Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS6410224 B1
Publication typeGrant
Application numberUS 08/777,916
Publication dateJun 25, 2002
Filing dateDec 23, 1996
Priority dateDec 7, 1992
Fee statusLapsed
Also published asUS5658780, US20030003469
Publication number08777916, 777916, US 6410224 B1, US 6410224B1, US-B1-6410224, US6410224 B1, US6410224B1
InventorsDan T. Stinchcomb, Kenneth G. Draper, James McSwiggen
Original AssigneeRibozyme Pharmaceuticals, Inc.
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Cleavage of protein using enzyme; therapy for inflammation, asthma, rheumatic diseases, autoimmune diseases
US 6410224 B1
Abstract
Enzymatic RNA molecules which cleave rel A mRNA.
Images(6)
Previous page
Next page
Claims(4)
What is claimed is:
1. A method for specifically cleaving RNA encoding a Rel-A subunit of NF-k B protein using an enzymatic RNA molecule, comprising the step of contacting said RNA with said enzymatic RNA molecule under conditions suitable for said cleaving.
2. The method of claim 1, wherein said enzymatic RNA molecule is in a motif selected from the group consisting of Hammerhead, Hairpin, Hepatitis Delta Virus, Group I Intron, RNAse P RNA and VSRNA.
3. A method of claim 1, wherein said enzymatic RNA molecule comprises between 12 and 100 nucleotides complementary to said RNA encoding the Rel-A subunit of the NF-kB protein.
4. A method of claim 1, wherein said enzymatic RNA molecule comprises between 14 and 24 nucleotides complementary to said RNA encoding the Rel-A subunit of the NF-kB protein.
Description
RELATED APPLICATIONS

This is continuation of application Ser. No. 08/291,932 filed Aug. 15, 1994, now U.S. Pat. No. 5,658,780, hereby incorporated by reference in its totality (including drawings), which is a continuation-in-part of Stinchcomb et al., “Method and Composition for Treatment of Restenosis and Cancer Using Ribozymes,” filed May 18, 1994, U.S. Ser. No. 08/245,466, now abandoned, which is a continuation-in-part of Draper, “Method and Reagent for Treatment of a Stenotic Condition”, filed Dec. 7, 1992, U.S. Ser. No. 07/987,132, now abandoned both hereby incorporated by reference herein.

FIELD OF THE INVENTION

The present invention relates to therapeutic compositions and methods for the treatment or diagnosis of diseases or conditions related to NF-κB levels, such as restenosis, rheumatoid arthritis, asthma, inflammatory or autoimmune disorders and transplant rejection.

BACKGROUND OF THE INVENTION

The following is a brief description of the physiological role of NF-κB. The discussion is not meant to be complete and is provided only for understanding of the invention that follows. This summary is not an admission that any of the work described below is prior art to the claimed invention.

The nuclear DNA-binding activity, NF-κB, was first identified as a factor that binds and activates the immunoglobulin κ light chain enhancer in B cells. NF-κB now is known to activate transcription of a variety of other cellular genes (e.g., cytokines, adhesion proteins, oncogenes and viral proteins) in response to a variety of stimuli (e.g., phorbol esters, mitogens, cytokines and oxidative stress). In addition, molecular and biochemical characterization of NF-κB has shown that the activity is due to a homodimer or heterodimer of a family of DNA binding subunits. Each subunit bears a stretch of 300 amino acids that is homologous to the oncogene, v-rel. The activity first described as NF-κB is a heterodimer of p49 or p50 with p65. The p49 and p50 subunits of NF-κB (encoded by the nf-κB2 or nf-κB1 genes, respectively) are generated from the precursors NF-κB1 (p105) or NF-κB2 (p100). The p65 subunit of NF-κB (now termed Rel A ) is encoded by the rel A locus.

The roles of each specific transcription-activating complex now are being elucidated in cells (N. D. Perkins, et al., 1992 Proc. Natl Acad. Sci USA 89, 1529-1533). For instance, the heterodimer of NF-κB1 and Rel A (p50/p65) activates transcription of the promoter for the adhesion molecule, VCAM-1, while NF-κB2/RelA heterodimers (p49/p65) actually inhibit transcription (H. B. Shu, et al., Mol. Cell. Biol. 13, 6283-6289 (1993)). Conversely, heterodimers of NF-κB2/RelA (p49/p65) act with Tat-I to activate transcription of the HIV genome, while NF-κB1/RelA (p50/p65) heterodimers have little effect (J. Liu, N. D. Perkins, R. M. Schmid, G. J. Nabel, J. Virol. 1992 66, 3883-3887). Similarly, blocking rel A gene expression with antisense oligonucleotides specifically blocks embryonic stem cell adhesion; blocking NF-κB1 gene expression with antisense oligonucleotides had no effect on cellular adhesion (Narayanan et al., 1993 Mol. Cell. Biol. 13, 3802-3810). Thus, the promiscuous role initially assigned to NF-κB in transcriptional activation (M. J. Lenardo, D. Baltimore, 1989 Cell 58, 227-229) represents the sum of the activities of the rel family of DNA-binding proteins. This conclusion is supported by recent transgenic “knock-out” mice of individual members of the rel family. Such “knock-outs” show few developmental defects, suggesting that essential transcriptional activation functions can be performed by more than one member of the rel family.

A number of specific inhibitors of NF-κB function in cells exist, including treatment with phosphorothioate antisense oliogonucleotide, treatment with double-stranded NF-κB binding sites, and over expression of the natural inhibitor MAD-3 (an IκB family member). These agents have been used to show that NF-κB is required for induction of a number of molecules involved in inflammation, as described below.

NF-κB is required for phorbol ester-mediated induction of IL-6 (I. Kitajima, et al., Science 258, 1792-5 (1992)) and IL-8 (Kunsch and Rosen, 1993 Mol. Cell. Biol. 13, 6137-46).

NF-κB is required for induction of the adhesion molecules ICAM-1 (Eck, et al., 1993 Mol. Cell. Biol. 13, 6530-6536), VCAM-1 (Shu et al., supra), and E-selectin (Read, et al., 1994 J. Exp. Med. 179, 503-512) on endothelial cells.

NF-κB is involved in the induction of the integrin subunit, CD18, and other adhesive properties of leukocytes (Eck et al., 1993 supra).

The above studies suggest that NF-κB is integrally involved in the induction of cytokines and adhesion molecules by inflammatory mediators. Two recent papers point to another connection between NF-κB and inflammation: glucocorticoids may exert their anti-inflammatory effects by inhibiting NF-κB. The glucocorticoid receptor and p65 both act at NF-κB binding sites in the ICAM-1 promoter (van de Stolpe, et al., 1994 J. Biol. Chem. 269, 6185-6192). Glucocorticoid receptor inhibits NF-κB-mediated induction of IL-6 (Ray and Prefontaine, 1994 Proc. Natl Acad. Sci USA 91, 752-756). Conversely, overexpression of p65 inhibits glucocorticoid induction of the mouse mammary tumor virus promoter. Finally, protein cross-linking and co-immunoprecipitation experiments demonstrated direct physical interaction between p65 and the glucocorticoid receptor (Id.).

SUMMARY OF THE INVENTION

This invention relates to ribozymes, or enzymatic RNA molecules, directed to cleave mRNA species encoding Rel A protein (p65). In particular, applicant describes the selection and function of ribozymes capable of cleaving this RNA and their use to reduce activity of NF-κB in various tissues to treat the diseases discussed herein. Such ribozymes are also useful for diagnostic applications.

Ribozymes that cleave rel A mRNA represent a novel therapeutic approach to inflammatory or autoimmune disorders. Antisense DNA molecules have been described that block NF-κB activity. See Narayanan et al., supra. However, ribozymes may show greater perdurance or lower effective doses than antisense molecules due to their catalytic properties and their inherent secondary and tertiary structures. Such ribozymes, with their catalytic activity and increased site specificity (as described below), represent more potent and safe, therapeutic molecules than antisense oligonucleotides.

Applicant indicates that these ribozymes are able to inhibit the activity of NF-κB and that the catalytic activity of the ribozymes is required for their inhibitory effect. Those of ordinary skill in the art, will find that it is clear from the examples described that other ribozymes that cleave rel A encoding mRNAs may be readily designed and are within the invention.

Six basic varieties of naturally-occurring enzymatic RNAs are known presently. Each can catalyze the hydrolysis of RNA phosphodiester bonds in trans (and thus can cleave other RNA molecules) under physiological conditions. Table I summarizes some of the characteristics of these ribozymes. In general, enzymatic nucleic acids act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base-pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.

The enzymatic nature of a ribozyme is advantageous over other technologies, such as antisense technology (where a nucleic acid molecule simply binds to a nucleic acid target to block its translation) since the concentration of ribozyme necessary to affect a therapeutic treatment is lower than that of an antisense oligonucleotide. This advantage reflects the ability of the ribozyme to act enzymatically. Thus, a single ribozyme molecule is able to cleave many molecules of target RNA. In addition, the ribozyme is a highly specific inhibitor, with the specificity of inhibition depending not only on the base pairing mechanism of binding to the target RNA, but also on the mechanism of target RNA cleavage. Single mismatches, or base-substitutions, near the site of cleavage can completely eliminate catalytic activity of a ribozyme. Similar mismatches in antisense molecules do not prevent their action (Woolf, T. M., et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 7305-7309). Thus, the specificity of action of a ribozyme is greater than that of an antisense oligonucleotide binding the same RNA site.

In preferred embodiments of this invention, the enzymatic nucleic acid molecule is formed in a hammerhead or hairpin motif, but may also be formed in the motif of a hepatitis delta virus, group I intron or RNaseP RNA (in association with an RNA guide sequence) or Neurospora VS RNA. Examples of such hammerhead motifs are described by Rossi et al., 1992, Aids Research and Human Retroviruses, 8, 183, of hairpin motifs by Hampel et al., “RNA Catalyst for Cleaving Specific RNA Sequences,” filed Sep. 20, 1989, which is a continuation-in-part of U.S. Ser. No. 07/247,100 filed Sep. 20, 1988, Hampel and Tritz, 1989, Biochemistry, 28, 4929, and Hampel et al., 1990, Nucleic Acids Res.earch, 18,299, and an example of the hepatitis delta virus motif is described by Perrotta and Been, 1992, Biochemistry, 31, 16, of the RNaseP motif by Guerrier-Takada et al., 1983,Cell, 35, 849, Neurospora VS RNA ribozyme motif is described by Collins (Saville and Collins, 1990 Cell 61, 685-696; Saville and Collins, 1991 Proc. Natl. Acad. Sci. USA 88, 8826-8830; Collins and Olive, 1993 Biochemistry 32, 2795-2799) and of the Group I intron by Cech et al., U.S. Pat. No. 4,987,071. These specific motifs are not limiting in the invention and those skilled in the art will recognize that all that is important in an enzymatic nucleic acid molecule of this invention is that it has a specific substrate binding site which is complementary to one or more of the target gene RNA regions, and that it have nucleotide sequences within or surrounding that substrate binding site which impart an RNA cleaving activity to the molecule.

The invention provides a method for producing a class of enzymatic cleaving agents which exhibit a high degree of specificity for the RNA of a desired target. The enzymatic nucleic acid molecule is preferably targeted to a highly conserved sequence region of a target Rel A encoding mRNA such that specific treatment of a disease or condition can be provided with either one or several enzymatic nucleic acids. Such enzymatic nucleic acid molecules can be delivered exogenously to specific cells as required. Alternatively, the ribozymes can be expressed from DNA vectors that are delivered to specific cells.

Synthesis of nucleic acids greater than 100 nucleotides in length is difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. In this invention, small enzymatic nucleic acid motifs (e.g., of the hammerhead or the hairpin structure) are used for exogenous delivery. The simple structure of these molecules increases the ability of the enzymatic nucleic acid to invade targeted regions of the mRNA structure. However, these catalytic RNA molecules can also be expressed within cells from eukaryotic promoters (e.g., Scanlon, K. J., et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet, M., et al., 1992, Antisense Res. Dev., 2, 3-15; Dropulic, B., et al., 1992, J Virol, 66, 1432-41; Weerasinghe, M., et al., 1991, J Virol, 65, 5531-4; Ojwang, J. O., et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen, C. J., et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver, H., et al., 1990, Science, 247, 1222-1225)). Those skilled in the art realize that any ribozyme can be expressed in eukaryotic cells from the appropriate DNA vector. The activity of such ribozymes can be augmented by their release from the primary transcript by a second ribozyme (Draper et al., PCT WO93/23569, and Sullivan et al., PCT WO94/02595, both hereby incorporated in their totality by reference herein; Ohkawa, J., et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira, K., et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura, M., et al., 1993, Nucleic Acids Res., 21, 3249-55) .

Inflammatory mediators such as lipopolysaccharide (LPS), interleukin-1 (IL-1) or tumor necrosis factor-a (TNF-α) act on cells by inducing transcription of a number of secondary mediators, including other cytokines and adhesion molecules. In many cases, this gene activation is known to be mediated by the transcriptional regulator, NF-κB. One subunit of NF-κB, the relA gene product (termed RelA or p65) is implicated specifically in the induction of inflammatory responses. Ribozyme therapy, due to its exquisite specificity, is particularly well-suited to target intracellular factors that contribute to disease pathology. Thus, ribozymes that cleave mRNA encoded by rel A may represent novel therapeutics for the treatment of inflammatory and autoimmune disorders.

Thus, in a first aspect, the invention features ribozymes that inhibit RelA production. These chemically or enzymatically synthesized RNA molecules contain substrate binding domains that bind to accessible regions of their target mRNAs. The RNA molecules also contain domains that catalyze the cleavage of RNA. The RNA molecules are preferably ribozymes of the hammerhead or hairpin motif. Upon binding, the ribozymes cleave the target RelA encoding mRNAs, preventing translation and p65 protein accumulation. In the absence of the expression of the target gene, a therapeutic effect may be observed.

By “inhibit” is meant that the activity or level of RelA encoding mRNA is reduced below that observed in the absense of the ribozyme, and preferably is below that level observed in the presence of an inactive RNA molecule able to bind to the same site on the mRNA, but unable to cleave that RNA.

Such ribozymes are useful for the prevention of the diseases and conditions discussed above, and any other diseases or conditions that are related to the level of NF-κB activity in a cell or tissue. By “related” is meant that the inhibition of relA mRNA and thus reduction in the level of NF-κB activity will relieve to some extent the symptoms of the disease or condition.

Ribozymes are added directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells. The RNA or RNA complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection or the use of a catheter, infusion pump or stent, with or without their incorporation in biopolymers. In preferred embodiments, the ribozymes have binding arms which are complementary to the sequences in Tables II, III, VI-VII. Examples of such ribozymes are shown in Tables IV-VII. Examples of such ribozymes consist essentially of sequences defined in these Tables. By “consists essentially of” is meant that the active ribozyme contains an enzymatic center equivalent to those in the examples, and binding arms able to bind mRNA such that cleavage at the target site occurs. Other sequences may be present which do not interfere with such cleavage.

In another aspect of the invention, ribozymes that cleave target molecules and inhibit NF-κB activity are expressed from transcription units inserted into DNA, RNA, or viral vectors. Preferably, the recombinant vectors capable of expressing the ribozymes are locally delivered as described above, and transiently persist in target cells. Once expressed, the ribozymes cleave the target mRNA. The recombinant vectors are preferably DNA plasmids or adenovirus vectors. However, other mammalian cell vectors that direct the expression of RNA may be used for this purpose.

Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The drawings will first briefly be described.

Drawings:

FIG. 1 is a diagrammatic representation of the hammerhead ribozyme domain (SEQ ID No:2) known in the art.

FIG. 2a is a diagrammatic representation of the hammerhead ribozyme domain known in the art; FIG. 2b is a diagrammatic representation of the hammerhead ribozyme as divided by Uhlenbeck (1987, Nature, 327, 596-600) into a substrate and enzyme portion; FIG. 2c is a similar diagram showing the hammerhead divided by Haseloff and Gerlach (1988, Nature, 334, 585-591) into two portions; and FIG. 2d is a similar diagram showing the hammerhead divided by Jeffries and Symons (1989, Nucl. Acids. Res., 17, 1371-1371) into two portions.

FIG. 3 is a representation of the general structure of the hairpin ribozyme domain (SEQ ID NO:4) known in the art.

FIG. 4 is a representation of the general structure of the hepatitis delta virus ribozyme domain (SEQ ID NO:5) known in the art.

FIG. 5 is a representation of the general. structure of the VS RNA ribozyme domain (SEQ ID NO:6) known in the art.

FIG. 6 is a schematic representation of an RNAseH accessibility assay. Specifically, the left side of FIG. 6 is a diagram of complementary DNA oligonucleotides bound to accessible sites on the target RNA. Complementary DNA oligonucleotides are represented by broad lines labeled A, B, and C. Target RNA is represented by the thin, twisted line. The right side of FIG. 6 is a schematic of a gel separation of uncut target RNA from a cleaved target RNA. Detection of target RNA is by autoradiography of body-labeled, T7 transcript. The bands common to each lane represent uncleaved target RNA; the bands unique to each lane represent the cleaved products.

Ribozymes

Ribozymes of this invention block to some extent NF-κB expression and can be used to treat disease or diagnose such disease. Ribozymes will be delivered to cells in culture and to cells or tissues in animal models of restenosis, transplant rejection and rheumatoid arthritis. Ribozyme cleavage of relA mRNA in these systems may prevent inflammatory cell function and alleviate disease symptoms.

Target Sites

Targets for useful ribozymes can be determined as disclosed in Draper et al supra. Sullivan et al., supra, as well as by Draper et al., “Method and reagent for treatment of arthritic conditions U.S. Ser. No. 08/152,487, filed Nov. 12, 1993, and hereby incorporated by reference herein in totality. Rather than repeat the guidance provided in those documents here, below are provided specific examples of such methods, not limiting to those in the art. Ribozymes to such targets are designed as described in those applications and synthesized to be tested in vitro and in vivo, as also described. Such ribozymes can also be optimized and delivered as described therein. While specific examples to mouse and human RNA are provided, those in the art will recognize that the equivalent human RNA targets described can be used as described below. Thus, the same target may be used, but binding arms suitable for targeting human RNA sequences are present in the ribozyme. Such targets may also be selected as described below.

The sequence of human and mouse relA mRNA can be screened for accessible sites using a computer folding algorithm. Potential hammerhead or hairpin ribozyme cleavage sites were identified. These sites are shown in Tables II, III, and VI-VII. (All sequences are 5′ to 3′ in the tables.) While mouse and human sequences can be screened and ribozymes thereafter designed, the human targetted sequences are of most utility. However, as discussed in Stinchcomb et al. supra, mouse targetted ribozmes are useful to test efficacy of action of the ribozyme prior to testing in humans. The nucleotide base position is noted in the Tables as that site to be cleaved by the designated type of ribozyme. (In Table II, lower case letters indicate positions that are not conserved between the Human and the Mouse rel A sequences.)

Hammerhead ribozymes are designed that could bind and are individually analyzed by computer folding (Jaeger, J. A., et al., 1989, Proc. Natl. Acad. Sci. USA, 86, 7706-7710) to assess whether the ribozyme sequences fold into the appropriate secondary structure. Those ribozymes with unfavorable intramolecular interactions between the binding arms and the catalytic core are eliminated from consideration. Varying binding arm lengths can be chosen to optimize activity. Generally, at least 5 bases on each arm are able to bind to, or otherwise interact with, the target RNA.

Referring to FIG. 6, mRNA is screened for accessible cleavage sites by the method described generally in Draper et al., WO/US93/04020 hereby incorporated by reference herein. Briefly, DNA oligonucleotides representing potential hammerhead ribozyme cleavage sites are synthesized. A polymerase chain reaction is used to generate a substrate for T7 RNA polymerase transcription from human or murine rel A cDNA clones. Labeled RNA transcripts are synthesized in vitro from the two templates. The oligonucleotides and the labeled transcripts are annealed, RNAseH is added and the mixtures are incubated for the designated times at 37° C. Reactions are stopped and RNA separated on sequencing polyacrylamide gels. The percentage of the substrate cleaved is determined by autoradiographic quantitation using a phosphor imaging system. From these data, hammerhead ribozyme sites are chosen as the most accessible.

Ribozymes of the hammerhead motif are designed to anneal to various sites in the mRNA message. The binding arms are complementary to the target site sequences described above. The ribozymes are chemically synthesized. The method of synthesis used follows the procedure for normal RNA synthesis as described in Usman, N.; Ogilvie, K. K.; Jiang, M.-Y.; Cedergren, R. J. 1987, J. Am. Chem. Soc., 109, 7845-7854 and in Scaringe, S. A.; Franklyn, C.; Usman, N., 1990, Nucleic Acids Res., 18, 5433-5441 and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end. The average stepwise coupling yields were >98%. Inactive ribozymes were synthesized by substituting a U for G5and a U for A14 (numbering from (Hertel, K. J., et al., 1992, Nucleic Acids Res., 20, 3252)). Hairpin ribozymes are synthesized in two parts and annealed to reconstruct the active ribozyme (Chowrira, B. M. and Burke, J. M., 1992, Nucleic Acids Res., 20, 2835-2840). All ribozymes are modified to enhance stability by modification of five ribonucleotides at both the 5′ and 3′ ends with 2′-O-methyl groups. Ribozymes are purified by gel electrophoresis using general methods or are purified by high pressure liquid chromatography (HPLC; See Usman et al., Synthesis, deprotection, analysis and purification of RNA and ribozymes, filed May, 18, 1994, U.S. Ser. No. 08/245,736 the totality of which is hereby incorporated herein by reference.) and are resuspended in water.

The sequences of the chemically synthesized ribozymes useful in this study are shown in Tables IV-VII . Those in the art will recognize that these sequences are representative only of many more such sequences where the enzymatic portion of the ribozyme (all but the binding arms) is altered to affect activity and may be formed of ribonucleotides or other nucleotides or non-nucleotides. Such ribozymes are equivalent to the ribozymes described specifically in the Tables.

Optimizing Ribozyme Activity

Ribozyme activity can be optimized as described by Stinchcomb et al., supra. The details will not be repeated here, but include altering the length of the ribozyme binding arms (stems I and III, see FIG. 2c), or chemically synthesizing ribozymes with modifications that prevent their degradation by serum ribonucleases (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., Nature 1990, 344:565; Pieken et al., Science 1991, 253:314; Usman and Cedergren, Trends in Biochem. Sci. 1992, 17:334; Usman et al., International Publication No. WO 93/15187; and Rossi et al., International Publication No. WO 91/03162, as well as Usman, N. et al. U.S. patent application Ser. No. 07/829,729, and Sproat, B. European Patent Application 92110298.4 which describe various chemical modifications that can be made to the sugar moieties of enzymatic RNA molecules. All these publications are hereby incorporated by reference herein.), modifications which enhance their efficacy in cells, and removal of stem II bases to shorten RNA synthesis times and reduce chemical requirements.

Sullivan, et al., supra, describes the general methods for delivery of enzymatic RNA molecules. Ribozymes may be administered to cells by a variety of methods known to those familiar to the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres. For some indications, ribozymes may be directly delivered ex vivo to cells or tissues with or without the aforementioned vehicles. Alternatively, the RNA/vehicle combination is locally delivered by direct injection or by use of a catheter, infusion pump or stent. Other routes of delivery include, but are not limited to, intrvascular, intramuscular, subcutaneous or joint injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. More detailed descriptions of ribozyme delivery and administration are provided in Sullivan, et al., supra and Draper, et al., supra which have been incorporated by reference herein.

Another means of accumulating high concentrations of a ribozyme(s) within cells is to incorporate the ribozyme-encoding sequences into a DNA expression vector. Transcription of the ribozyme sequences are driven from a promoter for eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol III). Transcripts from pol II or pol III promoters will be expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type will depend on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby. Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein, O. and Moss, B., 1990, Proc. Natl. Acad. Sci. U S A, 87, 6743-7; Gao, X. and Huang, L., 1993, Nucleic Acids Res., 21, 2867-72; Lieber, A., et al., 1993, Methods Enzymol., 217, 47-66; Zhou, Y., et al., 1990, Mol. Cell. Biol., 10, 4529-37). Several investigators have demonstrated that ribozymes expressed from such promoters can function in mammalian cells (e.g. (Kashani-Sabet, M., et al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang, J. O., et al., 1992, Proc. Natl. Acad. Sci. U S A, 89, 10802-6; Chen, C. J., et al., 1992, Nucleic Acids Res., 20, 4581-9; Yu, M., et al., 1993, Proc. Natl. Acad. Sci. U S A, 90, 6340-4; L'Huillier, P. J., et al., 1992, Embo J., 11, 4411-8; Lisziewicz, J., et al., 1993, Proc. Natl. Acad. Sci. U. S. A., 90, 8000-4)). The above ribozyme transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated vectors), or viral RNA vectors (such as retroviral vectors).

In a preferred embodiment of the invention, a transcription unit expressing a ribozyme that cleaves relA RNA is inserted into a plasmid DNA vector or an adenovirus DNA viral vector. Both vectors have been used to transfer genes to the intact vasculature or to joints of live animals (Willard, J. E., et al., 1992, Circulation, 86, I-473.; Nabel, E. G., et al., 1990, Science, 249, 1285-1288.) and both vectors lead to transient gene expression. The adenovirus vector is delivered as recombinant adenoviral particles. DNA may be delivered alone or complexed with vehicles (as described for RNA above). The DNA, DNA/vehicle complexes, or the recombinant adenovirus particles are locally administered to the site of treatment, e.g., through the use of an injection catheter, stent or infusion pump or are directly added to cells or tissues ex vivo.

EXAMPLE 1

NF-κB Hammerhead Ribozymes

By engineering ribozyme motifs we have designed several ribozymes directed against rel A mRNA sequences. These ribozymes are synthesized with modifications that improve their nuclease resistance. The ability of ribozymes to cleave relA target sequences in vitro is evaluated.

The ribozymes will be tested for function in vivo by analyzing cytokine-induced VCAM-1, ICAM-1, IL-6 and IL-8 expression levels. Ribozymes will be delivered to cells by incorporation into liposomes, by complexing with cationic lipids, by microinjection, or by expression from DNA vectors. Cytokine-induced VCAM-1, ICAM-1, IL-6 and IL-8 expression will be monitored by ELISA, by indirect immunofluoresence, and/or by FACS analysis. Rel A mRNA levels will be assessed by Northern analysis, RNAse protection or primer extension analysis or quantitative RT-PCR. Activity of NF-κB will be monitored by gel-retardation assays. Ribozymes that block the induction of NF-κB activity and/or rel A mRNA by more than 50% will be identified.

RNA ribozymes and/or genes encoding them will be locally delivered to transplant tissue ex vivo in animal models. Expression of the ribozyme will be monitored by its ability to block ex vivo induction of VCAM-1, ICAM-1, IL-6 and IL-8 mRNA and protein. The effect of the anti-rel A ribozymes on graft rejection will then be assessed. Similarly, ribozymes will be introduced into joints of mice with collagen-induced arthritis or rabbits with Streptococcal cell wall-induced arthritis. Liposome delivery, cationic lipid delivery, or adeno-associated virus vector delivery can be used. One dose (or a few infrequent doses) of a stable anti-relA ribozyme or a gene construct that constitutively expresses the ribozyme may abrogate inflammatory and immune responses in these diseases.

