Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS6545137 B1
Publication typeGrant
Application numberUS 09/060,299
Publication dateApr 8, 2003
Filing dateApr 15, 1998
Priority dateApr 15, 1997
Fee statusPaid
Also published asCA2286313A1, CA2286313C, DE69837542D1, EP0988379A1, EP0988379B1, WO1998046743A1
Publication number060299, 09060299, US 6545137 B1, US 6545137B1, US-B1-6545137, US6545137 B1, US6545137B1
InventorsJohn A. Todd, John W. Hess, Charles T. Caskey, Roger D Cox, David Gerhold, Holly Hammond, Patricia Hey, Yoshihiko Kawaguchi, Tony R. Merriman, Michael L. Metzker, Yusuke Nakagawa, Michael S. Phillips, Rebecca C.J. Twells
Original AssigneeJohn A. Todd, John W. Hess, Charles T. Caskey, Roger D Cox, David Gerhold, Holly Hammond, Patricia Hey, Yoshihiko Kawaguchi, Tony R. Merriman, Michael L. Metzker, Yusuke Nakagawa, Michael S. Phillips, Rebecca C.J. Twells
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Autoimmune diseases; antiinflammatory agents; viricides; antidiabetic agents; binding to low density lipoproteins
US 6545137 B1
Abstract
A novel receptor, “LDL-receptor related protein-3” (“LRP-3”), is provided, along with encoding nucleic acid. The gene is associated with type 1 diabetes (insulin dependent diabetes mellitus), and experimental evidence provides indication that it is the IDDM susceptibility gene IDDM4. In various aspects the invention provides nucleic acid, including coding sequences, oligonucleotide primers and probes, polypeptides, pharmaceutical compositions, methods of diagnosis or prognosis, and other methods relating to and based on the gene, including methods of treatment of diseases in which the gene may be implicated, including autoimmune diseases, such as glomerulonephritis, diseases and disorders involving disruption of endocytosis and/or antigen presentation, diseases and disorders involving cytokine clearance and/or inflammation, viral infection, elevation of free fatty acids or hypercholesterolemia, osteoporosis, Alzheimer's disease, and diabetes.
Images(67)
Previous page
Next page
Claims(10)
What is claimed is:
1. An isolated nucleic acid molecule encoding a polypeptide which comprises the amino acid sequence shown in FIG. 5(e)(SEQ ID NO:4).
2. A nucleic acid molecule encoding a polypeptide which comprises the amino acid sequence shown in FIG. 5(c)(SEQ ID NO:3).
3. A nucleic acid molecule according to claim 1 comprising the coding sequence shown in FIG. 5(a)(SEQ ID NO:1).
4. An isolated nucleic acid molecule encoding a polypeptide which binds and takes up low density lipoprotein, said nucleic acid hybridizing under stringent conditions to nucleic acid according to claim 3, said stringent conditions comprising hybridization overnight at 42° C. in 0.25M Na2HPO4, pH 7.2, 6.5% SDS, 10% dextran sulphate and washing at 55° C. in 0.1×SSC, 0.1% SDS.
5. An oligonucleotide fragment of a nucleic acid molecule according to claim 3 of at least 14 nucleotides.
6. An oligonucleotide consisting of a nucleotide sequence of any one of SEQ ID NOs: 49-52, 54-57, 59-62, 64-69, 72-74, 238, and 334-346.
7. A method of producing the polypeptide shown in FIG. 5(c)(SEQ ID NO: 3) which comprises introducing a nucleic acid encoding the polypeptide into a host cell, causing or allowing expression of the nucleic acid and isolating and/or purifying the polypeptide produced thereby.
8. A method according to claim 7 further comprising formulating the polypeptide into a composition which includes at least one additional component.
9. An isolated nucleic acid molecule encoding a polypeptide which binds and takes up low density lipoprotein, said polypeptide comprising an amino acid sequence which shows greater than 90% homology with the amino acid sequence shown in FIG. 5(e)(SEQ ID NO:4).
10. A composition comprising a nucleic acid molecule which encodes a polypeptide which is selected from the group consisting of polypeptides shown in FIGS. 5(e)(SEQ ID NO:4) and 5(c)(SEQ ID NO:3), and a physiologically acceptable excipient.
Description

This application claims benefit of U.S. Provisional Application Nos. 60/043,553 and 60/048,740, filed Apr. 15, 1997 and Jun. 5, 1997, respectively.

FIELD OF THE INVENTION

The present invention relates to nucleic acids, polypeptides, oligonucleotide probes and primers, methods of diagnosis or prognosis, and other methods relating to and based on the identification of a gene, which is characterised as a member of the LDL-receptor family and for which there are indications that some alleles are associated with susceptibility to insulin-dependent diabetes mellitus (“IDDM”), also known as type 1 diabetes.

More particularly, the present invention is based on cloning and characterisation of a gene which the present inventors have termed “LDL-receptor related protein-5 (LRP5)” (previously “LRP-3”), based on characteristics of the encoded polypeptide which are revealed herein for the first time and which identify it as a member of the LDL receptor family. Furthermore, experimental evidence is included herein which provides indication that LRP5 is the IDDM susceptibility gene IDDM4.

BACKGROUND OF THE INVENTION

Diabetes, the dysregulation of glucose homeostasis, affects about 6% of the general population. The most serious form, type 1 diabetes, which affects up to 0.4% of European-derived population, is caused by autoimmune destruction of the insulin producing β-cells of the pancreas, with a peak age of onset of 12 years. The β-cell destruction is irreversible, and despite insulin replacement by injection patients suffer early mortality, kidney failure and blindness (Bach, 1994; Tisch and McDevitt, 1996). The major aim, therefore, of genetic research is to identify the genes predisposing to type 1 diabetes and to use this information to understand disease mechanisms and to predict and prevent the total destruction of β-cells and the disease.

The mode of inheritance of type 1 diabetes does not follow a simple Mendelian pattern, and the concordance of susceptibility genotype and the occurrence of disease is much less than 100%, as evidenced by the 30-70% concordance of identical twins (Matsuda and Kuzuya, 1994; Kyvik et al, 1995). Diabetes is caused by a number of genes or polygenes acting together in concert, which makes it particularly difficult to identify and isolate individual genes.

The main IDDM locus is encoded by the major histo-compatibility complex (MHC) on chromosome 6p21 (IDDM1). The degree of familial clustering at this locus, λs=2.5, where λs=P expected [sharing of zero alleles at the locus identical-by-descent (IBD)]/P observed [sharing of zero alleles IBD] (Risch 1987; Todd, 1994), with a second locus on chromosome 11p15, IDDM2, the insulin minisatellite λs=1.25 (Bell et al, 1984; Thomson et al, 1989; Owerbach et al, 1990; Julier et al, 1991; Bain et al, 1992; Spielman et al, 1993; Davies et al, 1994; Bennett et al, 1995). These loci were initially detected by small case control association studies, based on their status as functional candidates, which were later confirmed by further case-control, association and linkage studies.

These two loci, however, cannot account for all the observed clustering of disease in families (λs=15), which is estimated from the ratio of the risk for siblings of patients and the population prevalence (6%/0.4%) (Risch, 1990). We initiated a positional cloning strategy in the hope of identifying the other loci causing susceptibility to type 1 diabetes, utilising the fact that markers linked to a disease gene will show excess of alleles shared identical-by-descent in affected sibpairs (Penrose, 1953; Risch, 1990; Holmans, 1993).

The initial genome-wide scan for linkage utilising 289 microsatellite markers, in 96 UK sibpair families, revealed evidence of linkage to an additional eighteen loci (Davies et al, 1994). Confirmation of linkage to two of these loci was achieved by analysis of two additional family sets (102 UK families and 84 USA families), IDDM4 on chromosome 11q13 (MLS 1.3, P=0.003 at FGF3) and IDDM5 on chromosome 6q (MLS 1.8 at ESR). At IDDM4 the most significant linkage was obtained in the subset of families sharing 1 or 0 alleles IBD at HLA (MLS=2.8; P=0.001; λs=1.2) (Davies et al, 1994). This linkage was also observed by Hashimoto et al (1994) using 251 affected sibpairs, obtaining P=0.0008 in all sibpairs. Combining these results, with 596 families, provides substantial support for IDDM4 (P=1.5×10-6) (Todd and Farrall, 1996; Luo et al, 1996).

BRIEF DESCRIPTION OF THE INVENTION

The present inventors now disclose for the first time a gene encoding a novel member of the LDL-receptor family, which they term “LRP5” (previously “LRP-3”). Furthermore, evidence indicates that the gene represents the IDDM susceptibility locus IDDM4, the identification and isolation of which is a major scientific breakthrough.

Over the last 10 years many genes for single gene or monogenic diseases, which are relatively rare in the population, have been positioned by linkage analysis in families, and localised to a small enough region to allow identification of the gene. The latter sublocalisation and fine mapping can be carried out in single gene rare diseases because recombinations within families define the boundaries of the minimal interval beyond any doubt. In contrast, in common diseases such as diabetes or asthma the presence of the disease mutation does not always coincide with the development of the disease: disease susceptibility mutations in common disorders provide risk of developing of the disease, and this risk is usually much less than 100%. Hence, susceptibility genes in common diseases cannot be localised using recombination events within families, unless tens of thousands of families are available to fine map the locus. Because collections of this size are impractical, investigators are contemplating the use of association mapping, which relies on historical recombination events during the history of the population from which the families came from.

Association mapping has been used in over a dozen examples of rare single gene traits, and particularly in genetically isolated populations such as Finland to fine map disease mutations. Nevertheless, association mapping is fundamentally different from straight forward linkage mapping because even though the degree of association between two markers or a marker and a disease mutation is proportional to the physical distance along the chromosome this relationship can be unpredictable because it is dependent on the allele frequencies of the markers, the history of the population and the age and number of mutations at the disease locus. For rare, highly penetrant single gene diseases there is usually one major founder chromosome in the population under study, making it relatively feasible to locate an interval that is smaller than one that can be defined by standard recombination events within living families. The resolution of this method in monogenic diseases in which there is one main founder chromosome is certainly less than 2cM, and in certain examples the resolution is down to 100 kb of DNA (Hastbacka et al. (1994) Cell 78,1-20).

In common diseases like type 1 diabetes, which are caused by a number of genes or polygenes acting together in concert the population frequency of the disease allele may be very high, perhaps exceeding 50%, and there are likely to be several founder chromosomes, all of which impart risk, and not a 100% certainty of disease development. Because association mapping is dependent on unpredictable parameters, and because founder chromosomes will be several and common in frequency in the general population, the task of fine mapping polygenes is currently one of some controversy, and many doubt the feasibility at all of a systematic genetic approach using a combination of linkage and association mapping. Recently, Risch and Marakandis have provided some mathematical background to the feasibility of association mapping in complex diseases (Science 273 1516-1517, 1996) but they did not take into account the effect of multiple founder chromosomes.

As a result of these uncertainties, extremely large numbers of diabetic families are required for genotyping, with a large number of markers across a specific region, giving a linkage disequilibrium curve which may have several peaks. The question is, which peak identifies the aetiological mutation, and in what ways can we establish this? To our knowledge, the linkage disequilibrium curves and haplotype association maps shown in FIGS. 3, 4, 19 and 20 are the first of their kind for any complex polygenic disease for any locus. Curves of this nature have not been published yet in the literature, even for the well-established IDDM1/MHC locus. In this respect the work described here is entirely novel and at the cutting edge of research into the genetics of polygenes.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 illustrates approximate localisation of IDDM4 on chromosome 11q13. Multipoint linkage map of maximum likelihood IBD in a subgroup of HLA 1:0 sharers in 150 families. MLS of 2.3 at FGF3 and D11S1883 (λs=1.19) were obtained (Davies et al (1994) Nature 371: 130-136).

FIG. 2 shows a physical map of the region D11S987—Galanin on chromosome 11q13. The interval was cloned in pacs, bacs and cosmids, and restriction mapped using a range of restriction enzymes to determine the physical distance between each marker.

FIG. 3 shows a single-point linkage disequilibrium curve at the IDDM4 region. 1289 families were analysed by TDT, with a peak at H0570POLYA,) P=0.001. x-axis: physical distance in kb; y-axis: TDT χ2 statistic (tdf).

FIG. 4 shows a three-point rolling linkage disequilibrium curve at IDDM4, with 1289 families, from four different populations (UK, USA, Sardinia and Norway). In order to minimise the effects of variation in allele frequency at each polymorphism, the TDT data was obtained at three consecutive markers, and expressed as an average of the three. x-axis: physical distance in kb; y-axis: TDT χ2 statistic.

FIG. 5(a) shows DNA sequence of the LRP5 isoform 1 cDNA (SEQ ID NO:1).

FIG. 5(b) shows the DNA sequence of the longest open reading frame present in the LRP5 cDNA (SEQ ID NO:2).

FIG. 5(c) amino acid sequence translation (in standard single letter code) of the open reading frame in FIG. 5(b) (SEQ ID NO:3).

FIG. 5(d) motifs of LRP5 isoform 1 (SEQ ID NO:3), encoded by the open reading frame contained in FIG. 5(b) (SEQ ID NO:2). Symbols: Underlined residues 1-24 contain a signal for protein export and cleavage, ▾ indicates the position of an intron/exon boundary, * indicates a putative N-linked glycosylation site in the proposed extracellular portion of the receptor. The EGF-binding motifs are shaded light gray, LDL-receptor ligand motifs are shaded a darker gray. The spacer regions are indicated by the underlined four amino acids with high similarity to the YWTD motif. A putative transmembrane spanning domain is underlined with a heavy line. Areas shaded in the cytoplasmic domain (1409 to end) may be involved in endocytosis.

FIG. 5(e) amino acid sequence of the mature LRP5 protein (SEQ ID NO:4).

FIG. 5(f) shows the comparison of the nucleotide sequence of the first 432 nucleotides of the 5′ end of the human isoform1 cDNA sequence (FIG. 5(a) (SEQ ID NO:1)) on the upper line (SEQ ID NO:5) with the first 493 nucleotides of the 5′ end of the mouse Lrp5 cDNA sequence (FIG. 16(a) (SEQ ID NO:35)) on the lower line (SEQ ID NO:6). The comparison was performed using the GCG algorithm GAP (Genetics Computer Group, Madison, Wis.).

FIG. 5(g) shows the comparison of the first 550 amino acids of human LRP5 isoform 1 (SEQ ID NO:7) with the first 533 amino acids of mouse Lrp5 (SEQ ID NO:8) using the GCG algorithm GAP (Genetics Computer Group, Madison, Wis.).

FIG. 6(a) shows the amino acid sequence of LRP5 motifs (SEQ ID NOS:9 to 22). A comparison was made using the program crossmatch (obtained from Dr. Phil Green, University of Washington) between the motifs present in LRP1 and the LRP5 amino acid sequence. The best match for each LRP5 motif is shown. For each motif, the top line is the LRP5 isoform 1 amino acid sequence, the middle line is amino acids that are identical in the two motifs, the lower line is the amino acid sequence of the best match LRP1 motif. Of particular note are the conserved cysteine (C) residues that are the hallmark of both the EGF-precursor and LDL-receptor ligand binding motifs(SEQ ID NOS:9-22).

FIG. 6(b) illustrates the motif organization of the LDL-receptor and LRP5. The LDL-receptor ligand binding motif are represented by the light gray boxes, the EGFlike motifs are represented by the dark gray boxes. The YWTD spacer motifs are indicated by the vertical lines. The putative transmembrane domains are represented by the black box.

FIG. 7 shows LRP5 gene structure. The DNA sequence of contiguous pieces of genomic DNA is represented by the heavy lines and are according to the indicated scale. The position of the markers D11S1917(UT5620), H0570POLYA, L3001CA, D11S1337, and D11S970 are indicated. The exons are indicated by the small black boxes with their numerical or alphabetical name below, the size of the exons is not to scale.

FIG. 8 illustrates different LRP5 gene isoforms. Alternatively spliced 5′ ends of the LRP5 gene are indicated with the isoform number for each alternatively spliced form. The light gray arrow indicates the start of translation which occurs in exon 6 in isoform 1, may occur upstream of exon 1 in isoform 3 and occurs in exon B in isoforms 2, 4, 5, and 6. The core 22 exons (A to V) are represented by the box.

FIG. 9 is a SNP map of Contig 57. Polymorphisms were identified by the comparison of the DNA sequence of BAC 14-1-15 with cosmids EO 864 and BO 7185. Corresponding Table 6 indicates a PCR amplicon that includes the site of the polymorphism, the nature of the single nucleotide polymorphis (SNP), its location and the restriction site that is altered, if any. The line represents the contiguous genomic DNA with the relative location of the polymorphisms and the amplicons used to detect them. The large thin triangles represent the site of putative exons. The marker H0570POLYA is indicated.

FIG. 10 is a SNP map of Contig 58. Polymorphisms were identified by the comparison of the DNA sequence of BAC 14-1-15 with cosmid BO 7185. Corresponding Table 6 indicates a PCR amplicon that includes the site of the polymorphism, the nature of the single nucleotide polymorphism (SNP), its location and the restriction site that is altered, if any. The line represents the contiguous genomic DNA with the relative location of the polymorphisms and the amplicons used to detect them. The large thin triangle at the very end of the line represents exon A of LRP5.

FIG. 11(a) shows the DNA sequence of the isoform 2 cDNA (SEQ ID NO:23).

FIG. 11(b) shows the longest open reading frame of isoform 2 (also isoform 4,5,6) (SEQ ID NO:24).

FIG. 11(c) shows the amino acid sequence of isoform 2 (also isoform 4,5,6) (SEQ ID NO:25), encoded by the open reading frame of FIG. 12(b).

FIG. 12(a) shows the DNA sequence of isoform 3 cDNA (SEQ ID NO:26).

FIG. 12(b) shows sequence obtained by GRAIL and a putative extension of isoform 3 (SEQ ID NO:27).

FIG. 12(c) shows a putative open reading frame for isoform 3 (SEQ ID NO:28).

FIG. 12(d) shows the amino acid sequence of isoform 3 (SEQ ID NO:29).

FIG. 12(e) shows the GRAIL predicted promoter sequence for isoform 3 (SEQ ID NO:30).

FIG. 13 shows the DNA sequence of the isoform 4 cDNA (SEQ ID NO:31), which contains an open reading frame encoding isoform 2 (FIG. 11(b)).

FIG. 14 shows the DNA sequence of the present in cDNA isoform 5 (SEQ ID NO:32), which contains an open reading frame encoding isoform 2 (FIG. 11(b)).

FIG. 15(a) shows the DNA sequence of isoform 6 (SEQ ID NO:33), which contains an open reading frame encoding isoform 2(FIG. 11 (b)).

FIG. 15(b) shows the GRAIL predicted promoter sequence associated with isoform6 (SEQ ID NO:34).

FIG. 16(a) shows the DNA sequence of a portion of the mouse Lrp5 cDNA (SEQ ID NO:35).

FIG. 16(b) shows the DNA sequence of the 5′ extension of the mouse clone (SEQ ID NO:36).

FIG. 16(c) shows the DNA sequence of a portion of the open reading frame of mouse Lrp5 (SEQ ID NO:37).

FIG. 16(d) show the amino acid sequence of the open reading frame encoding a portion of mouse Lrp5 (SEQ ID NO:8).

FIG. 17(a)shows DNA sequence of exons A to V (SEQ ID NO:38).

FIG. 17(b) shows the amino acid sequence (SEQ ID NO:39) encoded by an open reading frame contained in FIG. 17(a).

FIG. 18(a) shows the nucleotide sequence of the full length mouse Lrp5 cDNA (SEQ ID NO:40).

FIG. 18(b) shows the nucleotide sequence for the longest open reading frame present in the mouse Lrp5 cDNA (SEQ ID NO:41).

FIG. 18(c) shows the amino acid sequence translation (in single letter code) of the open reading frame in FIG. 18(b) (SEQ ID NO:42).

FIG. 18(d) shows an alignment of the amino acid sequence of the human LRP5 protein and the mouse Lrp5 protein (SEQ ID NOS:3,42) program using the GCG algorithm GAP (Genetics Computer Group, Madison, Wis.).

FIG. 18(e) shows an alignment of the amino acid sequence of the mature human LRP5 protein with the mature mouse LRP5 (SEQ ID NOS:43,44) program using the GCG algorithm GAP (Genetics Computer Group, Madison, Wis.).

FIG. 19 shows a schematic representation of haplotypes across the IDDM4 region. Three distinct haplotypes are shown. Haplotype A is protective against IDDM whereas haplotypes B and C are susceptible/non-protective for IDDM.

FIG. 20 shows a schematic representation of single nucleotide polymorphism (SNP) haplotypes across the IDDM4 region. Haplotype A is protective whereas haplotypes B, C, D, and E are susceptible/non-protective. A minimal region of 25 kb which is Identical By Descent (IBD) for the four susceptible haplotypes is indicated. The SNP designations, e.g. 57-3, are as described in Table 6 and FIGS. 9 and 10.

LRP5 Gene Structure

The gene identified contains 22 exons, termed A-V, which encode most of the mature LRP5 protein. The 22 exons account for 4961 nucleotides of the LRP5 gene transcript (FIG. 5(a) (SEQ ID NO: 1) and are located in an approximately 110 kb of genomic DNA. The genomic DNA containing these exons begins downstream of the genetic marker L3001CA and includes the genetic markers D11S1337, 141ca5, and D11S970 (FIG. 7). Several different 5′ ends of the LRP5 transcript have been identified. Of particular interest is isoform 1 with a 5′ end encoding a signal peptide sequence for protein export (secretory leader peptide) across the plasma membrane. As discussed below the LRP5 protein is likely to contain a large extracellular domain, therefore it would be anticipated that this protein would have a signal sequence. The exon encoding the signal sequence, termed exon 6, lies near the genetic marker H0570POLYA. This exon is 35 kb upstream of exon A and thus extends the genomic DNA comprising the LRP5 gene to at least 160 kb.

Several additional isoforms of the LRP5 gene that arise from alternative splicing of the 5′ end have been identified by PCR (FIG. 8). The functional relevance of these additional isoforms is not clear. Two of these LRP5 transcripts contain exon 1 which is located upstream of the genetic marker D11S1917(UT5620) and expands the LRP5 gene to approximately 180 kb of genomic DNA. The transcript termed isoform 3 consists of exon 1 spliced directly to exon A. The reading frame is open at the 5′ end and thus there is the potential for additional coding information present in exons upstream of exon 1. Alternatively, centromeric extension of exon 1 to include all of the open reading frame associated with this region yields the open reading frame for isoform 3.

The second transcript that contains exon 1 also contains exon 5, which is located near the genetic marker H0570POLYA. The open reading frame for this isoform, isoform 2, begins in exon B and thus encodes a truncated LRP5 protein which lacks any predicted secretory leader peptide in the first 100 amino acids. There are three additional transcripts each with an open reading frame beginning in exon B and with 5′ ends near the genetic marker L3001CA.

Expression Profile of LRP5

Northern blot analysis indicates that the major mRNA transcript for the LRP5 gene is approximately 5 to 5.5 kb and is most highly expressed in liver, pancreas, prostate, and placenta. Expression is also detected in skeletal muscle, kidney, spleen, thymus, ovary, lung, small intestine, and colon. Minor bands both larger and smaller than 5 kb are detected and may represent alternative splicing events or related family members.

LRP5 is a Member of the LDL-receptor Family

The gene identified in the IDDM4 locus, lrp5, is a member of the LDL-receptor family. This family of proteins has several distinguishing characteristics, a large extracellular domain containing cysteine rich motifs which are involved in ligand binding, a single transmembrane spanning domain, and an “NPXY” (SEQ ID NO:45) internalization motif(Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637). The functional role of the members of this family is the clearance of their ligands by the mechanism of receptor mediated endocytosis. This is illustrated by the most highly characterized member of the family, the LDL-receptor which is responsible for the clearance of LDL cholesterol from plasma (Goldstein, et. al. (1985) Ann. Rev. Cell Biol. 1: 1-39).

LRP5 is most closely related to the LDL-receptor related protein (LRP) which is also know as the alpha2-macroglobulin receptor. Translation of the open reading frame (ORF) of isoform 1 yields the LRP5 protein. Comparison of the LRP5 protein to human LRP1 using the algorithm GAP (Genetics Computer Group, Madison, Wis.) reveals an overall amino acid similarity of 55% and 34% identity to the region of the human LRP1 protein from amino acids 1236 to 2934. The DNA of this ORF is 45% identical to LRP1 encoding DNA as indicated by GAP. A slightly lower but significant level of similarity is seen with the megalin receptor also termed LRP2 and gp330 (Saito, et al. (1994) Proc. Natl. Acad. Sci. 91: 9725-9729), as well as the Drosophilla vitellogenin receptor (Schonboum et. al. (1995) Proc. Natl. Acad. Sci. 92: 1485-1489). Similarity is also observed with other members of the LDL-receptor family including the LDL-receptor (Suedhof et. al. (1985) Science 228: 815-822) and the VLDL receptor (Oka et. al. (1994) Genomics 20: 298-300). Due to the presence of EGF-like motifs in LRP5 similarity is also observed with the EGF precursor and nidogen precursor which are not members of the LDL-receptor family.

Properties and Motifs of LRP5

The N-terminal portion of LRP5 likely has the potential for a signal sequence cleavage site. Signal sequences are frequently found in proteins that are exported across the plasma membrane (von Heijne (1994) Ann. Rev. Biophys. Biomol. Struc. 23: 167-192). In addition, other members of the LDL-receptor family contain a signal sequence for protein export.

The presence of a signal sequence cleavage site was initially identified by a comparison of the human LRP5 with a mouse cDNA sequence that we obtained. The initial mouse partial cDNA sequence that we obtained, 1711 nucleotides (FIG. 16(a) (SEQ ID NO:35)), is 87% identical over an approximately 1500 nucleotide portion to the human LRP5 cDNA and thus is likely to be the mouse ortholog (Lrp5) of the human LRP5. The cloned portion of the mouse cDNA contains an open reading frame (FIG. 16(c) (SEQ ID NO:37)) encoding 533 amino acids. The initiating codon has consensus nucleotides for efficient translation at both the −3 (purine) and +4 (G nucleotide) positions (Kozak, M. 1996, Mamalian Genome 7:563-574). A 500 amino acid of the portion of the mouse Lrp5 (FIG. 5(g) and FIG. 16(d) (SEQ ID NO:8)) is 96% identical to human LRP5, further supporting the proposal that this is the mouse ortholog of LRP5.

Significantly, the first 200 nucleotides of the mouse cDNA have very little similarity to the 5′ extensions present in isoforms 2-6 discussed below. By contrast this sequence is 75% identical with the human sequence for exon 6 that comprises the 5′ end of isoform 1. Thus isoform 1 which encodes a signal peptide for protein export likely represents the most biologically relevant form of LRP5.

Importantly, both the human LRP5 and mouse Lrp5 open reading frames encodes a peptide with the potential to act as a eukaryotic signal sequence for protein export (von Heijne, 1994, Ann. Rev. Biophys. Biomol. Struc. 23:167-192). The highest score for the signal sequence as determined by using the SigCleave program in the GCG analysis package (Genetics Computer Group, Madison Wis.) generates a mature peptide beginning at residue 25 of human LRP5 and residue 29 of mouse Lrp5 (FIGS. 5(d and g)). Additional sites that may be utilized produce mature peptides in the human LRP5 beginning at amino acid residues 22, 23, 23, 26, 27, 28, 30 or 32. Additional cleavage sites in the mouse Lrp5 result in mature peptides beginning at amino acid residue 31, 32, 33, or 38 (FIG. 5(g) (SEQ ID NO:8)). The mature human LRP5 protein is show in FIG. 5(e) (SEQ ID NO:4).

The other alternative isoforms of LRP5 lack a signal sequence near the N-terminus of the encoded protein. The functional relevance of these additional isoforms is not known, however there are several exported proteins which lack a signal sequence and are transported by a signal peptide independent mechanism (Higgins, C. F. (1992) Ann. Rev. Cell Biol. 8: 67-113). Thus it is possible that the putative extracellular domain of these isoforms is translocated across the plasma membrane.

The extracellular domain of members of the LDL receptor family contains multiple motifs containing six cysteine residues within an approximately 40 amino acid region. (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637). Several classes of these cysteine rich motifs have been defined based on the spacing of the cysteine residues and the nature of other conserved amino acids within the motif. The LDL-receptor ligand binding (class A) motif is distinguished by a cluster of acidic residues in the C-terminal portion of the motif which includes a highly conserved SDE sequence. The importance of this acidic region in ligand binding has been demonstrated by mutagenesis studies (Russell et. al. (1989) J. Biol. Chem. 264: 21682-21688). Three LDL-receptor ligand binding motifs are found in the LRP5 protein (FIG. 6(a) (SEQ ID NOS:9 to 22)). The EGF-like (class B) motif lacks the cluster of acidic residues present in the LDL-receptor ligand binding motif. In addition, the spacing of the cysteine residues differs in the EGF-like motifs relative to the LDL-receptor ligand binding motif. The LRP5 protein contains 4 EGF-precursor (B.2) motifs, which have the property of an NGGCS motif between the first and second cysteine residue (FIG. 6(a) (SEQ ID NOS:9 to 22)).

