Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.


  1. Advanced Patent Search
Publication numberUS6191165 B1
Publication typeGrant
Application numberUS 08/866,007
Publication dateFeb 20, 2001
Filing dateMay 30, 1997
Priority dateMay 31, 1996
Fee statusLapsed
Also published asUS7019024, US20010012857, US20060287298
Publication number08866007, 866007, US 6191165 B1, US 6191165B1, US-B1-6191165, US6191165 B1, US6191165B1
InventorsVassil Iliya Ognyanov, Laurence A. Borden, Stanley Charles Bell, Jing Zhang
Original AssigneeAllelix Neuroscience Inc.
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Pharmaceutical for treatment of neurological and neuropsychiatric disorders
US 6191165 B1
The invention provides a pharmaceutical for treatment of neurological and neuropsychiatric disorders comprising a compound of the formula:
or a pharmaceutically acceptable salt thereof.
Previous page
Next page
What is claimed:
1. A compound of the following formula:
or a pharmaceutically acceptable salt thereof,
(1) C* is a substituted carbon;
(2) R2 (a) is hydrogen, (C1-C6) alkyl, (C1-C6) alkoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl, or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R1 is not aminoethylene, —O—R8 or —S—R8*) hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R1, Rxb or Ryb, (d) is R2a linked by R2b to C*, or (e) is ethylene forming a third bridging structure as set forth in (2iii)(b)(i);
(2i) Rx is Rxa linked by Rxb to C*;
(2ii) Ry is Rya linked by Ryb to C*;
(2iii) Rxa, Rya and R2a, are independently Ar, which is phenyl or naphthyl, or a 5 to 7-membered non-aromatic ring having 0 heteroatoms wherein:
(a) each of Rxa and Rya can be independently substituted with one of Rq, RrO— or RsS—, wherein each of Rq, Rr and Rs are independently Ar or adamantyl, and
(b) Rxa, Rya, R2a, Rq, Rr and Rs can be substituted or additionally substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C12) alkyl, (C2-C12) alkenyl, amino, (C1-C6) alkylamino, dialkylamino wherein each alkyl of dialkylamino is independently C1 to C6, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, or amidino wherein the amidino can be independently substituted with up to three (C1-C6) alkyl groups, wherein:
(i.) the substitutions of Rxa and Rya can be combined to form a second bridge between Rxa and Rya comprising (1) methylene or ethylene, which methylene or ethylene can be substituted by an R2 when R2 is ethylene to form the third bridging structure, or (2) —CH═CH— or wherein Rxa and Rya can be directly linked by a single bond;
(2iv) Rxb and R2b are independently a single bond or (C1-C2) alkylene;
(2v) Ryb is a single bond, oxy, (C1-C2) alkylene, ethenylene or —CH═ (where the double bond is with C*), thio, methyleneoxy or methylenethio, or either —N(R6) or —CH2—N(R6*)—, wherein R6 and R6* are hydrogen or (C1-C6) alkyl;
(3) R1 comprises: a straight-chained (C2-C3) aliphatic group; ═N—O-(ethylene), wherein the unmatched double bond is linked to C*; —O—R8 or —S—R8* wherein R8 or R8* is a ethylene or ethenylene and O or S is bonded to C*; aminoethylene where the amino is bonded to C*:
wherein R1 can be substituted with up to one hydroxy, up to one (C1-C6) alkoxy or up to one (C2-C7) alkanoyloxy, with up to two independent (C1-C6) alkyl, with up to one oxo, up to one (C1-C6) alkylidene, with the proviso that the hydroxy, alkoxy, alkanoyloxy or oxo substituents are not bonded to a carbon that is bonded to a nitrogen or oxygen;
wherein if R1 contributes a heteroatom linked to C*, then Ryb does not contribute a heteroatom linked to C*; and
wherein the alkyl or alkylidene substituents of R1 can be linked to form a 3 to 7-membered non-aromatic ring;
(4) R3 (a) is hydrogen, (C1-C6) alkyl, or phenyl or phenylalkyl wherein the alkyl is C1 to C6 and the phenyl or phenyl of phenylalkyl can be substituted with the same substituents defined above for the phenyl of Rxa, (b) is —R12C(Rxx)(Ryy)(R11), wherein R12 is bonded to N, Rxx is independently the same as Rx, Ryy is independently the same as Ry, R11 is independently the same as R2 and R12 is independently the same as R1;
(5) R4 and R4* are independently hydrogen or (C1-C6) alkyl, or one of R4 and R4* can be (C1-C6) hydroxyalkyl; and
(6) R5 is (CO)NR13R14, (CO)OR15, (CO)SR16, (SO2)NR17R18, (PO)(OR19)(OR20), (CR22)(OR23)(OR24), CN or tetrazol-5-yl, wherein (a) R13, R14, R15, R16, R17, R18 R19 and R20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and, (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the amino can be substituted with up to two independent (C1-C6) alkyls, Ar-alkyl wherein the alkyl is C1-C6, or Ar, and (b) R22 is hydrogen or OR25 and R23, R24 and R25 are independently (C1-C6) alkyl, phenyl, benzyl or acetyl or, the alkyls of R23 and R24 can be combined to include 1,3-dioxolane or 1,3-dioxane:
wherein the phenyl or naphthyl groups of R13, R14, R15, R16, R17, R18, R19, R20, R22, R23 or R24 can be substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, cyano, hydroxy, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamine, dialkylamine wherein each alkyl is independently C1 to C6, amino, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent (C1 -C6) alkyl, (C1-C6) alkylsulfonyl, or amidino that can substituted with up to three (C1-C6) alkyl;
wherein R13 and R14 together with the attached nitrogen can form a 5 to 7-membered ring;
and wherein further the following provisos apply:
if R15 is hydrogen and R1 is propylene, then at least one of the following applies (1) both Rxa and Rya are not fluorophenyl, (2) Ry is Ar—(C1-C2)alkyl, Ar-oxy, Ar-methoxy, Ar-thio, Ar-methylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (3) R2 is R2a R2b—, (4) R2 is not hydrogen, or (5) R3 is not hydrogen;
if R15 is hydrogen and R1 is ethylene or C*R1 is prop-1-enylene, then at least one of the following applies (1) an Ar of at least one of Rxa and Rya is substituted with a radical different from hydrogen, (2) Ry is Ar—(C1-C2)alkyl, Ar-oxy, Ar-methoxy, Ar-thio, Ar-methylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (3) R2 is R2a R2b—, (4) R2 is not hydrogen, or (5) R3 is not hydrogen;
if R5 is C(O)NR13R14 wherein R13 and R14 are hydrogen, (C1-C8) alkyl, phenyl or substituted phenyl, then at least one of the following applies (1) an Ar of at least one of Rx and Ry is substituted with a radical different from hydrogen, fluoro, chloro, or bromo (2) Ry is Ar—(C1-C2)alkyl, Ar-oxy, Ar-methoxy, Ar-thio, Ar-methylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (3) R2 is R2a R2b—, (4) R2 is not hydrogen, (5) R3 is not hydrogen, or (6) R1 is not ethylene;
if R2 is phenyl or p-methylphenyl, then at least one of the following applies (1) the Ar of Rx and Ry are not substituted with p-methylphenyl or p-methoxyphenyl, (2) an Ar of at least one of Rx and Ry is substituted with a radical different from hydrogen, (3) Ry is Ar—(C1-C2)alkyl, Ar-oxy, Ar-methoxy, Ar-thio, Ar-methylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, or (4) R1 is not aminoethylene, OR8 or SR8*;
if R2 is p-methoxyphenyl, then at least one of the following applies (1) an Ar of at least one of Rx and Ry is substituted with a radical different from hydrogen, (2) Ry is Ar—(C1-C2)alkyl, Ar-oxy, Ar-methoxy, Ar-thio, Ar-methylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, or (3) R1 is not OR8 or —SR8*, and
the compound is not N-(1,1-diphenylpropyl)-glycinamide or N-(1,1-diphenylpropyl)-glycinamide having one or more halo substitutions on one or more of the phenyls and differs therefrom by at least two of the following: (a) substitutions or (b) differences in Rx, Ry, R1, R3, R4, R4* or R5.
2. The compound of claim 1, wherein (A) at least one of Rxa, Rya and R2a is substituted with fluoro, chloro, bromo, hydroxy, trifluoromethyl, trifluoromethoxy, nitro, cyano or (C3-C8) alkyl, (B) at least one of Rxa and Rya is substituted with Rq, RrO— or RsS—, (B) R3 is hydrogen, (C1-C6) alkyl, or phenyl or phenylalkyl wherein the alkyl is C1 to C6 and either such phenyl can be substituted with the same substituents defined above for the phenyl of Rxa or (C) the ring structures of Rxa, Rya and R2a, including substituents thereto, otherwise include at least two aromatic ring structures that together include from 15 to 20 ring atoms.
3. The compound of claim 2, wherein at least one of Rxa, Rya and R2a is substituted with fluoro, trifluoromethyl, trifluoromethoxy, nitro, cyano, or (C3-C8) alkyl.
4. The compound of claim 1, wherein at least one of Rxa and Rya is substituted with Rq, RrO—, or RsS—.
5. The compound of claim 1, wherein an Ar of at least one of Rxa, Rya and R2a is phenyl.
6. The compound of claim 1, wherein Ryb is oxy, methyleneoxy, thio, or methylenethio.
7. The compound of claim 6, wherein Ryb is oxy or thio.
8. The compound of claim 1, wherein R5 is (CO)NR13R14, (CO)OR15 or (CO)SR16.
9. The compound of claim 8, wherein R15 is (C2-C6) alkyl, (C2-C4) hydroxyalkyl, phenyl, phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the amino can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted.
10. The compound of claim 8, wherein R15 is hydrogen.
11. The compound of claim 1, wherein R4 is hydrogen, methyl or hydroxymethyl and R4* is hydrogen.
12. The compound of claim 1, wherein R1 is —O—R8 or —S—R8*.
13. The compound of claim 12, wherein Rxa—Rxb—, Rya—Ryb— and C* form:
wherein A and B are Ar ring structures consistent with the definitions of Rxa and Rya, respectively, and Y is C* wherein R21 either (i.) completes a single bond linking two Ar rings of Rxa and Rya, or (ii.) is (C1-C2) alkylene or —CH═CH—, and wherein Rxa and Rya can be substituted.
14. The compound of claim 13, wherein R21 is CH2CH2 or CH═CH.
15. The compound of claim 1, wherein Rxa and Rya together can be substituted with up to six substituents, R2a, Rq, Rr and Rs can each be substituted with up to 3 substituents, and wherein the presence of each of Rq, RrO— or RsS— is considered a substitution to the respective ring structure of Rxa and Rya.
16. The compound of claim 1, wherein a phenyl of R3 is substituted with up to three substituents.
17. The compound of claim 1, wherein the Ar of R13, R14, R15, R16 R17, R18 R19 or R20 is substituted with up to three substituents.
18. The compound of claim 1, wherein the compound is an optically pure enantiomer.
19. A pharmaceutical composition comprising the compound of claim 1 and a pharmaceutically acceptable excipient.
20. The pharmaceutical composition of claim 19, wherein the compound is present in an effective amount for:
(1) treating schizophrenia,
(2) treating epilepsy,
(3) treating spasticity,
(4) treating muscle spasm,
(5) treating pain,
(6) treating mood disorders,
(7) enhancing memory or learning, or
(8) treating learning disorders.
21. The compound of claim 1 wherein:
(1) R2 is hydrogen,
(2) Rxa and Rya are both phenyl and at least one of Rxa and Rya is substituted with one of phenyl, phenoxy, or phenylthio,
(3) Rxb is a single bond and Ryb is a single bond or oxy, and
(4) R5 is (CO)NR13R14 or (CO)OR15, wherein R13, R14, and R15 are independently hydrogen; (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of OR15 has no more than secondary branching; (C2-C6) hydroxyalkyl or aminoalkyl mere the alkyl is C2 to C6 and the amino can be substituted with up to two independent (C1-C6) alkyl or phenylalkyl, wherein the alkyl is C1-C6 and the phenyl can be substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, cyano, hydroxy, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamine, dialkylamine wherein each alkyl is independently C1 to C6, amino, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can substituted with up to three (C1-C6) alkyl.
22. A method of (1) treating schizophrenia comprising administering a schizophrenia treating effective amount of a compound, (2) of treating epilepsy comprising administering an epilepsy treating effective amount of a compound, (3) treating spasticity comprising administering a spasticity treating effective amount of a compound, (4) treating muscle spasm comprising administering a muscle spasm treating effective amount of a compound, (5) treating pain comprising administering a pain treating effective amount of a compound, (6) treating mood disorders comprising administering a mood disorder treating effective amount of a compound, (7) enhancing memory or learning comprising administering a memory or learning enhancing effective amount of a compound, or (8) treating learning disorders, comprising administering an amount effective for said treating or enhancing of a compound of formula:
or a pharmaceutically acceptable salt thereof,
(1) C* is a substituted carbon;
(2) R2 (a) is hydrogen, (C1-C6) alkyl, (C1-C6) alkoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl, or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R1 is not aminoethylene, —O—R8 or —S—R8*) hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R1, Rxb or Ryb, (d) is R2a linked by R2b to C*, or (e) is ethylene forming a third bridging structure as set forth in (2iii)(b)(i);
(2i) Rx is Rxa linked by Rxb to C*;
(2ii) Ry is Rya linked by Ryb to C*;
(2iii) Rxa, Rya and R2a, are independently Ar, which is phenyl or naphthyl, or a 5 to 7-membered non-aromatic ring having 0 heteroatoms wherein:
(a) each of Rxa and Rya can be independently substituted with one of Rq, RrO— or RsS—, wherein each of Rq, Rr and Rs are independently Ar or adamantyl , and
(b) Rxa, Rya, R2a, Rq, Rr and Rs can be substituted or additionally substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C12) alkyl, (C2-C12) alkenyl, amino, (C1-C6) alkylamino, dialkylamino wherein each alkyl of dialkylamino is independently C1 to C6, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, or amidino wherein the amidino can be independently substituted with up to three (C1-C6) alkyl groups, wherein:
(i.) the substitutions of Rxa and Rya can be combined to form a second bridge between Rxa and Rya comprising (1) methylene or ethylene, which methylene or ethylene can be substituted by an R2 when R2 is ethylene to form the third bridging structure, or (2) —CH═CH— or wherein Rxa and Rya can be directly linked by a single bond;
(2iv) Rxb and R2b are independently a single bond or (C1-C2) alkylene;
(2v) Ryb is a single bond, oxy, (C1-C2) alkylene, ethenylene or —CH═(where the double bond is with C*), thio, methyleneoxy or methylenethio, or either —N(R6) or —CH2—N(R6*)—, wherein R6 and R6* are hydrogen or (C1-C6) alkyl;
(3) R1 comprises: a straight-chained (C2-C3) aliphatic group; ═N—O—(ethylene), wherein the unmatched double bond is linked to C*; —O—R8or —S—R8* wherein R8 or R8* is a ethylene or ethenylene and O or S is bonded to C*; aminoethylene where the amino is bonded to C*:
wherein R1 can be substituted with up to one hydroxy, up to one (C1-C6) alkoxy or up to one (C2-C7) alkanoyloxy, with up to two independent (C1-C6) alkyl, with up to one oxo, up to one (C1-C6) alkylidene, with the proviso that the hydroxy, alkoxy, alkanoyloxy or oxo substituents are not bonded to a carbon that is bonded to a nitrogen or oxygen;
wherein if R1 contributes a heteroatom linked to C*, then Ryb does not contribute a heteroatom linked to C*; and
wherein the alkyl or alkylidene substituents of R1 can be linked to form a 3 to 7-membered non-aromatic ring;
(4) R3 (a) is hydrogen, (C1-C6) alkyl, or phenyl or phenylalkyl wherein the alkyl is C1 to C6 and the phenyl or phenyl of phenylalkyl can be substituted with the same substituents defined above for the phenyl of Rxa, (b) is —R12C(Rxx)(Ryy)(R11), wherein R12 is bonded to N, Rxx is independently the same as Rx, Ryy is independently the same as Ry, R11 is independently the same as R2 and R12 is independently the same as R1;
(5) R4 and R4* are independently hydrogen or (C1-C6) alkyl, or one of R4 and R4* can be (C1-C6) hydroxyalkyl;
(6) R5 is (CO)NR13R14, (CO)OR15, (CO)SR16, (SO2)NR17R18, (PO)(OR19)(OR20), (CR22)(OR23)(OR24), CN or tetrazol-5-yl, wherein (a) R13, R14, R15, R16, R17, R18 R19 and R20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and, (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the amino can be substituted with up to two independent (C1-C6) alkyls, Ar-alkyl wherein the alkyl is C1-C6, or Ar, and (b) R22 is hydrogen or OR25 and R23, R24 and R25 are independently (C1-C6) alkyl, phenyl, benzyl or acetyl or, the alkyls of R23 and R24 can be combined to include 1,3-dioxolane or 1,3-dioxane:
wherein the phenyl or naphthyl groups of R13, R14, R15, R16, R17, R18, R19, R20, R22, R23 or R24 can be substituted with substituents selected from the group consisting of fluoro, chloro, bromo, nitro, cyano, hydroxy, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamine, dialkylamine wherein each alkyl is independently C1 to C6, amino, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent (C1-C6) alkyl, (C1 -C6) alkylsulfonyl, or amidino that can substituted with up to three (C1-C6) alkyl
wherein R13 and R14 together with the attached nitrogen can form a 5 to 7-membered ring;
and wherein further the following provisos apply:
if R5 is C(O)NR13R14 wherein R13 and R14 are hydrogen, (C1-C8) alkyl, phenyl or substituted phenyl, then at least one of the following applies (1) an Ar of at least one of Rx and Ry is substituted with a radical different from hydrogen, fluoro, chloro, or bromo (2) Ry is Ar—(C1-C2)alkyl, Ar-oxy, Ar-methoxy, Ar-thio, Ar-methylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (3) R2 is R2a R2b—, (4) R2 is not hydrogen (5) R3 is not hydrogen, or (6) R1 is not ethylene; and
the compound is not N-(1,1-diphenylpropyl)-glycinamide or N-(1,1-diphenylpropyl)-glycinamide having one or more halo substitutions on one or more of the phenols and differs therefrom by at least two of the following: (a) substitutions or (b) differences in Rx, Ry, R1, R3, R4, R4* or R5.
23. The method of claim 22, wherein the spasticity is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury or dystonia.
24. The method of claim 22 of (1) treating schizophrenia comprising administering a schizophrenia treating effective amount of a compound, (5) treating pain comprising administering a pain treating effective amount of a compound or (6) treating mood disorders comprising administering a mood disorder treating effective amount of a compound.
25. The method of claim 22 of treating schizophrenia comprising administering a schizophrenia treating effective amount of the compound.
26. The pharmaceutical composition of claim 19, wherein the compound is present in an effective amount for treating schizophrenia.
27. The compound of claim 1, wherein R1 is a straight-chained (C2-C3) aliphatic group.
28. The compound of claim 27, wherein R2 forms a double bond with an adjacent carbon from R1.

The present application is a continuation-in-part of: U.S. Ser. No. 08/656,063, filed May 31, 1996, now abandoned, U.S. Ser. No. 08/655,912, filed May 31, 1996, now abandoned, U.S. Ser. No. 08/808,755, filed Feb. 27, 1997, and U.S. Ser. No. 08/808,754, filed Feb. 27, 1997, now abandoned, each of which applications are now converted to provisional applications 60/041,503; 60/044,387; 60/041,504; and 60/070,900.

The present invention relates to a class of substituted amines, pharmaceutical compositions and methods of treating neurological and neuropsychiatric disorders.

