ID NO:26:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 57 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(iv) ANTI-SENSE: YES(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:TACCCTATCACCTACACTTACACTGAGACTACTTGGACTCTGAGTGAGTACAGTCTG57(2) INFORMATION FOR SEQ ID NO:27:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 13 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:AGCTGAGGTGCAG13__________________________________________________________________________
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US5530101 *Dec 19, 1990Jun 25, 1996Protein Design Labs, Inc.Humanized immunoglobulins
EP0239400A2 *Mar 26, 1987Sep 30, 1987Medical Research CouncilRecombinant antibodies and methods for their production
EP0323805A2 *Dec 28, 1988Jul 12, 1989Buchegger, FranzNovel antibodies
EP0323806A1 *Dec 28, 1988Jul 12, 1989Ciba-Geigy AgNovel chimeric antibodies
Non-Patent Citations
Reference
1 *Biechmann et al Nature 332:323 327 1988.
2Biechmann et al Nature 332:323-327 1988.
3 *Curti: Crit. Rev. Onc/Hemat. 14:29 39 1993.
4Curti: Crit. Rev. Onc/Hemat. 14:29-39 1993.
5 *HAMS TibTech 11:42 44 1993.
6HAMS TibTech 11:42-44 1993.
7 *Queen et al PNAS 86:10029 10033 1989.
8Queen et al PNAS 86:10029-10033 1989.
9 *Waldmann Science 252:1657 1662 1991.
10Waldmann Science 252:1657-1662 1991.
11Washington Post "Colon Cancer Test Found To Be Flawed" Aug. 25, 1993.
12 *Washington Post Colon Cancer Test Found To Be Flawed Aug. 25, 1993.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6509015Mar 31, 2000Jan 21, 2003Basf AktiengesellschaftHuman antibodies that bind human TNFa
US6719971Nov 2, 2000Apr 13, 2004Genentech, Inc.Method for making humanized antibodies
US6800738Nov 2, 2000Oct 5, 2004Genentech, Inc.Method for making humanized antibodies
US7141653Mar 27, 2003Nov 28, 2006Schering CorporationHuman monoclonal antibodies to interleukin-5
US7223394Mar 7, 2001May 29, 2007Abbott Biotechnology LtdHuman antibodies that bind human TNFα
US7422742Oct 4, 2006Sep 9, 2008Schering CorporationMethods for using human monoclonal antibodies to interleukin-5
US7465705Feb 10, 2005Dec 16, 2008Yale UniversityNogo receptor antagonists
US7541031Apr 17, 2007Jun 2, 2009Abbott Biotechnology Ltd.Methods for treating rheumatoid arthritis using human antibodies that bind human TNFα
US7588761Sep 21, 2005Sep 15, 2009Abbott Biotechnology Ltd.Human antibodies that bind human TNFα
US7705132Oct 5, 2007Apr 27, 2010Amgen Inc.Stable polypeptide formulations
US7767641Apr 23, 2004Aug 3, 2010Yale UniversityRegulator of endothelial cell function and vessel remodeling
US7803372Oct 8, 2003Sep 28, 2010Immunomedics, Inc.Antibody therapy
US7846895Sep 6, 2007Dec 7, 2010The Regents Of The University Of CaliforniaSelectively targeted antimicrobial peptides and the use thereof
US7863426Apr 4, 2007Jan 4, 2011Abbott Biotechnology Ltd.Antibody purification
US7875598Mar 4, 2004Jan 25, 2011The Regents Of The University Of CaliforniaCompositions useful for the treatment of microbial infections
US7906625Jan 23, 2006Mar 15, 2011Amgen Inc.Humanized anti-amyloid antibody
US7910100Oct 4, 2005Mar 22, 2011Max-Planck-Gesellschaft zur Forderung der WissenAntibodies directed to the mammalian EAG1 ion channel protein
US7919090Dec 16, 2009Apr 5, 2011Immunomedics, Inc.Antibody therapy
US7923221Apr 13, 1995Apr 12, 2011Genentech, IncMethods of making antibody heavy and light chains having specificity for a desired antigen
US7932372Jul 10, 2006Apr 26, 2011Amgen Fremont Inc.Antibodies to MAdCAM
US8030456Dec 15, 2008Oct 4, 2011Yale UniversityNogo receptor antagonists
US8034771Sep 10, 2007Oct 11, 2011Amgen Inc.IL-1F6 polypeptides
US8062636Feb 18, 2011Nov 22, 2011Immunomedics, Inc.Antibody therapy
US8075890Jan 4, 2008Dec 13, 2011Genentech, Inc.Method for making humanized antibodies
US8197813Mar 10, 2009Jun 12, 2012Abbott Biotechnology Ltd.Human antibodies that bind human TNFα
US8206714Feb 11, 2009Jun 26, 2012Abbott Biotechnology Ltd.Methods for treating rheumatoid arthritis using human antibodies that bind human TNFa
US8216572Sep 26, 2011Jul 10, 2012Immunomedics, Inc.Antibody therapy
US8231876Sep 15, 2010Jul 31, 2012Abbott Biotechnology Ltd.Purified antibody composition
US8241632Mar 5, 2010Aug 14, 2012Amgen Inc.Stable polypeptide formulations
US8278421Dec 13, 2006Oct 2, 2012Xoma Techolology Ltd.Human antibodies specific for gastrin materials and methods
US8329173Jul 10, 2008Dec 11, 2012Pierre Fabre MedicamentAntibodies inhibiting c-Met dimerization and uses thereof
US8372400Oct 13, 2009Feb 12, 2013Abbott Biotechnology Ltd.Methods of treating disorders using human antibodies that bind human TNFα
