Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS6015783 A
Publication typeGrant
Application numberUS 08/814,052
Publication dateJan 18, 2000
Filing dateMar 6, 1997
Priority dateJan 29, 1996
Fee statusPaid
Also published asCA2239576A1, CN1109740C, CN1209833A, DE69730821D1, DE69730821T2, EP0882123A1, EP0882123B1, WO1997028243A1
Publication number08814052, 814052, US 6015783 A, US 6015783A, US-A-6015783, US6015783 A, US6015783A
InventorsClaus von der Osten, Joel R. Cherry, Mads E. Bjornvad, Jesper Vind, Michael Dolberg Rasmussen
Original AssigneeNovo Nordisk A/S
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Process for removal or bleaching of soiling or stains from cellulosic fabric
US 6015783 A
Abstract
The present invention relates to a process for removal or bleaching of soiling or stains present on cellulosic fabric, wherein the fabric is contacted in aqueous medium with a modified enzyme (enzyme hybrid) which comprises a catalytically active amino acid sequence of a non-cellulolytic enzyme linked to an amino acid sequence comprising a cellulose-binding domain. The invention further relates to a detergent composition comprising an enzyme hybrid of the type in question and a surfactant, and to a process for washing soiled or stained cellulosic fabric, wherein the fabric is washed in an aqueous medium to which is added such a detergent composition.
Images(53)
Previous page
Next page
Claims(11)
We claim:
1. A process for removal or bleaching of soiling or stains present on cellulosic fabric, comprising contacting the fabric in an aqueous medium with an enzyme hybrid which comprises a catalytically active amino acid sequence of a non-cellulolytic enzyme linked to an amino acid sequence comprising a cellulose-binding domain, wherein:
(i) the catalytically active amino acid sequence is derived from an enzyme selected from the group consisting of amylases, proteases, lipases, pectinases and oxidoreductases, wherein the amylase is derived from a species of Bacillus, Thermoanaerobactor, or Thermoanaerobacterium; the protease is derived from a species of Bacillus or Fusarium; the lipase is derived from a species of Humicola, Rhizomucor, Penicillium, Geotricum, Rhizopus, Fusarium, Candida, Pseudomonas or Bacillus; and the oxidoreductase is selected from the group consisting of a peroxidase and a laccase, wherein the peroxidase is derived from a species of Coprinus, Fusarium, Humicola, Tricoderma, Myrothecium, Verticillum, Arthromyces, Caldariomyces, Ulocladium, Embellisia, Cladosporium, Dreschlera, Phanerochaete, Coriolus, Trametes, Rhizopus, Mucor, Streptomyces, Streptoverticillum, Bacillus, Rhodobacter, Rhodomonus, Streptococcus, or Pseudomonas and the laccase is derived from a species of Trametes, Aspergillus, Neurospora, Podospora, Botrytis, Collybia, Fomes, Lentinus, Pleurotus, Rhizoctonia, Coprinus, Psatyrella, Phlebia, Pyricularia, Rigidoporus, Myceliophthora, Schytalidium or Polyporus; and
(ii) the cellulose-binding domain is derived from an enzyme selected from the group consisting of cellulases, xylanases, mannanases, arabinofuranosidases, acetylesterases, and chitinases.
2. The process according to claim 1, wherein the soiling or stain originates from starch, protein, fat, soil, clay, fruit, vegetables, coffee, tea, spices, red wine, body fluids, grass or ink.
3. The process according to claim 2, wherein the amylase is derived from Bacillus licheniformis.
4. The process according to claim 3, wherein the peroxidase is derived from C. cinereus.
5. The process according to claim 1, wherein the enzyme hybrid is obtained by a method comprising growing a transformed host cell containing an expression cassette which comprises a DNA sequence encoding the enzyme hybrid, whereby the enzyme hybrid is expressed.
6. A detergent composition comprising an enzyme hybrid which comprises:
(a) a catalytically active amino acid sequence of a non-cellulolytic enzyme linked to an amino acid sequence comprising a cellulose-binding domain, wherein
(i) the catalytically active amino acid sequence is derived from an enzyme selected from the group consisting of amylases, proteases, lipases, pectinases and oxidoreductases, wherein the amylase is derived from a species of Bacillus, Thermoanaerobactor, or Thermoanaerobacterium; the protease is derived from a species of Bacillus or Fusarium; the lipase is derived from a species of Humicola, Rhizomucor, Penicillium, Geotricum, Rhizopus, Fusarium, Candida, Pseudomonas or Bacillus; and the oxidoreductase is selected from the group consisting of a peroxidase and a laccase, wherein the peroxidase is derived from a species of Coprinus, Fusarium, Humicola, Tricoderma, Myrothecium, Verticillum, Arthromyces, Caldariomyces, Ulocladium, Embellisia, Cladosporium, Dreschlera, Phanerochaete, Coriolus, Trametes, Rhizopus, Mucor, Streptomyces, Streptoverticillum, Bacillus, Rhodobacter, Rhodomonus, Streptococcus, or Pseudomonas, and the laccase is derived from a species of Trametes, Aspergillus, Neurospora, Podospora, Botrytis, Collybia, Fomes, Lentinus, Pleurotus, Rhizoctonia, Coprinus, Psatyrella, Phlebia, Pyricularia, Rigidoporus, Myceliophthora, Schytalidium or Polyporus; and
(ii) the cellulose-binding domain is derived from an enzyme selected from the group consisting of cellulases, xylanases, mannanases, arabinofuranosidases, acetylesterases, and chitinases; and
(b) a surfactant.
7. A process for washing soiled or stained cellulosic fabric, comprising washing the fabric in an aqueous medium with a detergent composition according to claim 6.
8. An enzyme hybrid encoded by a hybrid-encoding DNA sequence comprising a sequence contained in a DNA sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18 and SEQ ID No. 19.
9. An enzyme hybrid according to claim 8 having an amino acid sequence comprising an amino acid sequence selected from the group consisting of SEQ ID No. 2, SEQ ID No. 6 and SEQ ID No. 8.
10. A process for removal or bleaching of soiling or stains present on cellulosic fabric, comprising contacting the fabric in an aqueous medium with an enzyme hybrid which comprises a catalytically active amino acid sequence of a non-cellulolytic enzyme linked to an amino acid sequence comprising a cellulose-binding domain, wherein said enzyme hybrid is selected from the group consisting of:
(a) a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:6, and SEQ ID NO:8; and
(b) a polypeptide encoded by a DNA sequence selected from the group consisting of SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18,and SEQ ID NO:19.
11. A detergent composition as defined in claim 6, wherein said enzyme hybrid is selected from the group consisting of:
(a) a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:6, and SEQ ID NO:8; and
(b) a polypeptide encoded by a DNA sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO:11, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO:17, SEQ ID NO:18,and SEQ ID NO:19, and
(b) a surfactant.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a continuation of application Ser. No. PCT/DK97/00042 filed Jan. 29, 1997 and claims priority under 35 U.S.C. 119 of Danish application serial no. 0094/96 filed Jan. 29, 1996, the contents of which are fully incorporated herein by reference.

FIELD OF THE INVENTION

The present invention relates to an improved enzymatic process for cleaning fabric or textile, notably cellulosic fabric or textile, particularly for removing or bleaching stains present on cellulosic fabric.

BACKGROUND OF THE INVENTION

Enzymatic processes for washing clothes (laundry washing) and other types of fabric or textile have been known for many years.

Certain types of soiling or stains have generally been found to be problematical to remove in such washing procedures. These are typically stains originating from starch, proteins, fats, red wine, fruit (such as blackcurrant, cherry, strawberry or tomato), vegetables (such as carrot or beetroot), tea, coffee, spices (such as curry or paprika), body fluids, grass, or ink (e.g. from ball-point pens or fountain pens).

It is an object of the present invention to improve the performance of a washing enzyme under conventional washing conditions by modifying the enzyme so as to alter (increase) the affinity of the enzyme for cellulosic fabric, whereby the modified enzyme is believed to be able to come into closer contact, and/or more lasting contact, with the soiling or stain in question.

SUMMARY OF THE INVENTION

It has now surprisingly been found possible to achieve improved cleaning of cellulosic fabric or textile, particularly improved removal or bleaching of stains present thereon, by means of an enzymatic process wherein the fabric or textile is contacted with an enzyme which has been modified so as to have increased affinity (relative to the unmodified enzyme) for binding to a cellulosic fabric or textile.

DETAILED DESCRIPTION OF THE INVENTION

The present invention thus relates, inter alia, to a process for removal or bleaching of soiling or stains present on cellulosic fabric or textile, wherein the fabric or textile is contacted in aqueous medium with a modified enzyme (enzyme hybrid) which comprises a catalytically (enzymatically) active amino acid sequence of a non-cellulolytic enzyme linked to an amino acid sequence comprising a cellulose-binding domain.

Stains

Soiling or stains which may be removed according to the present invention include those already mentioned above, i.e. soiling or stains originating from, for example, starch, proteins, fats, red wine, fruit [such as blackcurrant, cherry, strawberry or tomato (in particular tomato in ketchup or spaghetti sauce)], vegetables (such as carrot or beetroot), tea, coffee, spices (such as curry or paprika), body fluids, grass, or ink (e.g. from ball-point pens or fountain pens). Other types of soiling or stains which are appropriate targets for removal or bleaching in accordance with the invention include sebum, soil (i.e. earth), clay, oil and paint.

Cellulosic fabric

The term "cellulosic fabric" is intended to indicate any type of fabric, in particular woven fabric, prepared from a cellulose-containing material, such as cotton, or from a cellulose-derived material (prepared, e.g., from wood pulp or from cotton).

In the present context, the term "fabric" is intended to include garments and other types of processed fabrics, and is used interchangeably with the term "textile".

Examples of cellulosic fabric manufactured from naturally occurring cellulosic fibre are cotton, ramie, jute and flax (linen) fabrics. Examples of cellulosic fabrics made from man-made cellulosic fibre are viscose (rayon) and lyocell (e.g. Tencel™) fabric; also of relevance in the context of the invention are all blends of cellulosic fibres (such as viscose, lyocell, cotton, ramie, jute or flax) with other fibres, e.g. with animal hair fibres such as wool, alpaca or camel hair, or with polymer fibres such as polyester, polyacrylic, polyamide or polyacetate fibres.

Specific examples of blended cellulosic fabric are viscose/cotton blends, lyocell/cotton blends (e.g. Tencel™/cotton blends), viscose/wool blends, lyocell/wool blends, cotton/wool blends, cotton/polyester blends, viscose/cotton/polyester blends, wool/cotton/polyester blends, and flax/cotton blends.

Cellulose-binding domains

Although a number of types of carbohydrate-binding domains have been described in the patent and scientific literature, the majority thereof--many of which derive from cellulolytic enzymes (cellulases)--are commonly referred to as "cellulose-binding domains"; a typical cellulose-binding domain (CBD) will thus be one which occurs in a cellulase and which binds preferentially to cellulose and/or to poly- or oligosaccharide fragments thereof.

Cellulose-binding (and other carbohydrate-binding) domains are polypeptide amino acid sequences which occur as integral parts of large polypeptides or proteins consisting of two or more polypeptide amino acid sequence regions, especially in hydrolytic enzymes (hydrolases) which typically comprise a catalytic domain containing the active site for substrate hydrolysis and a carbohydrate-binding domain for binding to the carbohydrate substrate in question. Such enzymes can comprise more than one catalytic domain and one, two or three carbohydrate-binding domains, and they may further comprise one or more polypeptide amino acid sequence regions linking the carbohydrate-binding domain(s) with the catalytic domain(s), a region of the latter type usually being denoted a "linker".

Examples of hydrolytic enzymes comprising a cellulose-binding domain are cellulases, xylanases, mannanases, arabinofuranosidases, acetylesterases and chitinases. "Cellulose-binding domains" have also been found in algae, e.g. in the red alga Porphyra purpurea in the form of a non-hydrolytic polysaccharide-binding protein [see P. Tomme et al., Cellulose-Binding Domains--Classification and Properties in Enzymatic Degradation of Insoluble Carbohydrates, John N. Saddler and Michael H. Penner (Eds.), ACS Symposium Series, No. 618 (1996)]. However, most of the known CBDs [which are classified and referred to by P. Tomme et al. (op cit.) as "cellulose-binding domains"] derive from cellulases and xylanases.

In the present context, the term "cellulose-binding domain" is intended to be understood in the same manner as in the latter reference (P. Tomme et al., op. cit). The P. Tomme et al. reference classifies more than 120 "cellulose-binding domains" into 10 families (I-X) which may have different functions or roles in connection with the mechanism of substrate binding. However, it is to be anticipated that new family representatives and additional families will appear in the future, and in connection with the present invention a representative of one such new CBD family has in fact been identified (see Example 2 herein).

In proteins/polypeptides in which CBDs occur (e.g. enzymes, typically hydrolytic enzymes such as cellulases), a CBD may be located at the N or C terminus or at an internal position.

That part of a polypeptide or protein (e.g. hydrolytic enzyme) which constitutes a CBD per se typically consists of more than about 30 and less than about 250 amino acid residues. For example: those CBDs listed and classified in Family I in accordance with P. Tomme et al. (op. cit.) consist of 33-37 amino acid residues, those listed and classified in Family IIa consist of 95-108 amino acid residues, those listed and classified in Family VI consist of 85-92 amino acid residues, whilst one CBD (derived from a cellulase from Clostridium thertnocellum) listed and classified in Family VII consists of 240 amino acid residues. Accordingly, the molecular weight of an amino acid sequence constituting a CBD per se will typically be in the range of from about 4 kD to about 40 kD, and usually below about 35 kD.

Enzyme hybrids

Enzyme classification numbers (EC numbers) referred to in the present specification with claims are in accordance with the Recommendations (1992) of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, Academic Press Inc., 1992.

A modified enzyme (enzyme hybrid) for use in accordance with the invention comprises a catalytically active (enzymatically active) amino acid sequence (in general a polypeptide amino acid sequence) of a non-cellulolytic enzyme (i.e. a catalytically active amino acid sequence of an enzyme other than a cellulase) useful in relation to the cleaning of fabric or textile (typically the removal or bleaching of soiling or stains from fabrics or textiles in washing processes), in particular of an enzyme selected from the group consisting of amylases (e.g. α-amylases, EC 3.2.1.1), proteases (i.e. peptidases, EC 3.4), lipases (e.g. triacylglycerol lipases, EC 3.1.1.3) and oxidoreductases (e.g. peroxidases, EC 1.11.1, such as those classified under EC 1.11.1.7; or phenol-oxidizing oxidases, such as laccases, EC 1.10.3.2, or other enzymes classified under EC 1.10.3), fused (linked) to an amino acid sequence comprising a cellulose-binding domain. The catalytically active amino acid sequence in question may comprise or consist of the whole of--or substantially the whole of--the full amino acid sequence of the mature enzyme in question, or it may consist of a portion of the full sequence which retains substantially the same catalytic (enzymatic) properties as the full sequence.

Modified enzymes (enzyme hybrids) of the type in question, as well as detailed descriptions of the preparation and purification thereof, are known in the art [see, e.g., WO 90/00609, WO 94/24158 and WO 95/16782, as well as Greenwood et al., Biotechnology and Bioengineering 44 (1994) pp. 1295-1305]. They may, e.g., be prepared by transforming into a host cell a DNA construct comprising at least a fragment of DNA encoding the cellulose-binding domain ligated, with or without a linker, to a DNA sequence encoding the enzyme of interest, and growing the transformed host cell to express the fused gene. One relevant, but non-limiting, type of recombinant product (enzyme hybrid) obtainable in this manner--often referred to in the art as a "fusion protein"--may be described by one of the following general formulae:

A-CBD-MR-X-B

A-X-MR-CBD-B

In the latter formulae, CBD is an amino acid sequence comprising at least the cellulose-binding domain (CBD) per se.

MR (the middle region; a linker) may be a bond, or a linking group comprising from 1 to about 100 amino acid residues, in particular of from 2 to 40 amino acid residues, e.g. from 2 to 15 amino acid residues. MR may, in principle, alternatively be a non-amino-acid linker.

X is an amino acid sequence comprising the above-mentioned, catalytically (enzymatically) active sequence of amino acid residues of a polypeptide encoded by a DNA sequence encoding the non-cellulolytic enzyme of interest.

The moieties A and B are independently optional. When present, a moiety A or B constitutes a terminal extension of a CBD or X moiety, and normally comprises one or more amino acid residues.

It will thus, inter alia, be apparent from the above that a CBD in an enzyme hybrid of the type in question may be positioned C-terminally, N-terminally or internally in the enzyme hybrid. Correspondingly, an X moiety in an enzyme hybrid of the type in question may be positioned N-terminally, C-terminally or internally in the enzyme hybrid.

Enzyme hybrids of interest in the context of the invention include enzyme hybrids which comprise more than one CBD, e.g. such that two or more CBDs are linked directly to each other, or are separated from one another by means of spacer or linker sequences (consisting typically of a sequence of amino acid residues of appropriate length). Two CBDs in an enzyme hybrid of the type in question may, for example, also be separated from one another by means of an -MR-X- moiety as defined above.

A very important issue in the construction of enzyme hybrids of the type in question is the stability towards proteolytic degradation. Two- and multi-domain proteins are particularly susceptible towards proteolytic cleavage of linker regions connecting the domains. Proteases causing such cleavage may, for example, be subtilisins, which are known to often exhibit broad substrate specificities [see, e.g.: Gr.o slashed.n et al., Biochemistry 31 (1992), pp. 6011-6018; Teplyakov et al., Protein Engineering 5 (1992), pp. 413-420].

Glycosylation of linker residues in eukaryotes is one of Nature's ways of preventing proteolytic degradation. Another is to employ amino acids which are less favoured by the surrounding proteases. The length of the linker also plays a role in relation to accessibility by proteases. Which "solution" is optimal depends on the environment in which the enzyme hybrid is to function.

When constructing new enzyme hybrid molecules, linker stability thus becomes an issue of great importance. The various linkers described in examples presented herein (vide infra) in the context of the present invention are intended to take account of this issue.

Cellulases (cellulase genes) useful for preparation of CBDs

Techniques suitable for isolating a cellulase gene are well known in the art. In the present context, the terms "cellulase" and "cellulolytic enzyme" refer to an enzyme which catalyses the degradation of cellulose to glucose, cellobiose, triose and/or other cello-oligosaccharides.

Preferred cellulases (i.e. cellulases comprising preferred CBDs) in the present context are microbial cellulases, particularly bacterial or fungal cellulases. Endoglucanases, notably endo-1,4-β-glucanases (EC 3.2.1.4), particularly monocomponent (recombinant) endo-1,4-β-glucanases, are a preferred class of cellulases,.

Useful examples of bacterial cellulases are cellulases derived from or producible by bacteria from the group consisting of Pseudomonas, Bacillus, Cellulomonas, Clostridium, Microspora, Thermotoga, Caldocellum and Actinomycets such as Streptomyces, Termomonospora and Acidothemus, in particular from the group consisting of Pseudomonas cellulolyticus, Bacillus lautus, Cellulomonas fimi, Clostridium thermocellum, Microspora bispora, Termomonospora fusca, Termomonospora cellulolyticum and Acidothemus cellulolyticus.

The cellulase may be an acid, a neutral or an alkaline cellulase, i.e. exhibiting maximum cellulolytic activity in the acid, neutral or alkaline range, respectively.

A useful cellulase is an acid cellulase, preferably a fungal acid cellulase, which is derived from or producible by fungi from the group of genera consisting of Trichoderma, Myrothecium, Aspergillus, Phanaerochaete, Neurospora, Neocallimastix and Botrytis.

A preferred useful acid cellulase is one derived from or producible by fungi from the group of species consisting of Trichoderma viride, Trichoderma reesei, Trichoderma longibrachiatum, Myrothecium verrucaria, Aspergillus niger, Aspergillus oryzae, Phanaerochaete chrysosporium, Neurospora crassa, Neocallimastix partriciarum and Botrytis cinerea.

Another useful cellulase is a neutral or alkaline cellulase, preferably a fungal neutral or alkaline cellulase, which is derived from or producible by fungi from the group of genera consisting of Aspergillus, Penicillium, Myceliophthora, Humicola, Irpex, Fusarium, Stachybotrys, Scopulariopsis, Chaetomium, Mycogone, Verticillium, Myrothecium, Papulospora, Gliocladium, Cephalosporium and Acremonium.

A preferred alkaline cellulase is one derived from or producible by fungi from the group of species consisting of Humicola insolens, Fusarium oxysporum, Myceliopthora thermophila, Penicillium janthinellum and Cephalosporium sp., preferably from the group of species consisting of Humicola insolens DSM 1800, Fusarium oxysporum DSM 2672, Myceliopthora thermophila CBS 117.65, and Cephalosporium sp. RYM-202.

A preferred cellulase is an alkaline endoglucanase which is immunologically reactive with an antibody raised against a highly purified ˜43 kD endoglucanase derived from Humicola insolens DSM 1800, or which is a derivative of the latter ˜43 kD endoglucanase and exhibits cellulase activity.

Other examples of useful cellulases are variants of parent cellulases of fungal or bacterial origin, e.g. variants of a parent cellulase derivable from a strain of a species within one of the fungal genera Humicola, Trichoderma or Fusarium.

Isolation of a cellulose-binding domain

In order to isolate a cellulose-binding domain of, e.g., a cellulase, several genetic engineering approaches may be used. One method uses restriction enzymes to remove a portion of the gene and then to fuse the remaining gene-vector fragment in frame to obtain a mutated gene that encodes a protein truncated for a particular gene fragment. Another method involves the use of exonucleases such as Bal31 to systematically delete nucleotides either externally from the 5' and the 3' ends of the DNA or internally from a restricted gap within the gene. These gene-deletion methods result in a mutated gene encoding a shortened gene molecule whose expression product may then be evaluated for substrate-binding (e.g. cellulose-binding) ability. Appropriate substrates for evaluating the binding ability include cellulosic materials such as Avicel™ and cotton fibres. Other methods include the use of a selective or specific protease capable of cleaving a CBD, e.g. a terminal CBD, from the remainder of the polypeptide chain of the protein in question

As already indicated (vide supra), once a nucleotide sequence encoding the substrate-binding (carbohydrate-binding) region has been identified, either as cDNA or chromosomal DNA, it may then be manipulated in a variety of ways to fuse it to a DNA sequence encoding the enzyme or enzymatically active amino acid sequence of interest. The DNA fragment encoding the carbohydrate-binding amino acid sequence, and the DNA encoding the enzyme or enzymatically active amino acid sequence of interest are then ligated with or without a linker. The resulting ligated DNA may then be manipulated in a variety of ways to achieve expression. Preferred microbial expression hosts include certain Aspergillus species (e.g. A. niger or A. oryzae), Bacillus species, and organisms such as Escherichia coli or Saccharomyces cerevisiae.

Amylolytic enzymes

Amylases (e.g. α- or β-amylases) which are appropriate as the basis for enzyme hybrids of the types employed in the context of the present invention include those of bacterial or fungal origin. Chemically or genetically modified mutants of such amylases are included in this connection. Relevant α-amylases include, for example, α-amylases obtainable from Bacillus species, in particular a special strain of B. licheniformis, described in more detail in GB 1296839. Relevant commercially available amylases include Duramyl™, Termamyl™, Fungamyl™ and BAN™ (all available from Novo Nordisk A/S, Bagsvaerd, Denmark), and Rapidase™ and Maxamyl™ P (available from Gist-Brocades, Holland).

Other useful amylolytic enzymes are CGTases (cyclodextrin glucanotransferases, EC 2.4.1.19), e.g. those obtainable from species of Bacillus, Thermoanaerobactor or Thermoanaerobacterium.

Proteolytic enzymes

Proteases (peptidases) which are appropriate as the basis for enzyme hybrids of the types employed in the context of the present invention include those of animal, vegetable or microbial origin. Proteases of microbial origin are preferred. Chemically or genetically modified mutants of such proteases are included in this connection. The protease may be a serine protease, preferably an alkaline microbial protease or a trypsin-like protease. Examples of alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279). Examples of trypsin-like proteases are trypsin (e.g. of porcine or bovine origin) and the Fusarium protease described in WO 89/06270.

Relevant commercially available protease enzymes include Alcalase™, Savinase™, Primase, Durazym™ and Esperase™ (all available from Novo Nordisk A/S, Bagsvaerd, Denmark), Maxatase™, Maxacal™, Maxapem™ and Properase™ (available from Gist-Brocades, Holland), Purafect™ and Purafect™ OXP (available from Genencor International), and Opticlean™ and Optimase™ (available from by Solvay Enzymes).

Lipolvtic enzymes

Lipolytic enzymes (lipases) which are appropriate as the basis for enzyme hybrids of the types employed in the context of the present invention include those of bacterial or fungal origin. Chemically or genetically modified mutants of such lipases are included in this connection.

Examples of useful lipases include a Humicola lanuginosa lipase, e.g. as described in EP 258 068 and EP 305 216; a Rhizomucor miehei lipase, e.g. as described in EP 238 023; a Candida lipase, such as a C. antarctica lipase, e.g. the C. antarctica lipase A or B described in EP 214 761; a Pseudomonas lipase, such as one of those described in EP 721 981 (e.g. a lipase obtainable from a Pseudomonas sp. SD705 strain having deposit accession number FERM BP-4772), in PCT/JP96/00426, in PCT/JP96/00454 (e.g. a P. solanacearum lipase), in EP 571 982 or in WO 95/14783 (e.g. a P. mendocina lipase), a P. alcaligenes or P. pseudoalcaligenes lipase, e.g. as described in EP 218 272, a P. cepacia lipase, e.g. as described in EP 331 376, a P. stutzeri lipase, e.g. as disclosed in GB 1,372,034, or a P. fluorescens lipase; a Bacillus lipase, e.g. a B. subtilis lipase [Dartois et al., Biochemica et Biophysica Acta 1131 (1993) pp. 253-260], a B. stearothermophilus lipase (JP 64/744992) and a B. pumilus lipase (WO 91/16422).

Furthermore, a number of cloned lipases may be useful, including the Penicillium camembertii lipase described by Yamaguchi et al. in Gene 103 (1991), pp. 61-67, the Geotricum candidum lipase [Y. Schimada et al., J. Biochem. 106 (1989), pp. 383-388], and various Rhizopus lipases such as an R. delemar lipase [M. J. Hass et al., Gene 109 (1991) pp. 117-113], an R. niveus lipase [Kugimiya et al., Biosci. Biotech. Biochem. 56 (1992), pp. 716-719] and a R. oryzae lipase.

Other potentially useful types of lipolytic enzymes include cutinases, e.g. a cutinase derived from Pseudomonas mendocina as described in WO 88/09367, or a cutinase derived from Fusarium solani f. pisi (described, e.g., in WO 90/09446).

Suitable commercially available lipases include Lipolase™ and Lipolase Ultra™ (available from Novo Nordisk A/S), M1 Lipase™, Lumafast™ and Lipomax™ (available from Gist-Brocades) and Lipase P "Amano" (available from Amano Pharmaceutical Co. Ltd.).

Oxidoreductases

Oxidoreductases which are appropriate as the basis for enzyme hybrids of the types employed in the context of the present invention include peroxidases (EC 1.11.1) and oxidases, such as laccases (EC 1.10.3.2) and certain related enzymes.

Peroxidases

Peroxidases (EC 1.11.1) are enzymes acting on a peroxide (e.g. hydrogen peroxide) as acceptor. Very suitable peroxidases are those classified under EC 1.11.1.7, or any fragment derived therefrom, exhibiting peroxidase activity. Synthetic or semisynthetic derivatives thereof (e.g. with porphyrin ring systems, or microperoxidases, cf., for example, U.S. Pat. No. 4,077,768, EP 537 381, WO 91/05858 and WO 92/16634) may also be of value in the context of the invention.

Very suitable peroxidases are peroxidases obtainable from plants (e.g. horseradish peroxidase or soy bean peroxidase) or from microorganisms, such as fungi or bacteria. In this respect, some preferred fungi include strains belonging to the subdivision Deuteromycotina, class Hyphomycetes, e.g. Fusarium, Humicola, Tricoderma, Myrothecium, Verticillum, Arthromyces, Caldariomyces, Ulocladium, Embellisia, Cladosporium or Dreschlera, in particular Fusarium oxysporum (DSM 2672), Humicola insolens, Trichoderma resii, Myrothecium verrucana (IFO 6113), Verticillum alboatrum, Verticillum dahlie, Arthromyces ramosus (FERM P-7754), Caldariomyces fumago, Ulocladium chartarum, Embellisia alli or Dreschlera halodes.

Other preferred fungi include strains belonging to the subdivision Basidiomycotina, class Basidiomycetes, e.g. Coprinus, Phanerochaete, Coriolus or Trametes, in particular Coprinus cinereus f. microsporus (IFO 8371), Coprinus macrorhizus, Phanerochaete chrysosporium (e.g. NA-12) or Trametes versicolor (e.g. PR4 28-A).

Further preferred fungi include strains belonging to the subdivision Zygomycotina, class Mycoraceae, e.g. Rhizopus or Mucor, in particular Mucor hiemalis.

Some preferred bacteria include strains of the order Actinomycetales, e.g. Streptomyces spheroides (ATTC 23965), Streptomyces thermoviolaceus (IFO 12382) or Streptoverticillum verticillium ssp. verticillium.

Other preferred bacteria include Bacillus pumilus (ATCC 12905), Bacillus stearothermophilus, Rhodobacter sphaeroides, Rhodomonas palustri, Streptococcus lactis, Pseudomonas purrocinia (ATCC 15958) or Pseudomonas fluorescens (NRRL B-11).

Further preferred bacteria include strains belonging to Myxococcus, e.g. M. virescens.

Other potential sources of useful particular peroxidases are listed in B. C. Saunders et al., Peroxidase, London 1964, pp. 41-43.

The peroxidase may furthermore be one which is producible by a method comprising cultivating a host cell--transformed with a recombinant DNA vector which carries a DNA sequence encoding said peroxidase as well as DNA sequences encoding functions permitting the expression of the DNA sequence encoding the peroxidase--in a culture medium under conditions permitting the expression of the peroxidase, and recovering the peroxidase from the culture.

A suitable recombinantly produced peroxidase is a peroxidase derived from a Coprinus sp., in particular C. macrorhizus or C. cinereus according to WO 92/16634, or a variant thereof, e.g. a variant as described in WO 94/12621.

Oxidases and related enzymes

Preferred oxidases in the context of the present invention are oxidases classified under EC 1.10.3, which are oxidases employing molecular oxygen as acceptor (i.e. enzymes catalyzing oxidation reactions in which molecular oxygen functions as oxidizing agent).

As indicated above, laccases (EC 1.10.3.2) are very suitable oxidases in the context of the invention. Examples of other useful oxidases in the context of the invention include the catechol oxidases (EC 1.10.3.1) and bilirubin oxidases (EC 1.3.3.5). Further useful, related enzymes include monophenol monooxygenases (EC 1.14.18.1).

Laccases are obtainable from a variety of plant and microbial sources, notably from bacteria and fungi (including filamentous fungi and yeasts), and suitable examples of laccases are to found among those obtainable from fungi, including laccases obtainable from strains of Aspergillus, Neurospora (e.g. N. crassa), Podospora, Botrytis, Collybia, Fomes, Lentinus, Pleurotus, Trametes (e.g. T. villosa or T. versicolor [some species/strains of Trametes being known by various names and/or having previously been classified within other genera; e.g. Trametes villosa=T. pinsitus=Polyporus pinsitis (also known as P. pinsitus or P. villosus)=Coriolus pinsitus], Polyporus, Rhizoctonia (e.g. R. solani), Coprinus (e.g. C. plicatilis or C. cinereus), Psatyrella, Myceliophthora (e.g. M. thermophila), Schytalidium, Phlebia (e.g. P. radita; see WO 92/01046), Coriolus (e.g. C.hirsutus; see JP 2-238885), Pyricularia or Rigidoporus.