Synaptic transmission is a complex form of intercellular communication that involves a considerable array of specialized structures in both the pre- and post-synaptic neuron. High-affinity neurotransmitter transporters are one such component, located on the pre-synaptic terminal and surrounding glial cells (Kanner and Schuldiner, CRC Critical Reviews in Biochemistry, 22, 1032 (1987)). Transporters sequester neurotransmitter from the synapse, thereby regulating the concentration of neurotransmitter in the synapse, as well as its duration therein, which together influence the magnitude of synaptic transmission. Further, by preventing the spread of transmitter to neighboring synapses, transporters maintain the fidelity of synaptic transmission. Last, by sequestering released transmitter into the presynaptic terminal, transporters allow for transmitter reutilization.

Neurotransmitter transport is dependent on extracellular sodium and the voltage difference across the membrane; under conditions of intense neuronal firing, as, for example, during a seizure, transporters can function in reverse, releasing neurotransmitter in a calcium-independent non-exocytotic manner (Attwell et al., Neuron, 11, 401-407 (1993)). Pharmacologic modulation of neurotransmitter transporters thus provides a means for modifying synaptic activity, which provides useful therapy for the treatment of neurological and psychiatric disturbances.

The amino acid glycine is a major neurotransmitter in the mammalian central nervous system, functioning at both inhibitory and excitatory synapses. By nervous system, both the central and peripheral portions of the nervous system are intended. These distinct functions of glycine are mediated by two different types of receptor, each of which is associated with a different class of glycine transporter. The inhibitory actions of glycine are mediated by glycine receptors that are sensitive to the convulsant alkaloid strychnine, and are thus referred to as “strychnine-sensitive.” Such receptors contain an intrinsic chloride channel that is opened upon binding of glycine to the receptor, by increasing chloride conductance, the threshold for firing of an action potential is increased. Strychnine-sensitive glycine receptors are found predominantly in the spinal cord and brainstem, and pharmacological agents that enhance the activation of such receptors will thus increase inhibitory neurotransmission in these regions.

Glycine functions in excitatory transmission by modulating the actions of glutamate, the major excitatory neurotransmitter in the central nervous system. See Johnson and Ascher, Nature, 325, 529-531 (1987); Fletcher et al., Glycine Transmission, (Otterson and Storm-Mathisen, eds., 1990), pp. 193-219. Specifically, glycine is an obligatory co-agonist at the class of glutamate receptor termed N-methyl-D-aspartate (NMDA) receptor. Activation of NMDA receptors increases sodium and calcium conductance, which depolarizes the neuron, thereby increasing the likelihood that it will fire an action potential. NMDA receptors are widely distributed throughout the brain, with a particularly high density in the cerebral cortex and hippocampal formation.

Molecular cloning has revealed the existence in mammalian brains of two classes of glycine transporters, termed GlyT-1 and GlyT-2. GlyT-1 is found predominantly in the forebrain, and its distribution corresponds to that of glutamatergic pathways and NMDA receptors (Smith, et al., Neuron 8, 927-935 (1992)). Molecular cloning has further revealed the existence of three variants of GlyT-1, termed GlyT-1a, GlyT-1b and GlyT-1c (Kim, et al., Molecular Pharmacology, 45, 608-617 (1994)), each of which displays a unique distribution in the brain and peripheral tissues. These variants arise by differential splicing and exon usage, and differ in their N-terminal regions. GlyT-2, in contrast, is found predominantly in the brain stem and spinal cord, and its distribution corresponds closely to that of strychnine-sensitive glycine receptors (Liu et al., J. Biological Chemistry, 268, 22802-22808 (1993); Jursky and Nelson, J. Neurochemistry, 64, 1026-1033 (1995)). These data are consistent with the view that, by regulating the synaptic levels of glycine, GlyT-1 and GlyT-2 selectively influence the activity of NMDA receptors and strychnine-sensitive glycine receptors, respectively.

Compounds that inhibit or activate glycine transporters would thus be expected to alter receptor function, and provide therapeutic benefits in a variety of disease states. For example, inhibition of GlyT-2 can be used to diminish the activity of neurons having strychnine-sensitive glycine receptors via increasing synaptic levels of glycine, thus diminishing the transmission of pain-related (i.e., nociceptive) information in the spinal cord, which has been shown to be mediated by these receptors. Yaksh, Pain, 37, 111-123 (1989). Additionally, enhancing inhibitory glycinergic transmission through strychnine-sensitive glycine receptors in the spinal cord can be used to decrease muscle hyperactivity, which is useful in treating diseases or conditions associated with increased muscle contraction, such as spasticity, myoclonus, and epilepsy (Truong et al., Movement Disorders, 3, 77-87 (1988); Becker, FASEB J., 4, 2767-2774 (1990)). Spasticity that can be treated via modulation of glycine receptors is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury, dystonia, and other conditions of illness and injury of the nervous system.

NMDA receptors are critically involved in memory and learning (Rison and Stanton, Neurosci. Biobehav. Rev., 19, 533-552 (1995); Danysz et al., Behavioral Pharmacol., 6, 455-474 (1995)); and, furthermore, decreased function of NMDA-mediated neurotransmission appears to underlie, or contribute to, the symptoms of schizophrenia (Olney and Farber, Archives General Psychiatry, 52, 998-1007 (1996). Thus, agents that inhibit GlyT-1 and thereby increase glycine activation of NMDA receptors can be used as novel antipsychotics and anti-dementia agents, and to treat other diseases in which cognitive processes are impaired, such as attention deficit disorders and organic brain syndromes. Conversely, over-activation of NMDA receptors has been implicated in a number of disease states, in particular the neuronal death associated with stroke and possibly neurodegenerative diseases, such as Alzheimer's disease, multi-infarct dementia, AIDS dementia, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis or other conditions in which neuronal cell death occurs, such as stroke or head trauma. Coyle & Puttfarcken, Science, 262, 689-695 (1993); Lipton and Rosenberg, New Engl. J. of Medicine, 330, 613-622 (1993); Choi, Neuron, 1, 623-634 (1988). Thus, pharmacological agents that increase the activity of GlyT-1 will result in decreased glycine-activation of NMDA receptors, which activity can be used to treat these and related disease states. Similarly, drugs that directly block the glycine site on the NMDA receptors can be used to treat these and related disease states.


By the present invention, a class of compounds has been identified that inhibit glycine transport via the GlyT-1 or GlyT-2 transporters, or are precursors, such as pro-drugs, to compounds that inhibit such transport, or are synthetic intermediates for preparing compounds that inhibit such transport. Thus, the invention provides a class of compounds formula:

or a pharmaceutically acceptable salt thereof,


(1) X is nitrogen or carbon, and R2 is not present when X is nitrogen;

(2) R2 (a) is hydrogen, (C1-C6) alkyl, (C1-C6) alkoxy, cyano, (C2-C7) alkanoyl, aminocarbonyl, (C1-C6) alkylaminocarbonyl or dialkylaminocarbonyl wherein each alkyl is independently C1 to C6, (b) comprises (where R1 is not aminoethylene, —O—R8 or —S—R8*) hydroxy, fluoro, chloro, bromo or (C2-C7) alkanoyloxy, (c) forms a double bond with an adjacent carbon or nitrogen from one of either R1, Rxb or Ryb, or (d) is R2a linked by R2b to X;

(2i) Rx is Rxa linked by Rxb to X;

(2ii) Ry is Rya linked by Ryb to X;

(2iii) Rxa, Rya and R2a, are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring having from 0 to 2 heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, wherein:

(a) aryl is phenyl or naphthyl,

(b) heteroaryl comprises a five-membered ring, a six-membered ring, a six-membered ring fused to a five-membered ring, a five-membered ring fused to a six-membered ring, or a six-membered ring fused to a six-membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon,

(c) each of Rxa, Rya and R2a can be independently substituted with one of Rq, RrO— or RsS—, wherein each of Rq, Rr and Rs are independently aryl, heteroaryl, adamantyl or a 5 to 7-membered non-aromatic ring as these ring structures are defined for Rxa, and

(d) Rxa, Rya, R2a, Rq, Rr and Rs can be additionally substituted with one or more substituents selected from the group consisting of fluoro, chloro, bromo, nitro, hydroxy, cyano, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, adamantyl, (C1-C12) alkyl, (C1-C12) alkenyl, amino, (C1-C6) alkylamino, dialkylamino wherein each alkyl is independently C1 to C6, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can independently substituted with up to three (C1-C6) alkyl, or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl ring structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl, wherein:

(i.) the substitutions of Rxa, Rya and R2a can be combined to form a second bridge between two of Rxa, Rya and R2a comprising (1) (C1-C2) alkyl or alkenyl, which can be independently substituted with one or more (C1-C6) alkyl, (2) sulfur, (3) oxygen, (4) amino, which can be substituted for hydrogen with one (C1-C6) alkyl (5) carbonyl, (6) —CH2C(═O)—, which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (7) —C(═O)—O—, (8) —CH2—O—, which can be substituted for hydrogen with up to two independent (C1-C6) alkyl, (9) —C(═O)N(R24), wherein R24 is hydrogen or (C1-C6) alkyl, (10) —CH2—NH—, which can be substituted for hydrogen with up to three (C1-C6) alkyl, or (11) —CH═N—, which can be substituted for hydrogen with (C1-C6) alkyl, or wherein two of Rxa, Rya and R2a can be directly linked by a single bond;

(2iv) Rxb and R2b are independently a single bond or (C1-C2) alkylene;

(2v) Ryb is a singe bond, oxa, (C1-C2) alkylene, ethenylene or —CH═ (where the double bond is with X), thia, methyleneoxy or methylenethio, or either —N(R6) or —CH2—N(R6*)—, wherein R6 and R6* are hydrogen or (C1-C6) alkyl, wherein when X is nitrogen X is not bonded to another heteroatom;

(3) R1 comprises: a straight-chained (C2-C3) aliphatic group; where X is carbon, ═N—O-(ethylene), wherein the unmatched double bond is linked to X; (where X is carbon and Ryb does not include a heteroatom attached to X), —O—R8or —S—R8* wherein R8 or R8* is a ethylene or ethenylene and O or S is bonded to X; (where X is carbon and Ryb does not include a heteroatom attached to X), aminoethylene where the amino is bonded to X:

wherein R1 can be substituted with up to one hydroxy, up to one (C1-C6) alkoxy or up to one (C2-C7) alkanoyloxy, with up to two independent (C1-C6) alkyl, with up to one oxo, up to one (C1-C6) alkylidene, with the proviso that the hydroxy, alkoxy, alkanoyloxy or oxo substituents are not bonded to a carbon that is bonded to a nitrogen or oxygen;

wherein the alkyl or alkylidene substituents of R1 can be linked to form a 3 to 7-membered non-aromatic ring; and

wherein if X is nitrogen, X is linked to R1 by a single bond and the terminal carbon of R1 that links R1 to N is saturated;

(4) R3 (a) is hydrogen, (C1-C6) alkyl, or phenyl or phenylalkyl wherein the alkyl is C1 to C6 and either such phenyl can be substituted with the same substituents defined above for the aryl or heteroaryl of Rxa, (b) is —R12Z(Rxx)(Ryy)(R11), wherein R12 is bonded to N, Z is independently the same as X, Rxx is independently the same as Rx, Ryy is independently the same as Ry, R11 is independently the same as R2 and R12 is independently the same as R1, or (c) forms, together with R4, a ring C, as follows:

 wherein R4* is hydrogen when ring C is present;

(5) n is 0 or 1, and where if n is 1, R3* is either (C1-C6) alkyl (with the attached nitrogen having a positive charge) or oxygen (forming an N-oxide) and X is carbon;

(5′) Q together with the illustrated ring nitrogen and ring carbon bearing R5 form ring C, wherein ring C is a 3 to 8-membered ring, a 3 to 8-membered ring substituted with a 3 to 6-membered spiro ring, or a 3 to 8-membered ring fused with a 5 to 6-membered ring, wherein the fused ring lacking the illustrated ring nitrogen can be aromatic or heteroaromatic, wherein for each component ring of ring C there are up to two heteroatoms selected from oxygen, sulfur or nitrogen, including the illustrated nitrogen, and the rest carbon, with the proviso that the ring atoms include no quaternary nitrogens other than the illustrated nitrogen, with the proviso that, in saturated rings, ring nitrogen atoms are separated from other ring heteroatoms by at least two intervening carbon atoms:

wherein the carbon and nitrogen ring atoms of ring C can be substituted with substituents selected from (C1-C6) alkyl, (C2-C6) alkenylene, cyano, nitro, trifluoromethyl, (C2-C7) alkyloxycarbonyl, (C1-C6) alkylidene, hydroxyl, (C1-C6) alkoxy, oxo, hydroxycarbonyl, aryl wherein the aryl is as defined for Rxa or heteroaryl wherein the heteroaryl is as defined for Rxa, with the proviso that ring atoms substituted with alkylidene, hydroxycarbonyl or oxo are carbon, with the further proviso that ring atoms substituted with hydroxyl or alkoxy are separated from other ring heteroatoms by at least two intervening carbon atoms;

(6) R4 and R4* are independently hydrogen or (C1-C6) alkyl, or one of R4 and R4* can be (C1-C6) hydroxyalkyl; and

(7) R5 is (CO)NR13R14, (CO)OR15, (CO)SR16, (SO2)NR17R18, (PO)(OR19)(OR20), (CR22)(OR23)(OR24), CN or tetrazol-5-yl, wherein R13, R14, R15, R16, R17, R18 R19 and R20 are independently hydrogen, (C1-C8) alkyl which can include a (C3-C8) cycloalkyl, wherein the carbon linked to the oxygen of R15 or the sulfur of R16 has no more than secondary branching and, (C2-C6) hydroxyalkyl, aminoalkyl where the alkyl is C2 to C6 and the amino can be substituted with up to two independent (C1-C6) alkyls, arylalkyl wherein the alkyl is C1-C6, heteroarylalkyl wherein the alkyl is C1 to C6, aryl or heteroaryl, R22 is hydrogen or OR25 and R23, R24 and R25 are (C1-C6) alkyl, phenyl, benzyl, acetyl or, where R22 is hydrogen, the alkyls of R23 and R24 can be combined to include 1,3-dioxolane or 1,3-dioxane:

wherein the aryl is phenyl or naphthyl and the heteroaryl is a five-membered ring, a six-membered ring, a six-membered ring fused to a five-membered ring, a five-membered ring fused to a six-membered ring, or a six-membered ring fused to a six-membered ring, wherein the heteroaryl is aromatic and contains heteroatoms selected from the group consisting of oxygen, sulfur and nitrogen, with the remaining ring atoms being carbon;

wherein the aryl, heteroaryl, aryl or arylalkyl or the heteroaryl of heteroarylalkyl can be substituted with [preferably up to three] substituents selected from the group consisting of fluoro, chloro, bromo, nitro, cyano, hydroxy, trifluoromethyl, amidosulfonyl which can have up to two independent (C1-C6) N-alkyl substitutions, (C1-C6) alkyl, (C2-C6) alkenyl, (C1-C6) alkylamine, dialkylamine wherein each alkyl is independently C1 to C6, amino, (C1-C6) alkoxy, (C2-C7) alkanoyl, (C2-C7) alkanoyloxy, trifluoromethoxy, hydroxycarbonyl, (C2-C7) alkyloxycarbonyl, aminocarbonyl that can be N-substituted with up to two independent (C1-C6) alkyl, (C1-C6) alkylsulfonyl, amidino that can substituted with up to three (C1-C6) alkyl, or methylenedioxy or ethylenedioxy with the two oxygens bonded to adjacent positions on the aryl or heteroaryl ring structure, which methylenedioxy or ethylenedioxy can be substituted with up to two independent (C1-C6) alkyl; and

wherein R13 and R14 together with the nitrogen can form a 5 to 7-membered ring that can contain one additional heteroatom selected from oxygen and sulfur.

In a preferred embodiment, the ring Q is a 4 to 8-membered ring that includes the illustrated ring nitrogen, with the remaining ring atoms being carbon.

Preferably, (A) at least one of Rxa, Rya and R2a is substituted with fluoro, chloro, bromo, hydroxy, trifluoromethyl, trifluoromethoxy, nitro, cyano, (C3-C8) alkyl, Rq, RrO—, RsS—, (B) R3 is hydrogen, (C1-C6) alkyl, or phenyl or phenylalkyl wherein the alkyl is C1 to C6 and either such phenyl can be substituted with the same substituents defined for the aryl or heteroaryl of Rxa or (C) the ring structures of Rxa, Rya and R2a, including substituents thereto, otherwise include at least two aromatic ring structures that together include from 15 to 20 ring atoms. Examples of preferred structures under clause (C) include A45, A53, A56, A57, A60-5, A73-74, A78-81, A86-89, A93-96, A99, A100, A102, A105-106, A108-109, A116, A122-123 and A176. Preferably, at least one of Rxa, Rya and R2a is substituted with fluoro, trifluoromethyl, trifluoromethoxy, nitro, cyano, or (C3-C8) alkyl. Preferably, Rxa, Rya and R2a is substituted with Rq, RrO—, or RsS—. Preferably, an aryl or heteroaryl of at least one of Rxa, Rya and R2a is phenyl. Preferably, Ryb is oxa, methyleneoxy, thia, methylenethia. Preferably, Ryb is oxa or thia. Preferably, R5 is (CO)NR13R14, (CO)OR15 or (CO)SR16.

In one embodiment, R15 is (C2-C6) alkyl, (C2-C4) hydroxyalkyl, phenyl, phenylalkyl wherein the alkyl is C1-C3, or aminoalkyl where the alkyl is C2-C6 and the amino can be substituted with up to two independent (C1-C3) alkyls, wherein the phenyl or the phenyl of phenylalkyl can be substituted as recited above. Preferably, n is zero. Preferably, R15 is hydrogen. Preferably, R4 is hydrogen, methyl or hydroxymethyl and R4* is hydrogen. Preferably, at least one of Rxa, Rya and R2a is a heteroaryl comprising diazolyl, triazolyl, tetrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, thiolyl, diazinyl, triazinyl, benzoazolyl, benzodiazolyl, benzothiazolyl, benzoxazolyl, benzoxolyl, benzothiolyl, quinolyl, isoquinolyl, benzodiazinyl, benzotriazinyl, pyridyl, thienyl, furanyl, pyrrolyl, indolyl, isoindoyl or pyrimidyl. Preferably, R1 is —O—R8 or —S—R8*. Preferably, the second bridge between two of Rxa, Rya and R2a (of Section (2iii)(d)(i.)) is L, and satisfies the following formula:

wherein A and B are aryl or heteroaryl groups of Rxa and Rya, respectively. Preferably, Rxa—Rxb—, Rya—Ryb— and X form:

wherein Y is a carbon bonded to R1 by a single or double bond or a nitrogen that is bonded to R1 and wherein R21 either (i.) completes a single bond linking two aryl or heteroaryl rings of Rx and Ry, (ii.) is (C1-C2) alkylene or alkenylene, (iii.) is sulfur or (iv.) is oxygen, and wherein Rx and Ry can be substituted as set forth above. Preferably, R21 is CH2CH2 or CH═CH. Preferably, the alkylenedioxy substitution of Rxa, Rya, R2a, Rq, Rr or Rs is as follows:

wherein the alkylenedioxy can be substituted with up to two independent (C1-C3) alkyl.

In one preferred embodiment, Rxa and Rya together can be substituted with up to six substituents, R2a, Rq, Rr and Rs can each be substituted with up to 3 substituents, and wherein the presence of each of Rq, Rr or Rs is considered a substitution to the respective ring structure of Rxa, Rya and R2a. Preferably, a phenyl of R3 is substituted with up to three substituents. Preferably, the compound is an optically pure enantiomer (i.e., at least about 80% ee, preferably at least about 90% ee, more preferably at least about 95% ee). Preferably, the compound is part of a pharmaceutical composition comprising a pharmaceutically acceptable excipient. Preferably, the compound of the composition is present in an effective amount for:

(1) treating or preventing schizophrenia,

(2) enhancing treating or preventing dementia,

(3) treating or preventing epilepsy,

(4) treating or preventing spasticity,

(5) treating or preventing muscle spasm,

(6) treating or preventing pain,

(7) preventing neural cell death after stroke,

(8) preventing neural cell death in an animal suffering from a neurodegenerative disease

(9) treating or preventing mood disorders such as depression,

(10) enhancing memory or learning, or

(11) treating or preventing learning disorders.