US8372401May 8, 2012Feb 12, 2013Abbott Biotechnology Ltd.Human antibodies that bind human TNFα
US8414893Dec 19, 2008Apr 9, 2013Amgen Inc.Anti-amyloid antibodies and uses thereof
US8414894Dec 30, 2011Apr 9, 2013Abbott Biotechnology Ltd.Human antibodies that bind human TNFα and methods of using same
US8481021Sep 2, 2011Jul 9, 2013Amgen Inc.IL-1F5 polypeptides
US8535676May 21, 2012Sep 17, 2013Immunomedics, Inc.Antibody therapy
US8545839Jun 1, 2010Oct 1, 2013Pierre Fabre MedicamentAnti-c-Met antibody
US8557964Mar 30, 2010Oct 15, 2013Pierre Fabre MedicamentAnti CXCR4 antibodies and their use for the treatment of cancer
US8569462Jun 1, 2012Oct 29, 2013Xoma Technology Ltd.Antibodies specific for TGF-beta and methods for treating thereof
US8586716Aug 3, 2007Nov 19, 2013Novartis AgEPHB3-specific antibody and uses thereof
US8629250Jan 30, 2008Jan 14, 2014Amgen Inc.Hepcidin, hepcidin antagonists and methods of use
US8652469Jul 27, 2006Feb 18, 2014Novartis AgM-CSF-specific monoclonal antibody and uses thereof
US8669345Jan 26, 2007Mar 11, 2014Biogen Idec Ma Inc.Nogo receptor antagonists
US8680058Nov 2, 2010Mar 25, 2014The Regents Of The University Of CaliforniaSelectively targeted antimicrobial peptides and the use thereof
US8715664May 16, 2006May 6, 2014Abbvie Biotechnology Ltd.Use of human TNFα antibodies for treatment of erosive polyarthritis
US8729249Sep 14, 2012May 20, 2014Pierre Fabre MedicamentAnti-cMET antibody
US8741290Dec 2, 2009Jun 3, 2014Pierre Fabre MedicamentAnti-cMet antibody
US8747850Sep 14, 2012Jun 10, 2014Pierre Fabre MedicamentAnti-cMET antibody
US8753633Jun 15, 2012Jun 17, 2014Abbvie Biotechnology Ltd.Human antibodies that bind human TNFα
US8765128Sep 14, 2012Jul 1, 2014Pierre Fabre MedicamentAnti-cMET antibody
US8778342Aug 15, 2013Jul 15, 2014Immunomedics, Inc.Antibody therapy
US8808700Mar 28, 2014Aug 19, 2014Abbvie Biotechnology Ltd.Use of TNF alpha inhibitor for treatment of erosive polyarthritis
US8846046Oct 24, 2003Sep 30, 2014Abbvie Biotechnology Ltd.Low dose methods for treating disorders in which TNFα activity is detrimental
US8871192Jun 11, 2013Oct 28, 2014Amgen Inc.IL-1F8 polypeptides
US8883156Jun 26, 2013Nov 11, 2014Abbvie Biotechnology Ltd.Purified antibody composition
US8889135Jun 5, 2002Nov 18, 2014Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US8889136Apr 11, 2005Nov 18, 2014Abbvie Biotechnology Ltd.Multiple-variable dose regimen for treating TNFα-related disorders
US8895009Aug 1, 2013Nov 25, 2014Abbvie Biotechnology Ltd.Purified antibody composition
US8906372Aug 2, 2013Dec 9, 2014Abbvie Biotechnology Ltd.Purified antibody composition
US8906373Apr 30, 2014Dec 9, 2014Abbvie Biotechnology Ltd.Use of TNF-alpha inhibitor for treatment of psoriasis
US8911737Apr 18, 2014Dec 16, 2014Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US8916153Jun 26, 2013Dec 23, 2014Abbvie Biotechnology Ltd.Purified antibody composition
US8921526Mar 12, 2014Dec 30, 2014Abbvie, Inc.Mutated anti-TNFα antibodies and methods of their use
US8926976Sep 24, 2010Jan 6, 2015Xoma Technology Ltd.Modulators
US8946395Nov 12, 2013Feb 3, 2015Abbvie Inc.Purification of proteins using hydrophobic interaction chromatography
US8961973Mar 28, 2014Feb 24, 2015Abbvie Biotechnology Ltd.Multiple-variable dose regimen for treating TNFα-related disorders
US8961974Mar 28, 2014Feb 24, 2015Abbvie Biotechnology Ltd.Multiple-variable dose regimen for treating TNFα-related disorders
US8974790May 30, 2014Mar 10, 2015Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US8986693Oct 9, 2014Mar 24, 2015Abbvie Biotechnology Ltd.Use of TNFα inhibitor for treatment of psoriasis
US8992926Sep 26, 2014Mar 31, 2015Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US8999337Jun 10, 2008Apr 7, 2015Abbvie Biotechnology Ltd.Methods for treating juvenile idiopathic arthritis by inhibition of TNFα
US9005614Nov 22, 2010Apr 14, 2015Novartis AgPRLR-specific antibody and uses thereof
US9006398Oct 16, 2013Apr 14, 2015Novartis AgEPHB3-specific antibody and uses thereof
US9017680Nov 14, 2014Apr 28, 2015Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US9017687Nov 13, 2013Apr 28, 2015Abbvie, Inc.Low acidic species compositions and methods for producing and using the same using displacement chromatography
US9061005Mar 28, 2012Jun 23, 2015Abbvie Biotechnology LtdMultiple-variable dose regimen for treating idiopathic inflammatory bowel disease
US9062106Apr 26, 2012Jun 23, 2015Abbvie Inc.Methods for controlling the galactosylation profile of recombinantly-expressed proteins
US9067990Mar 14, 2013Jun 30, 2015Abbvie, Inc.Protein purification using displacement chromatography