The size of the members of the LDL receptor family and the number of the cysteine-rich repeats in the extracellular domain varies greatly. LRP1 is a large protein of 4544 amino acids and contains 31 LDL-receptor ligand binding motifs (class A) and 22 EGF-like motifs (class B) (Herz et. al., (1988) EMBO 7: 4119-4127). Similarly the megalin receptor, LRP2, is a protein of 4660 amino acids and consists of 36 LDL-receptor ligand binding motifs and 17 EGF-like motifs (Saito et. al. (1994) PNAS 91: 9725-9729). In contrast, the LDL receptor is a relatively small protein of 879 amino acids which contains 7 LDL-ligand binding motifs and 3 EGF-like motifs. The predicted size of the mature LRP5 protein, 1591 amino acids, is intermediate between LRP1 and the LDL receptor. As indicated above the LRP5 protein contains four EGF-like motifs and three LDL-ligand binding motifs. It has been postulated that the multiple motif units, particularly evident in LRP1 and LRP2, account for the ability of these proteins to bind multiple lipoprotein and protein ligands (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637).

The arrangement of the LDL-receptor ligand binding and EGF-like motifs relative to each other is similar in both the LDL receptor, LRP1, and LRP2. In each of these proteins multiple LDL-ligand binding motifs are grouped together and followed by at least one EGF-like motif (Herz et. al., (1988) EMBO 7: 4119-4127, 1988). By contrast, in the LRP5 protein an EGF-like motif precedes the group of three LDL-ligand binding motifs (FIG. 6(b)). An additional property unique to LRP5 is that the LDL-ligand binding motifs in LRP5 are followed by the putative transmembrane domain. The different arrangement of the motifs may define LRP5 as a member of a new subfamily within the LDL-receptor related protein family.

LRP5 has a signal peptide for protein export at the N-terminus of the protein. Signal peptide cleavage yields a mature LRP5 protein which begins with an EGF precursor spacer domain from amino acids 31-297 (amino acid residue numbers are based upon the LRP5 precursor). The EGF precursor spacer domain is composed of five approximately 50 amino acid repeats that each contain the characteristic sequence motif Tyr-Trp-Thr-Asp (YWTD) (SEQ ID NO:46). There are three additional spacer domains from amino acids 339-602, 643-903, and 944-1214. Each spacer domain is followed by an EGF repeat from amino acids 297-338 (egf1), 603-642 (egf2), 904-943 (egf3), and 1215-1255 (egf4). The EGF repeats contain six conserved cysteine residues and are of the B.2 class which has an Asn-Gly-Gly-Cys (NGGC) (SEQ ID NO:47) motif as a feature (Herz et al. 1988, EMBO J 7:4119-27) (FIG. 6(a) (SEQ ID NO:9 to 22)). A single unit defined as an EGF precursor spacer domain and an EGF repeat, is repeated four times in LRP5. The last EGF repeat is adjacent to three consecutive LDLR repeats from amino acids 1257-1295(ldlr1), 1296-1333 (ldlr2), and 1334-1372 (ldlr3). The LDLR repeats have the conserved cysteine residues, as well as, the motif Ser-Asp-Glu (SDE) as a characteristic feature (FIG. 6(a) (SEQ ID NOS:9 to 22)). There are thirteen amino acids separating the LDLR repeats from the putative transmembrane spanning domain of 23 amino acids from 1386-1408. The putative extracellular domain of LRP5 has six potential sites for N-linked glycosylation at amino acid residues 93, 138, 446, 499, 705, and 878 (FIG. 5(d) (SEQ ID NO:3)).

The intracellular domain of LRP5 is comprised of 207 amino acids which is longer than most members of the family but similar in size to LRP2 (Saito et. al. (1994) PNAS 91:9725-9729). It does not exhibit similarity to the LDL-receptor family, nor is it similar to any other known proteins. The cytoplasmic domain of LRP5 is comprised of 16% proline and 15% serine residues (FIG. 5(d) (SEQ ID NO:3)). Most members of the LDL-receptor family contain a conserved NPXY motif in the cytoplasmic domain which has been implicated in endocytosis by coated pits (Chen et. al. (1990) J. Biol. Chem. 265: 3116-3123). Mutagenesis studies have indicated that the critical residue for recognition by components of the endocytotic process is the tyrosine residue (Davis, et al. (1987) Cell 45: 15-24). Replacement of the tyrosine residue by phenylalanine or tryptophan is tolerated, thus the minimal requirement for this residue appears to be that it is aromatic amino acid (Davis, et al. (1987) Cell 45: 15-24). Structural studies have indicated that the critical function of the NP residues is to provide a beta-turn that presents the aromatic residue (Bansal and Gierasch (1991) Cell 67: 1195-1201).

Although the cytoplasmic domain of LRP5 does not contain an NPXY motif, there are several aromatic residues in the LRP5 cytoplasmic domain that lie in putative turn regions (FIG. 5(d) (SEQ ID NO:3)) and thus may be involved in facilitating endocytosis. In particular tyrosine 1473 which occurs in the sequence VPLY (SEQ ID NOS:48) motif has the proline and tyrosine in the correct position, relative to the consensus motif. Although the NPXY motif has been implicated in endocytosis in several proteins it is not an absolute requirement as there are proteins that lack the NPXY motif, e.g. the transferrin receptor, that undergo endocytosis by coated pits (Chen, et. al. (1990) J. Biol. Chem. 265: 3116-3123). In any event, we anticipate that the primary function of this protein will be receptor mediated endocytosis of its ligand.

Potential Roles of LRP5

The ability of members of the LDL-receptor family to bind multiple ligands suggests that LRP5 may function to bind one or more ligands. Moreover, in a fashion analogous to other members of the family, once bound the LRP5 receptor ligand complex would endocytose resulting in clearance of the ligand from the extracellular milieu. The nature of the LRP5 ligand may be a lipid, a protein, a protein complex, or a lipoprotein and may possess a variety of functions. Although the physiological function of the most closely related member of the LDL-receptor family, LRP1, is uncertain, it does possess a number of biochemical activities. LRP1 binds to alpha-2 macroglobulin. Alpha-2 macroglobulin is a plasma complex that contains a “bait” ligand for a variety of proteinases e.g. trypsin, chymotrypsin, pancreatic elastase and plasma kallikrein (Jensen (1989) J. Biol. Chem. 20:11539-11542). Once the proteinase binds and enzymatically cleaves the “bait” alpha-2 macroglobulin undergoes a conformational change and “traps” the proteinase. The proteinase:alpha-2 macroglobulin complex is rapidly cleared by LRP. This mechanism scavenges proteinases that have the potential to mediate a variety of biological functions e.g. antigen processing and proteinase secretion (Strickland et. al. (1990) J. Biol. Chem. 265: 17401-17404). The importance of this function is evidenced by the prenatal death of Lrp1 knockout mice (Zee et. al. (1994) Genomics 23: 256-259).

Antigen presentation is a critical component in the development of IDDM as is evidenced by the pivotal role of MHC haplotypes in conferring disease susceptibility (Tisch and McDivitt (1996) Cell 85: 291-297). By analogy with LRP1, LRP5 may play a role in antigen presentation in which case polymorphisms within this gene could affect the development of autoimmunity in the type 1 diabetic patient.

The alpha-2 macroglobulin complex also binds cytokines and growth factors such as interleukin-1 beta, interleukin 2, interleukin 6, transforming growth factor-beta, and fibroblast growth factor (Moestrup and Gliemann (1991) J. Biol. Chem. 266: 14011-14017). Thus the alpha-2 macroglobulin receptor has the potential to play a role in the clearance of cytokines and growth factors. The role of cytokines in mediating immune and inflammatory responses is well established. For example, the interleukin-2 gene is a strong candidate gene for the Idd3 locus in the non-obese diabetic mouse, an animal model for type 1 diabetes (Denny et. al. (1977) Diabetes 46:695-700). If LRP5 binds alpha-2 macroglobulin or related complexes then it may play a role in the immune response by mediating cytokine clearance. For example, the LRP5 which is expressed in pancreas, the target tissue of IDDM, may play a role in clearing cytokines from the inflammatory infiltrate (insulitis) that is ongoing in the disease. A polymorphism in LRP5 that reduces the ability of LRP5 to clear cytokines may increase an individuals susceptibility to developing IDDM. Furthermore an individual with a polymorphism that increases the ability of LRP5 to clear cytokines may be protected from developing IDDM. Conversely, certain cytokines counteract other cytokines and thus removal of certain beneficial cytokines by LRP5 may confer disease susceptibility and thus a polymorphism that reduces LRP5 activity may confer protection from developing the disease.

Increases of free fatty acids (FFA) have been shown to reduce insulin secretion in animals (Boden et. al. (1997) Diabetes 46: 3-10). In addition, ApoE which is a ligand for the LDL-receptor, has been associated with an antioxidant activity (Miyata and Smith (1996) Nature Genet. 14: 55-61) and oxidative damage is a central pathogenic mechanism in pancreatic β-cell destruction in type 1 diabetes (Bac (1994) Endocrin. Rev. 15: 516-542). Thus alterations in the ability of LRP5 to bind ApoE and related lipoproteins may influence the susceptibility to oxidative damage in pancreatic β-cells. Transfection of forms of LRP5 into β-cells may facilitate resistance of β cells to damage by the immune system in autoimmunity and in transplantation.

A pharmacological entity termed the lipolysis-stimulated receptor (LSR) which binds and endocytoses chylomicron remnants in the presence of FFA has been described (Mann et. al. (1995) Biochemistry 34: 10421-10431. One possible role for the LRP5 gene product is that it is responsible for this activity.

Another member of the LRP family is LRP2, also known as megalin and gp330, this protein has been implicated in Heymann's nephritis, an autoimmune disease of the kidney in rats (Saito et. al. (1994) PNAS 91: 9725-9729). Heymann's nephritis is a model of glomerularnephritis and is characterized by the development of autoantibodies to the alpha-2 macroglobulin receptor associated protein, also known as the Heymann nephritis antigen. The Heymann nephritis antigen binds to LRP2 (Strickland et. al. (1991) J. Biol. Chem. 266: 13364-13369). LRP2 may play a role in this disease by clearance of this pathogenic protein. In an analogous manner the function of LRP5 may be to bind and clear proteins in the pancreas to which the IDDM patient has generated autoantibodies. Alternatively LRP5 itself may be an autoantigen in the IDDM patient.

LRP1 has been identified as the receptor for certain bacterial toxins (Krieger and Herz (1994) Ann. Rev. Biochem. 63: 601-637) and the human rhinovirus (Hofer et. al. (1994) Proc. Natl. Acad. Sci. 91: 1839-42). It is possible that a viral infection alters an individuals susceptibility to IDDM (Epstein (1994) N. Eng. J. Med. 331: 1428-1436). If certain viruses utilize LRP5 as a mode of entry into the cell then polymorphisms in LRP5 may alter the individuals susceptibility to type 1 diabetes.

Alterations in LRP5 may participate in the pathogenesis of other diseases. LRP1 binds lipoproteins such as apoE and C-apolipoproteins. The clearance of lipoproteins such as apoE and apoB by the LDL receptor is its primary role, mutations in the LDL receptor lead to hypercholesterolemia (Chen et. al. (1990) J. Biol. Chem. 265: 3116-3123). Therefore mutations in LRP5 that decrease the ability of the protein to scavenge lipoproteins may cause an elevation in cholesterol. Variations in LRP5 could predispose to the development of macrovascular complications in diabetics, the major cause of death. In type 2 diabetics, pancreatic pathology is characterised by the deposition of amyloid. Amyloid deposition may decrease pancreatic β-cell function. LRP5 could function in the metabolism of islet amyloid and influence susceptibility to type 2 diabetes as well as type 1 diabetes. The role of ApoE in Alzheimer's disease indicates that proteins such as LRP1 and possibly LRP5 have the potential to contribute to the pathogenesis of this disease.

Polymorphism in genes involved in the development of osteoporosis-pseudoglioma syndrome have been mapped to a 3-cM region of chromosome 11 which includes the gene encoding LRP5 (Gong et. al. (1996) Am. J. Hum. Genet. 59: 146-151). The pathogenic mechanism of this disease is unknown but is believed to involve a regulatory role, patients with have aberrant vascular growth in the vitero-retina. The potential role of LRP5 in the clearance of fibroblast growth factor, a mediator of angiogenesis, and the chromosomal location of the gene suggests that it may play a role in this disease. This proposed function could also be connected with the development of retinopathy in diabetes.

Polymoorphisms in the LRP5 Gene

The exons of the LRP5 gene are being scanned for polymorphisms. There are several polymorphisms that change an amino acid in LRP5 that have been identified in IDDM patients (Table 5). Of particular interest is a C to T transition, which changes an Ala codon to Val, in one of the three conserved LDL receptor ligand binding motifs. In addition to this polymorphism described above, a C to T transition was identified in the codon for Asn709 (with no effect on the encoded amino acid), and three polymorphisms were identified in intronic sequences flanking the exons. An additional set of polymorphisms has been identified by comparing experimentally derived cDNA sequences with the genomic DNA sequence (Table 5). Some of these polymorphism will be analyzed in a large number of IDDM patients and control individuals to determine their association with IDDM.

A number of (approximately 30) single nucleotide polymorphisms (SNPs) were identified in the genomic DNA sequences of overlapping BAC and cosmid clones surrounding the genetic marker poly A. The contiguous genomic sequences containing these polymorphism have been termed contig 57 (FIG. 9), which contains exons 1 and 5 along with the genetic markers poly A and D11S1917(UT5620), and contig 58 (FIG. 10) which contains the genetic marker L3001ca and part of exon A.

Additional Experimental Evidence

A region of identity-by-descent associated with type 1 diabetes has been identified in the 5′ portion of the LRP5 gene. By combining data from SNPs and microsatellite markers we have identified a region identical-by-descent in susceptible haplotypes, the minimal region consists of 25 kb which contains the putative regulatory regions of LRP5 and the first exon. This strengthens the genetic evidence for LRP5 being a diabetes risk gene. Therefore therapies that affect LRP5 may be useful in the prevention and treatment of type 1 diabetes.

Overexpression of LRP5 in mice provides evidence for LRP5 affecting lipoprotein metabolism. Statistically significant evidence for modulation of triglycerides by LRP5 has been obtained. Thus therapies that affect LRP5 may be useful in the treatment of cardiovascular disease and conditions where serum triglycerides are elevated.

Suggestive evidence was obtained for LRP5 reducing serum cholesterol when it is above normal. There is also evidence for the ability of LRP5 to interact with very low-density lipoprotein particles and reduce their levels in serum. Therefore therapies that affect LRP-5 may be useful in the treatment of cardiovascular disease and conditions where serum cholesterol levels are elevated.

Biochemical studies indicate that LRP5 has the capacity to function in the uptake of low-density lipoprotein (LDL) particles. Thus therapies that affect LRP5 may be useful in the treatment of cardiovascular disease where LDL levels are elevated.

Overexpression of LRP5 in mice provided statistically significant evidence for a reduction in serum alkaline phosphatase. A reduction in serum alkaline phosphatase is consistent with LRP5 playing a role in modulation of the immune response. This provides evidence for LRP5 participating in the pathogenesis of type 1 diabetes. Therefore therapies that affect LRP5 may be useful in the treatment of autoimmune diseases.

Cellular localization of LRP5 indicates that it is expressed in a particular subtype, the phagocytic macrophages, of mature tissue macrophages. Evidence from the literature indicates that this class of macrophages is involved in autoimmune disease, supporting a role for LRP5 in autoimmune disease and type 1 diabetes. Therefore therapies that affect LRP5 may be useful in the treatment of autoimmune diseases.

Full length cDNAs for both human and mouse LRP5 have been obtained. Antibodies directed against LRP5 have been developed. These reagents provide tools to further analyze the biological function of LRP5.

Irrespective of LRP5's actual mode of action and involvement in IDDM and other diseases, the experimental work described herein establishes and supports the practical applications which are disclosed as aspects and embodiments of the present invention.

According to one aspect of the present invention there is provided a nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which includes the amino acid sequence shown in FIG. 5(c) (SEQ ID NO:3), FIG. 5(d) (SEQ ID NO:3) or FIG. 5(e) (SEQ ID NO:4). The amino acid sequence of FIG. 5(c) (SEQ ID NO:3) includes that of FIG. 5(e) (SEQ ID NO:4) and a signal sequence.

The coding sequence may be that shown included in FIG. 5(a) (SEQ ID NO: 1) or FIG. 5(b) (SEQ ID NO:2) or it may be a mutant, variant, derivative or allele of the sequence shown. The sequence may differ from that shown by a change which is one or more of addition, insertion, deletion and substitution of one or more nucleotides of the sequence shown. Changes to a nucleotide sequence may result in an amino acid change at the protein level, or not, as determined by the genetic code.

Thus, nucleic acid according to the present invention may include a sequence different from the sequence shown in FIG. 5(a) (SEQ ID NO: 1) or FIG. 5(b) (SEQ ID NO:2) yet encode a polypeptide with the same amino acid sequence. The amino acid sequence shown in FIG. 5(c) (SEQ ID NO:3) consists of 1615 residues.

On the other hand the encoded polypeptide may comprise an amino acid sequence which differs by one or more amino acid residues from the amino acid sequence shown in FIG. 5(c) (SEQ ID NO:3). Nucleic acid encoding a polypeptide which is an amino acid sequence mutant, variant, derivative or allele of the sequence shown in FIG. 5(c) (SEQ ID NO:3) is further provided by the present invention. Such polypeptides are discussed below. Nucleic acid encoding such a polypeptide may show at the nucleotide sequence and/or encoded amino acid level greater than about 60% homology with the coding sequence shown in FIG. 5(a) (SEQ ID NO: 1) and/or the amino acid sequence shown in FIG. 5(c) (SEQ ID NO:3), greater than about 70% homology, greater than about 80% homology, greater than about 90% homology or greater than about 95% homology. For amino acid “homology”, this may be understood to be similarity (according to the established principles of amino acid similarity, e.g. as determined using the algorithm GAP (Genetics Computer Group, Madison, Wis.) or identity. GAP uses the Needleman and Wunsch algorithm to align two complete sequences that maximizes the number of matches and minimizes the number of gaps. Generally, the default parameters are used, with a gap creation penalty=12 and gap extension penalty=4. Use of either of the terms “homology” and “homologous” herein does not imply any necessary evolutionary relationship between compared sequences, in keeping for example with standard use of terms such as “homologous recombination” which merely requires that two nucleotide sequences are sufficiently similar to recombine under the appropriate conditions. Further discussion of polypeptides according to the present invention, which may be encoded by nucleic acid according to the present invention, is found below.

The present invention extends to nucleic acid that hybridizes with any one or more of the specific sequences disclosed herein under stringent conditions. Suitable conditions include, e.g. for detection of sequences that are about 80-90% identical such as detection of mouse LRP5 with a human probe or vice versa, hybridization overnight at 42° C. in 0.25M Na2HPO4, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55° C. in 0.1×SSC, 0.1% SDS. For detection of sequences that are greater than about 90% identical, suitable conditions include hybridization overnight at 65° C. in 0.25M Na2HPO4, pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60° C. in 0.1×SSC, 0.1% SDS.

The coding sequence may be included within a nucleic acid molecule which has the sequence shown in FIG. 5(a) (isoform 1) (SEQ ID NO: 1) or FIG. 5(b) (SEQ ID NO:2) and encode the full polypeptide of isoform 1 (FIG. 5(c) (SEQ ID NO:3)). Mutants, variants, derivatives and alleles of these sequences are included within the scope of the present invention in terms analogous to those set out in the preceding paragraph and in the following disclosure.

Also provided by the present invention in various aspects and embodiments is a nucleic acid molecule encoding a polypeptide which includes the amino acid sequence shown in FIG. 17(b) (SEQ ID NO:39). This sequence forms a substantial part of the amino acid sequence shown in FIG. 5(e) (SEQ ID NO:4). Nucleic acid encoding a polypeptide which includes the amino acid sequence shown in FIG. 17(b) (SEQ ID NO:39) may include the coding sequence shown in FIG. 17(b) (SEQ ID NO:39), or an allele, variant, mutant or derivative in similar terms to those discussed above and below for other aspects and embodiments of the present invention.

According to various aspects of the present invention there are also provided various isoforms of the LRP5 polypeptide and gene. The gene of FIG. 5 is known as isoform 1. Included within the present invention is a nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which includes the amino acid sequence of a polypeptide shown in FIG. 11(c) (isoform 2) (SEQ ID NO:25). The coding sequence may be as shown in FIG. 11(b) (SEQ ID NO:24) (which may be included within a molecule which has the sequence shown in FIG. 11(a) (isoform 2) (SEQ ID NO:23) or the sequence shown in FIG. 12(a) (isoform 3) (SEQ ID NO:26)), FIG. 13 (isoform 4) (SEQ ID NO:31), FIG. 14 (isoform 5) (SEQ ID NO:32) and FIG. 15 (isoform 6) (SEQ ID NO:33). Mutants, derivatives, variants and alleles of these sequences are also provided by the present invention, as disclosed.

Further nucleic acid molecules according to the present invention include the nucleotide sequence of any of FIG. 5(a) (SEQ ID NO: 1), FIG. 12(b) (SEQ ID NO:27), FIG. 12(e) (SEQ ID NO:30), FIG. 15(b) (SEQ ID NO:34), FIG. 16(a) (SEQ ID NO:35) and FIG. 16(b) (SEQ ID NO:36) and nucleic acid encoding the amino acid sequences encoded by FIG. 5(a) (SEQ ID NO: 1), FIG. 11(b) (SEQ ID NO:24), FIG. 12(c) (SEQ ID NO:28) or FIG. 16(c) (SEQ ID NO:37), along with mutants, alleles, variants and derivatives of these sequences. Further included are nucleic acid molecules encoding the amino acid sequence of FIG. 18(c) (SEQ ID NO:42), particularly including the coding sequence shown in FIG. 18(b) (SEQ ID NO:41).

Particular alleles according to the present invention have sequences have a variation indicated in Table 5 or Table 6. One or more of these may be associated with susceptibility to IDDM or other disease. Alterations in a sequence according to the present invention which are associated with IDDM or other disease may be preferred in accordance with embodiments of the present invention. Implications for screening, e.g. for diagnostic or prognostic purposes, are discussed below.

Generally, nucleic acid according to the present invention is provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the human genome, except possibly one or more regulatory sequence(s) for expression. Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA. The coding sequence shown herein is a DNA sequence. Where nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as encompassing reference to the RNA equivalent, with U substituted for T.

Nucleic acid may be provided as part of a replicable vector, and also provided by the present invention are a vector including nucleic acid as set out above, particularly any expression vector from which the encoded polypeptide can be expressed under appropriate conditions, and a host cell containing any such vector or nucleic acid. An expression vector in this context is a nucleic acid molecule including nucleic acid encoding a polypeptide of interest and appropriate regulatory sequences for expression of the polypeptide, in an in vitro expression system, e.g. reticulocyte lysate, or in vivo, e.g. in eukaryotic cells such as COS or CHO cells or in prokaryotic cells such as E. coli. This is discussed further below.

The nucleic acid sequence provided in accordance with the present invention is useful for identifying nucleic acid of interest (and which may be according to the present invention) in a test sample. The present invention provides a method of obtaining nucleic acid of interest, the method including hybridisation of a probe having the sequence shown in any of FIGS. 5(a), 11(a), 11(b), 12(a), 12(b), 12(c), 12(e), 13, 14, 15, 15(b) 16(a), 16(b), and 16(c), or a complementary sequence, to target nucleic acid. Hybridisation is generally followed by identification of successful hybridisation and isolation of nucleic acid which has hybridised to the probe, which may involve one or more steps of PCR. It will not usually be necessary to use a probe with the complete sequence shown in any of these figures. Shorter fragments, particularly fragments with a sequence encoding the conserved motifs (FIG. 5(c,d), and FIG. 6(a) (SEQ ID NOS:9 to 22)) may be used.

Nucleic acid according to the present invention is obtainable using one or more oligonucleotide probes or primers designed to hybridise with one or more fragments of the nucleic acid sequence shown in any of the figures, particularly fragments of relatively rare sequence, based on codon usage or statistical analysis. A primer designed to hybridise with a fragment of the nucleic acid sequence shown in any of the figures may be used in conjunction with one or more oligonucleotides designed to hybridise to a sequence in a cloning vector within which target nucleic acid has been cloned, or in so-called “RACE” (rapid amplification of cDNA ends) in which cDNA's in a library are ligated to an oligonucleotide linker and PCR is performed using a primer which hybridises with a sequence shown and a primer which hybridises to the oligonucleotide linker.

Such oligonucleotide probes or primers, as well as the full-length sequence (and mutants, alleles, variants and derivatives) are also useful in screening a test sample containing nucleic acid for the presence of alleles, mutants and variants, with diagnostic and/or prognostic implications as discussed in more detail below.

Nucleic acid isolated and/or purified from one or more cells (e.g. human) or a nucleic acid library derived from nucleic acid isolated and/or purified from cells (e.g. a cDNA library derived from mRNA isolated from the cells), may be probed under conditions for selective hybridisation and/or subjected to a specific nucleic acid amplification reaction such as the polymerase chain reaction (PCR) (reviewed for instance in “PCR protocols; A Guide to Methods and Applications”, Eds. Innis et al, 1990, Academic Press, New York, Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed), PCR technology, Stockton Press, NY, 1989, and Ehrlich et al, Science, 252:1643-1650, (1991)). PCR comprises steps of denaturation of template nucleic acid (if double-stranded), annealing of primer to target, and polymerisation. The nucleic acid probed or used as template in the amplification reaction may be genomic DNA, cDNA or RNA. Other specific nucleic acid amplification techniques include strand displacement activation, the QB replicase system, the repair chain reaction, the ligase chain reaction and ligation activated transcription. For convenience, and because it is generally preferred, the term PCR is used herein in contexts where other nucleic acid amplification techniques may be applied by those skilled in the art. Unless the context requires otherwise, reference to PCR should be taken to cover use of any suitable nucleic amplification reaction available in the art.

In the context of cloning, it may be necessary for one or more gene fragments to be ligated to generate a full-length coding sequence. Also, where a full-length encoding nucleic acid molecule has not been obtained, a smaller molecule representing part of the full molecule, may be used to obtain full-length clones. Inserts may be prepared from partial cDNA clones and used to screen cDNA libraries. The full-length clones isolated may be subcloned into expression vectors and activity assayed by transfection into suitable host cells, e.g. with a reporter plasmid.

A method may include hybridisation of one or more (e.g. two) probes or primers to target nucleic acid. Where the nucleic acid is double-stranded DNA, hybridisation will generally be preceded by denaturation to produce single-stranded DNA. The hybridisation may be as part of a PCR procedure, or as part of a probing procedure not involving PCR. An example procedure would be a combination of PCR and low stringency hybridisation. A screening procedure, chosen from the many available to those skilled in the art, is used to identify successful hybridisation events and isolated hybridised nucleic acid.

Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art. For instance, probes may be radioactively, fluorescently or enzymatically labelled. Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR, RN'ase cleavage and allele specific oligonucleotide probing. Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined. DNA for probing may be prepared from RNA preparations from cells.

Preliminary experiments may be performed by hybridising under low stringency conditions various probes to Southern blots of DNA digested with restriction enzymes. Suitable conditions would be achieved when a large number of hybridising fragments were obtained while the background hybridisation was low. Using these conditions nucleic acid libraries, e.g. cDNA libraries representative of expressed sequences, may be searched. Those skilled in the art are well able to employ suitable conditions of the desired stringency for selective hybridisation, taking into account factors such as oligonucleotide length and base composition, temperature and so on. On the basis of amino acid sequence information, oligonucleotide probes or primers may be designed, taking into account the degeneracy of the genetic code, and, where appropriate, codon usage of the organism from the candidate nucleic acid is derived. An oligonucleotide for use in nucleic acid amplification may have about 10 or fewer codons (e.g. 6, 7 or 8), i.e. be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length, but need not be than 18-20. Those skilled in the art are well versed in the design of primers for use processes such as PCR. Various techniques for synthesizing oligonucleotide primers are well known in the art, including phosphotriester and phosphodiester synthesis methods.

Preferred amino acid sequences suitable for use in the design of probes or PCR primers may include sequences conserved (completely, substantially or partly) encoding the motifs present in LRP5 (FIG. 5(d) (SEQ ID NO:3)).