Preferred laccases in the context of the invention include laccase obtainable from species/strains of Trametes (e.g. T. villosa), Myceliophthora (e.g. M. thermophila), Schytalidium or Polyporus.

Other enzymes

Further classes of enzymes which are appropriate as the basis for enzyme hybrids of the types employed in the context of the present invention include pectinases (polygalacturonases; EC 3.2.1.15).

Plasmids

Preparation of plasmids capable of expressing fusion proteins having the amino acid sequences derived from fragments of more than one polypeptide is well known in the art (see, for example, WO 90/00609 and WO 95/16782). The expression cassette may be included within a replication system for episomal maintenance in an appropriate cellular host or may be provided without a replication system, where it may become integrated into the host genome. The DNA may be introduced into the host in accordance with known techniques such as transformation, microinjection or the like.

Once the fused gene has been introduced into the appropriate host, the host may be grown to express the fused gene. Normally it is desirable additionally to add a signal sequence which provides for secretion of the fused gene. Typical examples of useful fused genes are:

Signal sequence--(pro-peptide)--carbohydrate-binding domain--linker--enzyme sequence of interest, or

Signal sequence--(pro-peptide)--enzyme sequence of interest--linker--carbohydrate-binding domain,

in which the pro-peptide sequence normally contains 5-100, e.g. 5-25, amino acid residues.

The recombinant product may be glycosylated or non-glycosylated.

Detergent compositions

Surfactant system

The detergent compositions according to the present invention comprise a surfactant system, wherein the surfactant can be selected from nonionic and/or anionic and/or cationic and/or ampholytic and/or zwitterionic and/or semi-polar surfactants.

The surfactant is typically present at a level from 0.1% to 60% by weight. The surfactant is preferably formulated to be compatible with enzyme hybrid and enzyme components present in the composition. In liquid or gel compositions the surfactant is most preferably formulated in such a way that it promotes, or at least does not degrade, the stability of any enzyme hybrid or enzyme in these compositions.

Suitable systems for use according to the present invention comprise as a surfactant one or more of the nonionic and/or anionic surfactants described herein.

Polyethylene, polypropylene, and polybutylene oxide conden-sates of alkyl phenols are suitable for use as the nonionic surfactant of the surfactant systems of the present invention, with the polyethylene oxide condensates being pre-ferred. These compounds include the condensation products of alkyl phenols having an alkyl group containing from about 6 to about 14 carbon atoms, preferably from about 8 to about 14 carbon atoms, in either a straight chain or branched-chain configuration with the alkylene oxide. In a preferred embodiment, the ethylene oxide is present in an amount equal to from about 2 to about 25 moles, more preferably from about 3 to about 15 moles, of ethylene oxide per mole of alkyl phenol. Commercially available nonionic surfactants of this type include Igepal™ CO-630, marketed by the GAF Corporation; and Triton™ X-45, X-114, X-100, and X-102, all marketed by the Rohm & Haas Company. These surfactants are commonly referred to as alkylphenol alkoxylates (e.g., alkyl phenol ethoxylates).

The condensation products of primary and secondary aliphatic alcohols with about I to about 25 moles of ethylene oxide are suitable for use as the nonionic surfactant of the nonionic surfactant systems of the present invention. The alkyl chain of the aliphatic alcohol can either be straight or branched, primary or secondary, and generally contains from about 8 to about 22 carbon atoms. Preferred are the condensation products of alcohols having an alkyl group containing from about 8 to about 20 carbon atoms, more preferably from about 10 to about 18 carbon atoms, with from about 2 to about 10 moles of ethylene oxide per mole of alcohol. About 2 to about 7 moles of ethylene oxide and most preferably from 2 to 5 moles of ethylene oxide per mole of alcohol are present in said condensation products. Examples of commercially available nonionic surfactants of this type include Tergitol™ 15-S-9 (The condensation product of C11 -C15 linear alcohol with 9 moles ethylene oxide), Tergitol™ 24-L-6 NMW (the condensation product of C12 -C14 primary alcohol with 6 moles ethylene oxide with a narrow molecular weight distribution), both marketed by Union Carbide Corporation; Neodol™ 45-9 (the condensation product of C14 -C15 linear alcohol with 9 moles of ethylene oxide), Neodol™ 23-3 (the condensation product of C12 -C13 linear alcohol with 3.0 moles of ethylene oxide), Neodol™ 45-7 (the condensation product of C14 -C15 linear alcohol with 7 moles of ethylene oxide), Neodol™ 45-5 (the condensation product of C14 -C15 linear alcohol with 5 moles of ethylene oxide) marketed by Shell Chemical Company, Kyro™ EOB (the condensation product of C13 -C15 alcohol with 9 moles ethylene oxide), marketed by The Procter & Gamble Company, and Genapol LA 050 (the condensation product of C12 -C14 alcohol with 5 moles of ethylene oxide) marketed by Hoechst. Preferred range of HLB in these products is from 8-11 and most preferred from 8-10.

Also useful as the nonionic surfactant of the surfactant systems of the present invention are alkylpolysaccharides disclosed in U.S. Pat. No. 4,565,647, having a hydrophobic group containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms and a polysaccharide, e.g. a polyglycoside, hydrophilic group containing from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7 saccharide units. Any reducing saccharide containing 5 or 6 carbon atoms can be used, e.g., glucose, galactose and galactosyl moieties can be substituted for the glucosyl moieties (optionally the hydrophobic group is attached at the 2-, 3-, 4-, etc. positions thus giving a glucose or galactose as opposed to a glucoside or galactoside). The intersaccharide bonds can be, e.g., between the one position of the additional saccharide units and the 2-, 3-, 4-, and/or 6-positions on the preceding saccharide units.

The preferred alkylpolyglycosides have the formula

R2 O(Cn H2n O)t (glycosyl)x 

wherein R2 is selected from the group consisting of alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain from about 10 to about 18, preferably from about 12 to about 14, carbon atoms; n is 2 or 3, preferably 2; t is from 0 to about 10, pre-ferably 0; and x is from about 1.3 to about 10, preferably from about 1.3 to about 3, most preferably from about 1.3 to about 2.7. The glycosyl is preferably derived from glucose. To prepare these compounds, the alcohol or alkylpolyethoxy alcohol is formed first and then reacted with glucose, or a source of glucose, to form the glucoside (attachment at the 1-position). The additional glycosyl units can then be attached between their 1-position and the preceding glycosyl units 2-, 3-, 4-, and/or 6-position, preferably predominantly the 2-position.

The condensation products of ethylene oxide with a hydrophobic base formed by the condensation of propylene oxide with propylene glycol are also suitable for use as the additional nonionic surfactant systems of the present invention. The hydrophobic portion of these compounds will preferably have a molecular weight from about 1500 to about 1800 and will exhibit water insolubility. The addition of polyoxyethylene moieties to this hydrophobic portion tends to increase the water solubility of the molecule as a whole, and the liquid character of the product is retained up to the point where the polyoxyethylene content is about 50% of the total weight of the condensation product, which corresponds to condensation with up to about 40 moles of ethylene oxide. Examples of compounds of this type include certain of the commercially available Pluronic™ surfactants, marketed by BASF.

Also suitable for use as the nonionic surfactant of the nonionic surfactant system of the present invention, are the condensation products of ethylene oxide with the product resulting from the reaction of propylene oxide and ethylenediamine. The hydrophobic moiety of these products consists of the reaction product of ethylenediamine and excess propylene oxide, and generally has a molecular weight of from about 2500 to about 3000. This hydrophobic moiety is condensed with ethylene oxide to the extent that the condensation product contains from about 40% to about 80% by weight of polyoxyethylene and has a molecular weight of from about 5,000 to about 11,000. Examples of this type of nonionic surfactant include certain of the commercially available Tetronic™ compounds, marketed by BASF.

Preferred for use as the nonionic surfactant of the surfactant systems of the present invention are polyethylene oxide condensates of alkyl phenols, condensation products of primary and secondary aliphatic alcohols with from about 1 to about 25 moles of ethyleneoxide, alkylpolysaccharides, and mixtures hereof. Most preferred are C8 -C14 alkyl phenol ethoxylates having from 3 to 15 ethoxy groups and C8 -C18 alcohol ethoxylates (preferably C10 avg.) having from 2 to 10 ethoxy groups, and mixtures thereof.

Highly preferred nonionic surfactants are polyhydroxy fatty acid amide surfactants of the formula ##STR1## wherein R1 is H, or R1 is C1-4 hydrocarbyl, 2-hydroxyethyl, 2-hydroxypropyl or a mixture thereof, R2 is C5-31 hydrocarbyl, and Z is a polyhydroxyhydrocarbyl having a linear hydrocarbyl chain with at least 3 hydroxyls directly connected to the chain, or an alkoxylated derivative thereof. Preferably, R1 is methyl, R2 is straight C11-15 alkyl or C16-18 alkyl or alkenyl chain such as coconut alkyl or mixtures thereof, and Z is derived from a reducing sugar such as glucose, fructose, maltose or lactose, in a reductive amination reaction.

Highly preferred anionic surfactants include alkyl alkoxylated sulfate surfactants. Examples hereof are water soluble salts or acids of the formula RO(A)m SO3 M wherein R is an unsubstituted C10 -C-24 alkyl or hydroxyalkyl group having a C10 -C24 alkyl component, preferably a C12 -C20 alkyl or hydro-xyalkyl, more preferably C12 -C18 alkyl or hydroxyalkyl, A is an ethoxy or propoxy unit, m is greater than zero, typically between about 0.5 and about 6, more preferably between about 0.5 and about 3, and M is H or a cation which can be, for example, a metal cation (e.g., sodium, potassium, lithium, calcium, magnesium, etc.), ammonium or substituted-ammonium cation. Alkyl ethoxylated sulfates as well as alkyl propoxylated sulfates are contemplated herein. Specific examples of substituted ammonium cations include methyl-, dimethyl, trimethyl-ammonium cations and quaternary ammonium cations such as tetramethyl-ammonium and dimethyl piperdinium cations and those derived from alkylamines such as ethylamine, diethylamine, triethylamine, mixtures thereof, and the like. Exemplary surfactants are C12 -C18 alkyl polyethoxylate (1.0) sulfate (C12 -C18 E(1.0)M), C12 -C18 alkyl polyethoxylate (2.25) sulfate (C12 -C18 (2.25)M, and C12 -C18 alkyl polyethoxylate (3.0) sulfate (C12 -C18 E(3.0)M), and C12 -C18 alkyl polyethoxylate (4.0) sulfate (C12 -C18 E(4.0)M), wherein M is conveniently selected from sodium and potassium.

Suitable anionic surfactants to be used are alkyl ester sulfonate surfactants including linear esters of C8 -C20 carboxylic acids (i.e., fatty acids) which are sulfonated with gaseous SO3 according to "The Journal of the American Oil Chemists Society", 52 (1975), pp. 323-329. Suitable starting materials would include natural fatty substances as derived from tallow, palm oil, etc.

The preferred alkyl ester sulfonate surfactant, especially for laundry applications, comprise alkyl ester sulfonate surfactants of the structural formula: ##STR2## wherein R3 is a C8 -C20 hydrocarbyl, preferably an alkyl, or combination thereof, R4 is a C1 -C6 hydrocarbyl, preferably an alkyl, or combination thereof, and M is a cation which forms a water soluble salt with the alkyl ester sulfonate. Suitable salt-forming cations include metals such as sodium, potassium, and lithium, and substituted or unsubstituted ammonium cations, such as monoethanolamine, diethonolamine, and triethanolamine. Preferably, R3 is C10 -C16 alkyl, and R4 is methyl, ethyl or isopropyl. Especially preferred are the methyl ester sulfonates wherein R3 is C10 -C16 alkyl.

Other suitable anionic surfactants include the alkyl sulfate surfactants which are water soluble salts or acids of the formula ROSO3 M wherein R preferably is a C10 -C24 hydrocarbyl, preferably an alkyl or hydroxyalkyl having a C10 -C20 alkyl component, more preferably a C12 -C18 alkyl or hydroxyalkyl, and M is H or a cation, e.g., an alkali metal cation (e.g. sodium, potassium, lithium), or ammonium or substituted ammonium (e.g. methyl-, dimethyl-, and trimethyl ammonium cations and quaternary ammonium cations such as tetramethyl-ammonium and dimethyl piperdinium cations and quaternary ammonium cations derived from alkylamines such as ethylamine, diethylamine, triethylamine, and mixtures thereof, and the like). Typically, alkyl chains of C12 -C16 are preferred for lower wash temperatures (e.g. below about 50 C.) and C16 -C18 alkyl chains are preferred for higher wash temperatures (e.g. above about 50 C.).

Other anionic surfactants useful for detersive purposes can also be included in the laundry detergent compositions of the present invention. Theses can include salts (including, for example, sodium, potassium, ammonium, and substituted ammonium salts such as mono- di- and triethanolamine salts) of soap, C8 -C22 primary or secondary alkanesulfonates, C8 -C24 olefinsulfonates, sulfonated polycarboxylic acids prepared by sulfonation of the pyrolyzed product of alkaline earth metal citrates, e.g., as described in British patent specification No. 1,082,179, C8 -C24 alkylpolyglycolethersulfates (containing up to 10 moles of ethylene oxide); alkyl glycerol sulfonates, fatty acyl glycerol sulfonates, fatty oleyl glycerol sulfates, alkyl phenol ethylene oxide ether sulfates, paraffin sulfonates, alkyl phosphates, isethionates such as the acyl isethionates, N-acyl taurates, alkyl succinamates and sulfosuccinates, monoesters of sulfosuccinates (especially saturated and unsaturated C12 -C8 monoesters) and diesters of sulfosuccinates (especially saturated and unsaturated C6 -C12 diesters), acyl sarcosinates, sulfates of alkylpolysaccharides such as the sulfates of alkylpolyglucoside (the nonionic nonsulfated compounds being described below), branched primary alkyl sulfates, and alkyl polyethoxy carboxylates such as those of the formula RO(CH2 CH2 O)k --CH2 COO--M+ wherein R is a C8 -C22 alkyl, k is an integer from 1 to 10, and M is a soluble salt forming cation. Resin acids and hydrogenated resin acids are also suitable, such as rosin, hydrogenated rosin, and resin acids and hydrogenated resin acids present in or derived from tall oil.

Alkylbenzene sulfonates are highly preferred. Especially preferred are linear (straight-chain) alkyl benzene sulfonates (LAS) wherein the alkyl group preferably contains from 10 to 18 carbon atoms.

Further examples are described in "Surface Active Agents and Detergents" (Vol. I and II by Schwartz, Perrry and Berch). A variety of such surfactants are also generally disclosed in U.S. Pat. No. 3,929,678, (Column 23, line 58 through Column 29, line 23, herein incorporated by reference).

When included therein, the laundry detergent compositions of the present invention typically comprise from about 1% to about 40%, preferably from about 3% to about 20% by weight of such anionic surfactants.

The laundry detergent compositions of the present invention may also contain cationic, ampholytic, zwitterionic, and semi-polar surfactants, as well as the nonionic and/or anionic surfactants other than those already described herein.

Cationic detersive surfactants suitable for use in the laundry detergent compositions of the present invention are those having one long-chain hydrocarbyl group. Examples of such cationic surfactants include the ammonium surfactants such as alkyltrimethylammonium halogenides, and those surfactants having the formula:

[R2 (OR3)y ][R4 (OR3)y ]2 R5 N+X--

wherein R2 is an alkyl or alkyl benzyl group having from about 8 to about 18 carbon atoms in the alkyl chain, each R3 is selected form the group consisting of --CH2 CH2 --, --CH2 CH(CH3)--, --CH2 CH(CH2 OH)--, --CH2 CH2 CH2 --, and mixtures thereof; each R4 is selected from the group consisting of C1 -C4 alkyl, C1 -C4 hydroxyalkyl, benzyl ring structures formed by joining the two R4 groups, --CH2 CHOHCHOHCOR6 CHOHCH2 OH, wherein R6 is any hexose or hexose polymer having a molecular weight less than about 1000, and hydrogen when y is not 0; R5 is the same as R4 or is an alkyl chain, wherein the total number of carbon atoms or R2 plus R5 is not more than about 18; each y is from 0 to about 10,and the sum of the y values is from 0 to about 15; and X is any compatible anion.

Highly preferred cationic surfactants are the water soluble quaternary ammonium compounds useful in the present composition having the formula:

R1 R2 R3 R4 N+ X-            (i)

wherein R1 is C8 -C16 alkyl, each of R2, R3 and R4 is independently C1 -C4 alkyl, C1 -C4 hydroxy alkyl, benzyl, and --(C2 H40)x H where x has a value from 2 to 5, and X is an anion. Not more than one of R2, R3 or R4 should be benzyl.

The preferred alkyl chain length for R1 is C12 -C15, particularly where the alkyl group is a mixture of chain lengths derived from coconut or palm kernel fat or is derived synthetically by olefin build up or OXO alcohols synthesis.

Preferred groups for R2 R3 and R4 are methyl and hydroxyethyl groups and the anion X may be selected from halide, methosulphate, acetate and phosphate ions.

Examples of suitable quaternary ammonium compounds of formulae (i) for use herein are:

coconut trimethyl ammonium chloride or bromide;

coconut methyl dihydroxyethyl ammonium chloride or bromide;

decyl triethyl ammonium chloride;

decyl dimethyl hydroxyethyl ammonium chloride or bromide;

C12-15 dimethyl hydroxyethyl ammonium chloride or bromide;

coconut dimethyl hydroxyethyl ammonium chloride or bromide;

myristyl trimethyl ammonium methyl sulphate;

lauryl dimethyl benzyl ammonium chloride or bromide;

lauryl dimethyl (ethenoxy)4 ammonium chloride or bromide;

choline esters (compounds of formula (i) wherein R1 is ##STR3## alkyl and R2 R3 R4 are methyl). di-alkyl imidazolines [compounds of formula (i)].

Other cationic surfactants useful herein are also described in U.S. Pat. No. 4,228,044 and in EP 000 224.

When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 25%, preferably from about 1% to about 8% by weight of such cationic surfactants.

Ampholytic surfactants are also suitable for use in the laundry detergent compositions of the present invention. These surfactants can be broadly described as aliphatic derivatives of secondary or tertiary amines, or aliphatic derivatives of heterocyclic secondary and tertiary amines in which the aliphatic radical can be straight- or branched-chain. One of the aliphatic substituents contains at least about 8 carbon atoms, typically from about 8 to about 18 carbon atoms, and at least one contains an anionic water-solubilizing group, e.g. carboxy, sulfonate, sulfate. See U.S. pat. No. 3,929,678 (column 19, lines 18-35) for examples of ampholytic surfactants.

When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such ampholytic surfactants.

Zwitterionic surfactants are also suitable for use in laundry detergent compositions. These surfactants can be broadly described as derivatives of secondary and tertiary amines, derivatives of heterocyclic secondary and tertiary amines, or derivatives of quaternary ammonium, quaternary phosphonium or tertiary sulfonium compounds. See U.S. Pat. No. 3,929,678 (column 19, line 38 through column 22, line 48) for examples of zwitterionic surfactants.

When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such zwitterionic surfactants.

Semi-polar nonionic surfactants are a special category of nonionic surfactants which include water-soluble amine oxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and 2 moieties selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; watersoluble phosphine oxides containing one alkyl moiety of from about 10 to about 18 carbon atoms and 2 moieties selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; and water-soluble sulfoxides containing one alkyl moiety from about 10 to about 18 carbon atoms and a moiety selected from the group consisting of alkyl and hydroxyalkyl moieties of from about 1 to about 3 carbon atoms.

Semi-polar nonionic detergent surfactants include the amine oxide surfactants having the formula: ##STR4## wherein R3 is an alkyl, hydroxyalkyl, or alkyl phenyl group or mixtures thereof containing from about 8 to about 22 carbon atoms; R4 is an alkylene or hydroxyalkylene group containing from about 2 to about 3 carbon atoms or mixtures thereof; x is from 0 to about 3: and each R5 is an alkyl or hydroxyalkyl group containing from about 1 to about 3 carbon atoms or a polyethylene oxide group containing from about 1 to about 3 ethylene oxide groups. The R5 groups can be attached to each other, e.g., through an oxygen or nitrogen atom, to form a ring structure.

These amine oxide surfactants in particular include C10 -C18 alkyl dimethyl amine oxides and C8 -C12 alkoxy ethyl dihydroxy ethyl amine oxides.

When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such semi-polar nonionic surfactants.

Builder system

The compositions according to the present invention may further comprise a builder system. Any conventional builder system is suitable for use herein including aluminosilicate materials, silicates, polycarboxylates and fatty acids, materials such as ethylenediamine tetraacetate, metal ion sequestrants such as aminopolyphosphonates, particularly ethylenediamine tetramethylene phosphonic acid and diethylene triamine pentamethylenephosphonic acid. Though less preferred for obvious environmental reasons, phosphate builders can also be used herein.

Suitable builders can be an inorganic ion exchange material, commonly an inorganic hydrated aluminosilicate material, more particularly a hydrated synthetic zeolite such as hydrated zeolite A, X, B, HS or MAP.

Another suitable inorganic builder material is layered silicate, e.g. SKS-6 (Hoechst). SKS-6 is a crystalline layered silicate consisting of sodium silicate (Na2 Si2 O5).

Suitable polycarboxylates containing one carboxy group include lactic acid, glycolic acid and ether derivatives thereof as disclosed in Belgian Patent Nos. 831,368, 821,369 and 821,370. Polycarboxylates containing two carboxy groups include the water-soluble salts of succinic acid, malonic acid, (ethylenedioxy) diacetic acid, maleic acid, diglycollic acid, tartaric acid, tartronic acid and fumaric acid, as well as the ether carboxylates described in German Offenle-enschrift 2,446,686 and 2,446,487, U.S. Pat. No. 3,935,257 and the sulfinyl carboxylates described in Belgian Patent No. 840,623. Polycarboxylates containing three carboxy groups include, in particular, water-soluble citrates, aconitrates and citraconates as well as succinate derivatives such as the carboxymethyloxysuccinates described in British Patent No. 1,379,241, lactoxysuccinates described in Netherlands Application 7205873, and the oxypolycarboxylate materials such as 2-oxa-1,1,3-propane tricarboxylates described in British Patent No. 1,387,447.

Polycarboxylates containing four carboxy groups include oxydisuccinates disclosed in British Patent No. 1,261,829, 1,1,2,2,-ethane tetracarboxylates, 1,1,3,3-propane tetracarboxylates containing sulfo substituents include the sulfosuccinate derivatives disclosed in British Patent Nos. 1,398,421 and 1,398,422 and in U.S. Pat. No. 3,936,448, and the sulfonated pyrolysed citrates described in British Patent No. 1,082,179, while polycarboxylates containing phosphone substituents are disclosed in British Patent No. 1,439,000.

Alicyclic and heterocyclic polycarboxylates include cyclopentane-cis,cis-cis-tetracarboxylates, cyclopentadienide pentacarboxylates, 2,3,4,5-tetrahydro-furan--cis, cis, cis-tetracarboxylates, 2,5-tetrahydro-furan-cis, discarboxylates, 2,2,5,5,-tetrahydrofuran--tetracarboxylates, 1,2,3,4,5,6-hexane--hexacarboxylates and carboxymethyl derivatives of polyhydric alcohols such as sorbitol, mannitol and xylitol. Aromatic polycarboxylates include mellitic acid, pyromellitic acid and the phthalic acid derivatives disclosed in British Patent No. 1,425,343.

Of the above, the preferred polycarboxylates are hydroxy-carboxylates containing up to three carboxy groups per molecule, more particularly citrates.

Preferred builder systems for use in the present compositions include a mixture of a water-insoluble aluminosilicate builder such as zeolite A or of a layered silicate (SKS-6), and a water-soluble carboxylate chelating agent such as citric acid.

A suitable chelant for inclusion in the detergent composi-ions in accordance with the invention is ethylenediamine-N,N'-disuccinic acid (EDDS) or the alkali metal, alkaline earth metal, ammonium, or substituted ammonium salts thereof, or mixtures thereof. Preferred EDDS compounds are the free acid form and the sodium or magnesium salt thereof. Examples of such preferred sodium salts of EDDS include Na2 EDDS and Na4 EDDS. Examples of such preferred magnesium salts of EDDS include MgEDDS and Mg2 EDDS. The magnesium salts are the most preferred for inclusion in compositions in accordance with the invention.

Preferred builder systems include a mixture of a water-insoluble aluminosilicate builder such as zeolite A, and a water soluble carboxylate chelating agent such as citric acid.

Other builder materials that can form part of the builder system for use in granular compositions include inorganic materials such as alkali metal carbonates, bicarbonates, silicates, and organic materials such as the organic phosphonates, amino polyalkylene phosphonates and amino polycarboxylates.

Other suitable water-soluble organic salts are the homo- or co-polymeric acids or their salts, in which the polycarboxylic acid comprises at least two carboxyl radicals separated form each other by not more than two carbon atoms.

Polymers of this type are disclosed in GB-A-1,596,756. Examples of such salts are polyacrylates of MW 2000-5000 and their copolymers with maleic anhydride, such copolymers having a molecular weight of from 20,000 to 70,000, especially about 40,000.

Detergency builder salts are normally included in amounts of from 5% to 80% by weight of the composition. Preferred levels of builder for liquid detergents are from 5% to 30%.

Enzymes

In addition to the enzyme hybrid(s) in question, detergent compositions of the invention may comprise other enzymes which provide cleaning performance and/or fabric care benefits. Such enzymes include proteases, lipases, cutinases, amylases, cellulases, peroxidases and oxidases (e.g. laccases).

Proteases: Any protease suitable for use in alkaline solutions may, for example, be used. Suitable proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically or genetically modified mutants are included. The protease may be a serine protease, preferably an alkaline microbial protease or a trypsin-like protease. Examples of alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279). Examples of trypsin-like proteases are trypsin (e.g. of porcine or bovine origin) and the Fusarium protease described in WO 89/06270.

Preferred commercially available protease enzymes include those sold under the trade names Alcalase, Savinase, Primase, Durazym, and Esperase by Novo Nordisk A/S (Denmark), those sold under the tradename Maxatase, Maxacal, Maxapem, Properase, Purafect and Purafect OXP by Genencor International, and those sold under the tradename Opticlean and Optimase by Solvay Enzymes. Protease enzymes may be incorporated into the compositions in accordance with the invention at a level of from 0.00001% to 2% of enzyme protein by weight of the composition, suitably at a level of from 0.0001% to 1% of enzyme protein by weight of the composition, such as at a level of from 0.001% to 0.5% of enzyme protein by weight of the composition, appropriately at a level of from 0.01% to 0.2% of enzyme protein by weight of the composition.

Lipases: Any lipase suitable for use in alkaline solutions may, for example, be used. Suitable lipases include those of bacterial or fungal origin. Chemically or genetically modified mutants are included.

Examples of useful lipases include a Humicola lanuginosa lipase, e.g., as described in EP 258 068 and EP 305 216, a Rhizomucor miehei lipase, e.g., as described in EP 238 023, a Candida lipase, such as a C. antarctica lipase, e.g., the C. antarctica lipase A or B described in EP 214 761, a Pseudomonas lipase such as a P. alcaligenes and P. pseudoalcaligenes lipase, e.g. as described in EP 218 272, a P. cepacia lipase, e.g., as described in EP 331 376, a P. stutzeri lipase, e.g., as disclosed in GB 1,372,034, a P. fluorescens lipase, a Bacillus lipase, e.g., a B. subtilis lipase (Dartois et al., (1993), Biochemica et Biophysica acta 1131, 253-260), a B. stearothermophilus lipase (JP 64/744992) and a B. pumilus lipase (WO 91/16422).

Furthermore, a number of cloned lipases may be useful, including the Penicillium camembertii lipase described by Yamaguchi et al., (1991), Gene 103, 61-67), the Geotricum candidum lipase (Schimada, Y. et al., (1989), J. Biochem., 106, 383-388), and various Rhizopuslipases such as a R. delemarlipase (Hass, M. J et al., (1991), Gene 109, 117-113), a R. niveus lipase (Kugimiya et al., (1992), Biosci. Biotech. Biochem. 56, 716-719) and a R. oryzae lipase.

Other types of lipolytic enzymes such as cutinases may also be useful, e.g., a cutinase derived from Pseudomonas mendocina as described in WO 88/09367, or a cutinase derived from Fusarium solani pisi (e.g. described in WO 90/09446).

Especially suitable lipases are lipases such as M1 Lipase™, Luma fast™ and Lipomax™ (Genencor), Lipolase™ and Lipolase Ultra™ (Novo Nordisk A/S), and Lipase P "Amano" (Amano Pharmaceutical Co. Ltd.).

The lipases are normally incorporated in the detergent composition at a level of from 0.00001% to 2% of enzyme protein by weight of the composition, such as at a level of from 0.0001% to 1% of enzyme protein by weight of the composition, e.g. at a level of from 0.001% to 0.5% of enzyme protein by weight of the composition, appropriately at a level of from 0.01% to 0.2% of enzyme protein by weight of the composition.

Amylases: Any amylase (e.g. α- and/or β-) suitable for use in alkaline solutions may, for example, be used. Suitable amylases include those of bacterial or fungal origin. Chemically or genetically modified mutants are included. Amylases include, for example, α-amylases obtained from a special strain of B. licheniformis, described in more detail in GB 1,296,839. Commercially available amylases are Duramyl™, Termamyl™, Fungamyl™ and BAN™ (available from Novo Nordisk A/S) and Rapidase™ and Maxamyl P™ (available from Genencor).

The amylases are normally incorporated in the detergent composition at a level of from 0.00001% to 2% of enzyme protein by weight of the composition, such as at a level of from 0.0001% to 1% of enzyme protein by weight of the composition, e.g. at a level of from 0.001% to 0.5% of enzyme protein by weight of the composition, appopriately at a level of from 0.01% to 0.2% of enzyme protein by weight of the composition.

Cellulases: Any cellulase suitable for use in alkaline solutions may, for example, be used. Suitable cellulases include those of bacterial or fungal origin. Chemically or genetically modified mutants are included. Suitable cellulases are disclosed in U.S. Pat No. 4,435,307, which discloses fungal cellulases produced from Humicola insolens. Especially suitable cellulases are the cellulases having colour care benefits. Examples of such cellulases are cellulases described in European patent application No. 0 495 257.

Commercially available cellulases include Celluzyme™ produced by a strain of Humicola insolens, (Novo Nordisk A/S), and KAC-500(B)™ (Kao Corporation).

Cellulases are normally incorporated in the detergent composition at a level of from 0.00001% to 2% of enzyme protein by weight of the composition, such as at a level of from 0.0001% to 1% of enzyme protein by weight of the composition, e.g. at a level of from 0.001% to 0.5% of enzyme protein by weight of the composition, appropriately at a level of from 0.01% to 0.2% of enzyme protein by weight of the composition.