US9067992Dec 8, 2014Jun 30, 2015Abbvie Biotechnology Ltd.Use of TNFα inhibitor for treatment of psoriatic arthritis
US9073987May 30, 2014Jul 7, 2015Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US9085618Nov 12, 2013Jul 21, 2015Abbvie, Inc.Low acidic species compositions and methods for producing and using the same
US9085620Apr 8, 2015Jul 21, 2015Abbvie Biotechnology Ltd.Use of TNFα inhibitor for treatment of psoriatic arthritis
US9090686Oct 27, 2010Jul 28, 2015Pierre Fabre MedicamentAntibodies for the treatment of HIV
US9090688Sep 22, 2014Jul 28, 2015Abbvie Inc.Methods for controlling the galactosylation profile of recombinantly-expressed proteins
US9090689Apr 8, 2015Jul 28, 2015Abbvie Biotechnology Ltd.Use of TNFα inhibitor for treatment of psoriasis
US9096666Nov 21, 2014Aug 4, 2015Abbvie Biotechnology LtdPurified antibody composition
US9102723Nov 21, 2014Aug 11, 2015Abbvie Biotechnology LtdPurified antibody composition
US9107907Nov 9, 2012Aug 18, 2015Pierre Fabre MedicamentAntibodies inhibiting c-Met dimerization, and uses thereof
US9145458Sep 26, 2013Sep 29, 2015Xoma Technology Ltd.Antibodies specific for TGF-β and methods of treatment thereof
US9150645Mar 14, 2013Oct 6, 2015Abbvie, Inc.Cell culture methods to reduce acidic species
US9175078Jan 23, 2009Nov 3, 2015Amgen Inc.Ferroportin antibodies and methods of use
US9181337Nov 12, 2013Nov 10, 2015Abbvie, Inc.Modulated lysine variant species compositions and methods for producing and using the same
US9181572Mar 14, 2013Nov 10, 2015Abbvie, Inc.Methods to modulate lysine variant distribution
US9187559Feb 20, 2015Nov 17, 2015Abbvie Biotechnology LtdMultiple-variable dose regimen for treating idiopathic inflammatory bowel disease
US9193787Oct 23, 2014Nov 24, 2015Abbvie Inc.Human antibodies that bind human TNF-alpha and methods of preparing the same
US9200069Feb 4, 2015Dec 1, 2015Abbvie, Inc.Low acidic species compositions and methods for producing and using the same
US9200070May 15, 2015Dec 1, 2015Abbvie, Inc.Low acidic species compositions and methods for producing and using the same
US9206390Mar 14, 2013Dec 8, 2015Abbvie, Inc.Methods to control protein heterogeneity
US9228015Jan 2, 2014Jan 5, 2016Biogen Idec Ma Inc.Nogo receptor antagonists and methods of increasing neurite outgrowth
US9234033Feb 26, 2015Jan 12, 2016Abbvie, Inc.Methods to control protein heterogeneity
US9249182Mar 14, 2013Feb 2, 2016Abbvie, Inc.Purification of antibodies using hydrophobic interaction chromatography
US9249223Mar 30, 2011Feb 2, 2016Pierre Fabre MedicamentHumanized anti CXCR4 antibodies for the treatment of cancer
US9255143Feb 11, 2015Feb 9, 2016Abbvie Inc.Methods for controlling the galactosylation profile of recombinantly-expressed proteins
US9266949Dec 18, 2014Feb 23, 2016Abbvie, Inc.Low acidic species compositions and methods for producing and using the same
US9273132Jul 10, 2015Mar 1, 2016Abbvie Biotechnology LtdPurified antibody composition
US9284370Apr 6, 2015Mar 15, 2016Abbvie Biotechnology Ltd.Methods for treating juvenile idiopathic arthritis
US9290568Feb 26, 2015Mar 22, 2016Abbvie, Inc.Methods to control protein heterogeneity
US9315574Dec 29, 2014Apr 19, 2016Abbvie, Inc.Low acidic species compositions and methods for producing and using the same
US9328165Aug 31, 2015May 3, 2016Abbvie Biotechnology Ltd.Purified antibody composition
US9328169Jan 7, 2005May 3, 2016Pfizer Inc.Human antibodies that bind human MAdCAM
US9334319Mar 14, 2013May 10, 2016Abbvie Inc.Low acidic species compositions
US9346879Dec 29, 2014May 24, 2016Abbvie Inc.Protein purification methods to reduce acidic species
US9351490Feb 11, 2014May 31, 2016The Regents Of The University Of CaliforniaSelectively targeted antimicrobial peptides and the use thereof
US9359434Sep 2, 2015Jun 7, 2016Abbvie, Inc.Cell culture methods to reduce acidic species
US9365645Feb 3, 2016Jun 14, 2016Abbvie, Inc.Methods for controlling the galactosylation profile of recombinantly-expressed proteins
US9388248Sep 13, 2013Jul 12, 2016Pierre Fabre MedicamentAnti-CXCR4 antibodies and their use for the treatment of cancer
US9399061Apr 10, 2007Jul 26, 2016Abbvie Biotechnology LtdMethods for determining efficacy of TNF-α inhibitors for treatment of rheumatoid arthritis
US9427478Dec 23, 2014Aug 30, 2016Innate PharmaEnzymatic conjugation of polypeptides
US9441039May 7, 2013Sep 13, 2016Amgen Inc.Anti-erythropoietin antibodies
US9469691Apr 9, 2014Oct 18, 2016Pierre Fabre MedicamentAnti-cMET antibody
US9499614Mar 13, 2014Nov 22, 2016Abbvie Inc.Methods for modulating protein glycosylation profiles of recombinant protein therapeutics using monosaccharides and oligosaccharides