A further aspect of the present invention provides an oligonucleotide or polynucleotide fragment of the nucleotide sequence shown in any of the figures herein providing nucleic acid according to the present invention, or a complementary sequence, in particular for use in a method of obtaining and/or screening nucleic acid. Some preferred oligonucleotides have a sequence shown in Table 2 (SEQ ID NOS:49-54), Table 4 (SEQ ID NOS:83-317), Table 7 (SEQ ID NOS:, Table 8 (SEQ ID NOS:318-333) or Table 9 (SEQ ID NOS:49-74, 334-402), or a sequence which differs from any of the sequences shown by addition, substitution, insertion or deletion of one or more nucleotides, but preferably without abolition of ability to hybridise selectively with nucleic acid in accordance with the present invention, that is wherein the degree of similarity of the oligonucleotide or polynucleotide with one of the sequences given is sufficiently high.

In some preferred embodiments, oligonucleotides according to the present invention that are fragments of any of the sequences shown, or any allele associated with IDDM or other disease susceptibility, are at least about 10 nucleotides in length, more preferably at least about 15 nucleotides in length, more preferably at least about 20 nucleotides in length. Such fragments themselves individually represent aspects of the present invention. Fragments and other oligonucleotides may be used as primers or probes as discussed but may also be generated (e.g. by PCR) in methods concerned with determining the presence in a test sample of a sequence indicative of IDDM or other disease susceptibility.

Methods involving use of nucleic acid in diagnostic and/or prognostic contexts, for instance in determining susceptibility to IDDM or other disease, and other methods concerned with determining the presence of sequences indicative of IDDM or other disease susceptibility are discussed below.

Further embodiments of oligonucleotides according to the present invention are anti-sense oligonucleotide sequences based on the nucleic acid sequences described herein. Anti-sense oligonucleotides may be designed to hybridise to the complementary sequence of nucleic acid, pre-mRNA or mature mRNA, interfering with the production of polypeptide encoded by a given DNA sequence (e.g. either native polypeptide or a mutant form thereof), so that its expression is reduce or prevented altogether. Anti-sense techniques may be used to target a coding sequence, a control sequence of a gene, e.g. in the 5′ flanking sequence, whereby the antisense oligonucleotides can interfere with control sequences. Anti-sense oligonucleotides may be DNA or RNA and may be of around 14-23 nucleotides, particularly around 15-18 nucleotides, in length. The construction of antisense sequences and their use is described in Peyman and Ulman, Chemical Reviews, 90:543-584, (1990), and Crooke, Ann. Rev. Pharmacol. Toxicol., 32:329-376, (1992).

Nucleic acid according to the present invention may be used in methods of gene therapy, for instance in treatment of individuals with the aim of preventing or curing (wholly or partially) IDDM or other disease. This may ease one or more symptoms of the disease. This is discussed below.

Nucleic acid according to the present invention, such as a full-length coding sequence or oligonucleotide probe or primer, may be provided as part of a kit, e.g. in a suitable container such as a vial in which the contents are protected from the external environment. The kit may include instructions for use of the nucleic acid, e.g. in PCR and/or a method for determining the presence of nucleic acid of interest in a test sample. A kit wherein the nucleic acid is intended for use in PCR may include one or more other reagents required for the reaction, such as polymerase, nucleosides, buffer solution etc. The nucleic acid may be labelled. A kit for use in determining the presence or absence of nucleic acid of interest may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal cavity or a syringe for removing a blood sample (such components generally being sterile).

According to a further aspect, the present invention provides a nucleic acid molecule including a LRP5 gene promoter.

In another aspect, the present invention provides a nucleic acid molecule including a promoter, the promoter including the sequence of nucleotides shown in FIG. 12(e) (SEQ ID NO:30) or FIG. 15(b) (SEQ ID NO:34). The promoter may comprise one or more fragments of the sequence shown in FIG. 12(e) (SEQ ID NO:30) or FIG. 15(b) (SEQ ID NO:34), sufficient to promote gene expression. The promoter may comprise or consist essentially of a sequence of nucleotides 5′ to the LRP5 gene in the human chromosome, or an equivalent sequence in another species, such as the mouse.

Any of the sequences disclosed in the figures herein may be used to construct a probe for use in identification and isolation of a promoter from a genomic library containing a genomic LRP5 gene. Techniques and conditions for such probing are well known in the art and are discussed elsewhere herein. To find minimal elements or motifs responsible for tissue and/or developmental regulation, restriction enzyme or nucleases may be used to digest a nucleic acid molecule, followed by an appropriate assay (for example using a reporter gene such as luciferase) to determine the sequence required. A preferred embodiment of the present invention provides a nucleic acid isolate with the minimal nucleotide sequence shown in FIG. 12(e) (SEQ ID NO:30) or FIG. 15(b) (SEQ ID NO:34) required for promoter activity.

As noted, the promoter may comprise one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression. Other regulatory sequences may be included, for instance as identified by mutation or digest assay in an appropriate expression system or by sequence comparison with available information, e.g. using a computer to search on-line databases.

By “promoter” is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3′ direction on the sense strand of double-stranded DNA).

“Operably linked” means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is “under transcriptional initiation regulation” of the promoter.

The present invention extends to a promoter which has a nucleotide sequence which is allele, mutant, variant or derivative, by way of nucleotide addition, insertion, substitution or deletion of a promoter sequence as provided herein. Preferred levels of sequence homology with a provided sequence may be analogous to those set out above for encoding nucleic acid and polypeptides according to the present invention. Systematic or random mutagenesis of nucleic acid to make an alteration to the nucleotide sequence may be performed using any technique known to those skilled in the art. One or more alterations to a promoter sequence according to the present invention may increase or decrease promoter activity, or increase or decrease the magnitude of the effect of a substance able to modulate the promoter activity.

“Promoter activity” is used to refer to ability to initiate transcription. The level of promoter activity is quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter. The amount of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridise with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction. Use of a reporter gene facilitates determination of promoter activity by reference to protein production.

Further provided by the present invention is a nucleic acid construct comprising a LRP5 promoter region or a fragment, mutant, allele, derivative or variant thereof able to promoter transcription, operably linked to a heterologous gene, e.g. a coding sequence. A “heterologous” or “exogenous” gene is generally not a modified form of LRP5. Generally, the gene may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression. A gene whose encoded product may be assayed following expression is termed a “reportergene”, i.e. a gene which “reports” on promoter activity.

The reporter gene preferably encodes an enzyme which catalyses a reaction which produces a detectable signal, preferably a visually detectable signal, such as a coloured product. Many examples are known, including β-galactosidase and luciferase. β-galactosidase activity may be assayed by production of blue colour on substrate, the assay being by eye or by use of a spectro-photometer to measure absorbance. Fluorescence, for example that produced as a result of luciferase activity, may be quantitated using a spectrophotometer. Radioactive assays may be used, for instance using chloramphenicol acetyltransferase, which may also be used in non-radioactive assays. The presence and/or amount of gene product resulting from expression from the reporter gene may be determined using a molecule able to bind the product, such as an antibody or fragment thereof. The binding molecule may be labelled directly or indirectly using any standard technique.

Those skilled in the art are well aware of a multitude of possible reporter genes and assay techniques which may be used to determine gene activity. Any suitable reporter/assay may be used and it should be appreciated that no particular choice is essential to or a limitation of the present invention.

Nucleic acid constructs comprising a promoter (as disclosed herein) and a heterologous gene (reporter) may be employed in screening for a substance able to modulate activity of the promoter. For therapeutic purposes, e.g. for treatment of IDDM or other disease, a substance able to up-regulate expression of the promoter may be sought. A method of screening for ability of a substance to modulate activity of a promoter may comprise contacting an expression system, such as a host cell, containing a nucleic acid construct as herein disclosed with a test or candidate substance and determining expression of the heterologous gene.

The level of expression in the presence of the test substance may be compared with the level of expression in the absence of the test substance. A difference in expression in the presence of the test substance indicates ability of the substance to modulate gene expression. An increase in expression of the heterologous gene compared with expression of another gene not linked to a promoter as disclosed herein indicates specificity of the substance for modulation of the promoter.

A promoter construct may be introduced into a cell line using any technique previously described to produce a stable cell line containing the reporter construct integrated into the genome. The cells may be grown and incubated with test compounds for varying times. The cells may be grown in 96 well plates to facilitate the analysis of large numbers of compounds. The cells may then be washed and the reporter gene expression analysed. For some reporters, such as luciferase the cells will be lysed then analysed.

Following identification of a substance which modulates or affects promoter activity, the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.

Thus, the present invention extends in various aspects not only to a substance identified using a nucleic acid molecule as a modulator of promoter activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for increasing LRP5 expression for instance in treatment (which may include preventative treatment) of IDDM or other disease, use of such a substance in manufacture of a composition for administration, e.g. for increasing LRP5 expression for instance in treatment of IDDM or other disease, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.

A further aspect of the present invention provides a polypeptide which has the amino acid sequence shown in FIG. 5(c) (SEQ ID NO:3), which may be in isolated and/or purified form, free or substantially free of material with which it is naturally associated, such as other polypeptides or such as human polypeptides other than that for which the amino acid sequence is shown in FIG. 5(c) (SEQ ID NO:3), or (for example if produced by expression in a prokaryotic cell) lacking in native glycosylation, e.g. unglycosylated. Further polypeptides according to the present invention have an amino acid sequence selected from that shown in the polypeptide shown in FIG. 11(c) (SEQ ID NO:25), that shown in 12(d), and the partial polypeptide shown in FIG. 16(d) (SEQ ID NO:8).

Polypeptides which are amino acid sequence variants, alleles, derivatives or mutants are also provided by the present invention. A polypeptide which is a variant, allele, derivative or mutant may have an amino acid sequence which differs from that given in a figure herein by one or more of addition, substitution, deletion and insertion of one or more amino acids. Preferred such polypeptides have LRP5 function, that is to say have one or more of the following properties: immunological cross-reactivity with an antibody reactive the polypeptide for which the sequence is given in a figure herein; sharing an epitope with the polypeptide for which the amino acid sequence is shown in a figure herein (as determined for example by immunological cross-reactivity between the two polypeptides; a biological activity which is inhibited by an antibody raised against the polypeptide whose sequence is shown in a figure herein; ability to reduce serum triglyceride; ability to reduce serum cholesterol; ability to interact with and/or reduce serum levels of very low-density lipoprotein particles; ability to affect serum alkaline phosphatase levels. Alteration of sequence may change the nature and/or level of activity and/or stability of the LRP5 protein.

A polypeptide which is an amino acid sequence variant, allele, derivative or mutant of the amino acid sequence shown in a figure herein may comprise an amino acid sequence which shares greater than about 35%. sequence identity with the sequence shown, greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90% or greater than about 95%. The sequence may share greater than about 60% similarity, greater than about 70% similarity, greater than about 80% similarity or greater than about 90% similarity with the amino acid sequence shown in the relevant figure. Amino acid similarity is generally defined with reference to the algorithm GAP (Genetics Computer Group, Madison, Wis.) as noted above, or the TBLASTN program, of Altschul et al. (1990) J. Mol. Biol. 215: 403-10. Similarity allows for “conservative variation”, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine. Particular amino acid sequence variants may differ from that shown in a figure herein by insertion, addition, substitution or deletion of 1 amino acid, 2, 3, 4, 5-10, 10-20 20-30, 30-50, 50-100, 100-150, or more than 150 amino acids.

Sequence comparison may be made over the full-length of the relevant sequence shown herein, or may more preferably be over a contiguous sequence of about or greater than about 20, 25, 30, 33, 40, 50, 67, 133, 167, 200, 233, 267, 300, 333, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, or more amino acids or nucleotide triplets, compared with the relevant amino acid sequence or nucleotide sequence as the case may be.

The present invention also includes active portions, fragments, derivatives and functional mimetics of the polypeptides of the invention. An “active portion” of a polypeptide means a peptide which is less than said full length polypeptide, but which retains a biological activity, such as a biological activity selected from binding to ligand, involvement in endocytosis. Thus an active portion of the LRP5 polypeptide may, in one embodiment, include the transmembrane domain and the portion of the cytoplasmic tail involved in endocytosis. Such an active fragment may be included as part of a fusion protein, e.g. including a binding portion for a different ligand. In different embodiments, combinations of LDL and EGF motifs may be included in a molecule to confer on the molecule different binding specificities.

A “fragment” of a polypeptide generally means a stretch of amino acid residues of at least about five contiguous amino acids, often at least about seven contiguous amino acids, typically at least about nine contiguous amino acids, more preferably at least about 13 contiguous amino acids, and, more preferably, at least about 20 to 30 or more contiguous amino acids. Fragments of the LRP5 polypeptide sequence may include antigenic determinants or epitopes useful for raising antibodies to a portion of the amino acid sequence. Alanine scans are commonly used to find and refine peptide motifs within polypeptides, this involving the systematic replacement of each residue in turn with the amino acid alanine, followed by an assessment of biological activity.

Preferred fragments of LRP5 include those with any of the following amino acid sequences:

SYFHLFPPPPSPCTDSS (SEQ ID NOS:403)
VDGRQNIKRAKDDGT (SEQ ID NOS:404)
EVLFTTGLIRPVALVVDN (SEQ ID NOS:405)
IQGHLDFVMDILVFHS, (SEQ ID NOS:406)

which may be used for instance in raising or isolating antibodies. Variant and derivative peptides, peptides which have an amino acid sequence which differs from one of these sequences by way of addition, insertion, deletion or substitution of one or more amino acids are also provided by the present invention, generally with the proviso that the variant or derivative peptide is bound by an antibody or other specific binding member which binds one of the peptides whose sequence is shown. A peptide which is a variant or derivative of one of the shown peptides may compete with the shown peptide for binding to a specific binding member, such as an antibody or antigen-binding fragment thereof.

A “derivative” of a polypeptide or a fragment thereof may include a polypeptide modified by varying the amino acid sequence of the protein, e.g. by manipulation of the nucleic acid encoding the protein or by altering the protein itself. Such derivatives of the natural amino acid sequence may involve one or more of insertion, addition, deletion or substitution of one or more amino acids, which may be without fundamentally altering the qualitative nature of biological activity of the wild type polypeptide. Also encompassed within the scope of the present invention are functional mimetics of active fragments of the LRP5 polypeptides provided (including alleles, mutants, derivatives and variants). The term “functional mimetic” means a substance which may not contain an active portion of the relevant amino acid sequence, and probably is not a peptide at all, but which retains in qualitative terms biological activity of natural LRP5 polypeptide. The design and screening of candidate mimetics is described in detail below.

Sequences of amino acid sequence variants representative of preferred embodiments of the present invention are shown in Table 5 and Table 6. Screening for the presence of one or more of these in a test sample has a diagnostic and/or prognostic use, for instance in determining IDDM or other disease susceptibility, as discussed below.

Other fragments of the polypeptides for which sequence information is provided herein are provided as aspects of the present invention, for instance corresponding to functional domains. One such functional domain is the putative extracellular domain, such that a polypeptide fragment according to the present invention may include the extracellular domain of the polypeptide of which the amino acid sequence is shown in FIG. 5(e) (SEQ ID NO:4) or FIG. 5(c) (SEQ ID NO:3). This runs to amino acid 1385 of the precursor sequence of FIG. 5(c) (SEQ ID NO:3). Another useful LRP5 domain is the cytoplasmic domain, 207 amino acids shown in FIG. 5(d) (SEQ ID NO:3). This may be used in targeting proteins to move through the endocytotic pathway.

A polypeptide according to the present invention may be isolated and/or purified (e.g. using an antibody) for instance after production by expression from encoding nucleic acid (for which see below). Thus, a polypeptide may be provided free or substantially free from contaminants with which it is naturally associated (if it is a naturally-occurring polypeptide). A polypeptide may be provided free or substantially free of other polypeptides. Polypeptides according to the present invention may be generated wholly or partly by chemical synthesis. The isolated and/or purified polypeptide may be used in formulation of a composition, which may include at least one additional component, for example a pharmaceutical composition including a pharmaceutically acceptable excipient, vehicle or carrier. A composition including a polypeptide according to the invention may be used in prophylactic and/or therapeutic treatment as discussed below.

A polypeptide, peptide fragment, allele, mutant, derivative or variant according to the present invention may be used as an immunogen or otherwise in obtaining specific antibodies. Antibodies are useful in purification and other manipulation of polypeptides and peptides, diagnostic screening and therapeutic contexts. This is discussed further below.

A polypeptide according to the present invention may be used in screening for molecules which affect or modulate its activity or function, e.g. binding to ligand, involvement in endocytosis, movement from an intracellular compartment to the cell surface, movement from the cell surface to an intracellular compartment. Such molecules may interact with the ligand binding portion of LRP5, the cytoplasmic portion of LRP5, or with one or more accessory molecules e.g. involved in movement of vesicles containing LRP5 to and from the cell surface, and may be useful in a therapeutic (possibly including prophylactic) context.

It is well known that pharmaceutical research leading to the identification of a new drug may involve the screening of very large numbers of candidate substances, both before and even after a lead compound has been found. This is one factor which makes pharmaceutical research very expensive and time-consuming. Means for assisting in the screening process can have considerable commercial importance and utility. Such means for screening for substances potentially useful in treating or preventing IDDM or other disease is provided by polypeptides according to the present invention. Substances identified as modulators of the polypeptide represent an advance in the fight against IDDM and other diseases since they provide basis for design and investigation of therapeutics for in vivo use. Furthermore, they may be useful in any of a number of conditions, including autoimmune diseases, such as glomerulonephritis, diseases and disorders involving disruption of endocytosis and/or antigen presentation, diseases and disorders involving cytokine clearance and/or inflammation, viral infection, pathogenic bacterial toxin contamination, elevation of free fatty acids or hypercholesterolemia, type 2 diabetes, osteoporosis, and Alzheimer's disease, given the functional indications for LRP5, discussed elsewhere herein. As noted elsewhere, LRP5, fragments thereof, and nucleic acid according to the invention may also be useful in combatting any of these diseases and disorders.

A method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with the polypeptide in a suitable reaction medium, testing the activity of the treated polypeptide and comparing that activity with the activity of the polypeptide in comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.

Combinatorial library technology (Schultz, J S (1996) Biotechnol. Prog. 12:729-743) provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide. Prior to or as well as being screened for modulation of activity, test substances may be screened for ability to interact with the polypeptide, e.g. in a yeast two-hybrid system (which requires that both the polypeptide and the test substance can be expressed in yeast from encoding nucleic acid). This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide.

Following identification of a substance which modulates or affects polypeptide activity, the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.

Thus, the present invention extends in various aspects not only to a substance identified as a modulator of polypeptide activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. for treatment (which may include preventative treatment) of IDDM or other disease, use of such a substance in manufacture of a composition for administration, e.g. for treatment of IDDM or other disease, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.

A substance identified using as a modulator of polypeptide or promoter function may be peptide or non-peptide in nature. Non-peptide “small molecules” are often preferred for many in vivo pharmaceutical uses. Accordingly, a mimetic or mimick of the substance (particularly if a peptide) may be designed for pharmaceutical use. The designing of mimetics to a known pharmaceutically active compound is a known approach to the development of pharmaceuticals based on a “lead” compound. This might be desirable where the active compound is difficult or expensive to synthesise or where it is unsuitable for a particular method of administration, e.g. peptides are not well suited as active agents for oral compositions as they tend to be quickly degraded by proteases in the alimentary canal. Mimetic design, synthesis and testing may be used to avoid randomly screening large number of molecules for a target property.

There are several steps commonly taken in the design of a mimetic from a compound having a given target property. Firstly, the particular parts of the compound that are critical and/or important in determining the target property are determined. In the case of a peptide, this can be done by systematically varying the amino acid residues in the peptide, e.g. by substituting each residue in turn. These parts or residues constituting the active region of the compound are known as its “pharmacophore”.

Once the pharmacophore has been found, its structure is modelled to according its physical properties, e.g. stereochemistry, bonding, size and/or charge, using data from a range of sources, e.g. spectroscopic techniques, X-ray diffraction data and NMR. Computational analysis, similarity mapping (which models the charge and/or volume of a pharmacophore, rather than the bonding between atoms) and other techniques can be used in this modelling process.

In a variant of this approach, the three-dimensional structure of the ligand and its binding partner are modelled. This can be especially useful where the ligand and/or binding partner change conformation on binding, allowing the model to take account of this the design of the mimetic.

A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be grafted. The template molecule and the chemical groups grafted on to it can conveniently be selected so that the mimetic is easy to synthesise, is likely to be pharmacologically acceptable, and does not degrade in vivo, while retaining the biological activity of the lead compound. The mimetic or mimetics found by this approach can then be screened to see whether they have the target property, or to what extent they exhibit it. Further optimisation or modification can then be carried out to arrive at one or more final mimetics for in vivo or clinical testing.

Mimetics of substances identified as having ability to modulate LRP5 polypeptide or promoter activity using a screening method as disclosed herein are included within the scope of the present invention. A polypeptide, peptide or substance able to modulate activity of a polypeptide according to the present invention may be provided in a kit, e.g. sealed in a suitable container which protects its contents from the external environment. Such a kit may include instructions for use.

A convenient way of producing a polypeptide according to the present invention is to express nucleic acid encoding it, by use of the nucleic acid in an expression system. Accordingly, the present invention also encompasses a method of making a polypeptide (as disclosed), the method including expression from nucleic acid encoding the polypeptide (generally nucleic acid according to the invention). This may conveniently be achieved by growing a host cell in culture, containing such a vector, under appropriate conditions which cause or allow expression of the polypeptide. Polypeptides may also be expressed in in vitro systems, such as reticulocyte lysate.

Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. Suitable host cells include bacteria, eukaryotic cells such as mammalian and yeast, and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells, COS cells and many others. A common, preferred bacterial host is E. coli. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors may be plasmids, viral e.g. 'phage, or phagemid, as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 1992.

Thus, a further aspect of the present invention provides a host cell containing nucleic acid as disclosed herein. The nucleic acid of the invention may be integrated into the genome (e.g. chromosome) of the host cell. Integration may be promoted by inclusion of sequences which promote recombination with the genome, in accordance with standard techniques. The nucleic acid may be on an extra-chromosomal vector within the cell.

A still further aspect provides a method which includes introducing the nucleic acid into a host cell. The introduction, which may (particularly for in vitro introduction) be generally referred to without limitation as “transformation”, may employ any available technique. For eukaryotic cells, suitable techniques may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus. For bacterial cells, suitable techniques may include calcium chloride transformation, electroporation and transfection using bacteriophage.

Marker genes such as antibiotic resistance or sensitivity genes may be used in identifying clones containing nucleic acid of interest, as is well known in the art.

The introduction may be followed by causing or allowing expression from the nucleic acid, e.g. by culturing host cells (which may include cells actually transformed although more likely the cells will be descendants of the transformed cells) under conditions for expression of the gene, so that the encoded polypeptide is produced. If the polypeptide is expressed coupled to an appropriate signal leader peptide it may be secreted from the cell into the culture medium. Following production by expression, a polypeptide may be isolated and/or purified from the host cell and/or culture medium, as the case may be, and subsequently used as desired, e.g. in the formulation of a composition which may include one or more additional components, such as a pharmaceutical composition which includes one or more pharmaceutically acceptable excipients, vehicles or carriers (e.g. see below).

Introduction of nucleic acid may take place in vivo by ay of gene therapy, as discussed below. A host cell containing nucleic acid according to the present invention, e.g. as a result of introduction of the nucleic acid into the cell or into an ancestor of the cell and/or genetic alteration of the sequence endogenous to the cell or ancestor (which introduction or alteration may take place in vivo or ex vivo), may be comprised (e.g. in the soma) within an organism which is an animal, particularly a mammal, which may be human or non-human, such as rabbit, guinea pig, rat, mouse or other rodent, cat, dog, pig, sheep, goat, cattle or horse, or which is a bird, such as a chicken. Genetically modified or transgenic animals or birds comprising such a cell are also provided as further aspects of the present invention.

Thus, in various further aspects, the present invention provides a non-human animal with a human LRP5 transgene within its genome. The transgene may have the sequence of any of the isoforms identified herein or a mutant, derivative, allele or variant thereof as disclosed. In one preferred embodiment, the heterologous human LRP5 sequence replaces the endogenous animal sequence. In other preferred embodiments, one or more copies of the human LRP5 sequence are added to the animal genome.

Preferably the animal is a rodent, and most preferably mouse or rat.

This may have a therapeutic aim. (Gene therapy is discussed below.) The presence of a mutant, allele or variant sequence within cells of an organism, particularly when in place of a homologous endogenous sequence, may allow the organism to be used as a model in testing and/or studying the role of the LRP5 gene or substances which modulate activity of the encoded polypeptide and/or promoter in vitro or are otherwise indicated to be of therapeutic potential.

An animal model for LRP5 deficiency may be constructed using standard techniques for introducing mutations into an animal germ-line. In one example of this approach, using a mouse, a vector carrying an insertional mutation within the LRP5 gene may be transfected into embryonic stem cells. A selectable marker, for example an antibiotic resistance gene such as neoR, may be included to facilitate selection of clones in which the mutant gene has replaced the endogenous wild type homologue. Such clones may be also be identified or further investigated by Southern blot hybridisation. The clones may then be expanded and cells injected into mouse blastocyst stage embryos. Mice in which the injected cells have contributed to the development of the mouse may be identified by Southern blotting. These chimeric mice may then be bred to produce mice which carry one copy of the mutation in the germ line. These heterozygous mutant animals may then be bred to produce mice carrying mutations in the gene homozygously. The mice having a heterozygous mutation in the LRP5 gene may be a suitable model for human individuals having one copy of the gene mutated in the germ line who are at risk of developing IDDM or other disease.

Animal models may also be useful for any of the various diseases discussed elsewhere herein.

Instead of or as well as being used for the production of a polypeptide encoded by a transgene, host cells may be used as a nucleic acid factory to replicate the nucleic acid of interest in order to generate large amounts of it. Multiple copies of nucleic acid of interest may be made within a cell when coupled to an amplifiable gene such as dihyrofolate reductase (DHFR), as is well known. Host cells transformed with nucleic acid of interest, or which are descended from host cells into which nucleic acid was introduced, may be cultured under suitable conditions, e.g. in a fermentor, taken from the culture and subjected to processing to purifiy the nucleic acid. Following purification, the nucleic acid or one or more fragments thereof may be used as desired, for instance in a diagnostic or prognostic assay as discussed elsewhere herein.

The provision of the novel LRP-5 polypeptide isoforms and mutants, alleles, variants and derivatives enables for the first time the production of antibodies able to bind these molecules specifically.

Accordingly, a further aspect of the present invention provides an antibody able to bind specifically to the polypeptide whose sequence is given in a figure herein. Such an antibody may be specific in the sense of being able to distinguish between the polypeptide it is able to bind and other human polypeptides for which it has no or substantially no binding affinity (e.g. a binding affinity of about 1000× less). Specific antibodies bind an epitope on the molecule which is either not present or is not accessible on other molecules. Antibodies according to the present invention may be specific for the wild-type polypeptide. Antibodies according to the invention may be specific for a particular mutant, variant, allele or derivative polypeptide as between that molecule and the wild-type polypeptide, so as to be useful in diagnostic and prognostic methods as discussed below. Antibodies are also useful in purifying the polypeptide or polypeptides to which they bind, e.g. following production by recombinant expression from encoding nucleic acid.

Preferred antibodies according to the invention are isolated, in the sense of being free from contaminants such as antibodies able to bind other polypeptides and/or free of serum components. Monoclonal antibodies are preferred for some purposes, though polyclonal antibodies are within the scope of the present invention.

Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al., 1992, Nature 357: 80-82). Isolation of antibodies and/or antibody-producing cells from an animal may be accompanied by a step of sacrificing the animal.

As an alternative or supplement to immunising a mammal with a peptide, an antibody specific for a protein may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulin binding domains on their surfaces; for instance see WO92/01047. The library may be naive, that is constructed from sequences obtained from an organism which has not been immunised with any of the proteins (or fragments), or may be one constructed using sequences obtained from an organism which has been exposed to the antigen of interest.

Suitable peptides for use in immunising an animal and/or isolating anti-LRP5 antibody include any of the following amino acid sequences:

SYFHLFPPPPSPCTDSS (SEQ ID NOS:403)
VDGRQNIKRAKDDGT (SEQ ID NOS:404)
EVLFTTGLIRPVALVVDN (SEQ ID NOS:405)
IQGHLDFVMDILVFHS. (SEQ ID NOS:406)

Antibodies according to the present invention may be modified in a number of ways. Indeed the term “antibody” should be construed as covering any binding substance having a binding domain with the required specificity. Thus the invention covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including synthetic molecules and molecules whose shape mimicks that of an antibody enabling it to bind an antigen or epitope.