Uses

A therapeutic agent that inhibits cytokine gene expression, inhibits adhesion molecule expression, and mimics the anti-inflammatory effects of glucocorticoids (without inducing steroid-responsive genes) is ideal for the treatment of inflammatory and autoimmune disorders. Disease targets for such a drug are numerous. Target indications and the delivery options each entails are summarized below. In all cases, because of the potential immunosuppressive properties of a ribozyme that cleaves rel A mRNA, uses are limited to local delivery, acute indications, or ex vivo treatment.

Rheumatoid arthritis (RA).

Due to the chronic nature of RA, a gene therapy approach is logical. Delivery of a ribozyme to inflamed joints is mediated by adenovirus, retrovirus, or adeno-associated virus vectors. For instance, the appropriate adenovirus vector can be administered by direct injection into the synovium: high efficiency of gene transfer and expression for several months would be expected (B. J. Roessler, E. D. Allen, J. M. Wilson, J. W. Hartman, B. L. Davidson, J. Clin. Invest. 92, 1085-1092 (1993)). It is unlikely that the course of the disease could be reversed by the transient, local administration of an anti-inflammatory agent. Multiple administrations may be necessary. Retrovirus and adeno-associated virus vectors would lead to permanent gene transfer and expression in the joint. However, permanent expression of a potent anti-inflammatory agent may lead to local immune deficiency.

Restenosis.

Expression of NF-κB in the vessel wall of pigs causes a narrowing of the luminal space due to excessive deposition of extracellular matrix components. This phenotype is similar to matrix deposition that occurs subsequent to coronary angioplasty. In addition, NF-κB is required for the expression of the oncogene c-myb (F. A. La Rosa, J. W. Pierce, G. E. Soneneshein, Mol. Cell. Biol. 14, 1039-44 (1994)). Thus NF-κB induces smooth muscle proliferation and the expression of excess matrix components: both processes are thought to contribute to reocclusion of vessels after coronary angioplasty.

Transplantation.

NF-κB is required for the induction of adhesion molecules (Eck et al., supra, K. O'Brien, et al., J. Clin. Invest. 92, 945-951 (1993)) that function in immune recognition and inflammatory responses. At least two potential modes of treatment are possible. In the first, transplanted organs are treated ex vivo with ribozymes or ribozyme expression vectors. Transient inhibition of NF-κB in the transplanted endothelium may be sufficient to prevent transplant-associated vasculitis and may significantly modulate graft rejection. In the second, donor B cells are treated ex vivo with ribozymes or ribozyme expression vectors. Recipients would receive the treatment prior to transplant. Treatment of a recipient with B cells that do not express T cell co-stimulatory molecules (such as ICAM-1, VCAM-1, and/or B7 an B7-2) can induce antigen-specific anergy. Tolerance to the donor's histocompatibility antigens could result; potentially, any donor could be used for any transplantation procedure.

Asthma.

Granulocyte macrophage colony stimulating factor (GM-CSF) is thought to play a major role in recruitment of eosinophils and other inflammatory cells during the late phase reaction to asthmatic trauma. Again, blocking the local induction of GM-CSF and other inflammatory mediators is likely to reduce the persistent inflammation observed in chronic asthmatics. Aerosol delivery of ribozymes or adenovirus ribozyme expression vectors is a feasible treatment.

Gene Therapy.

Immune responses limit the efficacy of many gene transfer techniques. Cells transfected with retrovirus vectors have short lifetimes in immune competent individuals. The length of expression of adenovirus vectors in terminally differentiated cells is longer in neonatal or immune-compromised animals. Insertion of a small ribozyme expression cassette that modulates inflammatory and immune responses into existing adenovirus or retrovirus constructs will greatly enhance their potential.

Thus, ribozymes of the present invention that cleave rel A mRNA and thereby NF-κB activity have many potential therapeutic uses, and there are reasonable modes of delivering the ribozymes in a number of the possible indications. Development of an effective ribozyme that inhibits NF-κB function is described above; available cellular and activity assays are number, reproducible, and accurate. Animal models for NF-κB function (Kitajima, et al., supra) and for each of the suggested disease targets exist and can be used to optimize activity.

Diagnostic Uses

Ribozymes of this invention may be used as diagnostic tools to examine genetic drift and mutations within diseased cells. The close relationship between ribozyme activity and the structure of the target RNA allows the detection of mutations in any region of the molecule which alters the base-pairing and three-dimensional structure of the target RNA. By using multiple ribozymes described in this invention, one may map nucleotide changes which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with ribozymes may be used to inhibit gene expression and define the role (essentially) of specified gene products in the progression of disease. In this manner, other genetic targets may be defined as important mediators of the disease. These experiments will lead to better treatment of the disease progression by affording the possibility of combinational therapies (e.g., multiple ribozymes targeted to different genes, ribozymes coupled with known small molecule inhibitors, or intermittent treatment with combinations of ribozymes and/or other chemical or biological molecules). Other in vitro uses of ribozymes of this invention are well known in the art, and include detection of the presence of mRNA associated with an NF-κB related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a ribozyme using standard methodology.

In a specific example, ribozymes which can cleave only wild-type or mutant forms of the target RNA are used for the assay. The first ribozyme is used to identify wild-type RNA present in the sample and the second ribozyme will be used to identify mutant RNA in the sample. As reaction controls, synthetic substrates of both wild-type and mutant RNA will be cleaved by both ribozymes to demonstrate the relative ribozyme efficiencies in the reactions and the absence of cleavage of the “non-targeted” RNA species. The cleavage products from the synthetic substrates will also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population. Thus each analysis will require two ribozymes, two substrates and one unknown sample which will be combined into six reactions. The presence of cleavage products will be determined using an RNAse protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired phenotypic changes in target cells. The expression of mRNA whose protein product is implicated in the development of the phenotype (i.e., NF-κB) is adequate to establish risk. If probes of comparable specific activity are used for both transcripts, then a qualitative comparison of RNA levels will be adequate and will decrease the cost of the initial diagnosis. Higher mutant form to wild-type ratios will be correlated with higher risk whether RNA levels are compared qualitatively or quantitatively.

Other embodiments are within the following claims.

TABLE II
Mouse rel A HH Target sequence
nt. HH Target Seq. ID
Pos. Sequence No.
19 AAUGGCU a caCaGgA 7
22 aGCUCcU a cGUgGUG 8
26 CcUCcaU u GcGgACa 9
93 GAUCUGU U uCCCCUC 10
94 uAUCUGUU u CCCCUCA 11
100 UuCCCCU C AUCUUuC 12
103 CCCUCAU C UuuCCcu 13
105 CUCAUCU U uCCcuCA 14
106 UCACUU u CccuCAG 15
129 CAGGCuU C UGGgCCU 16
138 GGgCCuU A UGUGGAG 17
148 UGGAGAU C AucGAaC 18
151 AGAUCAU c GaaCAGC 19
180 AUGCGaU U CCGCUAu 20
181 UGCGaUU C CGCUAuA 21
186 UUCCGCU A uAAaUGC 22
204 GGGCGCU C aGCGGGC 23
217 GCAGuAU u CcuGGCG 24
239 CACAGAU A CCACCAA 25
262 CCACCAU C AAGAUCA 26
268 CGaAUCU C AAUGGCU 27
276 AAUGGCU A CACAGGA 28
301 UuCGaAU C UCCCUGG 29
303 CGUCU C CCUGGUC 30
310 CCCUGGU C ACCAAGG 31
323 GGcCCCU C CUCcuga 32
326 uCCaCCU C ACCGGCC 33
335 CCGGCCU C AuCCaCA 34
349 AuGAaCU U GugGGgA 35
352 AGaUcaU c GaACAGc 36
375 GAUGGCU a CUAUGAG 37
376 AUGGucU C UccGgaG 38
378 GGCUaCU A UGAGGCU 39
391 CUGAcCU C UGCCCaG 40
409 GCaGuAU C CauAGcU 41
416 CCgCAGU a UCCAuAg 42
417 CAuAGcU U CCAGAAC 43
418 AuAGcUU C CAGAACC 44
433 UGGGgAU C CAGUGUG 45
795 GGCUCCU U UUCuCAA 46
796 GCUCCUU U UcuCAAG 47
797 CUCCUUU U CuCAAGC 48
798 UCCUUUU C uCAAGCU 49
829 UGGCCAU U GUGUUCC 50
834 AUUGUGU U CCGGACu 51
835 UUGUGUU C CGGACuC 52
845 GACuCCU C CgUACGC 53
849 CCUCCgU A CGCcGAC 54
872 cCAGGCU C CUGUuCG 55
883 UuCGaGU C UCCAUGC 56
885 CGaGUCU C CAUGCAG 57
905 GCGGCCU U CUGAUCG 58
906 CGGCCUU C uGAuCGc 59
919 GcGAGCU C AGUGAGC 60
936 AUGGAgU U CCAGUAC 61
937 UGGAgUU C CAGUACu 62
942 UUCCAGU A CuUGCCA 63
953 GCCuCAU c CaCAuGA 64
962 AGAuGAU C GcCACCG 65
965 CagUacU u gCCaGAc 66
973 ACCGGAU U GaaGAGA 67
986 GAgACcU u CAAGagu 68
996 AGGACcU A UGAGACC 69
1005 GAGACCU U CAAGAGu 70
1006 AGACCUU C AACAGUA 71
1015 AGAGuAU C AUGAAGA 72
1028 GAAGAGU C CUUUCAa 73
1031 GAGUCCU U UCAauGG 74
1032 AGUCCUU U CaauGGA 75
1033 GUCCUUU C AauGGAC 76
1058 CCGGCCU C CaaCcCG 77
1064 UaCACCU u GaucCAa 78
1072 GgCGUAU U GCUGUGC 79
1082 UGUGCCU a CCCGaAa 80
1083 aaGCCUU C CCGGaAGu 81
1092 CCaAaCU C AaCUUCU 82
1097 CUCAaCU U CUGUCCC 83
1098 UCAaCUU C UGUCCCC 84
1102 CUUCUGU C CCCAAGC 85
1125 CAGCCCU A caCCUUc 86
1127 GCCaUAU a gCcUUAC 87
1131 cAUCCCU c agCacCA 88
1132 AcaCCUU c cCagCAU 89
1133 UCCaUcU c CagCuUC 90
1137 UUUACuU u AgCgCgc 91
1140 cCagCAU C CCUCAGC 92
1153 CCACCAU C AACUuUG 93
1158 AUCAACU u UGAUGAG 94
1680 GAAGACU U CUCCUCC 95
1681 AAGACUU C UCCUCCA 96
1683 GACUUCU C CUCCAUU 97
1686 UUCUCCU C CAUUGCG 98
1690 CCUCCAU U GCGGACA 99
1704 AUGGACU U CUCuGCu 100
1705 UCGACUU C UCuGCuC 101
1707 GACUUCU C uGCuCUu 102
1721 uuUGAGU C AGAUCAG 103
1726 GUCAGAU C AGCUCCU 104
1731 AUCAGCU C CUAAGGu 105
1734 ACCUCCU A AGGuGcU 106
1754 CaGugCU C CCaAGAG 107
467 cCAGGCU c cuguUCg 108
469 AaGCCAU u AGcCAGC 109
473 UuUgAGU C AGauCAg 110
481 AGCaAGU C CAGACCA 111
501 AACCCCU U UCAcGUU 112
502 ACCCCUU u CAcGUUC 113
508 UuCAcGU U CCUAUAG 114
509 uCAcGUU C CUAUAGA 115
512 cGUUCCU A UAGAgGA 116
514 UUCCUAU A GAgGAGC 117
534 GGGGACU A uGACuUG 118
556 UGCGcCU C UGCUUCC 119
561 CUCUGCU U CCAGGUG 120
562 UCUGCUU C CAGGUGA 121
585 aAgCCAU u AGcCAGc 122
598 GGCCCCU C CUCCUGa 123
613 CcCCUGU C CUcuCaC 124
616 CUGUCCU c uCaCAUC 125
617 gucCCUU C CUCAgCC 126
620 CCUUCCU C AgCCaug 127
623 UCCUgcU u CCAUCUc 128
628 AUCCgAU u UUUGAuA 129
630 CCgAUuU U UGAuAAc 130
631 CgAUuUU U GAuAAcC 131
638 UGgCcAU u GUGuuCC 132
661 CCGAGCU C AAGAUCU 133
667 UCAAGAU C UGCCGAG 134
687 CGgAACU C UGGgAGC 135
700 GCUGCCU C GGUGGGG 136
715 AUGAGAU C UUCuUgC 137
717 GAGAUCU U CuUgCUG 138
718 AGAUCUU C uUgCUGU 139
721 UucUCCU c CauUGcG 140
751 AaGACAU U GAGGUGU 141
759 GAGGUGU A UUUCACG 142
761 GGUGUAU U UCACGGG 143
762 GUGUAUU U CACGGGA 144
763 UGUAUUU C ACGGGAC 145
792 CGAGGCU C CUUUUCu 146
1167 GAUGAGU U UuCCcCC 147
1168 AUGAGUU U uCCcCCA 148
1169 UGAGUUU u CCcCCAU 149
1182 AUGcUGU U aCCaUCa 150
1183 UGcUGUU a CCaUCaG 151
1184 GGccccU C CUcCUGa 152
1187 GUccCuU c CUcaGCc 153
1188 UUaCCaU C aGGGCAG 154
1198 GGgAGuU u AGuCuGa 155
1209 CAGCCCU a caCCUUc 156
1215 cuGGCCU U aGCaCCG 157
1229 GGuCCCU u CCucAGc 158
1237 CCCAgCU C CUGCCCC 159
1250 CCAGcCU C CAGgCuC 160
1268 CCCaCCU C CuGCCcc 161
1279 CCAUGGU c cCuuCcu 162
1281 gUGGgcU C ACCUgcG 163
1286 AUgAGuU u UccCCCA 164
1309 CuCCUGU u CgAGUCu 165
1315 cCCCAGU u CUAaCCC 166
1318 CAGUuCU A aCCCCgG 167
1331 gGGuCCU C CcCAGuC 168
1334 CuuUuCU C AaGCUGa 169
1389 ACGCUGU C gGAaGCC 170
1413 CUGCAGU U UCAUGcU 171
1414 UCCAGUU U GAUGcUG 172
1437 GGGGCCU U GCUUGGC 173
1441 CCUUGCU U GCCAACA 174
1467 GgaGUGU U CACACAC 175
1468 gaCUGUU C ACAGACC 176
1482 CUCGCAU C uGUgGAC 177
1486 CUUCgGU a GggAACU 178
1494 GACAACU C aGAGUUU 179
1500 UCaGAGU U UCAGCAC 180
1501 CaGAGUU U CAGCAGC 181
1502 aCAGUUU C ACCAGCU 182
1525 gGUGCAU c CCUGUGu 183
1566 AUGGAGU A CCCUGAa 184
1577 UGAaGCU A UAACUCG 185
1579 AaGCUAU A ACUCGCC 186
1583 UAUAACU C GCCUgGU 187
1588 CUCuCCU A GaGAggG 188
1622 CCCAGCU C CUGCcCC 189
1628 UCCUCCU u CggUaGG 190
1648 CGGGGCU u CCCAAUG 191
1660 cUGaCCU C ugccCAG 192
1663 cuCUgCU U cCAGGUG 193
1664 uCUgCUU c CAGGuGA 194
1665 CUCgcUU u cGGAGgU 195

TABLE III
Human rel A HH Target Sequences
nt. HH Target Seq. ID
Pos. Sequence No.
19 AAUGGCU C GUCUGUA 196
22 GGCUCGU C UGUAGUG 197
26 CGUCUGU A GUGCACG 198
93 GAACUGU U CCCCCUC 199
94 AACUGUU C CCCCUCA 200
100 UCCCCCU C AUCUUCC 201
103 CCCUCAU C UUCCCGG 202
105 CUCAUCU U CCCGGCA 203
106 UCAUCUU C CCGGCAG 204
129 CAGGCCU C UGGCCCC 205
138 GGCCCCU A UGUGGAG 206
148 UGGAGAU C AUUGAGC 207
151 AGAUCAU U GAGCAGC 208
180 AUGCGCU U CCGCUAC 209
181 UGCGCUU C CGCUACA 210
186 UUCCGCU A CAAGUGC 211
204 GGGCGCU C CGCGGGC 212
217 GCAGCAU C CCAGGCG 213
239 CACAGAU A CCACCAA 214
262 CCACCAU C AAGAUCA 215
268 UCAAGAU C AAUGGCU 216
276 AAUGGCU A CACAGGA 217
301 UGCGCAU C UCCCUGG 218
303 CGCAUCU C CCUGGUC 219
310 CCCUGGU C ACCAAGG 220
323 GGACCCU C CUCACCG 221
326 CCCUCCU C ACCGGCC 222
335 CCGGCCU C ACCCCCA 223
349 ACGAGCU U GUAGGAA 224
352 AGCUUGU A GGAAAGG 225
375 GAUGGCU U CUAUGAG 226
376 AUGGCUU C UAUGAGG 227
378 GGCUUCU A UGAGGCU 228
391 CUGAGCU C UGCCCGG 229
409 GCUGCAU C CACAGUU 230
416 CCACAGU U UCCAGAA 231
417 CACAGUU U CCAGAAC 232
418 ACAGUUU C CAGAACC 233
433 UGGGAAU C CAGUGUG 234
795 GGCUCCU U UUCGCAA 235
796 GCUCCUU U UCGCAAG 236
797 CUCCUUU U CGCAAGC 237
798 UCCUUUU C GCAAGCU 238
829 UGGCCAU U GUGUUCC 239
834 AUUGUGU U CCGGACC 240
835 UUGUGUU C CGGACCC 241
845 GACCCCU C CCUACGC 242
849 CCUCCCU A CGCAGAC 243
872 GCAGGCU C CUGUGCG 244
883 UGCGUGU C UCCAUGC 245
885 CGUGUCU C CAUGCAG 246
905 GCGGCCU U CCGACCG 247
906 CGGCCUU C CGACCGG 248
919 GGGAGCU C AGUGAGC 249
936 AUGGAAU U CCAGUAC 250
937 UGGAAUU C CAGUACC 251
942 UUCCAGU A CCUGCCA 252
953 GCCAGAU A CAGACGA 253
962 AGACGAU C GUCACCG 254
965 CGAUCGU C ACCGGAU 255
973 ACCGGAU U GAGGAGA 256
986 GAAACGU A AAAGGAC 257
996 AGGACAU A UGAGACC 258
1005 GAGACCU U CAAGAGC 259
1006 AGACCUU C AAGAGCA 260
1015 AGAGCAU C AUGAAGA 261
1028 GAAGAGU C CUUUCAG 262
1031 GAGUCCU U UCAGCGG 263
1032 AGUCCUU U CAGCGGA 264
1033 GUCCUUU C AGCGGAC 265
1058 CCGGCCU C CACCUCG 266
1064 UCCACCU C GACGCAU 267
1072 GACGCAU U GCUGUGC 268
1082 UGUGCCU U CCCGCAG 269
1083 GUGCCUU C CCGCAGC 270
1092 CGCAGCU C AGCUUCU 271
1097 CUCAGCU U CUGUCCC 272
1098 UCAGCUU C UGUCCCC 273
1102 CUUCUGU C CCCAAGC 274
1125 CAGCCCU A UCCCUUU 275
1127 GCCCUAU C CCUUUAC 276
1131 UAUCCCU U UACGUCA 277
1132 AUCCCUU U ACGUCAU 278
1133 UCCCUUU A CGUCAUC 279
1137 UUUACGU C AUCCCUG 280
1140 ACGUCAU C CCUGAGC 281
1153 GCACCAU C AACUAUG 282
1158 AUCAACU A UGAUGAG 283
1680 GAAGACU U CUCCUCC 284
1681 AAGACUU C UCCUCCA 285
1683 GACUUCU C CUCCAUU 286
1686 UUCUCCU C CAUUGCG 287
1690 CCUCCAU U GCGGACA 288
1704 AUGGACU U CUCAGCC 289
1705 UGGACUU C UCAGCCC 290
1707 GACUUCU C AGCCCUG 291
1721 GCUGAGU C AGAUCAG 292
1726 GUCAGAU C AGCUCCU 293
1731 AUCAGCU C CUAAGGG 294
1734 AGCUCCU A AGGGGGU 295
1754 CUGCCCU C CCCAGAG 296
467 GCAGGCU A UCAGUCA 297
469 AGGCUAU C AGUCAGC 298
473 UAUCAGU C AGCGCAU 299
481 AGCGCAU C CAGACCA 300
501 AACCCCU U CCAAGUU 301
502 ACCCCUU C CAAGUUC 302
508 UCCAAGU U CCUAUAG 303
509 CCAAGUU C CUAUAGA 304
512 AGUUCCU A UAGAAGA 305
514 UUCCUAU A GAAGAGC 306
534 GGGGACU A CGACCUG 307
556 UGCGGCU C UGCUUCC 308
561 CUCUGCU U CCAGGUG 309
562 UCUGCUU C CAGGUGA 310
585 GACCCAU C AGGCAGG 311
598 GGCCCCU C CGCCUGC 312
613 CGCCUGU C CUUCCUC 313
616 CUGUCCU U CCUCAUC 314
617 UGUCCUU C CUCAUCC 315
620 CCUUCCU C AUCCCAU 316
623 UCCUCAU & CCAUCUU 317
628 AUCCCAU C UUUGACA 318
630 CCCAUCU U UGACAAU 319
631 CCAUCUU U GACAAUC 320
638 UGACAAU C GUGCCCC 321
661 CCGAGCU C AAGAUCU 322
667 UCAAGAU C UGCCGAG 323
687 CGAAACU C UGGCAGC 324
700 GCUGCCU C GGUGGGG 325
715 AUGAGAU C UUCCUAC 326
717 GAGAUCU U CCUACUG 327
718 AGAUCUU C CUACUGU 328
721 UCUUCCU A CUGUGUG 329
751 AGGACAU U GAGGUGU 330
759 GAGGUGU A UUUCACG 331
761 GGUGUAU U UCACGGG 332
762 GUGUAUU U CACGGGA 333
763 UGUAUUU C ACGGGAC 334
792 CGAGGCU C CUUUUCG 335
1167 GAUGAGU U UCCCACC 336
1168 AUGAGUU U CCCACCA 337
1169 UGAGUUU C CCACCAU 338
1182 AUGGUGU U UCCUUCU 339
1183 UGGUGUU U CCUUCUG 340
1184 GGUGUUU C CUUCUGG 341
1187 GUUUCCU U CUGGGCA 342
1188 UUUCCUU C UGGGCAG 343
1198 GGCAGAU C AGCCAGG 344
1209 CAGGCCU C GGCCUUG 345
1215 UCGGCCU U GGCCCCG 346
1229 GGCCCCU C CCCAAGU 347
1237 CCCAAGU C CUGCCCC 348
1250 CCAGGCU C CAGCCCC 349
1268 CCCUGCU C CAGCCAU 350
1279 CCAUGGU A UCAGCUC 351
1281 AUGGUAU C AGCUCUG 352
1286 AUCAGCU C UGGCCCA 353
1309 CCCCUGU C CCAGUCC 354
1315 UCCCAGU C CUAGCCC 355
1318 CAGUCCU A GCCCCAG 356
1331 AGGCCCU C CUCAGGC 357
1334 CCCUCCU C AGGCUGU 358
1389 ACGCUGU C AGAGGCC 359
1413 CUGCAGU U UGAUGAU 360
1414 UGCAGUU U GAUGAUG 361
1437 GGGGCCU U GCUUGGC 362
1441 CCUUGCU U GGCAACA 363
1467 GCUGUGU U CACAGAC 364
1468 CUGUGUU C ACAGACC 365
1482 CUGGCAU C CGUCGAC 366
1486 CAUCCGU C GACAACU 367
1494 GACAACU C CGAGUUU 368
1500 UCCGAGU U UCAGCAG 369
1501 CCGAGUU U CAGCAGC 370
1502 CGAGUUU C AGCAGCU 371
1525 AGGGCAU A CCUGUGG 372
1566 AUGGAGU A CCCUGAG 373
1577 UGAGGCU A UAACUCG 374
1579 AGGCUAU A ACUCGCC 375
1583 UAUAACU C GCCUAGU 376
1588 CUCGCCU A GUGACAG 377
1622 CCCAGCU C CUGCUCC 378
1628 UCCUGCU C CACUGGG 379
1648 CGGGGCU C CCCAAUG 380
1660 AUGGCCU C CUUUCAG 381
1663 GCCUCCU U UCAGGAG 382
1664 CCUCCUU U CAGGAGA 383
1665 CUCCUUU C AGGAGAU 384