In another embodiment, the invention provides a method (1) of treating or preventing schizophrenia comprising administering a schizophrenia treating or preventing effective amount of a compound, (2) of treating or preventing dementia comprising administering a dementia treating or preventing effective amount of a compound, (3) of treating or preventing epilepsy comprising administering an epilepsy treating or preventing effective amount of a compound, (4) of treating or preventing spasticity comprising administering a spasticity treating or preventing effective amount of a compound, (5) of treating or preventing muscle spasm comprising administering a muscle spasm treating or preventing effective amount of a compound, (6) of treating or preventing pain comprising administering a pain treating or preventing effective amount of a compound, (7) of preventing neural cell death after stroke comprising administering a neural cell death preventing effective amount of a compound, (8) of preventing neural cell death in an animal suffering from a neurodegenerative disease, (9) treating or preventing mood disorders such as depression, (10) enhancing memory or learning, or (11) treating or preventing learning disorders, comprising administering an amount effective for said treating, preventing or enhancing of a compound of formula XI or a pharmaceutically acceptable salt thereof, wherein the substituents are as defined above, except that R25 differs from R1 in that it can be a straight-chained C4 aliphatic group. Preferably, the spasticity treated or prevented is associated with epilepsy, stroke, head trauma, multiple sclerosis, spinal cord injury or dystonia. Preferably, the neurodegenerative disease treated or prevented is Alzheimer's disease, multi-infarct dementia, AIDS dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis or stroke or head trauma (such as can result in neuronal cell death).

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising:

A) reacting a compound of one of the following formulas


 wherein L1 is a nucleophilic substitution leaving group, with a compound of the formula



B) reacting a compound of the formula


 with a compound of the formula


 wherein L2 is a nucleophilic substitution leaving group.

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising:

A) reductively alkylating a compound of the formula


 with a compound of the formula


 where R1* differs from R1 in that it lacks the carbon that is part of the illustrated aldehyde carbonyl,


B) reductively alkylating a compound of the formula


 with a compound of the formula


In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reductively alkylating RdNH2 with a compound of the formula

wherein Rd and Rc are independently the same as defined for Rx, and wherein R27 has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur and does not include any double bonds conjugated with the above-illustrated carbonyl.

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reacting RfOH or Rf*SH with a compound of the formula

to form an ether or a thioether, respectively, wherein Rf and Rf* are independently the same as defined for Rx, wherein R27 has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur and does not include any double bonds at the atom bonded to the above-illustrated L5-substituted carbon and wherein L5 is a nucleophilic substitution leaving group.

The method of claim 28, further comprising synthesizing the compound of formula

by replacing the hydroxyl of formula

with another nucleophilic substitution leaving group. Preferably, the method comprises reacting a compound of formula

with an azodicarboxylate in the presence of a phosphine compound.

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reacting ReM with a compound of the formula

to form a compound of the formula

wherein Re is independently the same as defined for Rx, wherein M is a metal-containing substituent such that ReM is a organometallic reagent.

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising dehydrating a compound of the formula

to form a compound of the formula

wherein C* (the tertiary carbon marked with an adjacent “*”) has a double bond with an adjacent carbon, R28* and R28 have the same definition as R1 except that R28* and R28 do not include a heteroatom.

In another embodiment, the invention provides a method of synthesizing a compound of the invention comprising reducing a compound of the formula

wherein C* has a double bond with an adjacent carbon and Rc is independently the same as defined for Rx, to form a compound of the formula

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula:

with a compound of formula

with a compound of formula

wherein L3 is a nucleophilic substitution leaving group.

In another embodiment, the invention provides a method of synthesizing of a compound of the invention, the method comprising reacting a compound of formula

with Ar-Q wherein Ar is aryl which is substituted with an electron-withdrawing group or heteroaryl which is substituted with an electron-withdrawing group, and wherein Q is halide (preferably fluoro or chloro), to form

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing a compound of formula X:

by reacting a compound of formula:

with RdNHSO2Ar. The method can further comprise converting the compound of formula X to:

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising reacting a compound of formula

with a compound of formula

to form a compound of formula

In another embodiment, the invention provides a method of synthesizing a compound that can be used to synthesize the compound of the invention, the method comprising synthesizing the compound of formula:

said synthesis comprising reducing the ketone of a compound of formula


FIG. 1 depicts several reactions that can be employed in the synthesis of the compounds of the invention.

FIG. 2 depicts representative syntheses utilized in making compounds of the invention.

FIG. 3 shows additional representative syntheses utilized in making compounds of the invention.

FIG. 4 shows additional representative syntheses utilized in making compounds of the invention.


The following terms shall have the meaning set forth below:


Excipients are pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, enteral (e.g., oral or inhalation) or topical application that do not deleteriously react with the active compositions. Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions, alcohols, gum arabic, benzyl alcohols, gelatine, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

effective amount

The meaning of “effective amount” will be recognized by clinicians but includes amount effective to (1) reduce, ameliorate or eliminate one or more symptoms of the disease sought to be treated, (2) induce a pharmacological change relevant to treating the disease sought to be treated, or (3) prevent or lessen the frequency of occurrence of a disease.

neuronal cell death prevention

Neuronal cell death is “prevented” if there is a reduction in the amount of cell death that would have been expected to have occurred but for the administration of a compound of the invention.

oxo substitution

References to oxo as a “substituent” refer to “═O” substitutions.


The compounds of the invention are generally prepared according to one of the following synthetic schemes, although alternative schemes will be recognized by those of ordinary skill.

In Reaction 1 or Reaction 2, L1 and L2 are good nucleophilic substitution leaving groups such as a halide, especially a bromide, a tosylate, a brosylate (p-bromobenzenesulfonate), and the like. The reaction is preferably conducted in the presence of a base such as potassium carbonate or a tertiary amine such as diisopropylethylamine. Where the leaving group is a halide, the reaction is preferably conducted in the presence of an iodide salt such as potassium iodide. Suitable organic solvents include, for example, methanol, dioxane, acetonitrile or dimethyformamide. Reaction 1 is favorably conducted at a temperature range of about 50° C. to about 100° C. Reaction 2 is favorably conducted at a temperature range of about 15° C. to about 40° C. Avoiding more elevated temperatures helps decrease the formation of additional alkylation products. Those of ordinary skill will recognize that reaction 2 should be conducted with compounds that lack ring C.

In Reaction 3, R1* satisfies the definition of R1 except for the absence of the carbon that is part of an aldehyde group in the starting material. The reductive alkylation of Reaction 3 or Reaction 4 can be effected by several known methods (see, for example, “Reductive Alkylation,” W. S. Emerson in Organic Reactions, Vol. 4, John Wiley & Sons, 1948, p. 174 et seq.) including reaction with hydrogen in the presence of a catalyst such as palladium on carbon, reaction with sodium cyanoborohydride or reaction with sodium triacetoxyborohydride when groups labile to catalytic hydrogenation are present. It will be recognized that an intermediate Schiff's base is formed in the reaction, which Schiff's base is reduced to form the linkage. The intermediate Schiff's base can be isolated and then reduced in a separate reaction. Solvent selection will vary with such factors as the solubility of the starting materials, the degree to which the solvent favors the dehydration reaction forming the Schiff's base, and the suitability of the solvent in the reduction process. Suitable solvents using catalytic hydrogenation to reduce the Schiff's base include ethanol. Suitable solvents using a borohydride to reduce the Schiff's base include alcoholic solvents such as methanol or ethanol. In some cases, a drying process can be employed during the reaction to promote the dehydration reaction that forms the Schiff's base that is reduced. Such drying processes include refluxing under conditions selected to remove water as an azeotrope or the use of molecular sieves or other drying reagents. Suitable reaction temperatures include the range from about 20° C. to the reflux temperature of the solvent employed.

In Reaction 5, shown in FIG. 1, Rc is independently the same as defined for Rx. The starting material I can be synthesized, for instance, using the chemistry of Reaction 13 (similar to Reaction 1), as follows:

wherein R27 has the same definition as R1 except that it does not include a nitrogen, oxygen or sulfur and does not include any double bonds conjugated with the above-illustrated carbonyl, and wherein L3 is a good nucleophilic substitution leaving group such as a halide, especially a bromide, a tosylate, a brosylate (p-bromobenzenesulfonate), and the like. In Reaction 5 shown in FIG. 1, Rd—NH2 is reacted with I to give II under conditions that effect a reductive alkylation, as described for Reaction 3 and Reaction 4. Rd is independently the same as defined for Rx. Alternatively, II can be synthesized via Reaction 18 by reacting Rd—NH2 with VIII under the conditions described for Reaction 1.

In Reaction 6, shown in FIG. 1, Re is independently the same as defined for Rx. In Reaction 6, I is reacted with a organometallic reagent such as an aryllithium or an aryl or arylalkyl Grignard reagent to form III, as described, for instance, in Section 5.1.2 of Cary and Sundberg, Advanced Organic Chemistry, Part 2, Plenum, New York, 1977, pp. 170-180, and references cited therein. This reaction is described below in more detail for the synthesis of compound A32 (step 2 of Example 5A). Those of ordinary skill will be aware that in some cases where R5 includes an ester, the organometallic reagent may react with the ester group; in those such cases where the yield of the desired product is too low, the solvent, the organometallic reagent or the ester substitution can be varied.

In Reaction 7, shown in FIG. 1, III is subjected to conditions suitable for dehydration to form the double bond of IV. Such conditions are, for instance, those described in H. Weiland, Ber. 45: 484 et seq. (1912), wherein III is refluxed with acetic anhydride. In the illustration, the double bond forms with the adjacent carbon atom of R27. The double bond will typically form with this orientation where Rc and Re are aryl or heteroaryl and the adjacent carbon of R27 is saturated and not fully substituted, but other orientations are possible depending on the composition of Rc, Re and R27.

In Reaction 8, shown in FIG. 1, IV is reduced to form V, for instance using any of a number of known methods for reducing carbon—carbon double bonds, such as catalytic hydrogenation in the presence of an appropriate hydrogenation catalyst. An example of this process is described below for compound A4 (Example 10).

In Reaction 9, shown in FIG. 1, III is acylated, for instance, with acetic anhydride in the presence of an acylation catalyst such as 4-dimethylaminopyridine. In this context, R3 should not be hydrogen, though a hydrogen substituent can be restored to this position after Reaction 9 by using a suitable protecting group to mask the nitrogen.

In Reaction 10, shown in FIG. 1, the ketone moiety of I is reduced, for instance by any of a number of known methods for selectively reducing ketones, such as reaction with lithium tri-tert-butoxyaluminohydride. An example of this process is described below for the preparation of compound A31 (step 1 of Example 8A).

For Reaction 11, shown in FIG. 1, the hydroxyl of VII is replaced by a leaving group L5, wherein the leaving group is, for instance, chloro or bromo, by reacting VII with, for instance, thionyl chloride or thionyl bromide. An example of this process is described below for the preparation of compound A31 (step 2 of Example 8A).

For Reaction 12, shown in FIG. 1, Rf is independently the same as defined for Rx. VIII is reacted with RfOH in the presence of a base such as potassium carbonate or sodium hydride. Alternatively, the thio-containing analog of IX can be synthesized by reacting VIII with RfSH. An example of this process is described below for the synthesis of compound A31 (step 3 of Example 8A). The transformations of Reactions 11 and 12 can be conducted in a single pot, for instance by a Mitzunobu reaction such as described in Examples 8C, Step 1 and 8D, Step 2. Alternatively, VII can be directly reacted with an aryl halide or chloride, preferably an aryl fluoride or chloride, to form IX, such as is described in U.S. Pat. Nos. 5,166,437 and 5,362,886. It will be recognized that typically the aryl halide used in this reaction will typically have an electron-withdrawing group that facilitates the reaction, such as a trifluoromethyl or nitro group in the para position. 1-fluoronaphthalene is also suitable for this reaction, since the ring fused to the fluoro-substituted ring is the electron withdrawing group.

In reaction 19, VII is reacted with RdNHSO2Ar to yield X, as described for example in Example 8C, Step 1. In reaction 20, X is coverted to II as described, for example, in Example 8C, Step 2.

A number of other well-known synthetic approaches can be applied. For instance, acids can be formed by the hydrolysis of the corresponding esters. Amine derivatives can be formed by the alkylation of primary, secondary or tertiary amines. A number of double bond containing compounds can be hydrogenated to form the corresponding single bond. The N-oxide compounds of the invention are typically formed from the corresponding tertiary nitrogen by known methods.

In some cases, the chemistries outlined above may have to be modified, for instance by use of protective groups, to prevent side reactions due to reactive groups, such as reactive groups incorporated into heterocyclic rings or attached as substituents.

Compounds of the invention may also be prepared by adapting the classical solution chemistries outlined above into solid-phase synthetic techniques. For example, R13, R15, R16, R17 and R20 can be residues other than hydrogen representing functionalized resin or suitably selected linker attached to functionalized resin. The linker and the functional group represented by R5 should be stable under the conditions employed for the above-described reactions. The compounds of the invention where R13, R15, R16, R17 is R20 is hydrogen, are then cleaved from the resin or the linker leaving the remainder of the molecule intact. For example, solid-phase synthesis of peptoids [oligo(N-substituted glycines)] using robotic synthesizer was described by Zuckermann et al., J. Am. Chem. Soc., 114, 10646-10647, (1992) and Spellmeyer et al., WO 95/04072. Under analogous conditions, acylation reaction of Rink amide polystyrene resin with bromoacetic acid in the presence of N,N′-diisopropylcarbodiimide followed by displacement of the bromine with N-substituted amine (Reaction 2) and cleavage can provide N-substituted glycinamides (R13 and R14 are hydrogen).

Using the reactions described herein, including hydrolysis of esters, alkylation of amines, or hydrogenation reactions, the following compounds of the invention have been synthesized:

Compound A12 is a bis-alkylation byproduct of the synthesis of A9 using reaction I.

The compounds of the invention that incorporate ═N—O— can be prepared, for example, by alkylating an amine (such as sarcosine or glycine) with O-(2-halogenethyl)alkanone oximes, which can be prepared by condensing alkanones with hydroxylamine, followed by O-alkylation (such as with 1,2-dihaloethane).

It will be recognized that numerous salt forms of the compounds herein described are available and suitable for use in the invention or during the synthesis of compounds of the invention. The invention contemplates that in certain instances where stereoisomers are available that one such isomer can be more active than another; in such a case, it will be desirable to isolate the particular isomeric form. The invention, of course, encompasses both the particular stereoisomers and racemic mixtures. As described herein, chemical approaches, starting with for example commercially available, optically pure starting materials (or made using enantioselective reactions), can also used to synthesize optically pure versions of the compounds of the invention. It will be recognized that such optically pure compounds are within the invention. Enantiomeric excess (“ee”) can be enhanced by purification techniques such as crystallization or chromatography on chiral supports. Enantiomeric excess can be quantitated by a number of analytic techniques including NMR, optical rotation measures and appropriate chromatography.

Additional, related compounds are described in two U.S. patent applications were filed concurrently with a parent hereof as U.S. Ser. No. 08/655,912 (Ognyanov et al.), U.S. Ser. No. 08/655,847 (Ognyanov et al.), U.S. Ser. No. 08/808,755 (PHARMACEUTICAL FOR TREATMENT OF NEUROPSYCHIATRIC AND NEUROLOGICAL DISORDERS, Ognyanov et al.) and U.S. Ser. No. 08/807,681 (PHARMACEUTICAL FOR TREATING OF NEUROLOGICAL AND NEUROPSYCHIATRIC DISORDERS, Ognyanov et al.), which applications are also incorporated herein by reference in their entirety. Further incorporated by reference in its entirety are U.S. application Ser. No. 08/655,912 (Ognyanov et al.) and are U.S. application Ser. No. 08/808,754 (Ognyanov et al.) the parents of the present application.

In a preferred embodiment, at least one of the following applies:

if R15 is hydrogen and R1 is propylene, then at least one [preferably at least two, more preferably at least three] of the following applies (1) both Rx and Ry are not p-fluorophenyl, (2) one of Rx and Ry includes a heteroaryl, (3) Ry is arylalkyl, heteroarylalkyl, aryloxy, heteroaryloxy, arylmethoxy, heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (4) R2 is Rxa Rxb—, (5) R2* is not hydrogen, (6) R3 is not hydrogen, (7) n is one, or (8) R3 and R4 form ring Q;

if R15 is hydrogen and R1 is ethylene or X—R1 is prop-1-enylene, then at least one [preferably at least two, more preferably at least three] of the following applies (1) an aryl of at least one of Rx and Ry is substituted with a radical different from hydrogen, (2) one of Rx and Ry comprises a heteroaryl, (3) Ry is arylalkyl, heteroarylalkyl, aryloxy, heteroaryloxy, arylmethoxy, heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (4) R2 is Rxa Rxb—, (5) R2* is not hydrogen, (6) R3 is not hydrogen, (7) n is one, or (8) R3 and R4 form ring Q;

if R5 is C(O)NH2, then at least one [preferably at least two, more preferably at least three] of the following applies (1) an aryl of at least one of Rx and Ry is substituted with a radical different from hydrogen, (2) one of Rx and Ry comprises a heteroaryl, (3) Ry is arylalkyl, heteroarylalkyl, aryloxy, heteroaryloxy, arylmethoxy, heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (4) R2 is Rxa Rxb—, (5) R2* is not hydrogen, (6) R3 is not hydrogen, (7) n is one, (8) R1 is not ethylene, or (9) R3 and R4 form ring Q;

if R13 is hydrogen and R14 is (3,4-dihydro-2H-1-benzopyran-4-yl)methylene, then at least one [preferably at least two, more preferably at least three] of the following applies (1) an aryl of at least one of Rx and Ry is substituted with a radical different from hydrogen, (2) one of Rx and Ry comprises a heteroaryl, (3) Ry is arylalkyl heteroarylalkyl, aryloxy, heteroaryloxy, arylmethoxy, heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (4) R2 is Rxa Rxb—, (5) R2* is not hydrogen, (6) R3 is not ethyl, (7) n is one, or (8) R3 and R4 form ring Q; and

if R2 is phenyl, p-methylphenyl or p-methoxyphenyl, then at least one [preferably at least two, more preferably at least three] of the following applies (1) the aryls of Rx and Ry are not substituted with p-methylphenyl or p-methoxyphenyl, (2) an aryl of at least one of Rx and Ry is substituted with a radical different from hydrogen, (3) one of Rx and Ry comprises a heteroaryl, (4) Ry is arylalkyl, heteroarylalkyl, aryloxy, heteroaryloxy, arylmethoxy, heteroarylmethoxy, arylthio, heteroarylthio, arylmethylthio, heteroarylmethylthio, Ar—N(R6)— or Ar—CH2—N(R6*)—, (5) R1 is not aminoethylene, OR8 or SR8*, (6) n is one, or (7) R3 and R4 form ring Q.

In one preferred embodiment of the the methods, particularly treating or preventing epilepsy or spasticity or enhancing memory, the compound conforms with paragraph (f), above.

The glycine transporter genes and their respective gene products are responsible for the reuptake of glycine from the synaptic cleft into presynaptic nerve endings or glial cells, thus terminating the action of glycine. Neurological disorders or conditions associated with improperly controlled glycine receptor activity, or which could be treated with therapeutic agents that modulate glycine receptor activity, include spasticity (Becker, FASEB Journal, 4, 2767-2774 (1990)) and pain realization (Yaksh, Pain, 37, 111-123 (1989)). Additionally, glycine interacts at N-methyl-D-aspartate (NMDA) receptors, which have been implicated in learning and memory disorders and certain clinical conditions such as epilepsy, Alzheimer's and other cognition-related diseases, and schizophrenia. See Rison and Stanton, Neurosci. Biobehav. Rev., 19, 533-552 (1995); Danysz et al., Behavioral Pharmacol., 6, 455-474 (1995).