Example antibody fragments, capable of binding an antigen or other binding partner are the Fab fragment consisting of the VL, VH, Cl and CH1 domains; the Fd fragment consisting of the VH and CH1 domains; the Fv fragment consisting of the VL and VH domains of a single arm of an antibody; the dAb fragment which consists of a VH domain; isolated CDR regions and F(ab′)2 fragments, a bivalent fragment including two Fab fragments linked by a disulphide bridge at the hinge region. Single chain Fv fragments are also included.

A hybridoma producing a monoclonal antibody according to the present invention may be subject to genetic mutation or other changes. It will further be understood by those skilled in the art that a monoclonal antibody can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulin variable region, or the complementarity determining regions (CDRs), of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulin. See, for instance, EP184187A, GB 2188638A or EP-A-0239400. Cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023.

Hybridomas capable of producing antibody with desired binding characteristics are within the scope of the present invention, as are host cells, eukaryotic or prokaryotic, containing nucleic acid encoding antibodies (including antibody fragments) and capable of their expression. The invention also provides methods of production of the antibodies including growing a cell capable of producing the antibody under conditions in which the antibody is produced, and preferably secreted.

The reactivities of antibodies on a sample may be determined by any appropriate means. Tagging with individual reporter molecules is one possibility. The reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals. The linkage of reporter molecules may be directly or indirectly, covalently, e.g. via a peptide bond or non-covalently. Linkage via a peptide bond may be as a result of recombinant expression of a gene fusion encoding antibody and reporter molecule.

One favoured mode is by covalent linkage of each antibody with an individual fluorochrome, phosphor or laser dye with spectrally isolated absorption or emission characteristics. Suitable fluorochromes include fluorescein, rhodamine, phycoerythrin and Texas Red. Suitable chromogenic dyes include diaminobenzidine.

Other reporters include macromolecular colloidal particles or particulate material such as latex beads that are coloured, magnetic or paramagnetic, and biologically or chemically active agents that can directly or indirectly cause detectable signals to be visually observed, electronically detected or otherwise recorded. These molecules may be enzymes which catalyse reactions that develop or change colours or cause changes in electrical properties, for example. They may be molecularly excitable, such that electronic transitions between energy states result in characteristic spectral absorptions or emissions. They may include chemical entities used in conjunction with biosensors. Biotin/avidin or biotin/streptavidin and alkaline phosphatase detection systems may be employed.

The mode of determining binding is not a feature of the present invention and those skilled in the art are able to choose a suitable mode according to their preference and general knowledge. Particular embodiments of antibodies according to the present invention include antibodies able to bind and/or which bind specifically, e.g. with an affinity of at least 10−7 M, to one of the following peptides:

SYFHLFPPPPSPCTDSS (SEQ ID NOS:403)
VDGRQNIKRAKDDGT (SEQ ID NOS:404)
EVLFTTGLIRPVALVVDN (SEQ ID NOS:405)
IQGHLDFVMDILVFHS. (SEQ ID NOS:406)

Antibodies according to the present invention may be used in screening for the presence of a polypeptide, for example in a test sample containing cells or cell lysate as discussed, and may be used in purifying and/or isolating a polypeptide according to the present invention, for instance following production of the polypeptide by expression from encoding nucleic acid therefor. Antibodies may modulate the activity of the polypeptide to which they bind and so, if that polypeptide has a deleterious effect in an individual, may be useful in a therapeutic context (which may include prophylaxis).

An antibody may be provided in a kit, which may include instructions for use of the antibody, e.g. in determining the presence of a particular substance in a test sample. One or more other reagents may be included, such as labelling molecules, buffer solutions, elutants and so on. Reagents may be provided within containers which protect them from the external environment, such as a sealed vial.

The identification of the LRP5 gene and indications of its association with IDDM and other diseases paves the way for aspects of the present invention to provide the use of materials and methods, such as are disclosed and discussed above, for establishing the presence or absence in a test sample of an variant form of the gene, in particular an allele or variant specifically associated with IDDM or other disease. This may be for diagnosing a predisposition of an individual to IDDM or other disease. It may be for diagnosing IDDM of a patient with the disease as being associated with the IDDM4 gene.

This allows for planning of appropriate therapeutic and/or prophylactic treatment, permitting stream-lining of treatment by targeting those most likely to benefit.

A variant form of the gene may contain one or more insertions, deletions, substitutions and/or additions of one or more nucleotides compared with the wild-type sequence (such as shown in Table 5 or Table 6) which may or may not disrupt the gene function. Differences at the nucleic acid level are not necessarily reflected by a difference in the amino acid sequence of the encoded polypeptide. However, a mutation or other difference in a gene may result in a frame-shift or stop codon, which could seriously affect the nature of the polypeptide produced (if any), or a point mutation or gross mutational change to the encoded polypeptide, including insertion, deletion, substitution and/or addition of one or more amino acids or regions in the polypeptide. A mutation in a promoter sequence or other regulatory region may prevent or reduce expression from the gene or affect the processing or stability of the mRNA transcript. For instance, a sequence alteration may affect alternative splicing of mRNA. As discussed, various LRP5 isoforms resulting from alternative splicing are provided by the present invention.

There are various methods for determining the presence or absence in a test sample of a particular nucleic acid sequence, such as the sequence shown in any figure herein, or a mutant, variant or allele thereof, e.g. including an alteration shown in Table 5 or Table 6.

Tests may be carried out on preparations containing genomic DNA, cDNA and/or mRNA. Testing cDNA or mRNA has the advantage of the complexity of the nucleic acid being reduced by the absence of intron sequences, but the possible disadvantage of extra time and effort being required in making the preparations. RNA is more difficult to manipulate than DNA because of the wide-spread occurrence of RN'ases. Nucleic acid in a test sample may be sequenced and the sequence compared with the sequence shown in any of the figures herein, to determine whether or not a difference is present. If so, the difference can be compared with known susceptibility alleles (e.g. as shown in Table 5 or Table 6) to determine whether the test nucleic acid contains one or more of the variations indicated, or the difference can be investigated for association with IDDM or other disease.

Since it will not generally be time- or labour-efficient to sequence all nucleic acid in a test sample or even the whole LRP5 gene, a specific amplification reaction such as PCR using one or more pairs of primers may be employed to amplify the region of interest in the nucleic acid, for instance the LRP5 gene or a particular region in which polymorphisms associated with IDDM or other disease susceptibility occur. The amplified nucleic acid may then be sequenced as above, and/or tested in any other way to determine the presence or absence of a particular feature. Nucleic acid for testing may be prepared from nucleic acid removed from cells or in a library using a variety of other techniques such as restriction enzyme digest and electrophoresis.

Nucleic acid may be screened using a variant- or allele-specific probe. Such a probe corresponds in sequence to a region of the LRP5 gene, or its complement, containing a sequence alteration known to be associated with IDDM or other disease susceptibility. Under suitably stringent conditions, specific hybridisation of such a probe to test nucleic acid is indicative of the presence of the sequence alteration in the test nucleic acid. For efficient screening purposes, more than one probe may be used on the same test sample.

Allele- or variant-specific oligonucleotides may similarly be used in PCR to specifically amplify particular sequences if present in a test sample. Assessment of whether a PCR band contains a gene variant may be carried out in a number of ways familiar to those skilled in the art. The PCR product may for instance be treated in a way that enables one to display the polymorphism on a denaturing polyacrylamide DNA sequencing gel, with specific bands that are linked to the gene variants being selected.

SSCP heteroduplex analysis may be used for screening DNA fragments for sequence variants/mutations. It generally involves amplifying radiolabelled 100-300 bp fragments of the gene, diluting these products and denaturing at 95° C. The fragments are quick-cooled on ice so that the DNA remains in single stranded form. These single stranded fragments are run through acrylamide based gels. Differences in the sequence composition will cause the single stranded molecules to adopt difference conformations in this gel matrix making their mobility different from wild type fragments, thus allowing detecting of mutations in the fragments being analysed relative to a control fragment upon exposure of the gel to X-ray film. Fragments with altered mobility/conformations may be directly excised from the gel and directly sequenced for mutation.

Sequencing of a PCR product may involve precipitation with isopropanol, resuspension and sequencing using a TaqFS+ Dye terminator sequencing kit. Extension products may be electrophoresed on an ABI 377 DNA sequencer and data analysed using Sequence Navigator software.

A further possible screening approach employs a PTT assay in which fragments are amplified with primers that contain the consensus Kozak initiation sequences and a T7 RNA polymerase promoter. These extra sequences are incorporated into the 5′ primer such that they are in frame with the native coding sequence of the fragment being analysed. These PCR products are introduced into a coupled transcription/translation system. This reaction allows the production of RNA from the fragment and translation of this RNA into a protein fragment. PCR products from controls make a protein product of a wild type size relative to the size of the fragment being analysed. If the PCR product analysed has a frame-shift or nonsense mutation, the assay will yield a truncated protein product relative to controls. The size of the truncated product is related to the position of the mutation, and the relative region of the gene from this patient may be sequenced to identify the truncating mutation.

An alternative or supplement to looking for the presence of variant sequences in a test sample is to look for the presence of the normal sequence, e.g. using a suitably specific oligonucleotide probe or primer. Use of oligonucleotide probes and primers has been discussed in more detail above.

Allele- or variant-specific oligonucleotide probes or primers according to embodiments of the present invention may be selected from those shown in Table 4 (SEQ ID NOS:83-317), Table 7 (SEQ ID NOS:240-317) or Table 8 (SEQ ID NOS:318-333).

Approaches which rely on hybridisation between a probe and test nucleic acid and subsequent detection of a mismatch may be employed. Under appropriate conditions (temperature, pH etc.), an oligonucleotide probe will hybridise with a sequence which is not entirely complementary. The degree of base-pairing between the two molecules will be sufficient for them to anneal despite a mis-match. Various approaches are well known in the art for detecting the presence of a mis-match between two annealing nucleic acid molecules.

For instance, RN'ase A cleaves at the site of a mis-match. Cleavage can be detected by electrophoresing test nucleic acid to which the relevant probe or probe has annealed and looking for smaller molecules (i.e. molecules with higher electrophoretic mobility) than the full length probe/test hybrid.

Thus, an oligonucleotide probe that has the sequence of a region of the normal LRP5 gene (either sense or anti-sense strand) in which mutations associated with IDDM or other disease susceptibility are known to occur (e.g. see Table 5 and Table 6) may be annealed to test nucleic acid and the presence or absence of a mis-match determined. Detection of the presence of a mis-match may indicate the presence in the test nucleic acid of a mutation associated with IDDM or other disease susceptibility. On the other hand, an oligonucleotide probe that has the sequence of a region of the gene including a mutation associated with IDDM or other disease susceptibility may be annealed to test nucleic acid and the presence or absence of a mis-match determined. The presence of a mis-match may indicate that the nucleic acid in the test sample has the normal sequence (the absence of a mis-match indicating that the test nucleic acid has the mutation). In either case, a battery of probes to different regions of the gene may be employed.

The presence of differences in sequence of nucleic acid molecules may be detected by means of restriction enzyme digestion, such as in a method of DNA fingerprinting where the restriction pattern produced when one or more restriction enzymes are used to cut a sample of nucleic acid is compared with the pattern obtained when a sample containing the normal gene shown in a figure herein or a variant or allele, e.g. as containing an alteration shown in Table 5 or Table 6 is digested with the same enzyme or enzymes.

The presence or absence of a lesion in a promoter or other regulatory sequence may also be assessed by determining the level of mRNA production by transcription or the level of polypeptide production by translation from the mRNA. Determination of promoter activity has been discussed above.

A test sample of nucleic acid may be provided for example by extracting nucleic acid from cells or biological tissues or fluids, urine, saliva, faeces, a buccal swab, biopsy or preferably blood, or for pre-natal testing from the amnion, placenta or foetus itself.

There are various methods for determining the presence or absence in a test sample of a particular polypeptide, such as the polypeptide with the amino acid sequence shown in any figure herein or an amino acid sequence mutant, variant or allele thereof.

A sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies), specific for one or more particular variants of the polypeptide shown in a figure herein. A sample may be tested for the presence of a binding partner for a specific binding member such as an antibody (or mixture of antibodies), specific for the polypeptide shown in a figure herein. In such cases, the sample may be tested by being contacted with a specific binding member such as an antibody under appropriate conditions for specific binding, before binding is determined, for instance using a reporter system as discussed. Where a panel of antibodies is used, different reporting labels may be employed for each antibody so that binding of each can be determined.

A specific binding member such as an antibody may be used to isolate and/or purify its binding partner polypeptide from a test sample, to allow for sequence and/or biochemical analysis of the polypeptide to determine whether it has the sequence and/or properties of the polypeptide whose sequence is disclosed herein, or if it is a mutant or variant form. Amino acid sequence is routine in the art using automated sequencing machines.

A test sample containing one or more polypeptides may be provided for example as a crude or partially purified cell or cell lysate preparation, e.g. using tissues or cells, such as from saliva, faeces, or preferably blood, or for pre-natal testing from the amnion, placenta or foetus itself.

Whether it is a polypeptide, antibody, peptide, nucleic acid molecule, small molecule or other pharmaceutically useful compound according to the present invention that is to be given to an individual, administration is preferably in a “prophylactically effective amount” or a “therapeutically effective amount” (as the case may be, although prophylaxis may be considered therapy), this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practioners and other medical doctors.

A composition may be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.

Pharmaceutical compositions according to the present invention, and for use in accordance with the present invention, may include, in addition to active ingredient, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material will depend on the route of administration, which may be oral, or by injection, e.g. cutaneous, subcutaneous or intravenous.

Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

For intravenous, cutaneous or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, or Lactated Ringer's Injection. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.

Targeting therapies may be used to deliver the active agent more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Targeting may be desirable for a variety of reasons; for example if the agent is unacceptably toxic, or if it would otherwise require too high a dosage, or if it would not otherwise be able to enter the target cells.

Instead of administering an agent directly, it may be be produced in target cells by expression from an encoding gene introduced into the cells, e.g. in a viral vector (see below). The vector may be targeted to the specific cells to be treated, or it may contain regulatory elements which are switched on more or less selectively by the target cells. Viral vectors may be targeted using specific binding molecules, such as a sugar, glycolipid or protein such as an antibody or binding fragment thereof. Nucleic acid may be targeted by means of linkage to a protein ligand (such as an antibody or binding fragment thereof) via polylysine, with the ligand being specific for a receptor present on the surface of the target cells.

An agent may be administered in a precursor form, for conversion to an active form by an activating agent produced in, or targeted to, the cells to be treated. This type of approach is sometimes known as ADEPT or VDEPT; the former involving targeting the activating agent to the cells by conjugation to a cell-specific antibody, while the latter involves producing the activating agent, e.g. an enzyme, in a vector by expression from encoding DNA in a viral vector (see for example, EP-A-415731 and WO 90/07936).

Nucleic acid according to the present invention, e.g. encoding the authentic biologically active LRP-5 polypeptide or a functional fragment thereof, may be used in a method of gene therapy, to treat a patient who is unable to synthesize the active polypeptide or unable to synthesize it at the normal level, thereby providing the effect provided by the wild-type with the aim of treating and/or preventing one or more symptoms of IDDM and/or one or more other diseases.

Vectors such as viral vectors have been used to introduce genes into a wide variety of different target cells. Typically the vectors are exposed to the target cells so that transfection can take place in a sufficient proportion of the cells to provide a useful therapeutic or prophylactic effect from the expression of the desired polypeptide. The transfected nucleic acid may be permanently incorporated into the genome of each of the targeted cells, providing long lasting effect, or alternatively the treatment may have to be repeated periodically.

A variety of vectors, both viral vectors and plasmid vectors, are known in the art, see e.g. U.S. Pat. No. 5,252,479 and WO 93/07282. In particular, a number of viruses have been used as gene transfer vectors, including adenovirus, papovaviruses, such as SV40, vaccinia virus, herpesviruses, including HSV and EBV, and retroviruses, including gibbon ape leukaemia virus, Rous Sarcoma Virus, Venezualian equine enchephalitis virus, Moloney murine leukaemia virus and murine mammary tumourvirus. Many gene therapy protocols in the prior art have used disabled murine retroviruses.

Disabled virus vectors are produced in helper cell lines in which genes required for production of infectious viral particles are expressed. Helper cell lines are generally missing a sequence which is recognised by the mechanism which packages the viral genome and produce virions which contain no nucleic acid. A viral vector which contains an intact packaging signal along with the gene or other sequence to be delivered (e.g. encoding the LRP5 polypeptide or a fragment thereof) is packaged in the helper cells into infectious virion particles, which may then be used for the gene delivery.

Other known methods of introducing nucleic acid into cells include electroporation, calcium phosphate co-precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer. Liposomes can encapsulate RNA, DNA and virions for delivery to cells. Depending on factors such as pH, ionic strength and divalent cations being present, the composition of liposomes may be tailored for targeting of particular cells or tissues. Liposomes include phospholipids and may include lipids and steroids and the composition of each such component may be altered. Targeting of liposomes may also be achieved using a specific binding pair member such as an antibody or binding fragment thereof, a sugar or a glycolipid.

The aim of gene therapy using nucleic acid encoding the polypeptide, or an active portion thereof, is to increase the amount of the expression product of the nucleic acid in cells in which the level of the wild-type polypeptide is absent or present only at reduced levels. Such treatment may be therapeutic or prophylactic, particularly in the treatment of individuals known through screening or testing to have an IDDM4 susceptibility allele and hence a predisposition to the disease.

Similar techiques may be used for anti-sense regulation of gene expression, e.g. targeting an antisense nucleic acid molecule to cells in which a mutant form of the gene is expressed, the aim being to reduce production of the mutant gene product. Other approaches to specific down-regulation of genes are well known, including the use of ribozymes designed to cleave specific nucleic acid sequences. Ribozymes are nuceic acid molecules, actually RNA, which specifically cleave single-stranded RNA, such as mRNA, at defined sequences, and their specificity can be engineered. Hammerhead ribozymes may be preferred because they recognise base sequences of about 11-18 bases in length, and so have greater specificity than ribozymes of the Tetrahymena type which recognise sequences of about 4 bases in length, though the latter type of ribozymes are useful in certain circumstances. References on the use of ribozymes include Marschall, et al. Cellular and Molecular Neurobiology, 1994. 14(5): 523; Hasselhoff, Nature 334: 585 (1988) and Cech, J. Amer. Med. Assn., 260: 3030 (1988).

Aspects of the present invention will now be illustrated with reference to the accompanying figures described already above and experimental exemplification, by way of example and not limitation. Further aspects and embodiments will be apparent to those of ordinary skill in the art. All documents mentioned in this specification are hereby incorporated herein by reference.

EXAMPLE 1 Cloning of LRP5

As noted above, confirmation of linkage to two of the 18 potential loci for IDDM predisposition was achieved by analysis of two family sets (102 UK families and 84 USA families), IDDM4 on chromosome 11q13 (MLS 1.3, P=0.01 at FGF3) and IDDM5 on chromosome 6q (MLS 1.8 P=0.003 at ESR). At IDDM4 the most significant linkage was obtained in the subset of families sharing 1 or 0 alleles IBD at HLA (MLS=2.8; P=0.0002; ls=1.2) (Davies et al, 1994). This linkage was also observed by Hashimoto et al (1994) using 251 affected sibpairs, obtaining P=0.0008 in all sibpairs. Combining these results, with 596 families, provides substantial support for IDDM4 (P=1.5×10−6) (Todd and Farrall, 1996; Luo et al, 1996).

Multipoint analysis with other markers in the FGF3 region produced an MLS of 2.3 at FGF3 and D11S1883 (ls=1.19), and delineated the interval to a 27cM region, flanked by the markers D11S903 and D11S527 (FIG. 1).

Multipoint linkage analysis cannot localise the gene to a small region unless several thousand multiplex families are available. Instead, association mapping has been used for rare single gene diseases which can narrow the interval containing the disease gene to less than 2cM or 2M bases. Nevertheless, this method is highly unpredictable and has not previously been used to locate a polygene for a common disease. Association mapping has been used to locate the IDDM2/INS polygene but this relied on the selection of a functional candidate polymorphism/gene and was restricted to a very small (<30kb) region. Linkage disequilibrium (LD) or association studies were carried out in order to delineate the IDDM4 region to less than 2cM. In theory, association of a particular allele very close to the founder mutation will be detected in populations descended from that founder. The transmission disequilibrium test (TDT, Spielman et al, 1993) measures association by assessing the deviation from 50% of the transmission of alleles from a marker locus from parents to affected children. The detection of association is dependent on the ancestry of each population studied to be as homogeneous as possible, in order to reduce the possiblity that the presence of several founder-chromosomes, decreasing the power to detect the association. These parameters are highly unpredictable.

Analysis of markers spanning the IDDM4 linkage interval, LD was detected at D11S1917(UT5620) in 554 families, P=0.01. A physical map of this region, comprising approximately 500 kb, was achieved by constructing a pac, bac and cosmid contig (FIG. 2). The region was physically mapped by hybridisation of markers onto restriction-enzyme digested clones resolved through agarose, and Southern blotted.

Further microsatellites (both published, and those isolated from the clones by microsatellite rescue) were analysed within 1289 families, from four different populations (UK, USA, Sardinia and Norway). A LD graph was constructed, with a peak at H0570POLYA, P=0.001, flanked by the markers D11S987 and 18018AC (FIG. 3). The LD detected at a polymorphic marker is influenced by allele frequency, and whether the mutation causing susceptibility to type 1 diabetes arose on a chromosome where the allele in LD is the same allele as that on protective or neutral chromosomes. In the case where the marker being analysed has the same allele in LD with both susceptible and protective genotypes, these will remain undetected by single point analysis, in effect cancelling each other out, and showing little or no evidence for LD with the disease locus. Unpredictability of the method arising from this has been noted already above.

In order to maximise the information obtained with each marker, a three point rolling LD curve was produced with the IDDM4 markers (FIG. 4). In this case the percentage transmission (% T) was calculated from a marker, and its two immediate flanking markers, and averaged between them to minimise the effects of fluctuating allele frequency. This also produced a peak at H0570POLYA, with P=0.04, and indicates that the IDDM4 mutation is more likely to be in the interval E0864CA-D11S1337 (75 kb).

By the identification of this 75 kb interval which shows association with type 1 diabetes, disease associated haplotypes were identified. These are derived from the original founder chromosomes on which the diabetes mutation or mutations IDDM4 arose. In order to identify the mutation causing susceptibility to type 1 diabetes, a refined linkage disequilibrium curve, based on single nucleotide polymorphisms (SNPS) and haplotypes, is constructed. SNPs are identified by sequencing individuals with specific haplotypes which have been identified from the microsatellite analysis: homozygous susceptible to type 1 diabetes, homozygous protective for type 1 diabetes, and controls. One of these SNPs may be the etiological mutation IDDM4, or may be in very strong linkage disequilibrium with the primary disease locus, and hence be at a peak of the refined curve. Cross-match analysis further reduces the number of candidate SNPs, as shown by the localisation of the IDDM2 mutation by this method (Bennett et al, 1995; Bennett and Todd, 1996). This requires identification of distinct haplotypes or founder chromosomes, which have a different arrangement of alleles from the main susceptible or protective haplotypes, so that association or transmission of candidate SNP alleles can be tested in different haplotype backgrounds. The candidate mutations can be assessed for effects on gene function or regulation.

In different populations different IDDM4 mutations may have arisen in the same gene. We are sequencing several putative founder chromosome or disease associated haplotypes from several unrelated individuals from different populations to identify candidate mutations for IDDM4, and which cluster in the same gene.

To carry out an extensive search for DNA mutations or polymorphisms, the entire region and flanking regions of the associated region was sequenced (the 75 kb core region and 125 kb of flanking DNA). The DNA sequence also aids in gene identification and is complementary to other methods of gene identification such as cDNA selection or gene identification by DNA sequencing and comparative analysis of homologous mouse genomic DNA.

Various strategies were used in the hope of identifying potential coding sequences within this region: sequencing, computer prediction of putative exons and promoters, and cDNA selection, to try to increase the likelihood of identifying all the genes within this interval.

Construction of Libraries for Shotgun Sequencing

DNA was prepared from either cosmids, BACs (Bacterial Artificial Chromosomes), or PACs (P1 Artificial Chromosomes). Cells containing the vector were streaked on Luria-Bertani (LB) agar plates supplemented with the appropriate antibiotic. A single colony was used to inoculate 200 ml of LB media supplemented with the appropriate antibiotic and grown overnight at 37° C. The cells were pelleted by centrifugation and plasmid DNA was prepared by following the QIAGEN (Chatsworth, Calif.) Tip500 Maxi plasmid/cosmid purification protocol with the following modifications; the cells from 100 ml of culture were used for each Tip500 column, the NaCl concentration of the elution buffer was increased from 1.25M to 1.7M, and the elution buffer was heated to 65° C.

Purified BAC and PAC DNA was digested with Not I restriction endonuclease and then subjected to pulse field gel electrophoresis using a BioRad CHEF Mapper system. (Richmond, Calif.). The digested DNA was electrophoresed overnight in a 1% low melting temperature agarose (BioRad, Richmond Calif.) gel that was prepared with 0.5×Tris Borate EDTA (10×stock solution, Fisher, Pittsburg, Pa.). The CHEF Mapper autoalgorithm default settings were used for switching times and voltages. Following electrophoresis the gel was stained with ethidium bromide (Sigma, St. Louis, Mo.) and visualized with a ultraviolet transilluminator. The insert band(s) was excised from the gel. The DNA was eluted from the gel slice by beta-Agarase (New England Biolabs, Beverly Mass.) digestion according to the manufacturer's instructions. The solution containing the DNA and digested agarose was brought to 50 mM Tris pH 8.0, 15 mM MgCl2, and 25% glycerol in a volume of 2 ml and placed in a AERO-MIST nebulizer (CIS-US, Bedford Mass.). The nebulizer was attatched to a nitrogen gas source and the DNA was randomly sheared at 10 psi for 30 sec. The sheared DNA was ethanol precipitated and resuspended in TE (10 mM Tris, 1 mM EDTA). The ends were made blunt by treatment with Mung Bean Nuclease (Promega, Madison, Wis.) at 30° C. for 30 min, followed by phenol/chloroform extraction, and treatment with T4 DNA polymerase (GIBCO/BRL, Gaithersburg, Md.) in multicore buffer (Promega, Madison, Wis.) in the presence of 40 uM dNTPs at 16° C. To facilitate subcloning of the DNA fragments, BstX I adapters (Invitrogen, Carlsbad, Calif.) were ligated to the fragments at 14° C. overnight with T4 DNA ligase (Promega, Madison Wis.). Adapters and DNA fragments less than 500 bp were removed by column chromatography using a cDNA sizing column (GIBCO/BRL, Gaithersburg, Md.) according to the instructions provided by the manufacturer. Fractions containing DNA greater than 1 kb were pooled and concentrated by ethanol precipitation. The DNA fragments containing BstX I adapters were ligated into the BstX I sites of PSHOT II which was constructed by subcloning the BstX I sites from pcDNA II (Invitrogen, Carlsbad, Calif.) into the BssH II sites of pBlueScript (Stratagene, La Jolla, Calif.). PSHOT II was prepared by digestion with BstX I restriction endonuclease and purified by agarose gel electrophoresis. The gel purified vector DNA was extracted from the agarose by following the Prep-A-Gene (BioRad, Richmond, Calif.) protocol. To reduce ligation of the vector to itself, the digested vector was treated with calf intestinal phosphatase (GIBCO/BRL, Gaithersburg, Md.). Ligation reactions of the DNA fragments with the cloning vector were transformed into ultra-competent XL-2 Blue cells (Stratagene, La Jolla, Calif.), and plated on LB agar plates supplemented with 100 ug/ml ampicillin. Individual colonies ere picked into a 96 well plate containing 100 ul/well of LB broth supplemented with ampicillin and grown overnight at 37° C. Approximately 25 ul of 80% sterile glycerol was added to each well and the cultures stored at −80° C.

Preparation of Plasmiid DNA

Glycerol stocks were used to inoculate 5 ml of LB broth supplemented with 100 ug/ml ampicillin either manually or by using a Tecan Genesis RSP 150 robot (Tecan AG, Hombrechtikon, Switzerland) programmed to inoculate 96 tubes containing 5 ml broth from the 96 wells. The cultures were grown overnight at 37° C. with shaking to provide aeration. Bacterial cells were pelleted by centrifugation, the supernatant decanted, and the cell pellet stored at −20° C. Plasmid DNA was prepared with a QIAGEN Bio Robot 9600 (QIAGEN, Chatsworth Calif.) according to the Qiawell Ultra protocol. To test the frequency and size of inserts plasmid DNA was digested with the restriction endonuclease Pvu II. The size of the restriction endonuclease products was examined by agarose gel electrophoresis with the average insert size being 1 to 2 kb.