TABLE IV
Mouse rel A HH Ribozyme Sequences
nt. Sequence HH Ribozyme Sequence Seq. ID No.
19 UCCUGUG CUGAUGAGGCCGAAAGGCCGAA AGCCAUU 385
22 CACCACG CUGAUGAGGCCGAAAGGCCGAA AGGAGCU 386
26 UGUCCGC CUGAUGAGGCCGAAAGGCCGAA AUGGAGG 387
93 GAGGGGA CUGAUGAGGCCGAAAGGCCGAA ACAGAUC 388
94 UGAGGGG CUGAUGAGGCCGAAAGGCCGAA AACAGAU 389
100 GAAAGAU CUGAUGAGGCCGAAAGGCCGAA AGGGGAA 390
103 AGGGAAA CUGAUGAGGCCGAAAGGCCGAA AUGAGGG 391
105 UGAGGGA CUGAUGAGGCCGAAAGGCCGAA AGAUGAG 392
106 CUGAGGG CUGAUGAGGCCGAAAGGCCGAA AAGAUGA 393
129 AGGCCCA CUGAUGAGGCCGAAAGGCCGAA AAGCCUG 394
138 CUCCACA CUGAUGAGGCCGAAAGGCCGAA AAGGCCC 395
148 GUUCGAU CUGAUGAGGCCGAAAGGCCGAA AUCUCCA 396
151 GCUGUUC CUGAUGAGGCCGAAAGGCCGAA AUGAUCU 397
180 AUAGCGG CUGAUGAGGCCGAAAGGCCGAA AUCGCAU 398
181 UAUAGCG CUGAUGAGGCCGAAAGGCCGAA AAUCGCA 399
186 GCAUUUA CUGAUGAGGCCGAAAGGCCGAA AGCGGAA 400
204 GCCCGCU CUGAUGAGGCCGAAAGGCCGAA AGCGCCC 401
217 CGCCAGG CUGAUGAGGCCGAAAGGCCGAA AUACUGC 402
239 UUGGUGG CUGAUGAGGCCGAAAGGCCGAA AUCUGUG 403
262 UGAUCUU CUGAUGAGGCCGAAAGGCCGAA AUGGUGG 404
268 AGCCAUU CUGAUGAGGCCGAAAGGCCGAA AUCUUGA 405
276 UCCUGUG CUGAUGAGGCCGAAAGGCCGAA AGCCAUU 406
301 CCAGGGA CUGAUGAGGCCGAAAGGCCGAA AUUCGAA 407
303 GACCAGG CUGAUGAGGCCGAAAGGCCGAA AGAUUCG 408
310 CCUUGGU CUGAUGAGGCCGAAAGGCCGAA ACCAGGG 409
323 UCAGGAG CUGAUGAGGCCGAAAGGCCGAA AGGGGCC 410
326 GGCCGGU CUGAUGAGGCCGAAAGGCCGAA AGGUGGA 411
335 UGUGGAU CUGAUGAGGCCGAAAGGCCGAA AGGCCGG 412
349 UCCCCAC CUGAUGAGGCCGAAAGGCCGAA AGUUCAU 413
352 GCUGUUC CUGAUGAGGCCGAAAGGCCGAA AUGAUCU 414
375 CUCAUAG CUGAUGAGGCCGAAAGGCCGAA AGCCAUC 415
376 CUCCGGA CUGAUGAGGCCGAAAGGCCGAA AGACCAU 416
378 AGCCUCA CUGAUGAGGCCGAAAGGCCGAA AGUAGCC 417
391 CUGGGCA CUGAUGAGGCCGAAAGGCCGAA AGGUCAG 418
409 AGCUAUG CUGAUGAGGCCGAAAGGCCGAA AUACUGC 419
416 CUAUGGA CUGAUGAGGCCGAAAGGCCGAA ACUGCGG 420
417 GUUCUGG CUGAUGAGGCCGAAAGGCCGAA AGCUAUG 421
418 GGUUCUG CUGAUGAGGCCGAAAGGCCGAA AAGCUAU 422
433 CACACUG CUGAUGAGGCCGAAAGGCCGAA AUCCCCA 423
467 CGAACAG CUGAUGAGGCCGAAAGGCCGAA AGCCUGG 424
469 GCUGGCU CUGAUGAGGCCGAAAGGCCGAA AUGGCUU 425
473 CUGAUCU CUGAUGAGGCCGAAAGGCCGAA ACUCAAA 426
481 UGGUCUG CUGAUGAGGCCGAAAGGCCGAA AUUCGCU 427
501 AACGUGA CUGAUGAGGCCGAAAGGCCGAA AGGGGUU 428
502 GAACGUG CUGAUGAGGCCGAAAGGCCGAA AAGGGGU 429
508 CUAUAGG CUGAUGAGGCCGAAAGGCCGAA ACGUGAA 430
509 UCUAUAG CUGAUGAGGCCGAAAGGCCGAA AACGUGA 431
512 UCCUCUA CUGAUGAGGCCGAAAGGCCGAA AGGAACG 432
514 GCUCCUC CUGAUGAGGCCGAAAGGCCGAA AUAGGAA 433
534 CAAGUCA CUGAUGAGGCCGAAAGGCCGAA AGUCCCC 434
556 GGAAGCA CUGAUGAGGCCGAAAGGCCGAA AGGCGCA 435
561 CACCUGG CUGAUGAGGCCGAAAGGCCGAA AGCAGAG 436
562 UCACCUG CUGAUGAGGCCGAAAGGCCGAA AAGCAGA 437
585 GCUGGCU CUGAUGAGGCCGAAAGGCCGAA AUGGCUU 438
598 UCAGGAG CUGAUGAGGCCGAAAGGCCGAA AGGGGCC 439
613 GUGAGAG CUGAUGAGGCCGAAAGGCCGAA ACAGGGG 440
616 GAUGUGA CUGAUGAGGCCGAAAGGCCGAA AGGACAG 441
617 GGCUGAG CUGAUGAGGCCGAAAGGCCGAA AAGGGAC 442
620 CAUGGCU CUGAUGAGGCCGAAAGGCCGAA AGGAAGG 443
623 GAGAUGG CUGAUGAGGCCGAAAGGCCGAA AGCAGGA 444
628 UAUCAAA CUGAUGAGGCCGAAAGGCCGAA AUCGGAU 445
630 GUUAUCA CUGAUGAGGCCGAAAGGCCGAA AAAUCGG 446
631 GGUUAUC CUGAUGAGGCCGAAAGGCCGAA AAAAUCG 447
638 GGAACAC CUGAUGAGGCCGAAAGGCCGAA AUGGCCA 448
661 AGAUCUU CUGAUGAGGCCGAAAGGCCGAA AGCUCGG 449
667 CUCGGCA CUGAUGAGGCCGAAAGGCCGAA AUCUUGA 450
687 GCUCCCA CUGAUGAGGCCGAAAGGCCGAA AGUUCCG 451
700 CCCCACC CUGAUGAGGCCGAAAGGCCGAA AGGCAGC 452
715 GCAAGAA CUGAUGAGGCCGAAAGGCCGAA AUCUCAU 453
717 CAGCAAG CUGAUGAGGCCGAAAGGCCGAA AGAUCUC 454
718 ACAGCAA CUGAUGAGGCCGAAAGGCCGAA AAGAUCU 455
721 CGCAAUG CUGAUGAGGCCGAAAGGCCGAA AGGAGAA 456
751 ACACCUC CUGAUGAGGCCGAAAGGCCGAA AUGUCUU 457
759 CGUGAAA CUGAUGAGGCCGAAAGGCCGAA ACACCUC 458
761 CCCGUGA CUGAUGAGGCCGAAAGGCCGAA AUACACC 459
762 UCCCGUG CUGAUGAGGCCGAAAGGCCGAA AAUACAC 460
763 GUCCCGU CUGAUGAGGCCGAAAGGCCGAA AAAUACA 461
792 AGAAAAG CUGAUGAGGCCGAAAGGCCGAA AGCCUCG 462
795 UUGAGAA CUGAUGAGGCCGAAAGGCCGAA AGGAGCC 463
796 CUUGAGA CUGAUGAGGCCGAAAGGCCGAA AAGGAGC 464
797 GCUUGAG CUGAUGAGGCCGAAAGGCCGAA AAAGGAG 465
798 AGCUUGA CUGAUGAGGCCGAAAGGCCGAA AAAAGGA 466
829 GGAACAC CUGAUGAGGCCGAAAGGCCGAA AUGGCCA 467
834 AGUCCGG CUGAUGAGGCCGAAAGGCCGAA ACACAAU 468
835 GAGUCCG CUGAUGAGGCCGAAAGGCCGAA AACACAA 469
845 GCGUACG CUGAUGAGGCCGAAAGGCCGAA AGGAGUC 470
849 GUCGGCG CUGAUGAGGCCGAAAGGCCGAA ACGGAGG 471
872 CGAACAG CUGAUGAGGCCGAAAGGCCGAA AGCCUGG 472
883 GCAUGGA CUGAUGAGGCCGAAAGGCCGAA ACUCGAA 473
885 CUGCAUG CUGAUGAGGCCGAAAGGCCGAA AGACUCG 474
905 CGAUCAG CUGAUGAGGCCGAAAGGCCGAA AGGCCGC 475
906 GCGAUCA CUGAUGAGGCCGAAAGGCCGAA AAGGCCG 476
919 GCUCACU CUGAUGAGGCCGAAAGGCCGAA AGCUCGC 477
936 GUACUGG CUGAUGAGGCCGAAAGGCCGAA ACUCCAU 478
937 AGUACUG CUGAUGAGGCCGAAAGGCCGAA AACUCCA 479
942 UGGCAAG CUGAUGAGGCCGAAAGGCCGAA ACUGGAA 480
953 UCAUGUG CUGAUGAGGCCGAAAGGCCGAA AUGAGGC 481
962 CGGUGGC CUGAUGAGGCCGAAAGGCCGAA AUCAUCU 482
965 GUCUGGC CUGAUGAGGCCGAAAGGCCGAA AGUACUG 483
973 UCUCUUC CUGAUGAGGCCGAAAGGCCGAA AUCCGGU 484
986 ACUCUUG CUGAUGAGGCCGAAAGGCCGAA AGGUCUC 485
996 GGUCUCA CUGAUGAGGCCGAAAGGCCGAA AGGUCCU 486
1005 ACUCUUG CUGAUGAGGCCGAAAGGCCGAA AGGUCUC 487
1006 UACUCUU CUGAUGAGGCCGAAAGGCCGAA AAGGUCU 488
1015 UCUUCAU CUGAUGAGGCCGAAAGGCCGAA AUACUCU 489
1028 UUGAAAG CUGAUGAGGCCGAAAGGCCGAA ACUCUUC 490
1031 CCAUUGA CUGAUGAGGCCGAAAGGCCGAA AGGACUC 491
1032 UCCAUUG CUGAUGAGGCCGAAAGGCCGAA AAGGACU 492
1033 GUCCAUU CUGAUGAGGCCGAAAGGCCGAA AAAGGAC 493
1058 CGGGUUG CUGAUGAGGCCGAAAGGCCGAA AGGCCGG 494
1064 UUGGAUC CUGAUGAGGCCGAAAGGCCGAA AGGUGUA 495
1072 GCACAGC CUGAUGAGGCCGAAAGGCCGAA AUACGCC 496
1082 UUUCGGG CUGAUGAGGCCGAAAGGCCGAA AGGCACA 497
1083 ACUUCGG CUGAUGAGGCCGAAAGGCCGAA AAGGCUU 498
1092 AGAAGUU CUGAUGAGGCCGAAAGGCCGAA AGUUUCG 499
1097 GGGACAG CUGAUGAGGCCGAAAGGCCGAA AGUUGAG 500
1098 GGGGACA CUGAUGAGGCCGAAAGGCCGAA AAGUUGA 501
1102 GCUUGGG CUGAUGAGGCCGAAAGGCCGAA ACAGAAG 502
1125 GAAGGUG CUGAUGAGGCCGAAAGGCCGAA AGGGCUG 503
1127 GUAAGGC CUGAUGAGGCCOAAAGGCCGAA AUAUGGC 504
1131 UGGUGCU CUGAUGAGGCCGAAAGGCCGAA AGGGAUG 505
1132 AUGCUGG CUGAUGAGGCCGAAAGGCCGAA AAGGUGU 506
1133 GAAGCUG CUGAUGAGGCCGAAAGGCCGAA AGAUGGA 507
1137 GCGCGCU CUGAUGAGGCCGAAAGGCCGAA AAGUAAA 508
1140 GCUGAGG CUGAUGAGGCCGAAAGGCCGAA AUGCUGG 509
1153 CAAAGUU CUGAUGAGGCCGAAAGGCCGAA AUGGUGC 510
1158 CUCAUCA CUGAUGAGGCCGAAAGGCCGAA AGUUGAU 511
1167 GGGGGAA CUGAUGAGGCCGAAAGGCCGAA ACUCAUC 512
1168 UGGGGGA CUGAUGAGGCCGAAAGGCCGAA AACUCAU 513
1169 AUGGGGG CUGAUGAGGCCGAAAGGCCGAA AAACUCA 514
1182 UGAUGGU CUGAUGAGGCCGAAAGGCCGAA ACAGCAU 515
1183 CUGAUGG CUGAUGAGGCCGAAAGGCCGAA AACAGCA 516
1184 UCAGGAG CUGAUGAGGCCGAAAGGCCGAA AGGGGCC 517
1187 GGCUGAG CUGAUGAGGCCGAAAGGCCGAA AAGGGAC 518
1188 CUGCCCU CUGAUGAGGCCGAAAGGCCGAA AUGGUAA 519
1198 UCAGACU CUGAUGAGGCCGAAAGGCCGAA AACUCCC 520
1209 GAAGGUG CUGAUGAGGCCGAAAGGCCGAA AGGGCUG 521
1215 CGGUGCU CUGAUGAGGCCGAAAGGCCGAA AGGCCAG 522
1229 GCUGAGG CUGAUGAGGCCGAAAGGCCGAA AGGGACC 523
1237 GGGGCAG CUGAUGAGGCCGAAAGGCCGAA AGCUGGG 524
1250 GAGCCUG CUGAUGAGGCCGAAAGGCCGAA AGGCUGG 525
1268 GGGGCAG CUGAUGAGGCCGAAAGGCCGAA AGCUGGG 526
1279 AGGAAGG CUGAUGAGGCCGAAAGGCCGAA ACCAUGG 527
1281 CGCAGCU CUGAUGAGGCCGAAAGGCCGAA AGCCCAC 528
1286 UGGGGGA CUGAUGAGGCCGAAAGGCCGAA AACUCAU 529
1309 AGACUCG CUGAUGAGGCCGAAAGGCCGAA ACAGGAG 530
1315 GGGUUAG CUGAUGAGGCCGAAAGGCCGAA ACUGGGG 531
1318 CCGGGGU CUGAUGAGGCCGAAAGGCCGAA AGAACUG 532
1331 GACUGGG CUGAUGAGGCCGAAAGGCCGAA AGGACCC 533
1334 UCAGCUU CUGAUGAGGCCGAAAGGCCGAA AGAAAAG 534
1389 GGCUUCC CUGAUGAGGCCGAAAGGCCGAA ACAGCGU 535
1413 AGCAUCA CUGAUGAGGCCGAAAGGCCGAA ACUGCAG 536
1414 CAGCAUC CUGAUGAGGCCGAAAGGCCGAA AACUGCA 537
1437 GCCAAGC CUGAUGAGGCCGAAAGGCCGAA AGGCCCC 538
1441 UGUUGCC CUGAUGAGGCCGAAAGGCCGAA AGCAAGG 539
1467 GUCUGUG CUGAUGAGGCCGAAAGGCCGAA ACACUCC 540
1468 GGUCUGU CUGAUGAGGCCGAAAGGCCGAA AACACUC 541
1482 GUCCACA CUGAUGAGGCCGAAAGGCCGAA AUGCCAG 542
1486 AGUUCCC CUGAUGAGGCCGAAAGGCCGAA ACCGAAG 543
1494 AAACUCU CUGAUGAGGCCGAAAGGCCGAA AGUUGUC 544
1500 CUGCUGA CUGAUGAGGCCGAAAGGCCGAA ACUCUGA 545
1501 GCUGCUG CUGAUGAGGCCGAAAGGCCGAA AACUCUG 546
1502 AGCUGCU CUGAUGAGGCCGAAAGGCCGAA AAACUCU 547
1525 ACACAGG CUGAUGAGGCCGAAAGGCCGAA AUGCACC 548
1566 UUCAGGG CUGAUGAGGCCGAAAGGCCGAA ACUCCAU 549
1577 CGAGUUA CUGAUGAGGCCGAAAGGCCGAA AGCUUCA 550
1579 GGCGAGU CUGAUGAGGCCGAAAGGCCGAA AUAGCUU 551
1583 ACCAGGC CUGAUGAGGCCGAAAGGCCGAA AGUUAUA 552
1588 CCCUCUC CUGAUGAGGCCGAAAGGCCGAA AGGAGAG 553
1622 GGGGCAG CUGAUGAGGCCGAAAGGCCGAA AGCUGGG 554
1628 CCUACCG CUGAUGAGGCCGAAAGGCCGAA AGCAGGA 555
1648 CAUUGGG CUGAUGAGGCCGAAAGGCCGAA AGCCCCG 556
1660 CUGGGCA CUGAUGAGGCCGAAAGGCCGAA AGGUCAG 557
1663 CACCUGG CUGAUGAGGCCGAAAGGCCGAA AGCAGAG 558
1664 UCACCUG CUGAUGAGGCCGAAAGGCCGAA AAGCAGA 559
1665 ACCUCCG CUGAUGAGGCCGAAAGGCCGAA AAGCGAG 560
1680 GGAGGAG CUGAUGAGGCCGAAAGGCCGAA AGUCUUC 561
1681 UGGAGGA CUGAUGAGGCCGAAAGGCCGAA AAGUCUU 562
1683 AAUGGAG CUGAUGAGGCCGAAAGGCCGAA AGAAGUC 563
1686 CGCAAUG CUGAUGAGGCCGAAAGGCCGAA AGGAGAA 564
1690 UGUCCGC CUGAUGAGGCGGAAAGGCCGAA AUGGAGG 565
1704 AGCAGAG CUGAUGAGGCCGAAAGGCCGAA AGUCCAU 566
1705 GAGCAGA CUGAUGAGGCCGAAAGGCCGAA AAGUCCA 567
1707 AAGAGCA CUGAUGAGGCCGAAAGGCCGAA AGAAGUC 568
1721 CUGAUCU CUGAUGAGGCCGAAAGGCCGAA ACUCAAA 569
1726 AGGAGCU CUGAUGAGGCCGAAAGGCCGAA AUCUGAC 570
1731 ACCUUAG CUGAUGAGGCCGAAAGGCCGAA AGCUGAU 571
1734 AGGACCU CUGAUGAGGCCGAAAGGCCGAA AGGAGCU 572
1754 CUCUUGG CUGAUGAGGCCGAAAGGCCGAA AGCACUG 573

TABLE V
Human rel A HH Ribozyme Sequences
nt. Sequence HH Ribozyme Sequence SEQ ID NO.
19 UACAGAC CUGAUGAGGCCGAAAGGCCGAA AGCCAUU 574
22 CACUACA CUGAUGAGGCCGAAAGGCCGAA ACGAGCC 575
26 CGUGCAC CUGAUGAGGCCGAAAGGCCGAA ACACACG 576
93 GAGGGGG CUGAUGAGGCCGAAAGGCCGAA ACAGUUC 577
94 UGAGGGG CUGAUGAGGCCGAAAGGCCGAA AACAGUU 578
100 GGAAGAU CUGAUGAGGCCGAAAGGCCGAA AGGGGGA 579
103 CCGGGAA CUGAUGAGGCCGAAAGGCCGAA AUGAGGG 580
105 UGCCGGG CUGAUGAGGCCGAAAGGCCGAA AGAUGAG 581
106 CUGCCGG CUGAUGAGGCCGAAAGGCCGAA AAGAUGA 582
129 GGGGCCA CUGAUGAGGCCGAAAGGCCGAA AGGCCUG 583
138 CUCCACA CUGAUGAGGCCGAAAGGCCGAA AGGGGCC 584
148 GCUCAAU CUGAUGAGGCCGAAAGGCCGAA AUCUCCA 585
151 GCUGCUC CUGAUGAGGCCGAAAGGCCGAA AUGAUCU 586
180 GUAGCGG CUGAUGAGGCCGAAAGGCCGAA AGCGCAU 587
181 UGUAGCG CUGAUGAGGCCGAAAGGCCGAA AAGCGCA 588
186 GCACUUG CUGAUGAGGCCGAAAGGCCGAA AGCGGAA 589
204 GCCCGCG CUGAUGAGGCCGAAAGGCCGAA AGCGCCC 590
217 CGCCUGG CUGAUGAGGCCGAAAGGCCGAA AUGCUGC 591
239 UUGGUGG CUGAUGAGGCCGAAAGGCCGAA AUCUGUG 592
262 UGAUCUU CUGAUGAGGCCGAAAGGCCGAA AUGGUGG 593
268 AGCCAUU CUGAUGAGGCCGAAAGGCCGAA AUCUUGA 594
276 UCCUGUG CUGAUGAGGCCGAAAGGCCGAA AGCCAUU 595
301 CCAGGGA CUGAUGAGGCCGAAAGGCCGAA AUGCGCA 596
303 GACCAGG CUGAUGAGGCCGAAAGGCCGAA AGAUGCG 597
310 CCUUGGU CUGAUGAGGCCGAAAGGCCGAA ACCAGGG 598
323 CGGUGAG CUGAUGAGGCCGAAAGGCCGAA AGGGUCC 599
326 GGCCGGU CUGAUGAGGCCGAAAGGCCGAA AGGAGGG 600
335 UGGGGGU CUGAUGAGGCCGAAAGGCCGAA AGGCCGG 601
349 UUCCUAC CUGAUGAGGCCGAAAGGCCGAA AGCUCGU 602
352 CCUUUCC CUGAUGAGGCCGAAAGGCCGAA ACAAGCU 603
375 CUCAUAG CUGAUGAGGCCGAAAGGCCGAA AGCCAUC 604
376 CCUCAUA CUGAUGAGGCCGAAAGGCCGAA AAGCCAU 605
378 AGCCUCA CUGAUGAGGCCGAAAGGCCGAA AGAAGCC 606
391 CCGGGCA CUGAUGAGGCCGAAAGGCCGAA AGCUCAG 607
409 AACUGUG CUGAUGAGGCCGAAAGGCCGAA AUGCAGC 608
416 UUCUGGA CUGAUGAGGCCGAAAGGCCGAA ACUGUGG 609
417 GUUCUGG CUGAUGAGGCCGAAAGGCCGAA AACUGUG 610
418 GGUUCUG CUGAUGAGGCCGAAAGGCCGAA AAACUGU 611
433 CACACUG CUGAUGAGGCCGAAAGGCCGAA AUUCCCA 612
467 UGACUGA CUGAUGAGGCCGAAAGGCCGAA AGCCUGC 613
469 GCUGACU CUGAUGAGGCCGAAAGGCCGAA AUAGCCU 614
473 AUGCGCU CUGAUGAGGCCGAAAGGCCGAA ACUGAUA 615
461 UGGUCUG CUGAUGAGGCCGAAAGGCCGAA AUGCGCU 616
501 AACUUGG CUGAUGAGGCCGAAAGGCCGAA AGGGGUU 617
502 GAACUUG CUGAUGAGGCCGAAAGGCCGAA AAGGGGU 618
508 CUAUAGG CUGAUGAGGCCGAAAGGCCGAA ACUUGAA 619
509 UCUAUAG CUGAUGAGGCCGAAAGGCCGAA AACUUGG 620
512 UCUUCUA CUGAUGAGGCCGAAAGGCCGAA AGGAACU 621
514 GCUCUUC CUGAUGAGGCCGAAAGGCCGAA AUAGGAA 622
534 CAGGUCG CUGAUGAGGCCGAAAGGCCGAA AGUCCCC 623
556 GGAAGCA CUGAUGAGGCCGAAAGGCCGAA AGCCGCA 624
561 CACCUGG CUGAUGAGGCCGAAAGGCCGAA AGCAGAG 625
562 UCACCUG CUGAUGAGGGGGAAAGGCCGAA AAGCAGA 626
585 CCUGCCU CUGAUGAGGCCGAAAGGCCGAA AUGGGUC 627
598 GCAGGGG CUGAUGAGGCCGAAAGGCCGAA AGGGGCC 628
613 GAGGAAG CUGAUGAGGCCGAAAGGCCGAA ACAGGCG 629
616 GAUGAGG CUGAUGAGGCCGAAAGGCCGAA AGGACAG 630
617 GGAUGAG CUGAUGAGGCGGAAAGGCCGAA AAGGACA 631
620 AUGGGAU CUGAUGAGGCCGAAAGGGGGAA AGGAAGG 632
623 AAGAUGG CUGAUGAGGCCGAAAGGGCGAA AUGAGGA 633
628 UGUCAAA CUGAUGAGGCCGAAAGGCCGAA AUCGGAU 634
630 AUUGUCA CUGAUGAGGCCGAAAGGCCGAA AGAUGGG 635
631 GAUUGUC CUGAUGAGGCCGAAAGGCCGAA AAGAUGG 636
638 GGGGCAC CUGAUGAGGGCGAAAGGCCGAA AUUGUCA 637
661 AGAUCUU CUGAUGAGGCCGAAAGGGCGAA AGCUCGG 638
667 CUCGGCA CUGAUGAGGCCGAAAGGCCGAA AUCUUGA 639
687 GCUGCCA CUGAUGAGGCCGAAAGGCCGAA AGUUUGG 640
700 CCGCAGC CUGAUGAGGCCGAAAGGCCGAA AGGCAGG 641
715 GUAGGAA CUGAUGAGGGGGAAAGGCCGAA AUCUCAU 642
717 CAGUAAG CUGAUGAGGCCGAAAGGCCGAA AGAUCUC 643
718 ACAGUAG CUGAUGAGGGCGAAAGGCCGAA AAGAUCU 644
721 CACACAG CUGAUGAGGCCGAAAGGCCGAA AGGAAGA 645
751 ACACCUC CUGAUGAGGGGGAAAGGCCGAA AUGUCCU 646
759 CGUGAAA CUGAUGAGGCCGAAAGGCCGAA ACAGCUC 647
761 CCCGUGA CUGAUGAGGCCGAAAGGCCGAA AUACACC 648
762 UCCCGUG CUGAUGAGGCCGAAAGGCCGAA AAUACAC 649
763 GUGGCGU CUGAUGAGGGGGAAAGGCCGAA AAAUACA 650
792 CGAAAAG CUGAUGAGGGGGAAAGGCCGAA AGCCUCG 651
795 UUGCGAA CUGAUGAGGCCGAAAGGCGGAA AGGAGCC 652
796 CUUGCGA CUGAUGAGGCCGAAAGGCCGAA AAGGAGG 653
797 GCUUGCG CUGAUGAGGCCGAAAGGCCGAA AAAGGAG 654
798 AGCUUGC CUGAUGAGGCCGAAAGGCCGAA AAAAGGA 655
829 GGAACAC CUGAUGAGGCCGAAAGGCCGAA AUGGCCA 656
834 GGUCCGG CUGAUGAGGCCGAAAGGCCGAA ACACAAU 657
835 GGGUCCG CUGAUGAGGCCGAAAGGCCGAA AACACAA 658
845 GCGUAGG CUGAUGAGGCCGAAAGGCCGAA AGGGGUC 659
849 GUCUGCG CUGAUGAGGCCGAAAGGCCGAA AGGGAGG 660
872 CGCACAG CUGAUGAGGGCGAAAGGGCGAA AGCCUGC 661
883 GCAUGGA CUGAUGAGGGCGAAAGGGGGAA ACACGCA 662
885 CUGCAUG CUGAUGAGGCCGAAAGGCCGAA AGACACG 662
905 CGGUCGG CUGAUGAGGCCGAAAGGCCGAA AGGCCGC 664
906 CGGGUCG CUGAUGAGGCGGAAAGGCCGAA AAGGGGG 665
919 GCUCACU CUGAUGAGGCCGAAAGGCCGAA AGCUCCC 666
936 GUACUGG CUGAUGAGGCCGAAAGGCGGAA AUUCCAU 667
937 GGUACUG CUGAUGAGGCCGAAAGGGGGAA AAUUCCA 668
942 UGGCAGG CUGAUGAGGCCGAAAGGCCGAA ACUGGAA 669
953 UCGUCUG CUGAUGAGGCCGAAAGGCCGAA AUCUGGC 670
962 CGGUGAC CUGAUGAGGCCGAAAGGCCGAA AUGGUGU 671
965 AUCCGGU CUGAUGAGGCCGAAAGGCCGAA ACGAUCG 672
973 UCUCCUC CUGAUGAGGCCGAAAGGCCGAA AUCCGGU 673
986 GUCCUUU CUGAUGAGGCCGAAAGGGCGAA AGGUUUC 674
996 GGUCUCA CUGAUGAGGCCGAAAGGCCGAA AUGUCCU 675
1005 GCUCUUG CUGAUGAGGCCGAAAGGCCGAA AGGUCUC 676
1006 UGCUCUU CUGAUGAGGCCGAAAGGCCGAA AAGGUCU 677
1015 UCUUCAU CUGAUGAGGCCGAAAGGCCGAA AUGCUCU 678
1028 CUGAAAG CUGAUGAGGCCGAAAGGCCGAA ACUCUUC 679
1031 CCGCUGA CUGAUGAGGCCGAAAGGCCGAA AGGACUC 680
1032 UCCGCUG CUGAUGAGGCCGAAAGGCCGAA AAGGACU 681
1033 GUCCGCU CUGAUGAGGCCGAAAGGCCGAA AAAGGAC 682
1058 CGAGGUG CUGAUGAGGCCGAAAGGCCGAA AGGCCGG 683
1064 AUGCGUC CUGAUGAGGCCGAAAGGCCGAA AGGUGGA 684
1072 GCACAGC CUGAUGAGGCCGAAAGGCCGAA AUGCGUC 685
1082 CUGCGGG CUGAUGAGGCCGAAAGGCCGAA AGGCACA 686
1083 GCUGCGG CUGAUGAGGCCGAAAGGCCGAA AAGGCAC 687
1092 AGAAGCU CUGAUGAGGCCGAAAGGCCGAA AGCUGCG 688
1097 GGGACAG CUGAUGAGGCCGAAAGGCCGAA AGCUGAG 689
1098 GGGGACA CUGAUGAGGCCGAAAGGCCGAA AAGCUGA 690
1102 GCUUGGG CUGAUGAGGCCGAAAGGCCGAA ACAGAAG 691
1125 AAAGGGA CUGAUGAGGCCGAAAGGCCGAA AGGGCUG 692
1127 GUAAAGG CUGAUGAGGCCGAAAGGCCGAA AUAGGGC 693
1131 UGACGUA CUGAUGAGGCCGAAAGGCCGAA AGGGAUA 694
1132 AUGACGU CUGAUGAGGCCGAAAGGCCGAA AAGGGAU 695
1133 GAUGACG CUGAUGAGGCCGAAAGGCCGAA AAAGGGA 696
1137 CAGGGAU CUGAUGAGGCCGAAAGGCCGAA ACGUAAA 697
1140 GCUCAGG CUGAUGAGGCCGAAAGGCCGAA AUGACGU 698
1153 CAUAGUU CUGAUGAGGCCGAAAGGCCGAA AUGGUGC 699
1158 CUCAUCA CUGAUGAGGCCGAAAGGCCGAA AGUUGAU 700
1167 GGUGGGA CUGAUGAGGCCGAAAGGCCGAA ACUCAUC 701
1168 UGGUGGG CUGAUGAGGCCGAAAGGCCGAA AACUCAU 702
1169 AUGGUGG CUGAUGAGGCCGAAAGGCCGAA AAACUCA 703
1182 AGAAGGA CUGAUGAGGCCGAAAGGCCGAA ACACCAU 704
1183 CAGAAGG CUGAUGAGGCCGAAAGGCCGAA AACACCA 705
1184 CCAGAAG CUGAUGAGGCCGAAAGGCCGAA AAACACC 706
1187 UGCCCAG CUGAUGAGGCCGAAAGGCCGAA AAGAAAC 707
1188 CUGCCCA CUGAUGAGGCCGAAAGGCCGAA AAGGAAA 708
1198 CCUGGCU CUGAUGAGGCCGAAAGGCCGAA AUCUGCC 709
1209 GAAGGCC CUGAUGAGGCCGAAAGGCCGAA AGGCCUG 710
1215 CGGGGCC CUGAUGAGGCCGAAAGGCCGAA AGGCCGA 711
1229 ACUUGGG CUGAUGAGGCCGAAAGGCCGAA AGGGGCC 712
1237 GGGGCAG CUGAUGAGGCCGAAAGGCCGAA ACUUGGG 713
1250 GGGGCUG CUGAUGAGGCCGAAAGGCCGAA AGCCUGG 714
1268 AUGGCUG CUGAUGAGGCCGAAAGGCCGAA AGCAGGG 715
1279 GAGCUGA CUGAUGAGGCCGAAAGGCCGAA ACCAUGG 716
1281 CAGAGCU CUGAUGAGGCCGAAAGGCCGAA AUACCAU 717
1286 UGGGCCA CUGAUGAGGCCGAAAGGCCGAA AGCUGAU 718
1309 GGACUGG CUGAUGAGGCCGAAAGGCCGAA ACAGGGG 719
1315 GGGCUAG CUGAUGAGGCCGAAAGGCCGAA ACUGGGA 720
1318 CUGGGGC CUGAUGAGGCCGAAAGGCCGAA AGGACUG 721
1331 GCCUGAG CUGAUGAGGCCGAAAGGCCGAA AGGGCCU 722
1334 ACAGCCU CUGAGAGGCCGAAAGGCCGAA AGGAGGG 723
1389 GGCCUCU CUGAUGAGGCCGAAAGGCCGAA ACAGCGU 724
1413 AUCAUCA CUGAGAGGCCGAAAGGCCGAA ACUGCAG 725
1414 CAUCAUC CUGAUGAGGCCGAAAGGCCGAA AACUGCA 726
1437 GCCAAGC CUGAUGAGGCCGAAAGGCCGAA AGGCCCC 727
1441 UGUUGCC CUGAUGAGGCCGAAAGGCCGAA AGCAAGG 728
1467 GUCUGUG CUGAUGAGGCCGAAAGGCCGAA ACACAGC 729
1468 GGUCUGU CUGAUGAGGCCGAAAGGCCGAA AACACAG 730
1482 GUCGACG CUGAUGAGGCCGAAAGGCCGAA AUGCCAG 731
1486 AGUUGUC CUGAGAGGCCGAAAGGCCGAA ACGGAUG 732
1494 AAACUCG CUGAUGAGGCCGAAAGGCCGAA AGUUGUC 733
1500 CUGCUGA CUGAUGAGGCCGAAAGGCCGAA ACUCGGA 734
1501 GCUGCUG CUGAUGAGGCCGAAAGGCCGAA AACUCGG 735
1502 AGCUGCU CUGAUGAGGCCGAAAGGCCGAA AAACUCG 736
1525 CCACAGG CUGAUGAGGCCGAAAGGCCGAA AUGCCCU 737
1566 CUCAGGG CUGAUGAGGCCGAAAGGCCGAA ACUCCAU 738
1577 CGAGUUA CUGAGAGGCCGAAAGGCCGAA AGCCUCA 739
1579 GGCGAGU CUGAUGAGGCCGAAAGGCCGAA AUAGCCU 740
1583 ACCAGGC CUGAUGAGGCCGAAAGGCCGAA AGUUAUA 741
1588 CUGUCAC CUGAUGAGGCCGAAAGGCCGAA AGGCGAG 742
1622 GGAGCAG CUGAUGAGGCCGAAAGGCCGAA AGCUGGG 743
1628 CCCAGUG CUGAUGAGGCCGAAAGGCCGAA AGCAGGA 744
1648 CAUUGGG CUGAUGAGGCCGAAAGGCCGAA AGCCCCG 745
1660 CUGAAAG CUGAUGAGGCCGAAAGGCCGAA AGGCCAU 746
1663 CUCCUGA CUGAUGAGGCCGAAAGGCCGAA AGGAGGC 747
1664 UCUCCUG CUGAUGAGGCCGAAAGGCCGAA AAGGAGG 748
1665 AUCUCCU CUGAUGAGGCCGAAAGGCCGAA AAAGGAG 749
1680 GGAGGAG CUGAUGAGGCCGAAAGGCCGAA AGUCUUC 750
1661 UGGAGGA CUGAUGAGGCCGAAAGGCCGAA AAGUCUU 751
1683 AAUGGAG CUGAUGAGGCCGAAAGGCCGAA AGAAGUC 752
1686 CGCAAUG CUGAUGAGGCCGAAAGGCCGAA AGGAGAA 753
1690 UGUCCGC CUGAUGAGGCCGAAAGGCCGAA AUGGAGG 754
1704 GGCUGAG CUGAUGAGGCCGAAAGGCCGAA AGUCCAU 755
1705 GGGCUGA CUGAUGAGGCCGAAAGGCCGAA AAGUCCA 756
1707 CAGGGCU CUGAUGAGGCCGAAAGGCCGAA AGAAGUC 757
1721 CUGAUCU CUGAUGAGGCCGAAAGGCCGAA ACUCAGC 758
1726 AGGAGCU CUGAUGAGGCCGAAAGGCCGAA AUCUGAC 759
1731 CCCUUAG CUGAUGAGGCCGAAAGGCCGAA AGCUGAU 760
1734 ACCCCCU CUGAUGAGGCCGAAAGGCCGAA AGGAGCU 761
1754 CUCUGGG CUGAUGAGGCCGAAAGGCCGAA AGGGCAG 762