US9499615Jul 20, 2015Nov 22, 2016Abbvie Biotechnology LtdMultiple-variable dose regimen for treating idiopathic inflammatory bowel disease
US9499616Oct 27, 2015Nov 22, 2016Abbvie Inc.Modulated lysine variant species compositions and methods for producing and using the same
US9505833Nov 12, 2013Nov 29, 2016Abbvie Inc.Human antibodies that bind human TNF-alpha and methods of preparing the same
US9505834Mar 31, 2016Nov 29, 2016Abbvie Inc.Methods for controlling the galactosylation profile of recombinantly-expressed proteins
US9512214Feb 28, 2014Dec 6, 2016Abbvie, Inc.Methods to control protein heterogeneity
US9512216Jun 3, 2016Dec 6, 2016Abbvie Biotechnology Ltd.Use of TNFα inhibitor
US9522953Jan 28, 2016Dec 20, 2016Abbvie, Inc.Low acidic species compositions and methods for producing and using the same
US9546212Jun 10, 2016Jan 17, 2017Abbvie Biotechnology Ltd.Methods of administering anti-TNFα antibodies
US9550826Jun 30, 2016Jan 24, 2017Abbvie Inc.Glycoengineered binding protein compositions
US9574002Jun 1, 2012Feb 21, 2017Amgen Inc.Human antigen binding proteins that bind to a complex comprising β-Klotho and an FGF receptor
US9598667Oct 3, 2014Mar 21, 2017Abbvie Inc.Use of metal ions for modulation of protein glycosylation profiles of recombinant proteins
US9605064Aug 18, 2010Mar 28, 2017Abbvie Biotechnology LtdMethods and compositions for treatment of skin disorders
US9610301Jan 15, 2009Apr 4, 2017Abbvie Deutschland Gmbh & Co KgPowdered protein compositions and methods of making same
US9624295Apr 10, 2007Apr 18, 2017Abbvie Biotechnology Ltd.Uses and compositions for treatment of psoriatic arthritis
US9624308Nov 5, 2013Apr 18, 2017Pierre Fabre MedicamentAntigen binding proteins
US9669093Feb 12, 2016Jun 6, 2017Abbvie Biotechnology LtdMethods for treating juvenile idiopathic arthritis
US9683033Jan 28, 2016Jun 20, 2017Abbvie, Inc.Cell culture methods to reduce acidic species
US9688752Mar 2, 2015Jun 27, 2017Abbvie Inc.Low acidic species compositions and methods for producing and using the same using displacement chromatography
US9688759Sep 25, 2015Jun 27, 2017Amgen, Inc.Ferroportin antibodies and methods of use
US9689862Nov 5, 2012Jun 27, 2017Peirre Fabre MedicamentAntigen binding protein and its use as addressing product for the treatment of cancer
US9708399Jun 8, 2015Jul 18, 2017Abbvie, Inc.Protein purification using displacement chromatography
US9708400Oct 27, 2015Jul 18, 2017Abbvie, Inc.Methods to modulate lysine variant distribution
US20020068066 *Jun 15, 2001Jun 6, 2002Wenyuan ShiMethod for the treatment and prevention of dental caries
US20020147312 *Jan 30, 2002Oct 10, 2002O'keefe TheresaHybrid antibodies and uses thereof
US20030035799 *May 16, 2002Feb 20, 2003Glaxo Wellcome Inc.Glycosylated antibody
US20030194404 *Mar 27, 2003Oct 16, 2003Schering CorporationHuman monoclonal antibodies to interleukin-5 and methods and compositions comprising same
US20030235585 *Jun 5, 2002Dec 25, 2003Fischkoff Steven A.Methods of administering anti-TNFalpha antibodies
US20040009172 *Apr 24, 2003Jan 15, 2004Steven FischkoffUse of anti-TNFalpha antibodies and another drug
US20040126372 *Jul 18, 2003Jul 1, 2004Abbott Biotechnology Ltd.Treatment of TNFalpha related disorders
US20040166111 *Oct 24, 2003Aug 26, 2004Zehra KaymakcalanLow dose methods for treating disorders in which TNFalpha activity is detrimental
US20040191248 *Oct 8, 2003Sep 30, 2004Immunomedics, Inc.Antibody therapy
US20040236078 *Apr 30, 2004Nov 25, 2004Genentech, Inc.Method for making humanized antibodies
US20050107596 *Apr 23, 2002May 19, 2005Madaio Michael P.Anti-alpha3(IV)nc1 monoclonal antibodies and animal model for human anti-glomerular basement membrane autoantibody disease
US20050232917 *Jan 7, 2005Oct 20, 2005Nicholas PullenAntibodies to MAdCAM
US20050271655 *Feb 10, 2005Dec 8, 2005Biogen Idec Ma Inc.Nogo receptor antagonists
US20060009385 *Apr 11, 2005Jan 12, 2006Abbott Biotechnology Ltd.Multiple-variable dose regimen for treating TNFalpha-related disorders
US20060024293 *Sep 21, 2005Feb 2, 2006Abbott Biotechnology Ltd.Human antibodies that bind human TNFalpha
US20060083741 *Oct 6, 2005Apr 20, 2006Hoffman Rebecca STreatment of respiratory syncytial virus (RSV) infection
US20060135498 *Mar 4, 2004Jun 22, 2006Wenyuan ShiCompositions useful for the treatment of microbial infections
US20070025994 *Oct 4, 2006Feb 1, 2007Schering CorporationHuman monoclonal antibodies to interleukin-5 and methods and compositions comprising same
US20070041905 *Feb 17, 2006Feb 22, 2007Hoffman Rebecca SMethod of treating depression using a TNF-alpha antibody
US20070065429 *Apr 16, 2004Mar 22, 2007Biogen Idec Ma Inc.Nogo-receptor antagonists for the treatment of conditions involving amyloid plaques