Peroxidases/oxidases: Peroxidase enzymes are normally used in combination with hydrogen peroxide or a source thereof (e.g. a percarbonate, perborate or persulfate). Oxidase enzymes are used in combination with oxygen. Both types of enzymes are used for "solution bleaching", i.e. to prevent transfer of a textile dye from a dyed fabric to another fabric when said fabrics are washed together in a wash liquor, preferably together with an enhancing agent as described in e.g. WO 94/12621 and WO 95/01426. Suitable peroxidases/oxidases include those of plant, bacterial or fungal origin. Chemically or genetically modified mutants are included.

Peroxidase and/or oxidase enzymes are normally incorporated in the detergent composition at a level of from 0.00001% to 2% of enzyme protein by weight of the composition, such as at a level of from 0.0001% to 1% of enzyme protein by weight of the composition, e.g. at a level of from 0.001% to 0.5% of enzyme protein by weight of the composition, appropriately at a level of from 0.01% to 0.2% of enzyme protein by weight of the composition.

Mixtures of the above-mentioned enzymes may also be included in detergent compositions of the invention, e.g. a mixture of a protease, an amylase, a lipase and/or a cellulase.

The enzyme hybrid, or any other enzyme incorporated in the detergent composition, is normally incorporated in the detergent composition at a level from 0.00001% to 2% of enzyme protein by weight of the composition, preferably at a level from 0.0001% to 1% of enzyme protein by weight of the composition, such as at a level of from 0.001% to 0.5% of enzyme protein by weight of the composition, e.g. at a level of from 0.01% to 0.2% of enzyme protein by weight of the composition.

Bleaching agents: Additional optional detergent ingredients that can be included in the detergent compositions of the present invention include bleaching agents such as PB1, PB4 and percarbonate with a particle size of 400-800 microns. These bleaching agent components can include one or more oxygen bleaching agents and, depending upon the bleaching agent chosen, one or more bleach activators. When present oxygen bleaching compounds will typically be present at levels of from about 1% to about 25%. In general, bleaching compounds are optional added components in non-liquid formulations, e.g. granular detergents.

A bleaching agent component for use herein can be any of the bleaching agents useful for detergent compositions including oxygen bleaches, as well as others known in the art.

A bleaching agent suitable for the present invention can be an activated or non-activated bleaching agent.

One category of oxygen bleaching agent that can be used encompasses percarboxylic acid bleaching agents and salts thereof. Suitable examples of this class of agents include magnesium monoperoxyphthalate hexahydrate, the magnesium salt of meta-chloro perbenzoic acid, 4-nonylamino-4-oxoperoxybutyric acid and diperoxydodecanedioic acid. Such bleaching agents are disclosed in U.S. Pat. No. 4,483,781, U.S. Pat. No. 740,446, EP 0 133 354 and U.S. Pat. No. 4,412,934. Highly preferred bleaching agents also include 6-nonylamino-6-oxoperoxycaproic acid as described in U.S. Pat. No. 4,634,551.

Another category of bleaching agents that can be used encompasses the halogen bleaching agents. Examples of hypohalite bleaching agents, for example, include trichloro isocyanuric acid and the sodium and potassium dichloroisocyanurates and N-chloro and N-bromo alkane sulphonamides. Such materials are normally added at 0.5-10% by weight of the finished product, preferably 1-5% by weight.

The hydrogen peroxide releasing agents can be used in combination with bleach activators such as tetra-acetylethylenediamine (TAED), nonanoyloxybenzenesulfonate (NOBS, described in U.S. Pat. No. 4,412,934), 3,5-trimethyl-hexsanoloxybenzenesulfonate (ISONOBS, described in EP 120 591) or pentaacetylglucose (PAG), which are perhydrolyzed to form a peracid as the active bleaching species, leading to improved bleaching effect. In addition, very suitable are the bleach activators C8(6-octanamido-caproyl) oxybenzene-sulfonate, C9(6-nonanamido caproyl) oxybenzenesulfonate and C10 (6-decanamido caproyl) oxybenzenesulfonate or mixtures thereof. Also suitable activators are acylated citrate esters such as disclosed in European Patent Application No. 91870207.7.

Useful bleaching agents, including peroxyacids and bleaching systems comprising bleach activators and peroxygen bleaching compounds for use in cleaning compositions according to the invention are described in application U.S. Ser. No. 08/136,626.

The hydrogen peroxide may also be present by adding an enzymatic system (i.e. an enzyme and a substrate therefore) which is capable of generation of hydrogen peroxide at the beginning or during the washing and/or rinsing process. Such enzymatic systems are disclosed in European Patent Application EP 0 537 381.

Bleaching agents other than oxygen bleaching agents are also known in the art and can be utilized herein. One type of non-oxygen bleaching agent of particular interest includes photoactivated bleaching agents such as the sulfonated zinc and/or aluminium phthalocyanines. These materials can be deposited upon the substrate during the washing process. Upon irradiation with light, in the presence of oxygen, such as by hanging clothes out to dry in the daylight, the sulfonated zinc phthalocyanine is activated and, consequently, the substrate is bleached. Preferred zinc phthalocyanine and a photoactivated bleaching process are described in U.S. Pat. No. 4,033,718. Typically, detergent composition will contain about 0.025% to about 1.25%, by weight, of sulfonated zinc phthalocyanine.

Bleaching agents may also comprise a manganese catalyst. The manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching", Nature 369, 1994, pp. 637-639.

Suds suppressors: Another optional ingredient is a suds suppressor, exemplified by silicones, and silica-silicone mixtures. Silicones can generally be represented by alkylated polysiloxane materials, while silica is normally used in finely divided forms exemplified by silica aerogels and xerogels and hydrophobic silicas of various types. Theses materials can be incorporated as particulates, in which the suds suppressor is advantageously releasably incorporated in a water-soluble or water-dispersible, substantially non surface-active detergent impermeable carrier. Alternatively the suds suppressor can be dissolved or dispersed in a liquid carrier and applied by spraying on to one or more of the other components.

A preferred silicone suds controlling agent is disclosed in U.S. Pat. No. 3,933,672. Other particularly useful suds suppressors are the self-emulsifying silicone suds suppressors, described in German Patent Application DTOS 2,646,126. An example of such a compound is DC-544, commercially available form Dow Corning, which is a siloxane-glycol copolymer. Especially preferred suds controlling agent are the suds suppressor system comprising a mixture of silicone oils and 2-alkyl-alkanols. Suitable 2-alkyl-alkanols are 2-butyl-octanol which are commercially available under the trade name Isofol 12 R.

Such suds suppressor system are described in European Patent Application EP 0 593 841.

Especially preferred silicone suds controlling agents are described in European Patent Application No. 92201649.8. Said compositions can comprise a silicone/ silica mixture in combination with fumed nonporous silica such as AerosilR.

The suds suppressors described above are normally employed at levels of from 0.001% to 2% by weight of the composition, preferably from 0.01% to 1% by weight.

Other components: Other components used in detergent compositions may be employed, such as soil-suspending agents, soil-releasing agents, optical brighteners, abrasives, bactericides, tarnish inhibitors, coloring agents, and/or encapsulated or nonencapsulated perfumes.

Especially suitable encapsulating materials are water soluble capsules which consist of a matrix of polysaccharide and polyhydroxy compounds such as described in GB 1,464,616.

Other suitable water soluble encapsulating materials comprise dextrins derived from ungelatinized starch acid esters of substituted dicarboxylic acids such as described in U.S. Pat. No. 3,455,838. These acid-ester dextrins are, preferably, prepared from such starches as waxy maize, waxy sorghum, sago, tapioca and potato. Suitable examples of said encapsulation materials include N-Lok manufactured by National Starch. The N-Lok encapsulating material consists of a modified maize starch and glucose. The starch is modified by adding monofunctional substituted groups such as octenyl succinic acid anhydride.

Antiredeposition and soil suspension agents suitable herein include cellulose derivatives such as methylcellulose, carboxymethylcellulose and hydroxyethylcellulose, and homo- or co-polymeric polycarboxylic acids or their salts. Polymers of this type include the polyacrylates and maleic anhydride-acrylic acid copolymers previously mentioned as builders, as well as copolymers of maleic anhydride with ethylene, methylvinyl ether or methacrylic acid, the maleic anhydride constituting at least 20 mole percent of the copolymer. These materials are normally used at levels of from 0.5% to 10% by weight, more preferably form 0.75% to 8%, most preferably from 1% to 6% by weight of the composition.

Preferred optical brighteners are anionic in character, examples of which are disodium 4,4'-bis-(2-diethanolamino-4-anilino -s- triazin-6-ylamino)stilbene-2:2'-disulphonate, disodium 4,-4'-bis-(2-morpholino-4-anilino-s-triazin-6-ylamino-stilbene-2:2'-disulphonate, disodium 4,4'-bis-(2,4-dianilino-s-triazin-6-ylamino)stilbene-2:2'-disulphonate, monosodium 4',4"-bis-(2,4-dianilino-s-tri-azin-6-ylamino)stilbene-2-sulphonate, disodium 4,4'-bis-(2-anilino-4-(N-methyl-N-2-hydroxyethylamino)-s-triazin-6-ylamino)stilbene-2,2'-disulphonate, disodium 4,4'-bis-(4-phenyl-2,1,3-triazol-2-yl)-stilbene-2,2'disulphonate, disodium 4,4'bis(2-anilino-4-(1-methyl-2-hydroxyethylamino)-s-triazin-6-ylami-no)stilbene-2,2'disulphonate, sodium 2(stilbyl-4"-(naphtho-1',2':4,5)-1,2, 3,-triazole-2"-sulphonate and 4,4'-bis(2-sulphostyryl)biphenyl.

Other useful polymeric materials are the polyethylene glycols, particularly those of molecular weight 1000-10000, more particularly 2000 to 8000 and most preferably about 4000. These are used at levels of from 0.20% to 5% more preferably from 0.25% to 2.5% by weight. These polymers and the previously mentioned homo- or co-polymeric polycarboxylate salts are valuable for improving whiteness maintenance, fabric ash deposition, and cleaning performance on clay, proteinaceous and oxidizable soils in the presence of transition metal impurities.

Soil release agents useful in compositions of the present invention are conventionally copolymers or terpolymers of terephthalic acid with ethylene glycol and/or propylene glycol units in various arrangements. Examples of such polymers are disclosed in U.S. Pat. No. 4,116,885 and 4,711,730 and EP 0 272 033. A particular preferred polymer in accordance with EP 0 272 033 has the formula:

(CH3 (PEG)43)0.75 (POH)0.25 [T-PO)2.8 (T-PEG)0.4 ]T(POH)0.25 ((PEG)43 CH3)0.75

where PEG is --(OC2 H4)0-, PO is (OC3 H6 O) and T is (pOOC6 H4 CO).

Also very useful are modified polyesters as random copolymers of dimethyl terephthalate, dimethyl sulfoisophthalate, ethylene glycol and 1,2-propanediol, the end groups consisting primarily of sulphobenzoate and secondarily of mono esters of ethylene glycol and/or 1,2-propanediol. The target is to obtain a polymer capped at both end by sulphobenzoate groups, "primarily", in the present context most of said copolymers herein will be endcapped by sulphobenzoate groups. However, some copolymers will be less than fully capped, and therefore their end groups may consist of monoester of ethylene glycol and/or 1,2-propanediol, thereof consist "secondarily" of such species.

The selected polyesters herein contain about 46% by weight of dimethyl terephthalic acid, about 16% by weight of 1,2-propanediol, about 10% by weight ethylene glycol, about 13% by weight of dimethyl sulfobenzoic acid and about 15% by weight of sulfoisophthalic acid, and have a molecular weight of about 3.000. The polyesters and their method of preparation are described in detail in EP 311 342.

Softening agents: Fabric softening agents can also be incorporated into laundry detergent compositions in accordance with the present invention. These agents may be inorganic or organic in type. Inorganic softening agents are exemplified by the smectite clays disclosed in GB-A-1 400898 and in U.S. Pat. No. 5,019,292. Organic fabric softening agents include the water insoluble tertiary amines as disclosed in GB-A1 514 276 and EP 0 011 340 and their combination with mono C2 -C14 quaternary ammonium salts are disclosed in EP-B-0 026 528 and di-long-chain amides as disclosed in EP 0 242 919. Other useful organic ingredients of fabric softening systems include high molecular weight polyethylene oxide materials as disclosed in EP 0 299 575 and 0 313 146.

Levels of smectite clay are normally in the range from 5% to 15%, more preferably from 8% to 12% by weight, with the material being added as a dry mixed component to the remainder of the formulation. Organic fabric softening agents such as the water-insoluble tertiary amines or dilong chain amide materials are incorporated at levels of from 0.5% to 5% by weight, normally from 1% to 3% by weight whilst the high molecular weight polyethylene oxide materials and the water soluble cationic materials are added at levels of from 0.1% to 2%, normally from 0.15% to 1.5% by weight. These materials are normally added to the spray dried portion of the composition, although in some instances it may be more convenient to add them as a dry mixed particulate, or spray them as molten liquid on to other solid components of the composition.

Polymeric dye-transfer inhibiting agents: The detergent compositions according to the present invention may also comprise from 0.001% to 10%, preferably from 0.01% to 2%, more preferably form 0.05% to 1% by weight of polymeric dye- transfer inhibiting agents. Said polymeric dye-transfer inhibiting agents are normally incorporated into detergent compositions in order to inhibit the transfer of dyes from colored fabrics onto fabrics washed therewith. These polymers have the ability of complexing or adsorbing the fugitive dyes washed out of dyed fabrics before the dyes have the opportunity to become attached to other articles in the wash.

Especially suitable polymeric dye-transfer inhibiting agents are polyamine N-oxide polymers, copolymers of N-vinyl-pyrrolidone and N-vinylimidazole, polyvinylpyrrolidone polymers, polyvinyloxazolidones and polyvinylimidazoles or mixtures thereof.

Addition of such polymers also enhances the performance of the enzymes according the invention.

The detergent composition according to the invention can be in the form of a liquid, paste, gel, bar or granulate (i.e. in granular form).

Non-dusting granulates may be produced, e.g., as disclosed in U.S. Pat. No. 4,106,991 and 4,661,452 (both to Novo Industri A/S) and may optionally be coated by methods known in the art. Examples of waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molecular weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591.

Granular compositions according to the present invention can also be in "compact form", i.e. they may have a relatively higher density than conventional granular detergents, i.e. form 550 to 950 g/l; in such case, the granular detergent compositions according to the present invention will contain a lower amount of "Inorganic filler salt", compared to conventional granular detergents; typical filler salts are alkaline earth metal salts of sulphates and chlorides, typically sodium sulphate; "Compact" detergent typically comprise not more than 10% filler salt. The liquid compositions according to the present invention can also be in "concentrated form", in such case, the liquid detergent compositions according to the present invention will contain a lower amount of water, compared to conventional liquid detergents. Typically, the water content of the concentrated liquid detergent is less than 30%, more preferably less than 20%, most preferably less than 10% by weight of the detergent compositions.

The compositions of the invention may, for example, be formulated as hand and machine laundry detergent compositions including laundry additive compositions and compositions suitable for use in the pretreatment of stained fabrics.

The following examples are intended to exemplify compositions within the scope of the present invention, but are not intended to limit or otherwise define the scope of the invention. In the detergent compositions, the abbreviated component identifications have the following meanings:

LAS: Sodium linear C12 alkyl benzene sulphonate

TAS: Sodium tallow alkyl sulphate

XYAS: Sodium C1X -C1Y alkyl sulfate

SS: Secondary soap surfactant of formula 2-butyl octanoic acid

25EY: A C12 -C15 predominantly linear primary alcohol condensed with an average of Y moles of ethylene oxide

45EY: A C14 -C5 predominantly linear primary alcohol condensed with an average of Y moles of ethylene oxide

XYEZS: C1X -C1Y sodium alkyl sulfate condensed with an average of Z moles of ethylene oxide per mole

Nonionic: C13 -C15 mixed ethoxylated/propoxylated fatty alcohol with an average degree of ethoxylation of 3.8 and an average degree of propoxylation of 4.5 sold under the tradename Plurafax LF404 by BASF Gmbh

CFAA: C12 -C14 alkyl N-methyl glucamide

TFAA: C16 -C18 alkyl N-methyl glucamide

Silicate: Amorphous Sodium Silicate (SiO2 :Na2 O ratio=2.0)

NaSKS-6: Crystalline layered silicate of formula δ-Na2 Si2 O5

Carbonate: Anhydrous sodium carbonate

Phosphate: Sodium tripolyphosphate

MA/AA: Copolymer of 1:4 maleic/acrylic acid, average molecular weight about 80,000

Polyacrylate: Polyacrylate homopolymer with an average molecular weight of 8,000 sold under the tradename PA30 by BASF Gmbh

Zeolite A: Hydrated Sodium Aluminosilicate of formula Na12 (AlO2 SiO2)12.27H2 O having a primary particle size in the range from 1 to 10 micrometers

Citrate: Tri-sodium citrate dihydrate

Citric: Citric Acid

Perborate: Anhydrous sodium perborate monohydrate bleach, empirical formula NaBO2.H2 O2

PB4: Anhydrous sodium perborate tetrahydrate

Percarbonate: Anhydrous sodium percarbonate bleach of empirical formula 2Na2 CO3.3H2 O2

TAED: Tetraacetyl ethylene diamine

CMC: Sodium carboxymethyl cellulose

DETPMP: Diethylene triamine penta (methylene phosphonic acid), marketed by Monsanto under the Tradename Dequest 2060

PVP: Polyvinylpyrrolidone polymer

EDDS: Ethylenediamine-N,N'-disuccinic acid, [S,S] isomer in the form of the sodium salt

Suds 25% paraffin wax Mpt 50 C., 17% hydrophobic silica, 58%

Suppressor: paraffin oil

Granular Suds 12% Silicone/silica, 18% stearyl alcohol, 70%

suppressor: starch in granular form

Sulphate: Anhydrous sodium sulphate

HMWPEO: High molecular weight polyethylene oxide

TAE 25: Tallow alcohol ethoxylate (25)

In the following compositions, "Enzyme" refers to enzyme hybrid(s) and any added enzyme(s):

Detergent Example I

A granular fabric cleaning composition in accordance with the invention may be prepared as follows:

______________________________________Sodium linear C12 alkyl             6.5benzene sulfonateSodium sulfate    15.0Zeolite A         26.0Sodium nitrilotriacetate             5.0Enzyme            0.1PVP               0.5TAED              3.0Boric acid        4.0Perborate         18.0Phenol sulphonate 0.1Minors            Up to 100______________________________________

Detergent Example II

A compact granular fabric cleaning composition (density 800 g/l) in accord with the invention may be prepared as follows:

______________________________________45AS              8.025E3S             2.025E5              3.025E3              3.0TFAA              2.5Zeolite A         17.0NaSKS-6           12.0Citric acid       3.0Carbonate         7.0MA/AA             5.0CMC               0.4Enzyme            0.1TAED              6.0Percarbonate      22.0EDDS              0.3Granular suds suppressor             3.5water/minors      Up to 100%______________________________________

Detergent Example III

Granular fabric cleaning compositions in accordance with the invention which are useful in the laundering of coloured fabrics may be prepared as follows:

______________________________________LAS                  10.7   --TAS                  2.4    --TFAA                 --     4.045AS                 3.1    10.045E7                 4.0    --25E3S                --     3.068E11                1.8    --25E5                 --     8.0Citrate              15.0   7.0Carbonate            --     10Citric acid          2.5    3.0Zeolite A            32.1   25.0Na-SKS-6             --     9.0MA/AA                5.0    5.0DETPMP               0.2    0.8Enzyme                0.10   0.05Silicate             2.5    --Sulphate             5.2    3.0PVP                  0.5    --Poly (4-vinylpyridine)-N-                --     0.2Oxide/copolymer of vinyl-imidazole and vinyl-pyrrolidonePerborate            1.0    --Phenol sulfonate     0.2    --Water/Minors         Up to 100%______________________________________

Detergent Example IV

Granular fabric cleaning compositions in accordance with the invention which provide "Softening through the wash" capability may be prepared as follows:

______________________________________45AS                 --     10.0LAS                  7.6    --68AS                 1.3    --45E7                 4.0    --25E3                 --     5.0Coco-alkyl-dimethyl hydroxy-                1.4    1.0ethyl ammonium chlorideCitrate              5.0    3.0Na-SKS-6             --     11.0Zeolite A            15.0   15.0MA/AA                4.0    4.0DETPMP               0.4    0.4Perborate            15.0   --Percarbonate         --     15.0TAED                 5.0    5.0Smectite clay        10.0   10.0HMWPEO               --     0.1Enzyme                0.10   0.05Silicate             3.0    5.0Carbonate            10.0   10.0Granular suds suppressor                1.0    4.0CMC                  0.2    0.1Water/Minors         Up to 100%______________________________________

Detergent Example V

Heavy duty liquid fabric cleaning compositions in accordance with the invention may be prepared as follows:

______________________________________              I    II______________________________________LAS acid form        --     25.0Citric acid          5.0    2.025AS acid form       8.0    --25AE2S acid form     3.0    --25AE7                8.0    --CFAA                 5      --DETPMP               1.0    1.0Fatty acid           8      --Oleic acid           --     1.0Ethanol              4.0    6.0Propanediol          2.0    6.0Enzyme                0.10   0.05Coco-alkyl dimethyl  --     3.0hydroxy ethyl ammoniumchlorideSmectite clay        --     5.0PVP                  2.0    --Water/Minors         Up to 100%______________________________________

The enzyme hybrid may be incorporated in concentrations conventionally employed in detergents. It is at present contemplated that, in the detergent composition of the invention, the enzyme hybrid may suitably be added in an amount corresponding to 0.00001-1 mg (calculated as pure enzymatic protein) of enzyme hybrid per liter of wash liquor.

Reaction time

The reaction time for removing or bleaching the soiling or stain(s) from fabric may vary; the fabric may be soaked for one or two days, or the washing may be performed within a shorter period, typically machine-washed for a period of 1 to 90 minutes, preferably for a period of 1 to 30 minutes.

A further aspect of the invention relates to a DNA construct disclosed herein which encodes, or which comprises a sequence which encodes, an enzyme hybrid as disclosed in the present specification.

A still further aspect of the invention relates to a polypeptide (fusion protein or enzyme hybrid) which is encoded by such a DNA construct or sequence, and/or which is disclosed in the present specification. Thus, the invention encompasses an enzyme hybrid encoded by a hybrid-encoding DNA sequence comprised within the DNA sequences of SEQ ID No.1, SEQ ID No.3, SEQ ID No.5, SEQ ID No.7, SEQ ID No.9, SEQ ID No.10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18 or SEQ ID No. 19, or an enzyme hybrid having an amino acid sequence comprised within the amino acid sequences of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6 or SEQ ID No. 8.

The invention is further illustrated in the following example, which are not intended to be in any way limiting to the scope of the invention as claimed.

MATERIALS AND METHODS

Strains:

Bacillus agaradherens NCIMB No. 40482: comprises the endoglucanase enzyme encoding DNA sequence of Example 2, below.

Escherichia coli SJ2 [Diderichsen et al., J. Bacteriol. 172 (1990), pp. 4315-4321].

Electrocompetent cells prepared and transformed using a Bio-Rad GenePulser™ as recommended by the manufacturer.

Bacillus subtilis PL2306: this strain is the B. subtilis DN1885 with disrupted apr and npr genes [Diderichsen et al., J. Bacteriol. 172 (1990), pp. 4315-4321] disrupted in the transcriptional unit of the known Bacillus subtilis cellulase gene, resulting in cellulase-negative cells. The disruption was performed essentially as described in Sonenshein et al. (Eds.), Bacillus subtilis and other Gram-Positive Bacteria, American Society for Microbiology (1993), p.618.

Plasmids:

pDN1528 [Jorgensen et al., J. Bacteriol. 173 (1991), p.559-567].

pBluescriptKSII- (Stratagene, USA).

pDN1981 [Jorgensen et al., Gene 96 (1990), p. 37-41].

Solutions/Media

TY and LB agar [as described in Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley and Sons (1995)].

SB: 32 g Tryptone, 20 g yeast extract, 5 g sodium chloride and 5 ml 1 N sodium hydroxide are mixed in sterile water to a final volume of 1 litre. The solution is sterilised by autoclaving for 20 minutes at 121 C.

10% Avicel™: 100 g of Avicel™ (FLUKA, Switzerland) is mixed with sterile water to a final volume of 1 litre, and the resulting 10% Avicel™ is sterilised by autoclaving for 20 minutes at 121 C.

Buffer: 0.05 M potassium phosphate, pH 7.5.

General molecular biology methods

DNA manipulations and transformations were performed using standard methods of molecular biology [Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor lab., Cold Spring Harbor, N.Y. (1989); Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley and Sons (1995); C. R. Harwood and S. M. Cutting (Eds.) Molecular Biological Methods for Bacillus, John Wiley and Sons (1990)].

Enzymes for DNA manipulations were used according to the specifications of the suppliers.

EXAMPLE 1

Subcloning of a partial Termamyl sequence.

The alpha-amylase gene encoded on pDN1528 was PCR amplified for introduction of a BamHI site in the 3'-end of the coding region. The PCR and the cloning were carried out as follows:

Approximately 10-20 ng of plasmid pDN 1528 was PCR amplified in HiFidelity™ PCR buffer (Boehringer Mannheim, Germany) supplemented with 200 μM of each dNTP, 2.6 units of HiFidelity™ Expand enzyme mix, and 300 pmol of each primer:

#52893'-GCT TTA CGC CCG ATT GCT GAC GCT G          (SEQ ID No. 20)#267483'-GCG ATG AGA CGC GCG GCC GCC TAT CTT TGA ACA TAA ATT GAA ACG GAT CCG                                         (SEQ ID No. 21)(BamHI restriction site underlined].

The PCR reactions were performed using a DNA thermal cycler (Landgraf, Germany). One incubation at 94 C. for 2 min, 60 C. for 30 sec and 72 C. for 45 sec was followed by ten cycles of PCR performed using a cycle profile of denaturation at 94 C. for 30 sec, annealing at 60 C. for 30 sec, and extension at 72 C. for 45 sec and twenty cycles of denaturation at 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 45 sec (at this elongation step, 20 sec are added every cycle). 10 μl aliquots of amplification product were analyzed by electrophoresis in 1.0% agarose gels (NuSieve™, FMC) with ReadyLoad™ 100 bp DNA ladder (GibcoBRL, Denmark) as a size marker.

40 μl aliquots of PCR product generated as described above were purified using QIAquick™ PCR purification kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCl, pH 8.5. 25 μl of the purified PCR fragment was digested with BamHI and PstI, subjected to electrophoresis in 1.0% low gelling temperature agarose (SeaPlaque™ GTG, FMC) gels, and the relevant fragment was excised from the gel and purified using QIAquick™ Gel extraction Kit (Qiagen, USA) according to the manufacturer's instructions. The isolated DNA fragment was then ligated to BamHI-PstI digested pBluescriptll KS-, and the ligation mixture was used to transform E. coli SJ2.

Cells were plated on LB agar plates containing Ampicillin (200 μg/ml) and supplemented with X-gal (5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside, 50 μg/ml), and incubated at 37 C. overnight. The next day, white colonies were restreaked onto fresh LB-Ampicillin agar plates and incubated at 37 C. overnight. The following day, single colonies were transferred to liquid LB medium containing Ampicillin (200 μg/ml) and incubated overnight at 37 C. with shaking at 250 rpm.

Plasmids were extracted from the liquid cultures using QIAgen Plasmid Purification mini kit (Qiagen, USA) according to the manufacturer's instructions. 5 μl samples of the plasmids were digested with PstI and BamHI. The digestions were checked by gel electrophoresis on a 1.0% agarose gel (NuSieve™, FMC). One positive clone, containing the PstI-BamHI fragment containing part of the α-amylase gene, was designated pMB335. This plasmid was then used in the construction of α-amylase-CBD hybrid.

Isolation of genomic DNA

Clostridium stercorarium NCIMB 11754 was grown anaerobically at 60 C. in specified media as recommended by The National Collections of Industrial and Marine Bacteria Ltd. (NCIMB), Scotland. Cells were harvested by centrifugation.

Genomic DNA was isolated as described by Pitcher et al, Lett. Appl. Microbiol. 8 (1989), pp. 151-156.

In vitro amplification of the CBD-dimer of Clostridium stercorarium (NCIMB 11754) XynA

Approximately 100-200 ng of genomic DNA was PCR amplified in HiFidelity™ PCR buffer (Boehringer Mannheim, Germany) supplemented with 200 μM of each dNTP, 2.6 units of HiFidelity™ Expand enzyme mix, and 300 pmol of each primer:

#271835'-GCT GCA GGA TCC GTT TCA ATT TAT GTT CAA AGA TCT GGC GGA CCT GGA ACGCCA AAT                                          (SEQ ID No. 22)3'T GGA AGA GG#271823'-GCA CTA GCT AGA CGG CCG CTA CCA GTC AAC ATT AAC AGG ACC TGA G                                            (SEQ ID No. 23)(BamHI and EagI restriction sites underlined).

The primers were designed to amplify the DNA encoding the cellulose-binding domain of the XynA-encoding gene of Clostridium stercorarium NCIMB 11754; the DNA sequence was extracted from the database GenBank under the accession number D13325.

The PCR reactions were performed using a DNA thermal cycler (Landgraf, Germany). One incubation at 94 C. for 2 min, 60 C. for 30 sec and 72 C. for 45 sec was followed by ten cycles of PCR performed using a cycle profile of denaturation at 94 C. for 30 sec, annealing at 60 C. for 30 sec, and extension at 72 C. for 45 sec and twenty cycles of denaturation at 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 45 sec (at this elongation step, 20 sec are added every cycle). 10 μl aliquots of amplification product were analyzed by electrophoresis in 1.0% agarose gels (NuSieve™, FMC) with ReadyLoad™ 100 bp DNA ladder (GibcoBRL, Denmark) as a size marker.

Cloning by polymerase chain reaction (PCR):

Subcloning of PCR fragments.

40 μl aliquots of PCR product generated as described above were purified using QIAquick™ PCR purification kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCl, pH 8.5. 25 μl of the purified PCR fragment was digested with BamHI and EagI, subjected to electrophoresis in 1.0% low gelling temperature agarose (SeaPlaque™ GTG, FMC) gels, and the relevant fragment was excised from the gels and purified using QIAquick™ Gel extraction Kit (Qiagen, USA) according to the manufacturer's instructions. The isolated DNA fragment was then ligated to BamHI-NotI digested pMB335 and the ligation mixture was used to transform E. coli SJ2.

Identification and characterization of positive clones

Cells were plated on LB agar plates containing Ampicillin (200 μg/ml) and incubated at 37 C. overnight. The next day, colonies were restreaked onto fresh LB-Ampicillin agar plates and incubated at 37 C. overnight. The following day, single colonies were transferred to liquid LB medium containing Ampicillin (200 μg/ml) and incubated overnight at 37 C. with shaking at 250 rpm.

Plasmids were extracted from the liquid cultures using QIAgen Plasmid Purification mini kit (Qiagen, USA) according to the manufacturer's instructions. 5 μl samples of the plasmids were digested with BamHI and NotII. The digestions were checked by gel electrophoresis on a 1.0% agarose gel (NuSieve™, FMC). The appearance of a DNA fragment of the same size as seen from the PCR amplification indicated a positive clone.

One positive clone, containing the fusion construct of the α-amylase gene and the CBD-dimer of Clostridium stercorarium (NCIMB 11754) XynA, was designated MBamyX.