DNA Sequence Analysis of Shotgun Clones

DNA sequence analysis was performed using the ABI PRISM™ dye terminator cycle sequencing ready reaction kit with AmpliTaq DNA polymerase, FS (Perkin Elmer, Norwalk, Conn.). DNA sequence analysis was performed with M13 forward and reverse primers. Following amplification in a Perkin-Elmer 9600 the extension products were purified and analyzed on an ABI PRISM 377 automated sequencer (Perkin Elmer, Norwalk, Conn.). Approximately 12 to 15 sequencing reactions were performed per kb of DNA to be examined e.g. 1500 reactions would be performed for a PAC insert of 100 kb.

Assembly of DNA Sequences

Phred/Phrap was used for DNA sequences assembly. This program was developed by Dr. Phil Green and licensed from the University of Washington (Seattle, Wash.). Phred/Phrap consists of the following programs: Phred for base-calling, Phrap for sequence assembly, Crossmatch for sequence comparisons, Consed and Phrapview for visualization of data, and Repeatmasker for screening repetitive sequences. Vector and E. coli DNA sequences were identified by Crossmatch and removed from the DNA sequence assembly process. DNA sequence assembly was on a SUN Enterprise 4000 server running Solaris 2.51 operating system (Sun Microsystems Inc., Mountain View, Calif.) using default Phrap parameters. The sequence assemblies were further analyzed using Consed and Phrapview.

BioInformatic Analysis of Assembled DNA Sequences

When the assembled DNA sequences approached five to six fold coverage of the region of interest the exon and promoter prediction abilities of the program GRAIL (ApoCom, Oak Ridge) were utilized to aid in gene identification. ApoCom GRAIL is a commercial version of the Department of Energy developed GRAIL Gene Characterization Software licensed to ApoCom Inc. by Lockheed Martin Energy Research Corporation and ApoCom Client Tool for Genomics (ACTG) TM.

The DNA sequences at various stages of assembly were queried against the DNA sequences in the GenBank database (subject) using the BLAST algorithm (S.F. Altschul, et al. (1990) J. Mol. Biol. 215, 403-410), with default parameters. When examining large contiguous sequences of DNA repetitive elements were masked following identification by crossmatch with a database of mammalian repetitive elements. Following BLAST analysis the results were compiled by a parser program written by Dr. Guochun Xie (Merck Research Lab). The parser provided the following information from the database for each DNA sequence having a similarity with a P value greater than 10−6; the annotated name of the sequence, the database from which it was derived, the length and percent identity of the region of similarity, and the location of the similarity in both the query and the subject.

The BLAST analysis identified a high degree of similarities (90-100% identical) over a length of greater than 100 bp between DNA sequences we obtained and a number of human EST sequences present in the database. These human EST sequences clustered into groups that are represented by accession numbers; R73322, R50627, F07016. In general, each EST cluster is presumed to represent a single gene. The DNA sequences in R73322 cluster of 424 nucleotides had a lower but significant degree of DNA sequence similarity to the gene encoding the LDL receptor related protein (GenBank accession number X13916) and several other members of the LDL receptor family. Therefore it was concluded that the sequences that were highly similar to EST R73322 encoded a member of the LDL receptor family.

Members of each EST cluster were assembled using the program Sequencher (Perkin Elmer, Norwalk Conn.). To increase the accuracy of the EST sequence data extracted from the database relevent chromatogram trace files from the genomic DNA sequences obtained from shotgun sequencing were included in the assembly. The corrected EST sequences were reanalyzed by BLAST and BLASTX. For EST cluster 3, represented by accession number R50627 analysis of the edited EST assembly revealed that this cluster was similar to members of the LDL receptor family. This result suggested the possibility that these two EST clusters were components of the same gene.

Experimentally derived cDNA sequences were assembled using the program Sequencher (Perkin Elmer, Norwalk Conn.). Genomic DNA sequences and cDNA sequences were compared by using the program Crossmatch which allowed for a rapid and sensitive detection of the location of exons. The identification of intron/exon boundaries was then accomplished by manually comparing the genomic and cDNA sequences by using the program GeneWorks (Intelligenetics Inc., Campbell Calif.).

Northern Blot Analysis

Primers 256F and 622R ((SEQ ID NOS:51,52) Table 2) were used to amplify a PCR product of 366 bp from a fetal brain cDNA library. This product was purified on an agarose gel, the DNA extracted, and subcloned into pCR2.1 (Invitrogen, Carlsbad, Calif.). The 366 bp probe was labeled by random priming with the Amersham Rediprime kit (Arlington Heights, Ill.) in the presence of 50-100 uCi of 3000 Ci/mmole [alpha 32P]dCTP (Dupont/NEN, Boston, Mass.). Unincorporated nucleotides were removed with a ProbeQuant G-50 spin column (Pharmacia/Biotech, Piscataway, N.J.). The radiolabeled probe at a concentration of greater than 1×106 cpm/ml in rapid hybridization buffer (Clontech, Palo Alto, Calif.) was incubated overnight at 65° C. with human multiple tissue Northern's I and II (Clontech, Palo Alto, Calif.). The blots were washed by two 15 min incubations in 2×SSC, 0.1SDS (prepared from 20×SSC and 20% SDS stock solutions, Fisher, Pittsburg, Pa.) at room temperature, followed by two 15 min incubations in 1×SSC, 0.1% SDS at room temperature, and two 30 min incubations in 0.1×SSC, 0.1% SDS at 60° C. Autoradiography of the blots was done to visualize the bands that specifically hybridized to the radiolabeled probe.

The probe hybridized to an approximately 5-5.5 kb mRNA transcript that is most highly expressed in placenta, liver, pancreas, and prostate. It is expressed at an intermediate level in lung, skeletal muscle, kidney, spleen, thymus, ovary, small intestine, and colon. The message is expressed at a low level in brain, testis, and leukocytes. In tissues where the transcript is highly expressed, e.g. liver and pancreas, additional bands of 7 kb and 1.3 kb are observed.

Isolation of Full Length cDNAs

PCR based techniques were used to extend regions that were highly similar to ESTs and regions identified by exon prediction software (GRAIL). The one technique utilized is a variation on Rapid Amplification of cDNA Ends (RACE) termed Reduced Complexity cDNA Analysis (RCCA) similar procedures are reported by Munroe et. al. (1995) PNAS 92: 2209-2213 and Wilfinger et. al. (1997) BioTechniques 22: 481-486. This technique relies upon a PCR template that is a pool of approximately 20,000 cDNA clones, this reduces the complexity of the template and increases the probability of obtaining longer PCR extensions. A second technique that was used to extend cDNAs was PCR between regions that were identified in the genomic sequence of having the potential to be portions of a gene e.g. sequences that were very similar to ESTs or sequences that were identified by GRAIL. These PCR reactions were done on cDNA prepared from approximately 5 ug of mRNA (Clontech, Palo Alto, Calif.) with the SuperScript™ choice system (Gibco/BRL, Gaithersburg, Md.). The first strand cDNA synthesis was primed using 1 ug of oligo(dT)12-18 primer and 25 ng of random hexamers per reaction. Second strand cDNA synthesis was performed according to the manufacturer's instructions.

Identification of Additional Exons Related to EST Cluster 1

We scanned 96 wells of a human fetal brain plasmid library, 20,000 clones per well, by amplifying a 366 bp PCR product using primers 256F and 622R. The reaction mix consisted of 4 ul of plasmid DNA (0.2 ng/ml), 10 mM Tris-HCl pH 8.3, 50 mM KCl, 10% sucrose, 2.5 mM MgCl2, 0.1% Tetrazine, 200 mM dNTP's, 100 ng of each primer and 0.1 ul of Taq Gold (Perkin-Elmer, Norwalk, Conn.). A total reaction volume of 11 ul was incubated at 95° C. for 12 min followed by 32 cycles of 95° C. for 30 sec. 60° C., for 30 sec and 72° C. for 30 sec. Approximately 20 wells were found to contain the correct 366 bp fragment by PCR analysis. 5′ and 3′ RACE was subsequently performed on several of the positive wells containing the plasmid cDNA library using a vector specific primer and a gene specific primer. The vector specific primers, PBS 543R and PBS 873F were both used in combination with gene specific primers 117F and 518R because the orientation of the insert was not known. PCR amplification conditions consisted of 1×TaKaRa Buffer LA, 2.5 mM MgCl2, 500 mM dNTP's, 0.2 ul of TaKaRa LA Taq Polymerase (PanVera, Madison Wis.), 100 ng of each primer and 5 ul of the plasmid library at 0.2 ng/ml. In a total reaction volume of 20 ml, the thermal cycling conditions were as follows: 92° C. for 30 sec, followed by 32 cycles of 92° C. for 30 sec, 1 min at 60° C. and 10 min at 68° C. After the initial PCR amplification, a nested or semi-nested PCR reaction was performed using nested vector primers PBS 578R and PBS 838F and various gene specific primers (256F, 343F, 623R and 657R). The PCR products were separated from the unincorporated dNTP's and primers using QIAGEN, QIAquick PCR purification spin columns using standard protocols and resuspended in 30 ul of water. The amplification conditions for the nested and semi-nested PCR were the same as the initial PCR amplification except that 3 ul of the purified PCR fragment was used as template and that the cycling conditions were for only 20 cycles. Products obtained from this PCR amplification were analyzed on 1% agarose gels, excised fragments were purified using QIAGEN QIAquick spin columns and sequenced using ABI dye-terminator sequencing kits. The products were analyzed on ABI 377 sequencers according to standard protocols.

Connection of EST Clusters 1-3

As discussed above it is possible that each EST cluster represents a single gene, alternatively the EST clusters may be portions of the same gene. To distinguish between these two possiblities, primers were designed to the two other EST clusters in the region represented by EST accession numbers F07016 (cluster 2, containing 272 nucleotides) and R50627 (cluster 3, containing 1177 nucleotides). Primers from cluster 1 (117F and 499F) were paired with a primer from EST cluster 3 (4034R) in a PCR reaction. A 50 ul reaction was performed using the Takara LA Taq polymerase (Panvera, Madison, Wis.) in the reaction buffer supplied by the manufacturer with the addition of 0.32 mM dNTPs, primers, and approximately 30ng of lymph node cDNA. PCR products were amplified for 35 cycles of 94° C. for 30 sec, 60° C. for 30 sec, and 72° C. for 4 minutes. Products were electrophoresed on a 1% agarose gel and bands of 2.5 to 3 kb were excised, subcloned into pCR 2.1 (Invitrogen, Carlsbad, Calif.), and plasmid DNA was prepared for DNA sequence analysis.

The primary reaction described above generated by a primer in EST cluster 1 (638F) and EST cluster 3 (4173R) was utilized as the template for a reaction with a primer from EST cluster 1 (638F) and from EST cluster 2 (3556R). This semi-nested PCR reaction was performed with Takara LA Taq polymerase as described in the previous paragraph. An approximately 2 kb product was generated and subcloned for DNA sequence analysis. The assembly of the DNA sequence results of these PCR products indicated that EST clusters 1 to 3 were part of the same gene and established their orientation relative to each other in the mRNA transcript produced by this gene.

PCR reactions were also performed between EST clusters 2 and 3. Amplification from liver cDNA using Takara LA Taq polymerase (Panvera, Madison, Wis.) with the primers 2519F, 3011F, or 3154F (EST cluster 2) in combination with 5061R (EST cluster 3) was done for 35 cyles of 95° C. for 30 sec, 60° C. for 60 sec, and 72° C. for 3 minutes. The PCR products were gel purified, subcloned, and the DNA sequence was determined. The DNA sequence analysis of the ends of all these PCR products resulted in most of the cDNA sequence however to provide for complete DNA sequence of both strands oligonucleotide primers were designed and used for DNA sequencing (FIG. 5(a) (SEQ ID NO: 1)).

Extension of the 5′ End

RCCA analysis was utilized to obtain a number of clones extended 5′ by using the internal gene specific primers as described previously. Several clonal extensions were isolated however most of the clones analyzed stopped within exon A. One clone extended past the 5′ end of exon A but the sequence was contiguous with genomic DNA, since a body of evidence indicates an intron/exon boundary at the 5′ end of exon A it appeared likely that this extension is a result of unprocessed intronic sequence. A second clone h10 extended past this point but diverged from the genomic DNA sequence. It was concluded that this represented a chimeric clone that was present in the original fetal brain cDNA library.

Identification of 5′ end of Isoform 1

As described above results from RCCA experiments yielded a number of independent clones that terminated at the 5′ end of exon A. This suggested that the human LRP5 gene contains a region that the reverse transcriptase has difficulty transcribing. To circumvent this problem we decided to isolate the mouse ortholog of LRP5, since subtle differences in DNA sequence content can alter the ability of an enzyme to transcribe a region. To increase the probability of isolating the 5′ portion of the mouse gene a human probe of 366 nucleotides, described above and derived from exons A and B was used.

A cDNA library was constructed from mouse liver mRNA purchased from Clontech (Palo Alto, Calif.). cDNA was prepared using the SuperScript Choice system (Gibco/BRL Gaithersburg, Md.) according to the manufacturer's instructions. Phosphorylated Bst XI adapters (Invitrogen, San Diego, Calif.) were ligated to approximately 2 ug of mouse liver cDNA. The ligation mix was diluted and size-fractionated on a cDNA sizing column (Gibco/BRL Gaithersburg, Md.). Drops from the column were collected and the eluted volume from the column determined as described for the construction of shotgun libraries. The size-fractionated cDNA with the Bst XI linkers was ligated into the vector pSHOT II, described above, cut with the restriction endonuclease Bst XI, gel purified, and dephosphorylated with calf intestinal phosphatase (Gibco/BRL, Gaithersburg, Md.). The ligation containing approximately 10-20 ng of cDNA and approximately 100 ng of vector was incubated overnight at 14° C. The ligation was transformed into XL-2 Blue Ultracompetent cells (Stratagene, La Jolla, Calif.). The transformed cells were spread on twenty 133 mm Colony/Plaque Screen filters (Dupont/NEN, Boston, Mass.) at a density of approximately 30,000 colonies per plate on Luria Broth agar plates supplemented with 100 ug/ml ampicillin (Sigma, St. Louis, Mo.). The colonies were grown overnight and then replica plated onto two duplicate filters. The replica filters were grown for several hours at 37° C. until the colonies were visible and processed for in situ hybridization of colonies according to established procedures (Maniatis, Fritsch and Sambrook, 1982). A Stratalinker (Stratagene, La Jolla, Calif.) was used to crosslink the DNA to the filter. The filters were hybridized overnight with greater than 1,000,000 cpm/ml probe in 1×hybridization buffer (Gibco/BRL, Gaithersburg, Md.) containing 50%. formamide at 42° C. The probe was generated from a PCR product derived from the human LRP5 cDNA using primers 512F and 878R. This probe was random prime labeled with the Amersham Rediprime kit (Arlington Heights, IL) in the presence of 50-100 uCi of 3000 Ci/mmole [alpha 32P]dCTP (Dupont/NEN, Boston, Mass.) and purified using a ProbeQuant G-50 spin column (Pharmacia/Biotech, Piscataway, N.J.). The filters were washed with 0.1×SSC, 0.1% SDS at 42° C. Following autoradiography individual regions containing hybridization positive colonies were excised from the master filter and placed into 0.5 ml Luria Broth plus 20% glycerol. Each positive was replated at a density of approximate 50-200 colonies per 100 mm plate and screened by hybridization as described above. Single colonies were isolated and plasmid DNA was prepared for DNA sequence analysis.

Three clones were isolated from the mouse cDNA library the assembled sequence of the clones (FIG. 16(a) (SEQ ID NO:35)) that had a high degree of similarity (87% identical over an approximately 1700 nucleotide portion) with the human LRP5 gene and thus likely represent the mouse ortholog of LRP5. The 500 amino acid of the portion of the mouse LRP5 (FIG. 16(d) (SEQ ID NO:8)) that we initially obtained is 96%. identical to human LRP5. Significantly two of these clones had sequence that was 5′ of the region corresponding to exon A, clone 19a contained an additional 200 bp and clone 9a contained an additional 180 bp (FIG. 16(b) (SEQ ID NO:36)). The additional 200 bp contains an open reading frame that begins at bp 112 (FIG. 16(c) (SEQ ID NO:37)). The initiating codon has consensus nucleotides for efficient initiation of translation at both the −3 (purine) and +4 (G nucleotide) positions (Kozak, M. 1996, Mamalian Genome 7:563-574). This open reading frame encodes a peptide with the potential to act as a eukaryotic signal sequence for protein export (von Heijne, 1994, Ann. Rev. Biophys. Biomol. Struc. 23:167-192). The highest score for the signal sequence as determined by using the SigCleave program in the GCG analysis package (Genetics Computer Group, Madison Wis.) generates a mature peptide beginning at residue 29 of isoform 1. Additional sites that may be utilized produce mature peptides beginning at amino acid residue 31 (the first amino acid encoded by exon A) or amino acid residues 32, 33, or 38.

Molecular Cloning of the Full Length Mouse Lrp3 cDNA

The mouse cDNA clones isolated by nucleic acid hybridization contain 1.7 Kb of the 5′ end of the Lrp3 cDNA (FIG. 16(a) (SEQ ID NO:35)). This accounts for approximately one-third of the full length cDNA when compared to the human cDNA sequence. The remainder of the mouse Lrp3 cDNA was isolated using PCR to amplify products from mouse liver cDNA. PCR primers, Table 9 (SEQ ID NOS:49-74,334-402), were designed based upon DNA sequences identified by the sequence skimming of mouse genomic clones, BACs 53-d-8 and 131-p-15, which contain the mouse Lrp3 gene. BAC 53-d-8 was mapped by FISH analysis to mouse chromosome 19 which is syntenic with 11q13. Sequence skimming of these clones identified DNA sequences that corresponded to the coding region of human LRP5 as well as the 3′ untranslated region. This strategy resulted in the determination of a mouse cDNA sequence of 5059 nucleotides (FIG. 18(a) (SEQ ID NO:40)) which contains an open reading frame of 4842 nucleotides (FIG. 18(b) (SEQ ID NO:41)) that encodes a protein of 1614 amino acids (FIG. 18(c) (SEQ ID NO:42)). The putative ATG is in a sequence context favorable for initiation of translation (Kozak, M. 1996, Mamalian Genome 7:563-574).

Comparison of Human and Mouse LRP5

The cDNA sequences of human and mouse LRP5 display 87% identity. The open reading frame of the human LRP5 cDNA encodes a protein of 1615 amino acids (SEQ ID NO:3) that is 94% identical to the 1614 amino acid protein encoded by mouse Lrp3 (SEQ ID NOS:42) (FIG. 18(d)). The difference in length is due to a single amino acid deletion in the mouse Lrp3 signal peptide sequence. The signal peptide sequence is not highly conserved being less than 50% identical between human and mouse. The location of the putative signal sequence cleavage site is at amino acid residue 25 in the human and amino acid 29 in the mouse. Cleavage at these sites would result in mature human and mouse proteins of 1591 and 1586 amino acids, respectively, which are 95°. identical (FIG. 18(e) (SEQ ID NOS:43,44)). The high degree of overall sequence similarity argues strongly that the identified sequences are orthologs of the LRP5 gene. This hypothesis is further supported by the results of genomic Southern experiments (data not shown).

Identification of Human Signal Peptide Exon for Isoform 1

The human exon encoding a signal peptide was isolated from liver cDNA by PCR. The forward primer 1F (SEQ ID NO:51) (Table 9) was used in combination with one of the following reverse primers: 218R, 265R, 318R, and 361R (SEQ ID NOS:50,52,53,54) in a PCR reaction using Taq Gold polymerase (Perkin-Elmer, Norwalk, Conn.) and supplemented with either 3, 5, or 7% DMSO. Products were amplified for 40 cycles of 30 sec 95° C., 30 sec 58° C., and 1 min 72° C. The products were analyzed on an agarose gel and some of the reactions containing bands of the predicted size were selected for DNA sequence analysis and subcloning into pCR2.1 (Invitrogen, San Diego, Calif.).

The derived DNA sequence of 139 nucleotides upstream of exon 2 (also known as exon A) contains an ATG that is in a context for efficient initiation of translation: an adenine (A) residue at the −3 position and a guanine (G) residue at the +4 position (Kozak, M. 1996, Mamalian Genome 7:563-574). The open reading frame for this ATG continues for 4854 nucleotides (FIG. 5(b)) (SEQ ID NO:2) which encodes a polypeptide of 1615 amino acids (FIG. 5(c) (SEQ ID NO:3)).

The sequence following the initiator ATG codon encodes a peptide with the potential to act as a signal for protein export. The highest score for the signal sequence (15.3) indicated by the SigCleave program in the GCG analysis package (Genetics Computer Group, Madison Wis.) generates a mature polypeptide beginning at amino acid residue 25 (FIG. 5(d,e). Additional putative cleavage sites that may be utilized to produce a mature LRP5 protein are predicted for residues 23, 24, 26, 27, 28, 30 and 32 (the first amino acid encoded by exon A).

Determination of the Genomic DNA Sequence Containing and Flanking the Signal Peptide Exon

The region that contained genomic DNA sequence identical to the cDNA sequence encoding a signal peptide was in a gap between two stretches of contiguous genomic DNA sequence known as contigs 57 and 58. To close this gap four clones were chosen from the shotgun library that were determined to span this gap according to analysis by the program Phrapview licensed from Dr. Phil Green of the University of Washington (Seattle, Wash.). Direct DNA sequencing of these clones was unsuccessful, i.e. high GC content significantly reduced the efficiency of the cycle sequencing. To circumvent this problem PCR products were generated by incorporating 7-deaza-dGTP (Pharmacia, Pharmacia Biotech, Piscataway, N.J.). The conditions for these reactions consisted of a modification of the Klentaq Advantage-GC polymerase kit (Clontech, Palo Alto, Calif.). The standard reaction protocol was modified by supplementing the reaction mix with 200 uM 7-deaza-dGTP. Inserts were amplified with M13 forward and reverse primers for 32 cycles of 30 sec at 92° C., 1 min at 60° C., and 5 min at 68° C. Products were gel purified using Qiaquick gel extraction kit (Qiagen Inc., Santa Clarita, Calif.) and sequenced as described previously. Assembly of the resulting sequences closed the gap and generated a contiguous sequence of approximately 78,000 bp of genomic DNA.

Extension of Isoforms 2 and 3

The software package GRAIL (supra) predicts exons and promoter sequences from genomic DNA sequence. One region identified by GRAIL is an exon originally designated G1 and subsequently termed exon 1 that is approximately 55 kb upstream of the beginning of exon A (FIG. 12(c) (SEQ ID NO:28)). Three primers designated G1 1f to 3f were designed based on this sequence. This exon was of particular interest because GRAIL also predicted a promoter immediately upstream of the exonic sequence (FIG. 12 (e)). Furthermore one of the open reading frames in G1 encoded a peptide that had the characteristics of a eukaryotic signal sequence.

To determine whether the G1 predicted exon was part of the LRP5 gene, reverse transcriptase (RT) PCR was performed using the Taqara RNA PCR kit (Panvera, Madison Wis.). Human liver mRNA (50 ng) was used as the template for a 10 ul reverse transcriptase reaction. The reverse transcriptase reaction using one of the LRP5 specific primers (622R, 361R, or 318R) was incubated at 60° C. for 30 min, followed by 99° C. for 5 min, and then the sample was placed on ice. One of the forward primers, Table 2, (G1 1f, 2f, or 3f) (SEQ ID NOS:75,76,77) was added along with the reagents for PCR amplification and the reaction was amplified for 30 cycles of 30 sec at 94° C., 30 sec at 60° C., and 2 min at 72° C. This primary PCR reaction was then diluted 1:2 in water and 1 ul of the reaction was used in a second 20 ul reaction using nested primers. The reaction conditions for the second round of amplification were 30 cycles of 94° C. for 30 sec, 60° C. for 30 sec and 72° C. for 2 min. The products were separated on an agarose gel and excised. The purified fragments were subcloned into pCR 2.1 (Invitrogen, Carlsbad, Calif.), plasmid DNA was prepared, and the DNA sequence was determined.

The DNA sequence of these products indicated that G1 (exon 1) was present on at least a portion of the LRP5 transcripts. Two different isoforms were identified. The first, isoform 2 (FIG. 11(a) (SEQ ID NO:23)), identified in this experiment consists of exon 1 followed by an exon that we have given the designation exon 5. This splice variant has an open reading frame that initiates in exon B nucleotide 402 (FIG. 11(a)), the initiator methionine at this location does not conform to the consensus sequences for translation initiation (Kozak, M. (1996) Mamalian Genome 7:563-574). A second potential initiator methionine is present at nucleotide 453, this codon is in a context for efficient initiation of translation initiation (Kozak, M. (1996) Mamalian Genome 7:563-574). The longest potential open reading frame for isoform 2 (FIG. 11(c)) encodes a splice variant contains a eukaryotic signal sequence at amino acid 153. The mature peptide generated by this splice variant would be lacking the first five spacer domains and a portion of the first EGF-like motif.

The second isoform (isoform 3) consists of exon 1 followed by exon A (FIG. 12(a)). It is not known whether exon 1 is the first exon of isoform 2. However the location of a GRAIL predicted promoter upstream of G1 suggests the possibility that exon 1 is the first exon. Futhermore there is an open reading frame that extends past the 5′ intron/exon boundary postulated by GRAIL (FIG. 12(b)). Therefore we have examined the possiblity of incorporating this extended open reading frame into the LRPS transcript. The resulting open reading frame (FIG. 12(c)) encodes a 1639 amino acid protein (FIG. 12(d). The initiator methionine codon does not contain either of the consensus nucleotides that are thought to be important for efficient translation (Kozak, M. 1996, Mamalian Genome 7:563-574). Nor does the predicted protein contain a predicted eukaryotic signal sequence within the first 100 amino acids. Alternatively there may be additional exons upstream of exon 1 which provide the initiator methionine codon and/or a potential signal sequence.

RACE Extension of the 5′ End of lrp5: Isoforms 4 and 5

RACE is an established protocol for the analysis of cDNA ends. This procedure was performed using the Marathon RACE template purchased from Clontech (Palo Alto, Calif.). This was performed according to instructions using Clontech “Marathon” cDNA from fetal brain and mammary tissue. Two “nested” PCR amplifications were performed using the ELONGASE™ long-PCR enzyme mix & buffer from Gibco-BRL (Gaithersburg, Md.).

Marathon Primers

AP1: CCATCCTAATACGACTCACTATAGGGC (SEQ ID NOS:407)
AP2: ACTCACTATAGGGCTCGAGCGGC (SEQ ID NOS:408)

First round PCR used 2 microliters Marathon placenta cDNA template and 10 pmoles each of primers L217 and AP1. Thermal cycling was: 94° C. 30 sec, 68° C. 6 min, 5 cycles; 94° C. 30 sec, 64° C. 30 sec, 68° C. 4 min, 5 cycles; 94° C. 30 sec, 62° C. 30 sec, 68° C. 4 min, 30 cycles. One microliter from a 1/20 dilution of this reaction was added to a second PCR reaction as DNA template. This PCR reaction also differed from the first PCR reaction in that nested primers L120 and AP2 were used. Two products of approximately 1600 bp and 300 bp were observed and cloned into pCR2.1 (Invitrogen, Carlsbad Calif.). The DNA sequence of these clones indicated that they were generated by splicing of sequences to exon A. The larger 1.6 kb fragment (FIG. 13 (SEQ ID NO:31)) identified a region approximately 4365 nucleotides upstream of exon A and appeared to be contiguous with genomic DNA for 1555 base pairs. The sequence identified by the 300 bp fragment was approximately 5648 nucleotides upstream of exon A (FIG. 14 (SEQ ID NO:32)). This sequence had similarity to Alu repeats. The region identified by the 300 bp fragment was internal to the region identified by the 1.6 kb fragment. The open reading frame for these isoforms designated 4 and 5 is the same as described for isoform 2 (FIG. 11(b)).

Extension of Isoform 6

GRAIL (supra) analysis was used to predict potential promoter regions for the gene. Primers were designed to the isoform 6 promoter sequence (FIG. 15(b)) which was defined by GRAIL and is approximately 4 kb centromeric of exon A. This region was designated GRAIL promoter-1 (Gp-1).