US20070071747 *May 16, 2006Mar 29, 2007Hoffman Rebecca SUse of TNFalpha inhibitor for treatment of erosive polyarthritis
US20070077243 *Jun 1, 2006Apr 5, 2007Genentech, Inc.Method for making humanized antibodies
US20070081996 *Aug 18, 2006Apr 12, 2007Hoffman Rebecca SMethod of treating depression using a TNFalpha antibody
US20070123456 *Apr 23, 2004May 31, 2007Sessa William CNovel regulator of endothelial cell function and vessel remodeling
US20070166308 *Jul 10, 2006Jul 19, 2007Nicholas PullenAntibodies to MAdCAM
US20070202104 *Jul 18, 2003Aug 30, 2007Abbott Laboratories S.A.Treatment of spondyloarthropathies using TNFalpha inhibitors
US20070249813 *Apr 17, 2007Oct 25, 2007Salfeld Jochen GHuman antibodies that bind human TNFa
US20070292442 *Apr 4, 2007Dec 20, 2007Min WanAntibody purification
US20080003220 *Apr 19, 2007Jan 3, 2008Amgen, Inc.Buffering agents for biopharmaceutical formulations
US20080112953 *Oct 5, 2007May 15, 2008Amgen Inc.Stable formulations
US20080118496 *Jun 11, 2007May 22, 2008Medich John RUses and compositions for treatment of juvenile rheumatoid arthritis
US20080124326 *Oct 5, 2007May 29, 2008Amgen Inc.Stable polypeptide formulations
US20080124339 *Aug 20, 2007May 29, 2008Nicholas PullenAntibodies to MAdCAM
US20080131374 *May 4, 2007Jun 5, 2008Medich John RUses and compositions for treatment of rheumatoid arthritis
US20080166348 *Apr 10, 2007Jul 10, 2008Hartmut KupperUses and compositions for treatment of rheumatoid arthritis
US20080170991 *Sep 6, 2007Jul 17, 2008Wenyuan ShiSelectively targeted antimicrobial peptides and the use thereof
US20080213277 *Jan 30, 2008Sep 4, 2008Amgen Inc.Hepcidin, hepcidin antagonists and methods of use
US20080213282 *Dec 19, 2007Sep 4, 2008Jaby JacobFormulations
US20080233118 *Jul 27, 2006Sep 25, 2008Novartis AgUses Of Antibody To M-Csf
US20080279852 *Jul 28, 2008Nov 13, 2008Smithkline Beecham CorporationMethods of treatment with glycosylated antibodies
US20080292639 *Jan 23, 2006Nov 27, 2008Amgen Inc.Humanized Anti-Amyloid Antibody
US20090028851 *Oct 4, 2005Jan 29, 2009Maxplanck-Gesellschaft Zur F÷rderung Der WissenschNovel Antibodies Directed to the Mammalian Eag1 Ion Channel Protein
US20090053229 *May 12, 2006Feb 26, 2009Lee Daniel H SMethods of Treating Conditions Involving Neuronal Degeneration
US20090142261 *Aug 3, 2007Jun 4, 2009Novartis AgEPHB3-Specific Antibody and Uses Thereof
US20090155205 *Feb 11, 2009Jun 18, 2009Salfeld Jochen GHUMAN ANTIBODIES THAT BIND HUMAN TNFa
US20090258018 *Jun 10, 2008Oct 15, 2009Medich John RMethods for treating juvenile idiopathic arthritis
US20090304682 *Jan 7, 2008Dec 10, 2009Hoffman Rebecca SMultiple-variable dose regimen for treating TNFa-related disorders
US20090317399 *May 18, 2007Dec 24, 2009Pollack Paul FUses and compositions for treatment of CROHN'S disease
US20100016557 *Mar 10, 2009Jan 21, 2010Abbott Biotechnology Ltd.HUMAN ANTIBODIES THAT BIND HUMAN TNFalpha
US20100040604 *Oct 13, 2009Feb 18, 2010Salfeld Jochen GHUMAN ANTIBODIES THAT BIND HUMAN TNFalpha
US20100092464 *Jul 27, 2006Apr 15, 2010Novartis AgM-CSF-Specific Monoclonal Antibody and Uses Thereof
US20100115639 *Jul 10, 2008May 6, 2010Liliane GoetschAntibodies inhibiting c-met dimerization and uses thereof
US20100158908 *Mar 5, 2010Jun 24, 2010Amgen Inc.Stable Polypeptide Formulations
US20100221175 *Dec 16, 2009Sep 2, 2010Immunomedics, Inc.Antibody Therapy
US20110002935 *Sep 15, 2010Jan 6, 2011Min WanAntibody purification
US20110020218 *Mar 30, 2010Jan 27, 2011Christine Klinguer-HamourNovel anti cxcr4 antibodies and their use for the treatment of cancer
US20110076284 *Sep 24, 2010Mar 31, 2011Xoma Technology Ltd.Novel Modulators
US20110088104 *Oct 27, 2010Apr 14, 2011Christine Klinguer-HamourNovel antibodies for the treatment of hiv
US20110097262 *Jun 1, 2010Apr 28, 2011Liliane GoetschNOVEL ANTI-cMET ANTIBODY
US20110150760 *Nov 22, 2010Jun 23, 2011Novartis AgPRLR-Specific Antibody and Uses Thereof
US20110189085 *Feb 18, 2011Aug 4, 2011Immunomedics, Inc.Antibody Therapy
US20110239316 *Dec 2, 2009Sep 29, 2011Liliane GoetschANTI-cMET ANTIBODY
USRE45847Mar 19, 2014Jan 19, 2016Pfizer Inc.Antibodies to MAdCAM
EP1997512A2Apr 9, 2003Dec 3, 2008Biogen Idec MA Inc.Methods for treating TWEAK-related conditions
EP2172485A1Oct 1, 2008Apr 7, 2010Pierre Fabre MedicamentNovel anti CXCR4 antibodies and their use for the treatment of cancer
EP2194067A2Dec 20, 2001Jun 9, 2010Pfizer Inc.Antibodies to insulin-like growth factor I receptor (IGF-IR)
EP2246363A1Nov 17, 2003Nov 3, 2010Novartis Vaccines and Diagnostics, Inc.Methods for preventing and treating cancer metastasis and bone loss associated with cancer metastasis