Cloning of the fusion construct into a Bacillus-based expression vector

The pDN1528 vector contains the amyL gene of B. licheniformis; this gene is actively expressed in B. subtilis, resulting in the production of active α-amylase appearing in the supernatant. For expression purposes, the DNA encoding the fusion protein as constructed above was introduced to pDN1528.

This was done by digesting pMBamyX and pDN1528 with SalI-NotI, purifying the fragments and ligating the 4.7 kb pDN1528 SalI-NotI fragment with the 1.0 kb pMBamyX SalI-NotI fragment. This created an inframe fusion of the hybrid construction with the Termamyl™ (B. licheniformis α-amylase) gene. The DNA sequence of the fusion construction of pMB206, and the corresponding amino acid sequence, are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.

The ligation mixture was used to transform competent cells of B. subtilis PL2306. Cells were plated on LB agar plates containing chloramphenicol (6 μg/ml), 0.4% glucose and 10 mM potassium hydrogen phosphate, and incubated at 37 C. overnight. The next day, colonies were restreaked onto fresh LBPG (LB plates with 0.4% glucose and 10 mM potassium phosphate, pH 10) chloramphenicol agar plates and incubated at 37 C. overnight. The following day, single colonies of each clone were transferred to liquid LB medium containing chloramphenicol (6 μg/ml) and incubated overnight at 37 C. with shaking at 250 rpm.

Plasmids were extracted from the liquid cultures using QIAgen Plasmid Purification mini kit (Qiagen, USA) according to the manufacturer's instructions. However, the resuspension buffer was supplemented with 1 mg/ml of chicken egg white lysozyme (SIGMA, USA) prior to lysing the cells at 37 C. for 15 minutes. 5 μl samples of the plasmids were digested with BamHI and NotI. The digestions were checked by gel electrophoresis on a 1.5% agarose gel (NuSieve™, FMC). The appearance of a DNA fragment of the same size as seen from the PCR amplification indicated a positive clone. One positive clone was designated MB-BSamyx.

Expression, secretion and functional analysis of the fusion protein

The clone MB-BSamyx (expressing Termamyl™ fused to C. stercorarium XynA dimer CBD) was incubated for 20 hours in SB medium at 37 C. with shaking at 250 rpm. 1 ml of cell-free supernatant was mixed with 200 μl of 10% Avicel™. The mixture was incubated for 1 hour at 0 C. and then centrifuged for 5 minutes at 5000 g. The pellet was resuspended in 100 μl of SDS-PAGE buffer, and the suspension was boiled at 95 C. for 5 minutes, centrifuged at 5000 g for 5 minutes, and 25 μl was loaded onto a 4-20% Laemmli Tris-Glycine, SDS-PAGE NOVEX™ gel (Novex, USA). The samples were subjected to electrophoresis in an Xcell™ Mini-Cell (NOVEX, USA) as recommended by the manufacturer. All subsequent handling of gels, including staining (Coomassie), destaining and drying, were performed as described by the manufacturer.

The appearance of a protein band of molecular weight approx. 85 kDa indicated expression in B. subtilis of the Termamyl-CBD fusion amyx.

EXAMPLE 2

Identification of a novel CBD representing a new CBD family

The alkaline cellulase cloned in Bacillus subtilis as described below was expressed by incubating the clone for 20 hours in SB medium at 37 C. with shaking at 250 rpm. The expressed cellulase was shown to contain a CBD by its ability to specifically bind to Avicel™.

When left to incubate for a further 20 hours, the cellulase was proteolytically cleaved and two specific protein bands appeared in SDS-PAGE, one corresponding to the catalytic part of the cellulase, approximate molecular weight (MW) 35 kD, and the other corresponding to a proposed linker and CBD of approximate MW 8 kD.

The CBD was found to be the C-terminal part of the cellulase, and did not match any of the CBD families described previously [Tomme et al., Cellulose-Binding Domains: Classification and Properties, In: J. N. Saddler and M. H. Penner (Eds.), Enzymatic Degradation of Insoluble Carbohydrates, ACS Symposium Series No. 618 (1996)]. Accordingly, this CBD appears to be the first member of a new family.

Cloning of the alkaline cellulase (endoglucanase) from Bacillus agaradherens and expression of the alkaline cellulase in Bacillus subtilis

The nucleotide sequence encoding the alkaline cellulase from Bacillus agaradherens (deposited under accession No. NCIMB 40482) was cloned by PCR for introduction in an expression plasmid pDN1981. PCR was performed essentially as described above on 500 ng of genomic DNA, using the following two primers containing NdeI and Kpnl restriction sites for introducing the endoglucanase-encoding DNA sequence to pDN1981 for expression:

#208875'-GTA GGC TCA GTC ATA TGT TAC ACA TTG AAA GGG GAG GAG AAT CAT GAA AAAGAT AAC                                          (SEQ ID No. 24)TAC TAT TTT TGT CG-3'#213185'-GTA CCT CGC GGG TAC CAA GCG GCC GCT TAA TTG AGT GGT TCC CAC GGA                                            (SEQ ID No. 25)

After PCR cycling, the PCR fragment was purified using QIAquick™ PCR column kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCI, pH 8.5, digested with NdeI and Kpnl, purified and ligated to digested pDN1981. The ligation mixture was used to transform B. subtilis PL2306. Competent cells were prepared and transformed as described by Yasbin et al., J. Bacteriol. 121 (1975), pp. 296-304.

Isolation and testing of B. subtilis transformants

The transformed cells were plated on LB agar plates containing Kanamycin (10 mg/ml), 0.4% glucose, 10 mM potassium phosphate and 0.1% AZCL HE-cellulose (Megazyme, Australia), and incubated at 37 C. for 18 hours. Endoglucanase-positive colonies were identified as colonies surrounded by a blue halo.

Each of the positive transformants was inoculated in 10 ml TY medium containing Kanamycin (10 mg/ml). After 1 day of incubation at 37 C. with shaking at 250 rpm, 50 ml of supernatant was removed. The endoglucanase activity was identified by adding 50 ml of supernatant to holes punctured in the agar of LB agar plates containing 0.1% AZCL HE-cellulose.

After 16 hours incubation at 37 C., blue halos surrounding holes indicated expression of the endoglucanase in B. subtilis. One such clone was designated MB208. The encoding DNA sequence and amino acid sequence of the endoglucanase are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively.

The DNA sequence was determined as follows: Qiagen purified plasmid DNA was sequenced with the Taq deoxy terminal cycle sequencing kit (Perkin Elmer, USA) using the primers #21318 and #20887 (vide supra) and employing an Applied Biosystems 373A automated sequencer operated according to the manufacturer's instructions. Analysis of the sequence data is performed according to Devereux et al., Carcinogenesis 14 (1993), pp. 795-801.

In vitro amplification of the CBD of Bacillus agaradherens NCIMB 40482 endoglucanase

Approximately 10-20 ng of plasmid pMB208 was PCR amplified in HiFidelity™ PCR buffer (Boehringer Mannheim, Germany) supplemented with 200 μM of each dNTP, 2.6 units of HiFidelity™ Expand enzyme mix and 300 pmol of each primer:

#271845'-GCT GCA GGA TCC GTT TCA ATT TAT GTT CAA AGA TCT CCT GGA GAG TAT CCAGCA TGG                                          (SEQ ID No. 26)GAC CCA A-3'#284953'-GC ACA AGC TTG CGG CCG CTA ATT GAG TGG TTC CCA CGG ACC G                                            (SEQ ID No. 27)(BamHI and NotI restriction sites underlined).

The primers were designed to amplify the CBD-encoding DNA of the cellulase-encoding gene of Bacillus agaradherens NCIMB 40482.

The PCR reaction was performed using a DNA thermal cycler (Landgraf, Germany). One incubation at 94 C. for 2 min, 60 C. for 30 sec and 72 C. for 45 sec was followed by ten cycles of PCR performed using a cycle profile of denaturation at 94 C. for 30 sec, annealing at 60 C. for 30 sec, and extension at 72 C. for 45 sec and twenty cycles of denaturation at 94 C. for 30 sec, 60 C. for 30 sec and 72 C. for 45 sec (at this elongation step, 20 sec are added every cycle). 10 μl aliquots of amplification product were analyzed by electrophoresis in 1.5% agarose gels (NuSieve™, FMC) with ReadyLoad™ 100 bp DNA ladder (GibcoBRL, Denmark) as a size marker.

Cloning by polymerase chain reaction (PCR):

Subcloning of PCR fragments

40 μl aliquots of PCR products generated as described above were purified using QIAquick™ PCR purification kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCI, pH 8.5. 25 μl of the purified PCR fragment was digested with BamHI and NotI, subjected to electrophoresis in 1.5% low gelling temperature agarose (SeaPlaque™ GTG, FMC) gels, and the relevant fragment was excised from the gels and purified using QIAquick™ Gel extraction kit (Qiagen, USA) according to the manufacturer's instructions. The isolated DNA fragment was then ligated to BamHI-NotI digested pMB335, and the ligation mixture was used to transform E. coli SJ2.

Identification and characterization of positive clones

Cells were plated on LB agar plates containing Ampicillin (200 μg/ml) and incubated at 37 C. overnight. The next day, colonies were restreaked onto fresh LB-Ampicillin agar plates and incubated at 37 C. overnight. The following day, single colonies were transferred to liquid LB medium containing Ampicillin (200 μg/ml) and incubated overnight at 37 C. with shaking at 250 rpm.

Plasmids were extracted from the liquid cultures using QIAgen Plasmid Purification mini kit (Qiagen, USA) according to the manufacturer's instructions. 5 μl samples of the plasmids were digested with BamHI and NotI. The digestions were checked by gel electrophoresis on a 1.5% agarose gel (NuSieve™, FMC). The appearance of a DNA fragment of the same size as seen from the PCR amplification indicated a positive clone.

One positive clone, containing the fusion construct of the Termamyl™ α-amylase gene and the CBD of Bacillus agaradherens NCIMB 40482 alkaline cellulase Cel5A, was designated MBamyC5A.

Cloning of the fusion construct into a Bacillus-based expression vector

As mentioned previously, the amyL gene of B. licheniformis (contained in the pDN1528 vector) is actively expressed in B. subtilis, resulting in the production of active α-amylase appearing in the supernatant. For expression purposes, the DNA encoding the fusion protein as constructed above was introduced to pDN1528. This was done by digesting pMBamyC5A and pDN1528 with SalI-Noti, purifying the fragments and ligating the 4.7 kb pDN1528 SalI-NotI fragment with the 0.5 kb pMBamyC5A SalI-NotI fragment. This created an inframe fusion of the hybrid construction with the Termamyl™ gene. The DNA sequence of the fusion construction of pMB378, and the corresponding amino acid sequence, are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

The ligation mixture was used to transform competent cells of B. subtilis PL2306. Cells were plated on LB agar plates containing chloramphenicol (6 μg/ml), 0.4% glucose and 10 mM potassium hydrogen phosphate, and incubated at 37 C. overnight. The next day, colonies were restreaked onto fresh LBPG chloramphenicol agar plates and incubated at 37 C. overnight. The following day, single colonies of each clone were transferred to liquid LB medium containing chloramphenicol (6 μg/ml) and incubated overnight at 37 C. with shaking at 250 rpm.

Plasmids were extracted from the liquid cultures using QIAgen Plasmid Purification mini kit (Qiagen, USA) according to the manufacturer's instructions. However, the resuspension buffer was supplemented with 1 mg/ml of chicken egg white lysozyme (SIGMA, USA) prior to lysing the cells at 37 C. for 15 minutes. 5 μl samples of the plasmids were digested with BamHI and NotI. The digestions were checked by gel electrophoresis on a 1.5% agarose gel (NuSieve™, FMC). The appearance of a DNA fragment of the same size as seen from the PCR amplification indicated a positive clone. One positive clone was designated MB378.

Expression, secretion and functional analysis of the fusion protein

The clone MB378 (expressing Termamyl™ fused to Bacillus agaradherens Cel5A CBD) was incubated for 20 hours in SB medium at 37 C. with shaking at 250 rpm. 1 ml of cell-free supernatant was mixed with 200 μl of 10% Avicel™. The mixture was incubated for 1 hour at 0 C. and then centrifuged for 5 minutes at 5000 g. The pellet was resuspended in 100 μl of SDS-PAGE buffer, and the suspension was boiled at 95 C. for 5 minutes, centrifuged at 5000 g for 5 minutes, and 25 μl was loaded onto a 4-20% Laemmli Tris-Glycine, SDS-PAGE NOVEX™ gel (Novex, USA). The samples were subjected to electrophoresis in an Xcell™ Mini-Cell (NOVEX, USA) as recommended by the manufacturer. All subsequent handling of gels, including staining (Coomassie), destaining and drying, were performed as described by the manufacturer.

The appearance of a protein band of molecular weight approx. 60 kDa indicated expression in B. subtilis of the Termamyl™-CBD fusion encoded on the plasmid pMB378.

EXAMPLE 3

This example describes fusion of Termamyl™ and the CBD from Cellulomonas fimi (ATCC 484) cenA gene using the sequence overlap extension (SOE) procedure [see, e.g., Sambrook et al., Ausubel et al., or C. R. Harwood and S. M. Cutting (loc. cit.)]. The final construction is as follows: Termamyl™ promoter--Termamyl™ signal peptide--cenA CBD--linker--mature Termamyl™.

Amplification of the Termamyl™ fragment for SOE

Approximately 10-20 ng of plasmid pDN1528 was PCR amplified in HiFidelity™ PCR buffer (Boehringer Mannheim, Germany) supplemented with 200 μM of each dNTP, 2.6 units of HiFidelity™ Expand enzyme mix, and 100 pmol of each primer:

#45763'-CTC GTC CCA ATC GGT TCC GTC                (SEQ ID No. 28)#284035'-TGC ACT GGT ACA GTT CCT ACA ACT AGT CCT ACA CGT GCA AAT CTT AAT GGGACG                                           (SEQ ID No. 29)CTG-3'

The part of the primer #28403 constituting a fragment of the Termamyl™ sequence is underlined. The sequence on the 5' side of this underlined sequence is that coding for the linker region to the CBD.

The PCR reaction was performed using a DNA thermal cycler (Landgraf, Germany). One incubation at 94 C. for 2 min, 55 C. for 30 sec and 72 C. for 45 sec was followed by twenty cycles of PCR performed using a cycle profile of denaturation at 96 C. for 10 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 45 sec. 10 μl aliquots of the amplification product were analyzed by electrophoresis in 1.0% agarose gels (NuSieve™, FMC) with ReadyLoad™ 100 bp DNA ladder (GibcoBRL, Denmark) as a size marker.

40 μl aliquots of the PCR product generated as described above were purified using QIAquick™ PCR purification kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCI, pH 8.5.

Isolation of genomic DNA

Cellulomonas fimi ATCC 484 was grown in TY medium at 30 C. with shaking at 250 rpm for 24 hours. Cells were harvested by centrifugation.

Genomic DNA was isolated as described by Pitcher et al., Lett. Appl. Microbiol. 8 (1989), pp. 151-156.

In vitro amplification of the CBD of Cellulomonas fimi (ATCC 484) cenA gene for SOE procedure

Approximately 100-200 ng of genomic DNA was PCR amplified in HiFidelity™ PCR buffer (Boehringer Mannheim, Germany) supplemented with 200 μM of each dNTP, 2.6 units of HiFidelity™ Expand enzyme mix, and 100 pmol of each primer:

#88285'-CTG CCT CAT TCT GCA GCA GCG GCG GCA AAT CTT AAT GCT CCC GGC TGC CGCGTC GAC                                          (SEQ ID No. 30)3'C#284043'-TGT AGG AAC TGT ACC AGT GCA CGT GGT GCC GTT GAG C                                            (SEQ ID No. 31)(PstI restriction site underlined).

The primers were designed to amplify the DNA encoding the cellulose-binding domain of the CenA-encoding gene of Cellulomonas fimi (ATCC 484). The DNA sequence was extracted from the database GenBank under the accession number M15823.

PCR cycling was performed as follows: One incubation at 94 C. for 2 min, 55 C. for 30 sec and 72 C. for 45 sec was followed by thirty cycles of PCR performed using a cycle profile of denaturation at 96 C. for 10 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 45 sec. 10 μl aliquots of the amplification product were analyzed by electrophoresis in 1.0% agarose gels (NuSieve™, FMC) with ReadyLoad™ 100 bp DNA ladder (GibcoBRL, Denmark) as a size marker.

40 μl aliquots of the PCR product generated as described above were purified using QIAquick™ PCR purification kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCl, pH 8.5.

SOE of the CBD from Cellulomonas fimi (ATCC 484) cenA gene and the Termamyl™ gene

Approximately 100-200 ng of the PCR amplified Termamyl™ fragment and the PCR amplified cenA CBD fragment were used in a second round of PCR. SOE of the two fragments was performed in HiFidelity™ PCR buffer (Boehringer Mannheim, Germany) supplemented with 200 μM of each dNTP, 2.6 units of HiFidelity™ Expand enzyme mix.

A touch-down PCR cycling was performed as follows: One incubation at 96 C. for 2 min, 60 C. for 2 min and 72 C. for 45 sec. This cycle was repeated ten times with a 1 C. decrease of the annealing temperature at each cycle.

A third PCR reaction was started by adding 100 pmol of the two flanking primers #8828 and #4576 (vide supra) to amplify the hybrid DNA. PCR was performed by incubating the SOE reaction mixture at 96 C. for 2 min, 55 C. for 30 sec and 72 C. for 45 sec. This was followed by twenty cycles of PCR performed using a cycle profile of denaturation at 96 C. for 10 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 45 sec. 10 μl aliquots of the amplification product were analyzed by electrophoresis in 1.0% agarose gels (NuSieve™, FMC) with ReadyLoad™ 100 bp DNA ladder (GibcoBRL, Denmark) as a size marker. The SOE fragment had the expected size of 879 bp.

Subcloning of the SOE fragment coding for the CBD-Termamyl hybrid

40 μl of the SOE-PCR product generated as described above was purified using QIAquick™ PCR purification kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCI, pH 8.5. 25 μl of the purified PCR fragment was digested with PstI and KpnI, subjected to electrophoresis in 1.0% low gelling temperature agarose (SeaPlaque™ GTG, FMC) gels, and a fragment of 837 bp was excised from the gel and purified using QIAquick™ Gel extraction Kit (Qiagen, USA) according to the manufacturer's instructions. The isolated DNA fragment was then ligated to PstI- and KpnI-digested pDN1981, and the ligation mixture was used to transform competent cells of B. subtilis PL2306. Cells were plated on LB agar plates containing Kanamycin (10 μg/ml), 0.4% glucose and 10 mM potassium hydrogen phosphate, and incubated at 37 C. overnight. The next day, colonies were restreaked onto fresh LBPG Kanamycin agar plates and incubated at 37 C. overnight. The following day, single colonies of each clone were transferred to liquid LB medium containing Kanamycin (10 μg/ml) and incubated overnight at 37 C. with shaking at 250 rpm.

Plasmids were extracted from the liquid cultures using QIAgen Plasmid Purification mini kit (Qiagen, USA) according to the manufacturer's instructions. However, the resuspension buffer was supplemented with 1 mg/ml of chicken egg white lysozyme (SIGMA, USA) prior to lysing the cells at 37 C. for 15 minutes. 5 μl samples of the plasmids were digested with PstI and Kpnl. The digestions were checked by gel electrophoresis on a 1.5% agarose gel (NuSieve™, FMC). The appearance of a DNA fragment of 837 bp, the same size as seen from the PCR amplification, indicated a positive clone. One positive clone was designated MOL1297.

Expression, secretion and functional analysis of the fusion protein

The clone MOL1297 (expressing C. fimi cenA CBD fused to the N-terminal of TermamylT) was incubated for 20 hours in SB medium at 37 C. with shaking at 250 rpm. 1 ml of cell-free supernatant was mixed with 200 μl of 10% Avicel™. The mixture was incubated for 1 hour at 0 C. and then centrifuged for 5 min at 5000 g. The pellet was resuspended in 100 μl of SDS-PAGE buffer, boiled at 95 C. for 5 minutes, centrifuged at 5000 g for 5 minutes, and 25 μl was loaded on a 4-20% Laemmli Tris-Glycine, SDS-PAGE NOVEX gel (Novex, USA). The samples were subjected to electrophoresis in an Xcell™ Mini-Cell (NOVEX, USA) as recommended by the manufacturer. All subsequent handling of gels including staining (Coomassie), destaining and drying, was performed as described by the manufacturer.

The appearance of a protein band of MW approx. 85 kDa indicated expression in B. subtilis of the CBD-Termamyl™ fusion.

The encoding sequence for the C. fimi cenA CBD-Termamyl hybrid is shown in SEQ ID No. 7 (in which nucleotides 100-441 are the CBD-encoding part of the sequence). The corresponding amino acid sequence of the hybrid is shown in SEQ ID No. 8 (in which amino acid residues 30-147 are the CBD amino acid sequence).

EXAMPLE 4

This example describes the construction of fusion proteins (enzyme hybrid) from a lipase (Lipolase™; Humicola lanuginosa lipase) and a CBD. A construction with an N-terminal CBD was chosen, since the N-terminal of the enzyme is far from the active site, whereas the C-terminal is in relatively close proximity to the active site.

pIVI450 construction (CBD-linker-lipase)

This construct was made in order to express a protein having the Myceliophthora thermophila cellulase CBD and linker at the N-terminal of Lipolase™.

A PCR fragment was created using the clone pA2C161 (DSM 9967) containing the M. thermophila cellulase gene as template, and the following oligomers as primers:

#8202(SEQ ID No. 32)5' ACGTAGTGGCCACGCTAGGCGAGGTGGTGG 3'#19672(SEQ ID No. 33)5' CCACACTTCTCTTCCTTCCTC 3'

The PCR fragment was cut with BamHI and BalI, and cloned into pAHL which was also cut with BamHI and BalI just upstream of the presumed signal peptide processing site. The cloning was verified by sequencing (see SEQ ID No. 9).

Removing linker between CBD and lipase

This construct is made so that any linker of interest can be inserted between the CBD and the lipase in order to find an optimal linker.

An NheI site is introduced by the USE technique (Stratagene catalogue No. 200509) between the CBD and linker region in pIVI450, creating pIVI450+NheI site. pIVI450+NheI site is cut with XhoI and NheI, isolating the vector containing the CBD part.

The plasmid pIVI392 is cut with XhoI and NheI, and the fragment containing the Lipolase™ gene (minus signal peptide encoding sequence) is isolated.

The DNA fragments are ligated, generating pIVI450 CBD-NheI site-Lipolase™ containing an NheI site between the CBD and the lipase gene. In this NheI site different linkers can be introduced.

Introduction of non-glycosylated linker

The protein expressed from the construct described here contains a construction of the type: CBD-nonglycosylated linker-lipase.

The amino acid sequence of the linker is as follows:

(SEQ ID No. 34)NNNPQQGNPNQGGNNGGGNQGGGNGG

PCR is performed with the following primers:

#293155' GATCTAGCTAGCAACAATAACCCCCAGCAGGGCAACCCCAACCAGGGCGGGAACAACGGC 3'                                      (SEQ ID No. 35)#293165' GATCTAGCTAGCGCCGCCGTTGCCGCCGCCCTGGTTGCCGCCGCCGTTGTTCCCGCCCTG 3'                                      (SEQ ID No. 36)

The PCR fragment is cut with NheI, the vector pIVI450 CBD-NheI-Lipolase™ is likewise cut with NheI, and the two fragments are ligated, creating: pIVI450 CBD-Nonglycosylated linker-Lipolase™ (SEQ ID No. 10).

Introduction of H. insolens family 45 cellulase linker

The protein expressed from the construct described here contains a construction of the type: CBD-glycosylated linker-lipase.

The amino acid sequence of the linker is as follows:

(SEQ ID No. 37)VQIPSSSTSSPVNQPTSTSTTSTSTTSSPPVQPTTPS

PCR is performed with the following primers:

#29313(SEQ ID No. 38)5' GATACTGCTAGCGTCCAGATCCCCTCCAGC 3'#29314(SEQ ID No. 39)5' GATACTGCTAGCGCTGGGAGTCGTAGGCTG 3'

The PCR fragment is cut with NheI, the vector pIVI450 CBD-NheI-Lipolase™ is likewise cut with NheI, and the two fragments are ligated, creating: pIVI450 CBD-H. insolens family 45 cellulase linker-Lipolase™ (SEQ ID No. 11).

EXAMPLE 5

This example concerns fusion proteins comprising a CBD linked to Coprinus cinereus peroxidase (CiP) or to a mutant thereof (mCiP842) (see, e.g., WO 95/10602).

Yeast expression system

The pJC106/YNG344 host/vector system was chosen as the standard expression system for all CiP experiments utilizing yeast expression. Mutant mCiP842 contains the following amino acid substitutions relative to the parent CiP: V53A, E239G, Y272F, M242I. Constructions using this plasmid were performed with the same procedure as was used for the fusion of CBD to the wild type CiP gene.

Construction of the CBD-CiP fusion vector JC20A or JC20D: CiP signal seq.-H. insolens family 45 cellulase CBD-H. insolens family 45 cellulase linker-CiP or -mCiP842

The CBD-CiP fusion was constructed by amplifying four separate gene fragments using PCR. A) The CiP 5'-untranslated region and the CiP coding sequence from plasmid JC106 or mCiP842 encoding amino acids 1 to 22, B) the H. insolens family 45 cellulase CBD from plasmid pCaHj418 encoding amino acids 248-305, C) the H. insolens family 45 cellulase linker domain from plasmid pCaHj418 encoding amino acids 213-247, and D) the CiP coding sequence from plasmid JC106 or mCiP842 encoding amino acids 21 to 344.

The sequence of the H. insolens family 45 cellulase is disclosed in WO 91/17244.

Primers used in amplifications A through D were as follows:

Amplification A:  CiPpcrdwn:    CCCCCTTCCCTGGCGAATTCCGCATGAGG                           (SEQ ID No. 40)  JC20.1:    ACCTTGGGGTAGAGCGAGGGCACCGATG                           (SEQ ID No. 41)Amplification B:  JC20.2:    TGCACTGCTGAGAGGTGGGC   (SEQ ID No. 42)  JC20.3:    CAGGCACTGATGATACCAGT   (SEQ ID No. 43)Amplification C:  JC20.4:    CCCTCCAGCAGCACCAGCTCT  (SEQ ID No. 44)  JC20.5:    TCCTCCAGGACCCTGACCGCTCGGAGTCGTAGGCTG                           (SEQ ID No. 45)Amplification D:  JC20.6:    TACGACTCCGAGCGGTCAGGGTCCTGGAGGAGGCGGG                           (SEQ ID No. 46)  YES2term:    GGGAGGGCGTGAATGTAAG    (SEQ ID No. 47)

Amplified products of reactions A) and B) were purified and phosphorylated using T4 polynucleotide kinase, ligated to one another for 15 min. at room temperature, and amplified with primers 1 and 4 to generate product AB. Amplified products of reactions C) and D) were purified and mixed, then PCR-amplified to generate product CD. Reaction products AB and CD were purified and phosphorylated using T4 polynucleotide kinase, ligated to one another for 15 min. at room temperature, and amplified with primers 1 and 8 to generate the final product. The resulting product was purified, mixed with plasmid JC106 which had the CiP gene removed by digestion with BamHI and XhoI. Plasmid JC20A contains the wild type CiP gene, whereas plasmid JC20D contains the peroxide-stable mutant mCiP842. Transformants were selected on minimal media lacking uridine.

Construction of the other CBD-CiP fusion vectors JC21, 22, 23

Other plasmids containing alternate linkers between the H. insolens family 45 cellulase CBD and CiP were constructed in essentially the same way as described for plasmid JC20A above, using PCR and overlap extension. The resulting plasmids encode fusion proteins with the following domain compositions:

JC21: CiP signal seq.-truncated H. insolens family 45 cellulase CBD-H. insolens family 45 cellulase linker-CiP

JC22: CiP signal seq.-H. insolens family 45 cellulase CBD-linker from the NifA gene of Klebsiella pneumoniae-CiP

JC23: CiP signal seq.-H. insolens family 45 cellulase CBD-linker from the E. coli OmpA gene-CiP.

Scoring of transformants for peroxidase and cellulose-binding activity

Plate Assay: Yeast transformants were grown on minimal media plates containing 2% galactose (to induce the GALL yeast promoter driving CBD-CiP expression) that had been covered with a double filter layer consisting of cellulose acetate on top of nitrocellulose. After overnight growth, both filters were washed twice with 100 ml of 20 mM phosphate buffer, pH 7.0 for 5 minutes, after which no colony debris could be detected. Filters were then assayed for bound peroxidase activity by coating them with a 100 mM phosphate buffer, pH 7.0, containing 50 μg/ml of diamino-benzidine and 1 mM hydrogen peroxide. Bound peroxidase activity appears as a brown precipitate on the filter.

Liquid Assay: Liquid cultures of mutants demonstrating cellulose binding in the filter assay were grown overnight in minimal media containing 2% galactose. 20 μl samples of culture broth were mixed with Avicel crystalline cellulose (20 g/L) in 0.1 M phosphate buffer, pH 7, 0.01% Tween 20 in a total volume of 100 μl and incubated at 22 C. for 10 minutes. The mixture was then centrifuged to pellet the insoluble cellulose fraction, and the supernatants were assayed for peroxidase activity using the standard CiP assay (see, e.g, WO 95/10602). Binding was scored as the % activity bound to the insoluble cellulose fraction based on the decrease in soluble activity.

High pH/thermal stability screening of CBD-CiP fusions

This screening process utilizes broth samples from yeast cultures grown in microtiter plates. The 96-well plate screen is performed by first growing yeast transformants of a pool of mutants in 50 μL volumes of URA(-) medium, pH 6.0 in 96-well microtiter plates. Cultures are inoculated by dilution into medium and pipetting (robotic or manual autopipettor) into 96-well plates. These are placed in an incubator set at 30 C., 350 RPM and shaken for approximately 5 days. Plates are placed directly from the culture box onto the robotic system.

Both CiP and mCiP842 and the related fusion proteins were subjected to a combined pH--temperature--H2 O2 stress test: After an initial activity assay, cultures are diluted to ca. 0.06 PODU/ml (see WO 95/10602 for definition of PODU) and incubated in 200 μM hydrogen peroxide, 100 mM phosphate/borate buffer, pH10.5 at 50 C. After 0, 10, 20 and 30 minutes, samples are removed and residual activity is measured using the standard ABTS assay, pH 7.0. Improved mutants are those showing higher residual activity than CiP and are expressed as percent residual activity relative to the time 0 assay result.

Yeast expression plasmids designed to make five H. insolens family 45 cellulase CBD-CiP fusions were constructed and sequenced. The primary difference between the fusions is in the type of linker domain that connects the CBD to the CiP, as this was thought to be important for maximizing the binding of the CBD to cellulosic substrates.

All the constructs encode a fusion of four discrete domains: CiP signal sequence-H. insolens family 45 cellulase CBD-linker-CiP. Plasmid JC20A is a CBD-CiP fusion to the wild type CiP, while plasmid JC20D is a fusion to the stable mutant mCiP842 containing the amino acid substitutions V53A, E239G, M2421 and Y272F. Both JC20 constructs contain the natural H. insolens family 45 cellulase linker domain. Plasmid JC21 encodes a fusion protein identical to the JC20 product with the exception that it contains a truncated linker lacking residues 7 to 23 of the H. insolens family 45 cellulase linker. Plasmid JC22 has the H. insolens family 45 cellulase linker domain replaced with a 12 residue proline-rich linker from the outer membrane protein of E. coli (from the OmpA gene). The final plasmid, JC23, contains a fourth linker (called a Q linker) derived from the NifA gene of Klebsiella pneumoniae. This linker, 14 amino acids in length, contains 3 glutamine residues (hence the name Q linker) as well as 3 arginine residues, giving it a positive charge at neutral pH.