Compounds that inhibit GlyT-1 mediated glycine transport will increase glycine concentrations at NMDA receptors, which receptors are located in the forebrain, among other locations. This concentration increase elevates the activity of NMDA receptors, thereby alleviating schizophrenia and enhancing cognitive function. Alternatively, compounds that interact directly with the glycine receptor component of the NMDA receptor can have the same or similar effects as increasing or decreasing the availability of extracellular glycine caused by inhibiting or enhancing GlyT-1 activity, respectively. See, for example, Pitkänen et al., Eur. J. Pharmacol., 253, 125-129 (1994); Thiels et al., Neuroscience, 46, 501-509 (1992); and Kretschmer and Schmidt, J. Neurosci., 16, 1561-1569 (1996). Compounds that inhibit GlyT-2 mediated glycine transport will increase glycine concentrations at receptors located primarily in the brain stem and spinal cord, where glycine acts as an inhibitor of synaptic transmission. These compounds are effective against epilepsy, pain and spasticity, myospasm and other such conditions. See, for example, Becker, FASEB J. 4, 2767-2774 (1990) and Yaksh, Pain, 37, 111-123 (1989).

The compounds of the invention are, for instance, administered orally, sublingually, rectally, nasally, vaginally, topically (including the use of a patch or other transdermal delivery device), by pulmonary route by use of an aerosol, or parenterally, including, for example, intramuscularly, subcutaneously, intraperitoneally, intraarterially, intravenously or intrathecally. Administration can be by means of a pump for periodic or continuous delivery. The compounds of the invention are administered alone, or are combined with a pharmaceutically-acceptable carrier or excipient according to standard pharmaceutical practice. For the oral mode of administration, the compounds of the invention are used in the form of tablets, capsules, lozenges, chewing gum, troches, powders, syrups, elixirs, aqueous solutions and suspensions, and the like. In the case of tablets, carriers that are used include lactose, sodium citrate and salts of phosphoric acid. Various disintegrants such as starch, and lubricating agents such as magnesium stearate and talc, are commonly used in tablets. For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols. If desired, certain sweetening and/or flavoring agents are added. For parenteral administration, sterile solutions of the compounds of the invention are usually prepared, and the pHs of the solutions are suitably adjusted and buffered. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic. For ocular administration, ointments or droppable liquids may be delivered by ocular delivery systems known to the art such as applicators or eye droppers. Such compositions can include mucomimetics such as hyaluronic acid, chondroitin sulfate, hydroxypropyl methylcellulose or polyvinyl alcohol, preservatives such as sorbic acid, EDTA or benzylchromium chloride, and the usual quantities of diluents and/or carriers. For pulmonary administration, diluents and/or carriers will be selected to be appropriate to allow the formation of an aerosol.

Suppository forms of the compounds of the invention are useful for vaginal, urethral and rectal administrations. Such suppositories will generally be constructed of a mixture of substances that is solid at room temperature but melts at body temperature. The substances commonly used to create such vehicles include theobroma oil, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weight and fatty acid esters of polyethylene glycol. See, Remington's Pharmaceutical Sciences, 16th Ed., Mack Publishing, Easton, Pa., 1980, pp. 1530-1533 for further discussion of suppository dosage forms. Analogous gels or cremes can be used for vaginal, urethral and rectal administrations.

Numerous administration vehicles will be apparent to those of ordinary skill in the art, including without limitation slow release formulations, liposomal formulations and polymeric matrices.

Examples of pharmaceutically acceptable acid addition salts for use in the present invention include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric and sulfuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, p-toluenesulphonic and arylsulphonic acids, for example. Examples of pharmaceutically acceptable base addition salts for use in the present invention include those derived from non-toxic metals such as sodium or potassium, ammonium salts and organoamino salts such as triethylamine salts. Numerous appropriate such salts will be known to those of ordinary skill.

The physician or other health care profesional can select the appropriate dose and treatment regimen based on the subjects weight, age, and physical condition. Dosages will generally be selected to maintain a serum level of compounds of the invention between about 0.01 μg/cc and about 1000 μg/cc, preferably between about 0.1 μg/cc and about 100 μg/cc. For parenteral administration, an alternative measure of preferred amount is from about 0.001 mg/kg to about 10 mg/kg (alternatively, from about 0.01 mg/kg to about 10 mg/kg), more preferably from about 0.01 mg/kg to about 1 mg/kg (from about 0.1 mg/kg to about 1 mg/kg), will be administered. For oral administrations, an alternative measure of preferred administration amount is from about 0.001 mg/kg to about 10 mg/kg (from about 0.1 mg/kg to about 10 mg/kg), more preferably from about 0.01 mg/kg to about 1 mg/kg (from about 0.1 mg/kg to about 1 mg/kg). For administrations in suppository form, an alternative measure of preferred administration amount is from about 0.1 mg/kg to about 10 mg/kg, more preferably from about 0.1 mg/kg to about 1 mg/kg.

For use in assaying for activity in inhibiting glycine transport, eukaryokic cells, preferably QT-6 cells derived from quail fibroblasts, have been transfected to express one of the three known variants of human GlyT-1, namely GlyT-1a, GlyT-1b or GlyT-1c, or human GlyT-2. The sequences of these GlyT-1 transporters are described in Kim et al., Molec. Pharm. 45: 608-617, 1994, excepting that the sequence encoding the extreme N-terminal of GlyT-1a was merely inferred from the corresponding rat-derived sequence. This N-terminal protein-encoding sequence has now been confirmed to correspond to that inferred by Kim et al. The sequence of the human GlyT-2 is described by Albert et al., U.S. application Ser. No. 08/700,013, filed Aug. 20, 1996, which is incorporated herein by reference in its entirety. Suitable expression vectors include pRc/CMV (Invitrogen), Zap Express Vector (Stratagene Cloning Systems, LaJolla, Calif.; hereinafter “Stratagene”), pBk/CMV or pBk-RSV vectors (Stratagene), Bluescript II SK+/− Phagemid Vectors (Stratagene), LacSwitch (Stratagene), pMAM and pMAM neo (Clontech), among others. A suitable expression vector is capable of fostering expression of the included GlyT DNA in a suitable host cell, preferably a non-mammalian host cell, which can be eukaryotic, fungal, or prokaryotic. Such preferred host cells include amphibian, avian, fungal, insect, and reptilian cells.

As discussed above, the compounds of the invention have a number of pharmacological actions. The relative effectiveness of the compounds can be assessed in a number of ways, including the following:

comparing the activity mediated through GlyT-1 and GlyT-2 transporters. This testing identifies compounds (a) that are more active against GlyT-1 transporters and thus more useful in treating or preventing schizophrenia, increasing cognition and enhancing memory or (b) that are more active against GlyT-2 transporters and thus more useful in treating or preventing epilepsy, pain, spasticity or myospasm.

testing for NMDA receptor binding. This test establishes whether there is sufficient binding at this site, whether antagonist or agonist activity, to warrant further examination of the pharmacological effect of such binding.

testing the activity of the compounds in enhancing or diminishing calcium fluxes in primary neuronal tissue culture. A test compound that increases calcium flux either (a) has little or no antagonist activity at the NMDA receptor and should not affect the potentiation of glycine activity through GlyT-1 transporter inhibition or (b), if marked increases are observed over GlyT-1 inhibitors used for comparison and that have little direct interaction with NMDA receptors, then the compound is a receptor agonist. In either of the above-described cases, the test confirms activity in treating or preventing schizophrenia, increasing cognition, or enhancing memory. In contrast, a test compound that decreases calcium flux has a net effect wherein receptor antagonist activity predominates over any activity the compound has in increasing glycine activity through inhibiting glycine transport. In this case, the test confirms activity in limiting or preventing the cell damage and cell death arising after stroke or other ischemia-inducing conditions, or in limiting or preventing the cell damage associated with neurodegenerative diseases.

All animal methods of treatment or prevention described herein are preferably applied to mammals, most preferably humans.

The following examples further illustrate the present invention, but of course, should not be construed as in any way limiting its scope.

EXAMPLE 1 Synthesis of N-[(4,4-Diphenyl)but-3-enyl]glycine Ethyl Ester (Compound A26)

A mixture of 5.95 g (20.7 mmol) 4-bromo-1,1-diphenyl-1-butene (prepared as described in F. A. Ali et al., J. Med. Chem. 28: 653-660, 1985), 4.71 g (33.7 mmol) glycine ethyl ester hydrochloride (Aldrich, Milwaukee, Wis.), 11.62 g (84 mmol) potassium carbonate and 1.06 g (6.38 mmol) potassium iodide in 50 ml acetonitrile was refluxed with stirring under argon for seven hours. The reaction mixture was filtered, the solvent evaporated and the residue chromatographed on silica gel column with 20% ethyl acetate in hexanes to give 3.70 g (yield 58%) of N-[(4,4-diphenyl)but-3-enyl]glycine ethyl ester (compound A26) as an oil. NMR spectra of the product showed: 1H NMR (CDCl3, 300 MHz) 7.60-7.00 (m, 10 H), 6.09 (t, 1 H), 4.16 (q, 2 H), 3.35 (s, 2 H), 2.71 (t, 2 H), 2.32 (dt, 2 H), 1.25 (t, 3 H), 13C NMR (CDCl3, 75 MHz) 172.29, 143.25, 142.37, 139.82, 129.72, 128.13, 128.04, 127.97, 127.13, 126.92, 126.88, 126.68, 60.56, 50.73, 49.32, 30.33, 14.14.

EXAMPLE 2 Additional Syntheses According to Reaction 1

Additional compounds were synthesized using Reaction 1, as follows:

Amino acid or
Compound Reagent precusor Solvent Yield
A1 1 B X 27%
A2 1 C X 35%
A7 7 E X  9%
A9 4 E X 47%
A11 1 A X 70%
A12 4 E X  7%
A14 2 D X 15%
A18 6 E X 50%
A23 5 E X 26%
A24 3 D Y 20%
A43 8 F X 12%
A52 9 F X 28%
A57 10 F X 31%
A67 11 F X 10%
A71 12 E X 28%
A75 13 F X 73%
A77 14 F X 36%
A85 15 F X 86%
A87 16 F X 59%
A90 17 E X 16%
A95 17 F X 65%
A96 17 E X 50%
A104 15 E X 62%
A106 18 F X 65%
A121 19 E X  3%
A122 19 E X 40%
A123 19 F X 72%
A130 20 E X  6%
A132 21 F X 90%
A134 21 E X 67%
A170 6 F X 72%
A48 22 F x 87%
A50 23 F X 81%
A53 24 F X 76%
A59 25 F X 77%
A61 26 F X 91%
A63 27 F X 91%
A70 28 F X 89%
A73 29 F X 86%
A74 30 F X 76%
A78 31 F X 49%
A80 32 F X 66%
A82 33 F X 38%
A83 33 E X 25%
A88 34 F X 55%
A89 35 F X 75%
A99 36 F X 56%
A100 37 F X 67%
A111 38 F X 34%
A117 39 F X 58%
A118 40 F X 89%
A120 41 F X 62%
A125 42 F X 46%
A126 43 E X 57%
A127 44 E X  5%
A128 44 E X 53%
A129 44 F X 66%
A138 45 F X 48%
A140 46 F X 69%
A141 47 F X 51%
A142 48 F X 67%
A143 49 F X 61%
A145 50 F X 98%
A155 51 F X 70%
A156 52 F X 65%
A158 53 F X 59%
A159 54 F X 85%
A160 55 F X 87%
A171 56 F X 88%
A173 57 F X 81%
A177 58 F X 84%
A178 58 F X 60%
A179 59 F X 68%
A180 24 G X 85%

Reagent: 1) 4-bromo-1,1-diphenyl-1-butene, (prepared as described in F. A. Ali et al., J. Med. Chem., 28: 653-660, 1985); 2) 1,1′-(4-chlorobutylidene)bis(4-fluorobenzene), (Acros Organics, Pittsburgh, Pa.); 3) benzhydryl 2-bromoethyl ether, (prepared as described in M. R. Pavia et al., J. Med. Chem. 35: 4238-4248, 1992); 4) 9-fluorenylethanol p-toluenesulfate, [prepared by LiAlH4 reduction of 9-fluoreneacetic acid methyl ester (Aldrich) to 2-(9-fluorenyl)ethanol, followed by tosylation[; 5) 4-bromo-2,2-diphenyl butyronitrile (Aldrich); 6) 3-bis(4-fluorophenyl)propanol p-toluenesulfate [prepared by alkylation of diethyl malonate (Aldrich) with chlorobis(4-fluorophenyl)methane (Aldrich) followed by hydrolysis and decarboxylation, LiAlH4 reduction of the monocarboxylic acid, and tosylation of the formed alcohol]; 7) 10-(3-bromo-2-hydroxypropyl)phenothiazine [prepared essentially as described in British Patent 800,635]; 8) 3-tris(4-fluorophenyl)propanol p-toluenesulfonate prepared by alkylation of diethyl malonate (Aldrich) with 4,4′,4″-trifluorotrityl bromide (TCI America, Portland, Oreg.) followed by hydrolysis and decarboxylation, LiAlH4 reduction of the monocarboxylic acid, and tosylation of the formed alcohol]; 9) 3-cyclohexyl-3-phenylpropanol p-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium ylide of triethyl phosphonoacetate (Aldrich) with cyclohexyl phenyl ketone (Aldrich) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 10) 3-tris(4-methoxyphenyl)propanol p-toluenesulfonate [prepared by alkylation of diethyl malonate (Aldrich) with 4,4′,4″-trimethoxytrityl chloride (Aldrich) followed by hydrolysis and decarboxylation, LiAlH4, reduction of the monocarboxylic acid, and tosylation of the formed alcohol]; 11) 3-bis(3-fluorophenyl)propanol p-toluenesulfonate prepared by Horner-Emmons reaction of the sodium ylide of triethyl phosphonoacetate (Aldrich) with 3,3′-difluorobenzophenone (Aldrich) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 12) 3,5-diphenylpentanol p-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium ylide of triethyl phosphonoacetate (Aldrich) with 3-phenylpropiophenone (Pfaltz & Bauer Chemicals Catalog, Waterbury, Conn.) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 13) 3-bis(4-phenoxyphenyl)propanol p-toluenesulfonate [prepared by Homer-Emmons reaction of the sodium ylide of triethyl phosphonoacetate (Aldrich) with 4,4′-diphenoxybenzophenone (Lancaster, Windham, N.H.) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 14) 3-bis(4-biphenyl)propanol p-toluenesulfonate [prepared by Homer-Emmons reaction of the sodium ylide of triethyl phosphonoacetate (Aldrich) with 4-benzoylbiphenyl (Aldrich) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 15) 3-(4-tert-butylphenyl-3-phenypropanol p-toluenesulfonate [prepared by Homer-Emmons reaction of the sodium ylide of triethyl phosphonoacetate with 4-tert-butylbenzophenone (Aldrich) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 16) 3,3,3-tris(4-chlorophenyl)propanol p-toluenesulfonate [prepared by LiAlH4 reduction of 3,3,3-tris(4-chloropropionic acid) (Aldrich) followed by tosylation of the formed alcohol]; 17) 3-(2-naphthyl)-3-phenyl)propanol p-toluenesulfonate [prepared by Horner-Emmons reaction of the sodium ylide of triethyl phosphonoacetate with 2-benzoylnaphthalene (Aldrich) followed by catalytic hydrogenation of the intermediate -unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol); 18) 3,3,3-triphenylpropanol p-toluenesulfonate [prepared by LiAlH4 reduction of 3,3,3-triphenylpropionic acid (Aldrich) followed by tosylation of the formed alcohol]; 19) 3-(4-phenylphenyl)-3-phenylpropanol p-toluenesulfonate [prepared by Homer-Emmons reaction of the sodium ylide of triethyl phosphonoacetate with 4-benzoylbiphenyl (Aldrich) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 20) 1,2-diphenylbutan-1,4-diol p-toluenesulfonate [prepared by C-alkylation of deoxybenzoin (Aldrich) with ethyl bromoacetate (Aldrich) followed by LiAlH4 reduction of the intermediate β-ketoester and tosylation of the formed diol]; 21) 3-phenyl-3-(4-trifluoromethylphenyl)propanol p-toluenesulfonate prepared by Horner-Emmons reaction of the sodium ylide of triethyl phosphonoacetate with 4-(trifluoromethyl)benzophenone (Aldrich) followed by catalytic hydrogenation of the intermediate α,β-unsaturated ester, LiAlH4 reduction and tosylation of the formed alcohol]; 22) 3-chloro-1-(4-tert-butylphenoxy)-1-(4-fluorophenyl)propane [prepared analogously to the method of U.S. Pat. No. 5,281,624 by reduction of 3-chloro-4′-fluoropropiophenone (Aldrich) with 1.0 M borane-tetrahydrofuran complex (“BTC”, Aldrich) followed by Mitzunobu reaction (diethyl azodicarboxylate (“DEAD”), Ph3P, see Example 8C, Step 1) of the resulting alcohol with 4-tert-butylphenol (Aldrich)]; 23) 3-chloro-1-(2-methyl-5-pyridyloxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone (Aldrich) with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 5-hydroxy-2-methylpyridine (Aldrich)]; 24) 3-chloro-1-(4-phenylphenoxy)-1-(4-fluorophenyl)propane [prepared by reduction of 3-chloro-4′-fluoropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-phenylphenol (Aldrich)]; 25) 3-chloro-1-(4-tert-octylphenoxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-tert-butylphenol]; 26) (R)-(+)-3-chloro-1-(4-phenylphenoxy)-1-phenylpropane [prepared by Mitzunobu reaction (DEAD, Ph3P) of (R)-(+)-3chloro-1-phenyl-1-propanol (Aldrich) with 4-phenylphenol (Aldrich)(see, e.g., U.S. Pat. No. 5,068,432) (Reaction illustrated in FIG. 3, Reaction 27)]; Compound A61 was prepared with [α]D 25+54.9° (c 5.28, CHCl3); 27) (S)(−)(-3chloro-1-(4-phenylphenoxy)-1-phenylpropane [prepared by Mitzunobu reaction (DEAD, Ph3P) of (S)-(−)-3-chloro-1-phenyl-1-propanol (Aldrich) with 4-phenylphenol (see U.S. Pat. No. 5,068,432); Compound A63 was prepared with [α]D 25−54.6 (c 7.13, CHCl3); 28) 3-chloro-1-(4-tert-butylphenoxy)-1-phenylpropane (prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-tert-butylphenol]; 29) 3-chloro-1-{4-[4-(trifluoromethyl)phenoxy]phenoxy}-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-[4-trifluoromethyl)phenoxy]phenol (Aldrich)]; 30) 3-chloro-1-[4-(phenoxy)phenoxy]-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-phenoxyphenol (Aldrich)]; 31) 3-chloro-1-[4-(4-bromophenyl)phenoxy]-1-(4-fluorophenyl)propane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-(4-bromophenyl)phenol (Aldrich)]; 32) 3-chloro-1-[4-[4-cyanophenyl)phenoxy]-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4′-hydroxy4-biphenylcarbonitrile (Aldrich)]; 33) 3-chloro-1-(3-trifluoromethylphenoxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 3-trifluoromethylphenol (Aldrich)]; 34) 3-chloro-12-naphthyloxy)-1-phenylpropane [prepared by reduction of 3chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 2-naphthol (Aldrich)]; 35) 3-chloro-1-1-naphthyloxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 1-naphthol (Aldrich)]; 36) 3-chloro-14-methylphenoxy)-1-phenylpropane [prepared by reduction of 3chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with p-cresol (Aldrich)]; 37) 3-chloro-1-(4-phenylphenoxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-phenylphenol]; 38) 3-chloro-1-(4-amidosulfonylphenoxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-hydroxybenzenesulfonamide, (TCI America, Portland, Oreg.)]; 39) 3chloro-1-(4-nitrophenoxy)-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-nitrophenol (Aldrich)]; 40) 3-chloro-1-(4-nitro-3-trifluoromethylphenoxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-nitro-3-trifluoromethylphenol (Aldrich)]; 41) 3-chloro-1-(4-cyanophenoxy)-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-cyanophenol (Aldrich)]; 42) 3-chloro-1-phenoxy-1-phenylpropane [prepared by reduction of 3-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with phenol (Aldrich)); 43) 3-chloro-1-(4-trifluoromethylphenoxy)-1-phenylpropane [prepared by reduction of 3chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-trifluoromethylphenol; 44) 3chloro-1-[(4-trifluoromethoxy)phenoxy]-1-phenylpropane [prepared by reducing 3-chloropropiophenone with 1.0 M BTC, and Mitzunobu reaction (DEAD, Ph3P) of resulting alcohol with 4(trifluoromethoxy)phenol (Aldrich)]; 45) 3-chloro-1-(4-trifluoromethylphenoxy)-1-(2,4-dimethoxy)phenylpropane [prepared by reduction of 3chloro 2′,4′-dimethoxypropiophenone (Maybridge Chemical Co. Ltd., Cornwall, UK) with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-trifluoromethylphenol]; 46) 3-chloro-]-(3,4-methylenedioxyphenoxy)-1-(4-chlorophenyl)propane [prepared by reduction of 3,4′-dichloropropiophenone (Aldrich) with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with sesamol (Aldrich)]; 47) 3chloro-1-phenoxy-1-(4-bromophenyl)propane [prepared by reduction of 4-bromo-p-chloropropiophenone (Lancaster) with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with phenol); 48) 3chloro-1-(4-trifluoromethylphenoxy)-14-bromophenyl)propane [prepared by reduction of 4-bromo-β-chloropropiophenone, with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-trifluoromethylphenol]; 49)3-chloro-1-(4-methoxyphenoxy)-1-(4chlorophenyl)propane [prepared by reduction of 3,4′-dichloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-methoxyphenol (Aldrich)]; 50) 3chloro-1-(4-cyanophenoxy)-1-(4chlorophenyl)propane [prepared by reducing 3,4′-dichloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-cyanophenol]; 51) 3-chloro-1-(4-chlorophenoxy)-1-(4-bromophenyl)propane [prepared by reduction of 4-bromo-β-chloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-chlorophenol (Aldrich)]; 52) 3-chloro-1-phenoxy-1-(4-chlorophenyl)propane [prepared by reduction of 3,4′-dichloropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with phenol]; 53) 3-chloro-1-(4-methoxyphenoxy)-1-(4-fluorophenyl)propane [prepared by reducing 3-chloro-4′-fluoropropiophenone with 1.0 M BTC, and Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-methoxyphenol]; 54) 3chloro-1-phenoxy-1-4-fluorophenyl)propane [prepared by reduction of 3-chloro-4′-fluoropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with phenol]; 55) 3-chloro-1-(1trifluoromethylphenoxy)-1-(4-fluorophenyl)propane prepared by reduction of 3chloro-4′-fluoropropiophenone with 1.0 M BTC followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting alcohol with 4-trifluoromethylphenol]; 56) (R)-(+)-3-chloro-1-(4-nitrophenoxy)-1-phenylpropane [prepared (see, e.g., U.S. Pat. No. 5,068,432) by Mitzunobu reaction (DEAD, Ph3P) of (R)-(+)3chloro-1-phenyl-1-propanol (Aldrich) with 4-nitrophenol]; Compound A171 was prepared with [α]D 25+19.7° (c 5.18, CHCl3); 57) (S)-(−)-3-chloro-]-(4-phenylphenoxy)-1-(4-flurophenyl)propane [prepared with [α]D 25−46.3° (c 2.49, CHCl3) analogously to U.S. Pat. No. 5,068,432 by reduction of 3-chloro-4′-fluoropropiophenone with (+) diisopinocampheylboron chloride (Aldrich) followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting (R)-(+)-3-chloro-1-(4-fluorophenyl)-1-propanol {[α]D 25+22.1° (c 8.07, CHCl3)} with 4-phenylphenol, (Aldrich)]; Compound A173 was prepared with [α]D 2525.8° (c 3.03, CHCl3); 58) (R)-(+)-3-chloro-1-(4-phenylphenoxy)-1-(4-fluorophenyl)propane [prepared with [α]D 25+46.6° (c 2.73, CHCl3) analogously to U.S. Pat. No. 5,068,432 by reduction of 3-chloro-4′-fluoropropiophenone with (−) diisopinocampheylboron chloride (Aldrich) followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting (S)-(−)-3-chloro-1-(4-fluorophenyl)-1-propanol {[α]D 25−22.2° (c 2.37, CHCl3)} with 4-phenylphenol, (Aldrich)]; Compound A177 was prepared with [α]D 25+26.8° (c 3.10, CHCl3); Compound A178 was prepared with [α]D 25+20.0° (c 3.13,CHCl3); 59)(P)-(+)-3-chloro-1-[4-(1-adamantyl)phenoxy]-]-(4-flurophenyl)propane [prepared with [α]D 25+24.3° (c 2.19, CHCl3) analogously to U.S. Pat. No. 5,068,432 by reduction of 3-chloro-4-fluoropropiophenone with (−) diisopinocampheylboron chloride (Aldrich) followed by Mitzunobu reaction (DEAD, Ph3P) of the resulting (S)-(−)-3-chloro-1-(4-fluorophenyl)-1-propanol {[α]D 2522.2° (c 2.37, CHCl3)} with 4-(1-adamantyl)phenol, (Aldrich)]; Compound A179 was prepared with [α]D 25+17.8° (c 2.98, CHCl3).