EP2246364A1Apr 29, 2009Nov 3, 2010Pierre Fabre MedicamentAnti CXCR4 antibodies for the treatment of HIV
EP2261254A2Dec 19, 2008Dec 15, 2010Amgen, IncAnti-amyloid antibodies and uses thereof
EP2275445A2Mar 11, 2005Jan 19, 2011Vasgene Therapeutics, Inc.Antibodies binding to ephb4 for inhibiting angiogenesis and tumor growth
EP2287192A1Nov 17, 2003Feb 23, 2011Novartis Vaccines and Diagnostics, Inc.Methods for preventing and treating cancer metastasis and bone loss associated with cancer metastasis
EP2287194A2Mar 11, 2005Feb 23, 2011Vasgene Therapeutics, Inc.Antibodies binding to ephb4 for inhibiting angiogenesis and tumor growth
EP2287336A1Jul 31, 2009Feb 23, 2011Exhonit Therapeutics SAMethods and processes for diagnosing Alzheimer's disease
EP2301577A2Apr 9, 2003Mar 30, 2011Biogen Idec MA Inc.Methods for treating TWEAK-related conditions
EP2301578A2Apr 9, 2003Mar 30, 2011Biogen Idec MA Inc.Methods for treating TWEAK-related conditions
EP2308897A1Oct 9, 2009Apr 13, 2011Pierre Fabre MedicamentChimeric antibodies specific for CD151 and use thereof in the treatment of cancer
EP2311873A1Jan 6, 2005Apr 20, 2011Novartis Vaccines and Diagnostics, Inc.M-CSF-specific monoclonal antibody and uses thereof
EP2322550A1Dec 20, 2005May 18, 2011Amgen, IncCompositions comprising anti-IGF-1R Antibodies and Methods for obtaining said Antibodies
EP2322551A2Dec 20, 2005May 18, 2011Amgen, IncCompositions comprising Anti-IGF-1R Antibodies and Methods for their Production
EP2371863A1Mar 30, 2010Oct 5, 2011Pierre Fabre MedicamentHumanized anti CXCR4 antibodies for the treatment of cancer
EP2380913A1Jul 21, 2006Oct 26, 2011Pierre Fabre MedicamentNovel anti-IGF-IR antibodies and uses thereof
EP2415784A1Jul 10, 2008Feb 8, 2012Pierre Fabre MedicamentNovel antibodies inhibiting C-Met dimerization, and uses thereof
EP2415785A1Jul 10, 2008Feb 8, 2012Pierre Fabre MedicamentNovel antibodies inhibiting C-Met dimerization, and uses thereof
EP2423231A2Aug 17, 2007Feb 29, 2012Novartis AGPRLR-specific antibody and uses thereof
EP2426150A1Jun 28, 2007Mar 7, 2012Novo Nordisk A/SAnti-NKG2A antibodies and uses thereof
EP2433966A1Nov 2, 2007Mar 28, 2012U3 Pharma GmbHFGFR4 antibodies
EP2444418A2Sep 10, 2007Apr 25, 2012Amgen, IncIL-1 Family Variants
EP2491945A1Sep 27, 2007Aug 29, 2012Pierre Fabre MedicamentMethod for generating active antibodies against a resistance antigen, antibodies obtained by said method and their uses
EP2494984A1Sep 27, 2007Sep 5, 2012Pierre Fabre MedicamentMethod for generating active antibodies against a resistance antigen, antibodies obtained by said method and their uses
EP2494988A1Dec 6, 2007Sep 5, 2012Novartis AGAntagonist antibodies against EPHB3
EP2497491A1Sep 27, 2007Sep 12, 2012Pierre Fabre MedicamentMethod for generating active antibodies against a resistance antigen, antibodies obtained by said method and their uses
EP2526968A2Jan 26, 2007Nov 28, 2012Biogen Idec MA Inc.Nogo receptor antagonists
EP2535355A2Mar 23, 2006Dec 19, 2012Genmab A/SAntibodies against CD38 for treatment of multiple myeloma
EP2535356A1Jul 10, 2008Dec 19, 2012Pierre Fabre MedicamentNovel antibodies inhibiting C-MET dimerization, and uses thereof
EP2535357A1Jul 10, 2008Dec 19, 2012Pierre Fabre MedicamentNovel antibodies inhibiting C-MET dimerization, and uses thereof
EP2551282A2Mar 23, 2006Jan 30, 2013Genmab A/SAntibodies against CD38 for treatment of multiple myeloma
EP2559705A2Sep 7, 2007Feb 20, 2013Amgen Inc.Anti-activin a antibodies and uses thereof
EP2562186A1Jun 26, 2008Feb 27, 2013Amgen Inc.Antigen binding proteins that bind PAR-2
EP2567976A2Mar 23, 2006Mar 13, 2013Genmab A/SAntibodies against CD38 for treatment of multiple myeloma
EP2574628A1Jan 23, 2009Apr 3, 2013Amgen Inc.Ferroportin antibodies and methods of use
EP2589609A1Nov 3, 2011May 8, 2013Pierre Fabre MedicamentAntigen binding protein and its use as addressing product for the treatment of cancer
EP2620448A1Apr 28, 2009Jul 31, 2013Amgen Inc.Anti-hepcidin antibodies and methods of use
EP2628753A1Jan 23, 2009Aug 21, 2013Novo Nordisk A/SHumanized anti-human NKG2A monoclonal antibody
EP2711375A1Dec 3, 2010Mar 26, 2014Amgen Inc.Human Antigen Binding Proteins that bind Beta-Klotho, FGF Receptors and complexes thereof
EP2769993A1Dec 15, 2008Aug 27, 2014Novo Nordisk A/SAntibodies against human NKG2D and uses thereof
EP2796468A2Dec 20, 2001Oct 29, 2014Pfizer IncAntibodies to insulin-like growth factor I receptor
EP2803675A2Jan 23, 2009Nov 19, 2014Amgen, IncFerroportin antibodies and methods of use
EP2816059A1Apr 28, 2009Dec 24, 2014Amgen, IncAnti-hepcidin antibodies and methods of use