These JC20-series plasmids were transformed into S. cerevisae for expression and testing. After transformation, yeast colonies were grown on selective plates covered with a double filter layer: cellulose acetate filters on top of nitrocellulose. Wild type CiP secreted from yeast JC106 and the stable mutant mCiP842 pass through the cellulose acetate, then binds to the nitrocellulose where it can be visualized using diaminobenzidine (DAB) and H2 O2. The cellulose acetate filter does not bind any wild-type or mCiP842 peroxidase. In contrast, the N-terminal CBD-CiP fusions encoded by plasmids JC20A, JC20D, JC21, JC22, and JC23 are all detectable on both filters using the DAB assay, indicating that the fusion proteins have both peroxidase and cellulose-binding activities. Visual inspection of filters suggests that the NifA linker may improve binding slightly over the others, although the difference is marginal. In all cases the peroxidase activity bound to the cellulose acetate filter remains bound even after washing extensively with buffer at pH 7. The activity bound to the lower nitrocellulose filter suggests that binding of the CBD-CiP may be incomplete, or the cellulose filter gets saturated, allowing some of the fusion protein to pass through to the lower filter, or that some percentage of the fusion protein gets truncated to include only the peroxidase domain.

Sequence identifiers herein corresponding to the constructs are as as indicated below. Abbreviations are as follows:

EGV: Humicola insolens family 45 endoglucanase (cellulase)

CiPss: CiP signal sequence

CiP842: CiP mutant/variant mCiP842;

SEQ ID No. 12: Nucleotide sequence of the CiPss(+2 amino acids)-EGV CBD-EGV linker-CiP fusion in JC20.A;

SEQ ID No.13: Nucleotide sequence of the CiPss(+2 amino acids)-EGV CBD-EGV linker-CiP842 fusion in JC20.D1;

SEQ ID NO. 14: Nucleotide sequence of the CiPss(+2 amino acids)-EGV CBD-truncated EGV linker-CiP fusion in JC21;

SEQ ID No. 15: Nucleotide sequence of the CiPss(+2 amino acids)-EGV CBD-E. coli OmpA linker-CiP fusion in JC22;

SEQ ID No. 16: Nucleotide sequence of the CiPss(+2 amino acids)-EGV CBD-NifA linker-CiP fusion in JC23.

EXAMPLE 6

This example concerns fusion proteins comprising a CBD linked to Myceliophthora thermophila laccase (MtL) (MtL is described in, e.g., WO 95/33836).

Construction of the N-terminal MtL-CBD fusion pJC24

A DNA fragment containing the Coprinus cinereus peroxidase (CiP) signal sequence (22 amino acids), the H. insolens family 45 cellulase CBD (37 amino acids) and a NifA linker domain from Klebsiella pneumoniae (14 amino acids) was PCR-amplified using two specific primers to plasmid pJC23.

______________________________________primer name   sequence______________________________________CiPpcrdwn:    CTGGGGTAATTAATCAGCGAAGCGATG         (SEQ ID No. 48)JC24.1        AGCGCGTGGACGTTCGATGC         (SEQ ID No. 49)______________________________________

PCR amplification was performed using Pwo polymerase (Boehringer Mannheim) using the supplied buffer according to the manufacturer's instructions. The reaction was initiated after 3 min. at 96 C. by addition of the polymerase, and allowed to cycle 30 times with 30 sec at 96 C., 30 sec at 60 C. and 2 min at 72 C.

A second PCR fragment encoding the mature MtL peptide lacking both the signal peptide and propeptide (residues 48-620) was PCR amplified from a CDNA clone of the Myceliophthora laccase contained in plasmid pJRoC30. PCR amplification was performed using the same conditions as described above and the following primer pair:

______________________________________primer name    sequence______________________________________JC24.2   CAGCAGAGCTGCAACACCCCCAG                      (SEQ ID No. 50)YES2term GGGGAGGGCGTGAATGTAAG                      (SEQ ID No. 51)______________________________________

Following amplification, both DNA fragments were purified using the QiaQuick™ Spin purification kit (Qiagen, Inc.) according to the manufacturer's recommendations. The two DNA fragments were then ligated together and a portion of the ligation mix used as a template for PCR amplification using the CiPpcrdwn and YES2term primers under the same conditions as described above. The resulting 2.3 kb chimeric DNA fragment was gel-purified, cut with BamHI and NotI restriction enzymes, and ligated into the vector backbone of plasmid pJC106 to obtain plasmid pJC24.

Construction of the C-terminal MtL-CBD fusion pJC25

A PCR fragment encoding the entire MtL peptide (residues 1-620) and 232 bp of upstream sequence was amplified from plasmid pJRoC30 using the following primer pair:

______________________________________primer name   sequence______________________________________CiPpcrdwn:    CTGGGGTAATTAATCAGCGAAGCGATG         (SEQ ID No. 52)JC25.2        CGCCTTGACCAGCCACTCGCCCTCCTCG         (SEQ ID No. 53)______________________________________

A second DNA fragment encoding the H. insolens family 45 cellulase linker domain (35 amino acids), the H. insolens family 45 cellulase CBD (37 amino acids) and 20 bp of 3' non-coding sequence was amplified from the H. insolens family 45 cellulase plasmid pCaHj418 using the following primer pair:

______________________________________primer name    sequence______________________________________JC20.4   CCCTCCAGCAGCACCAGCTCTC    (SEQ ID No. 54)JC25.1NotI    ATAAGAATGCGGCCGCCTACAGGCACTGATGGTACCAGT    (SEQ ID No. 55)______________________________________

The two DNA fragments were ligated briefly and the full-length 2.3 kb fusion product was amplified as described above, using the primers CiPpcrdwn and JC25. INotI. This final PCR product was cloned into plasmid pJC106 to obtain plasmid pJC25.

Construction of the C-terminal MtL-CBD fusion pJC26

Plasmid pJC26 was constructed in exactly the same manner as pJC25, except that primer ML-ct was substituted for primer JC25. 1 and resulted in a truncated product of the MtL gene lacking the final 17 codons.

______________________________________primer name       sequence______________________________________ML-ct             CAGCAGAGCTGCAACACC______________________________________

Sequence identifiers herein corresponding to the constructs are as as indicated below. Abbreviations are as follows:

EGV: Humicola insolens family 45 endoglucanase (cellulase)

CiPss: CiP signal sequence

MtLss: MtL signal sequence

SEQ ID No. 17: Nucleotide sequence of the CiPss(+2 amino acids)-EGV CBD-NifA linker-MtL fusion in pJC24;

SEQ ID No. 18: Nucleotide sequence of the MtLss-MtL propeptide-MtL-EGV linker-EGV CBD fusion in pJC25;

SEQ ID No. 19: Nucleotide sequence of the MtLss-MtL propeptide-MtL (minus 17 amino acids)-EGV linker-EGV CBD fusion in pJC26. The codons corresponding to the 17 amino acids in question are shown in bold in SEQ ID No. 18.