Amino acid or amino acid precursor

A) L-alanine methyl ester hydrochloride, (Fluka, Ronkonkoma, N.Y.); B) D-alanine methyl ester hydrochloride (Aldrich); C) sarcosine methyl ester hydrochloride, (Lancaster, Windham, N.H.); D) glycine methyl ester hydrochloride (Aldrich); E) glycine ethyl ester hydrochloride (Aldrich); F) sarcosine ethyl ester hydrochloride (Aldrich); and G) methylaminoacetaldehyde dimethyl acetal (Aldrich).


X) acetonitrile; Y) methanol.

For the synthesis of A61, the reaction is illustrated in FIG. 3 (Reaction 28).

EXAMPLE 3 Synthesis of N-[(3,3-Diphenyl)propyl]glycine Ethyl Ester (Compound A22)

2.132 g (10.1 mmol) 3,3-diphenylpropylamine (Aldrich, Milwaukee, Wis.) was added to a mixture of 0.853 g (5.11 mmol) ethyl bromoacetate (Aldrich) and 2.7 g (19.57 mmol) potassium carbonate in 14 ml acetonitrile at rom temperature. The mixture was stirred under argon for 18 hours. The reaction mire was filtered, the solvent evaporated and the residue chromatographed on a silica gel column with 40% ethyl acetate in hexanes to give 1.05 g (yield 69%) N-[(3,3-diphenyl)propyl]glycine ethyl ester (Compound A22) as an oil. NMR spectra of the product showed: 1H NMR (CDCl3, 300 MHz) 7.40-7.10 (m, 10 H), 4.14 (q, 2 H),4.03 (t, 1 H),3.33 (s, 2 H), 2.56 (t, 2 H), 2.24 (dt, 2 H), 1.22 (t, 3 H); 13C NMR (CDCl3, 75 MHz) 172.44, 144.66, 128.43, 127.75, 126.15, 60.63, 50.93, 48.80, 47.92, 35.85, 14.17. 0.019 g of A28 was also isolated from the silica gel column.

EXAMPLE 4 Additional Syntheses Using Reaction 2

Additional compounds were synthesized using Reaction 2, as follows:

Compound Starting amine Reagent Solvent Yield
A5 1 A X 27%
A6 7 B Y 89%
A10 9 B Y 77%
A13 8 B Y 95%
A15 6 B Y 96%
A17 3 B X 14%
A19 1 C X 69%
A20 2 E X 57%
A21 1 B X 55%
A30 1 H X 42%
A33 1 D X 20%
A34 1 G X  7%
A35 1 F X 18%
A36 5 B X 80%
A37 4 B X 77%
A38 1 E X 70%
A39 1 I X 10%
A40 1 J X  3%
A108 10 B X 56%
A150 2 K X 56%
A157 1 L X 30%
A162 1 K X 36%
A165 1 M X 59%
A166 1 N X 51%
A167 1 O X 50%
A172 1 P X 46%

Starting amine

1) Fluoxetine [N-methyl-3-p-trifluoromethylphenoxy)-3-phenylpropylamine hydrochloride], (Sigma, St. Louis); 2) 3,3-diphenylpropylamine (Aldrich); 3) Nisoxetine hydrochloride [(±)-γ-(2-methoxyphenoxy)—N-methyl-benzenepropanamine hydrochloride], (RBI, Natick, Mass.); 4) 1,2-diphenyl-3-methyl4-(methylamino)-2-butanol hydrochloride, (Sigma-Aldrich Library of Rare Chemicals); 5) d-Norpropoxyphene (1,2-diphenyl-3-methyl4-methylamino-2-butyl propionate maleate salt), (Sigma); 6) Maprotyline hydrochloride [N-Methyl-9,10-ethanoanthracene-9(10H)-propanamine hydrochloride], (Sigma); 7) Nortriptyline hydrochloride {3-(10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5-ylidene)—N-methyl-1-propanamine hydrochloride}, (Sigma); 8) Desipiramine hydrochloride {10,11-dihydro-N-methyl-5H-dibenz[b,f]azepine-5-propanamine hydrochloride}, (Sigma); 9) Protriptyline hydrochloride {N-Methyl-5H-dibenzo[a,d]cycloheptene-5-propanamine hydrochloride}, (Sigma); 10) 3-(1-naphthyl)-3-phenylpropylamine [prepared by Horner-Emmons reaction of the sodium ylide of diethyl cyanomethylphosphonate (Aldrich) with α-benzoylnaphthalene, (Pfaltz & Bauer, Waterbury, Conn.) followed by catalytic hydrogenation of the intermediate α,β-unsaturated nitrile].


A) methyl bromoacetate (Aldrich); B) ethyl bromoacetate (Aldrich); C) propyl bromoacetate (Aldrich); D) phenyl bromoacetate (Aldrich); E) 2-bromoacetamide (Aldrich); F) 2chloro-N,N-diethylacetamide (Aldrich); G) N-ethylchloroacetamide (Lancaster); H) bromoacetonitrile (Aldrich); 1) 4-(bromomethylsulfonyl)morpholine, (Sigma—Aldrich Library of Rare Chemicals); J) diethyl chloromethylphosphonate (Aldrich); K) benzyl 2-bromoacetate, (Aldrich); L) p-nitrophenyl bromoacetate, (Lancaster); M) octyl chloroacetate, (Sigma-Aldrich Library of Rare Chemicals); N) isopropyl bromoacetate, (Aldrich); 0) n-butyl bromoacetate, (Pfatz & Bauer), Waterbury, Conn.); P) tert-butyl bromoacetate, (Aldrich).


X) acetonitrile; Y) ethanol.

EXAMPLE 5A Synthesis of N-{[3-Hydroxy-3-phenyl-3-(thien-2-yl)]propyl}sarcosine Ethyl Ester (Compound A32)

Step 1

N-[(3-Oxo-3-phenyl)propyl]sarcosine ethyl ester: A mixture of 3.37 g (20 mmol) 3-chloropropiophenone (Aldrich), (3.07 g, (20 mmol) sarcosine ethyl ester hydrochloride, 3.32 g (20 mmol) potassium iodide and 2.5 g potassium carbonate in 140 ml acetonitrile was heated under reflux with stirring for 2 hours (see Reaction 13, FIG. 2). The reaction mixture was filtered and the solvent evaporated. The residue was dissolved in dichloromethane, washed with water and dried over sodium sulphate. Evaporation of the solvent gave N-[(3-oxo-3-phenyl)propyl]sarcosine ethyl ester as a yellow oil which was used in step 2 without purification.

Step 2

2-Thienyllithium [generated by adding 1 ml of butyllithium (2.5 M in tetrahydrofuran) to 0.21 g (2.5 mmol) thiophene in 10 ml tetrahydrofuran at −78° C.] was added dropwise into a solution of 0.623 g (2.5 mmol) of N-[(3-oxo-3-phenyl)propyl]sarcosine ethyl ester (from step 1) in 30 ml of tetrahydrofuran at −78° C. (see Reaction 14, FIG. 2). After stirring at −78° C. for 1 h and at 20° C. for 1 h, the reaction was quenched by adding 20 ml 10% ammonium hydroxide solution at 0° C. The mixture was extracted with methylene chloride, the solvent evaporated and the residue chromatographed on silica gel column with 16% ethyl acetate in hexanes to give 0.43 g (yield 52%) N-{[3-hydroxy-3-phenyl-3-(thien-2-yl)]propyl}sarcosine ethyl ester (compound A32) as a beige solid.

EXAMPLE 5B Synthesis of N-{[3-Hydroxy-3-phenyl-3-(furan-2-yl)]propyl}sarcosine Ethyl Ester (Compound A161)

N-{[3-Hydroxy-3-phenyl-3-(furan-2-yl)]propyl}sarcosine ethyl ester was synthesized essentially as described in Example 5A (replacing 2-thienyllithium with 2-furanyllithium) (yield 14%).

EXAMPLE 6 Synthesis of N-[3-Phenyl-3(thien-2-yl)2-propenyl]sarcosine Ethyl Ester (Compound A41)

N-{[3-Hydroxy-3-phenyl-3-(thien-2-yl)]propyl}sarcosine ethyl ester (Compound 32 from Example 5), 0.118 g (0.354 mmol) was dissolved in 2 ml of formic acid. The solution was heated at 110° C. for 0.5 hour (see Reaction 19, FIG. 2). The deep red reaction mixture was concentrated and the residue was partitioned between water and CH2Cl2. The aqueous phase was extracted with CH2Cl2 and the CH2Cl2 solution was dried over Na2SO4. After evaporating the solvent, the residue was purified by preparative TLC with 1:3 ethyl acetate:hexanes to give 0.091 g (82%) N-[3-phenyl-3-(thien-2-yl)-2-propenyl]sarcosine ethyl ester (Compound A41) as a deep red oil.

EXAMPLE 7 Synthesis of N-[3-Phenyl-3-(thien-2-yl)propyl]sarcosine Ethyl Ester (Compound A42)

0.055 g (0.174 mmol) N-[3-Phenyl-3-(thien-2-yl)-2-propenyl]sarcosine ethyl ester (Compound 41 from Example 6) was hydrogenated over 0.055 g 10% Pd/C in 2 ml of EtOH. The hydrogenation was conducted at 40 psi for 16 hours at room temperature (see Reaction 20, FIG. 2). After filtering off the catalyst the solution was concentrated and the residue was purified by preparative TLC with 1:2 ethyl acetate:hexanes to give 0.012 g (22%) N-[3-phenyl-3-(thien-2-yl)propyl]sarcosine ethyl ester (Compound A42) as a yellow oil.

EXAMPLE 8A Synthesis of N-[(3-Phenyl-3-phenoxy)propyl]sarcosine ethyl ester (compound A31)

Step 1

N-[(3-Hydroxy-3-phenyl)propyl]sarcosine ethyl ester: 2.40 ml of LiAl(t-BuO)3 [lithium tri-tert-butoxyaluminohydride (Aldrich) (1 M in THF)] was added into a solution of 0.593 g (2.38 mmol) N-[(3-oxo-3-phenyl)propyl]sarcosine ethyl ester (step 1 of Example 5A) in 10 ml of tetrahydrofuran at −78° C. (see Reaction 15 in FIG. 2). After stirring at -78° C. for 1 h and 1 h at room temperature, the reaction was quenched by adding 10 ml 10% ammonium chloride solution at 0° C. and filtered through celite. The mixture was extracted with methylene chloride and dried over sodium sulphate. Evaporation of the solvent gave N-[(3-hydroxy-3-phenyl)propyl]sarcosine ethyl ester as a yellow oil which was used in the next step without further purification.

Step 2

N-[(3-Chloro-3-phenyl)propyl]sarcosine ethyl ester: The yellow oil of step 1 was dissolved in 20 ml of chloroform, 1 ml of SOCl2 was added and the mixture heated under reflux for 2 h (see Reaction 16 in FIG. 2). After addition of crushed ice, the reaction mixture was neutralized with a saturated solution of potassium carbonate and extracted with methylene chloride. The combined extracts were evaporated and the residue purified by preparative silica gel TLC with 20% ethyl acetate in hexanes to give 0.165 g N-[(3-chloro-3-phenyl)propyl]sarcosine ethyl ester (yield 26% in two steps).

Step 3

N-[(3-Phenyl-3-phenoxy)propyl]sarcosine ethyl ester (compound A31): A solution of 0.075 g (0.278 mmol) N-[(3-chloro-3-phenyl)propyl]sarcosine ethyl ester (from step 2) in 3 ml of anhydrous dimethylformamide was added into a solution of sodium phenoxide (generated by adding 0.022 g of 60% NaH in mineral oil to 0.054 g phenol in 2 ml dimethylformamide) at room temperature (see Reaction 17 in FIG. 2). The reaction mixture was stirred at room temperature for 30 hours, the solvent was evaporated under vacuum and the residue purified by preparative silica gel TLC with 35% ethyl acetate in hexanes to give 0.014 g (yield 15%) N-[(3-phenyl-3-phenoxypropyl]sarcosine ethyl ester (compound A31) as a yellow oil.

EXAMPLE 8B Additional Syntheses Using the Procedure of Example 8A

Compound A164 was prepared by alkylation of 4-methoxyphenol (Aldrich) with N-(3-chloro-3-phenylpropyl)sarcosine ethyl ester as described above in Example 8A (Step 3)—yield 5%.

Compound A119 was prepared by alkylation of thiophenol (Aldrich) with N-(3-chloro-3-phenylpropyl)sarcosine ethyl ester as described above in Example 8A (Step 3) yield 62%.

Compound A115 was prepared by alkylation of 4-(trifluoromethyl)thiophenol (Lancaster) with N-(3-chloro-3-phenylpropyl)sarcosine ethyl ester as described above in Example 8A (Step 3)—yield 93%.

Compound A68 was prepared by alkylation of 4-tert-butylthiophenol (Lancaster) with N-(3-chloro-3-phenylpropyl)sarcosine ethyl ester as described above in Example 8A (Step 3)—yield 5%.

EXAMPLE 8C Synthesis of N-[3Phenyl-3-(phenylaminopropyl]sarcosine Ethyl Ester (Compound A47)

Step 1

N-[3-Phenyl-3-(p-toluenesulfonanilido)propyl]sarcosine ethyl ester: 0.465 g (2.67 mmol) diethyl azodicarboxylate (“DEAD”, Aldrich) was added dropwise to a solution of 0.511 g (2.03 mmol) N-(3-hydroxy-3-phenylpropyl)sarcosine ethyl ester (from Example 8A, Step 1), 0.571 g (2.31 mmol) p-toluenesulfonanilide, (TCI America, Portland, Oreg.) and 0.712 g (2.71 mmol) triphenylphosphine in 2 ml anhydrous tetrahydrofuran with stirring under nitrogen and cooling with an ice bath. The mixture was stirred at room temperature for 4 hours, the solvent evaporated and the residue chromatographed on silica gel with 25% ethyl acetate in hexanes to give 0.730 g (yield 74%) N-[3-phenyl-3-(p-toluenesulfonanilido)propyl]sarcosine ethyl ester. 1H NMR (CDCl3, 300 MHz) 7.58 (d, 2 H), 7.40-6.90 (m, 10 H), 6.62 (d, 2 H), 5.55 (t, 1 H), 4.14 (q, 2 H), 3.20 (s, 2 H), 2.60-2.20 (m, 2 H), 2.39 (s, 3 H), 2.33 (s, 3 H), 2.20-1.80 (m, 2 H), 1.12 (t, 3 H); 13C NMR (CDCl3, 75 MHz) 170.74, 142.90, 138.33, 138.08, 134.88, 132.78, 129.14, 128.60, 128.36, 128.28, 127.93, 127.79, 127.46, 60.51, 60.26, 58.57, 53.93, 42.16, 30.60, 21.36, 14.12.