EP2839860A1Oct 11, 2013Feb 25, 2015Spirogen SÓrlPyrrolobenzodiazepines and conjugates thereof
EP2851373A1Dec 18, 2008Mar 25, 2015Xoma (Us) LlcMethods for the treatment of gout
EP2918605A1Nov 12, 2008Sep 16, 2015U3 Pharma GmbHAxl antibodies
EP2957296A1Sep 25, 2010Dec 23, 2015Xoma (Us) LlcInsulin receptor binding antibodies
EP3018144A1Aug 17, 2007May 11, 2016XOMA Technology Ltd.Prlr-specific antibody and uses thereof
EP3034620A1Dec 17, 2014Jun 22, 2016DiaxonhitCompositions and methods for diagnosing thyroid cancer
EP3050900A1Dec 19, 2012Aug 3, 2016Xoma (Us) LlcMethods for treating acne
EP3124045A2Dec 20, 2007Feb 1, 2017Xoma (Us) LlcTreatment of il-1 beta related diseases
EP3133084A1Sep 7, 2007Feb 22, 2017Amgen Inc.Anti-activin a antibodies and uses thereof
EP3135691A1Dec 2, 2009Mar 1, 2017Pierre Fabre MedicamentAnti-cmet antibody
EP3153525A1Mar 23, 2006Apr 12, 2017Genmab A/SAntibodies against cd38 for treatment of multiple myeloma
EP3187877A1Sep 24, 2010Jul 5, 2017XOMA Technology Ltd.Screening methods
WO2002102975A2 *Jun 11, 2002Dec 27, 2002C3 Scientific CorporationDna molecules and recombinant dna molecules for producing humanized monoclonal antibodies to s. mutans
WO2002102975A3 *Jun 11, 2002Apr 15, 2004Maxwell H AndersonDna molecules and recombinant dna molecules for producing humanized monoclonal antibodies to s. mutans
WO2008031061A2Sep 7, 2007Mar 13, 2008Amgen Inc.Anti-activin a antibodies and uses thereof
WO2008097503A2Feb 4, 2008Aug 14, 2008Biogen Idec Ma Inc.Use of semaphorin 6a for promoting myelination and oligodendrocyte differentiation
WO2009085200A2Dec 19, 2008Jul 9, 2009Amgen Inc.Anti-amyloid antibodies and uses thereof
WO2009086003A1Dec 18, 2008Jul 9, 2009Xoma Technology Ltd.Methods for the treatment of gout
WO2009094551A1Jan 23, 2009Jul 30, 2009Amgen Inc.Ferroportin antibodies and methods of use
WO2009139822A1Apr 28, 2009Nov 19, 2009Amgen Inc.Anti-hepcidin antibodies and methods of use
WO2010037831A1Oct 1, 2009Apr 8, 2010Pierre Fabre MedicamentAnti cxcr4 antibodies and their use for the treatment of cancer
WO2010107752A2Mar 16, 2010Sep 23, 2010Amgen Inc.Alpha-4-beta-7 heterodimer specific antagonist antibody
WO2011000962A2Jul 3, 2010Jan 6, 2011Bionor Immuno AsNovel therapeutic and diagnostic means
WO2011012691A2Jul 30, 2010Feb 3, 2011Exonhit Therapeutics SaProcesses and methods for diagnosis of alzheimer's disease
WO2011014671A1Jul 29, 2010Feb 3, 2011Amgen Inc.Polypeptides that bind tissue inhibitor of metalloproteinase type three (timp-3), compositions and methods
WO2011038301A2Sep 24, 2010Mar 31, 2011Xoma Technology Ltd.Screening methods
WO2011038302A2Sep 25, 2010Mar 31, 2011Xoma Technology Ltd.Novel modulators
WO2011042534A1Oct 8, 2010Apr 14, 2011Pierre Fabre MedicamentChimeric antibodies specific for cd151 and use thereof in the treatment of cancer
WO2011063277A1Nov 19, 2010May 26, 2011Amgen Inc.Anti-orai1 antigen binding proteins and uses thereof
WO2011071783A1Dec 3, 2010Jun 16, 2011Amgen Inc.Human antigen binding proteins that bind beta-klotho, fgf receptors and complexes thereof
WO2011121040A1Mar 30, 2011Oct 6, 2011Pierre Fabre MedicamentHumanized anti cxcr4 antibodies for the treatment of cancer
WO2011130417A2Apr 13, 2011Oct 20, 2011Amgen Inc.HUMAN FGF RECEPTOR AND β-KLOTHO BINDING PROTEINS
WO2011143511A2May 12, 2011Nov 17, 2011Columbia UniversityMethods for producing enteroendocrine cells that make and secrete insulin
WO2011151412A1Jun 1, 2011Dec 8, 2011Pierre Fabre MedicamentNovel anti-cmet antibody
WO2012012141A1Jun 28, 2011Jan 26, 2012Amgen Inc.Scnn1a/tnfrsf1a fusion proteins in cancer
WO2012021648A1Aug 10, 2011Feb 16, 2012Amgen Inc.Dual function in vitro target binding assay for the detection of neutralizing antibodies against target antibodies
WO2012024242A1Aug 15, 2011Feb 23, 2012Amgen Inc.Antibodies that bind myostatin, compositions and methods
WO2012032181A2Sep 9, 2011Mar 15, 2012Allozyne, IncNovel antibody derivatives
WO2012040518A2Sep 22, 2011Mar 29, 2012Amgen Inc.Carrier immunoglobulins and uses thereof
WO2012055980A1Oct 27, 2011May 3, 2012Pierre Fabre MedicamentAntibodies for the treatment of hiv
WO2012099983A1Jan 18, 2012Jul 26, 2012Amgen Inc.Nav1.7 knockout mice and uses thereof
WO2012106556A2Feb 2, 2012Aug 9, 2012Amgen Inc.Methods and compositons relating to inhibition of igf-1r
WO2012170438A2Jun 5, 2012Dec 13, 2012Amgen Inc.HUMAN ANTIGEN BINDING PROTEINS THAT BIND TO A COMPLEX COMPRISING β-KLOTHO AND AN FGF RECEPTOR
WO2012175576A1Jun 20, 2012Dec 27, 2012Pierre Fabre MedicamentAnti-cxcr4 antibody with effector functions and its use for the treatment of cancer.