TABLE VI
Human rel A Hairpin Ribozyme/Target Sequences
Seq Seq
nt. ID ID
Position Hairpin Ribozyme sequence No. Substrate No.
90 UGAGGGGG AGAA GUUC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 763 GAACU GUU CCCCCUCA 778
156 GCUGCUUG AGAA GCUC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 764 GAGCA GCC CAAGCAGC 779
362 GCCAUCCC AGAA GUCC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 765 GGACU GCC GGGAUGGC 780
413 GUUCUGGA AGAA GUGG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 766 CCACA GUU UCCAGAAC 781
606 GAAGGACA AGAA GCAG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 767 CUGCC GCC UGUCCUUC 782
652 UUGAGCUC AGAA GUGU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 768 ACACU GCC GAGCUCAA 783
695 CCCACCGA AGAA GCUG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 769 CAGCU GCC UCGGUGGG 784
853 AGGCUGGG AGAA GCGU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 770 ACGCA GAC CCCAGCCU 785
900 GGUCGGAA AGAA GCCG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 771 CGGCG GCC UUCCGACC 786
955 UGACGAUC AGAA GUAU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 772 AUACA GAC GAUCGUCA 787
1037 GUCGGUGG AGAA GCUG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 773 CAGCG GAC CCACCGAC 788
1045 GGCCGGGG AGAA GUGG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 774 CCACC GAC CCCCGGCC 789
1410 CAUCAUCA AGAA GCAG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 775 CUGCA GUU UGAUGAUG 790
1453 ACAGCUGG AGAA GUGC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 776 GCACA GAC CCAGCUGU 791
1471 GAUGCCAG AGAA GUGA ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 777 UCACA GAC CUGGCAUC 792

TABLE VII
Mouse rel A Hairpin Ribozyme/Target Sequences
Seq. Seq.
nt. ID ID
Position Hairpin Ribozyme sequence No. Substrate No.
137 GUUGCUUC AGAA GUUC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 793 GAACA GCC GAAGCAAC 812
273 GAGAUUCG AGAA GUUC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 794 GAACA GUU CGAAUCUC 813
343 GCCAUCCC AGAA GUCC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 795 GGACU GCC GGGAUGGC 814
366 GGGCAGAG AGAA GCCU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 796 AGGCU GAC CUCUGCCC 815
633 UUGAGCUC AGAA GUGU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 797 ACACU GCC GAGCUCAA 816
676 CCCACCGA AGAA GCUC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 798 GAGCU GCC UCGGUGGG 817
834 AGGCUGGG AGAA GCGU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 799 ACGCC GAC CCCAGCCU 818
881 GAUCAGAA AGAA GCCG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 800 CGGCG GCC UUCUGAUC 819
1100 AGGUGUAG AGAA GCGG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 801 CCGCA GCC CUACACCU 820
1205 GGGCAGAG AGAA GUGC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 802 GCACC GUC CUCUGCCC 821
1361 GGGCUUCC AGAA GCGU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 803 ACGCU GUC GGAAGCCC 822
1385 CAGCAUCA AGAA GCAG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 804 CUGCA GUU UGAUGCUG 823
1431 ACUCCUGG AGAA GUGC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 805 GCACA GAC CCAGGAGU 824
1449 GAUGCCAG AGAA GUGA ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 806 UCACA GAC CUGGCAUC 825
1802 AAGUCGGG AGAA GCUG ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 807 CAGCU GCC CCCGACUU 826
2009 UGGCUCCA AGAA GUCC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 808 GGACA GAC UGGAGCCA 827
2124 UGGUGUCG AGAA GCAC ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 809 GUGCU GCC CGACACCA 828
2233 AUUCUGAA AGAA GCCA ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 810 UGGCC GCC UUCAGAAU 829
2354 UCAGUAAA AGAA GUCU ACCAGAGAAACACACGUUGUGGUACAUUACCUGGUA 811 AGACA GCC UUUACUGA 830