Step 2

N-[3-Phenyl-3-(phenylamino)propyl]sarcosine ethyl ester (Compound A47): A solution of 0.284 g (0.6 mmol) N-[3-phenyl-3-(p-toluenesulfonanilido)propyl]sarcosine ethyl ester (from Step 1) in 3 ml anhydrous ethylene glycol dimethyl ether was added dropwise within 1 hour into solution of sodium naphthalenide [prepared from 0.545 g (5.04 mmol) naphthalene and 0.110 g (5.16 mmol) sodium) in 8 ml anhydrous ethylene glycol dimethyl ether with stirring under nitrogen and cooling with an ice bath. The mixture was stirred at room temperature for 1 hour, quenched with ice and extracted with ethyl acetate. The combined organic extracts were washed with brine, the solvent evaporated and the residue chromatographed on silica gel with 25% ethyl acetate in hexanes to give 0.092 g (yield 47%) N-[3-phenyl-3-(phenylamino)propyl]sarcosine ethyl ester (Compound A47). 1H NMR (CDCl3, 300 MHz) 7.50-7.00 (m, 7 H), 6.70-6.40 (m, 3 H), 5.75 (br. s, 1 H), 4.47 (t, 1 H), 4.18 (q, 2 H), 3.24 (s, 2 H), 2.57 (t, 2 H), 2.37 (s, 3 H), 2.10-1.70 (m, 2 H), 1.18 (t, 3 H); 13C NMR (CDCl3, 75 MHz) 170.73, 147.82, 143.89, 128.87, 128.43, 126.69, 126.26, 116.57, 113.17, 60.47, 58.53, 57.92, 54.47, 42.32, 35.19, 14.18.

EXAMPLE 8D Synthesis of [R]-(+)-N-[3-Phenyl-3-(4-tert-butylphenoxy)propyl]sarcosine Ethyl Ester (Compound A55) {[α]D 25+18.6° (c 7.84, CHCl3)}

Step 1

[S]-(−)-N-3-Hydroxy-3-phenylpropyl)sarcosine ethyl ester {[α]D 25−35° (c 4.88, CHCl3)}; prepared by alkylation of sarcosine ethyl ester with (R)-(+)-3-chloro-1-phenyl-1-propanol (Aldrich) under the conditions described in Example 1—yield 72%. See Reaction 23, FIG. 3.

Step 2

[R]-(+)-N-[3-Phenyl-3-(4-tert-butylphenoxy)propyl]sarcosine ethyl ester: prepared by Mitzunobu reaction (analogously to Example 8C, Step 1) of [S]-(−)-N-(3-hydroxy-3-phenylpropyl)sarcosine ethyl ester (from step 1) with 4-tert-butylphenol (Aldrich)—yield 41%; [α]D 25+18.6° (c 7.84, CHCl3). See Reaction 24, FIG. 3.

EXAMPLE 8E Synthesis of [R]-(+)-N-[3-Phenyl-3-(4-phenylphenoxy)propyl]sarcosine Ethyl Ester (Compound A61) {[α]D 25+22.3° (c 8.1. CHCl3)}

Another synthesis of compound A61 with [α]D 25+54.9° (c 5.28, CHCl3) was already described in Example 2.

Step 1

[S]-(−)—N-(3-Hydroxy-3-phenylpropyl)sarcosine ethyl ester: prepared analogously to the method of U.S. Pat. No. 5,068,432 by reduction of N-[(3-oxo3-phenyl)propyl]sarcosine ethyl ester (from step 1 of Example 5A) with (−) diisopinocampheylboron chloride (Aldrich)—yield 12%; [α]D 25−24.6° (c 3.63, CHCl3) (see Reaction 25, FIG. 3). Another synthesis of [S]-(−)-N-(3-hydroxy-3-phenylpropyl)sarcosine ethyl ester with [α]D 25 −35° (c 4.88, CHCl3) was already described in Example 8D (Step 1). See Reaction 23, FIG. 3.

Step 2

[R]-(+)—N-[3-Phenyl-3-(4-phenylphenoxy)propyl]sarcosine ethyl ester (Compound A61): prepared by Mitzunobu reaction (analogously to Example 8C, Step 1) of [S]-(−)—N-(3-hydroxy-3-phenylpropyl)sarcosine ethyl ester (from step 1) with 4-phenylphenol (Aldrich)—yield 22%; [α]D 25+22.3° (c 8.1, CHCl3). See Reaction 26, FIG. 3.

EXAMPLE 9A Synthesis of N-1(4,4-Diphenyl)but-3-enyl]-N-ethylglycine Ethyl Ester (Compound A16)

A mixture of 0.158 g (0.5 mmol) of N-[(4,4-diphenyl)but-3-enyl]glycine ethyl ester (Compound A26), 0.234 g (2.1 mmol) bromoethane, 0.281 g (2 mmol) potassium carbonate and 0.068 g (0.4 mmol) potassium iodide was stirred under argon for 20 hours at room temperature. The reaction mixture was filtered, the solvent evaporated, and the residue chromatographed on a silica gel column with 20% ethyl acetate in hexanes to yield 0.112 g (66%) N-[(4,4-diphenyl)but-3-enyl]-N-ethylglycine ethyl ester (Compound A16) as an oil. NMR spectra showed: 1H NMR (CDCl3, 300 MHz) 7.60-7.00 (m, 10 H), 6.09 (t, 1 H), 4.13 (q, 2 H), 3.27 (s, 2 H), 2.72 (t, 2 H), 2.61 (q, 2 H), 2.28 (dt, 2 H), 1.23 (t, 3 H), 1.01 (t, 3 H); 13C NMR (CDCl3, 75 MHz) 171.77, 142.96, 142.86, 140.33, 130.09, 128.49, 128.35, 127.48, 127.27, 127.19, 60.58, 54.90, 53.98, 48.20, 28.19, 14.57, 12.70.

EXAMPLE 9B Additional Syntheses Using the Procedure of Example 9A

Compound A147 was prepared by treatment of compound A150 with iodomethane under the conditions described in Example 9A—yield 30%.

EXAMPLE 10 Synthesis of N-[(4,4-Diphenyl)butyl]glycine Ethyl Ester (Compound A4)

0.072 g (0.23 mmol) of N-[(4,4 diphenyl)but-3-enyl]glycine ethyl ester (compound A26) was hydrogenated over 0.072 g 10% Pd/C in 5 ml ethanol under 40 psi for 3 hours at room temperature. The mixture was filtered from the catalyst through celite and the solvent evaporated to give 0.065 g (yield 90%) N-[(4,4-diphenyl)butyl]glycine ethyl ester (compound A4) as an oil. NMR spectra of the product showed: 1H NMR (CDCl3, 300 MHz) 7.40-7.10 (m, 10 ), 4.17 (q, 2 H), 3.89 (t, 1 H), 3.34 (s, 2 H), 2.61 (t, 2 H), 2.08 (dt, 2 H), 1.50-1.40 (m, 2 1), 1.25 (t, 3 H), 13C NMR (CDCl3, 75 MHz) 172.47, 144.89, 148.36, 127.77, 126.05, 60.63, 51.17, 50.90, 49.44, 33.19, 28.50, 14.17.

EXAMPLE 11 Additional Syntheses Using the Procedure of Example 10

Compound A25 was prepared by catalytic hydrogenation, using 10% palladium on carbon, of compound A2—yield 90%.

Compound A3 was prepared by catalytic hydrogenation, using 10% palladium on carbon, of compound A16—yield 90%.

EXAMPLE 12 Synthesis of N-[(4,4-Diphenyl)but-3enyl]glycine Hydrochloride (Compound A27)

To a solution of 0.093 g (0.3 mmol) of N-[(4,4-diphenyl)but-3-enyl]glycine ethyl ester (compound A26) in 2 ml methanol was added 3.4 ml 1N sodium hydroxide and the mixture was heated under reflux for four hours. The reaction mixture was concentrated to half volume, acidified with 4 N hydrochloric acid, and extracted 4 times with methylene chloride. The combined extracts were dried and evaporated to give 0.100 g (yield 86%) of N-[(4,4-diphenyl)but-3-enyl]glycine hydrochloride (compound A27). NMR spectra of the product showed: 1H NMR (CD3OD, 300 MHz) 7.40-7.00 (m, 10 H), 5.96 (t, I H), 3.81 (s, 1 H), 3.69 (s, 2 H, 3.04 (br.s, 2 H), 2.42 (br.s, 2 H); 13C NMR (CD3OD, 75 MHz) 166.78, 145.86, 145.82, 141.73, 139.34, 129.42, 128.42, 127.96, 127.41, 127.35, 127.02, 121.97, 121.87, 52.28, 26.43.

EXAMPLE 13A Additional Syntheses Using the Procedure of Example 12

The following N-modified amino acids were prepared by hydrolysis of the corresponding esters with 1N sodium hydroxide in methanol, or with 1N lithium hydroxide in ethanol at room temperature, followed by acidification with hydrochloric acid as described above in Example 12, where the parenthetical lists the starting ester, yield, and—where applicable, [α]D 25:

A8 (A4, 86%) A29 (A5, 70%) A44 (A48, 98%)
A45 (A53, 98%) A46 (A55, 98%, A49 (A50, 95%)
(c 2.4, CHCl3))
A51 (A52, 82%) A54 (A68, 52%) A56 (A57, 71%)
A58 (A59, 98%) A60 (A61, 80%, A62 (A63, 69%,
+25.3° −25.6
(c 2.13, MeOH) (c 2.4, MeOH))
A64 (A73, 90%) A65 (A74, 90%) A66 (A67, 60%)
A69 (A70, 99%) A72 (A75, 98%) A76 (A77, 75%)
A79 (A80, 62%) A81 (A89, 64%) A84 (A85, 93%)
A86 (A87, 98%) A91 (A71, 54%) A92 (A40, 90%)
A93 (A95, 95%) A94 (A96, 95%)
A98 (A100, 95%) A101 (A118, 53%) A102 (A108, 61%)
A103 (A104, 83%) A105 (A106, 86%) A107 (A115, 76%)
A109 (A123, 98%) A110 (A169, 68%) A112 (A117, 62%)
A113 (A119, 56%) A114 (A120, 98%) A116 (A122, 35%)
A124 (A126, 62%) A131 (A132, 82%) A135 (A134, 92%)
A136 (A145, 98%) A137 (A164, 85%) A144 (A158, 43%)
A152 (A156, 58%) A154 (A160, 98%) A174 (A43, 91%)
A175 (A171, 38%, A176 (A88, 61%) A181 (A173, 82%,
+10 −16.6°
(c 2.9, MeOH)) (c 3.11, MeOH))
A182 (A177, 78%, A183 (A178, 72%, A184 (A179, 98%,
+19.0° +13.7° +13.5°
(c 2.93, MeOH)) (c 2.68, MeOH)) (c 2.5, MeOH))

EXAMPLE 13B Synthesis of N-Methyl-N-[(1H-tetrazol-yl)methyl]-3,3-diphenylpropylamine Hydrochloride (Compound A146)

Step 1

A mixture of 2.11 g (10 mmol) 3,3-diphenylpropylamine (Aldrich), (0.54 g, 4.54 mmol) bromoacetonitrile (Aldrich), and 2.5 g potassium carbonate in 5 ml acetonitrile was stirred at room temperature for 16 hours. The reaction mixture was diluted with dichloromethane, washed with water, the solvent evaporated, and the residue chromatographed on silica gel column with 30% ethyl acetate in hexanes to give 1.24 g (yield 50%) N-cyanomethyl-3,3-diphenylpropylamine as an oil which solidified on standing. 1H NMR (CDCl3, 300 MHz) 7.45-7.10 (m, 10 H), 4.05 (t, 1 H), 3.50 (s, 2 H), 2.67 (t, 2 H), 2.23 (dt, 2H); 13C NMR (CDCl3, 75 MHz) 144.25, 128.53, 127.68, 126.33, 117.72, 48.58, 47.13, 37.19, 35.14.

Step 2

A mixture of 0.72 g (2.9 mmol) N-cyanomethyl-3,3-diphenylpropylamine (from step 1), 0.49 g (3.4 mmol) iodomethane and 1.6 g potassium carbonate in 5 ml acetonitrile was stirred at room temperature for 16 hours. The reaction mixture was diluted with dichloromethane, washed with water, the solvent evaporated, and the residue chromatographed on silica gel column with 20% ethyl acetate in hexanes to give 0.33 g (yield 43%) N-methyl-N-cyanomethyl-3,3-diphenylpropylamine as an oil which solidified on standing. 1H NMR ((CDCl3, 300 MHz) 7.30-7.10 (m, 10 H), 4.02 (t, 1 H, 3.47 (s, 3 H), 2.38 (t, 2 H), 2.32 (s, 3H), 2.19 (dt, 2H);

Step 3

A mixture of 0.132 g (0.5 mmol) N-methyl-N-cyanomethyl-3,3-diphenylpropylamine (from step 2) and 0.183 g (0.55 mmol) azidotributyltin (Aldrich) was stirred at 80° C. under argon for 16 hours. The reaction mixture was suspended with 1 M solution of hydrogen chloride in diethyl ether (Aldrich) and the precipitated yellow wax was purified by preparative TLC with 10% methanol in ethyl acetate to give 0.06 g (yield 35%) N-methyl-N-[(1H-tetrazol-5-yl)methyl]-3,3-diphenylpropylamine hydrochloride (Compound A146)as a white powder. 1H NMR (DMSO-d6, 300 MHz) 7.30-7.16(m, 10H),4.11 (s, 2H), 3.97 (t, I H), 2.60 (br. s, 2 H), 2.45 (s, 3H), 2.36 (br. s, 2H).

EXAMPLE 13C Additional Syntheses Using the Procedure of Example 13B

Compound A133 was prepared by treatment of compound A30 with azidotributyltin as described above in Example 13B (Step 3)—yield 11%.

EXAMPLE 13D Synthesis of Dimethyl(ethoxycarbonylmethyl)[3-phenyl-3-(4-trifluoromethylphenoxy)propyl]ammonium Iodide (Compound A148)

A solution of 0.152 g (0.38 mmol) N-[3-phenyl-3-(4-trifluoromethylphenoxy)propyl]sarcosine ethyl ester (Compound A2 ) and 0.273 g (1.93 mmol) iodomethane in 2 ml benzene was heated under reflux for 2 hours and the solvent evaporated. The residue was washed three times with anhydrous diethyl ether and dried under vacuum to give 0.175 g (yield 85%) dimethyl(ethoxycarbonylmethyl)[3-phenyl-3-(4trifluoromethylphenoxy)propyl]ammonium iodide (Compound A148) as a pale yellow hygroscopic powder.

EXAMPLE 14 Preparation of Cells Expressing GlyT-1 and GlyT-2

This example sets forth methods and materials used for growing and transfecting QT-6 cells.

QT-6 cells were obtained from American Type Culture Collection (Accession No. ATCC CRL-1708). Complete QT-6 medium for growing QT-6 is Medium 199 (Sigma Chemical Company, St. Louis, Mo.; hereinafter “Sigma”) supplemented to be 10% tryptose phosphate; 5% fetal bovine serum (Sigma); 1% penicillin-streptomycin (Sigma); and 1% sterile dimethylsulfoxide (DMSO; Sigma). Other solutions required for growing or transfecting QT-6 cells included:


450 μl TBS, 450 μl DEAE Dextran (Sigma), and 100 μl of DNA (4 μg) in TE, where the DNA includes GlyT-1a, GlyT-1b, GlyT-1c, or GlyT-2, in a suitable expression vector. The DNA used was as defined below.


Standard phosphate buffered saline, pH 7.4 including 1 mM CaCl2 and I mM MgCl2 sterilized through 0.2 g filter.


One ml of Solution B, 10 ml of Solution A; brought to 100 ml with distilled H2O; filter-sterilized and stored at 4° C.


0.01 M Tris, 0.001 M EDTA, pH 8.0.

DEAE dextran

Sigma, #D-9885. A stock solution was prepared consisting of 0.1% (1 mg/ml) of the DEAE dextran in TBS. The stock solution was filter sterilized and frozen in 1 ml aliquots.


Sigma, #C-6628. A stock solution was prepared consisting of 100 mM chloroquine in H2O. The stock solution was filter-sterilized and stored in 0.5 ml aliquots, frozen.

Solution A (10×)

NaCl 8.00 g
KCl 0.38 g
Na2HPO4 0.20 g
Tris base 3.00 g

The solution was adjusted to pH 7.5 with HCI, brought to 100.0 ml with distilled H2O, and filter-sterilized and stored at room temperature.

Solution B (100×)

CaCl2 · 2H2O 1.5 g
MgCl2 · 6H2O 1.0 g

The solution was brought to 100 ml with distilled H2O, and filter-sterilized; the solution was then stored at room temperature.


150 mM NaCl, 20 mM HEPES, 1 mM CaCl2, 10 mM glucose, 5 mM KCl, 1 mM MgCl2 H2O; adjusted with NaOH to pH 7.4.

Standard growth and passaging procedures used were as follows: Cells were grown in 225 ml flasks. For passaging, cells were washed twice with warm HBSS (5 ml each wash). Two ml of a 0.05% trypsin/EDTA solution was added, the culture was swirled, then the trypsin/EDTA solution was aspirated quickly. The culture was then incubated about 2 minutes (until cells lift off), then 10 ml of QT-6 media was added and the cells were further dislodged by swirling the flask and tapping its bottom. The cells were removed and transferred to a 15 ml conical tube, centrifuged at 1000×g for 10 minutes, and resuspended in 10 n11 of QT-6 medium. A sample was removed for counting, the cells were then diluted further to a concentration of 1×105 cells/ml using QT-6 medium, and 65 ml of the culture was added per 225 ml flask of passaged cells.

Transfection was accomplished using cDNA's prepared as follows:

The rat GlyT-2 (rGlyT-2) clone used contains the entire sequence of rGlyT-2 cloned into pBluescript SK+(Stratagene) as an Eco RI-Hind III fragment, as described in Liu et al., J. Biol. Chem. 26A 22802-22808 (1993). GlyT-2 was then subcloned into the pRc/RSV vector as follows: A PCR fragment corresponding to nucleotides 208 to 702 of the rGlyT-2 sequence was amplified by PCR using the oligonucleotide: 5′GGGGGAAGCTTATGGATTGCAGTGCTCC3′ as the 5′ primer and the oligonucleotide: 5′ GGGGGGGTACCCAACACCACTGTGCTCTG 3′ as the 3′ primer. This created a Hind III site immediately upstream of the translation start site. This fragment which contained a Kpn I site at the 3′ end, along with a Kpn 1-Pvu II fragment containing the remainder of the coding sequence of rGlyT-2, were cloned into pBluescript SK+ previously digested with Hind III and Sma I, in a three part ligation. A Hind III-Xba 1 fragment from this clone was then subcloned into the pRc/RSV vector. The resulting construct contains nucleotides 208 to 2720 of the rGlyT-2 nucleic acid in the pRc/RSV expression vector.

The human GlyT-1a (hGlyT-1a) clone used contains the sequence of hGlyT-1a from nucleotide position 183 to 2108 cloned into the pRc/CMV vector (Invitrogen, San Diego, Calif.) as a Hind III-Xba I fragment as described in Kim et al., Mol. Pharmacol. 45, 608-617, 1994. This cDNA encoding GlyT-1a actually contained the first 17 nucleotides (corresponding to the first 6 amino acids) of the GlyT-1a sequence from rat. To determine whether the sequence of human GlyT-1a was different in this region, the 5′ region of hGlyT-1a from nucleotide 1 to 212 was obtained by rapid amplification of cDNA end using the 5′ RACE system supplied by Gibco BRL (Gaithersburg, Md.). The gene specific primer: 5′ CCACATTGTAGTAGATGCCG 3′ corresponding to nucleotides 558 to 539 of the hGlyT-1a sequence, was used to prime cDNA synthesis from human brain mRNA, and the gene specific primer: 5′ GCAAACTGGCCGAAGGAGAGCTCC3′, corresponding to nucleotides 454 to 431 of the hGlyT-1a sequence, was used for PCR amplification. Sequencing of this 5′ region of GlyT-1a confirmed that the first 17 nucleotides of coding sequence are identical in human and rat GlyT-1a.