WO2013063298A1Oct 25, 2012May 2, 2013Amgen Inc.Methods of reducing or eliminating protein modification and degradation arising from exposure to uv light
WO2013064684A1Nov 5, 2012May 10, 2013Pierre Fabre MedicamentAntigen binding protein and its use as addressing product for the treatment of cancer
WO2013064685A1Nov 5, 2012May 10, 2013Pierre Fabre MedicamentAntigen binding protein and its use as addressing product for the treatment cancer
WO2013092998A1Dec 21, 2012Jun 27, 2013Innate PharmaEnzymatic conjugation of antibodies
WO2013096516A1Dec 19, 2012Jun 27, 2013Xoma Technology Ltd.Methods for treating acne
WO2013126813A1Feb 22, 2013Aug 29, 2013Amgen Inc.Autologous mammalian models derived from induced pluripotent stem cells and related methods
WO2013149219A2Mar 30, 2013Oct 3, 2013Sorrento Therapeutics Inc.Fully human antibodies that bind to vegfr2
WO2013169734A1May 7, 2013Nov 14, 2013Amgen Inc.Anti-erythropoietin antibodies
WO2013182660A1Jun 6, 2013Dec 12, 2013Bionor Immuno AsHiv vaccine
WO2013182662A1Jun 6, 2013Dec 12, 2013Bionor Immuno AsVaccine
WO2014022102A1Jul 17, 2013Feb 6, 2014Amgen Inc.Methods of using anti-apoptotic compounds to modulate one or more properties of a cell culture
WO2014057074A1Oct 11, 2013Apr 17, 2014Spirogen SÓrlPyrrolobenzodiazepines and conjugates thereof
WO2014068139A1Nov 5, 2013May 8, 2014Pierre Fabre MedicamentNovel antigen binding proteins and their use as addressing product for the treatment of cancer
WO2014109858A1Dec 11, 2013Jul 17, 2014Amgen Inc.Methods of using cell-cycle inhibitors to modulate one or more properties of a cell culture
WO2014132204A1Feb 26, 2014Sep 4, 2014Institut National De La Recherche Agronomique (Inra)Deamidated anti-gluten antibody and uses thereof
WO2014140174A1Mar 13, 2014Sep 18, 2014Spirogen SÓrlPyrrolobenzodiazepines and conjugates thereof
WO2014159764A1Mar 12, 2014Oct 2, 2014Amgen Inc.Chrdl-1 antigen binding proteins and methods of treatment
WO2015007337A1Jul 19, 2013Jan 22, 2015Bionor Immuno AsMethod for the vaccination against hiv
WO2015036956A1Sep 11, 2014Mar 19, 2015Institut National De La Sante Et De La Recherche MedicaleMethod for in vitro quantifying allo-antibodies, auto-antibodies and/or therapeutic antibodies
WO2015066357A1Oct 30, 2014May 7, 2015Amgen Inc.Use of monensin to regulate glycosylation of recombinant proteins
WO2015162291A1Apr 27, 2015Oct 29, 2015Pierre Fabre MedicamentIgf-1r antibody-drug-conjugate and its use for the treatment of cancer
WO2016037644A1Sep 10, 2014Mar 17, 2016Medimmune LimitedPyrrolobenzodiazepines and conjugates thereof
WO2016040767A2Sep 11, 2015Mar 17, 2016Amgen Inc.Chrdl-1 epitopes and antibodies
WO2016061240A1Oct 14, 2015Apr 21, 2016Amgen Inc.Promoter and regulatory elements for improved expression of heterologous genes in host cells
WO2016061551A1Oct 16, 2015Apr 21, 2016Amgen Inc.Antibodies directed to angiopoietin-1 and angiopoietin-2 for ocular therapies
WO2016097644A2Dec 18, 2015Jun 23, 2016Institut National De La Recherche AgronomiqueDiagnostic markers for crohn's disease
WO2016139297A1Mar 3, 2016Sep 9, 2016Ab2 Bio SaIl-18 binding protein (il-18bp) and antibodies in inflammatory diseases
WO2016141111A1Mar 3, 2016Sep 9, 2016Xoma (Us) LlcTreatment of post-prandial hyperinsulinemia and hypoglycemia after bariatric surgery
WO2016161410A2Apr 3, 2016Oct 6, 2016Xoma Technology Ltd.Treatment of cancer using inhibitors of tgf-beta and pd-1
WO2016177833A1May 4, 2016Nov 10, 2016Bionor Immuno AsDosage regimen for hiv vaccine
WO2016185135A1May 18, 2016Nov 24, 2016Universite de BordeauxTreatment and detection of trypanosomes
Classifications
U.S. Classification530/387.3, 536/23.53, 530/388.8
International ClassificationC12N15/09, C07K16/24, G01N33/531, C12R1/91, A61K39/395, C07K19/00, G01N33/577, G01N33/574, C07K1/22, C07K1/20, C07K16/00, A61P35/00, G01N33/563, C12P21/08, C07K16/46, C12N15/13, A61K38/00, C07K16/30
Cooperative ClassificationC07K2317/567, C07K2319/035, C07K2317/565, C07K16/241, A61K38/00, C07K2319/00, C07K2317/24, C07K16/3007
European ClassificationC07K16/24B, C07K16/30A
Legal Events
DateCodeEventDescription
Jul 13, 1998ASAssignment
Owner name: CELLTECH LIMITED, UNITED KINGDOM
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ADAIR, JOHN ROBERT;BODMER, MARK WILLIAM;MOUNTAIN, ANDREW;AND OTHERS;REEL/FRAME:009312/0941;SIGNING DATES FROM 19920319 TO 19920320
Owner name: CELLTECH THERAPEUTICS LIMITED, UNITED KINGDOM
Free format text: CHANGE OF NAME;ASSIGNOR:CELLTECH LIMITED;REEL/FRAME:009312/0943
Effective date: 19941003
Oct 9, 2001CCCertificate of correction
Aug 30, 2002FPAYFee payment
Year of fee payment: 4
Aug 11, 2006FPAYFee payment
Year of fee payment: 8
Oct 4, 2010REMIMaintenance fee reminder mailed
Mar 2, 2011LAPSLapse for failure to pay maintenance fees
Apr 19, 2011FPExpired due to failure to pay maintenance fee
Effective date: 20110302