The PCR primer Gp 1f (SEQ ID NO:78) (Table 2) was used in a PCR reaction with primer 574r and 599r using the polymerase Taq Gold in the reaction buffer supplied by the manufacturer (Perkin Elmer, Norwalk, Conn.). The reaction conditions were 12 min at 95° C. followed by 35 cycles of 95° C. for 30 sec, 60° C. for 30 sec, and 72° C. for 1 min 30 sec with approximately long of liver cDNA per 20 ul reaction. The primary reactions were diluted 20 fold in water and a second round of PCR using primer Gp 1f in combination with either 474r or 521r was done. Products were analyzed on a 2% agarose gel and bands of approximately 220 to 400 bp were subcloned into pCR 2.1 (Invitrogen, Carlsbad, Calif.) and analyzed by DNA sequence analysis. The open reading frame present in isoform 4 is the same as described for isoform 2 above (FIG. 11(b)).

Microsatellite Rescue

A vectorette library was made from each clone by restricting each clone and ligating on a specific bubble linker (Munroe, D. J. et al. (1994) Genomics 19, 506). PCR was carried out beween a primer (Not 1-A) specific for the linker, and a repeat motif (AC)11N, (where N is not A), at an annealing temperature of 65° C. The PCR products were gel purified and sequenced using the ABI PRISM dye terminator cycle sequencing kit as previously described. From this sequence, a primer was designed, which was used in PCR with the Not 1-A primer. This was also sequenced, and a second PCR primer designed, (Table 8 (SEQ ID NOS:318-333)) so that both primers flanked the repeat motif, and were used for genotyping.

Mutation Scanning

Single nucleotide polymorphisms (SNP's) were identified in type 1 diabetic patients using a sequencing scanning approach (Table 5).

Primers were designed to specifically amplify genomic fragments, approximately 500 to 800 bp in length, containing specific regions of interest (i.e. regions that contained LRP5 exons, previously identified SNP's or GRAIL predicted exons). To facilitate fluorescent dye primer sequencing, forward and reverse primer pairs were tailed with sequences that correspond to the M13 Universal primer (5′-TGTAAAACGACGGCCAGT-3′) (SEQ ID NO:409) and a modified M13 reverse primer (5′-GCTATGACCATGATTACGCC-3′) (SEQ ID NO:410), respectively. PCR products produced using the primer sets, mentioned above, were amplified in 50 ul reactions consisting of Perkin-Elmer 10×PCR Buffer, 200 mM dNTP's, 0.5 ul of Taq Gold (Perkin-Elmer Corp., Foster City, Calif.), 50 ng of patient DNA and 20 pmol/ml of forward and reverse primers. Cycling conditions were 95° C. for 12 min; 35 cycles of 95° C. for 30 sec, 57° C. for 30 sec and 68° C. for 2 min, followed by an extension of 72° C. for 6 min and a 4° C. hold.

Conditions were optimized so that only single DNA fragments were produced by these reaction. The PCR products were then purified for sequencing using QiaQuick strips or QiaQuick 96 well plates on the Qiagen robot (Qiagen Inc., Santa Clarita, Calif.). This purification step removes the unincorporated primers and nucleotides.

Direct BODIPY dye primer cycle sequencing was the method used to analyze the PCR products (Metzker et. al. (1996) Science 271, 1420-1422). A Tecan robot (Tecan, Research Triangle Park, N.C.) carried out the sequencing reactions using standard dye primer sequencing protocols (ABI Dye Primer Cycle Sequencing with AmpliTaq DNA Polymerase FS, Perkin-Elmer Corp., Foster City, Calif.). The reactions were generated using the following cycling conditions on a DNA Engine thermal cycler (M.J. Research Inc., Watertown, Mass.), 15 cycles of 95° C. for 4 sec, 55° C. for 10 sec, and 70° C. for 60 sec; followed by 15 cycles of 95° C. for 4 sec, and 70° C. for 60 sec. After cycling, samples were pooled, precipitated and dried down. The samples were resuspended in 3 ul of loading buffer and 2 ml were run on an ABI 377 Automated DNA sequencer.

Once SNP's have been identified, scanning technologies are employed to evaluate their informativeness as markers to assist in the determination of association of the gene with disease in the type 1 diabetic families. We are using restriction fragment length polymorphisms (RFLP's) to assess SNP's that change a restriction endonuclease site. Furthermore, we are using forced RFLP PCR (Li and Hood (1995) Genomics 26, 199-206; Haliassos et.al. (1989) Nuc. Acids Res. 17, 3608) and ARMS (Gibbs et.al. (1989) Nuc. Acids Res. 17, 2437-2448; Wu et. al. (1989) Proc. Natl. Acad. Sci. USA 86, 2757-2760) to evaluate SNP's that do not change a restriction endonuclease site. We are also trying to scan larger regions of the locus by developing fluorescent based Cleavase (CFLP) (Life Technologies, Gaithersburg, Md.) and Resolvase, (Avitech Diagnostics, Malvern, Pa.) assays.

Haplotype Analysis at IDDM4

Haplotype mapping (or identity-by-descent mapping) has been used in conjunction with association mapping to identify regions of identity-by-descent (IBD) in founder populations, where (some) of the affected individuals in a founder population share not only the mutation, but also a quite large genomic haplotype (hence identical piece of DNA) surrounding the disease locus. Recombinant haplotypes can be utilised to delineate the region containing the mutation. These methods have been used to map the genes of the recessive disorders: Wilson's disease, Batten's disease, Hirschsprung's disease and hereditary haemochromatosis (Tanzi, R., et al. (1993) Nature Genet 5, 344-350; The International Batten Disease Consortium. (1995) Cell 82, 949-957; Puffenberger, E., et al. (1994) Hum Mol Genet 3, 1217-1225; and Feder, J., et al. (1996) Nature Genet 13, 399-408). Similarly, in type 1 diabetes, for IDDM1, comparative MHC haplotype mapping between specific Caucasian and haplotypes of African origin identified both HLA-DQA1 and HLA-DQB1 as susceptibility loci for this disorder (Todd, J. et al (1989) Nature 338, 587-589; and Todd, J. et al (1987) Nature 329, 599-604).

On chromosome 11q13 haplotype analysis was undertaken in conjunction with association analysis in order to identify regions of IBD between haplotypes which are transmitted more often than expected, hence contain a susceptible allele at the aetiological locus; in contrast protective haplotypes will be transmitted less often than expected and contain a different (protective) allele at the aetiological locus. Evidence for a deviation in the expected transmission of alleles was shown with the two polymorphic markers D11S1917 and H0570POLYA. In 2042 type 1 diabetic families from the UK, USA, Norway, Sardinia, Romania, Finland, Italy and Denmark, transmission of D11S1917-H0570POLYA haplotype 3-2 to affected offspring was negative (46%), with a 2×2 test of heterogeneity between affected and unaffected transmissions produced χ2=23, df=1, p<1.5×10−6, providing good evidence that this is a protective haplotype. In contrast, the 2-3 haplotype was more transmitted to affected than non-affected offspring (% T=51.3; 2×2 contingency test; χ2=5.5, df=1, p<0.02), indicating that this was a susceptible (or possibly neutral) chromosome. A further haplotype, which is rare, has been identified which appears to be susceptible to type 1 diabetes (D11S1917-H0570POLYA, 3-3, % T affecteds=62.4, 2×2 contingency test, affecteds vs non-affecteds;chi2=6.7, df=1, p<0.009). Therefore, analysis of association in this region has produced evidence for a haplotype which contains an allele protective against type 1 diabetes, as it is significantly less transmitted to the affected offspring in comparison to the unaffected offspring, and evidence for two non-protective haplotypes, which have a neutral or susceptible effect on type 1 diabetes.

Extending this haplotype analysis to include the 14 flanking microsatellite markers 255ca5, D11S987, 255ca6, 255ca3, D11S1296, E0864CA, TAA, L3001CA, D11S1337, 14LCA5, D11S4178, D11S970, 14LCA1, 18O18, as well as the single nucleotide polymorphisms (SNPs) 58-1, Exon E (intronic, 8bp 3′ of exon 6) and Exon R (Ala1330, exon 18) (FIG. 19), revealed highly conserved haplotypes within this interval in the diabetic individuals. A distinct protective haplotype (A) has been identified (encompassing the 3-2 haplotype at D11S1917-H0570POLYA), as well as a distinct susceptible haplotype (B) (encompassing the 2-3 haplotype at D11S1917-H0570POLYA). The susceptible haplotype is IBD with the protective haplotype, 3′ of marker D11S1337, indicating that the aetiological variant playing a role in type 1 diabetes does not lie within the identical region, localising it 5′ of Exon E of the LRP-5 gene. This region that is IBD between the protective, and susceptible haplotypes prevents association analysis being undertaken, as no deviation in transmission to affected offspring would be detected. The rare susceptible haplotype (C), 3-3 at D11S1917-H0570POLYA, can also be identified. Haplotype analysis with the additional markers in the region reveals that this rare susceptible haplotype is identical to the susceptible haplotype between UT5620 and 14L15CA, potentially localising the aetiological variant between UT5620 and Exon E, which is approximately 100 kb. Therefore, the susceptible and rare susceptible haplotypes may carry an allele (or separate alleles) which confers a susceptible effect on type 1 diabetes, whereas the protective haplotype contains an allele protective against IDDM. The 5′ region of the LRP5 gene lies within this interval, encompassing the 5′ regulatory regions of the LRP5 gene and exons 1 to 6.

Analysis of the Italian and Sardinian haplotypes revealed an additional two susceptible haplotypes. At D11S1917-H0570POLYA in the Italian families haplotype 1-3, 63% T, 2×2 affected verses non-affecteds p=0.03 (haplotype D). At H0570POLYA -L3001 in the Sardinian families haplotype 1-2 58% T, 2×2 affected verses non-affecteds, p=0.05 (haplotype E).

Samples containing the above five haplotypes were genotyped with SNPs from the IDDM4 region in order to investigate regions of IBD (FIG. B). These SNPs confirmed the region of IBD between the susceptible haplotypes B and C between UT5620 and 14L15CA. It also confirmed the region of IBD between the protective and susceptible haplotypes A and B 3′ of marker D11S1337, excluding this region from containing the aetiological variant. The SNP analysis also revealed a potential region of IBD between UT5620 and TAA, between the susceptible haplotypes B, C, D and E, which is distinct from the protective haplotype A (a 25 kb region). The marker H0570POLYA lies within this interval, and is not identical in haplotype E compared to the other susceptible haplotypes; possibly this is due to mutation at this polymorphism, or it delineates a boundary within this region and the aetiological variant is either 5′ or 3′ of this marker. Further analysis of additional SNPs within this interval will be necessary.

Therefore haplotype mapping within the IDDM4 region has identified a region of IBD between the susceptible haplotypes B and C of 100 kb, in the 51 region of the LRP5 gene. SNP haplotype mapping has possibly further delineated this to a 25 kb interval encompassing the 5′ region of LRP5 which includes possible regulatory sequences for this gene; a putative promoter, and regions of homology with the mouse syntenic region (Table 12), as well as exon 1 of LRP5.

Construction of Adenovirus Vectors Containing LRP5

The full-length human LRP5 gene was cloned into the adenovirus transfer vector pdelE1sp1A-CMV-bGHPA containing the human Cytomegalovirus immediate early promoter and the bovine growth hormone polyadenylation signal to create pdehlrp3. This vector was used to construct an adenovirus containing the LRP5 gene inserted into the E1 region of the virus directed towards the 5′ ITR. In order to accommodate a cDNA of this length, the E3 region has been completely deleted from the virus as it has been described for pBHG10 (Bett at al.1994 Proc Natl Acad Sci 91: 8802-8806) An identical strategy was used to construct an adenoviral vector containing the full-length mouse Lrp5 gene.

A soluble version of mouse Lrp5 was constructed in which a His tag and a translational stop signal replaced the putative transmembrane spanning domain (primers listed in Table 9 (SEQ ID NOS:49-74,334-402)). This should result in the secretion of the extracellular domain of Lrp5 and facilitate the biochemical characterization of the putative ligand binding domain of Lrp5. Similarly a soluble version of human LRP5 can be constructed using primers shown in Table 9 (SEQ ID NOS:49-74,334-402). The extracellular domain runs to amino acid 1385 of the precursor (immature) protein sequence.

Identification of LRP5 Ligands

LRP5 demonstrates the ablility to bind and take up LDL (see below), but this activity is not a high level. Therefore, it is likely that LRP5 has the capacity to bind additional ligand(s). To identify LRP5 ligands the extracellular domain consisting of the first 1399 amino acids of human LRP5, or the corresponding region of mouse Lrp5 will be purified. A number of expression systems can be used these include plasmid based systems in Drosophila S2 cells, yeast and E. coli and viral based systems in mammalian cells and SF9 insect cells. A histidine tag will be used to purify LRP5 on a nickel column (Novagen, Madison Wis.). A variety of resins may be used in column chromatography to further enrich soluble LRP5. LRP5 will be attached to a solid support e.g. a nickel column. Solutions containing ligands from serum fractions, urine fractions, or fractions from tissue extracts will be fractionated over the LRP5 column. LRP5 complexed with bound ligand will be eluted from the nickel column with imidizole. The nature of the ligand(s) bound to LRP5 will be characterized by gel electrophoresis, amino acid sequence, amino acid composition, gas chromatography, and mass spectrophotometer.

Attachment of purified LRP5 to a BiaCore 2000 (BiaCore, Uppsula Sweden) chip will be used to determine whether ligands that bind to LRP5 are present in test solutions. Once ligands for LRP5 are identified the LRP5 chip will be used to characterize the kinetics of the LRP5 ligand interaction.

Adenoviral vectors containing soluble versions of LRP5 will be used to infect animals, isolation of ligand/LRP5 complexes from serum or liver extracts will be facilitated by the use of a histidine tag and antibodies directed against this portion of LRP5.

Treatment of Animals with LRPS Virus

A wide range of species may be treated with adenovirus vectors carrying a transgene. Mice are the preferred species for performing experiments due to the availability of a number of genetically altered strains of mice, i.e. knockout, transgenic and inbred mice. However larger animals e.g. rats or rabbits may be used when appropriate. A preferred animal model to test the ability of LRP5 to modify the development of type 1 diabetes is the non-obese diabetic (NOD) mouse. Preferred animal models for examination of a potential role for LRP5 in lipoprotein metabolism are mice in which members of the LDL-receptor family have been disrupted, e.g. the LDL-receptor (LDLR), or in which genes involved in lipoprotein metabolism, e.g. Apo-E, have been disrupted.

Adenoviruses are administered by injecting approximately 1×109 plaque forming units into the tail vein of a mouse. Based on previous studies this form of treatment results in the infection of hepatocytes at a relatively high frequency. Three different adenovirus treatments were prepared, 1.) adenovirus containing no insert (negative control), 2.) adenovirus containing human LDLR (positive control) or 3.) adenovirus containing human LRP5. Each of these viruses were used to infect five C57 wild type and five C57 LDLR knockout mice. A pretreatment bleed, 8 days prior to injection of the virus was used to examine serum chemistry values prior to treatment. The animals were injected with virus. On day five following administration of the virus a second (treatment) bleed was taken and the animals were euthanized for collection of serum for lipoprotein fractionation. In addition tissues were harvested for in situ analysis, immuno-histochemistry, and histopathology.

Throughout the experiment, animals were maintained in a standard light/dark cycle and given a regular chow diet. The animals were fasted prior to serum collection. In certain experimental conditions it may be desirable to give animals a high fat diet.

Standard clinical serum chemistry assays were performed to determine; serum triglycerides, total cholesterol, alkaline phosphatase, aspartate aminotransferase, alanine aminotransferase, urea nitrogen, and creatinine. Hematology was performed to examine the levels of circulating leukocytes, neutrophils, the percent lymphocytes, monocytes, and eosinophils, erythrocytes, platelets, hemoglobin, and percent hematocrit.

Serum lipoproteins were fractionated into size classes using a Superose 6 FPLC sizing column and minor modifications of the procedure described by Gerdes et al. (Clin. Chim. Acta 205:1-9 (1992)), the most significant difference from the Gerdes procedure being that only one column was used. Column fractions were collected and analyzed for cholesterol and triglyceride. The “area under the curve” was calculated for each lipoprotein class. The approximate peak fractions that correspond to each of the classes defined by density are: fraction 24 for VLDL, fraction 36 for LDL and fraction 51 for HDL.

LRP5 Overexpression Affects Serum Triglycerides and Lipoproteins

Statistical analysis of serum chemistry data indicated that relative to control virus there was a 300 decrease, p value=0.025, in triglyceride levels in animals treated with LRP5 containing virus (Table 10). This decrease in triglycerides occurred at a similar level in both wild type and KO mice. By comparison, the LDLR virus reduced serum triglycerides approximately 55%, relative to the contol virus. This result indicates that LRP5 has the potential to modulate serum triglyceride levels.

The serum lipoprotein profile indicated that the VLDL particle class was decreased in wild type mice treated with LRP5 virus. Although the number of samples analyzed was not sufficient for statistical analyses, this result is consistent with the observed decrease in serum triglycerides. These results suggest that LRP5 has the potential to bind and internalize lipid rich particles, causing the decrease in serum triglycerides and VLDL particles. Therefore treatment with LRP5 or with therapeutic agents that increase the expression of LRP5 or the biological activity of LRP5 may be useful in reducing lipid rich particles and triglycerides in patients with diseases that increase triglyceride levels, e.g. type 2 diabetes and obesity.

Although not statistically significant there was an observed trend towards a reduction in serum cholesterol levels as a consequence of LRP5 treatment (28%, p=0.073) in mice that have a high level of serum cholesterol (approximately 220 mg/dL), due to a disruption (knockout) of the LDL-receptor (Table 10). An opposite trend, in that LRP5 treatment elevated serum cholesterol (30%, p=0.08) was not observed in wild type mice which have a relatively low level of serum cholesterol (approximately 70 mg/dL). The small treatment groups, n=4, in these data sets limits the interpretation of these results and indicates that further experimentation is necessary. Nevertheless, these results suggest that in a state of elevated cholesterol an increase in the activity of LRP5 might reduce serum cholesterol levels. Therefore treatment with LRP5 or with therapeutic agents that increase either the expression of LRP5 or the biological activity of LRP5 may be useful in reducing cholesterol in patients with hypercholesterolemia.

LRP5 Overexpression may Affect Serum Alkaline Phosphatase Levels

Serum alkaline phosphatase levels can be dramatically elevated, e.g. 20 fold increase, as a consequence of an obstruction of the bile duct (Jaffe, M. S. and McVan, B., 1997, Davis's laboratory and diagnostic test handbook. pub. F. A. Davis Philadelphia Pa.). However, lower levels, up to a three fold increase of alkaline phosphatase can result from the inflammatory response that take place in response to an infectious agent in the liver, e.g. adenovirus. In animals treated with a control virus there was an approximately 2-fold increase in alkaline phosphatase levels. In contrast, there was only a slight increase in alkaline phophatase levels in animals treated with the LRP5 virus. Relative to the control the alkaline phosphatase level was reduced 49% in the LRP5 treated animals, p value=0.001 (Table 10).

The increase in alkaline phosphatase levels may be a consequence of the level of infection with the adenovirus, therefore, a possible explanation for the decrease in the animals treated with the LRP5 virus may simply be due to less virus in this treatment group. An indicator of the level of the viral infection is the appearance in the serum of the liver enzymes aspartate aminotransferase and alanine aminotransferase. These enzymes are normally found in the cytoplasm of cells and elevated in the serum when cellular damage occurs (Jaffe, M. S. and McVan, B., 1997, Davis's laboratory and diagnostic test handbook. pub. F. A. Davis Philadelphia Pa.). Therefore these enzymes serve as markers for the level of toxicity that is a consequence of the adenoviral infection. These enzymes are present at a normally low level prior to the infection and in animals that did not receive virus. Importantly, the levels of aspartate aminotransferase and alanine aminotransferase are higher in the animals given the LRP5 virus indicating that these animals have more cellular damage and thus a more extensive infection than the animals given the control virus (Table 11). Therefore, it is unlikely that the reduced level of alkaline phosphatase is simply owing to less LRP5 virus being administered. A second possible explanation is that LRP5 modifies the nature of the inflammatory response resulting from the adenovirus infection. A possible role for LRP5 in modulating the inflammatory response is consistent with the genetic data indicating that this gene is associated with risk for developing type 1 diabetes. Chronic insulitis or inflammation is a precursor to clinical onset of type 1 diabetes therefore LRP5 treatment or treatment with therapeutic agents that either increase the transcription of LRP5 may be of utility in preventing type 1 diabetes. Type 1 diabetes is an autoimmune disease, therefore treatment with LRP5 or with therapeutics agents that either increase the expression of LRP5 or the biological activity of LRP5 may be useful in treating other autoimmune diseases.

Expression of LRP5 in Cell Lines

Overexpression of LRP5 under the control of a heterologous promoter can be accomplished either by infection with an adenovirus containing LRP5 or by transfection with a plasmid vector containing LRP5. Transfection with a plasmid vector can lead to either transient or a stable expression of the transgene.

Endogenous LDL-receptors reduce the ability to detect the uptake of LDL by other members of the LDL-receptor family. To study lipoprotein uptake in the absence of the LDL-receptor, primary cell lines from human patients with familial hypercholesterolemia (FH) were used. These FH cell lines lack any endogenous LDL-receptor. FH fibroblasts were infected at an MOI of 500 plaque forming units per cell for 24 hours at 37° C. Following infection, cells were incubated with 40 μg/ml 125I-LDL at 37° C. After 4 hours, cells were washed and uptake of LDL measured. A modest (approximately 60%) increase in the level of LDL uptake was observed. By comparison, the infection of FH cells with an adenovirus containing the LDL-receptor resulted in a 20-fold increase in LDL uptake (p<0.0001, n=3). To determine whether this modest level of activity mediated by LRP5 was statistically significant, 24 individual wells were infected with LRP5 virus and analyzed. Statistical analysis of this experiment indicated that the increase in LDL uptake was highly signficant, p<0.0001. Therefore LRP5 can mediate LDL uptake. However, based on the modest level of activity, relative to the LDL-receptor, it does not appear that the primary activity of LRP5 is to mediate the uptake of LDL.

Additional cell lines exist that lack either the LDL-receptor or other members of the LDL-receptor family. The PEA-13 cell line (ATCC 2216-CRL) lacks the LRP1 receptor. Mutant CHO cells lacking the LDL receptor have been described by Kingsley and Krieger (Proceedings National Academy Sciences USA (1984) 81:5454). This cell line, known as ldlA7, is particularly useful for the creation of stable transfectant cell lines expressing recombinant LRP5.

Anti-LRP5 Antibodies

Western Blot Analysis

SYFHLFPPPPSPCTDSS (SEQ ID NOS:403)
VDGRQNIKRAKDDGT (SEQ ID NOS:404)
EVLFTTGLIRPVALVVDN (SEQ ID NOS:405)
IQGHLDFVMDILVFHS (SEQ ID NOS:406)

were evaluated by Western blot analysis.

COS cells were infected with an adenovirus containing human LRP5 cDNA. Three days after the infection the cells were harvested by scraping into phosphate buffered saline (Gibco/BRL Gaithersburg, Md.) containing the protease inhibitors PMSF (100 ug/ml), aprotinin (2 ug/ml), and pepstatin A (1 ug/ml). The cells were pelleted by a low speed spin, resuspended in phosphate buffered saline containing protease inhibitors and lysed by Dounce homogenization. Nuclei were removed with a low speed spin, 1000 rpm for 5 min in a Beckman J-9 rotor. The supernatant was collected and centrifuged at high speed, 100,000×g for 3 hours, to pellet the membranes. Membranes were resuspended in SDS-sample buffer (Novex, San Diego Calif.).

Membrane proteins were fractionated by electrophoresis on a 10% Tris-glycine acrylamide gel (Novex, San Diego Calif.). The fractionated proteins were transferred to PVDF paper (Novex, San Diego Calif.) according to the manufacturer's instructions. Standard Western blot analysis was performed on the membrane with the primary antibody being a 1:200 dilution of crude antisera and the secondary antibody a 1:3000 dilution of antirabbit IgG HRP conjugate (Amersham, Arlington Heights, Ill.). ECL reagents (Amersham, Arlington Heights, Ill.) were used to visualize proteins recognized by the antibodies present in the sera.

A band of approximately 170-180 kD was detected by sera from a rabbit immunized with the peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403). This band was only detected in the cells that were infected with the adenovirus containing human LRP5 and was not present in cells that were infected with a control virus. Furthermore, the detection of this 170 kD band was blocked by preadsorbing a 1:500 dilution of the sera with 0.1 ug/ml of the peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403) but not with 0.1 ug/ml of the peptide VDGRQNIKRAKDDGT (SEQ ID NOS:404). Therefore this protein band of approximately 170 kD detected by the antibody directed against the peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403) is human LRP5. The predicted size of the mature human LRP5 protein is 176 kD.

The antisera from a rabbit immunized with the peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403) was affinity purified with an Affigel 10 column (BioRad, Hercules Calif.) to which the MAP peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403) was covalently attatched. This results in antisera with greater specificity for LRP5.

The antisera from a rabbit immunized with the peptide IQGHLDFVMDILVFHS (SEQ ID NOS:406) is able to detect a band of approximately 170 kD that is present in cells infected with an LRP5 containing virus but not cells infected with a control virus. This antibody recognizes a peptide that is present in the putative extracellular domain of LRP5 and thus will be useful in detecting the soluble version of LRP5. However, there is greater background observed when using this antisera relative to that from the rabbit immunized with the peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403).

LRP5 is Expressed in Tissue Macrophages

The crude and affinity purified antisera to the LRP5 peptide SYFHLFPPPPSPCTDSS (SEQ ID NO:403) was used for immunocytochemistry studies in human liver. The antibody recognized tissue macrophages, termed Kupfer cells in the liver, that stained positive for LRP5 and positive for the marker RFD7 (Harlan Bioproducts, Indianapolis Ind.) which recognizes mature tissue phagocytes and negative for an MHC class II marker, RFD1 (Harlan Bioproducts, Indianapolis Ind.). This pattern of staining (RFD1-RFD7+) identifies a subpopulation of macrophages, the effector phagocytes. This class of macrophages has been implicated in the progression of disease in a model for autoimmune disease, experimental autoimmune neuritis (Jung. S. et al., 1993, J Neurol Sci 119: 195-202). The expression in phagocytic tissue macrophages supports a role for LRP3 in modulating the inflammatory component of the immune response. This result is consistent with the proposed role based on the differences observed in alkaline phoshatase levels in animals treated with LRP5 virus and the genetic data indicating that LRP5 is a diabetes risk gene.

Determination of Additional Conserved Regions of the LRP5 Gene

High throughput DNA sequencing of shotgun libraries prepared from mouse BAC clones 131-p-15 and 53-d-8 was used to identify regions of the LRP5 gene that are conserved between mouse and man. To identify these regions the mouse genomic DNA, either unassembled sequences or assembled contigs, was compared against an assembly of human genomic DNA. The comparison was done by using the BLAST algorithm with a cutoff of 80%. This analysis resulted in the identification of a majority of the exons of the LRP5 gene and identified a number of patches of conserved sequences at other locations in the gene (Table 12).

There are sequences conserved between human and mouse located 4.3 kb and 168 bp upstream of the putative ATG. These sequences may represent 5′ untranslated sequences of the mRNA transcript or promoter elements.

Within the putative first intron of 36 kb there are twelve patches that exhibit a degree of DNA sequence conservation. Some of these regions, e.g. 41707-41903, are quite extensive and have a high degreee of sequence conservation, similar to that observed for the exons of the LRP5 gene. Since these regions do not appear to be transcribed it is likely that these conserved regions play a role in regulating either the transcription of the LRP5 gene or the processing of the LRP5 mRNA transcript. Regardless of exact nature of their role these newly identified regions represent areas where sequence polymorphism may affect the biological activity of LRP5.

The BAC clone 131-p-15 which contains the first two exons of LRP5 was sequenced extensively, i.e. approximately 6× coverage. BAC clone 53-d-8 contains sequences from exon D to exon V, however the level of sequence coverage of this clone was only approximately 1× (skim sequencing). The skim sequencing of mouse BAC 53-d-8 resulted in 76% of the exons being detected, however in some instances only a portion of an exon was present in the mouse sequence data. In addition to the exons, there were three patches in the BAC 53-d-8 sequences that exhibited a degree of sequence conservation with the human sequences (Table 12). All of these were located in the large 20 kb intron between exons D and E. These sequences may represent regions that are important for the processing of this large intron and thus polymorphisms in these sequences may affect the expression level of LRP5.

Determination of Relative Abundance of Alternatively Spliced LRP5 MnPNA Transcripts

Several techniques may be used to determine the relative abundance of the different alternatively spliced isoforms of LRP5.