The human GlyT-1b (hGlyT-1b) clone used contains the sequence of hGlyT-1b from nucleotide position 213 to 2274 cloned into the pRc/CMV vector as a Hind III-Xba I fragment as described in Kim et al., Mol. Pharmacol. 45, 608-617, 1994.

The human GlyT-1c (hGlyT-1c) clone used contains the sequence of hGlyT-1c from nucleotide position 213 to 2336 cloned into the pRc/CMV vector (Invitrogen) as a Hind III-Xba I fragment as described in Kim et al., Mol. Pharmacol. 45, 608-617, 1994. The Hind III-Xba fragment of hGlyT-1c from this clone was then subcloned into the pRc/RSV vector. Transfection experiments were performed with GlyT-1c in both the pRc/RSV and pRc/CMV expression vectors.

The following four day procedure for the tranfections was used:

On day 1, QT-6 cells were plated at a density of 1×106 cells in 10 ml of complete QT-6 medium in 100 mm dishes.

On day 2, the media was aspirated and the cells were washed with 10 ml of PBS followed by 10 ml of TBS. The TBS was aspirated, and then 1 ml of the DEAE/DNA mix was added to the plate. The plate was swirled in the hood every 5 minutes. After 30 minutes, 8 ml of 80 μM chloroquine, in QT-6 medium was added and the culture was incubated for 2.5 hours at 37° C. and 5% CO2. The medium was then aspirated and the cells were washed two times with complete QT-6 media, then 100 ml complete QT-6 media was added and the cells were returned to the incubator.

On day 3, the cells were removed with trypsin/EDTA as described above, and plated into the wells of 96-well assay plates at approximately 2×105 cells/well.

On day 4, glycine transport was assayed (see Example 15).

EXAMPLE 15 Assay of Transport Via GlyT-1 or GlyT-2 Transporters

This example illustrates a method for the measurement of glycine uptake by transfected cultured cells.

Transient GlyT-transfected cells grown in accordance with Example 14 were washed three times with HEPES buffered saline (HBS). The cells were then incubated 10 minutes at 37° C., after which a solution was added containing 50 nM [3H]glycine (17.5 Ci/mmol) and either (a) no potential competitor, (b) 10 mM nonradioactive glycine or (c) a concentration of a candidate drug. A range of concentrations of the candidate drug was used to generate data for calculating the concentration resulting in 50% of the effect (e.g., the IC50s, which are the concentrations of drug inhibiting glycine uptake by 50%). The cells were then incubated another 10 minutes at 37° C., after which the cells were aspirated and washed three times with ice-cold HBS. The cells were harvested, scintillant was added to the cells, the cells were shaken for 30 minutes, and the radioactivity in the cells was counted using a scintillation counter. Data were compared between the same cells contacted or not contacted by a candidate agent, and between cells having GlyT-1 activity versus cells having GlyT-2 activity, depending on the assay being conducted.

EXAMPLE 16 Assay of Binding to NMDA Receptors

This example illustrates binding assays to measure interaction of compounds with the glycine site on the NMDA receptor.

Direct binding of [3H]glycine to the NMDA-glycine site was performed according to the method of Grimwood et al., Molecular Pharmacology 4, 923-930 (1992); Yoneda et al., J. Neurochem, 62, 102-112 (1994).

Preparation of membranes for the binding test required application of a series of standard methods. Unless otherwise specified, tissues and homogenates were kept on ice and centrifugations were conducted at 4° C. Homogenizations were conducted with an effort to minimize resulting rise in tissue/homogenate temperature. The membrane preparation included the following steps:

A. Sacrifice and decapitate four rats; remove cortices and hippocampi.

B. Homogenize tissue in twenty volumes of 0.32 M sucrose/5 mM Tris-Acetate (pH 7.4) with 20 strokes of a glass/teflon homogenizer.

C. Centrifuge tissue at 1000×g, 10 minutes. Save supernatant. Resuspend pellet in small volume of buffer and homogenize again. Centrifuge the homogenized pellet and combine the supernatant with the previous supernatant.

D. Centrifuge the combined supernatants at 40,000×g, for 30 minutes. Discard the supernatant.

E. Resuspend the pellet in 20 volumes of 5 mM Tris-Acetate (pH 7.4). Stir the suspension on ice for one hour. Centrifuge the suspension at 40,000×g for 30 minutes. Discard the supernatant and freeze the pellet for at least 24 hours.

F. Resuspend the pellet from step 5 in Tris Acetate buffer (5 mM, pH 7.4) containing 0.1% saponin (w/v; Sigma Chemical Co., St. Louis) to a protein concentration of 1 mg/ml. Leave on ice for 20 minutes. Centrifuge the suspension at 40,000×g for 30 minutes. Resuspend the pellet in saponin-free buffer and centrifuge again. Resuspend the pellet in Tris-Acetate buffer at a concentration of 10 mg/ml and freeze in aliquots.

G. On day three, remove an aliquot of membranes and thaw on ice. Dilute the suspension into 10 ml Tris-Acetate buffer and centrifuge at 40,000×g for 30 minutes. Repeat the wash step twice more for a total of 3 washes. Resuspend the final pellet at a concentration of 1 mg/ml in glycine-free Tris-Acetate buffer.

The binding test was performed in eppendorf tubes containing 150 μg of membrane protein and 50 nM [3H]glycine in a volume of 0.5 ml. Non-specific binding was determined with 1 mM glycine. Drugs were dissolved in assay buffer (50 mM Tris-acetate, pH 7.4) or DMSO (final concentration of 0.1%). Membranes were incubated on ice for 30 minutes and bound radioligand was separated from free radioligand by filtration on Whatman GF/B glass fiber filters or by centrifugation (18,000×g, 20 min). Filters or pellet was washed three times quickly with ice-cold 5 mM Tris-acetate buffer. Filters were dried and placed in scintillation tubes and counted. Pellets were dissolved in deoxycholate/NaOH (0.1 N) solution overnight, neutralized and radioactivity was determined by scintillation counting.

A second binding test for the NMDA-glycine site used [3H]dichlorokynurenic acid (DCKA) and membranes prepared as above. See, Yoneda et al., J. Neurochem., 60,634-645 (1993). The binding assay was performed as described for [3H]glycine above except that [3H]DCKA was used to label the glycine site. The final concentration of [3H]DCKA was 10 nM, and the assay was performed for 10 minutes on ice.

A third binding test used for the NMDA-glycine site used indirect assessment of affinity of ligands for the site by measuring the binding of [3H]MK-801 (dizocilpine). See, Palmer and Burns, J. Neurochem., 62, 187-196 (1994). Preparation of membranes for the test was the same as above. The binding assay allowed separate detection of antagonists and agonists.

The third binding test was operated to identify antagonists as follows: 100 μg of membranes were added to wells of a 96-well plate, along with glutamate (10 μM) and glycine (200 nM) and various concentrations of the ligand to be tested. The assay was started by the addition of 5 nM [3H]MK-801 (23.9 Ci/mmol), which binds to the ion channel associated with NMDA receptors. The final volume of the assay was 200 μl. The assay was performed for 1 hour at room temperature. Bound radioactivity was separated from free by filtration, using a TOMTEC harvester. Antagonist activity was indicated by decreasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand.

The third binding test was operated to identify agonists by performing the test as above, except that the concentration of glycine was 200 nM. Agonist activity was indicated by increasing radioactivity associated with the NMDA receptor with increasing concentration of the tested ligand.

EXAMPLE 17 Assay of Calcium Flux

This example illustrates a protocol for measuring calcium flux in primary neuronal calls.

The calcium flux measurement is performed in primary neuronal cell cultures, which are prepared from rat fetal cortices dissected from pregnant rats using standard procedures and techniques that require sterile dissecting equipment, a microscope and defined medium. The protocol used was adapted from Lu et al., Proc. Natl. Acad. Sci. USA, 88, 6289-6292 (1991).

Defined medium is prepared in advance in accordance with the following recipe:

Components Source (catalogue #) Final Concentration
D-glucose Sigma (G-7021) 0.6%
transferrin Sigma (T-2252) 100 μg/ml
insulin Sigma (I-5500) 25 μg/ml
progesterone Sigma (P-6149) 20 nM
putrescine Sigma (P-7505) 60 μM
selenium Sigma (S-5261) 30 nM
pen-strep▴ GIBCO (15070-014) 0.5 U-0.5 μg/ml
L-glutamine★ GIBCO (25030-016) 146 mg/l
MEM° GIBCO (11095 or 11090) 500 ml/l
F-12 GIBCO (11765) 500 ml/l
▴pen-strep: 5,000 U/ml penicillin and 5,000 μg/ml steptomycin
★add only when MEM without L-glutamine is used
°with L-glutamine or without L-glutamine, respectively

Before starting the dissection, tissue culture plates were treated with polylysine (100 μg/ml for at least 30 minutes at 37° C.) and washed with distilled water. Also, a metal tray containing two sets of sterile crude dissecting equipment (scissors and tweezers) and several sets of finer dissecting tools was autoclaved. A pair of scissors and tweezers were placed into a sterile beaker with 70% alcohol and brought to the dissecting table. A petri dish with cold phosphate buffered saline (PBS) was placed on ice next to the place of dissection.

A pregnant rat (E15 or 16 on arrival from Hilltop Lab Animals (Scottdale, Pa.), E17 or 18 at dissection) was placed in a CO2/dry ice chamber until it was unconscious. The rat was removed, pinned to a backing, the area of dissection was swabbed with 70% alcohol, and skin was cut and removed from the area of interest. A second pair of scissors was used to cut through and remove the prenatal pups in their sacs. The string of sacs was placed into the cold PBS and transported to a sterile hood.

The prenatal pups were removed from the sacs and decapitated. The skulls were then removed and the brains were carefully dislodged and placed into a clean petri dish with cold PBS. At this point, it was necessary to proceed with a dissecting microscope. The brain was turned so that the cortices were contacting the plate and the tissue between the dissector and the cortex (striatum and other brain parts) was scooped out. The hippocampus and olfactory bulb were cut away from the cortex. Then the tissue was turned over and the meninges were removed with tweezers. The remaining tissue (cortex) was placed in a small petri dish with defined media.

The tissue was chopped with a scalpel and then triturated with a glass pipet that had been fire polished. The chopped, triturated tissue was then transferred to a sterile plastic tube and continued to be triturated with a glass pipet with a finer opening. Cells were counted in a suitable counting chamber. Cells were plated at roughly 40,000 cells/well in 100 μl of defined medium for 96-well plates, 200,000 cells/well in 500 μl in 24-well plates, 400,000 cells/well in 1 ml in 12-well plates, 1.5×108 cells/35 mm dish in 1.5 μl and 10×108 cells/100 mm dish in 10 ml. To inhibit glia growth, cultures were treated with 100 μM 5-flouro-2-deoxyuridine (FDUR, Sigma (F-0503)) or 50/μM uridine (Sigma (U-3003)) and 50 μM FDUR.

The cortical cultures for the standard calcium flux assay were grown in 24-well plates in the defined medium described above for 7 days and fed once with serum coining media (10% heat inactivated fetal calf serum, 0.6% glucose in MEM) by exchanging half of the medium. Cultures were used after 12 days of incubation in vitro. The cultures were rinsed three times with HCSS (i.e. HEPES-buffered control salt solution, containing 120 MM NaCl, 5.4 mM KCl, 1.8 mM CaCl2 25 mM HEPES, and 15 mM glucose, in HPLC water and adjusted to pH 7.4 by NaOH, which was also made in HPLC water). In the third wash, the culture was incubated at 37° C. for 20 to 30 minutes.

Solutions containing 45Ca++ (5000 dpm/ml) and drugs for testing or controls were prepared in HCSS. Immediately before the above 45Ca++ solutions were added, cultures were washed twice with HCSS, and 250 μl of 45Ca++ solution per well was added, one plate at a time. The cultures were incubated for 10 minutes at room temperature, rinsed three times with HCSS, and 1 ml scintillation liquid per well was added, followed by shaking for at least 15 minutes. Retained radioactivity was counted in a scintillation counter.

EXAMPLE 18 Synthesis of N-(3-Cyano-3,3-diphenyl)propyl-2-piperidinecarboxylic Acid Methyl Ester (Compound B9)

A mixture of 0.3 g (1 mmol) of 4-bromo2,2diphenyl butyronitrile (Aldrich, Milwaukee, Wis.), 0.359 g (2 mmol) methyl pipecolinate hydrochloride (Aldrich), 0.553 g (4 mmol) potassium carbonate and 0.166 g (1 mmol) potassium iodide in 5 ml acetonitrile was refluxed under argon for 20 hours. The reaction mixture was filtered, the solvent evaporated and the residue chromatographed on silica gel column with 30% ethyl acetate in hexanes to give 0.173 g (yield 48%) of N-(3-cyano-3,3-diphenyl)propyl-2-piperidinecarboxylic acid methyl ester (compound B9) as an oil. NMR spectra of the product showed: 1H NMR (CDCl3, 300 MHz) 7.50-7.20 (m, 10H), 3.58 (s. 3 H), 3.10-3.00 (m, 2H), 2.70-2.50(m, 3 H), 2.50-2.35 (m, 1 H), 2.25-2.10 (m, 1 H), 1.90-1.50 (m, 4 H), 1.40-1.20 (m, 2 H); 13C NMR (CDCl3, 75 MHz) 173.59, 140.00, 139.00, 128.71, 127.72, 126.58, 126.46, 121.73, 103.85, 65.09, 52.88, 51.47, 50.92, 49.70, 36.35, 29.27, 24.82, 22.27.

EXAMPLE 19 Additional Syntheses Using Reaction 1

Additional compounds were synthesized using Reaction 1 as follows:

Compound Reagent Aminoacid Solvent Yield
B1 A 1 X 70%
B2 E 1 X 28%
B3 B 2 Y 13%
B4 B 1 X 57%
B6 C 3 Z 24%
B7 C 1 Z 48%
B8 D 1 X 77%
B11 D 4 X 61%
B12 B 3 X 43%
B13 B 4 X 39%
B14 C 5 Z 63%
B17 F 1 X 65%

Reagent: A) 1,1′-(4-chlorobutylidene)bis(4-fluorobenzene) (Acros Organics, Pittsburgh, Pa.); B) 4-bromo-1,1-diphenyl-1-butene [prepared as described in F. A. Ali et al., J. Med. Chem. 28: 653-660, 1985); C) benzydryl 2-bromoethyl ether, [prepared as described in M. R. Pavia et al., J. Med. Chem. 35: 4238-4248, 1992]; D) 3,3-diphenylpropyl tosylate [prepared by LiAlH4 reduction of 3,3-diphenylpropionic acid (Aldrich) to 3,3-diphenylpropanol, followed by tosylation]; E) 9-fluorenylethyl tosylate [prepared by LiAlH4 reduction of 9-fluoreneacetic acid methyl ester (Aldrich) to 2-(9-fluorenyl)ethanol, followed by tosylation]; and F) 3,3-bis(4-fluorophenyl)propyl tosylate [prepared by alkylation of diethyl malonate (Aldrich) with chlorobis(4-fluorophenyl)methane (Aldrich), followed by hydrolysis and decarboxylation, LiAlH4 reduction of the monocarboxylic acid, and tosylation of the formed alcohol).

Amino acid: 1) methyl pipecolinate hydrochloride (Aldrich); 2) methyl (S-(−)2-azetidinecarboxylate hydrochloride [prepared by methylation of S-(−)-2-azetidinecarboxylic acid (Aldrich) with chlorotrimethylsilane (Aldrich) in methanol according to the general procedure described in M. A. Brook et al., Synthesis, p. 201, 1983]; 3) L-proline methyl ester hydrochloride (Aldrich); 4) methyl (±)-trans-3-azabicyclo[3.1.0]hexane-2-carboxylate hydrochloride [prepared by methylation of (±)-trans-3-azabicyclo[3.1.0]hexane-2-carboxylic acid (Aldrich) with chlorotrimethylsilane (Aldrich) in methanol according to the general procedure described in M. A. Brook et al., Synthesis, 201, 1983]; 5) indole-2-carboxylic acid methyl ester hydrochloride prepared by methylation of indole-2-carboxylic acid (Aldrich) with chlorotrimethylsilane (Aldrich) in methanol according to the general procedure described in M. A. Brook et al., Synthesis 201, 1983].


X) acetonitrile; Y) dioxane; Z) methanol

EXAMPLE 20A Synthesis of N-(3,3-Diphenyl-3-hydroxy)propyl]pipecolic Acid Methyl Ester (Compound B18)

Step 1

N-[(3-Oxo-3-phenyl)propyl]pipecolic acid methyl ester: A mixture of 3.37 g (20 mmol) 3-chloropropiophenone (Aldrich), 3.59 g (20 mmol) methyl pipecolinate hydrochloride (Aldrich), 3.32 g (20 mmol) potassium iodide and 2.5 g potassium carbonate in 140 ml of acetonitrile was heated under reflux with stirring for 2h (Reaction 29, FIG. 4). The reaction mixture was filtered, the solvent evaporated and the residue dissolved in dichloromethane, washed with water and dried over sodium sulphate. Evaporation of the solvent gave N-[(3-oxo-3-phenyl)propyl]pipecolic acid methyl ester as a yellow oil which was used in the next step without further purification.

Step 2

0.21 ml of phenyllithium (1.8 M in cyclohexane-ether, Aldrich) was added dropwise into a solution of 0.101 g (0.367 mmol) of N-[(3-oxo3-phenyl)propyl]pipecolic acid methyl ester (from step 1) in 5 ml of tetrahydrofuran at −78+ C. (Reaction 30, FIG. 4). After stirring at −78° C. for 0.5 h and at 20° C. for 0.5 h, the reaction was quenched by adding 5 ml 10% ammonium chloride solution at 0° C. The mixture was extracted with methylene chloride, the solvent evaporated and the residue purified by preparative TLC with 40% ethyl acetate in hexanes to give 0.072 g (yield 56%) N-[(3,3-diphenyl-3-hydroxy)propyl]pipecolic acid methyl ester (compound B 18) as a pale yellow oil.

EXAMPLE 20B N-[3-(4-Chlorophenyl)-3-(4-fluorophenyl)3-hydroxypropyl]pipecolic Acid Methyl Ester (Compound B30)

Step 1

N-[3-(4-Fluorophenyl)-3-oxopropyl]pipecolic acid methyl ester was prepared in 92% yield by alkylation of methyl pipecolinate with 3chloro-4′-fluoropropiophenone (Aldrich) as described in Example 20A (Step 1).

Step 2

N-[3-(4-Chlorophenyl)-3-(4-fluorophenyl)-3-hydroxypropyl]pipecolic acid methyl ester (Compound B30): 7 ml (2 mmol) of 0.28 M solution of 4-chlorophenylmagnesium iodide in diethyl ether [prepared from 1-chloro-4-iodobenzene (Aldrich) and magnesium] was added dropwise to an ice-cooled solution of 0.605 g (2 mmol) N-[3-(4-fluorophenyl)-3-oxopropyl]pipecolic acid methyl ester (from Step 1) in 12 ml anhydrous diethyl ether with stirring under nitrogen. The mixture was stirred at room temperature for 16 hours, poured onto crushed ice and extracted with dichloromethane. The combined organic extracts were washed with brine, concentrated and the residue purified by preparative silica gel TLC with 25% ethyl acetate in hexanes to give 0.037 g (yield 4.5%) N-[3-(4-chlorophenyl)-3-(4-fluorophenyl)3-hydroxypropyl]pipecolic acid methyl ester (Compound B30).