__________________________________________________________________________#             SEQUENCE LISTING- (1) GENERAL INFORMATION:-    (iii) NUMBER OF SEQUENCES: 55- (2) INFORMATION FOR SEQ ID NO: 1:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 2253 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: DNA (genomic)#1:   (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- ATGAAACAAC AAAAACGGCT TTACGCCCGA TTGCTGACGC TGTTATTTGC GC - #TCATCTTC  60- TTGCTGCCTC ATTCTGCAGC AGCGGCGGCA AATCTTAATG GGACGCTGAT GC - #AGTATTTT 120- GAATGGTACA TGCCCAATGA CGGCCAACAT TGGAAGCGTT TGCAAAACGA CT - #CGGCATAT 180- TTGGCTGAAC ACGGTATTAC TGCCGTCTGG ATTCCCCCGG CATATAAGGG AA - #CGAGCCAA 240- GCGGATGTGG GCTACGGTGC TTACGACCTT TATGATTTAG GGGAGTTTCA TC - #AAAAAGGG 300- ACGGTTCGGA CAAAGTACGG CACAAAAGGA GAGCTGCAAT CTGCGATCAA AA - #GTCTTCAT 360- TCCCGCGACA TTAACGTTTA CGGGGATGTG GTCATCAACC ACAAAGGCGG CG - #CTGATGCG 420- ACCGAAGATG TAACCGCGGT TGAAGTCGAT CCCGCTGACC GCAACCGCGT AA - #TCTCAGGA 480- GAACACCTAA TTAAAGCCTG GACACATTTT CATTTTCCGG GGGCCGGCAG CA - #CATACAGC 540- GATTTTAAAT GGCATTGGTA CCATTTTGAC GGAACCGATT GGGACGAGTC CC - #GAAAGCTG 600- AACCGCATCT ATAAGTTTCA AGGAAAGGCT TGGGATTGGG AAGTTTCCAA TG - #AAAACGGC 660- AACTATGATT ATTTGATGTA TGCCGACATC GATTATGACC ATCCTGATGT CG - #CAGCAGAA 720- ATTAAGAGAT GGGGCACTTG GTATGCCAAT GAACTGCAAT TGGACGGAAA CC - #GTCTTGAT 780- GCTGTCAAAC ACATTAAATT TTCTTTTTTG CGGGATTGGG TTAATCATGT CA - #GGGAAAAA 840- ACGGGGAAGG AAATGTTTAC GGTAGCTGAA TATTGGCAGA ATGACTTGGG CG - #CGCTGGAA 900- AACTATTTGA ACAAAACAAA TTTTAATCAT TCAGTGTTTG ACGTGCCGCT TC - #ATTATCAG 960- TTCCATGCTG CATCGACACA GGGAGGCGGC TATGATATGA GGAAATTGCT GA - #ACGGTACG1020- GTCGTTTCCA AGCATCCGTT GAAATCGGTT ACATTTGTCG ATAACCATGA TA - #CACAGCCG1080- GGGCAATCGC TTGAGTCGAC TGTCCAAACA TGGTTTAAGC CGCTTGCTTA CG - #CTTTTATT1140- CTCACAAGGG AATCTGGATA CCCTCAGGTT TTCTACGGGG ATATGTACGG GA - #CGAAAGGA1200- GACTCCCAGC GCGAAATTCC TGCCTTGAAA CACAAAATTG AACCGATCTT AA - #AAGCGAGA1260- AAACAGTATG CGTACGGAGC ACAGCATGAT TATTTCGACC ACCATGACAT TG - #TCGGCTGG1320- ACAAGGGAAG GCGACAGCTC GGTTGCAAAT TCAGGTTTGG CGGCATTAAT AA - #CAGACGGA1380- CCCGGTGGGG CAAAGCGAAT GTATGTCGGC CGGCAAAACG CCGGTGAGAC AT - #GGCATGAC1440- ATTACCGGAA ACCGTTCGGA GCCGGTTGTC ATCAATTCGG AAGGCTGGGG AG - #AGTTTCAC1500- GTAAACGGCG GATCCGTTTC AATTTATGTT CAAAGATCTG GCGGACCTGG AA - #CGCCAAAT1560- AATGGCAGAG GAATTGGTTA TATTGAAAAT GGTAATACCG TAACTTACAG CA - #ATATAGAT1620- TTTGGTAGTG GTGCAACAGG GTTCTCTGCA ACTGTTGCAA CGGAGGTTAA TA - #CCTCAATT1680- CAAATCCGTT CTGACAGTCC TACCGGAACT CTACTTGGTA CCTTATATGT AA - #GTTCTACC1740- GGCAGCTGGA ATACATATCA ACCGTATCTA CAAACATCAG CAAAATTACC GG - #CGTTCATG1800- ATATTGTATT GGTATTCTCA GGTCCAGTCA ATGTGGACAA CTTCATATTT AG - #CAGAAGTT1860- CACCAGTGCC TGCACCTGGT GATAACACAA GAGACGCATA TTCTATCATT CA - #GGCCGAGG1920- ATTATGACAG CAGTTATGGT CCCAACCTTC AAATCTTTAG CTTACCAGGT GG - #TGGCAGCG1980- CTTGGCTATA TTGAAAATGG TTATTCCACT ACCTATAAAA ATATTGATTT TG - #GTGACGGC2040- GCAACGTCCG TAACAGCAAG AGTAGCTACC CAGAATGCTA CTACCATTCA GG - #TAAGATTG2100- GGAAGTCCAT CGGGTACATT ACTTGGAACA ATTTACGTGG GGTCCACAGG AA - #GCTTTGAT2160- ACTTATAGGG ATGTATCCGC TACCATTAGT AATACTGCGG GTGTAAAAGA TA - #TTGTTCTT2220#       2253       TTAA TGTTGACTGG TAG- (2) INFORMATION FOR SEQ ID NO: 2:-      (i) SEQUENCE CHARACTERISTICS:#acids    (A) LENGTH: 750 amino     (B) TYPE: amino acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: protein#2:   (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- Met Lys Gln Gln Lys Arg Leu Tyr Ala Arg Le - #u Leu Thr Leu Leu Phe#                15- Ala Leu Ile Phe Leu Leu Pro His Ser Ala Al - #a Ala Ala Ala Asn Leu#            30- Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Ty - #r Met Pro Asn Asp Gly#        45- Gln His Trp Lys Arg Leu Gln Asn Asp Ser Al - #a Tyr Leu Ala Glu His#    60- Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Ty - #r Lys Gly Thr Ser Gln#80- Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Ty - #r Asp Leu Gly Glu Phe#                95- His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gl - #y Thr Lys Gly Glu Leu#           110- Gln Ser Ala Ile Lys Ser Leu His Ser Arg As - #p Ile Asn Val Tyr Gly#       125- Asp Val Val Ile Asn His Lys Gly Gly Ala As - #p Ala Thr Glu Asp Val#   140- Thr Ala Val Glu Val Asp Pro Ala Asp Arg As - #n Arg Val Ile Ser Gly145                 1 - #50                 1 - #55                 1 -#60- Glu His Leu Ile Lys Ala Trp Thr His Phe Hi - #s Phe Pro Gly Ala Gly#               175- Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Ty - #r His Phe Asp Gly Thr#           190- Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Il - #e Tyr Lys Phe Gln Gly#       205- Lys Ala Trp Asp Trp Glu Val Ser Asn Glu As - #n Gly Asn Tyr Asp Tyr#   220- Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pr - #o Asp Val Ala Ala Glu225                 2 - #30                 2 - #35                 2 -#40- Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Gl - #u Leu Gln Leu Asp Gly#               255- Asn Arg Leu Asp Ala Val Lys His Ile Lys Ph - #e Ser Phe Leu Arg Asp#           270- Trp Val Asn His Val Arg Glu Lys Thr Gly Ly - #s Glu Met Phe Thr Val#       285- Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Le - #u Glu Asn Tyr Leu Asn#   300- Lys Thr Asn Phe Asn His Ser Val Phe Asp Va - #l Pro Leu His Tyr Gln305                 3 - #10                 3 - #15                 3 -#20- Phe His Ala Ala Ser Thr Gln Gly Gly Gly Ty - #r Asp Met Arg Lys Leu#               335- Leu Asn Gly Thr Val Val Ser Lys His Pro Le - #u Lys Ser Val Thr Phe#           350- Val Asp Asn His Asp Thr Gln Pro Gly Gln Se - #r Leu Glu Ser Thr Val#       365- Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Ph - #e Ile Leu Thr Arg Glu#   380- Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Me - #t Tyr Gly Thr Lys Gly385                 3 - #90                 3 - #95                 4 -#00- Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys Hi - #s Lys Ile Glu Pro Ile#               415- Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Al - #a Gln His Asp Tyr Phe#           430- Asp His His Asp Ile Val Gly Trp Thr Arg Gl - #u Gly Asp Ser Ser Val#       445- Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr As - #p Gly Pro Gly Gly Ala#   460- Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gl - #y Glu Thr Trp His Asp465                 4 - #70                 4 - #75                 4 -#80- Ile Thr Gly Asn Arg Ser Glu Pro Val Val Il - #e Asn Ser Glu Gly Trp#               495- Gly Glu Phe His Val Asn Gly Gly Ser Val Se - #r Ile Tyr Val Gln Arg#           510- Ser Gly Gly Pro Gly Thr Pro Asn Asn Gly Ar - #g Gly Ile Gly Tyr Ile#       525- Glu Asn Gly Asn Thr Val Thr Tyr Ser Asn Il - #e Asp Phe Gly Ser Gly#   540- Ala Thr Gly Phe Ser Ala Thr Val Ala Thr Gl - #u Val Asn Thr Ser Ile545                 5 - #50                 5 - #55                 5 -#60- Gln Ile Arg Ser Asp Ser Pro Thr Gly Thr Le - #u Leu Gly Thr Leu Tyr#               575- Val Ser Ser Thr Gly Ser Trp Asn Thr Tyr Gl - #n Pro Tyr Leu Gln Thr#           590- Ser Ala Lys Leu Pro Ala Phe Met Ile Leu Ty - #r Trp Tyr Ser Gln Val#       605- Gln Ser Met Trp Thr Thr Ser Tyr Leu Ala Gl - #u Val His Gln Cys Leu#   620- His Leu Val Ile Thr Gln Glu Thr His Ile Le - #u Ser Phe Arg Pro Arg625                 6 - #30                 6 - #35                 6 -#40- Ile Met Thr Ala Val Met Val Pro Thr Phe Ly - #s Ser Leu Ala Tyr Gln#               655- Val Val Ala Ala Leu Gly Tyr Ile Glu Asn Gl - #y Tyr Ser Thr Thr Tyr#           670- Lys Asn Ile Asp Phe Gly Asp Gly Ala Thr Se - #r Val Thr Ala Arg Val#       685- Ala Thr Gln Asn Ala Thr Thr Ile Gln Val Ar - #g Leu Gly Ser Pro Ser#   700- Gly Thr Leu Leu Gly Thr Ile Tyr Val Gly Se - #r Thr Gly Ser Phe Asp705                 7 - #10                 7 - #15                 7 -#20- Thr Tyr Arg Asp Val Ser Ala Thr Ile Ser As - #n Thr Ala Gly Val Lys#               735- Asp Ile Val Leu Val Phe Ser Gly Pro Val As - #n Val Asp Trp#           750- (2) INFORMATION FOR SEQ ID NO: 3:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 1203 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: DNA (genomic)#3:   (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- ATGAAAAAGA TAACTACTAT TTTTGTCGTA TTGCTTATGA CAGTGGCGTT GT - #TCAGTATA  60- GGAAACACGA CTGCTGCTGA TAATGATTCA GTTGTAGAAG AACATGGGCA AT - #TAAGTATT 120- AGTAACGGTG AATTAGTCAA TGAACGAGGC GAACAAGTTC AGTTAAAAGG GA - #TGAGTTCC 180- CATGGTTTGC AATGGTACGG TCAATTTGTA AACTATGAAA GTATGAAATG GC - #TAAGAGAT 240- GATTGGGGAA TAAATGTATT CCGAGCAGCA ATGTATACCT CTTCAGGAGG AT - #ATATTGAT 300- GATCCATCAG TAAAGGAAAA AGTAAAAGAG GCTGTTGAAG CTGCGATAGA CC - #TTGATATA 360- TATGTGATCA TTGATTGGCA TATCCTTTCA GACAATGACC CAAATATATA TA - #AAGAAGAA 420- GCGAAGGATT TCTTTGATGA AATGTCAGAG TTGTATGGAG ACTATCCGAA TG - #TGATATAC 480- GAAATTGCAA ATGAACCGAA TGGTAGTGAT GTTACGTGGG GCAATCAAAT AA - #AACCGTAT 540- GCAGAGGAAG TCATTCCGAT TATTCGTAAC AATGACCCTA ATAACATTAT TA - #TTGTAGGT 600- ACAGGTACAT GGAGTCAGGA TGTCCATCAT GCAGCTGATA ATCAGCTTGC AG - #ATCCTAAC 660- GTCATGTATG CATTTCATTT TTATGCAGGG ACACATGGTC AAAATTTACG AG - #ACCAAGTA 720- GATTATGCAT TAGATCAAGG AGCAGCGATA TTTGTTAGTG AATGGGGAAC AA - #GTGCAGCT 780- ACAGGTGATG GTGGCGTGTT TTTAGATGAA GCACAAGTGT GGATTGACTT TA - #TGGATGAA 840- AGAAATTTAA GCTGGGCCAA CTGGTCTCTA ACGCATAAAG ATGAGTCATC TG - #CAGCGTTA 900- ATGCCAGGTG CAAATCCAAC TGGTGGTTGG ACAGAGGCTG AACTATCTCC AT - #CTGGTACA 960- TTTGTGAGGG AAAAAATAAG AGAATCAGCA TCTATTCCGC CAAGCGATCC AA - #CACCGCCA1020- TCTGATCCAG GAGAACCGGA TCCAACGCCC CCAAGTGATC CAGGAGAGTA TC - #CAGCATGG1080- GATCCAAATC AAATTTACAC AAATGAAATT GTGTACCATA ACGGCCAGCT AT - #GGCAAGCA1140- AAATGGTGGA CACAAAATCA AGAGCCAGGT GACCCGTACG GTCCGTGGGA AC - #CACTCAAT1200#           1203- (2) INFORMATION FOR SEQ ID NO: 4:-      (i) SEQUENCE CHARACTERISTICS:#acids    (A) LENGTH: 400 amino     (B) TYPE: amino acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: protein#4:   (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- Met Lys Lys Ile Thr Thr Ile Phe Val Val Le - #u Leu Met Thr Val Ala#                15- Leu Phe Ser Ile Gly Asn Thr Thr Ala Ala As - #p Asn Asp Ser Val Val#            30- Glu Glu His Gly Gln Leu Ser Ile Ser Asn Gl - #y Glu Leu Val Asn Glu#        45- Arg Gly Glu Gln Val Gln Leu Lys Gly Met Se - #r Ser His Gly Leu Gln#    60- Trp Tyr Gly Gln Phe Val Asn Tyr Glu Ser Me - #t Lys Trp Leu Arg Asp#80- Asp Trp Gly Ile Asn Val Phe Arg Ala Ala Me - #t Tyr Thr Ser Ser Gly#                95- Gly Tyr Ile Asp Asp Pro Ser Val Lys Glu Ly - #s Val Lys Glu Ala Val#           110- Glu Ala Ala Ile Asp Leu Asp Ile Tyr Val Il - #e Ile Asp Trp His Ile#       125- Leu Ser Asp Asn Asp Pro Asn Ile Tyr Lys Gl - #u Glu Ala Lys Asp Phe#   140- Phe Asp Glu Met Ser Glu Leu Tyr Gly Asp Ty - #r Pro Asn Val Ile Tyr145                 1 - #50                 1 - #55                 1 -#60- Glu Ile Ala Asn Glu Pro Asn Gly Ser Asp Va - #l Thr Trp Gly Asn Gln#               175- Ile Lys Pro Tyr Ala Glu Glu Val Ile Pro Il - #e Ile Arg Asn Asn Asp#           190- Pro Asn Asn Ile Ile Ile Val Gly Thr Gly Th - #r Trp Ser Gln Asp Val#       205- His His Ala Ala Asp Asn Gln Leu Ala Asp Pr - #o Asn Val Met Tyr Ala#   220- Phe His Phe Tyr Ala Gly Thr His Gly Gln As - #n Leu Arg Asp Gln Val225                 2 - #30                 2 - #35                 2 -#40- Asp Tyr Ala Leu Asp Gln Gly Ala Ala Ile Ph - #e Val Ser Glu Trp Gly#               255- Thr Ser Ala Ala Thr Gly Asp Gly Gly Val Ph - #e Leu Asp Glu Ala Gln#           270- Val Trp Ile Asp Phe Met Asp Glu Arg Asn Le - #u Ser Trp Ala Asn Trp#       285- Ser Leu Thr His Lys Asp Glu Ser Ser Ala Al - #a Leu Met Pro Gly Ala#   300- Asn Pro Thr Gly Gly Trp Thr Glu Ala Glu Le - #u Ser Pro Ser Gly Thr305                 3 - #10                 3 - #15                 3 -#20- Phe Val Arg Glu Lys Ile Arg Glu Ser Ala Se - #r Ile Pro Pro Ser Asp#               335- Pro Thr Pro Pro Ser Asp Pro Gly Glu Pro As - #p Pro Thr Pro Pro Ser#           350- Asp Pro Gly Glu Tyr Pro Ala Trp Asp Pro As - #n Gln Ile Tyr Thr Asn#       365- Glu Ile Val Tyr His Asn Gly Gln Leu Trp Gl - #n Ala Lys Trp Trp Thr#   380- Gln Asn Gln Glu Pro Gly Asp Pro Tyr Gly Pr - #o Trp Glu Pro Leu Asn385                 3 - #90                 3 - #95                 4 -#00- (2) INFORMATION FOR SEQ ID NO: 5:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 1683 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: DNA (genomic)#5:   (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- ATGAAACAAC AAAAACGGCT TTACGCCCGA TTGCTGACGC TGTTATTTGC GC - #TCATCTTC  60- TTGCTGCCTC ATTCTGCAGC AGCGGCGGCA AATCTTAATG GGACGCTGAT GC - #AGTATTTT 120- GAATGGTACA TGCCCAATGA CGGCCAACAT TGGAAGCGTT TGCAAAACGA CT - #CGGCATAT 180- TTGGCTGAAC ACGGTATTAC TGCCGTCTGG ATTCCCCCGG CATATAAGGG AA - #CGAGCCAA 240- GCGGATGTGG GCTACGGTGC TTACGACCTT TATGATTTAG GGGAGTTTCA TC - #AAAAAGGG 300- ACGGTTCGGA CAAAGTACGG CACAAAAGGA GAGCTGCAAT CTGCGATCAA AA - #GTCTTCAT 360- TCCCGCGACA TTAACGTTTA CGGGGATGTG GTCATCAACC ACAAAGGCGG CG - #CTGATGCG 420- ACCGAAGATG TAACCGCGGT TGAAGTCGAT CCCGCTGACC GCAACCGCGT AA - #TCTCAGGA 480- GAACACCTAA TTAAAGCCTG GACACATTTT CATTTTCCGG GGGCCGGCAG CA - #CATACAGC 540- GATTTTAAAT GGCATTGGTA CCATTTTGAC GGAACCGATT GGGACGAGTC CC - #GAAAGCTG 600- AACCGCATCT ATAAGTTTCA AGGAAAGGCT TGGGATTGGG AAGTTTCCAA TG - #AAAACGGC 660- AACTATGATT ATTTGATGTA TGCCGACATC GATTATGACC ATCCTGATGT CG - #CAGCAGAA 720- ATTAAGAGAT GGGGCACTTG GTATGCCAAT GAACTGCAAT TGGACGGAAA CC - #GTCTTGAT 780- GCTGTCAAAC ACATTAAATT TTCTTTTTTG CGGGATTGGG TTAATCATGT CA - #GGGAAAAA 840- ACGGGGAAGG AAATGTTTAC GGTAGCTGAA TATTGGCAGA ATGACTTGGG CG - #CGCTGGAA 900- AACTATTTGA ACAAAACAAA TTTTAATCAT TCAGTGTTTG ACGTGCCGCT TC - #ATTATCAG 960- TTCCATGCTG CATCGACACA GGGAGGCGGC TATGATATGA GGAAATTGCT GA - #ACGGTACG1020- GTCGTTTCCA AGCATCCGTT GAAATCGGTT ACATTTGTCG ATAACCATGA TA - #CACAGCCG1080- GGGCAATCGC TTGAGTCGAC TGTCCAAACA TGGTTTAAGC CGCTTGCTTA CG - #CTTTTATT1140- CTCACAAGGG AATCTGGATA CCCTCAGGTT TTCTACGGGG ATATGTACGG GA - #CGAAAGGA1200- GACTCCCAGC GCGAAATTCC TGCCTTGAAA CACAAAATTG AACCGATCTT AA - #AAGCGAGA1260- AAACAGTATG CGTACGGAGC ACAGCATGAT TATTTCGACC ACCATGACAT TG - #TCGGCTGG1320- ACAAGGGAAG GCGACAGCTC GGTTGCAAAT TCAGGTTTGG CGGCATTAAT AA - #CAGACGGA1380- CCCGGTGGGG CAAAGCGAAT GTATGTCGGC CGGCAAAACG CCGGTGAGAC AT - #GGCATGAC1440- ATTACCGGAA ACCGTTCGGA GCCGGTTGTC ATCAATTCGG AAGGCTGGGG AG - #AGTTTCAC1500- GTAAACGGCG GATCCGTTTC AATTTATGTT CAAAGATCTC CTGGAGAGTA TC - #CAGCATGG1560- GATCCAAATC AAATTTACAC AAATGAAATT GTGTACCATA ACGGCCAGCT AT - #GGCAAGCA1620- AAATGGTGGA CACAAAATCA AGAGCCAGGT GACCCGTACG GTCCGTGGGA AC - #CACTCAAT1680#           1683- (2) INFORMATION FOR SEQ ID NO: 6:-      (i) SEQUENCE CHARACTERISTICS:#acids    (A) LENGTH: 560 amino     (B) TYPE: amino acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: protein#6:   (xi) SEQUENCE DESCRIPTION: SEQ ID NO:- Met Lys Gln Gln Lys Arg Leu Tyr Ala Arg Le - #u Leu Thr Leu Leu Phe#                15- Ala Leu Ile Phe Leu Leu Pro His Ser Ala Al - #a Ala Ala Ala Asn Leu#            30- Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Ty - #r Met Pro Asn Asp Gly#        45- Gln His Trp Lys Arg Leu Gln Asn Asp Ser Al - #a Tyr Leu Ala Glu His#    60- Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Ty - #r Lys Gly Thr Ser Gln#80- Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Ty - #r Asp Leu Gly Glu Phe#                95- His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gl - #y Thr Lys Gly Glu Leu#           110- Gln Ser Ala Ile Lys Ser Leu His Ser Arg As - #p Ile Asn Val Tyr Gly#       125- Asp Val Val Ile Asn His Lys Gly Gly Ala As - #p Ala Thr Glu Asp Val#   140- Thr Ala Val Glu Val Asp Pro Ala Asp Arg As - #n Arg Val Ile Ser Gly145                 1 - #50                 1 - #55                 1 -#60- Glu His Leu Ile Lys Ala Trp Thr His Phe Hi - #s Phe Pro Gly Ala Gly#               175- Ser Thr Tyr Ser Asp Phe Lys Trp His Trp Ty - #r His Phe Asp Gly Thr#           190- Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Il - #e Tyr Lys Phe Gln Gly#       205- Lys Ala Trp Asp Trp Glu Val Ser Asn Glu As - #n Gly Asn Tyr Asp Tyr#   220- Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pr - #o Asp Val Ala Ala Glu225                 2 - #30                 2 - #35                 2 -#40- Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Gl - #u Leu Gln Leu Asp Gly#               255- Asn Arg Leu Asp Ala Val Lys His Ile Lys Ph - #e Ser Phe Leu Arg Asp#           270- Trp Val Asn His Val Arg Glu Lys Thr Gly Ly - #s Glu Met Phe Thr Val#       285- Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala Le - #u Glu Asn Tyr Leu Asn#   300- Lys Thr Asn Phe Asn His Ser Val Phe Asp Va - #l Pro Leu His Tyr Gln305                 3 - #10                 3 - #15                 3 -#20- Phe His Ala Ala Ser Thr Gln Gly Gly Gly Ty - #r Asp Met Arg Lys Leu#               335- Leu Asn Gly Thr Val Val Ser Lys His Pro Le - #u Lys Ser Val Thr Phe#           350- Val Asp Asn His Asp Thr Gln Pro Gly Gln Se - #r Leu Glu Ser Thr Val#       365- Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Ph - #e Ile Leu Thr Arg Glu#   380- Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Me - #t Tyr Gly Thr Lys Gly385                 3 - #90                 3 - #95                 4 -#00- Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys Hi - #s Lys Ile Glu Pro Ile#               415- Leu Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Al - #a Gln His Asp Tyr Phe#           430- Asp His His Asp Ile Val Gly Trp Thr Arg Gl - #u Gly Asp Ser Ser Val#       445- Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr As - #p Gly Pro Gly Gly Ala#   460- Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gl - #y Glu Thr Trp His Asp465                 4 - #70                 4 - #75                 4 -#80- Ile Thr Gly Asn Arg Ser Glu Pro Val Val Il - #e Asn Ser Glu Gly Trp#               495- Gly Glu Phe His Val Asn Gly Gly Ser Val Se - #r Ile Tyr Val Gln Arg#           510- Ser Pro Gly Glu Tyr Pro Ala Trp Asp Pro As - #n Gln Ile Tyr Thr Asn#       525- Glu Ile Val Tyr His Asn Gly Gln Leu Trp Gl - #n Ala Lys Trp Trp Thr#   540- Gln Asn Gln Glu Pro Gly Asp Pro Tyr Gly Pr - #o Trp Glu Pro Leu Asn545                 5 - #50                 5 - #55                 5 -#60- (2) INFORMATION FOR SEQ ID NO:7:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 1893 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: cDNA-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- ATGAAACAAC AAAAACGGCT TTACGCCCGA TTGCTGACGC TGTTATTTGC GC - #TCATCTTC  60- TTGCTGCCTC ATTCTGCAGC AGCGGCGGCA AATCTTAATG CTCCCGGCTG CC - #GCGTCGAC 120- TACGCCGTCA CCAACCAGTG GCCCGGCGGC TTCGGCGCCA ACGTCACGAT CA - #CCAACCTC 180- GGCGACCCCG TCTCGTCGTG GAAGCTCGAC TGGACCTACA CCGCAGGCCA GC - #GGATCCAG 240- CAGCTGTGGA ACGGCACCGC GTCGACCAAC GGCGGCCAGG TCTCCGTCAC CA - #GCCTGCCC 300- TGGAACGGCA GCATCCCGAC CGGCGGCACG GCGTCGTTCG GGTTCAACGG CT - #CGTGGGCC 360- GGGTCCAACC CGACGCCGGC GTCGTTCTCG CTCAACGGCA CCACGTGCAC TG - #GTACAGTT 420- CCTACAACTA GTCCTACACG TGCAAATCTT AATGGGACGC TGATGCAGTA TT - #TTGAATGG 480- TACATGCCCA ATGACGGCCA ACATTGGAGG CGTTTGCAAA ACGACTCGGC AT - #ATTTGGCT 540- GAACACGGTA TTACTGCCGT CTGGATTCCC CCGGCATATA AGGGAACGAG CC - #AAGCGGAT 600- GTGGGCTACG GTGCTTACGA CCTTTATGAT TTAGGGGAGT TTCATCAAAA AG - #GGACGGTT 660- CGGACAAAGT ACGGCACAAA AGGAGAGCTG CAATCTGCGA TCAAAAGTCT TC - #ATTCCCGC 720- GACATTAACG TTTACGGGGA TGTGGTCATC AACCACAAAG GCGGCGCTGA TG - #CGACCGAA 780- GATGTAACCG CGGTTGAAGT CGATCCCGCT GACCGCAACC GCGTAATTTC AG - #GAGAACAC 840- CTAATTAAAG CCTGGACACA TTTTCATTTT CCGGGGCGCG GCAGCACATA CA - #GCGATTTT 900- AAATGGCATT GGTACCATTT TGACGGAACC GATTGGGACG AGTCCCGAAA GC - #TGAACCGC 960- ATCTATAAGT TTCAAGGAAA GGCTTGGGAT TGGGAAGTTT CCAATGAAAA CG - #GCAACTAT1020- GATTATTTGA TGTATGCCGA CATCGATTAT GACCATCCTG ATGTCGCAGC AG - #AAATTAAG1080- AGATGGGGCA CTTGGTATGC CAATGAACTG CAATTGGACG GTTTCCGTCT TG - #ATGCTGTC1140- AAACACATTA AATTTTCTTT TTTGCGGGAT TGGGTTAATC ATGTCAGGGA AA - #AAACGGGG1200- AAGGAAATGT TTACGGTAGC TGAATATTGG CAGAATGACT TGGGCGCGCT GG - #AAAACTAT1260- TTGAACAAAA CAAATTTTAA TCATTCAGTG TTTGACGTGC CGCTTCATTA TC - #AGTTCCAT1320- GCTGCATCGA CACAGGGAGG CGGCTATGAT ATGAGGAAAT TGCTGAACGG TA - #CGGTCGTT1380- TCCAAGCATC CGTTGAAATC GGTTACATTT GTCGATAACC ATGATACACA GC - #CGGGGCAA1440- TCGCTTGAGT CGACTGTCCA AACATGGTTT AAGCCGCTTG CTTACGCTTT TA - #TTCTCACA1500- AGGGAATCTG GATACCCTCA GGTTTTCTAC GGGGATATGT ACGGGACGAA AG - #GAGACTCC1560- CAGCGCGAAA TTCCTGCCTT GAAACACAAA ATTGAACCGA TCTTAAAAGC GA - #GAAAACAG1620- TATGCGTACG GAGCACAGCA TGATTATTTC GACCACCATG ACATTGTCGG CT - #GGACAAGG1680- GAAGGCGACA GCTCGGTTGC AAATTCAGGT TTGGCGGCAT TAATAACAGA CG - #GACCCGGT1740- GGGGCAAAGC GAATGTATGT CGGCCGGCAA AACGCCGGTG AGACATGGCA TG - #ACATTACC1800- GGAAACCGTT CGGAGCCGGT TGTCATCAAT TCGGAAGGCT GGGGAGAGTT TC - #ACGTAAAC1860#       1893       TTTA TGTTCAAAGA TAG- (2) INFORMATION FOR SEQ ID NO:8:-      (i) SEQUENCE CHARACTERISTICS:#acids    (A) LENGTH: 631 amino     (B) TYPE: amino acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: None-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Met Lys Gln Gln Lys Arg Leu Tyr Ala Arg Le - #u Leu Thr Leu Leu Phe#                15- Ala Leu Ile Phe Leu Leu Pro His Ser Ala Al - #a Ala Ala Ala Asn Leu#            30- Asn Ala Pro Gly Cys Arg Val Asp Tyr Ala Va - #l Thr Asn Gln Trp Pro#        45- Gly Gly Phe Gly Ala Asn Val Thr Ile Thr As - #n Leu Gly Asp Pro Val#    60- Ser Ser Trp Lys Leu Asp Trp Thr Tyr Thr Al - #a Gly Gln Arg Ile Gln#80- Gln Leu Trp Asn Gly Thr Ala Ser Thr Asn Gl - #y Gly Gln Val Ser Val#                95- Thr Ser Leu Pro Trp Asn Gly Ser Ile Pro Th - #r Gly Gly Thr Ala Ser#           110- Phe Gly Phe Asn Gly Ser Trp Ala Gly Ser As - #n Pro Thr Pro Ala Ser#       125- Phe Ser Leu Asn Gly Thr Thr Cys Thr Gly Th - #r Val Pro Thr Thr Ser#   140- Pro Thr Arg Ala Asn Leu Asn Gly Thr Leu Me - #t Gln Tyr Phe Glu Trp145                 1 - #50                 1 - #55                 1 -#60- Tyr Met Pro Asn Asp Gly Gln His Trp Arg Ar - #g Leu Gln Asn Asp Ser#               175- Ala Tyr Leu Ala Glu His Gly Ile Thr Ala Va - #l Trp Ile Pro Pro Ala#           190- Tyr Lys Gly Thr Ser Gln Ala Asp Val Gly Ty - #r Gly Ala Tyr Asp Leu#       205- Tyr Asp Leu Gly Glu Phe His Gln Lys Gly Th - #r Val Arg Thr Lys Tyr#   220- Gly Thr Lys Gly Glu Leu Gln Ser Ala Ile Ly - #s Ser Leu His Ser Arg225                 2 - #30                 2 - #35                 2 -#40- Asp Ile Asn Val Tyr Gly Asp Val Val Ile As - #n His Lys Gly Gly Ala#               255- Asp Ala Thr Glu Asp Val Thr Ala Val Glu Va - #l Asp Pro Ala Asp Arg#           270- Asn Arg Val Ile Ser Gly Glu His Leu Ile Ly - #s Ala Trp Thr His Phe#       285- His Phe Pro Gly Arg Gly Ser Thr Tyr Ser As - #p Phe Lys Trp His Trp#   300- Tyr His Phe Asp Gly Thr Asp Trp Asp Glu Se - #r Arg Lys Leu Asn Arg305                 3 - #10                 3 - #15                 3 -#20- Ile Tyr Lys Phe Gln Gly Lys Ala Trp Asp Tr - #p Glu Val Ser Asn Glu#               335- Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala As - #p Ile Asp Tyr Asp His#           350- Pro Asp Val Ala Ala Glu Ile Lys Arg Trp Gl - #y Thr Trp Tyr Ala Asn#       365- Glu Leu Gln Leu Asp Gly Phe Arg Leu Asp Al - #a Val Lys His Ile Lys#   380- Phe Ser Phe Leu Arg Asp Trp Val Asn His Va - #l Arg Glu Lys Thr Gly385                 3 - #90                 3 - #95                 4 -#00- Lys Glu Met Phe Thr Val Ala Glu Tyr Trp Gl - #n Asn Asp Leu Gly Ala#               415- Leu Glu Asn Tyr Leu Asn Lys Thr Asn Phe As - #n His Ser Val Phe Asp#           430- Val Pro Leu His Tyr Gln Phe His Ala Ala Se - #r Thr Gln Gly Gly Gly#       445- Tyr Asp Met Arg Lys Leu Leu Asn Gly Thr Va - #l Val Ser Lys His Pro#   460- Leu Lys Ser Val Thr Phe Val Asp Asn His As - #p Thr Gln Pro Gly Gln465                 4 - #70                 4 - #75                 4 -#80- Ser Leu Glu Ser Thr Val Gln Thr Trp Phe Ly - #s Pro Leu Ala Tyr Ala#               495- Phe Ile Leu Thr Arg Glu Ser Gly Tyr Pro Gl - #n Val Phe Tyr Gly Asp#           510- Met Tyr Gly Thr Lys Gly Asp Ser Gln Arg Gl - #u Ile Pro Ala Leu Lys#       525- His Lys Ile Glu Pro Ile Leu Lys Ala Arg Ly - #s Gln Tyr Ala Tyr Gly#   540- Ala Gln His Asp Tyr Phe Asp His His Asp Il - #e Val Gly Trp Thr Arg545                 5 - #50                 5 - #55                 5 -#60- Glu Gly Asp Ser Ser Val Ala Asn Ser Gly Le - #u Ala Ala Leu Ile Thr#               575- Asp Gly Pro Gly Gly Ala Lys Arg Met Tyr Va - #l Gly Arg Gln Asn Ala#           590- Gly Glu Thr Trp His Asp Ile Thr Gly Asn Ar - #g Ser Glu Pro Val Val#       605- Ile Asn Ser Glu Gly Trp Gly Glu Phe His Va - #l Asn Gly Gly Ser Val#   620- Ser Ile Tyr Val Gln Arg Glx625                 6 - #30- (2) INFORMATION FOR SEQ ID NO:9:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 5679 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- GCGCCCAATA CGCAAACCGC CTCTCCCCGC GCGTTGGCCG ATTCATTAAT GC - #AGCTGGCA  60- CGACAGGTTT CCCGACTGGA AAGCGGGCAG TGAGCGCAAC GCAATTAATG TG - #AGTTAGCT 120- CACTCATTAG GCACCCCAGG CTTTACACTT TATGCTTCCG GCTCGTATGT TG - #TGTGGAAT 