830 11 nucleic acid single linear The letter “N” stands for any base. “H” represents nucleotide C, A, or U. 1 NNNNUHNNNN N 11 32 nucleic acid single linear The letter “N” stands for any base. 2 NNNNNCUGAN GAGNNNNNNN NNNCGAAANN NN 32 14 nucleic acid single linear The letter “N” stands for any base. 3 NNNNNGUCNN NNNN 14 50 nucleic acid single linear The letter “N” stands for any base. 4 NNNNNNAGAA NNNNACCAGA GAAACACACG UUGUGGUAUA UUACCUGGUA 50 85 nucleic acid single linear 5 UGGCCGGCAU GGUCCCAGCC UCCUCGCUGG CGCCGGCUGG GCAACAUUCC GAGGGGACCG 60 UCCCCUCGGU AAUGGCGAAU GGGAC 85 176 nucleic acid single linear 6 GGGAAAGCUU GCGAAGGGCG UCGUCGCCCC GAGCGGUAGU AAGCAGGGAA CUCACCUCCA 60 AUUUCAGUAC UGAAAUUGUC GUAGCAGUUG ACUACUGUUA UGUGAUUGGU AGAGGCUAAG 120 UGACGGUAUU GGCGUAAGUC AGUAUUGCAG CACAGCACAA GCCCGCUUGC GAGAAU 176 15 base pairs nucleic acid single linear 7 AAUGGCUACA CAGGA 15 15 base pairs nucleic acid single linear 8 AGCUCCUACG UGGUG 15 15 base pairs nucleic acid single linear 9 CCUCCAUUGC GGACA 15 15 base pairs nucleic acid single linear 10 GAUCUGUUUC CCCUC 15 15 base pairs nucleic acid single linear 11 AUCUGUUUCC CCUCA 15 15 base pairs nucleic acid single linear 12 UUCCCCUCAU CUUUC 15 15 base pairs nucleic acid single linear 13 CCCUCAUCUU UCCCU 15 15 base pairs nucleic acid single linear 14 CUCAUCUUUC CCUCA 15 15 base pairs nucleic acid single linear 15 UCAUCUUUCC CUCAG 15 15 base pairs nucleic acid single linear 16 CAGGCUUCUG GGCCU 15 15 base pairs nucleic acid single linear 17 GGGCCUUAUG UGGAG 15 15 base pairs nucleic acid single linear 18 UGGAGAUCAU CGAAC 15 15 base pairs nucleic acid single linear 19 AGAUCAUCGA ACAGC 15 15 base pairs nucleic acid single linear 20 AUGCGAUUCC GCUAU 15 15 base pairs nucleic acid single linear 21 UGCGAUUCCG CUAUA 15 15 base pairs nucleic acid single linear 22 UUCCGCUAUA AAUGC 15 15 base pairs nucleic acid single linear 23 GGGCGCUCAG CGGGC 15 15 base pairs nucleic acid single linear 24 GCAGUAUUCC UGGCG 15 15 base pairs nucleic acid single linear 25 CACAGAUACC ACCAA 15 15 base pairs nucleic acid single linear 26 CCACCAUCAA GAUCA 15 15 base pairs nucleic acid single linear 27 UCAAGAUCAA UGGCU 15 15 base pairs nucleic acid single linear 28 AAUGGCUACA CAGGA 15 15 base pairs nucleic acid single linear 29 UUCGAAUCUC CCUGG 15 15 base pairs nucleic acid single linear 30 CGAAUCUCCC UGGUC 15 15 base pairs nucleic acid single linear 31 CCCUGGUCAC CAAGG 15 15 base pairs nucleic acid single linear 32 GGCCCCUCCU CCUGA 15 15 base pairs nucleic acid single linear 33 UCCACCUCAC CGGCC 15 15 base pairs nucleic acid single linear 34 CCGGCCUCAU CCACA 15 15 base pairs nucleic acid single linear 35 AUGAACUUGU GGGGA 15 15 base pairs nucleic acid single linear 36 AGAUCAUCGA ACAGC 15 15 base pairs nucleic acid single linear 37 GAUGGCUACU AUGAG 15 15 base pairs nucleic acid single linear 38 AUGGUCUCUC CGGAG 15 15 base pairs nucleic acid single linear 39 GGCUACUAUG AGGCU 15 15 base pairs nucleic acid single linear 40 CUGACCUCUG CCCAG 15 15 base pairs nucleic acid single linear 41 GCAGUAUCCA UAGCU 15 15 base pairs nucleic acid single linear 42 CCGCAGUAUC CAUAG 15 15 base pairs nucleic acid single linear 43 CAUAGCUUCC AGAAC 15 15 base pairs nucleic acid single linear 44 AUAGCUUCCA GAACC 15 15 base pairs nucleic acid single linear 45 UGGGGAUCCA GUGUG 15 15 base pairs nucleic acid single linear 46 GGCUCCUUUU CUCAA 15 15 base pairs nucleic acid single linear 47 GCUCCUUUUC UCAAG 15 15 base pairs nucleic acid single linear 48 CUCCUUUUCU CAAGC 15 15 base pairs nucleic acid single linear 49 UCCUUUUCUC AAGCU 15 15 base pairs nucleic acid single linear 50 UGGCCAUUGU GUUCC 15 15 base pairs nucleic acid single linear 51 AUUGUGUUCC GGACU 15 15 base pairs nucleic acid single linear 52 UUGUGUUCCG GACUC 15 15 base pairs nucleic acid single linear 53 GACUCCUCCG UACGC 15 15 base pairs nucleic acid single linear 54 CCUCCGUACG CCGAC 15 15 base pairs nucleic acid single linear 55 CCAGGCUCCU GUUCG 15 15 base pairs nucleic acid single linear 56 UUCGAGUCUC CAUGC 15 15 base pairs nucleic acid single linear 57 CGAGUCUCCA UGCAG 15 15 base pairs nucleic acid single linear 58 GCGGCCUUCU GAUCG 15 15 base pairs nucleic acid single linear 59 CGGCCUUCUG AUCGC 15 15 base pairs nucleic acid single linear 60 GCGAGCUCAG UGAGC 15 15 base pairs nucleic acid single linear 61 AUGGAGUUCC AGUAC 15 15 base pairs nucleic acid single linear 62 UGGAGUUCCA GUACU 15 15 base pairs nucleic acid single linear 63 UUCCAGUACU UGCCA 15 15 base pairs nucleic acid single linear 64 GCCUCAUCCA CAUGA 15 15 base pairs nucleic acid single linear 65 AGAUGAUCGC CACCG 15 15 base pairs nucleic acid single linear 66 CAGUACUUGC CAGAC 15 15 base pairs nucleic acid single linear 67 ACCGGAUUGA AGAGA 15 15 base pairs nucleic acid single linear 68 GAGACCUUCA AGAGU 15 15 base pairs nucleic acid single linear 69 AGGACCUAUG AGACC 15 15 base pairs nucleic acid single linear 70 GAGACCUUCA AGAGU 15 15 base pairs nucleic acid single linear 71 AGACCUUCAA GAGUA 15 15 base pairs nucleic acid single linear 72 AGAGUAUCAU GAAGA 15 15 base pairs nucleic acid single linear 73 GAAGAGUCCU UUCAA 15 15 base pairs nucleic acid single linear 74 GAGUCCUUUC AAUGG 15 15 base pairs nucleic acid single linear 75 AGUCCUUUCA AUGGA 15 15 base pairs nucleic acid single linear 76 GUCCUUUCAA UGGAC 15 15 base pairs nucleic acid single linear 77 CCGGCCUCCA ACCCG 15 15 base pairs nucleic acid single linear 78 UACACCUUGA UCCAA 15 15 base pairs nucleic acid single linear 79 GGCGUAUUGC UGUGC 15 15 base pairs nucleic acid single linear 80 UGUGCCUACC CGAAA 15 15 base pairs nucleic acid single linear 81 AAGCCUUCCC GAAGU 15 15 base pairs nucleic acid single linear 82 CGAAACUCAA CUUCU 15 15 base pairs nucleic acid single linear 83 CUCAACUUCU GUCCC 15 15 base pairs nucleic acid single linear 84 UCAACUUCUG UCCCC 15 15 base pairs nucleic acid single linear 85 CUUCUGUCCC CAAGC 15 15 base pairs nucleic acid single linear 86 CAGCCCUACA CCUUC 15 15 base pairs nucleic acid single linear 87 GCCAUAUAGC CUUAC 15 15 base pairs nucleic acid single linear 88 CAUCCCUCAG CACCA 15 15 base pairs nucleic acid single linear 89 ACACCUUCCC AGCAU 15 15 base pairs nucleic acid single linear 90 UCCAUCUCCA GCUUC 15 15 base pairs nucleic acid single linear 91 UUUACUUUAG CGCGC 15 15 base pairs nucleic acid single linear 92 CCAGCAUCCC UCAGC 15 15 base pairs nucleic acid single linear 93 GCACCAUCAA CUUUG 15 15 base pairs nucleic acid single linear 94 AUCAACUUUG AUGAG 15 15 base pairs nucleic acid single linear 95 GAAGACUUCU CCUCC 15 15 base pairs nucleic acid single linear 96 AAGACUUCUC CUCCA 15 15 base pairs nucleic acid single linear 97 GACUUCUCCU CCAUU 15 15 base pairs nucleic acid single linear 98 UUCUCCUCCA UUGCG 15 15 base pairs nucleic acid single linear 99 CCUCCAUUGC GGACA 15 15 base pairs nucleic acid single linear 100 AUGGACUUCU CUGCU 15 15 base pairs nucleic acid single linear 101 UGGACUUCUC UGCUC 15 15 base pairs nucleic acid single linear 102 GACUUCUCUG CUCUU 15 15 base pairs nucleic acid single linear 103 UUUGAGUCAG AUCAG 15 15 base pairs nucleic acid single linear 104 GUCAGAUCAG CUCCU 15 15 base pairs nucleic acid single linear 105 AUCAGCUCCU AAGGU 15 15 base pairs nucleic acid single linear 106 AGCUCCUAAG GUGCU 15 15 base pairs nucleic acid single linear 107 CAGUGCUCCC AAGAG 15 15 base pairs nucleic acid single linear 108 CCAGGCUCCU GUUCG 15 15 base pairs nucleic acid single linear 109 AAGCCAUUAG CCAGC 15 15 base pairs nucleic acid single linear 110 UUUGAGUCAG AUCAG 15 15 base pairs nucleic acid single linear 111 AGCGAAUCCA GACCA 15 15 base pairs nucleic acid single linear 112 AACCCCUUUC ACGUU 15 15 base pairs nucleic acid single linear 113 ACCCCUUUCA CGUUC 15 15 base pairs nucleic acid single linear 114 UUCACGUUCC UAUAG 15 15 base pairs nucleic acid single linear 115 UCACGUUCCU AUAGA 15 15 base pairs nucleic acid single linear 116 CGUUCCUAUA GAGGA 15 15 base pairs nucleic acid single linear 117 UUCCUAUAGA GGAGC 15 15 base pairs nucleic acid single linear 118 GGGGACUAUG ACUUG 15 15 base pairs nucleic acid single linear 119 UGCGCCUCUG CUUCC 15 15 base pairs nucleic acid single linear 120 CUCUGCUUCC AGGUG 15 15 base pairs nucleic acid single linear 121 UCUGCUUCCA GGUGA 15 15 base pairs nucleic acid single linear 122 AAGCCAUUAG CCAGC 15 15 base pairs nucleic acid single linear 123 GGCCCCUCCU CCUGA 15 15 base pairs nucleic acid single linear 124 CCCCUGUCCU CUCAC 15 15 base pairs nucleic acid single linear 125 CUGUCCUCUC ACAUC 15 15 base pairs nucleic acid single linear 126 GUCCCUUCCU CAGCC 15 15 base pairs nucleic acid single linear 127 CCUUCCUCAG CCAUG 15 15 base pairs nucleic acid single linear 128 UCCUGCUUCC AUCUC 15 15 base pairs nucleic acid single linear 129 AUCCGAUUUU UGAUA 15 15 base pairs nucleic acid single linear 130 CCGAUUUUUG AUAAC 15 15 base pairs nucleic acid single linear 131 CGAUUUUUGA UAACC 15 15 base pairs nucleic acid single linear 132 UGGCCAUUGU GUUCC 15 15 base pairs nucleic acid single linear 133 CCGAGCUCAA GAUCU 15 15 base pairs nucleic acid single linear 134 UCAAGAUCUG CCGAG 15 15 base pairs nucleic acid single linear 135 CGGAACUCUG GGAGC 15 15 base pairs nucleic acid single linear 136 GCUGCCUCGG UGGGG 15 15 base pairs nucleic acid single linear 137 AUGAGAUCUU CUUGC 15 15 base pairs nucleic acid single linear 138 GAGAUCUUCU UGCUG 15 15 base pairs nucleic acid single linear 139 AGAUCUUCUU GCUGU 15 15 base pairs nucleic acid single linear 140 UUCUCCUCCA UUGCG 15 15 base pairs nucleic acid single linear 141 AAGACAUUGA GGUGU 15 15 base pairs nucleic acid single linear 142 GAGGUGUAUU UCACG 15 15 base pairs nucleic acid single linear 143 GGUGUAUUUC ACGGG 15 15 base pairs nucleic acid single linear 144 GUGUAUUUCA CGGGA 15 15 base pairs nucleic acid single linear 145 UGUAUUUCAC GGGAC 15 15 base pairs nucleic acid single linear 146 CGAGGCUCCU UUUCU 15 15 base pairs nucleic acid single linear 147 GAUGAGUUUU CCCCC 15 15 base pairs nucleic acid single linear 148 AUGAGUUUUC CCCCA 15 15 base pairs nucleic acid single linear 149 UGAGUUUUCC CCCAU 15 15 base pairs nucleic acid single linear 150 AUGCUGUUAC CAUCA 15 15 base pairs nucleic acid single linear 151 UGCUGUUACC AUCAG 15 15 base pairs nucleic acid single linear 152 GGCCCCUCCU CCUGA 15 15 base pairs nucleic acid single linear 153 GUCCCUUCCU CAGCC 15 15 base pairs nucleic acid single linear 154 UUACCAUCAG GGCAG 15 15 base pairs nucleic acid single linear 155 GGGAGUUUAG UCUGA 15 15 base pairs nucleic acid single linear 156 CAGCCCUACA CCUUC 15 15 base pairs nucleic acid single linear 157 CUGGCCUUAG CACCG 15 15 base pairs nucleic acid single linear 158 GGUCCCUUCC UCAGC 15 15 base pairs nucleic acid single linear 159 CCCAGCUCCU GCCCC 15 15 base pairs nucleic acid single linear 160 CCAGCCUCCA GGCUC 15 15 base pairs nucleic acid single linear 161 CCCAGCUCCU GCCCC 15 15 base pairs nucleic acid single linear 162 CCAUGGUCCC UUCCU 15 15 base pairs nucleic acid single linear 163 GUGGGCUCAG CUGCG 15 15 base pairs nucleic acid single linear 164 AUGAGUUUUC CCCCA 15 15 base pairs nucleic acid single linear 165 CUCCUGUUCG AGUCU 15 15 base pairs nucleic acid single linear 166 CCCCAGUUCU AACCC 15 15 base pairs nucleic acid single linear 167 CAGUUCUAAC CCCGG 15 15 base pairs nucleic acid single linear 168 GGGUCCUCCC CAGUC 15 15 base pairs nucleic acid single linear 169 CUUUUCUCAA GCUGA 15 15 base pairs nucleic acid single linear 170 ACGCUGUCGG AAGCC 15 15 base pairs nucleic acid single linear 171 CUGCAGUUUG AUGCU 15 15 base pairs nucleic acid single linear 172 UGCAGUUUGA UGCUG 15 15 base pairs nucleic acid single linear 173 GGGGCCUUGC UUGGC 15 15 base pairs nucleic acid single linear 174 CCUUGCUUGG CAACA 15 15 base pairs nucleic acid single linear 175 GGAGUGUUCA CAGAC 15 15 base pairs nucleic acid single linear 176 GAGUGUUCAC AGACC 15 15 base pairs nucleic acid single linear 177 CUGGCAUCUG UGGAC 15 15 base pairs nucleic acid single linear 178 CUUCGGUAGG GAACU 15 15 base pairs nucleic acid single linear 179 GACAACUCAG AGUUU 15 15 base pairs nucleic acid single linear 180 UCAGAGUUUC AGCAG 15 15 base pairs nucleic acid single linear 181 CAGAGUUUCA GCAGC 15 15 base pairs nucleic acid single linear 182 AGAGUUUCAG CAGCU 15 15 base pairs nucleic acid single linear 183 GGUGCAUCCC UGUGU 15 15 base pairs nucleic acid single linear 184 AUGGAGUACC CUGAA 15 15 base pairs nucleic acid single linear 185 UGAAGCUAUA ACUCG 15 15 base pairs nucleic acid single linear 186 AAGCUAUAAC UCGCC 15 15 base pairs nucleic acid single linear 187 UAUAACUCGC CUGGU 15 15 base pairs nucleic acid single linear 188 CUCUCCUAGA GAGGG 15 15 base pairs nucleic acid single linear 189 CCCAGCUCCU GCCCC 15 15 base pairs nucleic acid single linear 190 UCCUGCUUCG GUAGG 15 15 base pairs nucleic acid single linear 191 CGGGGCUUCC CAAUG 15 15 base pairs nucleic acid single linear 192 CUGACCUCUG CCCAG 15 15 base pairs nucleic acid single linear 193 CUCUGCUUCC AGGUG 15 15 base pairs nucleic acid single linear 194 UCUGCUUCCA GGUGA 15 15 base pairs nucleic acid single linear 195 CUCGCUUUCG GAGGU 15 15 base pairs nucleic acid single linear 196 AAUGGCUCGU CUGUA 15 15 base pairs nucleic acid single linear 197 GGCUCGUCUG UAGUG 15 15 base pairs nucleic acid single linear 198 CGUCUGUAGU GCACG 15 15 base pairs nucleic acid single linear 199 GAACUGUUCC CCCUC 15 15 base pairs nucleic acid single linear 200 AACUGUUCCC CCUCA 15 15 base pairs nucleic acid single linear 201 UCCCCCUCAU CUUCC 15 15 base pairs nucleic acid single linear 202 CCCUCAUCUU CCCGG 15 15 base pairs nucleic acid single linear 203 CUCAUCUUCC CGGCA 15 15 base pairs nucleic acid single linear 204 UCAUCUUCCC GGCAG 15 15 base pairs nucleic acid single linear 205 CAGGCCUCUG GCCCC 15 15 base pairs nucleic acid single linear 206 GGCCCCUAUG UGGAG 15 15 base pairs nucleic acid single linear 207 UGGAGAUCAU UGAGC 15 15 base pairs nucleic acid single linear 208 AGAUCAUUGA GCAGC 15 15 base pairs nucleic acid single linear 209 AUGCGCUUCC GCUAC 15 15 base pairs nucleic acid single linear 210 UGCGCUUCCG CUACA 15 15 base pairs nucleic acid single linear 211 UUCCGCUACA AGUGC 15 15 base pairs nucleic acid single linear 212 GGGCGCUCCG CGGGC 15 15 base pairs nucleic acid single linear 213 GCAGCAUCCC AGGCG 15 15 base pairs nucleic acid single linear 214 CACAGAUACC ACCAA 15 15 base pairs nucleic acid single linear 215 CCACCAUCAA GAUCA 15 15 base pairs nucleic acid single linear 216 UCAAGAUCAA UGGCU 15 15 base pairs nucleic acid single linear 217 AAUGGCUACA CAGGA 15 15 base pairs nucleic acid single linear 218 UGCGCAUCUC CCUGG 15 15 base pairs nucleic acid single linear 219 CGCAUCUCCC UGGUC 15 15 base pairs nucleic acid single linear 220 CCCUGGUCAC CAAGG 15 15 base pairs nucleic acid single linear 221 GGACCCUCCU CACCG 15 15 base pairs nucleic acid single linear 222 CCCUCCUCAC CGGCC 15 15 base pairs nucleic acid single linear 223 CCGGCCUCAC CCCCA 15 15 base pairs nucleic acid single linear 224 ACGAGCUUGU AGGAA 15 15 base pairs nucleic acid single linear 225 AGCUUGUAGG AAAGG 15 15 base pairs nucleic acid single linear 226 GAUGGCUUCU AUGAG 15 15 base pairs nucleic acid single linear 227 AUGGCUUCUA UGAGG 15 15 base pairs nucleic acid single linear 228 GGCUUCUAUG AGGCU 15 15 base pairs nucleic acid single linear 229 CUGAGCUCUG CCCGG 15 15 base pairs nucleic acid single linear 230 GCUGCAUCCA CAGUU 15 15 base pairs nucleic acid single linear 231 CCACAGUUUC CAGAA 15 15 base pairs nucleic acid single linear 232 CACAGUUUCC AGAAC 15 15 base pairs nucleic acid single linear 233 ACAGUUUCCA GAACC 15 15 base pairs nucleic acid single linear 234 UGGGAAUCCA GUGUG 15 15 base pairs nucleic acid single linear 235 GGCUCCUUUU CGCAA 15 15 base pairs nucleic acid single linear 236 GCUCCUUUUC GCAAG 15 15 base pairs nucleic acid single linear 237 CUCCUUUUCG CAAGC 15 15 base pairs nucleic acid single linear 238 UCCUUUUCGC AAGCU 15 15 base pairs nucleic acid single linear 239 UGGCCAUUGU GUUCC 15 15 base pairs nucleic acid single linear 240 AUUGUGUUCC GGACC 15 15 base pairs nucleic acid single linear 241 UUGUGUUCCG GACCC 15 15 base pairs nucleic acid single linear 242 GACCCCUCCC UACGC 15 15 base pairs nucleic acid single linear 243 CCUCCCUACG CAGAC 15 15 base pairs nucleic acid single linear 244 GCAGGCUCCU GUGCG 15 15 base pairs nucleic acid single linear 245 UGCGUGUCUC CAUGC 15 15 base pairs nucleic acid single linear 246 CGUGUCUCCA UGCAG 15 15 base pairs nucleic acid single linear 247 GCGGCCUUCC GACCG 15 15 base pairs nucleic acid single linear 248 CGGCCUUCCG ACCGG 15 15 base pairs nucleic acid single linear 249 GGGAGCUCAG UGAGC 15 15 base pairs nucleic acid single linear 250 AUGGAAUUCC AGUAC 15 15 base pairs nucleic acid single linear 251 UGGAAUUCCA GUACC 15 15 base pairs nucleic acid single linear 252 UUCCAGUACC UGCCA 15 15 base pairs nucleic acid single linear 253 GCCAGAUACA GACGA 15 15 base pairs nucleic acid single linear 254 AGACGAUCGU CACCG 15 15 base pairs nucleic acid single linear 255 CGAUCGUCAC CGGAU 15 15 base pairs nucleic acid single linear 256 ACCGGAUUGA GGAGA 15 15 base pairs nucleic acid single linear 257 GAAACGUAAA AGGAC 15 15 base pairs nucleic acid single linear 258 AGGACAUAUG AGACC 15 15 base pairs nucleic acid single linear 259 GAGACCUUCA AGAGC 15 15 base pairs nucleic acid single linear 260 AGACCUUCAA GAGCA 15 15 base pairs nucleic acid single linear 261 AGAGCAUCAU GAAGA 15 15 base pairs nucleic acid single linear 262 GAAGAGUCCU UUCAG 15 15 base pairs nucleic acid single linear 263 GAGUCCUUUC AGCGG 15 15 base pairs nucleic acid single linear 264 AGUCCUUUCA GCGGA 15 15 base pairs nucleic acid single linear 265 GUCCUUUCAG CGGAC 15 15 base pairs nucleic acid single linear 266 CCGGCCUCCA CCUCG 15 15 base pairs nucleic acid single linear 267 UCCACCUCGA CGCAU 15 15 base pairs nucleic acid single linear 268 GACGCAUUGC UGUGC 15 15 base pairs nucleic acid single linear 269 UGUGCCUUCC CGCAG 15 15 base pairs nucleic acid single linear 270 GUGCCUUCCC GCAGC 15 15 base pairs nucleic acid single linear 271 CGCAGCUCAG CUUCU 15 15 base pairs nucleic acid single linear 272 CUCAGCUUCU GUCCC 15 15 base pairs nucleic acid single linear 273 UCAGCUUCUG UCCCC 15 15 base pairs nucleic acid single linear 274 CUUCUGUCCC CAAGC 15 15 base pairs nucleic acid single linear 275 CAGCCCUAUC CCUUU 15 15 base pairs nucleic acid single linear 276 GCCCUAUCCC UUUAC 15 15 base pairs nucleic acid single linear 277 UAUCCCUUUA CGUCA 15 15 base pairs nucleic acid single linear 278 AUCCCUUUAC GUCAU 15 15 base pairs nucleic acid single linear 279 UCCCUUUACG UCAUC 15 15 base pairs nucleic acid single linear 280 UUUACGUCAU CCCUG 15 15 base pairs nucleic acid single linear 281 ACGUCAUCCC UGAGC 15 15 base pairs nucleic acid single linear 282 GCACCAUCAA CUAUG 15 15 base pairs nucleic acid single linear 283 AUCAACUAUG AUGAG 15 15 base pairs nucleic acid single linear 284 GAAGACUUCU CCUCC 15 15 base pairs nucleic acid single linear 285 AAGACUUCUC CUCCA 15 15 base pairs nucleic acid single linear 286 GACUUCUCCU CCAUU 15 15 base pairs nucleic acid single linear 287 UUCUCCUCCA UUGCG 15 15 base pairs nucleic acid single linear 288 CCUCCAUUGC GGACA 15 15 base pairs nucleic acid single linear 289 AUGGACUUCU CAGCC 15 15 base pairs nucleic acid single linear 290 UGGACUUCUC AGCCC 15 15 base pairs nucleic acid single linear 291 GACUUCUCAG CCCUG 15 15 base pairs nucleic acid single linear 292 GCUGAGUCAG AUCAG 15 15 base pairs nucleic acid single linear 293 GUCAGAUCAG CUCCU 15 15 base pairs nucleic acid single linear 294 AUCAGCUCCU AAGGG 15 15 base pairs nucleic acid single linear 295 AGCUCCUAAG GGGGU 15 15 base pairs nucleic acid single linear 296 CUGCCCUCCC CAGAG 15 15 base pairs nucleic acid single linear 297 GCAGGCUAUC AGUCA 15 15 base pairs nucleic acid single linear 298 AGGCUAUCAG UCAGC 15 15 base pairs nucleic acid single linear 299 UAUCAGUCAG CGCAU 15 15 base pairs nucleic acid single linear 300 AGCGCAUCCA GACCA 15 15 base pairs nucleic acid single linear 301 AACCCCUUCC AAGUU 15 15 base pairs nucleic acid single linear 302 ACCCCUUCCA AGUUC 15 15 base pairs nucleic acid single linear 303 UCCAAGUUCC UAUAG 15 15 base pairs nucleic acid single linear 304 CCAAGUUCCU AUAGA 15 15 base pairs nucleic acid single linear 305 AGUUCCUAUA GAAGA 15 15 base pairs nucleic acid single linear 306 UUCCUAUAGA AGAGC 15 15 base pairs nucleic acid single linear 307 GGGGACUACG ACCUG 15 15 base pairs nucleic acid single linear 308 UGCGGCUCUG CUUCC 15 15 base pairs nucleic acid single linear 309 CUCUGCUUCC AGGUG 15 15 base pairs nucleic acid single linear 310 UCUGCUUCCA GGUGA 15 15 base pairs nucleic acid single linear 311 GACCCAUCAG GCAGG 15 15 base pairs nucleic acid single linear 312 GGCCCCUCCG CCUGC 15 15 base pairs nucleic acid single linear 313 CGCCUGUCCU UCCUC 15 15 base pairs nucleic acid single linear 314 CUGUCCUUCC UCAUC 15 15 base pairs nucleic acid single linear 315 UGUCCUUCCU CAUCC 15 15 base pairs nucleic acid single linear 316 CCUUCCUCAU CCCAU 15 15 base pairs nucleic acid single linear 317 UCCUCAUCCC AUCUU 15 15 base pairs nucleic acid single linear 318 AUCCCAUCUU UGACA 15 15 base pairs nucleic acid single linear 319 CCCAUCUUUG ACAAU 15 15 base pairs nucleic acid single linear 320 CCAUCUUUGA CAAUC 15 15 base pairs nucleic acid