Northern blot analysis of probes derived from specific transcripts is used to survey tissues for the abundance of a particular transcript. More sensitive techniques such as RNase protection assays will be performed. Reagents from commercially available kits (Ambion, Inc. Austin Tex.) are used to prepare probes. The relative abundance of transcript that hybridizes to a probe radiolabeled with [alpha]32P-UTP is analyzed by native and denaturing acrylamide gels (Novex Inc., San Diego, Calif.). Primer extension assays are performed according to established procedures (Sambrook et. al. (1989) Molecular Cloning, Cold Spring Harbour Press, NY) using reverse primers derived from the 5′ portion of the transcript.

Isolation of Other Species Homologs of LRP5 Gene

The LRP5 gene from different species, e.g. rat, dog, are isolated by screening of a cDNA library with portions of the gene that have been obtained from cDNA of the species of interest using PCR primers designed from the human LRP5 sequence. Degenerate PCR is performed by designing primers of 17-20 nucleotides with 32-128 fold degeneracy by selecting regions that code for amino acids that have low codon degeneracy e.g. Met and Trp. When selecting these primers preference is given to regions that are conserved in the protein e.g. the motifs shown in FIG. 6b. PCR products are analyzed by DNA sequence analysis to confirm their similarity to human LRP5. The correct product is used to screen cDNA libraries by colony or plaque hybridization at high stringency. Alternatively probes derived directly from the human LRP5 gene are utilized to isolate the cDNA sequence of LRP5 from different species by hybridization at reduced stringency. A cDNA library is generated as described above.

REFERENCES

1. Bach, J.-F (1994). Endocrine. Rev. 15: 516-542.

2. Bain, S., et al. (1992). Diabetes 41: 91A.

3. Bell, G. I., et al. (1984). Diabetes 33: 176-83.

4. Bennett, S. T., et al. (1995). Nature Genet. 9: 284-292.

5. Bennett, S. T. and Todd, J. A (1996). Annu. Rev. Genet.30: 343-370.

6. Buckler, A. et al. (1991). P.N.A.S USA 88: 4005-4009.

7. Davies, J. L., et al. (1994). Nature 371: 130-136.

8. Doria, A., et al (1996). Diabetologia 39: 594-599.

9. Hashimoto, L., et al. (1994). Nature 371: 161-164.

10. Holmans, P. (1993). Am. J. Hum. Genet. 52: 362-374.

11. Julier, C., et al. (1991a). Nature 354: 155-159.

12. Kennedy, G. C., et al. (1995). Nature Genet. 9: 293-298.

13. Kyvik, K. O., et al. (1995). Brit. Med. J. 311: 913-917.

14. Lucassen, A., et al. (1993). Nature Genet. 4: 305-310.

15. Lucassen, A., et al. (1995). Hum. Mol. Genet. 4: 501-506.

16. Luo, D.-F., et al. (1996). Hum. Mol. Genet. 5: 693-698.

17. Matsuda, A. and Kuzuya, T. (1994). Diab. Res. Clin. Pract. 24: Suppl., S63-S67.

18. Risch (1987). Am. J. Hum. Genet. 40: 1-14.

19. Owerbach, D., et al. (1990). Diabetes 39: 1504-1509.

20. Parimoo, S., et al. (1991). P.N.A.S. USA 88: 9623-9627.

21. Penrose, L. S. (1953). Acta. Genet. Stat. Med. 4: 257-265.

22. Risch, S. S. (1990). Diabetes 39: 1315-19.

23. Spielman, R., et al. (1993). Am. J. Hum. Genet. 52: 506-516.

24. Thomson, G., et al. (1989). Genet. Epidemiol. 6: 155-160.

25. Tisch, R. and McDevitt, H. O. (1996). Cell 85: 291-297.

26. Todd, J. A. (1994). Diabetic Med. 11: 6-16.

27. Todd, J. A., et al. (1987). Nature 329: 599-604.

28. Todd, J. A. and Farrall, M. (1996). Hum. Mol. Genet. 5: 1443-1448.

29. Todd, J. A., et al. (1989). Nature 338: 587-589.

30. Vafiadis, P., et al. (1996). J. Autoimmunity 9: 397-403.

TABLE 1
Haplotype analysis at D11S1917 (UT5620) - H057OPOLYA,
within 2582 families from UK, USA, Norway and Sardinia.
Susceptible, protective and neutral alleles were identified at
each polymorphism, and transmission of recombinant haplotypes
to diabetic offspring was calculated (t = transmission, nt = non
transmission) Significant transmission of the haplotype 332-
104 was detected (P = 0.005), as well as significant non-
transmission of the haplotype 328-103 (P = 0.03)
D11S1917
(UT5620) H057OPOLYA t nt P
328 104 539 474
Protective 332 103 427 521 0.002
Susceptible 332 104 60 33 0.005
Protective 328 103 16 31 0.03

TABLE 2
PCR Primers for obtaining LRP5 cDNA
Primers located within LRP5 cDNA:
The primers are numbered beginning at
nucleotide 1 in FIG. 5(a) (SEQ ID NO: 1).
1F (muex 1f): ATGGAGCCCGAGTGAGC (SEQ ID NO:49)
218R (27R): ATGGTGGACTCCAGCTTGAC (SEQ ID NO:50)
256F (1F): TTCCAGTTTTCCAAGGGAG (SEQ ID NO:51)
265R (26R): AAAACTGGAAGTCCACTGCG (SEQ ID NO:52)
318R (4R): GGTCTGCTTGATGGCCTC (SEQ ID NO:53)
343F (2F): GTGCAGAACGTGGTCATCT (SEQ ID NO:54)
Vector Primers for RCCA
361R (21R): GTGCAGAACGTGGTCATCT (SEQ ID NO:54)
622R (2R): AGTCCACAATGATCTTCCGG (SEQ ID NO:55)
638F (4F): CCAATGGACTGACCATCGAC (SEQ ID NO:56)
657R (1R): GTCGATGGTCAGTCCATTGG (SEQ ID NO:57)
956R (22R): TTGTCCTCCTCACAGCGAG (SEQ ID NO:58)
1713F (21F): GGACTTCATCTACTGGACTG (SEQ ID NO:59)
1481R (23R): CAGTCTGTCCAGTACATGAG (SEQ ID NO:60)
1981F (22F): GCCTTCTTGGTCTTCACCAG (SEQ ID NO:61)
2261F (23F): GGACCAACAGAATCGAAGTG (SEQ ID NO:62)
2484R (5R): GTCAATGGTGAGGTCGT (SEQ ID NO:63)
2519F (5F): ACACCAACATGATCGAGTCG (SEQ ID NO:64)
3011F (24F): ACAAGTTCATCTACTGGGTG (SEQ ID NO:65)
3154F (25F): CGGACACTGTTCTGGACGTG (SEQ ID NO:66)
3173R (25R): CACGTCCAGAACAGTGTCCG (SEQ ID NO:67)
3556R (3R): TCCAGTAGAGATGCTTGCCA (SEQ ID NO:68)
Vector Primers for RCCA
3577F (3F): ATCGAGCGTGTGGAGAAGAC (SEQ ID NO:69)
4094F (30F): TCCTCATCAAACAGCAGTGC (SEQ ID NO:70)
4173R (6R): CGGCTTGGTGATTTCACAC (SEQ ID NO:71)
4687F (6F): GTGTGTGACAGCGACTACAGC (SEQ ID NO:72)
4707R (30R): GCTGTAGTCGCTGTCACACAC (SEQ ID NO:73)
5061R (7R): GTACAAAGTTCTCCCAGCCC (SEQ ID NO:74)
PCR primers in Sequences identified by GRAIL
G1 1F: TCTTCTCCAGAGGATGCAGC (SEQ ID NO:75)
G1 2F: TTCGTCTTGAACTTCCCAGC (SEQ ID NO:76)
G1 3F: TCTTCTTCTCCAGAGGATGCA (SEQ ID NO:77)
Gp1 1F: AGGCTGGTCTCAAACTCCTG (SEQ ID NO:78)
PBS.543R: GGGGATGTGCTGCAAGGCGA (SEQ ID NO:79)
PBS.578R: CCAGGGTTTTCCCAGTCACGAC (SEQ ID NO:80)
PBS.838F: TTGTGTGGAATTGTGAGCGGATAAC (SEQ ID NO:81)
PBS.873F: CCCAGGCTTTACACTTTATGCTTCC (SEQ ID NO:82)

TABLE 3
Intron-Exon Organization of Human LRP-5
Exon Intron
3′ Acceptor Sequence Exon Size 5′ Donor Sequence Number &
Intron      Exon Number (bp) Exon      Intron Size (bp)
ccgggtcaac/ATGGAG Ex 1 (6) (91) CCGCGG/gtaggtgggc  1 (35051)
(SEQ ID NO: 411) (SEQ ID NO: 412)
tgccccacag/CCTCGC Ex 2 (A) (391) TCACGG/gtaaaccctg  2 (9408)
(SEQ ID NO: 413) (SEQ ID NO: 414)
cccgtcacag/GTACAT Ex 3 (B) (198) GTTCCG/gtaggtaccc  3 (6980)
(SEQ ID NO: 415) (SEQ ID NO: 416)
ctgactgcag/GCAGAA Ex 4 (C) (197) CTTTCT/gtgagtgccg  4 (1640)
(SEQ ID NO: 417) (SEQ ID NO: 418)
gttttcccag/TCCACA Ex 5 (D) (132) AGGCAG/gtgaggcggt  5 (20823)
(SEQ ID NO: 419) (SEQ ID NO: 420)
gtctccacag/GAGCCG Ex 6 (E) (397) GATGGG/gtaagacggg  6 (3213)
(SEQ ID NO: 421) (SEQ ID NO: 422)
tcttctccag/CCTCAT Ex 7 (F) (172) ATCGAG/gtgaggctcc  7 (13445)
(SEQ ID NO: 423) (SEQ ID NO: 424)
cgtcctgcag/GTGATC Ex 8 (G) (217) TCGTCG/gtgagtccgg  8 (2826)
(SEQ ID NO: 425) (SEQ ID NO: 426)
tcgcttccag/GAACCA Ex 9 (H) (290) CTGAAG/gtagcgtggg  9 (5000+)
(SEQ ID NO: 427) (SEQ ID NO: 428)
ctgctgccag/ACCATC Ex 10 (I) (227) CAAGGG/gtaagtgttt 10 (1295)
(SEQ ID NO: 429) (SEQ ID NO: 430)
tgccttccag/CTACAT Ex 11 (J) (185) TGCTGG/gtgagggccg 11 (2068)
(SEQ ID NO: 431) (SEQ ID NO: 432)
gttcatgcag/GTCAGG Ex 12 (K) (324) GCAGCC/gtaagtgcct 12 (2005)
(SEQ ID NO: 433) (SEQ ID NO: 434)
cctcctctag/CGCCCA Ex 13 (L) (200) ACCCAG/gcaggtgccc 13 (6963)
(SEQ ID NO: 435) (SEQ ID NO: 436)
tgtcttacag/CCCTTT Ex 14 (M) (209) GCGAGG/gtaggaggcc 14 (1405)
(SEQ ID NO: 437) (SEQ ID NO: 438)
cctcccgcag/GTACCT Ex 15 (N) (191) TGTCAG/gtaaggggcc 15 (686)
(SEQ ID NO: 439) (SEQ ID NO: 440)
ctgcttgcag/GGGCCA Ex 16 (O) (210) AGTTCT/gtacgtgggg 16 (3894)
(SEQ ID NO: 441) (SEQ ID NO: 442)
gtctttgcag/CAGCCC Ex 17 (P) (126) GTGGAG/gtaggtgtga 17 (3903)
(SEQ ID NO: 443) (SEQ ID NO: 444)
cctcccccag/AGCCGC Ex 18 (Q) (237) GTGACG/gtgaggccct 18 (3042)
(SEQ ID NO: 445) (SEQ ID NO: 446)
tcccttgcag/CCATCT Ex 19 (R) (111) TGTGTG/gtgagccagc 19 (1448)
(SEQ ID NO: 447) (SEQ ID NO: 448)
tctctggcag/AAATCA Ex 20 (S) (237) TCACAG/gtaaggagcc 20 (1095)
(SEQ ID NO: 449) (SEQ ID NO: 450)
tccctgccag/GCATCG Ex 21 (T) (140) CCGCCG/gtgaggggcg 21 (6514)
(SEQ ID NO: 451) (SEQ ID NO: 452)
ctctcctcag/ATCCTG Ex 22 (U) (98) GTACAG/gtaggacatc 22 (2275)
(SEQ ID NO: 453) (SEQ ID NO: 454)
tccctttcag/GCCCTA Ex 23 (V) (>262) 23 (19985)
(SEQ ID NO: 455)

TABLE 4
LRP-5 Exon primers
(SEQ ID NO: 83) E1x1 1f CAGGGTTTCATCCTTTGTGG
(SEQ ID NO: 84) E1x1 1fU TGTAAAACGACGGCCAGTCAGGGTTTCATCCTTTGTGG
(SEQ ID NO: 85) E1x1 1fR GCTATGACCATGATTACGCCCAGGGTTTCATCCTTTGTGG
(SEQ ID NO: 86) E1x1 1r TGACGGGAAGAGTTCCTCAG
(SEQ ID NO: 87) E1x1 1rR GCTATGACCATGATTACGCCTGACGGGAAGAGTTCCTCAG
(SEQ ID NO: 88) E1x5 1f TCTGCTCTTCCTGAACTGCC
(SEQ ID NO: 89) E1x5 1fU TGTAAAACGACGGCCAGTTCTGCTCTTCCTGAACTGCC
(SEQ ID NO: 90) E1x5 1r TTGAGTCCTTCAACAAGCCC
(SEQ ID NO: 91) E1x5 1rR GCTATGACCATGATTACGCCTTGAGTCCTTCAACAAGCCC
(SEQ ID NO: 92) E1x6 1fU TGTAAAACGACGGCCAGTTTCCCCACTCATAGAGGCTC
(SEQ ID NO: 93) E1x6 1rR GCTATGACCATGATTACGCCGCTCCCAACTCGCCAAGT
(SEQ ID NO: 94) E1x6a 1fU TGTAAAACGACGGCCAGTGGTCAACATGGAGGCAGC
(SEQ ID NO: 95) E1x6a 1rR GCTATGACCATGATTACGCCCAGGTGTCAGTCCGCTTG
(SEQ ID NO: 96) E1x6b 1fU TGTAAAACGACGGCCAGTGCAGAGAAGTTCTGAGC
(SEQ ID NO: 97) E1x6b 1rR GCTATGACCATGATTACGCCCACTTGGCCAGCCATACTC
(SEQ ID NO: 98) E1x6c 1fU TGTAAAACGACGGCCAGTCAAGCAAGCCTCTTGCTACC
(SEQ ID NO: 99) E1x6c 1rR GCTATGACCATGATTACGCCACTGCAATGAGGTGAAAGGC
(SEQ ID NO: 100) E1x6d 1fU TGTAAAACGACGGCCAGTCAGGTGAGAACAAGTGTCCG
(SEQ ID NO: 101) E1x6d 1rR GCTATGACCATGATTACGCCGCTGCCTCCATGTTGACC
(SEQ ID NO: 102) E1x6e 1fU TGTAAAACGACGGCCAGTTGTGCCTGGGTGAGATTCT
(SEQ ID NO: 103) E1x6e 1rR GCTATGACCATGATTACGCCTGTGGAGCCTCTATGAGTGG
(SEQ ID NO: 104) E1x6f 1fU TGTAAAACGACGGCCAGTGGGTGACAGGTGGCAGTAG
(SEQ ID NO: 105) E1x6f 1rR GCTATGACCATGATTACGCCGGAAGGAAGGACACTTGAGC
(SEQ ID NO: 106) E1x6g 1fU TGTAAAACGACGGCCAGTCCTGGTGTGTTTGAGAACCC
(SEQ ID NO: 107) E1x6g 1rR GCTATGACCATGATTACGCCCAATGGGAAGCCAGGCTAG
(SEQ ID NO: 108) E1xA 1f ATCTTGCTGGCTTAGCCAGT
(SEQ ID NO: 109) E1xA 1fU TGTAAAACGACGGCCAGTATCTTGCTGGCTTAGCCAGT
(SEQ ID NO: 110) E1xA 1fR GCTATGACCATGATTACGCCATCTTGCTGGCTTAGCCAGT
(SEQ ID NO: 111) E1xA 1r GCTCATGAAATTCGAGAGAG
(SEQ ID NO: 112) E1xA 1rR GCTATGACCATGATTACGCCGCTCATGCAAATTCGAGAGAG
(SEQ ID NO: 113) E1xB 1f CCTGTTGGTTATTTCCGATGG
(SEQ ID NO: 114) E1xB 1fU TGTAAAACGACGGCCAGTCCTGTTGGTTATTTCCGATGG
(SEQ ID NO: 115) E1xB 1fR GCTATGACCATGATTACGCCCCTGTTGGTTATTTCCGATGG
(SEQ ID NO: 116) E1xB 1r CCTGAGTTAAGAAGGAACGCC
(SEQ ID NO: 117) E1xB 1rR GCTATGACCATGATTACGCCCCTGAGTTAAGAAGGAACGCC
(SEQ ID NO: 118) E1xC 1f AATTGGGTCAGCAGCAATG
(SEQ ID NO: 119) E1xC 1fR GCTATGACCATGATTACGCCAATTGGGTCAGCAGCAATG
(SEQ ID NO: 120) E1xC 2f AATTGGGTCAGCAGCAATG
(SEQ ID NO: 121) E1xC 2fU TGTAAAACGACGGCCAGTAATTGGGTCAGCAGCAATG
(SEQ ID NO: 119) E1xC 2fR GCTATGACCATGATTACGCCAATTGGGTCAGCAGCAATG
(SEQ ID NO: 122) E1xC 1r TTGGATCGCTAGAGATTGGG
(SEQ ID NO: 123) E1xC 1rR GCTATGACCATGATTACGCCTTGGATCGCTAGAGATTGGG
(SEQ ID NO: 124) E1xC 2r GCACCCTAATTGGCACTCA
(SEQ ID NO: 125) E1xC 2rR GCTATGACCATGATTACGCCGCACCCTAATTGGCACTCA
(SEQ ID NO: 126) E1xD 1f TGACGGTCCTCTTCTGGAAC
(SEQ ID NO: 127) E1xD 1fR GCTATGACCATGATTACGCCTGACGGTCCTCTTCTGGAAC
(SEQ ID NO: 128) E1xD 2f CGAGGCAGGATGTGACTCAT
(SEQ ID NO: 129) E1xD 2fU TGTAAAACGACGGCCAGTCGAGGCAGGATGTGACTCAT
(SEQ ID NO: 130) E1xD 2fR GCTATGACCATGATTACGCCCGAGGCAGGATGTGACTCAT
(SEQ ID NO: 131) E1xD 1r AGTGGATCATTTCGAACGG
(SEQ ID NO: 132) E1xD 1rR GCTATGACCATGATTACGCCAGTGGATCATTTCGAACGG
(SEQ ID NO: 133) E1xD 2r CCAACTCAGCTTCCCGAGTA
(SEQ ID NO: 134) E1xD 2rR GCTATGACCATGATTACGCCCCAACTCAGCTTCCCGAGTA
(SEQ ID NO: 135) E1xE 1f TGGCTGAGTATTTCCCTTGC
(SEQ ID NO: 136) E1xE 1fU TGTAAAACGACGGCCAGTTGGCTGAGTATTTCCCTTGC
(SEQ ID NO: 137) E1xE 1fR GCTATGACCATGATTACGCCTGGCTGAGTATTTCCCTTGC
(SEQ ID NO: 138) E1xE 1r TTTAACAAGCCCTCCTCCG
(SEQ ID NO: 139) E1xE 1rR GCTATGACCATGATTACGCCTTTAACAAGCCCTCCTCCG
(SEQ ID NO: 140) E1xF 1f CAACGCCAGCATCTACTGA
(SEQ ID NO: 141) E1xF 1fU TGTAAAACGACGGCCAGTCAACGCCAGCATCTACTGA
(SEQ ID NO: 142) E1xF 1fR GCTATGACCATGATTACGCCCAACGCCAGCATCTCTACTGA
(SEQ ID NO: 143) E1xF 1r CAAATAGCAGAGCACAGGCA
(SEQ ID NO: 144) E1xF 1rR GCTATGACCATGATTACGCCCAAATAGCAGAGCACAGGCA
(SEQ ID NO: 145) E1xG 1f TGAAGTTGCTGCTCTTGGG
(SEQ ID NO: 146) E1xG 1fU TGTAAAACGACGGCCAGTTGAAGTTGCTGCTCTTGGG
(SEQ ID NO: 147) E1xG 1fR GCTATGACCATGATTACGCCTGAAGTTGCTGCTCTTGGG
(SEQ ID NO: 148) E1xG 1r CACTTCCTCCTCATGCAAGTC
(SEQ ID NO: 149) E1xG 1rR GCTATGACCATGATTACGCCCACTTCCTCCTCATGCAAGTC
(SEQ ID NO: 150) E1xH 1f AGACTGGAGCCTCTGTGTTCG
(SEQ ID NO: 151) E1xH 1fU TGTAAAACGACGGCCAGTAGACTGGAGCCTCTGTGTTCG
(SEQ ID NO: 152) E1xH 1fR GCTATGACCATGATTACGCCAGACTGGAGCCTCTGTGTTCG
(SEQ ID NO: 153) E1xH 1r TGTGTGTCTACCGGACTTGC
(SEQ ID NO: 154) E1xH 1rR GCTATGACCATGATTACGCCTGTGTGTCTACCGGACTTGC
(SEQ ID NO: 155) E1xH 2r GAACAGAGGCAAGGTTTTCCC
(SEQ ID NO: 156) E1xH 2rR GCTATGACCATGATTACGCCGAACAGAGGCAAGGTTTTCCC
(SEQ ID NO: 157) E1xI 1f AGAATCGCTTGAACCCAGG
(SEQ ID NO: 158) E1xI 1fR GCTATGACCATGATTACGCCAGAATCGCTTGAACCCAGG
(SEQ ID NO: 159) E1xI 2f GCTGGTTCCTAAAATGTGGC
(SEQ ID NO: 160) E1xI 2fU TGTAAAACGACGGCCAGTGCTGGTTCCTAAAATGTGGC
(SEQ ID NO: 161) E1xI 2fR GCTATGACCATGATTACGCCGCTGGTTCCTAAAATGTGGC
(SEQ ID NO: 162) E1xI 1r CATACGAGGTGAACACAAGGAC
(SEQ ID NO: 163) E1xI 1rR GCTATGACCATGATTACGCCCATACGAGGTGAACACAAGGAC
(SEQ ID NO: 164) E1xJ 1f TGAAGAGGTGGGGACAGTTG
(SEQ ID NO: 165) E1xJ 1fR GCTATGACCATGATTACGCCTGAAGAGGTGGGGACAGTTG
(SEQ ID NO: 166) E1xJ 2f CTTGTGCCTTCCAGCTACATC
(SEQ ID NO: 167) E1xJ 2fU TGTAAAACGACGGCCAGTCTTGTGCCTTCCAGCTACATC
(SEQ ID NO: 168) E1xJ 2fR GCTATGACCATGATTACGCCCTTGTGCCTTCCAGCTACATC
(SEQ ID NO: 169) E1xJ 1r AGTCCTGGCACAGGGATTAG
(SEQ ID NO: 170) E1xJ 1rR GCTATGACCATGATTACGCCAGTCCTGGCACAGGGATTAG
(SEQ ID NO: 171) E1xJ 2r ATAACTGCAGCAAAGGCACC
(SEQ ID NO: 172) E1xJ 2rR GCTATGACCATGATTACGCCATAACTGCAGCAAAGGCACC
(SEQ ID NO: 173) E1xK 1f GCTTCAGTGGATCTTGCTGG
(SEQ ID NO: 174) E1xK 1fU TGTAAAACGACGGCCAGTGCTTCAGTGGATCTTGCTGG
(SEQ ID NO: 175) E1xK 1fR GCTATGACCATGATTACGCCGCTTCAGTGGATCTTGCTGG
(SEQ ID NO: 176) E1xK 1r TGTGCAGTGCACAACCTACC
(SEQ ID NO: 177) E1xK 1rR GCTATGACCATGATTACGCCTGTGCAGTGCACAACCTACC
(SEQ ID NO: 178) E1xL 1f GTTGTCGAGTGGCGTGCTAT
(SEQ ID NO: 179) E1xL 1fU TGTAAAACGACGGCCAGTGTTGTCGAGTGGCGTGCTAT
(SEQ ID NO: 180) E1xL 1fR GCTATGACCATGATTACGCCGTTGTCGAGTGGCGTGCTAT
(SEQ ID NO: 181) E1xL 1r AAAAGTCCTGTGGGGTCTGA
(SEQ ID NO: 182) E1xL 1rR GCTATGACCATGATTACGCCAAAAGTCCTGTGGGGTCTGA
(SEQ ID NO: 183) E1xM 1f AGAAGTGTGGCCTCTGCTGT
(SEQ ID NO: 184) E1xM 1fU TGTAAAACGACGGCCAGTAGAAGTGTGGCCTCTGCTGT
(SEQ ID NO: 185) E1xM 1fR GCTATGACCATGATTACGCCAGAAGTGTGGCCTCTGCTGT
(SEQ ID NO: 186) E1xM 1r GTGAAAGAGCCTGTGTTTGCT
(SEQ ID NO: 187) E1xM 1rR GCTATGACCATGATTACGCCGTGAAAGAGCCTGTGTTTGCT
(SEQ ID NO: 188) E1xN 1f AGACCCTGCTTCCAAATAAGC
(SEQ ID NO: 189) E1xN 1fU TGTAAAACGACGGCCAGTAGACCCTGCTTCCAAATAAGC
(SEQ ID NO: 190) E1xN 1fR GCTATGACCATGATTACGCCAGACCCTGCTTCCAAATAAGC
(SEQ ID NO: 191) E1xN 1r ACTCATTTTCTGCCTGCC
(SEQ ID NO: 192) E1xN 1rR GCTATGACCATGATTACGCCACTCATTTTCTGCCTCTGCC
(SEQ ID NO: 193) E1xO 1f TGGCAGTCCTGTCAACCTCT
(SEQ ID NO: 194) E1xO 1fU TGTAAAACGACGGCCAGTTGGCAGTCCTGTCAACCTCT
(SEQ ID NO: 195) E1xO 1fR GCTATGACCATGATTACGCCTGGCAGTCCTGTCAACCTCT
(SEQ ID NO: 196) E1xO 1r CACACAGGATCTTGCACTGG
(SEQ ID NO: 197) E1xO 1rR GCTATGACCATGATTACGCCCACACAGGATCTTGCACTGG
(SEQ ID NO: 198) E1xP 1f AGGGCCAGTTCTCATGAGTT
(SEQ ID NO: 199) E1xP 1fU TGTAAAACGACGGCCAGTAGGGCCAGTTCTCATGAGTT
(SEQ ID NO: 200) E1xP 1fR GCTATGACCATGATTACGCCAGGGCCAGTTCTCATGAGTT
(SEQ ID NO: 201) E1xP 1r GGGCAAAGGAAGACACAATC
(SEQ ID NO: 202) E1xP 1rR GCTATGACCATGATTACGCCGGGCAAAGGAAGACACAATC
(SEQ ID NO: 203) E1xQ 1f CAACTTCTGCTTTGAAGCCC
(SEQ ID NO: 204) E1xQ 1fU TGTAAAACGACGGCCAGTCAACTTCTGCTTTGAAGCCC
(SEQ ID NO: 205) E1xQ 1fR GCTATGACCATGATTACGCCCAACTTCTGCTTTAAGCCC
(SEQ ID NO: 206) E1xQ 1r GACAGACTTGGCAATCTCCC
(SEQ ID NO: 207) E1xQ 1rR GCTATGACCATGATTACGCCGACAGACTTGGCAATCTCCC
(SEQ ID NO: 208) E1xR 1f TCTGCTCTCTGTTTGGAGTCC
(SEQ ID NO: 209) E1xR 1fU TGTAAAACGACGGCCAGTTCTGCTCTCTGTTTGGAGTCC
(SEQ ID NO: 210) E1xR 1fR GCTATGACCATGATTACGCCTCTGCTCTCTGTTTGGAGTCC
(SEQ ID NO: 211) E1xR 1r CCCTAAACTCCACGTTCCTG
(SEQ ID NO: 212) E1xR 1rR GCTATGACCATGATTACGCCCCCTAAACTCCACGTTCCTG
(SEQ ID NO: 213) E1xS 1f GGGTTAATGTTGGCCACATC
(SEQ ID NO: 214) E1xS 1fR GCTATGACCATGATTACGCCGGGTTAATGTTGGCCACATC
(SEQ ID NO: 215) E1xS 2f TTGGCAGGGATGTGTTGAG
(SEQ ID NO: 216) E1xS 2fU TGTAAAACGACGGCCAGTTTGGCAGGGATGTGTTGAG
(SEQ ID NO: 217) E1xS 2fR GCTATGACCATGATTACGCCTTGGCAGGGATGTGTTGAG
(SEQ ID NO: 218) E1xS 1r GTCTGCCACATGTGCAAGAG
(SEQ ID NO: 219) E1xS 1rR GCTATGACCATGATTACGCCGTCTGCCACATGTGCAAGAG
(SEQ ID NO: 220) E1xT 1f TGGTCTGAGTCTCGTGGGTA
(SEQ ID NO: 221) E1xT 1fU TGTAAAACGACGGCCAGTTGGTCTGAGTCTCGTGGGTA
(SEQ ID NO: 222) E1xT 1fR GCTATGACCATGATTACGCCTGGTCTGAGTCTCGTGGGTA
(SEQ ID NO: 223) E1xT 1r GAGGTGGATTTGGGTGAGATT
(SEQ ID NO: 224) E1xT 1rR GCTATGACCATGATTACGCCGAGGTGGATTTGGGTGAGATT
(SEQ ID NO: 225) E1xU 1f AGCCCTCTCTGCAAGGAAAG
(SEQ ID NO: 226) E1xU 1fU TGTAAAACGACGGCCAGTAGCCCTCTCTGCAAGGAAAG
(SEQ ID NO: 227) E1xU 1fR GCTATGACCATGATTACGCCAGCCCTCTCTGCAAGGAAAG
(SEQ ID NO: 228) E1xU 1r CAGAACGTGGAGTTCTGCTG
(SEQ ID NO: 229) E1xU 1rR GCTATGACCATGATTACGCCCAGAACGTGGAGTTCTGCTG
(SEQ ID NO: 230) E1xV 1f TACCGAATCCCACTCCTCTG
(SEQ ID NO: 231) E1xV 1fU TGTAAAACGACGGCCAGTTACCGAATCCCACTCCTCTG
(SEQ ID NO: 232) E1xV 1fR GCTATGACCATGATTACGCCTACCGAATCCCACTCCTCTG
(SEQ ID NO: 233) E1xV 2f CATGGTAGAGGTGGGACCAT
(SEQ ID NO: 234) E1xV 2fU TGTAAAACGACGGCCAGTCATGGTAGAGGTGGGACCAT
(SEQ ID NO: 235) E1xV 2fR GCTATGACCATGATTACGCCCATGGTAGAGGTGGGACCAT
(SEQ ID NO: 236) E1xV 1r GATATCCACCTCTGCCCAAG
(SEQ ID NO: 237) E1xV 1rR GCTATGACCATGATTACGCCGATATCCACCTCTGCCCAAG
(SEQ ID NO: 238) E1xV 2r TTACAGGGGCACAGAGAAGC
(SEQ ID NO: 239) E1xV 2rR GCTATGACCATGATTACGCCTTACAGGGGCACAGAGAAGC
SNP primers
(SEQ ID NO: 240) 57-1 1f GCAACAGAGCAAGACCCTGT
(SEQ ID NO: 241) 57-1 1fR GCTATGACCATGATTACGCCGCAACAGAGCAAGACCCTGT
(SEQ ID NO: 242) 57-1 1r AAATTAGCCAGGCATGGTG
(SEQ ID NO: 243) 57-1 1rR GCTATGACCATGATTACGCCAAATTAGCCAGGCATGGTG
(SEQ ID NO: 244) 57-1 1fU TGTAAAACGACGGCCAGTGCAACAGAGCAAGACCCTGT
(SEQ ID NO: 245) 57-2 1f CCTGCAGAAGGAAACCTGAC
(SEQ ID NO: 246) 57-2 1fR GCTATGACCATGATTACGCCCCTGCAGAAGGAAACCTGAC
(SEQ ID NO: 247) 57-2 1r CTGCATCTTTGCCACCATG
(SEQ ID NO: 248) 57-2 1rR GCTATGACCATGATTACGCCCTGCATCTTTGCCACCATG
(SEQ ID NO: 249) 57-2 1fU TGTAAAACGACGGCCAGTCCTGCAGAAGGAAACCTGAC
(SEQ ID NO: 250) 57-3 1f TTCCCAGGAGGCAAGTTATG
(SEQ ID NO: 251) 57-3 1fR GCTATGACCATGATTACGCCTTCCCAGGAGGCAAGTTATG
(SEQ ID NO: 252) 57-3 1r TGGGCTTAGGTGATCCTCAC
(SEQ ID NO: 253) 57-3 1rR GCTATGACCATGATTACGCCTGGGCTTAGGTGATCCTCAC
(SEQ ID NO: 254) 57-3 1fU TGTAAAACGACGGCCAGTTTCCCAGGAGGCAAGTTATG
(SEQ ID NO: 255) 57-4 1f ACCAAGCCCAACTAATCAGC
(SEQ ID NO: 256) 57-4 1fR GCTATGACCATGATTACGCCACCAAGCCCAACTAATCAGC
(SEQ ID NO: 257) 57-4 1r ATGCCTGTAATCCCAGCACT
(SEQ ID NO: 258) 57-4 1rR GCTATGACCATGATTACGCCATGCCTGTAATCCCAGCACT
(SEQ ID NO: 259) 57-4 1fU TGTAAAACGACGGCCAGTACCAAGCCCAACTAATCAGC
(SEQ ID NO: 260) 57-5 1f ACTGCAAGCCCTCTCTGAAC
(SEQ ID NO: 261) 57-5 1r CGAAGACTGCGAAACAGACA
(SEQ ID NO: 262) 58-1 1f CTAGTGCCGTGCAGAATGAG
(SEQ ID NO: 263) 58-1 1r GGCCACTGCAATGAGATACA
(SEQ ID NO: 264) 58-2 1f GAGAAACAGTTCCAGGGTGG
(SEQ ID NO: 265) 58-2 1fR GCTATGACCATGATTACGCCGAGAAACAGTTCCAGGGTGG
(SEQ ID NO: 266) 58-2 1r AAACTGAGGCTGGGAGAGGT
(SEQ ID NO: 267) 58-2 1rR GCTATGACCATGATTACGCCAAACTGAGGCTGGGAGAGGT
(SEQ ID NO: 268) 58-3 1f TGTTCTTCCTCACAGGGAGG
(SEQ ID NO: 269) 58-3 1fR GCTATGACCATGATTACGCCTGTTCTTCCTCACAGGGAGG
(SEQ ID NO: 270) 58-3 1r TCCCCAAATCTGTCCAGTTC
(SEQ ID NO: 271) 58-3 1rR GCTATGACCATGATTACGCCTCCCCAAATCTGTCCAGTTC
(SEQ ID NO: 272) 58-4 1f CATACCTGGAGGGATGCTTG
(SEQ ID NO: 273) 58-4 1fR GCTATGACCATGATTACGCCCATACCTGGAGGGATGCTTG
(SEQ ID NO: 274) 58-4 1r TAGGTTGCTGTGTGGCTTCA
(SEQ ID NO: 275) 58-4 1rR GCTATGACCATGATTACGCCTAGGTTGCTGTGTGGCTTCA
(SEQ ID NO: 276) 58-5 1f CTTCTGACAAAGCAGAGGCC
(SEQ ID NO: 277) 58-5 1fR GCTATGACCATGATTACGCCCTTCTGACAAAGCAGAGGCC
(SEQ ID NO: 278) 58-5 1r GCTGTTAGGGTTACCATCGC
(SEQ ID NO: 279) 58-5 1rR GCTATGACCATGATTACGCCGCTGTTAGGGTTACCATCGC
(SEQ ID NO: 280) 58-6 1f CCACAGGGTGATATGCTGTC
(SEQ ID NO: 281) 58-6 1fR GCTATGACCATGATTACGCCCCACAGGGTGATATGCTGTC
(SEQ ID NO: 282) 58-6 1r CGCCTGGCTACTTTGGTACT
(SEQ ID NO: 283) 58-6 1rR GCTATGACCATGATTACGCCCGCCTGGCTACTTTGGTACT
(SEQ ID NO: 284) 58-7 1f CCAAATGAACCTGGGCAAC
(SEQ ID NO: 285) 58-7 1fR GCTATGACCATGATTACGCCCCAAATGAACCTGGGCAAC
(SEQ ID NO: 286) 58-7 1r GTCTTGGCTCACTGCAACCT
(SEQ ID NO: 287) 58-7 1rR GCTATGACCATGATTACGCCGTCTTGGCTCACTGCAACCT
(SEQ ID NO: 288) 58-8 1f GCCAAGACTGTGCTACTGCA
(SEQ ID NO: 289) 58-8 1r CAGGGAGCAGATCTTACCCA
(SEQ ID NO: 290) 58-9 1f TGGGATTAACTAGGGAGGGG
(SEQ ID NO: 291) 58-9 1fR GCTATGACCATGATTACGCCTGGGATTAACTAGGGAGGGG
(SEQ ID NO: 292) 58-9 1r TGCTGCTGTCTCCATCTCTG
(SEQ ID NO: 293) 58-9 1rR GCTATGACCATGATTACGCCTGCTGCTGTCTCCATCTCTG
(SEQ ID NO: 294) 58-10 1f ACAGACCAGCAGTGAAACCTG
(SEQ ID NO: 295) 58-10 1fR GCTATGACCATGATTACGCCACAGACCAGCAGTGAAACCTG
(SEQ ID NO: 296) 58-10 1r GTTCACTGCAACCTCTGCCT
(SEQ ID NO: 297) 58-10 1rR GCTATGACCATGATTACGCCGTTCACTGCAACCTCTGCCT
(SEQ ID NO: 298) 58-11 1f GTTCTCGTAGATGCTTGCAGG
(SEQ ID NO: 299) 58-11 1fR GCTATGACCATGATTACGCCGTTCTCGTAGATGCTTGCAGG
(SEQ ID NO: 300) 58-11 1r GAGGCAGGAGGATCACTTGA
(SEQ ID NO: 301) 58-11 1rR GCTATGACCATGATTACGCCGAGGCAGGAGGATCACTTGA
(SEQ ID NO: 302) 58-12 1f TGAGCTGAGATCACACCGCT
(SEQ ID NO: 303) 58-12 1fR GCTATGACCATGATTACGCCTGAGCTGAGATCACACCGCT
(SEQ ID NO: 304) 58-12 1r AGTTGACACTTTGCTGGCCT
(SEQ ID NO: 305) 58-12 1rR GCTATGACCATGATTACGCCAGTTGACACTTTGCTGGCCT
(SEQ ID NO: 306) 58-13 1f CTCTGCATGGCTTAGGGACA
(SEQ ID NO: 307) 58-13 1fR GCTATGACCATGATTACGCCCTCTGCATGGCTTAGGGACA
(SEQ ID NO: 308) 58-13 1r GGCTGCTCTCTGCATTCTCT
(SEQ ID NO: 309) 58-13 1rR GCTATGACCATGATTACGCCGGCTGCTCTCTGCATTCTCT
(SEQ ID NO: 310) 58-14 1f CTGGCTTTAGCTTGCATTTCC
(SEQ ID NO: 311) 58-14 1fR GCTATGACCATGATTACGCCCTGGCTTTAGCTTGCATTTCC
(SEQ ID NO: 312) 58-14 1r TGCCTCAGTTTTCTCACCTGT
(SEQ ID NO: 313) 58-14 1rR GCTATGACCATGATTACGCCTGCCTCAGTTTTCTCACCTGT
(SEQ ID NO: 314) 58-15 1f CAAACAGCCACTGAGCATGT
(SEQ ID NO: 315) 58-15 1fR GCTATGACCATGATTACGCCCAAACAGCCACTGAGCATGT
(SEQ ID NO: 316) 58-15 1r TCCTCCTGTAGATGCCCAAG
(SEQ ID NO: 317) 58-15 1rR GCTATGACCATGATTACGCCTCCTCCTGTAGATGCCCAAG