180- TGTGAGCGGA TAACAATTTC ACACAGGAAA CAGCTATGAC CATGATTACG CC - #AAGCTTGC 240- ATGCCTGCAG GTCGACGCAT TCCGAATACG AGGCCTGATT AATGATTACA TA - #CGCCTCCG 300- GGTAGTAGAC CGAGCAGCCG AGCCAGTTCA GCGCCTAAAA CGCCTTATAC AA - #TTAAGCAG 360- TTAAAGAAGT TAGAATCTAC GCTTAAAAAG CTACTTAAAA ATCGATCTCG CA - #GTCCCGAT 420- TCGCCTATCA AAACCAGTTT AAATCAACTG ATTAAAGGTG CCGAACGAGC TA - #TAAATGAT 480- ATAACAATAT TAAAGCATTA ATTAGAGCAA TATCAGGCCG CGCACGAAAG GC - #AACTTAAA 540- AAGCGAAAGC GCTCTACTAA ACAGATTACT TTTGAAAAAG GCACATCAGT AT - #TTAAAGCC 600- CGAATCCTTA TTAAGCGCCG AAATCAGGCA GATAAAGCCA TACAGGCAGA TA - #GACCTCTA 660- CCTATTAAAT CGGCTTCTAG GCGCGCTCCA TCTAAATGTT CTGGCTGTGG TG - #TACAGGGG 720- CATAAAATTA CGCACTACCC GAATCGATAG AACTACTCAT TTTTATATAG AA - #GTCAGAAT 780- TCATAGTGTT TTGATCATTT TAAATTTTTA TATGGCGGGT GGTGGGCAAC TC - #GCTTGCGC 840- GGGCAACTCG CTTACCGATT ACGTTAGGGC TGATATTTAC GTGAAAATCG TC - #AAGGGATG 900- CAAGACCAAA GTAGTAAAAC CCCGGAAGTC AACAGCATCC AAGCCCAAGT CC - #TTCACGGA 960- GAAACCCCAG CGTCCACATC ACGAGCGAAG GACCACCTCT AGGCATCGGA CG - #CACCATCC1020- AATTAGAAGC AGCAAAGCGA AACAGCCCAA GAAAAAGGTC GGCCCGTCGG CC - #TTTTCTGC1080- AACGCTGATC ACGGGCAGCG ATCCAACCAA CACCCTCCAG AGTGACTAGG GG - #CGGAAATT1140- TAAAGGGATT AATTTCCACT CAACCACAAA TCACAGTCGT CCCCGGTATT GT - #CCTGCAGA1200- ATGCAATTTA AACTCTTCTG CGAATCGCTT GGATTCCCCG CCCCTAGTCG TA - #GAGCTTAA1260- AGTATGTCCC TTGTCGATGC GATGATACAC AACATATAAA TACTAGCAAG GG - #ATGCCATG1320- CTTGGAGGAT AGCAACCGAC AACATCACAT CAAGCTCTCC CTTCTCTGAA CA - #ATAAACCC1380- CACAGGGGGG ATCCACTAGT AACGGCCGCC AGTGTGCTGG AAAGCGACTT GA - #AACGCCCC1440- AAATGAAGTC CTCCATCCTC GCCAGCGTCT TCGCCACGGG CGCCGTGGCT CA - #AAGTGGTC1500- CGTGGCAGCA ATGTGGTGGC ATCGGATGGC AAGGATCGAC CGACTGTGTG TC - #GGGCTACC1560- ACTGCGTCTA CCAGAACGAT TGGTACAGCC AGTGCGTGCC TGGCGCGGCG TC - #GACAACGC1620- TGCAGACATC GACCACGTCC AGGCCCACCG CCACCAGCAC CGCCCCTCCG TC - #GTCCACCA1680- CCTCGCCTAG CGTGGCCAGT CCTATTCGTC GAGAGGTCTC GCAGGATCTG TT - #TAACCAGT1740- TCAATCTCTT TGCACAGTAT TCTGCAGCCG CATACTGCGG AAAAAACAAT GA - #TGCCCCAG1800- CTGGTACAAA CATTACGTGC ACGGGAAATG CCTGCCCCGA GGTAGAGAAG GC - #GGATGCAA1860- CGTTTCTCTA CTCGTTTGAA GACTCTGGAG TGGGCGATGT CACCGGCTTC CT - #TGCTCTCG1920- ACAACACGAA CAAATTGATC GTCCTCTCTT TCCGTGGCTC TCGTTCCATA GA - #GAACTGGA1980- TCGGGAATCT TAAGTTCCTC TTGAAAAAAA TAAATGACAT TTGCTCCGGC TG - #CAGGGGAC2040- ATGACGGCTT CACTTCGTCC TGGAGGTCTG TAGCCGATAC GTTAAGGCAG AA - #GGTGGAGG2100- ATGCTGTGAG GGAGCATCCC GACTATCGCG TGGTGTTTAC CGGACATAGC TT - #GGGTGGTG2160- CATTGGCAAC TGTTGCCGGA GCAGACCTGC GTGGAAATGG GTATGATATC GA - #CGTGTTTT2220- CATATGGCGC CCCCCGAGTC GGAAACAGGG CTTTTGCAGA ATTCCTGACC GT - #ACAGACCG2280- GCGGAACACT CTACCGCATT ACCCACACCA ATGATATTGT CCCTAGACTC CC - #GCCGCGCG2340- AATTCGGTTA CAGCCATTCT AGCCCAGAAT ACTGGATCAA ATCTGGAACC CT - #TGTCCCCG2400- TCACCCGAAA CGATATCGTG AAGATAGAAG GCATCGATGC CACCGGCGGC AA - #TAACCGGC2460- CGAACATTCC GGATATCCCT GCGCACCTAT GGTACTTCGG GTTAATTGGG AC - #ATGTCTTT2520- AGTGGCCGGC GCGGCTGGGT CGACTCTAGC GAGCTCGAGA TCTAGAGGGT GA - #CTGACACC2580- TGGCGGTAGA CAATCAATCC ATTTCGCTAT AGTTAAAGGA TGGGGATGAG GG - #CAATTGGT2640- TATATGATCA TGTATGTAGT GGGTGTGCAT AATAGTAGTG AAATGGAAGC CA - #AGTCATGT2700- GATTGTAATC GACCGACGGA ATTGAGGATA TCCGGAAATA CAGACACCGT GA - #AAGCCATG2760- GTCTTTCCTT CGTGTAGAAG ACCAGACAGA CAGTCCCTGA TTTACCCTTG CA - #CAAAGCAC2820- TAGAAAATTA GCATTCCATC CTTCTCTGCT TGCTCTGCTG ATATCACTGT CA - #TTCAATGC2880- ATAGCCATGA GCTCATCTTA GATCCAAGCA CGTAATTCCA TAGCCGAGGT CC - #ACAGTGGA2940- GCAGCAACAT TCCCCATCAT TGCTTTCCCC AGGGGCCTCC CAACGACTAA AT - #CAAGAGTA3000- TATCTCTACC GTCCAATAGA TCGTCTTCGC TTCAAAATCT TTGACAATTC CA - #AGAGGGTC3060- CCCATCCATC AAACCCAGTT CAATAATAGC CGAGATGCAT GGTGGAGTCA AT - #TAGGCAGT3120- ATTGCTGGAA TGTCGGGCCA GTTGGCCCGG GTGGTCATTG GCCGCCTGTG AT - #GCCATCTG3180- CCACTAAATC CGATCATTGA TCCACCGCCC ACGAGGCGCG TCTTTGCTTT TT - #GCGCGGCG3240- TCCAGGTTCA ACTCTCTCGC TCTAGATATC GATGAATTCA CTGGCCGTCG TT - #TTACAACG3300- TCGTGACTGG GAAAACCCTG GCGTTACCCA ACTTAATCGC CTTGCAGCAC AT - #CCCCCTTT3360- CGCCAGCTGG CGTAATAGCG AAGAGGCCCG CACCGATCGC CCTTCCCAAC AG - #TTGCGCAG3420- CCTGAATGGC GAATGGCGCC TGATGCGGTA TTTTCTCCTT ACGCATCTGT GC - #GGTATTTC3480- ACACCGCATA TGGTGCACTC TCAGTACAAT CTGCTCTGAT GCCGCATAGT TA - #AGCCAGCC3540- CCGACACCCG CCAACACCCG CTGACGCGCC CTGACGGGCT TGTCTGCTCC CG - #GCATCCGC3600- TTACAGACAA GCTGTGACCG TCTCCGGGAG CTGCATGTGT CAGAGGTTTT CA - #CCGTCATC3660- ACCGAAACGC GCGAGACGAA AGGGCCTCGT GATACGCCTA TTTTTATAGG TT - #AATGTCAT3720- GATAATAATG GTTTCTTAGA CGTCAGGTGG CACTTTTCGG GGAAATGTGC GC - #GGAACCCC3780- TATTTGTTTA TTTTTCTAAA TACATTCAAA TATGTATCCG CTCATGAGAC AA - #TAACCCTG3840- ATAAATGCTT CAATAATATT GAAAAAGGAA GAGTATGAGT ATTCAACATT TC - #CGTGTCGC3900- CCTTATTCCC TTTTTTGCGG CATTTTGCCT TCCTGTTTTT GCTCACCCAG AA - #ACGCTGGT3960- GAAAGTAAAA GATGCTGAAG ATCAGTTGGG TGCACGAGTG GGTTACATCG AA - #CTGGATCT4020- CAACAGCGGT AAGATCCTTG AGAGTTTTCG CCCCGAAGAA CGTTTTCCAA TG - #ATGAGCAC4080- TTTTAAAGTT CTGCTATGTG GCGCGGTATT ATCCCGTATT GACGCCGGGC AA - #GAGCAACT4140- CGGTCGCCGC ATACACTATT CTCAGAATGA CTTGGTTGAC GCGTCACCAG TC - #ACAGAAAA4200- GCATCTTACG GATGGCATGA CAGTAAGAGA ATTATGCAGT GCTGCCATAA CC - #ATGAGTGA4260- TAACACTGCG GCCAACTTAC TTCTGACAAC GATCGGAGGA CCGAAGGAGC TA - #ACCGCTTT4320- TTTGCACAAC ATGGGGGATC ATGTAACTCG CCTTGATCGT TGGGAACCGG AG - #CTGAATGA4380- AGCCATACCA AACGACGAGC GTGACACCAC GATGCCTGTA GCAATGGCAA CA - #ACGTTGCG4440- CAAACTATTA ACTGGCGAAC TACTTACTCT AGCTTCCCGG CAACAATTAA TA - #GACTGGAT4500- GGAGGCGGAT AAAGTTGCAG GACCACTTCT GCGCTCGGCC CTTCCGGCTG GC - #TGGTTTAT4560- TGCTGATAAA TCTGGAGCCG GTGAGCGTGG GTCTCGCGGT ATCATTGCAG CA - #CTGGGGCC4620- AGATGGTAAG CCCTCCCGTA TCGTAGTTAT CTACACGACG GGGAGTCAGG CA - #ACTATGGA4680- TGAACGAAAT AGACAGATCG CTGAGATAGG TGCCTCACTG ATTAAGCATT GG - #TAACTGTC4740- AGACCAAGTT TACTCATATA TACTTTAGAT TGATTTAAAA CTTCATTTTT AA - #TTTAAAAG4800- GATCTAGGTG AAGATCCTTT TTGATAATCT CATGACCAAA ATCCCTTAAC GT - #GAGTTTTC4860- GTTCCACTGA GCGTCAGACC CCGTAGAAAA GATCAAAGGA TCTTCTTGAG AT - #CCTTTTTT4920- TCTGCGCGTA ATCTGCTGCT TGCAAACAAA AAAACCACCG CTACCAGCGG TG - #GTTTGTTT4980- GCCGGATCAA GAGCTACCAA CTCTTTTTCC GAAGGTAACT GGCTTCAGCA GA - #GCGCAGAT5040- ACCAAATACT GTCCTTCTAG TGTAGCCGTA GTTAGGCCAC CACTTCAAGA AC - #TCTGTAGC5100- ACCGCCTACA TACCTCGCTC TGCTAATCCT GTTACCAGTG GCTGCTGCCA GT - #GGCGATAA5160- GTCGTGTCTT ACCGGGTTGG ACTCAAGACG ATAGTTACCG GATAAGGCGC AG - #CGGTCGGG5220- CTGAACGGGG GGTTCGTGCA CACAGCCCAG CTTGGAGCGA ACGACCTACA CC - #GAACTGAG5280- ATACCTACAG CGTGAGCTAT GAGAAAGCGC CACGCTTCCC GAAGGGAGAA AG - #GCGGACAG5340- GTATCCGGTA AGCGGCAGGG TCGGAACAGG AGAGCGCACG AGGGAGCTTC CA - #GGGGGAAA5400- CGCCTGGTAT CTTTATAGTC CTGTCGGGTT TCGCCACCTC TGACTTGAGC GT - #CGATTTTT5460- GTGATGCTCG TCAGGGGGGC GGAGCCTATG GAAAAACGCC AGCAACGCGG CC - #TTTTTACG5520- GTTCCTGGCC TTTTGCTGGC CTTTTGCTCA CATGTTCTTT CCTGCGTTAT CC - #CCTGATTC5580- TGTGGATAAC CGTATTACCG CCTTTGAGTG AGCTGATACC GCTCGCCGCA GC - #CGAACGAC5640#  5679            GTGA GCGAGGAAGC GGAAGAGAG- (2) INFORMATION FOR SEQ ID NO:10:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 5580 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- GCGCCCAATA CGCAAACCGC CTCTCCCCGC GCGTTGGCCG ATTCATTAAT GC - #AGCTGGCA  60- CGACAGGTTT CCCGACTGGA AAGCGGGCAG TGAGCGCAAC GCAATTAATG TG - #AGTTAGCT 120- CACTCATTAG GCACCCCAGG CTTTACACTT TATGCTTCCG GCTCGTATGT TG - #TGTGGAAT 180- TGTGAGCGGA TAACAATTTC ACACAGGAAA CAGCTATGAC CATGATTACG CC - #AAGCTTGC 240- ATGCCTGCAG GTCGACGCAT TCCGAATACG AGGCCTGATT AATGATTACA TA - #CGCCTCCG 300- GGTAGTAGAC CGAGCAGCCG AGCCAGTTCA GCGCCTAAAA CGCCTTATAC AA - #TTAAGCAG 360- TTAAAGAAGT TAGAATCTAC GCTTAAAAAG CTACTTAAAA ATCGATCTCG CA - #GTCCCGAT 420- TCGCCTATCA AAACCAGTTT AAATCAACTG ATTAAAGGTG CCGAACGAGC TA - #TAAATGAT 480- ATAACAATAT TAAAGCATTA ATTAGAGCAA TATCAGGCCG CGCACGAAAG GC - #AACTTAAA 540- AAGCGAAAGC GCTCTACTAA ACAGATTACT TTTGAAAAAG GCACATCAGT AT - #TTAAAGCC 600- CGAATCCTTA TTAAGCGCCG AAATCAGGCA GATAAAGCCA TACAGGCAGA TA - #GACCTCTA 660- CCTATTAAAT CGGCTTCTAG GCGCGCTCCA TCTAAATGTT CTGGCTGTGG TG - #TACAGGGG 720- CATAAAATTA CGCACTACCC GAATCGATAG AACTACTCAT TTTTATATAG AA - #GTCAGAAT 780- TCATAGTGTT TTGATCATTT TAAATTTTTA TATGGCGGGT GGTGGGCAAC TC - #GCTTGCGC 840- GGGCAACTCG CTTACCGATT ACGTTAGGGC TGATATTTAC GTGAAAATCG TC - #AAGGGATG 900- CAAGACCAAA GTAGTAAAAC CCCGGAAGTC AACAGCATCC AAGCCCAAGT CC - #TTCACGGA 960- GAAACCCCAG CGTCCACATC ACGAGCGAAG GACCACCTCT AGGCATCGGA CG - #CACCATCC1020- AATTAGAAGC AGCAAAGCGA AACAGCCCAA GAAAAAGGTC GGCCCGTCGG CC - #TTTTCTGC1080- AACGCTGATC ACGGGCAGCG ATCCAACCAA CACCCTCCAG AGTGACTAGG GG - #CGGAAATT1140- TAAAGGGATT AATTTCCACT CAACCACAAA TCACAGTCGT CCCCGGTATT GT - #CCTGCAGA1200- ATGCAATTTA AACTCTTCTG CGAATCGCTT GGATTCCCCG CCCCTAGTCG TA - #GAGCTTAA1260- AGTATGTCCC TTGTCGATGC GATGATACAC AACATATAAA TACTAGCAAG GG - #ATGCCATG1320- CTTGGAGGAT AGCAACCGAC AACATCACAT CAAGCTCTCC CTTCTCTGAA CA - #ATAAACCC1380- CACAGGGGGG ATCCACTAGT AACGGCCGCC AGTGTGCTGG AAAGCGACTT GA - #AACGCCCC1440- AAATGAAGTC CTCCATCCTC GCCAGCGTCT TCGCCACGGG CGCCGTGGCT CA - #AAGTGGTC1500- CGTGGCAGCA ATGTGGTGGC ATCGGATGGC AAGGATCGAC CGACTGTGTG TC - #GGGCTACC1560- ACTGCGTCTA CCAGAACGAT TGGTACAGCC AGTGCGCTAG CCCTCCTCGT CG - #ACCTGTCT1620- CGCAGGATCT GTTTAACCAG TTCAATCTCT TTGCACAGTA TTCTGCAGCC GC - #ATACTGCG1680- GAAAAAACAA TGATGCCCCA GCTGGTACAA ACATTACGTG CACGGGAAAT GC - #CTGCCCCG1740- AGGTAGAGAA GGCGGATGCA ACGTTTCTCT ACTCGTTTGA AGACTCTGGA GT - #GGGCGATG1800- TCACCGGCTT CCTTGCTCTC GACAACACGA ACAAATTGAT CGTCCTCTCT TT - #CCGTGGCT1860- CTCGTTCCAT AGAGAACTGG ATCGGGAATC TTAAGTTCCT CTTGAAAAAA AT - #AAATGACA1920- TTTGCTCCGG CTGCAGGGGA CATGACGGCT TCACTTCGTC CTGGAGGTCT GT - #AGCCGATA1980- CGTTAAGGCA GAAGGTGGAG GATGCTGTGA GGGAGCATCC CGACTATCGC GT - #GGTGTTTA2040- CCGGACATAG CTTGGGTGGT GCATTGGCAA CTGTTGCCGG AGCAGACCTG CG - #TGGAAATG2100- GGTATGATAT CGACGTGTTT TCATATGGCG CCCCCCGAGT CGGAAACAGG GC - #TTTTGCAG2160- AATTCCTGAC CGTACAGACC GGCGGAACAC TCTACCGCAT TACCCACACC AA - #TGATATTG2220- TCCCTAGACT CCCGCCGCGC GAATTCGGTT ACAGCCATTC TAGCCCAGAA TA - #CTGGATCA2280- AATCTGGAAC CCTTGTCCCC GTCACCCGAA ACGATATCGT GAAGATAGAA GG - #CATCGATG2340- CCACCGGCGG CAATAACCGG CCGAACATTC CGGATATCCC TGCGCACCTA TG - #GTACTTCG2400- GGTTAATTGG GACATGTCTT TAGTGGCCGG CGCGGCTGGG TCGACTCTAG CG - #AGCTCGAG2460- ATCTAGAGGG TGACTGACAC CTGGCGGTAG ACAATCAATC CATTTCGCTA TA - #GTTAAAGG2520- ATGGGGATGA GGGCAATTGG TTATATGATC ATGTATGTAG TGGGTGTGCA TA - #ATAGTAGT2580- GAAATGGAAG CCAAGTCATG TGATTGTAAT CGACCGACGG AATTGAGGAT AT - #CCGGAAAT2640- ACAGACACCG TGAAAGCCAT GGTCTTTCCT TCGTGTAGAA GACCAGACAG AC - #AGTCCCTG2700- ATTTACCCTT GCACAAAGCA CTAGAAAATT AGCATTCCAT CCTTCTCTGC TT - #GCTCTGCT2760- GATATCACTG TCATTCAATG CATAGCCATG AGCTCATCTT AGATCCAAGC AC - #GTAATTCC2820- ATAGCCGAGG TCCACAGTGG AGCAGCAACA TTCCCCATCA TTGCTTTCCC CA - #GGGGCCTC2880- CCAACGACTA AATCAAGAGT ATATCTCTAC CGTCCAATAG ATCGTCTTCG CT - #TCAAAATC2940- TTTGACAATT CCAAGAGGGT CCCCATCCAT CAAACCCAGT TCAATAATAG CC - #GAGATGCA3000- TGGTGGAGTC AATTAGGCAG TATTGCTGGA ATGTCGGGCC AGTTGGCCCG GG - #TGGTCATT3060- GGCCGCCTGT GATGCCATCT GCCACTAAAT CCGATCATTG ATCCACCGCC CA - #CGAGGCGC3120- GTCTTTGCTT TTTGCGCGGC GTCCAGGTTC AACTCTCTCG CTCTAGATAT CG - #ATGAATTC3180- ACTGGCCGTC GTTTTACAAC GTCGTGACTG GGAAAACCCT GGCGTTACCC AA - #CTTAATCG3240- CCTTGCAGCA CATCCCCCTT TCGCCAGCTG GCGTAATAGC GAAGAGGCCC GC - #ACCGATCG3300- CCCTTCCCAA CAGTTGCGCA GCCTGAATGG CGAATGGCGC CTGATGCGGT AT - #TTTCTCCT3360- TACGCATCTG TGCGGTATTT CACACCGCAT ATGGTGCACT CTCAGTACAA TC - #TGCTCTGA3420- TGCCGCATAG TTAAGCCAGC CCCGACACCC GCCAACACCC GCTGACGCGC CC - #TGACGGGC3480- TTGTCTGCTC CCGGCATCCG CTTACAGACA AGCTGTGACC GTCTCCGGGA GC - #TGCATGTG3540- TCAGAGGTTT TCACCGTCAT CACCGAAACG CGCGAGACGA AAGGGCCTCG TG - #ATACGCCT3600- ATTTTTATAG GTTAATGTCA TGATAATAAT GGTTTCTTAG ACGTCAGGTG GC - #ACTTTTCG3660- GGGAAATGTG CGCGGAACCC CTATTTGTTT ATTTTTCTAA ATACATTCAA AT - #ATGTATCC3720- GCTCATGAGA CAATAACCCT GATAAATGCT TCAATAATAT TGAAAAAGGA AG - #AGTATGAG3780- TATTCAACAT TTCCGTGTCG CCCTTATTCC CTTTTTTGCG GCATTTTGCC TT - #CCTGTTTT3840- TGCTCACCCA GAAACGCTGG TGAAAGTAAA AGATGCTGAA GATCAGTTGG GT - #GCACGAGT3900- GGGTTACATC GAACTGGATC TCAACAGCGG TAAGATCCTT GAGAGTTTTC GC - #CCCGAAGA3960- ACGTTTTCCA ATGATGAGCA CTTTTAAAGT TCTGCTATGT GGCGCGGTAT TA - #TCCCGTAT4020- TGACGCCGGG CAAGAGCAAC TCGGTCGCCG CATACACTAT TCTCAGAATG AC - #TTGGTTGA4080- CGCGTCACCA GTCACAGAAA AGCATCTTAC GGATGGCATG ACAGTAAGAG AA - #TTATGCAG4140- TGCTGCCATA ACCATGAGTG ATAACACTGC GGCCAACTTA CTTCTGACAA CG - #ATCGGAGG4200- ACCGAAGGAG CTAACCGCTT TTTTGCACAA CATGGGGGAT CATGTAACTC GC - #CTTGATCG4260- TTGGGAACCG GAGCTGAATG AAGCCATACC AAACGACGAG CGTGACACCA CG - #ATGCCTGT4320- AGCAATGGCA ACAACGTTGC GCAAACTATT AACTGGCGAA CTACTTACTC TA - #GCTTCCCG4380- GCAACAATTA ATAGACTGGA TGGAGGCGGA TAAAGTTGCA GGACCACTTC TG - #CGCTCGGC4440- CCTTCCGGCT GGCTGGTTTA TTGCTGATAA ATCTGGAGCC GGTGAGCGTG GG - #TCTCGCGG4500- TATCATTGCA GCACTGGGGC CAGATGGTAA GCCCTCCCGT ATCGTAGTTA TC - #TACACGAC4560- GGGGAGTCAG GCAACTATGG ATGAACGAAA TAGACAGATC GCTGAGATAG GT - #GCCTCACT4620- GATTAAGCAT TGGTAACTGT CAGACCAAGT TTACTCATAT ATACTTTAGA TT - #GATTTAAA4680- ACTTCATTTT TAATTTAAAA GGATCTAGGT GAAGATCCTT TTTGATAATC TC - #ATGACCAA4740- AATCCCTTAA CGTGAGTTTT CGTTCCACTG AGCGTCAGAC CCCGTAGAAA AG - #ATCAAAGG4800- ATCTTCTTGA GATCCTTTTT TTCTGCGCGT AATCTGCTGC TTGCAAACAA AA - #AAACCACC4860- GCTACCAGCG GTGGTTTGTT TGCCGGATCA AGAGCTACCA ACTCTTTTTC CG - #AAGGTAAC4920- TGGCTTCAGC AGAGCGCAGA TACCAAATAC TGTCCTTCTA GTGTAGCCGT AG - #TTAGGCCA4980- CCACTTCAAG AACTCTGTAG CACCGCCTAC ATACCTCGCT CTGCTAATCC TG - #TTACCAGT5040- GGCTGCTGCC AGTGGCGATA AGTCGTGTCT TACCGGGTTG GACTCAAGAC GA - #TAGTTACC5100- GGATAAGGCG CAGCGGTCGG GCTGAACGGG GGGTTCGTGC ACACAGCCCA GC - #TTGGAGCG5160- AACGACCTAC ACCGAACTGA GATACCTACA GCGTGAGCTA TGAGAAAGCG CC - #ACGCTTCC5220- CGAAGGGAGA AAGGCGGACA GGTATCCGGT AAGCGGCAGG GTCGGAACAG GA - #GAGCGCAC5280- GAGGGAGCTT CCAGGGGGAA ACGCCTGGTA TCTTTATAGT CCTGTCGGGT TT - #CGCCACCT5340- CTGACTTGAG CGTCGATTTT TGTGATGCTC GTCAGGGGGG CGGAGCCTAT GG - #AAAAACGC5400- CAGCAACGCG GCCTTTTTAC GGTTCCTGGC CTTTTGCTGG CCTTTTGCTC AC - #ATGTTCTT5460- TCCTGCGTTA TCCCCTGATT CTGTGGATAA CCGTATTACC GCCTTTGAGT GA - #GCTGATAC5520- CGCTCGCCGC AGCCGAACGA CCGAGCGCAG CGAGTCAGTG AGCGAGGAAG CG - #GAAGAGAG5580- (2) INFORMATION FOR SEQ ID NO:11:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 5697 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- GCGCCCAATA CGCAAACCGC CTCTCCCCGC GCGTTGGCCG ATTCATTAAT GC - #AGCTGGCA  60- CGACAGGTTT CCCGACTGGA AAGCGGGCAG TGAGCGCAAC GCAATTAATG TG - #AGTTAGCT 120- CACTCATTAG GCACCCCAGG CTTTACACTT TATGCTTCCG GCTCGTATGT TG - #TGTGGAAT 180- TGTGAGCGGA TAACAATTTC ACACAGGAAA CAGCTATGAC CATGATTACG CC - #AAGCTTGC 240- ATGCCTGCAG GTCGACGCAT TCCGAATACG AGGCCTGATT AATGATTACA TA - #CGCCTCCG 300- GGTAGTAGAC CGAGCAGCCG AGCCAGTTCA GCGCCTAAAA CGCCTTATAC AA - #TTAAGCAG 360- TTAAAGAAGT TAGAATCTAC GCTTAAAAAG CTACTTAAAA ATCGATCTCG CA - #GTCCCGAT 420- TCGCCTATCA AAACCAGTTT AAATCAACTG ATTAAAGGTG CCGAACGAGC TA - #TAAATGAT 480- ATAACAATAT TAAAGCATTA ATTAGAGCAA TATCAGGCCG CGCACGAAAG GC - #AACTTAAA 540- AAGCGAAAGC GCTCTACTAA ACAGATTACT TTTGAAAAAG GCACATCAGT AT - #TTAAAGCC 600- CGAATCCTTA TTAAGCGCCG AAATCAGGCA GATAAAGCCA TACAGGCAGA TA - #GACCTCTA 660- CCTATTAAAT CGGCTTCTAG GCGCGCTCCA TCTAAATGTT CTGGCTGTGG TG - #TACAGGGG 720- CATAAAATTA CGCACTACCC GAATCGATAG AACTACTCAT TTTTATATAG AA - #GTCAGAAT 780- TCATAGTGTT TTGATCATTT TAAATTTTTA TATGGCGGGT GGTGGGCAAC TC - #GCTTGCGC 840- GGGCAACTCG CTTACCGATT ACGTTAGGGC TGATATTTAC GTGAAAATCG TC - #AAGGGATG 900- CAAGACCAAA GTAGTAAAAC CCCGGAAGTC AACAGCATCC AAGCCCAAGT CC - #TTCACGGA 960- GAAACCCCAG CGTCCACATC ACGAGCGAAG GACCACCTCT AGGCATCGGA CG - #CACCATCC1020- AATTAGAAGC AGCAAAGCGA AACAGCCCAA GAAAAAGGTC GGCCCGTCGG CC - #TTTTCTGC1080- AACGCTGATC ACGGGCAGCG ATCCAACCAA CACCCTCCAG AGTGACTAGG GG - #CGGAAATT1140- TAAAGGGATT AATTTCCACT CAACCACAAA TCACAGTCGT CCCCGGTATT GT - #CCTGCAGA1200- ATGCAATTTA AACTCTTCTG CGAATCGCTT GGATTCCCCG CCCCTAGTCG TA - #GAGCTTAA1260- AGTATGTCCC TTGTCGATGC GATGATACAC AACATATAAA TACTAGCAAG GG - #ATGCCATG1320- CTTGGAGGAT AGCAACCGAC AACATCACAT CAAGCTCTCC CTTCTCTGAA CA - #ATAAACCC1380- CACAGGGGGG ATCCACTAGT AACGGCCGCC AGTGTGCTGG AAAGCGACTT GA - #AACGCCCC1440- AAATGAAGTC CTCCATCCTC GCCAGCGTCT TCGCCACGGG CGCCGTGGCT CA - #AAGTGGTC1500- CGTGGCAGCA ATGTGGTGGC ATCGGATGGC AAGGATCGAC CGACTGTGTG TC - #GGGCTACC1560- ACTGCGTCTA CCAGAACGAT TGGTACAGCC AGTGCGCTAG CGTCCAGATC CC - #CTCCAGCA1620- GCACCAGCTC TCCGGTCAAC CAGCCTACCA GCACCAGCAC CACGTCCACC TC - #CACCACCT1680- CGAGCCCGCC AGTCCAGCCT ACGACTCCCA GCGCTAGCCC TCCTCGTCGA CC - #TGTCTCGC1740- AGGATCTGTT TAACCAGTTC AATCTCTTTG CACAGTATTC TGCAGCCGCA TA - #CTGCGGAA1800- AAAACAATGA TGCCCCAGCT GGTACAAACA TTACGTGCAC GGGAAATGCC TG - #CCCCGAGG1860- TAGAGAAGGC GGATGCAACG TTTCTCTACT CGTTTGAAGA CTCTGGAGTG GG - #CGATGTCA1920- CCGGCTTCCT TGCTCTCGAC AACACGAACA AATTGATCGT CCTCTCTTTC CG - #TGGCTCTC1980- GTTCCATAGA GAACTGGATC GGGAATCTTA AGTTCCTCTT GAAAAAAATA AA - #TGACATTT2040- GCTCCGGCTG CAGGGGACAT GACGGCTTCA CTTCGTCCTG GAGGTCTGTA GC - #CGATACGT2100- TAAGGCAGAA GGTGGAGGAT GCTGTGAGGG AGCATCCCGA CTATCGCGTG GT - #GTTTACCG2160- GACATAGCTT GGGTGGTGCA TTGGCAACTG TTGCCGGAGC AGACCTGCGT GG - #AAATGGGT2220- ATGATATCGA CGTGTTTTCA TATGGCGCCC CCCGAGTCGG AAACAGGGCT TT - #TGCAGAAT2280- TCCTGACCGT ACAGACCGGC GGAACACTCT ACCGCATTAC CCACACCAAT GA - #TATTGTCC2340- CTAGACTCCC GCCGCGCGAA TTCGGTTACA GCCATTCTAG CCCAGAATAC TG - #GATCAAAT2400- CTGGAACCCT TGTCCCCGTC ACCCGAAACG ATATCGTGAA GATAGAAGGC AT - #CGATGCCA2460- CCGGCGGCAA TAACCGGCCG AACATTCCGG ATATCCCTGC GCACCTATGG TA - #CTTCGGGT2520- TAATTGGGAC ATGTCTTTAG TGGCCGGCGC GGCTGGGTCG ACTCTAGCGA GC - #TCGAGATC2580- TAGAGGGTGA CTGACACCTG GCGGTAGACA ATCAATCCAT TTCGCTATAG TT - #AAAGGATG2640- GGGATGAGGG CAATTGGTTA TATGATCATG TATGTAGTGG GTGTGCATAA TA - #GTAGTGAA2700- ATGGAAGCCA AGTCATGTGA TTGTAATCGA CCGACGGAAT TGAGGATATC CG - #GAAATACA2760- GACACCGTGA AAGCCATGGT CTTTCCTTCG TGTAGAAGAC CAGACAGACA GT - #CCCTGATT2820- TACCCTTGCA CAAAGCACTA GAAAATTAGC ATTCCATCCT TCTCTGCTTG CT - #CTGCTGAT2880- ATCACTGTCA TTCAATGCAT AGCCATGAGC TCATCTTAGA TCCAAGCACG TA - #ATTCCATA2940- GCCGAGGTCC ACAGTGGAGC AGCAACATTC CCCATCATTG CTTTCCCCAG GG - #GCCTCCCA3000- ACGACTAAAT CAAGAGTATA TCTCTACCGT CCAATAGATC GTCTTCGCTT CA - #AAATCTTT3060- GACAATTCCA AGAGGGTCCC CATCCATCAA ACCCAGTTCA ATAATAGCCG AG - #ATGCATGG3120- TGGAGTCAAT TAGGCAGTAT TGCTGGAATG TCGGGCCAGT TGGCCCGGGT GG - #TCATTGGC3180- CGCCTGTGAT GCCATCTGCC ACTAAATCCG ATCATTGATC CACCGCCCAC GA - #GGCGCGTC3240- TTTGCTTTTT GCGCGGCGTC CAGGTTCAAC TCTCTCGCTC TAGATATCGA TG - #AATTCACT3300- GGCCGTCGTT TTACAACGTC GTGACTGGGA AAACCCTGGC GTTACCCAAC TT - #AATCGCCT3360- TGCAGCACAT CCCCCTTTCG CCAGCTGGCG TAATAGCGAA GAGGCCCGCA CC - #GATCGCCC3420- TTCCCAACAG TTGCGCAGCC TGAATGGCGA ATGGCGCCTG ATGCGGTATT TT - #CTCCTTAC3480- GCATCTGTGC GGTATTTCAC ACCGCATATG GTGCACTCTC AGTACAATCT GC - #TCTGATGC3540- CGCATAGTTA AGCCAGCCCC GACACCCGCC AACACCCGCT GACGCGCCCT GA - #CGGGCTTG3600- TCTGCTCCCG GCATCCGCTT ACAGACAAGC TGTGACCGTC TCCGGGAGCT GC - #ATGTGTCA3660- GAGGTTTTCA CCGTCATCAC CGAAACGCGC GAGACGAAAG GGCCTCGTGA TA - #CGCCTATT3720- TTTATAGGTT AATGTCATGA TAATAATGGT TTCTTAGACG TCAGGTGGCA CT - #TTTCGGGG3780- AAATGTGCGC GGAACCCCTA TTTGTTTATT TTTCTAAATA CATTCAAATA TG - #TATCCGCT3840- CATGAGACAA TAACCCTGAT AAATGCTTCA ATAATATTGA AAAAGGAAGA GT - #ATGAGTAT3900- TCAACATTTC CGTGTCGCCC TTATTCCCTT TTTTGCGGCA TTTTGCCTTC CT - #GTTTTTGC3960- TCACCCAGAA ACGCTGGTGA AAGTAAAAGA TGCTGAAGAT CAGTTGGGTG CA - #CGAGTGGG4020- TTACATCGAA CTGGATCTCA ACAGCGGTAA GATCCTTGAG AGTTTTCGCC CC - #GAAGAACG4080- TTTTCCAATG ATGAGCACTT TTAAAGTTCT GCTATGTGGC GCGGTATTAT CC - #CGTATTGA4140- CGCCGGGCAA GAGCAACTCG GTCGCCGCAT ACACTATTCT CAGAATGACT TG - #GTTGACGC4200- GTCACCAGTC ACAGAAAAGC ATCTTACGGA TGGCATGACA GTAAGAGAAT TA - #TGCAGTGC4260- TGCCATAACC ATGAGTGATA ACACTGCGGC CAACTTACTT CTGACAACGA TC - #GGAGGACC4320- GAAGGAGCTA ACCGCTTTTT TGCACAACAT GGGGGATCAT GTAACTCGCC TT - #GATCGTTG4380- GGAACCGGAG CTGAATGAAG CCATACCAAA CGACGAGCGT GACACCACGA TG - #CCTGTAGC4440- AATGGCAACA ACGTTGCGCA AACTATTAAC TGGCGAACTA CTTACTCTAG CT - #TCCCGGCA4500- ACAATTAATA GACTGGATGG AGGCGGATAA AGTTGCAGGA CCACTTCTGC GC - #TCGGCCCT4560- TCCGGCTGGC TGGTTTATTG CTGATAAATC TGGAGCCGGT GAGCGTGGGT CT - #CGCGGTAT4620- CATTGCAGCA CTGGGGCCAG ATGGTAAGCC CTCCCGTATC GTAGTTATCT AC - #ACGACGGG4680- GAGTCAGGCA ACTATGGATG AACGAAATAG ACAGATCGCT GAGATAGGTG CC - #TCACTGAT4740- TAAGCATTGG TAACTGTCAG ACCAAGTTTA CTCATATATA CTTTAGATTG AT - #TTAAAACT4800- TCATTTTTAA TTTAAAAGGA TCTAGGTGAA GATCCTTTTT GATAATCTCA TG - #ACCAAAAT4860- CCCTTAACGT GAGTTTTCGT TCCACTGAGC GTCAGACCCC GTAGAAAAGA TC - #AAAGGATC4920- TTCTTGAGAT CCTTTTTTTC TGCGCGTAAT CTGCTGCTTG CAAACAAAAA AA - #CCACCGCT4980- ACCAGCGGTG GTTTGTTTGC CGGATCAAGA GCTACCAACT CTTTTTCCGA AG - #GTAACTGG5040- CTTCAGCAGA GCGCAGATAC CAAATACTGT CCTTCTAGTG TAGCCGTAGT TA - #GGCCACCA5100- CTTCAAGAAC TCTGTAGCAC CGCCTACATA CCTCGCTCTG CTAATCCTGT TA - #CCAGTGGC5160- TGCTGCCAGT GGCGATAAGT CGTGTCTTAC CGGGTTGGAC TCAAGACGAT AG - #TTACCGGA5220- TAAGGCGCAG CGGTCGGGCT GAACGGGGGG TTCGTGCACA CAGCCCAGCT TG - #GAGCGAAC5280- GACCTACACC GAACTGAGAT ACCTACAGCG TGAGCTATGA GAAAGCGCCA CG - #CTTCCCGA5340- AGGGAGAAAG GCGGACAGGT ATCCGGTAAG CGGCAGGGTC GGAACAGGAG AG - #CGCACGAG5400- GGAGCTTCCA GGGGGAAACG CCTGGTATCT TTATAGTCCT GTCGGGTTTC GC - #CACCTCTG5460- ACTTGAGCGT CGATTTTTGT GATGCTCGTC AGGGGGGCGG AGCCTATGGA AA - #AACGCCAG5520- CAACGCGGCC TTTTTACGGT TCCTGGCCTT TTGCTGGCCT TTTGCTCACA TG - #TTCTTTCC5580- TGCGTTATCC CCTGATTCTG TGGATAACCG TATTACCGCC TTTGAGTGAG CT - #GATACCGC5640- TCGCCGCAGC CGAACGACCG AGCGCAGCGA GTCAGTGAGC GAGGAAGCGG AA - #GAGAG5697- (2) INFORMATION FOR SEQ ID NO:12:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 1620 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- GAGAAAAAAC TATAGGATCC ACTAGTAACG GCCGCCAGTG TGCTCTAAAG AC - #TATGAAGC  60- TCTCGCTTTT GTCCACCTTC GCTGCTGTCA TCATCGGTGC CCTCGCTCTA CC - #CCAGGGTT 120- GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GCAATGGCTG GAGCGGCTGC AC - #CACCTGCG 180- TCGCTGGCAG CACTTGCACG AAGATTAATG ACTGGTACCA TCAGTGCCTG CC - #CTCCAGCA 240- GCACCAGCTC TCCGGTCAAC CAGCCTACCA GCACCAGCAC CACGTCCACC TC - #CACCACCT 300- CGAGCCCGCC AGTCCAGCCT ACGACTCCCA GCGGCCAGGG TCCTGGAGGA GG - #CGGGTCAG 360- TCACTTGCCC CGGTGGACAG TCCACTTCGA ACAGCCAGTG CTGCGTCTGG TT - #CGACGTTC 420- TAGACGATCT TCAGACCAAC TTCTACCAAG GGTCCAAGTG TGAGAGCCCT GT - #TCGCAAGA 480- TTCTTAGAAT TGTTTTCCAT GACGCGATCG GATTTTCGCC GGCGTTGACT GC - #TGCTGGTC 540- AATTCGGTGG TGGAGGAGCT GATGGCTCCA TCATTGCGCA TTCGAACATC GA - #ATTGGCCT 600- TCCCGGCTAA TGGCGGCCTC ACCGACACCG TCGAAGCCCT CCGCGCGGTC GG - #TATCAACC 660- ACGGTGTCTC TTTCGGCGAT CTCATCCAAT TCGCCACTGC CGTCGGCATG TC - #CAACTGCC 720- CTGGCTCTCC CCGACTTGAG TTCTTGACGG GCAGGAGCAA CAGTTCCCAA CC - #CTCCCCTC 780- CTTCGTTGAT CCCCGGTCCC GGAAACACGG TCACCGCTAT CTTGGATCGT AT - #GGGCGATG 840- CAGGCTTCAG CCCTGATGAA GTAGTCGACT TGCTTGCTGC GCATAGTTTG GC - #TTCTCAGG 900- AGGGTTTGAA CTCGGCCATC TTCAGATCTC CTTTGGACTC GACCCCTCAA GT - #TTTCGATA 960- CCCAGTTCTA CATTGAGACC TTGCTCAAGG GTACCACTCA GCCTGGCCCT TC - #TCTCGGCT1020- TTGCAGAGGA GCTCTCCCCC TTCCCTGGCG AATTCCGCAT GAGGTCCGAT GC - #TCTCTTGG1080- CTCGCGACTC CCGAACCGCC TGCCGATGGC AATCCATGAC CAGCAGCAAT GA - #AGTTATGG1140- GCCAGCGATA CCGCGCCGCC ATGGCCAAGA TGTCTGTTCT CGGCTTCGAC AG - #GAACGCCC1200- TCACCGATTG CTCTGACGTT ATTCCTTCTG CTGTGTCCAA CAACGCTGCT CC - #TGTTATCC1260- CTGGTGGCCT TACTGTCGAT GATATCGAGG TTTCGTGCCC GAGCGAGCCT TT - #CCCTGAAA1320- TTGCTACCGC CTCAGGCCCT CTCCCCTCCC TCGCTCCTGC TCCTTGATCT GG - #TGAAGATG1380- GTACATCCTG CTCTCTCATC ATCCCTCTTA GCTATTTATC CAATCTATCT AC - #CTATCTAT1440- GCAGTTTCTG TTCTATCACC ACAGGAAGCA AGAAAGAAAA ACAACAATGC AA - #CGTGAGCA1500- GAAATCAGCA AAAAAATAAA TCAGTATACT ACAGTAATGA GGCCAGTTTG CG - #TGGTGTCA1560- GAAGTAAGTA CGACTCGGCT TTACACACTG GCGGCCGCTC GAGCATGCAT CT - #AGAGGGCC1620- (2) INFORMATION FOR SEQ ID NO:13:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 1620 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- GAGAAAAAAC TATAGGATCC ACTAGTAACG GCCGCCAGTG TGCTCTAAAG AC - #TATGAAGC  60- TCTCGCTTTT GTCCACCTTC GCTGCTGTCA TCATCGGTGC CCTCGCTCTA CC - #CCAAGGTT 120- GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GCAATGGCTG GAGCGGCTGC AC - #CACCTGCG 180- TCGCTGGCAG CACTTGCACG AAGATTAATG ACTGGTATCA TCAGTGCCTG CC - #CTCCAGCA 240- GCACCAGCTC TCCGGTCAAC CAGCCTACCA GCACCAGCAC CACGTCCACC TC - #CACCACCT 300- CGAGCCCGCC AGTCCAGCCT ACGACTCCGA GCGGTCAGGG TCCTGGAGGA GG - #CGGGTCAG 360- TCACTTGCCC CGGTGGACAG TCCACTTCGA ACAGCCAGTG CTGCGTCTGG TT - #CGACGTTC 420- TAGACGATCT TCAGACCAAC TTCTACCAAG GGTCCAAGTG TGAGAGCCCT GT - #TCGCAAGA 480- TTCTTAGAAT TGTTTTCCAT GACGCGATCG GATTTTCGCC GGCGTTGACT GC - #TGCTGGTC 540- AATTCGGTGG TGGAGGAGCT GATGGCTCCA TCATTGCGCA TTCGAACATC GA - #ATTGGCCT 600- TCCCGGCTAA TGGCGGCCTC ACCGACACCG TCGAAGCCCT CCGCGCGGTC GG - #TATCAACC 660- ACGGTGTCTC TTTCGGCGAT CTCATCCAAT TCGCCACTGC CGTCGGCATG TC - #CAACTGCC 720- CTGGCTCTCC CCGACTTGAG TTCTTGACGG GCAGGAGCAA CAGTTCCCAA CC - #CTCCCCTC 780- CTTCGTTGAT CCCCGGTCCC GGAAACACGG TCACCGCTAT CTTGGATCGT AT - #GGGCGATG 840- CAGGCTTCAG CCCTGATGAA GTAGTCGACT TGCTTGCTGC GCATAGTTTG GC - #TTCTCAGG 900- AGGGTTTGAA CTCGGCCATC TTCAGATCTC CTTTGGACTC GACCCCTCAA GT - #TTTCGATA 960- CCCAGTTCTA CATTGAGACC TTGCTCAAGG GTACCACTCA GCCTGGCCCT TC - #TCTCGGCT1020- TTGCAGAGGA GCTCTCCCCC TTCCCTGGCG AATTCCGCAT GAGGTCCGAT GC - #TCTCTTGG1080- CTCGCGACTC CCGAACCGCC TGCCGATGGC