single linear 321 UGACAAUCGU GCCCC 15 15 base pairs nucleic acid single linear 322 CCGAGCUCAA GAUCU 15 15 base pairs nucleic acid single linear 323 UCAAGAUCUG CCGAG 15 15 base pairs nucleic acid single linear 324 CGAAACUCUG GCAGC 15 15 base pairs nucleic acid single linear 325 GCUGCCUCGG UGGGG 15 15 base pairs nucleic acid single linear 326 AUGAGAUCUU CCUAC 15 15 base pairs nucleic acid single linear 327 GAGAUCUUCC UACUG 15 15 base pairs nucleic acid single linear 328 AGAUCUUCCU ACUGU 15 15 base pairs nucleic acid single linear 329 UCUUCCUACU GUGUG 15 15 base pairs nucleic acid single linear 330 AGGACAUUGA GGUGU 15 15 base pairs nucleic acid single linear 331 GAGGUGUAUU UCACG 15 15 base pairs nucleic acid single linear 332 GGUGUAUUUC ACGGG 15 15 base pairs nucleic acid single linear 333 GUGUAUUUCA CGGGA 15 15 base pairs nucleic acid single linear 334 UGUAUUUCAC GGGAC 15 15 base pairs nucleic acid single linear 335 CGAGGCUCCU UUUCG 15 15 base pairs nucleic acid single linear 336 GAUGAGUUUC CCACC 15 15 base pairs nucleic acid single linear 337 AUGAGUUUCC CACCA 15 15 base pairs nucleic acid single linear 338 UGAGUUUCCC ACCAU 15 15 base pairs nucleic acid single linear 339 AUGGUGUUUC CUUCU 15 15 base pairs nucleic acid single linear 340 UGGUGUUUCC UUCUG 15 15 base pairs nucleic acid single linear 341 GGUGUUUCCU UCUGG 15 15 base pairs nucleic acid single linear 342 GUUUCCUUCU GGGCA 15 15 base pairs nucleic acid single linear 343 UUUCCUUCUG GGCAG 15 15 base pairs nucleic acid single linear 344 GGCAGAUCAG CCAGG 15 15 base pairs nucleic acid single linear 345 CAGGCCUCGG CCUUG 15 15 base pairs nucleic acid single linear 346 UCGGCCUUGG CCCCG 15 15 base pairs nucleic acid single linear 347 GGCCCCUCCC CAAGU 15 15 base pairs nucleic acid single linear 348 CCCAAGUCCU GCCCC 15 15 base pairs nucleic acid single linear 349 CCAGGCUCCA GCCCC 15 15 base pairs nucleic acid single linear 350 CCCUGCUCCA GCCAU 15 15 base pairs nucleic acid single linear 351 CCAUGGUAUC AGCUC 15 15 base pairs nucleic acid single linear 352 AUGGUAUCAG CUCUG 15 15 base pairs nucleic acid single linear 353 AUCAGCUCUG GCCCA 15 15 base pairs nucleic acid single linear 354 CCCCUGUCCC AGUCC 15 15 base pairs nucleic acid single linear 355 UCCCAGUCCU AGCCC 15 15 base pairs nucleic acid single linear 356 CAGUCCUAGC CCCAG 15 15 base pairs nucleic acid single linear 357 AGGCCCUCCU CAGGC 15 15 base pairs nucleic acid single linear 358 CCCUCCUCAG GCUGU 15 15 base pairs nucleic acid single linear 359 ACGCUGUCAG AGGCC 15 15 base pairs nucleic acid single linear 360 CUGCAGUUUG AUGAU 15 15 base pairs nucleic acid single linear 361 UGCAGUUUGA UGAUG 15 15 base pairs nucleic acid single linear 362 GGGGCCUUGC UUGGC 15 15 base pairs nucleic acid single linear 363 CCUUGCUUGG CAACA 15 15 base pairs nucleic acid single linear 364 GCUGUGUUCA CAGAC 15 15 base pairs nucleic acid single linear 365 CUGUGUUCAC AGACC 15 15 base pairs nucleic acid single linear 366 CUGGCAUCCG UCGAC 15 15 base pairs nucleic acid single linear 367 CAUCCGUCGA CAACU 15 15 base pairs nucleic acid single linear 368 GACAACUCCG AGUUU 15 15 base pairs nucleic acid single linear 369 UCCGAGUUUC AGCAG 15 15 base pairs nucleic acid single linear 370 CCGAGUUUCA GCAGC 15 15 base pairs nucleic acid single linear 371 CGAGUUUCAG CAGCU 15 15 base pairs nucleic acid single linear 372 AGGGCAUACC UGUGG 15 15 base pairs nucleic acid single linear 373 AUGGAGUACC CUGAG 15 15 base pairs nucleic acid single linear 374 UGAGGCUAUA ACUCG 15 15 base pairs nucleic acid single linear 375 AGGCUAUAAC UCGCC 15 15 base pairs nucleic acid single linear 376 UAUAACUCGC CUAGU 15 15 base pairs nucleic acid single linear 377 CUCGCCUAGU GACAG 15 15 base pairs nucleic acid single linear 378 CCCAGCUCCU GCUCC 15 15 base pairs nucleic acid single linear 379 UCCUGCUCCA CUGGG 15 15 base pairs nucleic acid single linear 380 CGGGGCUCCC CAAUG 15 15 base pairs nucleic acid single linear 381 AUGGCCUCCU UUCAG 15 15 base pairs nucleic acid single linear 382 GCCUCCUUUC AGGAG 15 15 base pairs nucleic acid single linear 383 CCUCCUUUCA GGAGA 15 15 base pairs nucleic acid single linear 384 CUCCUUUCAG GAGAU 15 36 base pairs nucleic acid single linear 385 UCCUGUGCUG AUGAGGCCGA AAGGCCGAAA GCCAUU 36 36 base pairs nucleic acid single linear 386 CACCACGCUG AUGAGGCCGA AAGGCCGAAA GGAGCU 36 36 base pairs nucleic acid single linear 387 UGUCCGCCUG AUGAGGCCGA AAGGCCGAAA UGGAGG 36 36 base pairs nucleic acid single linear 388 GAGGGGACUG AUGAGGCCGA AAGGCCGAAA CAGAUC 36 36 base pairs nucleic acid single linear 389 UGAGGGGCUG AUGAGGCCGA AAGGCCGAAA ACAGAU 36 36 base pairs nucleic acid single linear 390 GAAAGAUCUG AUGAGGCCGA AAGGCCGAAA GGGGAA 36 36 base pairs nucleic acid single linear 391 AGGGAAACUG AUGAGGCCGA AAGGCCGAAA UGAGGG 36 36 base pairs nucleic acid single linear 392 UGAGGGACUG AUGAGGCCGA AAGGCCGAAA GAUGAG 36 36 base pairs nucleic acid single linear 393 CUGAGGGCUG AUGAGGCCGA AAGGCCGAAA AGAUGA 36 36 base pairs nucleic acid single linear 394 AGGCCCACUG AUGAGGCCGA AAGGCCGAAA AGCCUG 36 36 base pairs nucleic acid single linear 395 CUCCACACUG AUGAGGCCGA AAGGCCGAAA AGGCCC 36 36 base pairs nucleic acid single linear 396 GUUCGAUCUG AUGAGGCCGA AAGGCCGAAA UCUCCA 36 36 base pairs nucleic acid single linear 397 GCUGUUCCUG AUGAGGCCGA AAGGCCGAAA UGAUCU 36 36 base pairs nucleic acid single linear 398 AUAGCGGCUG AUGAGGCCGA AAGGCCGAAA UCGCAU 36 36 base pairs nucleic acid single linear 399 UAUAGCGCUG AUGAGGCCGA AAGGCCGAAA AUCGCA 36 36 base pairs nucleic acid single linear 400 GCAUUUACUG AUGAGGCCGA AAGGCCGAAA GCGGAA 36 36 base pairs nucleic acid single linear 401 GCCCGCUCUG AUGAGGCCGA AAGGCCGAAA GCGCCC 36 36 base pairs nucleic acid single linear 402 CGCCAGGCUG AUGAGGCCGA AAGGCCGAAA UACUGC 36 36 base pairs nucleic acid single linear 403 UUGGUGGCUG AUGAGGCCGA AAGGCCGAAA UCUGUG 36 36 base pairs nucleic acid single linear 404 UGAUCUUCUG AUGAGGCCGA AAGGCCGAAA UGGUGG 36 36 base pairs nucleic acid single linear 405 AGCCAUUCUG AUGAGGCCGA AAGGCCGAAA UCUUGA 36 36 base pairs nucleic acid single linear 406 UCCUGUGCUG AUGAGGCCGA AAGGCCGAAA GCCAUU 36 36 base pairs nucleic acid single linear 407 CCAGGGACUG AUGAGGCCGA AAGGCCGAAA UUCGAA 36 36 base pairs nucleic acid single linear 408 GACCAGGCUG AUGAGGCCGA AAGGCCGAAA GAUUCG 36 36 base pairs nucleic acid single linear 409 CCUUGGUCUG AUGAGGCCGA AAGGCCGAAA CCAGGG 36 36 base pairs nucleic acid single linear 410 UCAGGAGCUG AUGAGGCCGA AAGGCCGAAA GGGGCC 36 36 base pairs nucleic acid single linear 411 GGCCGGUCUG AUGAGGCCGA AAGGCCGAAA GGUGGA 36 36 base pairs nucleic acid single linear 412 UGUGGAUCUG AUGAGGCCGA AAGGCCGAAA GGCCGG 36 36 base pairs nucleic acid single linear 413 UCCCCACCUG AUGAGGCCGA AAGGCCGAAA GUUCAU 36 36 base pairs nucleic acid single linear 414 GCUGUUCCUG AUGAGGCCGA AAGGCCGAAA UGAUCU 36 36 base pairs nucleic acid single linear 415 CUCAUAGCUG AUGAGGCCGA AAGGCCGAAA GCCAUC 36 36 base pairs nucleic acid single linear 416 CUCCGGACUG AUGAGGCCGA AAGGCCGAAA GACCAU 36 36 base pairs nucleic acid single linear 417 AGCCUCACUG AUGAGGCCGA AAGGCCGAAA GUAGCC 36 36 base pairs nucleic acid single linear 418 CUGGGCACUG AUGAGGCCGA AAGGCCGAAA GGUCAG 36 36 base pairs nucleic acid single linear 419 AGCUAUGCUG AUGAGGCCGA AAGGCCGAAA UACUGC 36 36 base pairs nucleic acid single linear 420 CUAUGGACUG AUGAGGCCGA AAGGCCGAAA CUGCGG 36 36 base pairs nucleic acid single linear 421 GUUCUGGCUG AUGAGGCCGA AAGGCCGAAA GCUAUG 36 36 base pairs nucleic acid single linear 422 GGUUCUGCUG AUGAGGCCGA AAGGCCGAAA AGCUAU 36 36 base pairs nucleic acid single linear 423 CACACUGCUG AUGAGGCCGA AAGGCCGAAA UCCCCA 36 36 base pairs nucleic acid single linear 424 CGAACAGCUG AUGAGGCCGA AAGGCCGAAA GCCUGG 36 36 base pairs nucleic acid single linear 425 GCUGGCUCUG AUGAGGCCGA AAGGCCGAAA UGGCUU 36 36 base pairs nucleic acid single linear 426 CUGAUCUCUG AUGAGGCCGA AAGGCCGAAA CUCAAA 36 36 base pairs nucleic acid single linear 427 UGGUCUGCUG AUGAGGCCGA AAGGCCGAAA UUCGCU 36 36 base pairs nucleic acid single linear 428 AACGUGACUG AUGAGGCCGA AAGGCCGAAA GGGGUU 36 36 base pairs nucleic acid single linear 429 GAACGUGCUG AUGAGGCCGA AAGGCCGAAA AGGGGU 36 36 base pairs nucleic acid single linear 430 CUAUAGGCUG AUGAGGCCGA AAGGCCGAAA CGUGAA 36 36 base pairs nucleic acid single linear 431 UCUAUAGCUG AUGAGGCCGA AAGGCCGAAA ACGUGA 36 36 base pairs nucleic acid single linear 432 UCCUCUACUG AUGAGGCCGA AAGGCCGAAA GGAACG 36 36 base pairs nucleic acid single linear 433 GCUCCUCCUG AUGAGGCCGA AAGGCCGAAA UAGGAA 36 36 base pairs nucleic acid single linear 434 CAAGUCACUG AUGAGGCCGA AAGGCCGAAA GUCCCC 36 36 base pairs nucleic acid single linear 435 GGAAGCACUG AUGAGGCCGA AAGGCCGAAA GGCGCA 36 36 base pairs nucleic acid single linear 436 CACCUGGCUG AUGAGGCCGA AAGGCCGAAA GCAGAG 36 36 base pairs nucleic acid single linear 437 UCACCUGCUG AUGAGGCCGA AAGGCCGAAA AGCAGA 36 36 base pairs nucleic acid single linear 438 GCUGGCUCUG AUGAGGCCGA AAGGCCGAAA UGGCUU 36 36 base pairs nucleic acid single linear 439 UCAGGAGCUG AUGAGGCCGA AAGGCCGAAA GGGGCC 36 36 base pairs nucleic acid single linear 440 GUGAGAGCUG AUGAGGCCGA AAGGCCGAAA CAGGGG 36 36 base pairs nucleic acid single linear 441 GAUGUGACUG AUGAGGCCGA AAGGCCGAAA GGACAG 36 36 base pairs nucleic acid single linear 442 GGCUGAGCUG AUGAGGCCGA AAGGCCGAAA AGGGAC 36 36 base pairs nucleic acid single linear 443 CAUGGCUCUG AUGAGGCCGA AAGGCCGAAA GGAAGG 36 36 base pairs nucleic acid single linear 444 GAGAUGGCUG AUGAGGCCGA AAGGCCGAAA GCAGGA 36 36 base pairs nucleic acid single linear 445 UAUCAAACUG AUGAGGCCGA AAGGCCGAAA UCGGAU 36 36 base pairs nucleic acid single linear 446 GUUAUCACUG AUGAGGCCGA AAGGCCGAAA AAUCGG 36 36 base pairs nucleic acid single linear 447 GGUUAUCCUG AUGAGGCCGA AAGGCCGAAA AAAUCG 36 36 base pairs nucleic acid single linear 448 GGAACACCUG AUGAGGCCGA AAGGCCGAAA UGGCCA 36 36 base pairs nucleic acid single linear 449 AGAUCUUCUG AUGAGGCCGA AAGGCCGAAA GCUCGG 36 36 base pairs nucleic acid single linear 450 CUCGGCACUG AUGAGGCCGA AAGGCCGAAA UCUUGA 36 36 base pairs nucleic acid single linear 451 GCUCCCACUG AUGAGGCCGA AAGGCCGAAA GUUCCG 36 36 base pairs nucleic acid single linear 452 CCCCACCCUG AUGAGGCCGA AAGGCCGAAA GGCAGC 36 36 base pairs nucleic acid single linear 453 GCAAGAACUG AUGAGGCCGA AAGGCCGAAA UCUCAU 36 36 base pairs nucleic acid single linear 454 CAGCAAGCUG AUGAGGCCGA AAGGCCGAAA GAUCUC 36 36 base pairs nucleic acid single linear 455 ACAGCAACUG AUGAGGCCGA AAGGCCGAAA AGAUCU 36 36 base pairs nucleic acid single linear 456 CGCAAUGCUG AUGAGGCCGA AAGGCCGAAA GGAGAA 36 36 base pairs nucleic acid single linear 457 ACACCUCCUG AUGAGGCCGA AAGGCCGAAA UGUCUU 36 36 base pairs nucleic acid single linear 458 CGUGAAACUG AUGAGGCCGA AAGGCCGAAA CACCUC 36 36 base pairs nucleic acid single linear 459 CCCGUGACUG AUGAGGCCGA AAGGCCGAAA UACACC 36 36 base pairs nucleic acid single linear 460 UCCCGUGCUG AUGAGGCCGA AAGGCCGAAA AUACAC 36 36 base pairs nucleic acid single linear 461 GUCCCGUCUG AUGAGGCCGA AAGGCCGAAA AAUACA 36 36 base pairs nucleic acid single linear 462 AGAAAAGCUG AUGAGGCCGA AAGGCCGAAA GCCUCG 36 36 base pairs nucleic acid single linear 463 UUGAGAACUG AUGAGGCCGA AAGGCCGAAA GGAGCC 36 36 base pairs nucleic acid single linear 464 CUUGAGACUG AUGAGGCCGA AAGGCCGAAA AGGAGC 36 36 base pairs nucleic acid single linear 465 GCUUGAGCUG AUGAGGCCGA AAGGCCGAAA AAGGAG 36 36 base pairs nucleic acid single linear 466 AGCUUGACUG AUGAGGCCGA AAGGCCGAAA AAAGGA 36 36 base pairs nucleic acid single linear 467 GGAACACCUG AUGAGGCCGA AAGGCCGAAA UGGCCA 36 36 base pairs nucleic acid single linear 468 AGUCCGGCUG AUGAGGCCGA AAGGCCGAAA CACAAU 36 36 base pairs nucleic acid single linear 469 GAGUCCGCUG AUGAGGCCGA AAGGCCGAAA ACACAA 36 36 base pairs nucleic acid single linear 470 GCGUACGCUG AUGAGGCCGA AAGGCCGAAA GGAGUC 36 36 base pairs nucleic acid single linear 471 GUCGGCGCUG AUGAGGCCGA AAGGCCGAAA CGGAGG 36 36 base pairs nucleic acid single linear 472 CGAACAGCUG AUGAGGCCGA AAGGCCGAAA GCCUGG 36 36 base pairs nucleic acid single linear 473 GCAUGGACUG AUGAGGCCGA AAGGCCGAAA CUCGAA 36 36 base pairs nucleic acid single linear 474 CUGCAUGCUG AUGAGGCCGA AAGGCCGAAA GACUCG 36 36 base pairs nucleic acid single linear 475 CGAUCAGCUG AUGAGGCCGA AAGGCCGAAA GGCCGC 36 36 base pairs nucleic acid single linear 476 GCGAUCACUG AUGAGGCCGA AAGGCCGAAA AGGCCG 36 36 base pairs nucleic acid single linear 477 GCUCACUCUG AUGAGGCCGA AAGGCCGAAA GCUCGC 36 36 base pairs nucleic acid single linear 478 GUACUGGCUG AUGAGGCCGA AAGGCCGAAA CUCCAU 36 36 base pairs nucleic acid single linear 479 AGUACUGCUG AUGAGGCCGA AAGGCCGAAA ACUCCA 36 36 base pairs nucleic acid single linear 480 UGGCAAGCUG AUGAGGCCGA AAGGCCGAAA CUGGAA 36 36 base pairs nucleic acid single linear 481 UCAUGUGCUG AUGAGGCCGA AAGGCCGAAA UGAGGC 36 36 base pairs nucleic acid single linear 482 CGGUGGCCUG AUGAGGCCGA AAGGCCGAAA UCAUCU 36 36 base pairs nucleic acid single linear 483 GUCUGGCCUG AUGAGGCCGA AAGGCCGAAA GUACUG 36 36 base pairs nucleic acid single linear 484 UCUCUUCCUG AUGAGGCCGA AAGGCCGAAA UCCGGU 36 36 base pairs nucleic acid single linear 485 ACUCUUGCUG AUGAGGCCGA AAGGCCGAAA GGUCUC 36 36 base pairs nucleic acid single linear 486 GGUCUCACUG AUGAGGCCGA AAGGCCGAAA GGUCCU 36 36 base pairs nucleic acid single linear 487 ACUCUUGCUG AUGAGGCCGA AAGGCCGAAA GGUCUC 36 36 base pairs nucleic acid single linear 488 UACUCUUCUG AUGAGGCCGA AAGGCCGAAA AGGUCU 36 36 base pairs nucleic acid single linear 489 UCUUCAUCUG AUGAGGCCGA AAGGCCGAAA UACUCU 36 36 base pairs nucleic acid single linear 490 UUGAAAGCUG AUGAGGCCGA AAGGCCGAAA CUCUUC 36 36 base pairs nucleic acid single linear 491 CCAUUGACUG AUGAGGCCGA AAGGCCGAAA GGACUC 36 36 base pairs nucleic acid single linear 492 UCCAUUGCUG AUGAGGCCGA AAGGCCGAAA AGGACU 36 36 base pairs nucleic acid single linear 493 GUCCAUUCUG AUGAGGCCGA AAGGCCGAAA AAGGAC 36 36 base pairs nucleic acid single linear 494 CGGGUUGCUG AUGAGGCCGA AAGGCCGAAA GGCCGG 36 36 base pairs nucleic acid single linear 495 UUGGAUCCUG AUGAGGCCGA AAGGCCGAAA GGUGUA 36 36 base pairs nucleic acid single linear 496 GCACAGCCUG AUGAGGCCGA AAGGCCGAAA UACGCC 36 36 base pairs nucleic acid single linear 497 UUUCGGGCUG AUGAGGCCGA AAGGCCGAAA GGCACA 36 36 base pairs nucleic acid single linear 498 ACUUCGGCUG AUGAGGCCGA AAGGCCGAAA AGGCUU 36 36 base pairs nucleic acid single linear 499 AGAAGUUCUG AUGAGGCCGA AAGGCCGAAA GUUUCG 36 36 base pairs nucleic acid single linear 500 GGGACAGCUG AUGAGGCCGA AAGGCCGAAA GUUGAG 36 36 base pairs nucleic acid single linear 501 GGGGACACUG AUGAGGCCGA AAGGCCGAAA AGUUGA 36 36 base pairs nucleic acid single linear 502 GCUUGGGCUG AUGAGGCCGA AAGGCCGAAA CAGAAG 36 36 base pairs nucleic acid single linear 503 GAAGGUGCUG AUGAGGCCGA AAGGCCGAAA GGGCUG 36 36 base pairs nucleic acid single linear 504 GUAAGGCCUG AUGAGGCCGA AAGGCCGAAA UAUGGC 36 36 base pairs nucleic acid single linear 505 UGGUGCUCUG AUGAGGCCGA AAGGCCGAAA GGGAUG 36 36 base pairs nucleic acid single linear 506 AUGCUGGCUG AUGAGGCCGA AAGGCCGAAA AGGUGU 36 36 base pairs nucleic acid single linear 507 GAAGCUGCUG AUGAGGCCGA AAGGCCGAAA GAUGGA 36 36 base pairs nucleic acid single linear 508 GCGCGCUCUG AUGAGGCCGA AAGGCCGAAA AGUAAA 36 36 base pairs nucleic acid single linear 509 GCUGAGGCUG AUGAGGCCGA AAGGCCGAAA UGCUGG 36 36 base pairs nucleic acid single linear 510 CAAAGUUCUG AUGAGGCCGA AAGGCCGAAA UGGUGC 36 36 base pairs nucleic acid single linear 511 CUCAUCACUG AUGAGGCCGA AAGGCCGAAA GUUGAU 36 36 base pairs nucleic acid single linear 512 GGGGGAACUG AUGAGGCCGA AAGGCCGAAA CUCAUC 36 36 base pairs nucleic acid single linear 513 UGGGGGACUG AUGAGGCCGA AAGGCCGAAA ACUCAU 36 36 base pairs nucleic acid single linear 514 AUGGGGGCUG AUGAGGCCGA AAGGCCGAAA AACUCA 36 36 base pairs nucleic acid single linear 515 UGAUGGUCUG AUGAGGCCGA AAGGCCGAAA CAGCAU 36 36 base pairs nucleic acid single linear 516 CUGAUGGCUG AUGAGGCCGA AAGGCCGAAA ACAGCA 36 36 base pairs nucleic acid single linear 517 UCAGGAGCUG AUGAGGCCGA AAGGCCGAAA GGGGCC 36 36 base pairs nucleic acid single linear 518 GGCUGAGCUG AUGAGGCCGA AAGGCCGAAA AGGGAC 36 36 base pairs nucleic acid single linear 519 CUGCCCUCUG AUGAGGCCGA AAGGCCGAAA UGGUAA 36 36 base pairs nucleic acid single linear 520 UCAGACUCUG AUGAGGCCGA AAGGCCGAAA ACUCCC 36 36 base pairs nucleic acid single linear 521 GAAGGUGCUG AUGAGGCCGA AAGGCCGAAA GGGCUG 36 36 base pairs nucleic acid single linear 522 CGGUGCUCUG AUGAGGCCGA AAGGCCGAAA GGCCAG 36 36 base pairs nucleic acid single linear 523 GCUGAGGCUG AUGAGGCCGA AAGGCCGAAA GGGACC 36 36 base pairs nucleic acid single linear 524 GGGGCAGCUG AUGAGGCCGA AAGGCCGAAA GCUGGG 36 36 base pairs nucleic acid single linear 525 GAGCCUGCUG AUGAGGCCGA AAGGCCGAAA GGCUGG 36 36 base pairs nucleic acid single linear 526 GGGGCAGCUG AUGAGGCCGA AAGGCCGAAA GCUGGG 36 36 base pairs nucleic acid single linear 527 AGGAAGGCUG AUGAGGCCGA AAGGCCGAAA CCAUGG 36 36 base pairs nucleic acid single linear 528 CGCAGCUCUG AUGAGGCCGA AAGGCCGAAA GCCCAC 36 36 base pairs nucleic acid single linear 529 UGGGGGACUG AUGAGGCCGA AAGGCCGAAA ACUCAU 36 36 base pairs nucleic acid single linear 530 AGACUCGCUG AUGAGGCCGA AAGGCCGAAA CAGGAG 36 36 base pairs nucleic acid single linear 531 GGGUUAGCUG AUGAGGCCGA AAGGCCGAAA CUGGGG 36 36 base pairs nucleic acid single linear 532 CCGGGGUCUG AUGAGGCCGA AAGGCCGAAA GAACUG 36 36 base pairs nucleic acid single linear 533 GACUGGGCUG AUGAGGCCGA AAGGCCGAAA GGACCC 36 36 base pairs nucleic acid single linear 534 UCAGCUUCUG AUGAGGCCGA AAGGCCGAAA GAAAAG 36 36 base pairs nucleic acid single linear 535 GGCUUCCCUG AUGAGGCCGA AAGGCCGAAA CAGCGU 36 36 base pairs nucleic acid single linear 536 AGCAUCACUG AUGAGGCCGA AAGGCCGAAA CUGCAG 36 36 base pairs nucleic acid single linear 537 CAGCAUCCUG AUGAGGCCGA AAGGCCGAAA ACUGCA 36 36 base pairs nucleic acid single linear 538 GCCAAGCCUG AUGAGGCCGA AAGGCCGAAA GGCCCC 36 36 base pairs nucleic acid single linear 539 UGUUGCCCUG AUGAGGCCGA AAGGCCGAAA GCAAGG 36 36 base pairs nucleic acid single linear 540 GUCUGUGCUG AUGAGGCCGA AAGGCCGAAA CACUCC 36 36 base pairs nucleic acid single linear 541 GGUCUGUCUG AUGAGGCCGA AAGGCCGAAA ACACUC 36 36 base pairs nucleic acid single linear 542 GUCCACACUG AUGAGGCCGA AAGGCCGAAA UGCCAG 36 36 base pairs nucleic acid single linear 543 AGUUCCCCUG AUGAGGCCGA AAGGCCGAAA CCGAAG 36 36 base pairs nucleic acid single linear 544 AAACUCUCUG AUGAGGCCGA AAGGCCGAAA GUUGUC 36 36 base pairs nucleic acid single linear 545 CUGCUGACUG AUGAGGCCGA AAGGCCGAAA CUCUGA 36 36 base pairs nucleic acid single linear 546 GCUGCUGCUG AUGAGGCCGA AAGGCCGAAA ACUCUG 36 36 base pairs nucleic acid single linear 547 AGCUGCUCUG AUGAGGCCGA AAGGCCGAAA AACUCU 36 36 base pairs nucleic acid single linear 548 ACACAGGCUG AUGAGGCCGA AAGGCCGAAA UGCACC 36 36 base pairs nucleic acid single linear 549 UUCAGGGCUG AUGAGGCCGA AAGGCCGAAA CUCCAU 36 36 base pairs nucleic acid single linear 550 CGAGUUACUG AUGAGGCCGA AAGGCCGAAA GCUUCA 36 36 base pairs nucleic acid single linear 551 GGCGAGUCUG AUGAGGCCGA AAGGCCGAAA UAGCUU 36 36 base pairs nucleic acid single linear 552 ACCAGGCCUG AUGAGGCCGA AAGGCCGAAA GUUAUA 36 36 base pairs nucleic acid single linear 553 CCCUCUCCUG AUGAGGCCGA AAGGCCGAAA GGAGAG 36 36 base pairs nucleic acid single linear 554 GGGGCAGCUG AUGAGGCCGA AAGGCCGAAA GCUGGG 36 36 base pairs nucleic acid single linear 555 CCUACCGCUG AUGAGGCCGA AAGGCCGAAA GCAGGA 36 36 base pairs nucleic acid single linear 556 CAUUGGGCUG AUGAGGCCGA AAGGCCGAAA GCCCCG 36 36 base pairs nucleic acid single linear 557 CUGGGCACUG AUGAGGCCGA AAGGCCGAAA GGUCAG 36 36 base pairs nucleic acid single linear 558 CACCUGGCUG AUGAGGCCGA AAGGCCGAAA GCAGAG 36 36 base pairs nucleic acid single linear 559 UCACCUGCUG AUGAGGCCGA AAGGCCGAAA AGCAGA 36 36 base pairs nucleic acid single linear 560 ACCUCCGCUG AUGAGGCCGA AAGGCCGAAA AGCGAG 36 36 base pairs nucleic acid single linear 561 GGAGGAGCUG AUGAGGCCGA AAGGCCGAAA GUCUUC 36 36 base pairs nucleic acid single linear 562 UGGAGGACUG AUGAGGCCGA AAGGCCGAAA AGUCUU 36 36 base pairs nucleic acid single linear 563 AAUGGAGCUG AUGAGGCCGA AAGGCCGAAA GAAGUC 36 36 base pairs nucleic acid single linear 564 CGCAAUGCUG AUGAGGCCGA AAGGCCGAAA GGAGAA 36 36 base pairs nucleic acid single linear 565 UGUCCGCCUG AUGAGGCCGA AAGGCCGAAA UGGAGG 36 36 base pairs nucleic acid single linear 566 AGCAGAGCUG AUGAGGCCGA AAGGCCGAAA GUCCAU 36 36 base pairs nucleic acid single linear 567 GAGCAGACUG AUGAGGCCGA AAGGCCGAAA AGUCCA 36 36 base pairs nucleic acid single linear 568 AAGAGCACUG AUGAGGCCGA AAGGCCGAAA GAAGUC 36 36 base pairs nucleic acid single linear 569 CUGAUCUCUG AUGAGGCCGA AAGGCCGAAA CUCAAA 36 36 base pairs nucleic acid single linear 570 AGGAGCUCUG AUGAGGCCGA AAGGCCGAAA UCUGAC 36 36 base pairs nucleic acid single linear 571 ACCUUAGCUG AUGAGGCCGA AAGGCCGAAA GCUGAU 36 36 base pairs nucleic acid single linear 572 AGCACCUCUG AUGAGGCCGA AAGGCCGAAA GGAGCU 36 36 base pairs nucleic acid single linear 573 CUCUUGGCUG AUGAGGCCGA AAGGCCGAAA GCACUG 36 36 base pairs nucleic acid single linear 574 UACAGACCUG AUGAGGCCGA AAGGCCGAAA GCCAUU 36 36 base pairs nucleic acid single linear 575 CACUACACUG AUGAGGCCGA AAGGCCGAAA CGAGCC 36 36 base pairs nucleic acid single linear 576 CGUGCACCUG AUGAGGCCGA AAGGCCGAAA CAGACG 36 36 base pairs nucleic acid single linear 577 GAGGGGGCUG AUGAGGCCGA AAGGCCGAAA CAGUUC 36 36 base pairs nucleic acid single linear 