Compound B21 was prepared in 4% yield analogously to Step 2 by reaction of N-(3-oxo-3-phenylpropyl)pipecolic acid methyl ester [synthesized analogously to Step 1 of Example 20A from ethyl pipecolinate (Aldrich)] with 4-chlorophenylmagnesium iodide.

EXAMPLE 20C N-[3-(4-Chlorophenyl)-3-(4-fluorophenyl)prop-2-enyl]pipecolic Acid Methyl Ester (Compound B20)

A solution of 0.035 g (0.086 mmol) N-[3-(4-chlorophenyl)-3-(4 fluorophenyl)-3-hydroxypropyl]pipecolic acid methyl ester (Compound B30) in 1 ml 99% formic acid was heated under reflux for 0.5 hours. The mixture was concentrated under vacuum the residue dissolved in ethyl acetate, washed with saturated sodium bicarbonate solution and brine, and the solvent evaporated. The residue was purified by preparative silica gel TLC with 5% diethyl ether in dichlorometane to give 0.018 g (yield 54%) N-[3-(4-chlorophenyl)-3-(4-fluorophenyl)prop-2-enyl]pipecolic acid methyl ester (Compound B20)

EXAMPLE 21A Synthesis of N-[3-Phenyl-3-(p-trifluoromethylphenoxy)propyl]pipecolic Acid Methyl Ester (Compound B16)

Step 1

0.70 ml of lithium tri-tert-butoxyaluminohydride (Aldrich) (1 M in THF) was added into a solution of 0.190 g, (0.69 mmol) N-[(3-oxo-3-phenyl)propyl]pipecolic acid methyl ester (prepared in step 1 of Example 20A) in 10 ml of THF at −78° C. (Reaction 31, FIG. 4). After stirring at −78° C. for 0.5 h and at room temperature for 20 h, the reaction was quenched by adding 10 ml 10% ammonium chloride solution at 0° C., filtered, and extracted with methylene chloride. After evaporation of the solvent, the residue was chromatographed on silica gel column with 30% ethyl acetate in hexanes to give 0.171 g (yield 89%) N-[(3-hydroxy-3-phenyl)propyl]pipecolic acid methyl ester as a pale yellow oil.

Step 2

To an ice cooled solution of 2.27 g (8.2 mmol) of N-[(3-hydroxy-3-phenyl)propyl]pipecolic acid methyl ester (from step 1) in 10 ml anhydrous methylene chloride was added dropwise 4 ml (51 mmol) thionyl chloride and the mixture heated under reflux for one hour (Reaction 32, FIG. 4). After addition of crushed ice, the reaction mixture was neutralized with saturated solution of potassium carbonate and extracted with methylene chloride. The combined extracts were evaporated and the residue chomatographed on silica gel column with 20% diethyl ether in hexanes to give 1.45 g (yield 60%) N-[(3-chloro-3-phenyl)propyl]pipecolic acid methyl ester as an oil.

Step 3

A solution of 0.082 g (0.28 mmol) of N-[(3-chloro-3-phenyl)propyl]pipecolic acid methyl ester (from step 2) in 1 ml of anhydrous dimethylformamide was added into a solution of sodium 4-trifluoromethylphenoxide in 2 ml anhydrous dimethylformamide at room temperature (Reaction 33, FIG. 4). The sodium 4-trifluoromethylphenoxide was generated by adding 0.040 g of 60% sodium hydride in mineral oil to a solution of 0.165 g (1 mmol) of α,α,α-trifluoro-p-cresol (Aldrich) in 2 ml of dimethylformamide. The reaction mixture was stirred at room temperature for 30 h, the solvent evaporated under vacuo and the residue purified by preparative TLC with 30% ethyl acetate in hexanes to give 0.079 g (yield 68%) N-[3-phenyl-3-(p-trifluoromethylphenoxy)propyl]pipecolic acid methyl ester (Compound B16) as a pale yellow oil.

EXAMPLE 21B Additional Syntheses Using the Procedure of Example 21A

Compound B23 was prepared by alkylation of 4-trifluoromethylphenol (Aldrich) with N-(3-chloro-3-phenylpropyl)pipecolic acid ethyl ester as described above in Example 21A (Step 3)—yield 6.5%.

Compound B24 was prepared by alkylation of phenol (Aldrich) with N-(3-chloro-3-phenylpropyl)pipecolic acid ethyl ester as described above in Example 21A (Step 3)—yield 4%.

Compound B25 was prepared by alkylation of 4-methoxyphenol (Aldrich) with N-(3-chloro-3-phenylpropyl)pipecolic acid ethyl ester as described above in Example 21A (Step 3)—yield 8%.

Compound B29 was prepared by alkylation of thiophenol (Aldrich) with N-(3chloro-3-phenylpropyl)pipecolic acid ethyl ester as described above in Example 21A (Step 3)—yield 12%.

EXAMPLE 21C Synthesis of N-[3-(4-chlorophenoxy)-3-phenylpropyl]pipecolic Acid Ethyl Ester (Compound B22)

0.133 g (0.76 mmol) diethyl azodicarboxylate (Aldrich) was added dropwise to a solution of 0.142 g (0.51 mmol) N-(3-hydroxy-3-phenylpropyl)pipecolic acid methyl ester (from Example 21A, Step 1), 0.083 g (0.64 mmol) p-chlorophenol (Aldrich) and 0.197 g (0.75 mmol) triphenylphosphine in 5 ml anhydrous tetrahydrofuran with stirring under nitrogen and cooling with an ice bath. The mixture was stirred at room temperature for 4 hours, the solvent evaporated and the residue purified by preparative silica gel TLC with 30% ethyl acetate in hexanes to give 0.09 g (yield 46%) N-[3-(4-chlorophenoxy)-3-phenylpropyl]pipecolic acid ethyl ester (Compound B22). (See Reaction 34, FIG. 4.)

EXAMPLE 22 Synthesis of N-(4,4-Diphenyl)butyl-2-piperidine Carboxylic Acid Methyl Ester (compound B10)

0.040 g (0.11 mmol) of N-[4,4-diphenyl)but-3-enyl]-2-piperidine carboxylic acid methyl ester (compound B4) was hydrogenated over 0.030 g 10% Pd/C in 5 ml ethanol under 40 psi for 4 hours at room temperature. The mixture was separated from the catalyst by filtration through celite and the solvent evaporated to give 0.028 g (yield 70%) N-(4,4-diphenyl)butyl-2-piperidine carboxylic acid methyl ester (compound B10) as an oil. NMR spectra of the product showed: 1H NMR (CDCl3, 300 MHz) 7.40-7.10 (m, 10 H), 3.X8 (t, 1 H), 3.65 (s, 3 H), 3.10-2.90 (n, 2 H), 2.60-2.45 (m, 1 H), 2.35-2.20 (m, 1 H), 2.10-1.90 (m, 3 H), 1.85-1.10 (m, 8 H); 13C NMR (CDCl3, 75 MHz) 174.57, 145.36, 145.23, 128.66, 128.12, 128.10, 126.34, 126.33, 65.66, 56.81, 51.78, 51.44, 50.78, 33.81, 29.88, 25.53, 25.39, 22.92.

EXAMPLE 23 Synthesis of N-[4,4-Diphenyl)but-3enyl]-L-2-azetidine Carboxylic Acid Hydrochloride (Compound B15)

To a solution of 0.050 g (0.3 mmol) of N-[(4,4-diphenyl)but-3-enyl]-L-2-azetidine carboxylic acid methyl ester (compound B3) in 2.4 ml ethanol was added 1.2 ml 1N lithium hydroxide and the mixture was stirred at room temperature for 20 hours. The reaction mixture was concentrated to half volume, acidified with 4 N hydrochloric acid, and extracted 4 times with methylene chloride. The combined extracts were dried and evaporated to give 0.041 g (yield 80%) of N-[(4,4-diphenyl)but-3-enyl]-L-2-azetidine carboxylic acid hydrochloride (compound B15). 1H NMR (CD3OD, 300 MHz) 7.50-7.00 (m, 10 H), 6.08 (t, 1 H), 4.62 (t, 1 H), 4.00-3.75 (m, 3 H), 3.30-3.20 (m, 1 H), 2.75-2.55 (m, 1 H), 2.50-2.30 (m, 3 H).

Compound B5 was prepared by hydrolysis of the corresponding ester, compound B14.

Compound B19 was prepared by hydrolysis of the corresponding ester, compound B23.

While this invention has been described with an emphasis upon preferred embodiments, it will be obvious to those of ordinary skill in the art that variations in the preferred devices and methods may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims that follow.

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US3929813Dec 26, 1973Dec 30, 1975Interx Research CorpNovel pro-drug derivatives of pyridinium aldoxime type cholinesterase reactivators and process for preparing same
US4383999Apr 28, 1982May 17, 1983Smithkline Beckman CorporationInhibition of GABA uptake by N-substituted azaheterocyclic carboxylic acids and their esters
US4514414Oct 25, 1982Apr 30, 1985Smithkline Beckman CorporationN-Substituted pyrrolidineacetic acids and their esters
US4639468Aug 23, 1985Jan 27, 1987Continental Pharma Inc.Derivatives of glycinamide, their preparation and their use
US4772615Oct 14, 1987Sep 20, 1988Warner-Lambert CompanyVarious N-substituted 3-piperidine carboxylic acids or N-substituted 3-pyridinecarboxylic acids and derivatives thereof
US4931450Oct 17, 1988Jun 5, 1990Novo Industri A/SAmino acid derivatives
US5010090Oct 7, 1988Apr 23, 1991Novo Nordisk A/S.N-(butenyl substituted) azaheterocyclic carboxylic acids
US5837730Dec 6, 1996Nov 17, 1998Javitt; Daniel C.Treatment of negative and cognitive symptoms of schizophrenia with glycine uptake antagonists
BE885303A1 * Title not available
CA2144475A1Mar 13, 1995Sep 15, 1995Eugen UhlmannPolyamide-oligonucleotide derivatives, their preparation and use
DE3010599A1 *Mar 20, 1980Oct 9, 1980Continental PharmaDerivate von glycinamid, deren herstellung und verwendung
EP0068544A2Jun 8, 1982Jan 5, 1983Janssen Pharmaceutica N.V.Novel N-aryl-piperazinealkanamides
EP0221572A2Nov 7, 1986May 13, 1987Warner-Lambert CompanyN-substituted 3-piperidine-or 3-pyridine-carboxylic acids and derivatives thereof
EP0231996A2Jan 6, 1987Aug 12, 1987Novo Nordisk A/SNovel amino acid derivatives
EP0666456A1Feb 4, 1994Aug 9, 1995Eaton CorporationRefrigerant receiver/drier
EP0672661A1Mar 8, 1995Sep 20, 1995Hoechst AktiengesellschaftSubstituted N-ethyl-glycinderivatives for the preparation of PNA and PNA-/DNA hybrides
EP0672677A2 *Mar 8, 1995Sep 20, 1995Hoechst AktiengesellschaftPolyamide-oligonucleotide derivatives, their production and use
JPH02129158A * Title not available
WO1995004072A1Apr 28, 1994Feb 9, 1995Chiron CorporationPeptoid alpha-1 adrenergic receptor ligands
Non-Patent Citations
1 *Beal, M. F., Aging, Energy, and Oxidative Stress in Neurodegenerative Diseases, Annals of Neurology, vol. 38, No. 3, pp. 357-366, Sep. 1995.
2 *Cecil et al., Textbook of Medicine, pp. 1992-1994, 1996.
3Computer Database Search, Search 1 Feb. 1996.
4Computer Database Search, Search II 1996.
5Computer Database Search, Search III 1996.
6Computer Database Search, Search IV 1996.
7Computer Database Search, Search V 1995.
8Computer Database Search, Search VI Oct. 1995.
9Computer Database Search, Search VII Jan. 1996.
10 *Edlung, P. O., Identification of Amperozide Metabolites in Urine from Rats, Rabbits, Dogs and Man by Frit-FAB LC/MS Using Deuterated Solvents to Gain Additional Structural Information, Journal of Mass Spectrometry, vol. 30, pp. 1380-1392, 1995.
11Fadia E. Ali et al., J. Med. Chem., 28:653-660 (1985).
12 *Grant & Hackh's Chemical Dictionary, pp. 366, 408, 415, 416 and 587, 1987.
13 *Inayama et al., A Rapid and Simple Screening Method for Methamphetamine in Urine by Radioimmunoassay using a I-Labeled Methamphetamine Derivative, Chemical & Pharmaceutical Bulletin, vol. 28, No. 9, pp. 2779-2782, Sep., 1980.
14 *Lehmann, J., Synthese Dihydroxylierter Diphenylalkylamine Uber Azalactone, Archiv der Pharmazie, vo.. 316, No. 4, pp. 339-346, Apr. 1983.
15 *Lewis et al., Photochemical Addition of Tertiary Amines to Stilbene. Free-Radical and Electron-Transfer Mechanisms for Amine Oxidation, Journal of the American Chemical Society, vol. 104, No. 7, pp. 1924-1929, Apr. 1982.
16Michael R. Pavia et al., J. Med. Chem., 35:4238-4248 (1992).
17Reyna J. Simon et al., Proc. Natl. Acad. Sci. USA, 89:9367-9371 (1992).
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6417387 *Mar 5, 2001Jul 9, 2002G.D. Searle & Co.α-and β-amino acid hydroxyethylamino sulfonamides useful as retroviral protease inhibitors
US6506780 *Jul 2, 2001Jan 14, 2003Pfizer Inc.Benzophenones and sulfones as inhibitors of glycine uptake
US6566550 *Feb 28, 2002May 20, 2003Pfizer IncSubstituted aromatic ethers as inhibitors of glycine transport
US6638981Aug 17, 2001Oct 28, 2003Epicept CorporationTopical compositions and methods for treating pain
US6667336Feb 15, 2002Dec 23, 2003Nps Allelix Corp.GlyT-1 inhibitors
US6784299 *Apr 16, 2003Aug 31, 2004Pfizer Inc.Substituted aromatic ethers as inhibitors of glycine transport
US7189757Oct 16, 2002Mar 13, 2007Hypnion, Inc.Treatment of sleep disorders using CNS target modulators
US7317026Dec 4, 2003Jan 8, 2008Hypnion, Inc.CNS target modulators
US7355042Apr 23, 2004Apr 8, 2008Hypnion, Inc.Treatment of CNS disorders using CNS target modulators
US7410993 *Aug 9, 2002Aug 12, 2008Ranbaxy Laboratories Limited3,6-disubstituted azabicyclo [3.1.0] hexane deriviatives useful as muscarinic receptor antagonists
US9187439Sep 19, 2012Nov 17, 2015Inception Orion, Inc.Tricyclic compounds useful as neurogenic and neuroprotective agents
US9663448Nov 1, 2013May 30, 2017Ben-Gurion University Of The Negev Research And Development AuthorityTri-aryl compounds and compositions comprising the same
US9670138Nov 12, 2013Jun 6, 2017Ben-Gurion University Of The Negev Research And Development AuthorityTelomerase activating compounds and methods of use thereof
US20030187021 *Oct 16, 2002Oct 2, 2003Hypnion, Inc.Treatment of CNS disorders using CNS target modulators
US20030208081 *Apr 16, 2003Nov 6, 2003Pfizer Inc.Substituted aromatic ethers as inhibitors of glycine transport
US20040076648 *Sep 25, 2003Apr 22, 2004Epicept CorporationTopical compositions and methods for treating pain
US20050009730 *Oct 16, 2002Jan 13, 2005Dale EdgarTreatment of cns disorders using cns target modulators
US20050080265 *Apr 23, 2004Apr 14, 2005Edgar Dale M.Treatment of CNS disorders using CNS target modulators
US20060142371 *Aug 9, 2002Jun 29, 2006Anita Mehta3,6-Disubstituted azabicyclo [3.1.0] hexane derivatives useful as muscarinic receptor
US20100074955 *Sep 18, 2007Mar 25, 2010Laboratorios Del Dr. Esteve, S.A.Combination of NMDA-Receptor Ligand and a Compound With 5-HT6 Receptor Affinity
US20100316678 *Jun 26, 2008Dec 16, 2010Cnsbio Pty Ltd.Combination methods and compositions for treatment of neuropathic pain
USRE42889Apr 23, 2007Nov 1, 2011G.D. Searle Llcα- and β- amino acid hydroxyethylamino sulfonamides useful as retroviral protease inhibitors
USRE43596Apr 23, 2007Aug 21, 2012G.D. Searle Llcα- and β-amino acid hydroxyethylamino sulfonamides useful as retroviral protease inhibitors
USRE43802Sep 21, 2011Nov 13, 2012G.D. Searle Llcα- and β-amino acid hydroxyethylamino sulfonamides useful as retroviral protease inhibitors
EP1545508A1 *Aug 9, 2002Jun 29, 2005Ranbaxy Laboratories, Ltd.3,6-disubstituted azabicyclo [3.1.0] hexane derivatives useful as muscarinic receptor antagonist
EP1545508A4 *Aug 9, 2002Nov 25, 2009Ranbaxy Lab Ltd3,6-disubstituted azabicyclo ¬3.1.0 hexane derivatives useful as muscarinic receptor antagonist
EP2152256A2 *Jun 4, 2008Feb 17, 2010Ben Gurion University Of The Negev Research And Development AuthorityTelomerase activating compounds and methods of use thereof
EP2152256A4 *Jun 4, 2008Nov 2, 2011Univ Ben GurionTelomerase activating compounds and methods of use thereof
EP2826472A3 *Jun 4, 2008May 20, 2015Ben Gurion University Of The Negev Research And Development AuthorityTelomerase activating compounds and their use
WO2009104080A2Feb 20, 2009Aug 27, 2009Targia PharmaceuticalsCns pharmaceutical compositions and methods of use
U.S. Classification514/523, 558/166, 514/576, 560/21, 564/319, 558/390, 564/164, 562/16, 560/13, 514/539, 560/17, 514/538, 564/165, 564/322, 514/620, 564/317, 560/12, 514/114, 564/316, 514/561, 564/320, 564/306
International ClassificationC07D257/04, C07C229/16, C07D295/088, C07D223/28, C07D207/16, C07D209/42, A61K31/445, A61K31/198, C07C303/40, C07D295/092, C07D317/64, C07D307/14, C07F9/38, C07D295/073, C07D211/60, A61K31/216, C07D205/04, C07D333/20, C07D209/02, C07C237/06, C07D279/24, C07D295/03, C07C255/43, C07C229/14, C07D213/65, C07D295/02
Cooperative ClassificationA61K31/216, C07D213/65, C07C255/43, C07F9/3808, C07D295/03, C07D205/04, A61K31/445, C07D223/28, C07C229/16, C07C237/06, C07D317/64, C07D333/20, C07D209/42, A61K31/198, C07D295/073, C07D209/02, C07D279/24, C07C303/40, C07D307/14, C07D279/26, C07D295/088, C07D257/04, C07C229/14, C07D207/16, C07D307/42, C07D211/60, C07C2603/88, C07C2603/32, C07C2603/74, C07C2603/18
European ClassificationA61K31/445, C07F9/38A1, C07D207/16, C07D333/20, C07D209/02, C07D213/65, C07C237/06, C07D205/04, C07C229/16, C07C255/43, C07D211/60, C07D209/42, A61K31/198, C07D307/14, C07D317/64, C07C229/14, C07C303/40, A61K31/216, C07D279/24, C07D223/28, C07D295/088, C07D257/04, C07D295/03, C07D295/073, C07D307/42, C07D279/26
Legal Events
Dec 5, 1997ASAssignment
Jul 14, 2004FPAYFee payment
Year of fee payment: 4
Jul 17, 2008FPAYFee payment
Year of fee payment: 8
Aug 7, 2008ASAssignment
Effective date: 20080728
Oct 1, 2012REMIMaintenance fee reminder mailed
Feb 20, 2013LAPSLapse for failure to pay maintenance fees
Apr 9, 2013FPExpired due to failure to pay maintenance fee
Effective date: 20130220