AATCCATGAC CAGCAGCAAT GA - #AGTTATGG1140- GCCAGCGATA CCGCGCCGCC ATGGCCAAGA TGTCTGTTCT CGGCTTCGAC AG - #GAACGCCC1200- TCACCGATTG CTCTGACGTT ATTCCTTCTG CTGTGTCCAA CAACGCTGCT CC - #TGTTATCC1260- CTGGTGGCCT TACTGTCGAT GATATCGAGG TTTCGTGCCC GAGCGAGCCT TT - #CCCTGAAA1320- TTGCTACCGC CTCAGGCCCT CTCCCCTCCC TCGCTCCTGC TCCTTGATCT GG - #TGAAGATG1380- GTACATCCTG CTCTCTCATC ATCCCTCTTA GCTATTTATC CAATCTATCT AC - #CTATCTAT1440- GCAGTTTCTG TTCTATCACC ACAGGAAGCA AGAAAGAAAA ACAACAATGC AA - #CGTGAGCA1500- GAAATCAGCA AAAAAATAAA TCAGTATACT ACAGTAATGA GGCCAGTTTG CG - #TGGTGTCA1560- GAAGTAAGTA CGACTCGGCT TTACACACTG GCGGCCGCTC GAGCATGCAT CT - #AGAGGGCC1620- (2) INFORMATION FOR SEQ ID NO:14:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 480 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- GAGAAAAAAC TATAGGATCC ACTAGTAACG GCCGCCAGTG TGCTCTAAAG AC - #TATGAAGC  60- TCTCGCTTTT GTCCACCTTC GCTGCTGTCA TCATCGGTGC CCTCGCTCTA CC - #CCAAGGTT 120- GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GCAATGGCTG GAGCGGCTGC AC - #CACCTGCG 180- TCGCTGGCAG CACTTGCACG AAGATTAATG ACTGGTACCA TCAGTGCCTG CC - #CTCCTCCA 240- GCACCAGCTC TCCGGTCAAC CAGCCTACCA GCACCAGCTC CAGCCCTCCA GT - #CCAGCCTA 300- CGACTCCTAG CGGACAAGGT CCTGGAGGAG GCGGGTCAGT CACTTGCCCC GG - #TGGACAGT 360- CCACTTCGAA CAGCCAGTGC TGCGTCTGGT TCGACGTTCT AGACGATCTT CA - #GACCAACT 420- TCTACCAAGG GTCCAAGTGT GAGAGCCCTG TTCGCAAGAT TCTTAGAATT GT - #TTTCCATG 480- (2) INFORMATION FOR SEQ ID NO:15:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 480 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- GAGAAAAAAC TATAGGATCC ACTAGTAACG GCCGCCAGTG TGCTCTAAAG AC - #TATGAAGC  60- TCTCGCTTTT GTCCACCTTC GCTGCTGTCA TCATCGGTGC CCTCGCTCTA CC - #CCAAGGTT 120- GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GCAATGGCTG GAGCGGCTGC AC - #CACCTGCG 180- TCGCTGGCAG CACTTGCACG AAGATTAATG ACTGGTACCA TCAGTGCCTC GC - #CCCCGTCG 240- TCGCCCCCGC CCCCGCCCCC GCCCCCCAAG GTCCTGGAGG AGGCGGGTCA GT - #CACTTGCC 300- CCGGTGGACA GTCCACTTCG AACAGCCAGT GCTGCGTCTG GTTCGACGTT CT - #AGACGATC 360- TTCAGACCAA CTTCTACCAA GGGTCCAAGT GTGAGAGCCC TGTTCGCAAG AT - #TCTTAGAA 420- TTGTTTTCCA TGACGCGATC GGATTTTCGC CGGCGTTGAC TGCTGCTGGT CA - #ATTCGGTG 480- (2) INFORMATION FOR SEQ ID NO:16:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 480 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- GAGAAAAAAC TATAGGATCC ACTAGTAACG GCCGCCAGTG TGCTCTAAAG AC - #TATGAAGC  60- TCTCGCTTTT GTCCACCTTC GCTGCTGTCA TCATCGGTGC CCTCGCTCTA CC - #CCAAGGTT 120- GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GCAATGGCTG GAGCGGCTGC AC - #CACCTGCG 180- TCGCTGGCAG CACTTGCACG AAGATTAATG ACTGGTACCA TCAGTGCCTG CA - #AGCCCCCC 240- AACAGAGCCC CCGCATCGAA CGTCCACGCG CTCAGGGTCC TGGAGGAGGC GG - #GTCAGTCA 300- CTTGCCCCGG TGGACAGTCC ACTTCGAACA GCCAGTGCTG CGTCTGGTTC GA - #CGTTCTAG 360- ACGATCTTCA GACCAACTTC TACCAAGGGT CCAAGTGTGA GAGCCCTGTT CG - #CAAGATTC 420- TTAGAATTGT TTTCCATGAC GCGATCGGAT TTTCGCCGGC GTTGACTGCT GC - #TGGTCAAT 480- (2) INFORMATION FOR SEQ ID NO:17:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 2279 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- CTGGGGTAAT TAATCAGCGA AGCGATGATT TTTGATCTAT TAACAGATAT AT - #AAATGCAA  60- AAACTGCATA ACCACTTTAA CTAATACTTT CAACATTTTC GGTTTGTATT AC - #TTCTTATT 120- CAAATGTAAT AAAAGTATCA ACAAAAAATT GTTAATATAC CTCTATACTT TA - #ACGTCAAG 180- GAGAAAAAAC TATAGGATCC ACTAGTAACG GCCGCCAGTG TGCTCTAAAG AC - #TATGAAGC 240- TCTCGCTTTT GTCCACCTTC GCTGCTGTCA TCATCGGTGC CCTCGCTCTA CC - #CCAGGGTT 300- GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GCAATGGCTG GAGCGGCTGC AC - #CACCTGCG 360- TCGCTGGCAG CACTTGCACG AAGATTAATG ACTGGTACCA TCAGTGCCTG CA - #AGCCCCCC 420- AACAGAGCCC CCGCATCGAA CGTCCACGCG CTCAGCAGAG CTGCAACACC CC - #CAGCAACC 480- GGGCGTGCTG GACTGACGGA TACGACATCA ACACCGACTA CGAAGTGGAC AG - #CCCGGACA 540- CGGGTGTTGT TCGGCCTTAT ACTCTGACTC TCACCGAAGT CGACAACTGG AC - #CGGACCTG 600- ATGGCGTCGT CAAGGAGAAG GTCATGCTGG TTAACAATAG TATAATCGGA CC - #AACAATCT 660- TTGCGGACTG GGGCGACACG ATCCAGGTAA CGGTCATCAA CAACCTCGAG AC - #CAACGGCA 720- CGTCGATCCA CTGGCACGGA CTGCACCAGA AGGGCACCAA CCTGCACGAC GG - #CGCCAACG 780- GTATCACCGA GTGCCCGATC CCGCCCAAGG GAGGGAGGAA GGTGTACCGG TT - #CAAGGCTC 840- AGCAGTACGG GACGAGCTGG TACCACTCGC ACTTCTCGGC CCAGTACGGC AA - #CGGCGTGG 900- TCGGGGCCAT TCAGATCAAC GGGCCGGCCT CGCTGCCGTA CGACACCGAC CT - #GGGCGTGT 960- TCCCCATCAG CGACTACTAC TACAGCTCGG CCGACGAGCT GGTGGAACTC AC - #CAAGAACT1020- CGGGCGCGCC CTTCAGCGAC AACGTCCTGT TCAACGGCAC GGCCAAGCAC CC - #GGAGACGG1080- GCGAGGGCGA GTACGCCAAC GTGACGCTCA CCCCGGGCCG GCGGCACCGC CT - #GCGCCTGA1140- TCAACACGTC GGTCGAGAAC CACTTCCAGG TCTCGCTCGT CAACCACACC AT - #GACCATCA1200- TCGCCGCCGA CATGGTGCCC GTCAACGCCA TGACGGTCGA CAGCCTCTTC CT - #CGGCGTCG1260- GCCAGCGCTA CGATGTCGTC ATCGAAGCCA GCCGAACGCC CGGGAACTAC TG - #GTTTAACG1320- TCACATTTGG CGGCGGCCTG CTCTGCGGCG GCTCCAGGAA TCCCTACCCG GC - #CGCCATCT1380- TCCACTACGC CGGCGCCCCC GGCGGCCCGC CCACGGACGA GGGCAAGGCC CC - #GGTCGACC1440- ACAACTGCCT GGACCTCCCC AACCTCAAGC CCGTCGTGGC CCGCGACGTG CC - #CCTGAGCG1500- GCTTCGCCAA GCGGCCCGAC AACACGCTCG ACGTCACCCT CGACACCACG GG - #CACGCCCC1560- TGTTCGTCTG GAAGGTCAAC GGCAGCGCCA TCAACATCGA CTGGGGCAGG CC - #CGTCGTCG1620- ACTACGTCCT CACGCAGAAC ACCAGCTTCC CACCCGGGTA CAACATTGTC GA - #GGTGAACG1680- GAGCTGATCA GTGGTCGTAC TGGTTGATCG AGAATGATCC CGGCGCACCT TT - #CACCCTAC1740- CGCATCCGAT GCACCTGCAC GGCCACGACT TTTACGTGCT GGGCCGCTCG CC - #CGACGAGT1800- CGCCGGCATC CAACGAGCGG CACGTGTTCG ATCCGGCGCG GGACGCGGGC CT - #GCTGAGCG1860- GGGCCAACCC TGTGCGGCGG GACGTGACGA TGCTGCCGGC GTTCGGGTGG GT - #GGTGCTGG1920- CCTTCCGGGC CGACAACCCG GGCGCCTGGC TGTTCCACTG CCACATCGCC TG - #GCACGTCT1980- CGGGCGGCCT GGGCGTCGTC TACCTCGAGC GCGCCGACGA CCTGCGCGGG GC - #CGTCTCGG2040- ACGCCGACGC CGACGACCTC GACCGCCTCT GCGCCGACTG GCGCCGCTAC TG - #GCCTACCA2100- ACCCCTACCC CAAGTCCGAC TCGGGCCTCA AGCACCGCTG GGTCGAGGAG GG - #CGAGTGGC2160- TGGTCAAGGC GTGAGCGAAG GAGGAAAAAG GCGGCCGCAT AGTATAGGCC GC - #TCGAGCAT2220- GCATCTAGAG GGCCGCATCA TGTAATTAGT TATGTCACGC TTACATTCAC GC - #CCTCCCC2279- (2) INFORMATION FOR SEQ ID NO:18:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 2300 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- CTGGGGTAAT TAATCAGCGA AGCGATGATT TTTGATCTAT TAACAGATAT AT - #AAATGCAA  60- AAACTGCATA ACCACTTTAA CTAATACTTT CAACATTTTC GGTTTGTATT AC - #TTCTTATT 120- CAAATGTAAT AAAAGTATCA ACAAAAAATT GTTAATATAC CTCTATACTT TA - #ACGTCAAG 180- GAGAAAAAAC TATAGGATCC CCAACATGAG GTCCTTCATC AGCGCCGCGA CG - #CTTTTGGT 240- GGGCATTCTC ACCCCTAGCG TTGCTGCTGC CCCTCCATCC ACCCCTGAGC AG - #CGCGACCT 300- GCTCGTCCCG ATCACGGAGA GGGAGGAGGC AGCCGTGAAG GCTCGCCAGC AG - #AGCTGCAA 360- CACCCCCAGC AACCGGGCGT GCTGGACTGA CGGATACGAC ATCAACACCG AC - #TACGAAGT 420- GGACAGCCCG GACACGGGTG TTGTTCGGCC TTATACTCTG ACTCTCACCG AA - #GTCGACAA 480- CTGGACCGGA CCTGATGGCG TCGTCAAGGA GAAGGTCATG CTGGTTAACA AT - #AGTATAAT 540- CGGACCAACA ATCTTTGCGG ACTGGGGCGA CACGATCCAG GTAACGGTCA TC - #AACAACCT 600- CGAGACCAAC GGCACGTCGA TCCACTGGCA CGGACTGCAC CAGAAGGGCA CC - #AACCTGCA 660- CGACGGCGCC AACGGTATCA CCGAGTGCCC GATCCCGCCC AAGGGAGGGA GG - #AAGGTGTA 720- CCGGTTCAAG GCTCAGCAGT ACGGGACGAG CTGGTACCAC TCGCACTTCT CG - #GCCCAGTA 780- CGGCAACGGC GTGGTCGGGG CCATTCAGAT CAACGGGCCG GCCTCGCTGC CG - #TACGACAC 840- CGACCTGGGC GTGTTCCCCA TCAGCGACTA CTACTACAGC TCGGCCGACG AG - #CTGGTGGA 900- ACTCACCAAG AACTCGGGCG CGCCCTTCAG CGACAACGTC CTGTTCAACG GC - #ACGGCCAA 960- GCACCCGGAG ACGGGCGAGG GCGAGTACGC CAACGTGACG CTCACCCCGG GC - #CGGCGGCA1020- CCGCCTGCGC CTGATCAACA CGTCGGTCGA GAACCACTTC CAGGTCTCGC TC - #GTCAACCA1080- CACCATGACC ATCATCGCCG CCGACATGGT GCCCGTCAAC GCCATGACGG TC - #GACAGCCT1140- CTTCCTCGGC GTCGGCCAGC GCTACGATGT CGTCATCGAA GCCAGCCGAA CG - #CCCGGGAA1200- CTACTGGTTT AACGTCACAT TTGGCGGCGG CCTGCTCTGC GGCGGCTCCA GG - #AATCCCTA1260- CCCGGCCGCC ATCTTCCACT ACGCCGGCGC CCCCGGCGGC CCGCCCACGG AC - #GAGGGCAA1320- GGCCCCGGTC GACCACAACT GCCTGGACCT CCCCAACCTC AAGCCCGTCG TG - #GCCCGCGA1380- CGTGCCCCTG AGCGGCTTCG CCAAGCGGCC CGACAACACG CTCGACGTCA CC - #CTCGACAC1440- CACGGGCACG CCCCTGTTCG TCTGGAAGGT CAACGGCAGC GCCATCAACA TC - #GACTGGGG1500- CAGGCCCGTC GTCGACTACG TCCTCACGCA GAACACCAGC TTCCCACCCG GG - #TACAACAT1560- TGTCGAGGTG AACGGAGCTG ATCAGTGGTC GTACTGGTTG ATCGAGAATG AT - #CCCGGCGC1620- ACCTTTCACC CTACCGCATC CGATGCACCT GCACGGCCAC GACTTTTACG TG - #CTGGGCCG1680- CTCGCCCGAC GAGTCGCCGG CATCCAACGA GCGGCACGTG TTCGATCCGG CG - #CGGGACGC1740- GGGCCTGCTG AGCGGGGCCA ACCCTGTGCG GCGGGACGTG ACGATGCTGC CG - #GCGTTCGG1800- GTGGGTGGTG CTGGCCTTCC GGGCCGACAA CCCGGGCGCC TGGCTGTTCC AC - #TGCCACAT1860- CGCCTGGCAC GTCTCGGGCG GCCTGGGCGT CGTCTACCTC GAGCGCGCCG AC - #GACCTGCG1920- CGGGGCCGTC TCGGACGCCG ACGCCGACGA CCTCGACCGC CTCTGCGCCG AC - #TGGCGCCG1980- CTACTGGCCT ACCAACCCCT ACCCCAAGTC CGACTCGGGC CTCAAGCACC GC - #TGGGTCGA2040- GGAGGGCGAG TGGCTGGTCA AGGCGCCCTC CAGCAGCACC AGCTCTCCGG TC - #AACCAGCC2100- TACCAGCACC AGCACCACGT CCACCTCCAC CACCTCGAGC CCGCCAGTCC AG - #CCTACGAC2160- TCCCAGCGGC TGCACTGCTG AGAGGTGGGC TCAGTGCGGC GGCAATGGCT GG - #AGCGGCTG2220- CACCACCTGC GTCGCTGGCA GCACTTGCAC GAAGATTAAT GACTGGTACC AT - #CAGTGCCT2280#                 230 - #0- (2) INFORMATION FOR SEQ ID NO:19:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 2249 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- CTGGGGTAAT TAATCAGCGA AGCGATGATT TTTGATCTAT TAACAGATAT AT - #AAATGCAA  60- AAACTGCATA ACCACTTTAA CTAATACTTT CAACATTTTC GGTTTGTATT AC - #TTCTTATT 120- CAAATGTAAT AAAAGTATCA ACAAAAAATT GTTAATATAC CTCTATACTT TA - #ACGTCAAG 180- GAGAAAAAAC TATAGGATCC CCAACATGAG GTCCTTCATC AGCGCCGCGA CG - #CTTTTGGT 240- GGGCATTCTC ACCCCTAGCG TTGCTGCTGC CCCTCCATCC ACCCCTGAGC AG - #CGCGACCT 300- GCTCGTCCCG ATCACGGAGA GGGAGGAGGC AGCCGTGAAG GCTCGCCAGC AG - #AGCTGCAA 360- CACCCCCAGC AACCGGGCGT GCTGGACTGA CGGATACGAC ATCAACACCG AC - #TACGAAGT 420- GGACAGCCCG GACACGGGTG TTGTTCGGCC TTATACTCTG ACTCTCACCG AA - #GTCGACAA 480- CTGGACCGGA CCTGATGGCG TCGTCAAGGA GAAGGTCATG CTGGTTAACA AT - #AGTATAAT 540- CGGACCAACA ATCTTTGCGG ACTGGGGCGA CACGATCCAG GTAACGGTCA TC - #AACAACCT 600- CGAGACCAAC GGCACGTCGA TCCACTGGCA CGGACTGCAC CAGAAGGGCA CC - #AACCTGCA 660- CGACGGCGCC AACGGTATCA CCGAGTGCCC GATCCCGCCC AAGGGAGGGA GG - #AAGGTGTA 720- CCGGTTCAAG GCTCAGCAGT ACGGGACGAG CTGGTACCAC TCGCACTTCT CG - #GCCCAGTA 780- CGGCAACGGC GTGGTCGGGG CCATTCAGAT CAACGGGCCG GCCTCGCTGC CG - #TACGACAC 840- CGACCTGGGC GTGTTCCCCA TCAGCGACTA CTACTACAGC TCGGCCGACG AG - #CTGGTGGA 900- ACTCACCAAG AACTCGGGCG CGCCCTTCAG CGACAACGTC CTGTTCAACG GC - #ACGGCCAA 960- GCACCCGGAG ACGGGCGAGG GCGAGTACGC CAACGTGACG CTCACCCCGG GC - #CGGCGGCA1020- CCGCCTGCGC CTGATCAACA CGTCGGTCGA GAACCACTTC CAGGTCTCGC TC - #GTCAACCA1080- CACCATGACC ATCATCGCCG CCGACATGGT GCCCGTCAAC GCCATGACGG TC - #GACAGCCT1140- CTTCCTCGGC GTCGGCCAGC GCTACGATGT CGTCATCGAA GCCAGCCGAA CG - #CCCGGGAA1200- CTACTGGTTT AACGTCACAT TTGGCGGCGG CCTGCTCTGC GGCGGCTCCA GG - #AATCCCTA1260- CCCGGCCGCC ATCTTCCACT ACGCCGGCGC CCCCGGCGGC CCGCCCACGG AC - #GAGGGCAA1320- GGCCCCGGTC GACCACAACT GCCTGGACCT CCCCAACCTC AAGCCCGTCG TG - #GCCCGCGA1380- CGTGCCCCTG AGCGGCTTCG CCAAGCGGCC CGACAACACG CTCGACGTCA CC - #CTCGACAC1440- CACGGGCACG CCCCTGTTCG TCTGGAAGGT CAACGGCAGC GCCATCAACA TC - #GACTGGGG1500- CAGGCCCGTC GTCGACTACG TCCTCACGCA GAACACCAGC TTCCCACCCG GG - #TACAACAT1560- TGTCGAGGTG AACGGAGCTG ATCAGTGGTC GTACTGGTTG ATCGAGAATG AT - #CCCGGCGC1620- ACCTTTCACC CTACCGCATC CGATGCACCT GCACGGCCAC GACTTTTACG TG - #CTGGGCCG1680- CTCGCCCGAC GAGTCGCCGG CATCCAACGA GCGGCACGTG TTCGATCCGG CG - #CGGGACGC1740- GGGCCTGCTG AGCGGGGCCA ACCCTGTGCG GCGGGACGTG ACGATGCTGC CG - #GCGTTCGG1800- GTGGGTGGTG CTGGCCTTCC GGGCCGACAA CCCGGGCGCC TGGCTGTTCC AC - #TGCCACAT1860- CGCCTGGCAC GTCTCGGGCG GCCTGGGCGT CGTCTACCTC GAGCGCGCCG AC - #GACCTGCG1920- CGGGGCCGTC TCGGACGCCG ACGCCGACGA CCTCGACCGC CTCTGCGCCG AC - #TGGCGCCG1980- CTACTGGCCT ACCAACCCCT ACCCCAAGTC CGACCCCTCC AGCAGCACCA GC - #TCTCCGGT2040- CAACCAGCCT ACCAGCACCA GCACCACGTC CACCTCCACC ACCTCGAGCC CG - #CCAGTCCA2100- GCCTACGACT CCCAGCGGCT GCACTGCTGA GAGGTGGGCT CAGTGCGGCG GC - #AATGGCTG2160- GAGCGGCTGC ACCACCTGCG TCGCTGGCAG CACTTGCACG AAGATTAATG AC - #TGGTACCA2220#          2249    GCCG CATTCTTAT- (2) INFORMATION FOR SEQ ID NO:20:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 25 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:#               25 CTGA CGCTG- (2) INFORMATION FOR SEQ ID NO:21:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 51 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:#             51CGGCCGC CTATCTTTGA ACATAAATTG AAACGGATCC G- (2) INFORMATION FOR SEQ ID NO:22:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 68 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- GCTGCAGGAT CCGTTTCAAT TTATGTTCAA AGATCTGGCG GACCTGGAAC GC - #CAAATAAT  60#          68- (2) INFORMATION FOR SEQ ID NO:23:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 46 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:#                 46GCT ACCAGTCAAC ATTAACAGGA CCTGAG- (2) INFORMATION FOR SEQ ID NO:24:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 71 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- GTAGGCTCAG TCATATGTTA CACATTGAAA GGGGAGGAGA ATCATGAAAA AG - #ATAACTAC  60#       71- (2) INFORMATION FOR SEQ ID NO:25:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 51 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:#             51ACCAAGC GGCCGCTTAA TTGAGTGGTT CCCACGGACC G- (2) INFORMATION FOR SEQ ID NO:26:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 64 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- GCTGCAGGAT CCGTTTCAAT TTATGTTCAA AGATCTCCTG GAGAGTATCC AG - #CATGGGAC  60#             64- (2) INFORMATION FOR SEQ ID NO:27:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 42 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:#  42              GCTA ATTGAGTGGT TCCCACGGAC CG- (2) INFORMATION FOR SEQ ID NO:28:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 21 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:#21                CCGT C- (2) INFORMATION FOR SEQ ID NO:29:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 57 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- TGCACTGGTA CAGTTCCTAC AACTAGTCCT ACACGTGCAA ATCTTAATGG GA - #CGCTG  57- (2) INFORMATION FOR SEQ ID NO:30:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 60 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- CTGCCTCATT CTGCAGCAGC GGCGGCAAAT CTTAATGCTC CCGGCTGCCG CG - #TCGACTAC  60- (2) INFORMATION FOR SEQ ID NO:31:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 37 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:#      37          GTGC ACGTGGTGCC GTTGAGC- (2) INFORMATION FOR SEQ ID NO:32:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 30 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:#           30     AGGC GAGGTGGTGG- (2) INFORMATION FOR SEQ ID NO:33:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 21 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: cDNA-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:#21                TCCT C- (2) INFORMATION FOR SEQ ID NO:34:-      (i) SEQUENCE CHARACTERISTICS:#acids    (A) LENGTH: 26 amino     (B) TYPE: amino acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:- Asn Asn Asn Pro Gln Gln Gly Asn Pro Asn Gl - #n Gly Gly Asn Asn Gly#                15- Gly Gly Asn Gln Gly Gly Gly Asn Gly Gly#            25- (2) INFORMATION FOR SEQ ID NO:35:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 60 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- GATCTAGCTA GCAACAATAA CCCCCAGCAG GGCAACCCCA ACCAGGGCGG GA - #ACAACGGC  60- (2) INFORMATION FOR SEQ ID NO:36:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 60 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: cDNA-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- GATCTAGCTA GCGCCGCCGT TGCCGCCGCC CTGGTTGCCG CCGCCGTTGT TC - #CCGCCCTG  60- (2) INFORMATION FOR SEQ ID NO:37:-      (i) SEQUENCE CHARACTERISTICS:#acids    (A) LENGTH: 37 amino     (B) TYPE: amino acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:- Val Gln Ile Pro Ser Ser Ser Thr Ser Ser Pr - #o Val Asn Gln Pro Thr#                15- Ser Thr Ser Thr Thr Ser Thr Ser Thr Thr Se - #r Ser Pro Pro Val Gln#            30- Pro Thr Thr Pro Ser   35- (2) INFORMATION FOR SEQ ID NO:38:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 30 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:#           30     AGAT CCCCTCCAGC- (2) INFORMATION FOR SEQ ID NO:39:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 30 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:#           30     GGAG TCGTAGGCTG- (2) INFORMATION FOR SEQ ID NO:40:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 29 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:#            29    ATTC CGCATGAGG- (2) INFORMATION FOR SEQ ID NO:41:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 28 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:#             28   AGGG CACCGATG- (2) INFORMATION FOR SEQ ID NO:42:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:# 20               GGGC- (2) INFORMATION FOR SEQ ID NO:43:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:# 20               CAGT- (2) INFORMATION FOR SEQ ID NO:44:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 21 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:#21                GCTC T- (2) INFORMATION FOR SEQ ID NO:45:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 36 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:#       36         CCGC TCGGAGTCGT AGGCTG- (2) INFORMATION FOR SEQ ID NO:46:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 37 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:#      37          CAGG GTCCTGGAGG AGGCGGG- (2) INFORMATION FOR SEQ ID NO:47:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 19 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:# 19               AAG- (2) INFORMATION FOR SEQ ID NO:48:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 27 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:#             27   GCGA AGCGATG- (2) INFORMATION FOR SEQ ID NO:49:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 20               ATGC- (2) INFORMATION FOR SEQ ID NO:50:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 23 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:#                23CCCC CAG- (2) INFORMATION FOR SEQ ID NO:51:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 20 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:# 20               TAAG- (2) INFORMATION FOR SEQ ID NO:52:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 27 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:#             27   GCGA AGCGATG- (2) INFORMATION FOR SEQ ID NO:53:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 28 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:#             28   TCGC CCTCCTCG- (2) INFORMATION FOR SEQ ID NO:54:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 22 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:#                 22CTC TC- (2) INFORMATION FOR SEQ ID NO:55:-      (i) SEQUENCE CHARACTERISTICS:#pairs    (A) LENGTH: 39 base     (B) TYPE: nucleic acid     (C) STRANDEDNESS: single     (D) TOPOLOGY: linear-     (ii) MOLECULE TYPE: cDNA-     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:#    39            CTAC AGGCACTGAT GGTACCAGT__________________________________________________________________________
Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US5525193 *Oct 26, 1994Jun 11, 1996Novo Nordisk A/SUse of monocomponent cellulase for removing inks, coatings, and toners from printed paper
US5536655 *Jul 15, 1994Jul 16, 1996Midwest Research InstituteGene coding for the E1 endoglucanase
US5578489 *Nov 24, 1992Nov 26, 1996Novo Nordisk A/SRemoval of hydrophobic esters from textiles
WO1990000609A1 *Jun 28, 1989Jan 25, 1990Univ British ColumbiaCellulose binding fusion proteins
WO1991010732A1 *Jan 18, 1991Jul 25, 1991Novo Nordisk AsAn enzyme exhibiting cellulase activity
WO1991017244A1 *May 8, 1991Nov 14, 1991Novo Nordisk AsAn enzyme capable of degrading cellulose or hemicellulose
WO1993005226A1 *Aug 28, 1992Mar 18, 1993Univ British ColumbiaMethod for modification of polysaccharide fibres
WO1993011249A1 *Dec 2, 1992Jun 10, 1993Novo Nordisk AsA method of cloning proteins in yeast and cellulase from humicola insolens
WO1994007998A1 *Oct 6, 1993Apr 14, 1994Novo Nordisk AsCellulase variants
WO1994024158A1 *Apr 14, 1994Oct 27, 1994Univ CaliforniaCellulose binding domain
WO1995016782A1 *Dec 19, 1994Jun 22, 1995Genencor IntNovel cellulase enzymes and systems for their expression
WO1996013524A1 *Oct 26, 1995May 9, 1996Edward A BayerModified cellulose-binding domain (cbd) proteins and use thereof
WO1997028243A1 *Jan 29, 1997Aug 7, 1997Novo Nordisk AsProcess for removal or bleaching of soiling or stains from cellulosic fabric
WO1997028256A1 *Jan 29, 1997Aug 7, 1997Novo Nordisk AsProcess for desizing cellulosic fabric
Non-Patent Citations
Reference
1 *Chalfie et al. (1994) Science 263:802 805.
2Chalfie et al. (1994) Science 263:802-805.
3 *Greenwood, J.M., et al., Biotechnology & Bioengineering, accession No. 11434006, vol. 44 (11), pp. 1295 1305 (1994).
4Greenwood, J.M., et al., Biotechnology & Bioengineering, accession No. 11434006, vol. 44 (11), pp. 1295-1305 (1994).
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6596679 *Jul 26, 2000Jul 22, 2003Unilever Home & Personal Care Usa Division Of Conopco, Inc.Bleaching detergent compositions
US6617143 *Oct 13, 2000Sep 9, 2003Novozymes A/SPolypeptides having glucanotransferase activity and nucleic acids encoding same
US7153818Jul 19, 2001Dec 26, 2006Henkel KgaaAmylolytic enzyme extracted from bacillus sp. A 7-7 (DSM 12368) and washing and cleaning agents containing this novel amylolytic enzyme
US7279315Jul 14, 2003Oct 9, 2007Novozymes A/SPolypeptides having glucanotransferase activity and nucleic acids encoding same
US7713723Dec 22, 2009May 11, 2010Novozymes A/SAlpha-amylase mutants with altered properties
US7741089Aug 11, 2004Jun 22, 2010Verenium CorporationLaccases, nucleic acids encoding them and methods for making and using them
US7803604Oct 22, 2007Sep 28, 2010Henkel Ag & Co. KgaaAmylolytic enzyme extracted from Bacillus sp. A 7-7 (DSM 12368) and washing and cleaning agents containing this novel amylolytic enzyme
US7981654 *Apr 15, 2010Jul 19, 2011Ab Enzymes OyCellulases and their uses
US8097442Apr 21, 2010Jan 17, 2012Verenium CorporationLaccases, nucleic acids encoding them and methods for making and using them
US8377670Aug 31, 2007Feb 19, 2013Verenium CorporationLaccases for bio-bleaching
US8670962Nov 20, 2012Mar 11, 2014Rockwell Automation Technologies, Inc.Process simulation utilizing component-specific consumption data
US8679825 *Sep 27, 2010Mar 25, 2014Toyota Motor Engineering & Manufacturing North America, Inc.Method facilitating removal of bioorganic stains from surfaces
US8738190 *Jan 8, 2010May 27, 2014Rockwell Automation Technologies, Inc.Industrial control energy object
US8892540Apr 24, 2009Nov 18, 2014Rockwell Automation Technologies, Inc.Dynamic sustainability search engine
US8951766Jan 18, 2013Feb 10, 2015Basf Enzymes LlcLaccases for bio-bleaching
US20040102349 *Jul 19, 2001May 27, 2004Roland BrevesNovel amylolytic enzyme extracted from bacillus sp.a 7-7 (dsm 12368) and washing and cleaning agents containing this novel amylolytic enzyme
US20050054752 *Sep 7, 2004Mar 10, 2005O'brien John P.Peptide-based diblock and triblock dispersants and diblock polymers
US20050074769 *Jul 14, 2003Apr 7, 2005Novozymes A/SPolypeptides having glucanotransferase activity and nucleic acids encoding same
US20110076738 *Sep 27, 2010Mar 31, 2011Toyota Motor Engineering & Manufacturing North America, IncSolvent-borne polymeric bioactive coatings for the facilitated removal of bioorganic stains
US20110172838 *Jul 14, 2011Rockwell Automation Technologies, Inc.Industrial control energy object
CN101631854BAug 31, 2007Aug 29, 2012巴斯夫欧洲公司Laccases for pulp bio-bleaching
EP2434008A1 *Aug 31, 2007Mar 28, 2012Verenium CorporationLaccases for pulp bio-bleaching
WO2005021714A2 *Aug 11, 2004Mar 10, 2005Diversa CorpLaccases, nucleic acids encoding them and methods for making and using them
WO2008027501A2 *Aug 31, 2007Mar 6, 2008Verenium CorpLaccases for pulp bio-bleaching
Classifications
U.S. Classification510/392
International ClassificationC07K19/00, C12N9/00, C11D3/386, C12N9/28, C12N9/20, C12N9/08, C12N9/42, C12N9/02
Cooperative ClassificationC12N9/2437, C12Y302/01004, C12N9/0065, C11D3/386, C12N9/20, C12N9/2417, C07K2319/00, C12N9/0061
European ClassificationC12N9/24A2B1A2, C12N9/00P22C2, C12N9/00P24, C12N9/24A2D, C12N9/20, C11D3/386
Legal Events
DateCodeEventDescription
Jul 14, 1997ASAssignment
Owner name: NOVO NORDISK A/S, DENMARK
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:VON DER OSTEN, CLAUS;CHERRY, JOEL R.;BJORNVAD, MADS E.;AND OTHERS;REEL/FRAME:008602/0187;SIGNING DATES FROM 19970314 TO 19970415
Dec 27, 2001ASAssignment
Jul 15, 2003FPAYFee payment
Year of fee payment: 4
Jul 23, 2007SULPSurcharge for late payment
Year of fee payment: 7
Jul 23, 2007FPAYFee payment
Year of fee payment: 8
May 31, 2011FPAYFee payment
Year of fee payment: 12