578 UGAGGGGCUG AUGAGGCCGA AAGGCCGAAA ACAGUU 36 36 base pairs nucleic acid single linear 579 GGAAGAUCUG AUGAGGCCGA AAGGCCGAAA GGGGGA 36 36 base pairs nucleic acid single linear 580 CCGGGAACUG AUGAGGCCGA AAGGCCGAAA UGAGGG 36 36 base pairs nucleic acid single linear 581 UGCCGGGCUG AUGAGGCCGA AAGGCCGAAA GAUGAG 36 36 base pairs nucleic acid single linear 582 CUGCCGGCUG AUGAGGCCGA AAGGCCGAAA AGAUGA 36 36 base pairs nucleic acid single linear 583 GGGGCCACUG AUGAGGCCGA AAGGCCGAAA GGCCUG 36 36 base pairs nucleic acid single linear 584 CUCCACACUG AUGAGGCCGA AAGGCCGAAA GGGGCC 36 36 base pairs nucleic acid single linear 585 GCUCAAUCUG AUGAGGCCGA AAGGCCGAAA UCUCCA 36 36 base pairs nucleic acid single linear 586 GCUGCUCCUG AUGAGGCCGA AAGGCCGAAA UGAUCU 36 36 base pairs nucleic acid single linear 587 GUAGCGGCUG AUGAGGCCGA AAGGCCGAAA GCGCAU 36 36 base pairs nucleic acid single linear 588 UGUAGCGCUG AUGAGGCCGA AAGGCCGAAA AGCGCA 36 36 base pairs nucleic acid single linear 589 GCACUUGCUG AUGAGGCCGA AAGGCCGAAA GCGGAA 36 36 base pairs nucleic acid single linear 590 GCCCGCGCUG AUGAGGCCGA AAGGCCGAAA GCGCCC 36 36 base pairs nucleic acid single linear 591 CGCCUGGCUG AUGAGGCCGA AAGGCCGAAA UGCUGC 36 36 base pairs nucleic acid single linear 592 UUGGUGGCUG AUGAGGCCGA AAGGCCGAAA UCUGUG 36 36 base pairs nucleic acid single linear 593 UGAUCUUCUG AUGAGGCCGA AAGGCCGAAA UGGUGG 36 36 base pairs nucleic acid single linear 594 AGCCAUUCUG AUGAGGCCGA AAGGCCGAAA UCUUGA 36 36 base pairs nucleic acid single linear 595 UCCUGUGCUG AUGAGGCCGA AAGGCCGAAA GCCAUU 36 36 base pairs nucleic acid single linear 596 CCAGGGACUG AUGAGGCCGA AAGGCCGAAA UGCGCA 36 36 base pairs nucleic acid single linear 597 GACCAGGCUG AUGAGGCCGA AAGGCCGAAA GAUGCG 36 36 base pairs nucleic acid single linear 598 CCUUGGUCUG AUGAGGCCGA AAGGCCGAAA CCAGGG 36 36 base pairs nucleic acid single linear 599 CGGUGAGCUG AUGAGGCCGA AAGGCCGAAA GGGUCC 36 36 base pairs nucleic acid single linear 600 GGCCGGUCUG AUGAGGCCGA AAGGCCGAAA GGAGGG 36 36 base pairs nucleic acid single linear 601 UGGGGGUCUG AUGAGGCCGA AAGGCCGAAA GGCCGG 36 36 base pairs nucleic acid single linear 602 UUCCUACCUG AUGAGGCCGA AAGGCCGAAA GCUCGU 36 36 base pairs nucleic acid single linear 603 CCUUUCCCUG AUGAGGCCGA AAGGCCGAAA CAAGCU 36 36 base pairs nucleic acid single linear 604 CUCAUAGCUG AUGAGGCCGA AAGGCCGAAA GCCAUC 36 36 base pairs nucleic acid single linear 605 CCUCAUACUG AUGAGGCCGA AAGGCCGAAA AGCCAU 36 36 base pairs nucleic acid single linear 606 AGCCUCACUG AUGAGGCCGA AAGGCCGAAA GAAGCC 36 36 base pairs nucleic acid single linear 607 CCGGGCACUG AUGAGGCCGA AAGGCCGAAA GCUCAG 36 36 base pairs nucleic acid single linear 608 AACUGUGCUG AUGAGGCCGA AAGGCCGAAA UGCAGC 36 36 base pairs nucleic acid single linear 609 UUCUGGACUG AUGAGGCCGA AAGGCCGAAA CUGUGG 36 36 base pairs nucleic acid single linear 610 GUUCUGGCUG AUGAGGCCGA AAGGCCGAAA ACUGUG 36 36 base pairs nucleic acid single linear 611 GGUUCUGCUG AUGAGGCCGA AAGGCCGAAA AACUGU 36 36 base pairs nucleic acid single linear 612 CACACUGCUG AUGAGGCCGA AAGGCCGAAA UUCCCA 36 36 base pairs nucleic acid single linear 613 UGACUGACUG AUGAGGCCGA AAGGCCGAAA GCCUGC 36 36 base pairs nucleic acid single linear 614 GCUGACUCUG AUGAGGCCGA AAGGCCGAAA UAGCCU 36 36 base pairs nucleic acid single linear 615 AUGCGCUCUG AUGAGGCCGA AAGGCCGAAA CUGAUA 36 36 base pairs nucleic acid single linear 616 UGGUCUGCUG AUGAGGCCGA AAGGCCGAAA UGCGCU 36 36 base pairs nucleic acid single linear 617 AACUUGGCUG AUGAGGCCGA AAGGCCGAAA GGGGUU 36 36 base pairs nucleic acid single linear 618 GAACUUGCUG AUGAGGCCGA AAGGCCGAAA AGGGGU 36 36 base pairs nucleic acid single linear 619 CUAUAGGCUG AUGAGGCCGA AAGGCCGAAA CUUGGA 36 36 base pairs nucleic acid single linear 620 UCUAUAGCUG AUGAGGCCGA AAGGCCGAAA ACUUGG 36 36 base pairs nucleic acid single linear 621 UCUUCUACUG AUGAGGCCGA AAGGCCGAAA GGAACU 36 36 base pairs nucleic acid single linear 622 GCUCUUCCUG AUGAGGCCGA AAGGCCGAAA UAGGAA 36 36 base pairs nucleic acid single linear 623 CAGGUCGCUG AUGAGGCCGA AAGGCCGAAA GUCCCC 36 36 base pairs nucleic acid single linear 624 GGAAGCACUG AUGAGGCCGA AAGGCCGAAA GCCGCA 36 36 base pairs nucleic acid single linear 625 CACCUGGCUG AUGAGGCCGA AAGGCCGAAA GCAGAG 36 36 base pairs nucleic acid single linear 626 UCACCUGCUG AUGAGGCCGA AAGGCCGAAA AGCAGA 36 36 base pairs nucleic acid single linear 627 CCUGCCUCUG AUGAGGCCGA AAGGCCGAAA UGGGUC 36 36 base pairs nucleic acid single linear 628 GCAGGCGCUG AUGAGGCCGA AAGGCCGAAA GGGGCC 36 36 base pairs nucleic acid single linear 629 GAGGAAGCUG AUGAGGCCGA AAGGCCGAAA CAGGCG 36 36 base pairs nucleic acid single linear 630 GAUGAGGCUG AUGAGGCCGA AAGGCCGAAA GGACAG 36 36 base pairs nucleic acid single linear 631 GGAUGAGCUG AUGAGGCCGA AAGGCCGAAA AGGACA 36 36 base pairs nucleic acid single linear 632 AUGGGAUCUG AUGAGGCCGA AAGGCCGAAA GGAAGG 36 36 base pairs nucleic acid single linear 633 AAGAUGGCUG AUGAGGCCGA AAGGCCGAAA UGAGGA 36 36 base pairs nucleic acid single linear 634 UGUCAAACUG AUGAGGCCGA AAGGCCGAAA UGGGAU 36 36 base pairs nucleic acid single linear 635 AUUGUCACUG AUGAGGCCGA AAGGCCGAAA GAUGGG 36 36 base pairs nucleic acid single linear 636 GAUUGUCCUG AUGAGGCCGA AAGGCCGAAA AGAUGG 36 36 base pairs nucleic acid single linear 637 GGGGCACCUG AUGAGGCCGA AAGGCCGAAA UUGUCA 36 36 base pairs nucleic acid single linear 638 AGAUCUUCUG AUGAGGCCGA AAGGCCGAAA GCUCGG 36 36 base pairs nucleic acid single linear 639 CUCGGCACUG AUGAGGCCGA AAGGCCGAAA UCUUGA 36 36 base pairs nucleic acid single linear 640 GCUGCCACUG AUGAGGCCGA AAGGCCGAAA GUUUCG 36 36 base pairs nucleic acid single linear 641 CCCCACCCUG AUGAGGCCGA AAGGCCGAAA GGCAGC 36 36 base pairs nucleic acid single linear 642 GUAGGAACUG AUGAGGCCGA AAGGCCGAAA UCUCAU 36 36 base pairs nucleic acid single linear 643 CAGUAGGCUG AUGAGGCCGA AAGGCCGAAA GAUCUC 36 36 base pairs nucleic acid single linear 644 ACAGUAGCUG AUGAGGCCGA AAGGCCGAAA AGAUCU 36 36 base pairs nucleic acid single linear 645 CACACAGCUG AUGAGGCCGA AAGGCCGAAA GGAAGA 36 36 base pairs nucleic acid single linear 646 ACACCUCCUG AUGAGGCCGA AAGGCCGAAA UGUCCU 36 36 base pairs nucleic acid single linear 647 CGUGAAACUG AUGAGGCCGA AAGGCCGAAA CACCUC 36 36 base pairs nucleic acid single linear 648 CCCGUGACUG AUGAGGCCGA AAGGCCGAAA UACACC 36 36 base pairs nucleic acid single linear 649 UCCCGUGCUG AUGAGGCCGA AAGGCCGAAA AUACAC 36 36 base pairs nucleic acid single linear 650 GUCCCGUCUG AUGAGGCCGA AAGGCCGAAA AAUACA 36 36 base pairs nucleic acid single linear 651 CGAAAAGCUG AUGAGGCCGA AAGGCCGAAA GCCUCG 36 36 base pairs nucleic acid single linear 652 UUGCGAACUG AUGAGGCCGA AAGGCCGAAA GGAGCC 36 36 base pairs nucleic acid single linear 653 CUUGCGACUG AUGAGGCCGA AAGGCCGAAA AGGAGC 36 36 base pairs nucleic acid single linear 654 GCUUGCGCUG AUGAGGCCGA AAGGCCGAAA AAGGAG 36 36 base pairs nucleic acid single linear 655 AGCUUGCCUG AUGAGGCCGA AAGGCCGAAA AAAGGA 36 36 base pairs nucleic acid single linear 656 GGAACACCUG AUGAGGCCGA AAGGCCGAAA UGGCCA 36 36 base pairs nucleic acid single linear 657 GGUCCGGCUG AUGAGGCCGA AAGGCCGAAA CACAAU 36 36 base pairs nucleic acid single linear 658 GGGUCCGCUG AUGAGGCCGA AAGGCCGAAA ACACAA 36 36 base pairs nucleic acid single linear 659 GCGUAGGCUG AUGAGGCCGA AAGGCCGAAA GGGGUC 36 36 base pairs nucleic acid single linear 660 GUCUGCGCUG AUGAGGCCGA AAGGCCGAAA GGGAGG 36 36 base pairs nucleic acid single linear 661 CGCACAGCUG AUGAGGCCGA AAGGCCGAAA GCCUGC 36 36 base pairs nucleic acid single linear 662 GCAUGGACUG AUGAGGCCGA AAGGCCGAAA CACGCA 36 36 base pairs nucleic acid single linear 663 CUGCAUGCUG AUGAGGCCGA AAGGCCGAAA GACACG 36 36 base pairs nucleic acid single linear 664 CGGUCGGCUG AUGAGGCCGA AAGGCCGAAA GGCCGC 36 36 base pairs nucleic acid single linear 665 CCGGUCGCUG AUGAGGCCGA AAGGCCGAAA AGGCCG 36 36 base pairs nucleic acid single linear 666 GCUCACUCUG AUGAGGCCGA AAGGCCGAAA GCUCCC 36 36 base pairs nucleic acid single linear 667 GUACUGGCUG AUGAGGCCGA AAGGCCGAAA UUCCAU 36 36 base pairs nucleic acid single linear 668 GGUACUGCUG AUGAGGCCGA AAGGCCGAAA AUUCCA 36 36 base pairs nucleic acid single linear 669 UGGCAGGCUG AUGAGGCCGA AAGGCCGAAA CUGGAA 36 36 base pairs nucleic acid single linear 670 UCGUCUGCUG AUGAGGCCGA AAGGCCGAAA UCUGGC 36 36 base pairs nucleic acid single linear 671 CGGUGACCUG AUGAGGCCGA AAGGCCGAAA UCGUCU 36 36 base pairs nucleic acid single linear 672 AUCCGGUCUG AUGAGGCCGA AAGGCCGAAA CGAUCG 36 36 base pairs nucleic acid single linear 673 UCUCCUCCUG AUGAGGCCGA AAGGCCGAAA UCCGGU 36 36 base pairs nucleic acid single linear 674 GUCCUUUCUG AUGAGGCCGA AAGGCCGAAA CGUUUC 36 36 base pairs nucleic acid single linear 675 GGUCUCACUG AUGAGGCCGA AAGGCCGAAA UGUCCU 36 36 base pairs nucleic acid single linear 676 GCUCUUGCUG AUGAGGCCGA AAGGCCGAAA GGUCUC 36 36 base pairs nucleic acid single linear 677 UGCUCUUCUG AUGAGGCCGA AAGGCCGAAA AGGUCU 36 36 base pairs nucleic acid single linear 678 UCUUCAUCUG AUGAGGCCGA AAGGCCGAAA UGCUCU 36 36 base pairs nucleic acid single linear 679 CUGAAAGCUG AUGAGGCCGA AAGGCCGAAA CUCUUC 36 36 base pairs nucleic acid single linear 680 CCGCUGACUG AUGAGGCCGA AAGGCCGAAA GGACUC 36 36 base pairs nucleic acid single linear 681 UCCGCUGCUG AUGAGGCCGA AAGGCCGAAA AGGACU 36 36 base pairs nucleic acid single linear 682 GUCCGCUCUG AUGAGGCCGA AAGGCCGAAA AAGGAC 36 36 base pairs nucleic acid single linear 683 CGAGGUGCUG AUGAGGCCGA AAGGCCGAAA GGCCGG 36 36 base pairs nucleic acid single linear 684 AUGCGUCCUG AUGAGGCCGA AAGGCCGAAA GGUGGA 36 36 base pairs nucleic acid single linear 685 GCACAGCCUG AUGAGGCCGA AAGGCCGAAA UGCGUC 36 36 base pairs nucleic acid single linear 686 CUGCGGGCUG AUGAGGCCGA AAGGCCGAAA GGCACA 36 36 base pairs nucleic acid single linear 687 GCUGCGGCUG AUGAGGCCGA AAGGCCGAAA AGGCAC 36 36 base pairs nucleic acid single linear 688 AGAAGCUCUG AUGAGGCCGA AAGGCCGAAA GCUGCG 36 36 base pairs nucleic acid single linear 689 GGGACAGCUG AUGAGGCCGA AAGGCCGAAA GCUGAG 36 36 base pairs nucleic acid single linear 690 GGGGACACUG AUGAGGCCGA AAGGCCGAAA AGCUGA 36 36 base pairs nucleic acid single linear 691 GCUUGGGCUG AUGAGGCCGA AAGGCCGAAA CAGAAG 36 36 base pairs nucleic acid single linear 692 AAAGGGACUG AUGAGGCCGA AAGGCCGAAA GGGCUG 36 36 base pairs nucleic acid single linear 693 GUAAAGGCUG AUGAGGCCGA AAGGCCGAAA UAGGGC 36 36 base pairs nucleic acid single linear 694 UGACGUACUG AUGAGGCCGA AAGGCCGAAA GGGAUA 36 36 base pairs nucleic acid single linear 695 AUGACGUCUG AUGAGGCCGA AAGGCCGAAA AGGGAU 36 36 base pairs nucleic acid single linear 696 GAUGACGCUG AUGAGGCCGA AAGGCCGAAA AAGGGA 36 36 base pairs nucleic acid single linear 697 CAGGGAUCUG AUGAGGCCGA AAGGCCGAAA CGUAAA 36 36 base pairs nucleic acid single linear 698 GCUCAGGCUG AUGAGGCCGA AAGGCCGAAA UGACGU 36 36 base pairs nucleic acid single linear 699 CAUAGUUCUG AUGAGGCCGA AAGGCCGAAA UGGUGC 36 36 base pairs nucleic acid single linear 700 CUCAUCACUG AUGAGGCCGA AAGGCCGAAA GUUGAU 36 36 base pairs nucleic acid single linear 701 GGUGGGACUG AUGAGGCCGA AAGGCCGAAA CUCAUC 36 36 base pairs nucleic acid single linear 702 UGGUGGGCUG AUGAGGCCGA AAGGCCGAAA ACUCAU 36 36 base pairs nucleic acid single linear 703 AUGGUGGCUG AUGAGGCCGA AAGGCCGAAA AACUCA 36 36 base pairs nucleic acid single linear 704 AGAAGGACUG AUGAGGCCGA AAGGCCGAAA CACCAU 36 36 base pairs nucleic acid single linear 705 CAGAAGGCUG AUGAGGCCGA AAGGCCGAAA ACACCA 36 36 base pairs nucleic acid single linear 706 CCAGAAGCUG AUGAGGCCGA AAGGCCGAAA AACACC 36 36 base pairs nucleic acid single linear 707 UGCCCAGCUG AUGAGGCCGA AAGGCCGAAA GGAAAC 36 36 base pairs nucleic acid single linear 708 CUGCCCACUG AUGAGGCCGA AAGGCCGAAA AGGAAA 36 36 base pairs nucleic acid single linear 709 CCUGGCUCUG AUGAGGCCGA AAGGCCGAAA UCUGCC 36 36 base pairs nucleic acid single linear 710 CAAGGCCCUG AUGAGGCCGA AAGGCCGAAA GGCCUG 36 36 base pairs nucleic acid single linear 711 CGGGGCCCUG AUGAGGCCGA AAGGCCGAAA GGCCGA 36 36 base pairs nucleic acid single linear 712 ACUUGGGCUG AUGAGGCCGA AAGGCCGAAA GGGGCC 36 36 base pairs nucleic acid single linear 713 GGGGCAGCUG AUGAGGCCGA AAGGCCGAAA CUUGGG 36 36 base pairs nucleic acid single linear 714 GGGGCUGCUG AUGAGGCCGA AAGGCCGAAA GCCUGG 36 36 base pairs nucleic acid single linear 715 AUGGCUGCUG AUGAGGCCGA AAGGCCGAAA GCAGGG 36 36 base pairs nucleic acid single linear 716 GAGCUGACUG AUGAGGCCGA AAGGCCGAAA CCAUGG 36 36 base pairs nucleic acid single linear 717 CAGAGCUCUG AUGAGGCCGA AAGGCCGAAA UACCAU 36 36 base pairs nucleic acid single linear 718 UGGGCCACUG AUGAGGCCGA AAGGCCGAAA GCUGAU 36 36 base pairs nucleic acid single linear 719 GGACUGGCUG AUGAGGCCGA AAGGCCGAAA CAGGGG 36 36 base pairs nucleic acid single linear 720 GGGCUAGCUG AUGAGGCCGA AAGGCCGAAA CUGGGA 36 36 base pairs nucleic acid single linear 721 CUGGGGCCUG AUGAGGCCGA AAGGCCGAAA GGACUG 36 36 base pairs nucleic acid single linear 722 GCCUGAGCUG AUGAGGCCGA AAGGCCGAAA GGGCCU 36 36 base pairs nucleic acid single linear 723 ACAGCCUCUG AUGAGGCCGA AAGGCCGAAA GGAGGG 36 36 base pairs nucleic acid single linear 724 GGCCUCUCUG AUGAGGCCGA AAGGCCGAAA CAGCGU 36 36 base pairs nucleic acid single linear 725 AUCAUCACUG AUGAGGCCGA AAGGCCGAAA CUGCAG 36 36 base pairs nucleic acid single linear 726 CAUCAUCCUG AUGAGGCCGA AAGGCCGAAA ACUGCA 36 36 base pairs nucleic acid single linear 727 GCCAAGCCUG AUGAGGCCGA AAGGCCGAAA GGCCCC 36 36 base pairs nucleic acid single linear 728 UGUUGCCCUG AUGAGGCCGA AAGGCCGAAA GCAAGG 36 36 base pairs nucleic acid single linear 729 GUCUGUGCUG AUGAGGCCGA AAGGCCGAAA CACAGC 36 36 base pairs nucleic acid single linear 730 GGUCUGUCUG AUGAGGCCGA AAGGCCGAAA ACACAG 36 36 base pairs nucleic acid single linear 731 GUCGACGCUG AUGAGGCCGA AAGGCCGAAA UGCCAG 36 36 base pairs nucleic acid single linear 732 AGUUGUCCUG AUGAGGCCGA AAGGCCGAAA CGGAUG 36 36 base pairs nucleic acid single linear 733 AAACUCGCUG AUGAGGCCGA AAGGCCGAAA GUUGUC 36 36 base pairs nucleic acid single linear 734 CUGCUGACUG AUGAGGCCGA AAGGCCGAAA CUCGGA 36 36 base pairs nucleic acid single linear 735 GCUGCUGCUG AUGAGGCCGA AAGGCCGAAA ACUCGG 36 36 base pairs nucleic acid single linear 736 AGCUGCUCUG AUGAGGCCGA AAGGCCGAAA AACUCG 36 36 base pairs nucleic acid single linear 737 CCACAGGCUG AUGAGGCCGA AAGGCCGAAA UGCCCU 36 36 base pairs nucleic acid single linear 738 CUCAGGGCUG AUGAGGCCGA AAGGCCGAAA CUCCAU 36 36 base pairs nucleic acid single linear 739 CGAGUUACUG AUGAGGCCGA AAGGCCGAAA GCCUCA 36 36 base pairs nucleic acid single linear 740 GGCGAGUCUG AUGAGGCCGA AAGGCCGAAA UAGCCU 36 36 base pairs nucleic acid single linear 741 ACUAGGCCUG AUGAGGCCGA AAGGCCGAAA GUUAUA 36 36 base pairs nucleic acid single linear 742 CUGUCACCUG AUGAGGCCGA AAGGCCGAAA GGCGAG 36 36 base pairs nucleic acid single linear 743 GGAGCAGCUG AUGAGGCCGA AAGGCCGAAA GCUGGG 36 36 base pairs nucleic acid single linear 744 CCCAGUGCUG AUGAGGCCGA AAGGCCGAAA GCAGGA 36 36 base pairs nucleic acid single linear 745 CAUUGGGCUG AUGAGGCCGA AAGGCCGAAA GCCCCG 36 36 base pairs nucleic acid single linear 746 CUGAAAGCUG AUGAGGCCGA AAGGCCGAAA GGCCAU 36 36 base pairs nucleic acid single linear 747 CUCCUGACUG AUGAGGCCGA AAGGCCGAAA GGAGGC 36 36 base pairs nucleic acid single linear 748 UCUCCUGCUG AUGAGGCCGA AAGGCCGAAA AGGAGG 36 36 base pairs nucleic acid single linear 749 AUCUCCUCUG AUGAGGCCGA AAGGCCGAAA AAGGAG 36 36 base pairs nucleic acid single linear 750 GGAGGAGCUG AUGAGGCCGA AAGGCCGAAA GUCUUC 36 36 base pairs nucleic acid single linear 751 UGGAGGACUG AUGAGGCCGA AAGGCCGAAA AGUCUU 36 36 base pairs nucleic acid single linear 752 AAUGGAGCUG AUGAGGCCGA AAGGCCGAAA GAAGUC 36 36 base pairs nucleic acid single linear 753 CGCAAUGCUG AUGAGGCCGA AAGGCCGAAA GGAGAA 36 36 base pairs nucleic acid single linear 754 UGUCCGCCUG AUGAGGCCGA AAGGCCGAAA UGGAGG 36 36 base pairs nucleic acid single linear 755 GGCUGAGCUG AUGAGGCCGA AAGGCCGAAA GUCCAU 36 36 base pairs nucleic acid single linear 756 GGGCUGACUG AUGAGGCCGA AAGGCCGAAA AGUCCA 36 36 base pairs nucleic acid single linear 757 CAGGGCUCUG AUGAGGCCGA AAGGCCGAAA GAAGUC 36 36 base pairs nucleic acid single linear 758 CUGAUCUCUG AUGAGGCCGA AAGGCCGAAA CUCAGC 36 36 base pairs nucleic acid single linear 759 AGGAGCUCUG AUGAGGCCGA AAGGCCGAAA UCUGAC 36 36 base pairs nucleic acid single linear 760 CCCUUAGCUG AUGAGGCCGA AAGGCCGAAA GCUGAU 36 36 base pairs nucleic acid single linear 761 ACCCCCUCUG AUGAGGCCGA AAGGCCGAAA GGAGCU 36 36 base pairs nucleic acid single linear 762 CUCUGGGCUG AUGAGGCCGA AAGGCCGAAA GGGCAG 36 52 base pairs nucleic acid single linear 763 UGAGGGGGAG AAGUUCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 764 GCUGCUUGAG AAGCUCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 765 GCCAUCCCAG AAGUCCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 766 GUUCUGGAAG AAGUGGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 767 GAAGGACAAG AAGCAGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 768 UUGAGCUCAG AAGUGUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 769 CCCACCGAAG AAGCUGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 770 AGGCUGGGAG AAGCGUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 771 GGUCGGAAAG AAGCCGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 772 UGACGAUCAG AAGUAUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 773 GUCGGUGGAG AAGCUGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 774 GGCCGGGGAG AAGUGGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 775 CAUCAUCAAG AAGCAGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 776 ACAGCUGGAG AAGUGCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 777 GAUGCCAGAG AAGUGAACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 16 base pairs nucleic acid single linear 778 GAACUGUUCC CCCUCA 16 16 base pairs nucleic acid single linear 779 GAGCAGCCCA AGCAGC 16 16 base pairs nucleic acid single linear 780 GGACUGCCGG GAUGGC 16 16 base pairs nucleic acid single linear 781 CCACAGUUUC CAGAAC 16 16 base pairs nucleic acid single linear 782 CUGCCGCCUG UCCUUC 16 16 base pairs nucleic acid single linear 783 ACACUGCCGA GCUCAA 16 16 base pairs nucleic acid single linear 784 CAGCUGCCUC GGUGGG 16 16 base pairs nucleic acid single linear 785 ACGCAGACCC CAGCCU 16 16 base pairs nucleic acid single linear 786 CGGCGGCCUU CCGACC 16 16 base pairs nucleic acid single linear 787 AUACAGACGA UCGUCA 16 16 base pairs nucleic acid single linear 788 CAGCGGACCC ACCGAC 16 16 base pairs nucleic acid single linear 789 CCACCGACCC CCGGCC 16 16 base pairs nucleic acid single linear 790 CUGCAGUUUG AUGAUG 16 16 base pairs nucleic acid single linear 791 GCACAGACCC AGCUGU 16 16 base pairs nucleic acid single linear 792 UCACAGACCU GGCAUC 16 52 base pairs nucleic acid single linear 793 GUUGCUUCAG AAGUUCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 794 GAGAUUCGAG AAGUUCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 795 GCCAUCCCAG AAGUCCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 796 GGGCAGAGAG AAGCCUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 797 UUGAGCUCAG AAGUGUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 798 CCCACCGAAG AAGCUCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 799 AGGCUGGGAG AAGCGUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 800 GAUCAGAAAG AAGCCGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 801 AGGUGUAGAG AAGCGGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 802 GGGCAGAGAG AAGUGCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 803 GGGCUUCCAG AAGCGUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 804 CAGCAUCAAG AAGCAGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 805 ACUCCUGGAG AAGUGCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 806 GAUGCCAGAG AAGUGAACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 807 AAGUCGGGAG AAGCUGACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 808 UGGCUCCAAG AAGUCCACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 809 UGGUGUCGAG AAGCACACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 810 AUUCUGAAAG AAGCCAACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 52 base pairs nucleic acid single linear 811 UCAGUAAAAG AAGUCUACCA GAGAAACACA CGUUGUGGUA CAUUACCUGG UA 52 16 base pairs nucleic acid single linear 812 GAACAGCCGA AGCAAC 16 16 base pairs nucleic acid single linear 813 GAACAGUUCG AAUCUC 16 16 base pairs nucleic acid single linear 814 GGACUGCCGG GAUGGC 16 16 base pairs nucleic acid single linear 815 AGGCUGACCU CUGCCC 16 16 base pairs nucleic acid single linear 816 ACACUGCCGA GCUCAA 16 16 base pairs nucleic acid single linear 817 GAGCUGCCUC GGUGGG 16 16 base pairs nucleic acid single linear 818 ACGCCGACCC CAGCCU 16 16 base pairs nucleic acid single linear 819 CGGCGGCCUU CUGAUC 16 16 base pairs nucleic acid single linear 820 CCGCAGCCCU ACACCU 16 16 base pairs nucleic acid single linear 821 GCACCGUCCU CUGCCC 16 16 base pairs nucleic acid single linear 822 ACGCUGUCGG AAGCCC 16 16 base pairs nucleic acid single linear 823 CUGCAGUUUG AUGCUG 16 16 base pairs nucleic acid single linear 824 GCACAGACCC AGGAGU 16 16 base pairs nucleic acid single linear 825 UCACAGACCU GGCAUC 16 16 base pairs nucleic acid single linear 826 CAGCUGCCCC CGACUU 16 16 base pairs nucleic acid single linear 827 GGACAGACUG GAGCCA 16 16 base pairs nucleic acid single linear 828 GUGCUGCCCG ACACCA 16 16 base pairs nucleic acid single linear 829 UGGCCGCCUU CAGAAU 16 16 base pairs nucleic acid single linear 830 AGACAGCCUU UACUGA 16

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US4987071Dec 3, 1986Jan 22, 1991University Patents, Inc.RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5168053Aug 17, 1990Dec 1, 1992Yale UniversityRibonuclease and genetically-engineered external guide sequence of nucleotides as treatment for AIDS
US5213580Mar 25, 1992May 25, 1993Endoluminal Therapeutics, Inc.Paving or stabilization a contour interior
US5328470Jul 26, 1991Jul 12, 1994The Regents Of The University Of MichiganCatheter
US5496698 *Dec 7, 1992Mar 5, 1996Ribozyme Pharmaceuticals, Inc.Method of isolating ribozyme targets
US5525468 *Aug 1, 1994Jun 11, 1996Ribozyme Pharmaceuticals, Inc.Assay for Ribozyme target site
WO1991003162A1Jun 5, 1990Mar 21, 1991Hope CityChimeric dna-rna catalytic sequences
WO1991015580A1Apr 10, 1991Oct 17, 1991Res Dev FoundationGene therapy for cell proliferative diseases
WO1991018624A1Nov 1, 1990Dec 12, 1991Hope CityRibozyme mediated reversal of transformation by cleavage of the hras oncogene rna
WO1991018625A1Dec 19, 1990Dec 12, 1991Hope CityRibozyme mediated reversal of transformation by cleavage of the hras oncogene rna
WO1991018913A1Jun 7, 1990Dec 12, 1991Hope CityRibozyme mediated reversal of transformation by cleavage of the hras oncogene rna
WO1992000080A1Jun 25, 1991Dec 27, 1991Wistar InstMethod for treating leukemias
WO1992007065A1Sep 23, 1991Apr 30, 1992Max Planck GesellschaftModified ribozymes
WO1992011298A1Dec 20, 1991Jun 22, 1992Ecostar Int LpPhotodegradable plastic composition
WO1992020348A1May 22, 1992Nov 26, 1992Univ TempleTreatment of colorectal carcinoma with antisense oligonucleotides to c-myb proto-oncogene
WO1993002654A2Aug 10, 1992Feb 18, 1993New England Deaconess HospitalA method of inducing hemoglobin synthesis in red blood cells and uses therefor
WO1993008845A1Nov 5, 1992May 13, 1993Massachusetts Inst TechnologyLocalized oligonucleotide therapy
WO1993009789A1Nov 12, 1992May 27, 1993Univ TempleTreatment of melanoma with antisense oligonucleotides to c-myb proto-oncogene
WO1993015187A1Jan 28, 1993Aug 5, 1993Massachusetts Inst TechnologyNucleozymes
WO1993023569A1Apr 29, 1993Nov 25, 1993Ribozyme Pharm IncMethod and reagent for inhibiting viral replication
WO1994002595A1Jul 2, 1993Feb 3, 1994Ribozyme Pharm IncMethod and reagent for treatment of animal diseases
Non-Patent Citations
Reference
1Akhtar and Juliano, "Cellular Uptake and Intracellular Fate of Antisense Oligonucleotides," Trends Cell Biol. 2:139-144 (1992).
2Alitalo et al., "Aberrant Expression of An Amplified c-myb oncogene in two cell lines from a colon carcinoma," Proc. Natl. Acad. Sci. USA 81:4534-4538 (1984).
3Anfossi et al., "An oligomer complementary to c-myb-encoded mRNA inhibits proliferation of human myeloid leukemia cell lines," Proc. Natl. Acad. Sci. USA 86:3379-3383 (1989).
4Austin et al., "Intimal Proliferation of Smooth Muscle Cells as an Explanation for Recurrent Coronary Artery Stenosis After Percutaneous Transluminal Coronary Angioplasty," J. Am. Coll. Cardiol. 6:369-375 (1985).
5Ballantyne et al., "Nucleotide sequence of the cDNA for murine intracellular adhesion molecule-1 (ICAM-1)," Nucleic Acids Research 17:5853 (1989).
6Banskota et al., "Insulin, Insulin-Like Growth Factor I and Platelet-Derived Growth Factor Interact Additively in the Induction of the Protooncogene c-myc and Cellular Proliferation in Cultured Bovine Aortic Smooth Muscle Cells," Molec. Endocrinol., 3:1183-1190 (1989).
7Barinaga, "Ribozymes: Killing the Messenger," Science 262:1512-1514 (1993).
8Belknap et al., "Transcriptional Regulation in Vascular Cells; Genetically Modified Animals," J. Cell. Biochem. S18A:277 (1994).
9Bennett et al., "Cationic Lipids Enhance Cellular Uptake and Activity of Phosphorothioate Antisense Oligonucleotides," Mol. Pharmacology 41:1023-1033 (1992).
10Biotech Abstracts Act. #91-00050 EP 388758 (Sep. 26, 1990).
11Biro et al., "Inhibitory Effects of Antisense Oligodeoxynucleotides targeting c-myc mRNA on smooth muscle cell proliferation and migration," Proc. Natl. Acad. Sci. U S A, 90:654-658 (1993).
12Blam et al., "Addition of Growth Hormone Secretion Signal to Basic Fibroblast Growth Factors Results in Cell Transformation and Secretion of Aberrant Forms of the Protein," Oncogene 3:129-136 (1988).
13 *Bours et al Molecular and Cellular Biology 12:685-695, Feb. 1992.*
14Brown et al.,"Expression of the c-myb Proto-oncogene in Bovine Vascular Smooth Muscle Cells," J. Biol. Chem. 267:4625-4630 (1992).
15Bywater et al., "Expression of Recombinant Platelet-Derived Growth Factor A-Chain and B-Chain Homodimers in Rat Cells and Human Fibroblastic Reveals Differences in Protein Processing and Autocrine Effects," Mol. Cell. Biol. 8:2753-2762 (1988).
16Calabretta et al., "Normal and Leukemic Hematopoietic Cells Manifest Differential Sensitivity to Inhibitory Effects of c-myb Antisense Oligodeoxynucleotides: An in vitro study relevant to bone marrow purging," Proc. Natl. Acad. Sci. USA, 88:2351-2355 (1991).
17Califf et al., "Restenosis: The Clinical Issues," in Textbook of Interventional Cardiology, E.J. Topol, eds., W. B. Saunders, Philadelphia, pp. 363-394 (1990).
18Cameron and Jennings, "Specific Gene Suppression by Engineered Ribozymes in Monkey Cells." Proc. Natl. Acad. Sci. USA 86:9139 (1989).
19Chen, "Multitarget-Ribozyme Directed to Cleave up to Nine Highly Conserved HIV-1 env RNA Regions Inhibits HIV-1 Replication-Potential Effectiveness Against Most Presently Sequenced HIV-1 Isolates," Nucleic Acids Res. 20:4581-4589 (1992).
20Chowrira and Burke, "Extensive Phosphorothioate Substitution Yields Highly Active and Nuclease-Resistant Hairpin Ribozymes," Nucleic Acids Res. 20:2835-2840 (1992).
21Chuat and Galibert, "Can Ribozymes be Used to Regulate Procaryote Gene Expression?" Biochem. and Biophys. Res. Commun. 162:1025 (1989).
22Cleary et al., "Cloning and Structural Analysis of cDNAs for bcl-2 and A Hybrid bcl-2/Immunoglobulin Transcript Resulting From the t(14;18) Translocation," Cell 47:199-28 (1986).
23Clowes et al., "Kinetics of Cellular Proliferation After Arterial Injury," Lab Invest. 49:327-333 (1983).
24Collins and Olive, "Reaction Conditions and Kinetics of Self-Cleavage of a Ribozyme Derived From Neurospora VS RNA," Biochemistry 32:2795-2799 (1993).
25Cotten et al., "Chicken Adenovirus (CELO Virus) Particles Augment Receptor-Mediated DNA Delivery to Mammalian Cells and Yield Exceptional Levels of Stable Transformants," J. Virol. 67:3777-3785 (1993).
26Cotten et al., "High Efficiency Receptor-Mediated Delivery of Small and Large (48 Kilobase Gene Constructs Using the Endosome-Disruption Activity of Defective or Chemically Inactivated Adenovirus Particles," Proc. Natl. Acad. Sci. USA 89:6094-6098 (1992).
27Cotten et al., "Transferrin-Polycation-Mediated Introduction of DNA into Human Leukemic Cells: Stimulation by Agents that Affect the Survival of Transfected DNA or Modulate Transferrin Receptor Levels" (Abstract), Proc. Natl. Acad. Sci. USA 87:4033-4037 (1990).
28Cristiano et al., "Hepatic Gene Therapy: Adenovirus Enhancement of Receptor-Mediated Gene Delivery and Expression in Primary Hepatocytes," Proc. Natl. Acad. Sci. USA 90:2122-2126 (1993).
29Curiel et al., "Adenovirus Enhancement of Transferrin-Polylysine-Mediated Gene Delivery," Proc. Nat. Acad. Sci. USA, 88:8850-8854 (1991).
30Dropulic et al., "Functional Characterization of a U5 Ribozyme: Intracellular Suppression of Human Immunodeficiency Virus Type I Expression," J Virol. 66:1432-1441 (1992).
31Eck et al., "Inhibition of Phorbol Ester-Induced Cellular Adhesion by Competitive Binding of NF-kappaB In Vivo," Mol. Cell. Biol. 13:6530-6536 (1993).
32Eck et al., "Inhibition of Phorbol Ester-Induced Cellular Adhesion by Competitive Binding of NF-κB In Vivo," Mol. Cell. Biol. 13:6530-6536 (1993).
33Edgington, "Ribozymes: Stop Making Sense," Biotechnology 10:256-262 (1992).
34Elroy-Stein and Moss, "Cytoplasmic Expression Based on Constitutive Synthesis of Bacteriophage T7 RNA Polymerase in Mammalian Cells," Proc. Natl. Acad. Sci. USA 87:6743-7 1990).
35Ferguson et al., "Compensation for Treating Wounds to Inhibit Scar Tissue-Contains Agent Esp. Antibody, Which Selectively Neutralises Fibrotic Growth Factors," WPI Acc#92-3659974/44.
36Ferguson et al., "Compensation for Treating Wounds to Inhibit Scar Tissue—Contains Agent Esp. Antibody, Which Selectively Neutralises Fibrotic Growth Factors," WPI Acc#92-3659974/44.
37Ferns et al., "Inhibition of Neointimal Smooth Muscle Accumulation After Angioplasty by an Antibody to PDGF," Science 253:1129-1132 (1991).
38Gao and Huang, "Cytoplasmic Expression of a Reporter Gene by Co-Delivery of T7 RNA Polymerase and T7 Promoter Sequence with Cationic Liposomes," Nucleic Acids Res. 21:2867-72 (1993).
39Garratt et al.,"Differential Histopathology of Primary Atherosclerotic and Restenotic Lesions in Coronary Arteries and Saphenous Vein Bypass Grafts: Analysis of Tissue Obtained From 73 Patients by Directional Atherectomy," J. Am. Coll. Cardio. 17:442-428 (1991).
40 *Geisler et al. Cell 71:613-621, Nov. 13, 1992.*
41 *Gewirtz et al. PNAS 93:3161-3163 (1996).*
42 *Ghosh et al. Cell 62:1019-1029, 1980.*
43Goldberg et al., "Vascular Smooth Muscle Cell Kinetics: A New Assay for Studying Patterns of Cellular Proliferation in vivo," Science, 205:920-922 (1979).
44Griffin and Baylin, "Expression of the c-myb Oncogene in Human Small Cell Lung Carcinoma," Cancer Res. 45:272-275 (1985).
45Grotendorst et al., "Attachment of Smooth Muscle Cells to Collagen and Their Migration Toward Platelet-Derived Growth Factor," Proc. Natl. Acad. Sci. USA 78:3669-3672 (982).
46Guerrier-Takada et al., "The RNA Moiety of Ribonuclease P Is the Catalytic Subunit of the Enzyme," Cell 35:849 (1983).
47Hajjar et al., "Tumor Necrosis Factor-Mediated Release of Platelet-Derived Growth Factor From Cultured Endothelial Cells," J. Exp. Med. 166:235-245 (1987).
48Hampel et al., ""Hairpin' Catalytic RNA Model: Evidence for Helices and Sequence Requirement for Substrate RNA", Nucleic Acids Research 18:299-304 (1990).
49Hampel et al., "‘Hairpin’ Catalytic RNA Model: Evidence for Helices and Sequence Requirement for Substrate RNA", Nucleic Acids Research 18:299-304 (1990).
50Harris et al., "Receptor-Mediated Gene Transfer to Airway Epithelial Cells in Primary Culture," Am. J. Respir. Cell Mol. Biol., 9:441-447 (1993).
51Haseloff and Gerlach, "Simple RNA Enzymes with New and Highly Specific Endoribonuclease Activities," Nature 334:585-591 (1988).
52Herschlag, "Implications of Ribozyme Kinetics for Targeting the Cleavage of Specific RNA Molecules in vivo: More Isn't Always Better," Proc. Natl. Acad. Sci. USA 88:6921-5 (1991).
53Hertel et al., "Numbering System for the Hammerhead," Nucleic Acids Res. 20:3252 (1992).
54Higashiyama et al., "A Heparin-Binding Growth Factor Secreted by Macrophage-Like Cells That is Related to EFG," Science 251:936-939 (1991).
55Jaeger et al., "Improved Predictions of Secondary Structures for RNA," Proc. Natl. Acad. Sci. USA 86:7706-7710 (1989).
56Jeffries and Symons, "A Catalytic 13-mer Ribozyme," Nucleic Acids Research 17:1371 (1989).
57Kashani-Sabet et al., "Reversal of the Malignant Phenotype by an Anti-ras Ribozyme," Antisense Research & Development 1:3-15 (1992).
58Kaye et al., "Structure and Expression of the Human L-myc Gene Reveal a Complex Pattern Of Alternative mRNA Processing," Mol. Cell. Biol. 8:186-195 (1988).
59Kindy and Sonenshein, "Regulation of Oncogene Expression in Cultured Aortic Smooth Muscle Cells," J. Biol. Chem. 261:12865-12868 (1986).
60Kita et al., "Sequence and expression of rat ICAM-1," Biochem. Biophys. Acta 1131:108-110 91992).
61 *Kitajima et al. Science 258:1792-1795, Dec. 1992.*
62Kitajima et al., "Ablation of Transplanted HTLV-I Tax-Transformed Tumors in Mice by Antisense Inhibition of NF-kappaB," Science 258:1792-1795 (1992).
63Kitajima et al., "Ablation of Transplanted HTLV-I Tax-Transformed Tumors in Mice by Antisense Inhibition of NF-κB," Science 258:1792-1795 (1992).
64Klagsbrun and Edelman, "Biological and Biochemical Properties of Fibroblast Growth Factors," Arteriosclerosis 9:269-278 (1989).
65Koizumi et al., "Ribozymes Designed to Inhibit Transformation of NIH3T3 Cells by the Activated c-Ha-ras Gene," Gene 117:179 (1992).
66Komuro et al., "Endothelin stimulates c-fos and c-myc expression and proliferation of vascular smooth muscle cells," FEBS Letters 238:249-252 (1988).
67Kunapuli et al., "Molecular Cloning of Human Angiotensinogen cDNA and Evidence for the Presence of Its mRNA in Rat Heart-DNA Sequence," Cir. Res. 60:786-790 (1987).
68Kunapuli et al., "Molecular Cloning of Human Angiotensinogen cDNA and Evidence for the Presence of Its mRNA in Rat Heart—DNA Sequence," Cir. Res. 60:786-790 (1987).
69Kunsch and Rosen, "NF-kappaB and Subunit-Specific Regulation of the Interleukin-8 Promoter," Mol. Cell. Biol. 13:6137-6146 (1993).
70Kunsch and Rosen, "NF-κB and Subunit-Specific Regulation of the Interleukin-8 Promoter," Mol. Cell. Biol. 13:6137-6146 (1993).
71La Rosa et al., "Differential Regulation of the c-myc Oncogene Promoter by the NF-kappaB Rel Family of Transcription Factors," Mol. Cell. Biol. 14:1039-1044 (1994).
72La Rosa et al., "Differential Regulation of the c-myc Oncogene Promoter by the NF-κB Rel Family of Transcription Factors," Mol. Cell. Biol. 14:1039-1044 (1994).
73 *Laurence et al. J. Virology 65:213-219, Jan. 1991.*
74Lenardo and Baltimore, "NF-kappaB: A Pleiotropic Mediator of Inducible and Tissue Specific Gene Control," Cell 58:227-229 (1989).
75Lenardo and Baltimore, "NF-κB: A Pleiotropic Mediator of Inducible and Tissue Specific Gene Control," Cell 58:227-229 (1989).
76L'Huillier et al., "Cytoplasmic Delivery of Ribozymes Leads to Efficient Reduction in alpha-Lactalbumin mRNA Levels in C1271 Mouse," Embo J. 11:4411-4418 (1992).
77L'Huillier et al., "Cytoplasmic Delivery of Ribozymes Leads to Efficient Reduction in α-Lactalbumin mRNA Levels in C1271 Mouse," Embo J. 11:4411-4418 (1992).
78Lieber et al., "Stable High-Level Gene Expression in Mammalian Cells by T7 Phage $NA Polymerase," Methods Enzymol. 217:47-66 (1993).
79Lindner and Reidy, "Proliferation of Smooth Muscle Cells After Vascular Injury Is Inhibited by an Antibody Against Basic Fibroblast Growth Factor," Proc. Natl. Acad. Sci. USA 88:3739-3743 (1991).
80Lisziewicz et al., "Inhibition of Human Immunodeficiency Virus Type 1 Replication by Regulated Expression of a Polymeric Tat Activation Response RNA Decoy as a Strategy for Gene Therapy in AIDS," Proc. Natl. Acad. Sci. U.S.A. 90:8000-8004 (1993).
81Liu et al., "Specific NF-kappaB Subunits Act in Concert with Tat To Stimulate Human Immunodeficiency Virus Type I Transcription," J. Virology 66:3883-3887 (1992).
82Liu et al., "Specific NF-κB Subunits Act in Concert with Tat To Stimulate Human Immunodeficiency Virus Type I Transcription," J. Virology 66:3883-3887 (1992).
83Majello et al., "Human c-myb Protooncogene: Nucleotide Sequence of cDNA and Organization of the Genomic Locus," Proc. Natl. Acad. Sci. USA, 83:9636-9640 (1986).
84Mamone et al., "Design of Hammerhead Ribozymes Targeted to Sequences in HIV, HSV and the RAT ANF Gene," Abstract of Keystone, CO (May 27, 1992).
85McGrath et al., "Structure and Organization of the Human Ki-ras Protooncogene And a Related Processed Pseudogene," 304:501-506 (1983).
86Melani et al., "Inhibition of Proliferation by c-myb Antisense Oligodeoxynucleotide in Colon Adenocarcinoma Cell Lines that Express c-myb," Cancer Res. 51:2897-2901 (1991).
87Minvielle et al., "A Novel Calcitonin Carboxyl-Terminal Peptide Produced in Medullary Thyroid Carcinoma by Alternative RNA Processing of the Calcitonin-Calcitonin Gene-Related Peptide Gene," J. Biol. Chem. 266:24627-24631 (1991).
88Nabel et al., "Recombinant Platelet-Derived Growth Factor B Gene Expression in Porcine Arteries Induces Intimal Hyperplasia In Vivo," J. Clin. Invest. 91:1822-1829 1993).
89Nabel et al., "Site-Specific Gene Expression in Vivo by Direct Gene Transfer Into the Arterial Wall," Science 249:1285-1288 (1990).
90Narayanan et al., "Evidence for Differential Functions of the p50 and p65 Subunits of NF-kappaB with a Cell Adhesion Model," Mol. Cell. Biol. 13:3802-3810 (1993).
91Narayanan et al., "Evidence for Differential Functions of the p50 and p65 Subunits of NF-κB with a Cell Adhesion Model," Mol. Cell. Biol. 13:3802-3810 (1993).
92O'Brien et al., "Vascular Cell Adhesion Molecule-1 is Expressed in Human Coronary Atherosclerotic Plaques," J. Clin. Invest. 92:945-951 (1993).
93Ohkawa et al., Nucleic Acids Symp. Ser. 27:15-6 (1992).
94Ohno et al., "Gene Therapy for Vascular Smooth Muscle Cell Proliferation After Arterial Injury," Science 265:781-784 (1994).
95Ojwang et al., "Inhibition of Human Immunodeficiency Virus Type 1 Expression by a Hairpin Ribozyme," Proc. Natl. Acad. Sci. USA 89:10802-10806 (1992).
96Pavco et al., "Regulation of Self-Splicing Reactions by Antisense RNA," Abstract of Keystone, CO (May 27, 1992).
97Perkins et al., "Distinct combinations of NF-kappaB subunits determine the specificity of transcriptional activation," Proc. Natl. Acad. Sci. USA 89:1529-1533 (1992).
98Perkins et al., "Distinct combinations of NF-κB subunits determine the specificity of transcriptional activation," Proc. Natl. Acad. Sci. USA 89:1529-1533 (1992).
99Perreault et al., "Mixed Deoxyribo- and Ribo-Oligonucleotides with Catalytic Activity," Nature 344:565-568 (1990).
100Perrotta and Been, "Cleavage of Oligoribonucleotides by a Ribozyme Derived from the Hepatitis delta Virus RNA Sequence," Biochemistry 31:16 (1992).
101Perrotta and Been, "Cleavage of Oligoribonucleotides by a Ribozyme Derived from the Hepatitis δ Virus RNA Sequence," Biochemistry 31:16 (1992).
102Pieken et al., "Kinetic Characterization of Ribonuclease-Resistant 2'-Modified Hammerhead Ribozymes," Science 253:314-317 (1991).
103Pieken et al., "Kinetic Characterization of Ribonuclease-Resistant 2′-Modified Hammerhead Ribozymes," Science 253:314-317 (1991).
104Popoma et al., "Clinical Trials of Restenosis After Coronary Angioplasty," Circulation 84:1426-1436 (1991).
105Raines et al., "Interleukin-1 Mitogenic Activity for Fibroblasts and Smooth Muscle Cells Is Due to PDGF-AA," Science 243:393-396 (1989).
106Raschella et al., "Inhibition of Proliferation by c-myb Antisense RNA and Oligodeoxynucleotides in Transformed Neuroectodermal Cell Lines," Cancer Res. 52:4221-4226 (1992).
107Ratajczak et al., "In Vivo Treatment of Human Leukemia in a scid Mouse Model With c-myb Antisense Oligodeoxynucleotides," Proc. Natl. Acad. Sci. USA 89:11823-11827 (1992).
108Ray and Prefontaine, "Physical association and functional antagonism between the p65 subunit of transcription factor NF-kappaB and the glucocorticoid receptor," Proc. Natl. Acad. Sci. USA 91:752-756 (1994).
109Ray and Prefontaine, "Physical association and functional antagonism between the p65 subunit of transcription factor NF-κB and the glucocorticoid receptor," Proc. Natl. Acad. Sci. USA 91:752-756 (1994).
110Read et al., "NF-kappaB and IkappaBalpha: An Inducible Regulatory System in Endothelial Activation," J. Exp. Med. 179:503-512 (1994).
111Read et al., "NF-κB and IκBα: An Inducible Regulatory System in Endothelial Activation," J. Exp. Med. 179:503-512 (1994).
112Riessen et al., "Arterial Gene Transfer Using Pure DNa Applied Directly to a Hydrogel-Coated Angioplasty Balloon,"Human Gene Therapy 4:749-758 (1993).
113Roessler et al., "Adenovirus-mediated Gene Transfer to Rabbit Synovium In Vivo," J. Clin. Invest. 92;1085-1092 (1993).
114 *Rojanasakul, Adv. Drug Delivery 18 (1996) 115-131.*
115Ross et al., "A Platelet-Dependent Serum Factor That Stimulates the Proliferation of Arterial Smooth Muscle Cells In Vitro," Proc. Natl. Acad. Sci. USA 71:1207-1210 (1974).
116Rossi et al., "Ribozymes as Anti-HIV-1 Therapeutic Agents: Principles, Applications, and Problems," Aids Research and Human Retroviruses 8:183 (1992).
117Rossi et al., J. Cell Biochem. Suppl 14A:D428 (1990).
118Ruben et al., "Isolation of a rel-related human cDNA that potentially encodes the 65-kD subunit of NF, kappba B," Science 251:5000 (1991).
119Ruben et al., "Isolation of a rel-related human cDNA that potentially encodes the 65-kD subunit of NF, kappba B," Science 254:5028 (1991).
120Ruben et al., Genes & Development 6:745-760 (1992).
121Sarver et al., "Catalytic RNAs (Ribozymes): A New Frontier in Biomedical Applications," AIDS Res. Revs. 2:259 (1992).
122Sarver et al., "Ribozymes as Potential Anti-HIV-1 Therapeutic Agents," Science 247:1222-1225 (1990).
123Saville and Collins, "A Site-Specific Self-Cleavage Reaction Performed by a Novel RNA In Neurospora Mitochondria," Cell 61:685-696 (1990).
124Saville and Collins, "RNA-Mediated Ligation of Self-Cleavage Products of a Neurospora Mitochondrial Plasmid Transcript," Proc. Natl. Acad. Sci. USA 88:8826-8830 (1991).
125Scanlon et al., "Ribozyme-Mediated Cleavage of c-fos mRNA Reduces Gene Expression of DNA Synthesis Enzymes and Metallothionein," Proc. Natl. Acad. Sci. USA 88:10591-10595 (1991).
126Scaringe et al., "Chemical synthesis of biologically active oligoribonucleotides using β-cyanoethyl protected ribonucleoside phosphoramidites," Nucl Acids Res. 18:5433-5441 (1990).
127 *Schmid et al. Nature 352:773-736, 1991.*
128Semba, "A v-erbB-Related Protooncogene, C-erB-2, Is Distinct From the c-erbB-1/Epidermal Growth Factor-Receptor Gene and Is Amplified in A Human Salivary Gland Adenocarcinoma," Proc. Natl. Acad. Sci. USA 82:6497-6501 (1985).
129Sessa et al., "Molecular Cloning and Expression of a cDNA Encoding Endothelial Cell Nitric Oxide Synthase," J. Biol. Chem. 267:15274-15276 (1992).
130Seth et al., "Mechanism of Enhancement of DNA Expression Consequent to Cointernalization of a Replication-Deficient Adenovirus and Unmodified Plasmid dDNA," J. Virol., 68:933-940 (1994).
131Shi et al., "Downregulation of c-myc Expression by Antisense Oligonucleotides Inhibits Proliferation of Human Smooth Muscle Cell," Circulation 88:1190-1195 (1993).
132Shu et al., "Differential Regulation of Vascular Cell Adhesion Molecule 1 Gene Expression by Specific NF-κB Subunits in Endothelial and Epithelial Cells," Mol. Cell. Biol. 13:6283-6289 (1993).
133Simmons et al., "ICAM, an adhesion ligand of LFA-1 is homologous to the neural cell adhesion molecule NCAM," Nature 331:624-627 (1988).
134Simons et al., "Antisense c-myb Oligonucleotides Inhibit Intimal Arterial Smooth Muscle Cell Accumulation in vivo," Nature 359:67-70 (1992).
135Simons et al., "Relation Between Activated Smooth Muscle Cells in Coronary-Artery Lesions and Restenosis After Atherectomy," New Engl. J. Med. 328:608-613 (1993).
136Sioud and Drulica, "Prevention of Human Immunodeficiency Virus Type 1 Integrase Expression in Escherichia coli by a Ribozyme," Proc. Natl. Acad. Sci. USA 88:7303 (1991).
137Sjolund et al., "Arterial Smooth Muscle Cells Express Platelet-Derived Growth Factor (PDGF) A Chain mRNA, Secrete a PDGF-Like Mitogen, and Bind Exogenous PDGF in a Phenotype- and Growth State-Dependent Manner," J. Cell. Biol. 106:403-413 (1988).
138Slamon et al., "Expression of Cellular Oncogenes in Human Malignancies," Science 224:256-262 (1984).
139Slamon et al., "Studies of the Human c-myb Gene and its Products in Human Acute Leukemias," Science 233:3467-351 (1986).
140Stull and Szoka, "Antigene, Ribozyme and Aptamer Nucleic Acid Drugs: Progress and Prospects," Pharmaceutical Research 12:465-483 (1995).
141 *Stull. Pharm. Res. 12:465-483 (1995).*
142Taira et al., "Construction of a novel RNA-transcript-trimming plasmid which can be used both in vitro and in place of run-off and (G)-free transcriptions and in vivo as multi-sequences transcription vectors," Nucleic Acids Research 19:5125-30 (1991).
143Ten Dijke et al., "Recombinant Transforming Growth Factor Type Beta-3 Biological Activities and Receptor-Binding Properties in Isolated Bone Cells," Mol. Cell Biol. 10:4473-4479 (1990).
144Tessler et al, "Basic Fibroblast Growth Factor Accumulates in the Nuclei of Vairous BFGF-Producing Cell Types," J. Cell. Physiol. 145:310-317 (1990).
145 *Thanos et al. Cell 71:777-789, Nov. 27, 1992.*
146Thiele et al., "Regulation of c-myb Expression in Human Neuroblastoma Cells During Retinoic Acid-Induced Differentiation," Mol. Cell. Biol. 8:1677-1683 (1988).
147Torelli et al., "Expression of c-myb Protooncogene and Other Cell Cycle-Related Genes in Normal and Neoplastic Human Colonic Mucosa," Cancer Res. 47:5266-5269 (1987).
148Uhlenbeck, "A Small Catalytic Oligoribonucleotide," Nature 327:596-600 (1987).
149Usman and Cedergren, "Exploiting the chemical synthesis of RNA," Trends in Biochem. Sci. 17:334-339 (1992).
150Usman et al.,"Automated Chemical Synthesis of Long Oligoribonucleotides Using 2′-O-Silylated Ribonucleoside 3′-O-Phosphoramidtes on a Controlled-Pore Glass Support: Synthesis of a 43-Nucleoside Sequence Similar to the 3′-Half Molecule of an Escherichia coli Formylmethoionine tRNA," J. Am. Chem. Soc. 109:7845-7854 (1987).
151van de Stolpe et al., "12-O-Tetradecanoylphorbol-13-acetate- and Tumor Necrosis Factor α-meidated Induction of Intercellular Adhesion Molecule-1 Is Inhibited by Dexamethasone," J. Biol. Chem. 269:6185-6192 (1994).
152Ventura et al., "Activation of HIV-Specific Ribozyme Activity by Self-Cleavage," Nucleic Acids Res. 21:3249-55 (1993).
153Weerasinghe et al., "Resistance to Human Immunodeficiency Virus Type 1 (HIV-1) Infection in Human CD4+ Lymphocyte-Derived Cell Lines Conferred by Using Retroviral Vectors Expressing and HIV-1 RNA-Specific Ribozyme," Journal of Virology 65:5531-4 (1994).
154Weiser et al., "The Growth-Related Transcription Factor OCT-1 is Expressed as a Function of Vascular Smooth Muscle Cell Modulation," J. Cell. Biochem. S18A:282 (1994).
155Westin et al., "Alternative Splicing of the Human c-myb Gene," Oncogene 5:1117-1124 (1990).
156Willard et al., Circulation 86:I-473 (1992).
157Woolf et al., "Specificity of Antisense Oligonucleotides in vivo," Proc. Natl. Acad. Sci. USA 89:7305-7309 (1992).
158Yu et al., "A Hairpin Ribozyme Inhibits Expression of Diverse Strains of Human Immunodeficiency Virus Type 1," Proc. Natl. Acad. Sci. U S A 90:6340-6344 (1993).
159 *Zaia et al., Status of ribozyme and antisense-based developmental approaches for anti-HIV-1 therapy, Annals N.Y. Acad. Sci., vol. 660, pp. 95-106, Jan. 1992.*
160Zenke et al., "Receptor-mediated Endocytosis of Transferrin-Polycation Conjugates: An Efficient Way to Introduce DNA into Hematopoietic Cells" (Abstract), Proc. Natl. Acad. Sci. USA 87:3655-3659 (1990).
161Zhou et al., "Synthesis of Function mRNA in Mammalian ells by Bacteriophage T3 RNA Polymerse," Mol. Cell. Biol. 10:4529-4537 (1990).
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US7932260May 12, 2005Apr 26, 2011Icos Corporation5-methyl-3-phenyl-2-[1-(9H-purin-6-ylamino)-propyl]-3H-quinazolin-4-one; 3-(4-fluoro-phenyl)-5-methyl-2-[1-(7H-pyrrolo[2,3-d]pyrimidin-4-ylamino)-ethyl]-3H-quinazolin-4-one; bone-resorption disorder or a cancer of a hematopoietic origin; disorders in which PI3K plays a role in leukocyte function
US8138195Apr 20, 2005Mar 20, 2012Icos CorporationInhibitors of human phosphatidylinositol 3-kinase delta
US8207153Mar 25, 2010Jun 26, 2012Icos CorporationQuinazolinones as inhibitors of human phosphatidylinositol 3-kinase delta
US8440677Mar 24, 2010May 14, 2013Gilead Calistoga LlcAtropisomers of 2-purinyl-3-tolyl-quinazolinone derivatives and methods of use
US8492389Oct 7, 2009Jul 23, 2013Icos CorporationInhibitors of human phosphatidylinositol 3-kinase delta
US8546409Apr 20, 2010Oct 1, 2013Gilead Calistoga LlcMethods of treatment for solid tumors
US8586597Dec 27, 2012Nov 19, 2013Icos Corporation6-fluoro-3-phenyl-2-[1-(9H-purin-6-ylamino)ethyl]-3H-quinazolin-4-one as an inhibitor of human phosphatidylinositol 3-kinase delta
US8623881Oct 7, 2009Jan 7, 2014Icos CorporationInhibitors of human phosphatidylinositol 3-kinase delta
US8637533Feb 17, 2012Jan 28, 2014Icos CorporationInhibitors of human phosphatidylinositol 3-kinase delta
US8653077Sep 28, 2011Feb 18, 2014Icos CorporationInhibitors of human phosphatidylinositol 3-kinase delta
US8691829Jul 21, 2010Apr 8, 2014Gilead Calistoga LlcTreatment of liver disorders with PI3K inhibitors
USRE44599Dec 28, 2012Nov 12, 2013Icos CorporationQuinazolinones as inhibitors of human phosphatidylinositol 3-kinase delta
USRE44638May 12, 2005Dec 10, 2013Icos CorporationQuinazolinones as inhibitors of human phosphatidylinositol 3-kinase delta
Legal Events
DateCodeEventDescription
Aug 22, 2006FPExpired due to failure to pay maintenance fee
Effective date: 20060625
Jun 26, 2006LAPSLapse for failure to pay maintenance fees
Jan 11, 2006REMIMaintenance fee reminder mailed