TABLE 5
LRP-5 exon SNPs
Exon Polymorphism Amino Acid Change Location
exon E G to A Intronic 10 bp 3′ of exon E
exon E C to T none Phe331, exon E
exon F G to A Intronic 50 bp 5′ of exon F
exon G C to T none Phe518, exon G
exon I C to T none Asn709, exon I
exon P C to T Intronic 82 bp 5′ of exon P
exon N C to T none Asp1068, exon N
exon N A to G none Val1088, exon N
exon Q C to T Ala1299 to Val Ala1299, exon Q
exon U T to C Val1494 to Ala Val1494, exon U

TABLE 6
SNP's Identified in the IDDM 4 Locus
List of PCR Fragments and available RFLP Sites for Analysis:
PCR Product SNP Location Enzyme
Contig 57
57-1 a/t 13363 none
57-1 a/g 13484 Bst XI
57-2 a/g 14490 none
57-2 a/g 14885 none
57-3 c/g 18776 Mae II
57-3 t/c 18901 Msp I
57-3 a/g 19313 Afl II
57-4 22T/25T 20800 none
57-5 g/a 23713 Msp I
Contig 58
58-15 c/t 3015 none
58-14 g/c 3897 Pfl MI
58-13 c/g 5574 Eco NI
58-12 t/g 6051 none
58-11 a/g 8168 none
58-10 a/g 8797 none
58-9 g/t 9445 none
58-9 c/t 9718 none
58-8 insert T 10926 Pst I
58-7 t/a 11449 Bst XI
58-7 t/c 11468 none
58-6 t/c 11878 none
58-6 g/a 12057 none
58-6 a/g 12180 Hga I
58-5 c/t 14073 none
58-4 a/g 15044 Mae II
58-4 t/c 15354 none
58-3 insert G 16325 none
58-2 g/a 17662 none
58-1 g/t 18439 Bgl II

TABLE 7
SNP primers
(SEQ ID NO: 240) 57-1 1f GCAACAGAGCAAGACCCTGT
(SEQ ID NO: 241) 57-1 1fR GCTATGACCATGATTACGCCGCAACAGAGCAAGACCCTGT
(SEQ ID NO: 242) 57-1 1r AAATTAGCCAGGCATGGTG
(SEQ ID NO: 243) 57-1 1rR GCTATGACCATGATTACGCCAAATTAGCCAGGCATGGTG
(SEQ ID NO: 244) 57-1 1fU TGTAAAACGACGGCCAGTGCAACAGAGCAAGACCCTGT
(SEQ ID NO: 245) 57-2 1f CCTGCAGAAGGAAACCTGAC
(SEQ ID NO: 246) 57-2 1fR GCTATGACCATGATTACGCCCCTGCAGGAAGGAAACCTGAC
(SEQ ID NO: 247) 57-2 1r CTGCATCTTTGCCACCATG
(SEQ ID NO: 248) 57-2 1rR GCTATGACCATGATTACGCCCTGCATCTTTGCCACCATG
(SEQ ID NO: 249) 57-2 1fU TGTAAAACGACGGCCAGTCCTGCAGAAGGAAACCTGAC
(SEQ ID NO: 250) 57-3 1f TTCCCAGGAGGCAAGTTATG
(SEQ ID NO: 251) 57-3 1fR GCTATGACCATGATTACGCCTTCCCAGGAGGCAAGTTATG
(SEQ ID NO: 252) 57-3 1r TGGGCTTAGGTGATCCTCAC
(SEQ ID NO: 253) 57-3 1rR GCTATGACCATGATTACGCCTGGGCTTAGGTGATCCTCAC
(SEQ ID NO: 254) 57-3 1fU TGTAAAACGACGGCCAGTTTCCCAGGAGGCAAGTTATG
(SEQ ID NO: 255) 57-4 1f ACCAAGCCCAACTAATCAGC
(SEQ ID NO: 256) 57-4 1fR GCTATGACCATGATTACGCCACCAAGCCCAACTAATCAGC
(SEQ ID NO: 257) 57-4 1r ATGCCTGTAATCCCAGCACT
(SEQ ID NO: 258) 57-4 1rR GCTATGACCATGATTACGCCATGCCTGTAATCCCAGCACT
(SEQ ID NO: 259) 57-4 1fU TGTAAAACGACGGCCAGTACCAAGCCCAACTAATCAGC
(SEQ ID NO: 260) 57-5 1f ACTGCAAGCCCTCTCTGAAC
(SEQ ID NO: 261) 57-5 1r CGAAGACTGCGAAACAGACA
(SEQ ID NO: 262) 58-1 1f CTAGTGCCGTGCAGAATGAG
(SEQ ID NO: 263) 58-1 1r GGCCACTGCAATGAGATACA
(SEQ ID NO: 264) 58-2 1f GAGAAACAGTTCCAGGGTGG
(SEQ ID NO: 265) 58-2 1fR GCTATGACCATGATTACGCCGAGAAACAGTTCCAGGGTGG
(SEQ ID NO: 266) 58-2 1r AAACTGAGGCTGGGAGAGGT
(SEQ ID NO: 267) 58-2 1rR GCTATGACCATGATTACGCCAAACTGAGGCTGGGAGAGGT
(SEQ ID NO: 268) 58-3 1f TGTTCTTCCTCACAGGGAGG
(SEQ ID NO: 269) 58-3 1fR GCTATGACCATGATTACGCCTGTTCTTCCTCACAGGGAGG
(SEQ ID NO: 270) 58-3 1r TCCCCAAATCTGTCCAGTTC
(SEQ ID NO: 271) 58-3 1rR GCTATGACCATGATTACGCCTCCCCAAATCTGTCCAGTTC
(SEQ ID NO: 272) 58-4 1f CATACCTGGAGGGATGCTTG
(SEQ ID NO: 273) 58-4 1fR GCTATGACCATGATTACGCCCATACCTGGAGGGATGCTTG
(SEQ ID NO: 274) 58-4 1r TAGGTTGCTGTGTGGCTTCA
(SEQ ID NO: 275) 58-4 1rR GCTATGACCATGATTACGCCTAGGTTGCTGTGTGGCTTCA
(SEQ ID NO: 276) 58-5 1f CTTCTGACAAAGCAGAGGCC
(SEQ ID NO: 277) 58-5 1fR GCTATGACCATGATTACGCCCTTCTGACAAAGCAGAGGCC
(SEQ ID NO: 278) 58-5 1r GCTGTTAGGGTTACCATCGC
(SEQ ID NO: 279) 58-5 1rR GCTATGACCATGATTACGCCGCTGTTAGGGTTACCATCGC
(SEQ ID NO: 280) 58-6 1f CCACAGGGTGATATGCTGTC
(SEQ ID NO: 281) 58-6 1fR GCTATGACCATGATTACGCCCCACAGGGTGATATGCTGTC
(SEQ ID NO: 282) 58-6 1r CGCCTGGCTACTTTGGTACT
(SEQ ID NO: 283) 58-6 1rR GCTATGACCATGATTACGCCCGCCTGGCTACTTTGGTACT
(SEQ ID NO: 284) 58-7 1f CCAAATGAACCTGGGCAAC
(SEQ ID NO: 285) 58-7 1fR GCTATGACCATGATTACGCCCCAAATGAACCTGGGCAAC
(SEQ ID NO: 286) 58-7 1r GTCTTGGCTCACTGCAACCT
(SEQ ID NO: 287) 58-7 1rR GCTATGACCATGATTACGCCGTCTTGGCTCACTGCAACCT
(SEQ ID NO: 288) 58-8 1f GCCAAGACTGTGCTACTGCA
(SEQ ID NO: 289) 58-8 1r CAGGGAGCAGATCTTACCCA
(SEQ ID NO: 290) 58-9 1f TGGGATTAACTAGGGAGGGG
(SEQ ID NO: 291) 58-9 1fR GCTATGACCATGATTACGCCTGGGATTAACTAGGGAGGGG
(SEQ ID NO: 292) 58-9 1r TGCTGCTGTCTCCATCTCTG
(SEQ ID NO: 293) 58-9 1rR GCTATGACCATGATTACGCCTGCTGCTGTCTCCATCTCTG
(SEQ ID NO: 294) 58-10 1f ACAGACCAGCAGTGAAACCTG
(SEQ ID NO: 295) 58-10 1fR GCTATGACCATGATTACGCCACAGACCAGCAGTGAAACCTG
(SEQ ID NO: 296) 58-10 1r GTTCACTGCAACCTCTGCCT
(SEQ ID NO: 297) 58-10 1rR GCTATGACCATGATTACGCCGTTCACTGCAACCTCTGCCT
(SEQ ID NO: 298) 58-11 1f GTTCTCGTAGATGCTTGCAGG
(SEQ ID NO: 299) 58-11 1fR GCTATGACCATGATTACGCCGTTCTCGTAGATGCTTGCAGG
(SEQ ID NO: 300) 58-11 1r GAGGCAGGAGGATCACTTGA
(SEQ ID NO: 301) 58-11 1rR GCTATGACCATGATTACGCCGAGGCAGGAGGATCACTTGA
(SEQ ID NO: 302) 58-12 1f TGAGCTGAGATCACACCGCT
(SEQ ID NO: 303) 58-12 1fR GCTATGACCATGATTACGCCTGAGCTGAGATCACACCGCT
(SEQ ID NO: 304) 58-12 1r AGTTGACACTTTGCTGGCCT
(SEQ ID NO: 305) 58-12 1rR GCTATGACCATGATTACGCCAGTTGACACTTTGCTGGCCT
(SEQ ID NO: 306) 58-13 1f CTCTGCATGGCTTAGGGACA
(SEQ ID NO: 307) 58-13 1fR GCTATGACCATGATTACGCCCTCTGCATGGCTTAGGGACA
(SEQ ID NO: 308) 58-13 1r GGCTGCTCTCTGCATTCTCT
(SEQ ID NO: 309) 58-13 1rR GCTATGACCATGATTACGCCGGCTGCTCTCTGCATTCTCT
(SEQ ID NO: 310) 58-14 1f CTGGCTTTAGCTTGCATTTCC
(SEQ ID NO: 311) 58-14 1fR GCTATGACCATGATTACGCCCTGGCTTTAGCTTGCATTTCC
(SEQ ID NO: 312) 58-14 1r TGCCTCAGTTTTCTCACCTGT
(SEQ ID NO: 313) 58-14 1rR GCTATGACCATGATTACGCCTGCCTCAGTTTTCTCACCTGT
(SEQ ID NO: 314) 58-15 1f CAAACAGCCACTGAGCATGT
(SEQ ID NO: 315) 58-15 1fR GCTATGACCATGATTACGCCCAAACAGCCACTGAGCATGT
(SEQ ID NO: 316) 58-15 1r TCCTCCTGTAGATGCCCAAG
(SEQ ID NO: 317) 58-15 1rR GCTATGACCATGATTACGCCTCCTCCTGTAGATGCCCAAG

TABLE 8
Primers designed by microsatellite rescue for genotyping and
restriction mapping of the IDDM4 region on chromosome 11q13.
The other primers used are published, and are also in the Genome
Database.
255CA3F GCCGAGAATTGTCATCTTAACT (SEQ ID NO: 318)
255CA3R GGATTGAAAGCTGCAAACTACA (SEQ ID NO: 319)
255CA5F GGAGCCACCACATCCAGTTA (SEQ ID NO: 320)
255CA5R TGGAGGGATTGCTTGAGG (SEQ ID NO: 321)
255CA6F AGGTGTACACCACCATGCCT (SEQ ID NO: 322)
255CA6R TGGTGCCAATTATTGCTGC (SEQ ID NO: 323)
14LCA5F AGATCTTATACACATGTGCGCG (SEQ ID NO: 324)
14LCA5R AGGTGACATCACTTACAGCGG (SEQ ID NO: 325)
L15CA1F ATTACCCAGGCATGGTGC (SEQ ID NO: 326)
L1SCA1R CAGGCACTTCTTCCAGGTCT (SEQ ID NO: 327)
18018ACF AGGGTTACACTGGAGTTTGC (SEQ ID NO: 328)
18018ACR AAACCTTCAATGTGTTCATTAAAAC (SEQ ID NO: 329)
E0864CAF TCAACTTTATTGGGGGTTTA (SEQ ID NO: 330)
E0864CAR AAGGTAAAAGTCCAAAATGG (SEQ ID NO: 331)
H0570POLYAF GGACAGTCAGTTATTGAAATG (SEQ ID NO: 332)
H0560POLYAR TTTCCTCTCTGGGAGTCTCT (SEQ ID NO: 333)
E0864CA was obtained from the cosmid E0864
H0570POLYA was obtained from the cosmid H0570
255CA5, 255CA3 and 255CA6 were obtained from the PAC2S5_m_19
14LCA5 and L15CA1 were obtained from the BAC 14_1_15
18018AC was obtained from the PAC 18_o_18

TABLE 9
PCR Primers for obtaining LRP-3 cDNA
A.) Primers located within humanLRP-3 cDNA: The primers
are numbered beginning at nucleotide 1 in FIG. 17 (a)
IF (muex 1f) (SEQ ID NO: 49)
ATGGAGCCCGAGTGAGC
200f (SEQ ID NO: 334)
TCAAGCTGGAGTCCACCATC
218R (27R) (SEQ ID NO: 50)
ATGGTGGACTCCAGCTTGAC
256F (1F) (SEQ ID NO: 51)
TTCCAGTTTTCCAAGGGAG
265R (26R) (SEQ ID NO: 52)
AAAACTGGAAGTCCACTGCG
318R (4R) (SEQ ID NO: 53)
GGTCTGCTTGATGGCCTC
343F (2F) (SEQ ID NO: 54)
GTGCAGAACGTGGTCATCT
361R (21R) (SEQ ID NO: 54)
GTGCAGAACGTGGTCATCT
622R (2R) (SEQ ID NO: 55)
AGTCCACAATGATCTTCCGG
638F (4F) (SEQ ID NO: 56)
CCAATGGACTGACCATCGAC
657R (1R) (SEQ ID NO: 57)
GTCGATGGTCAGTCCATTGG
936f (SEQ ID NO: 335)
CACTCGCTGTGAGGAGGAC
956R (22R) (SEQ ID NO: 58)
TTGTCCTCCTCACAGCGAG
1040f (51f) (SEQ ID NO: 336)
ACAACGGCAGGACGTGTAAG
1174f (40f) (SEQ ID NO: 337)
ATTGCCATCGACTACGACC
1277f (52f) (SEQ ID NO: 338)
TGGTCAACACCGAGATCAAC
1333f (SEQ ID NO: 339)
AACCTCTACTGGACCGACAC
1462f (41f) (SEQ ID NO: 340)
CTCATGTACTGGACAGACT
1481R (23R) (SEQ ID NO: 60)
CAGTCTGTCCAGTACATGAG
1607f (50f) (SEQ ID NO: 341)
GAGACGCCAAGACAGACAAG
1713F (21F) (SEQ ID NO: 59)
GGACTTCATCTACTGGACTG
1732r (40r) (SEQ ID NO: 342)
CAGTCCAGTAGATGAAGTCC
1904r (k275r) (SEQ ID NO: 343)
GTGAAGAAGCACAGGTGGCT
1960r (SEQ ID NO: 344)
TCATGTCACTCAGCAGCTCC
1981F (22F) (SEQ ID NO: 61)
GCCTTCTTGGTCTTCACCAG
2261F (23F) (SEQ ID NO: 62)
GGACCAACAGAATCGAAGTG
2484R (5R) (SEQ ID NO: 63)
GTCAATGGTGAGGTCGT
2519F (5F) (SEQ ID NO: 64)
ACACCAACATGATCGAGTCG
2780r (SEQ ID NO: 345)
CCGTTGTTGTGCATACAGTC
3011F (24F) (SEQ ID NO: 65)
ACAAGTTCATCTACTGGGTG
3154F (25F) (SEQ ID NO: 66)
CGGACACTGTTCTGGACGTG
3173R (25R) (SEQ ID NO: 67)
CACGTCCAGAACAGTGTCCG
3556R (3R) (SEQ ID NO: 68)
TCCAGTAGAGATGCTTGCCA
3577F (3F) (SEQ ID NO: 69)
ATCGAGCGTGTGGAGAAGAC
3851r (SEQ ID NO: 346)
GTGGCACATGCAAACTGGTC
4094F (30F) (SEQ ID NO: 70)
TCCTCATCAAACAGCAGTGC
4173R (6R) (SEQ ID NO: 71)
CGGCTTGGTGATTTCACAC
4687F (6F) (SEQ ID NO: 72)
GTGTGTGACAGCGACTACAGC
4707R (30R) (SEQ ID NO: 73)
GCTGTAGTCGCTGTCACACAC
5061R (7R) (SEQ ID NO: 74)
GTACAAAGTTCTCCCAGCCC
3′ end with XbaI site (SEQ ID NO: 347)
5069r
GCTCTAGAGTACAAAGTTCTCCCAGCCC
Soluble/HSV/His primers (SEQ ID NO: 348)
HLRP3_ His_primer1 (4203r)
ATCCTCGGGGTCTTCCGGGGCGAGTTCTGGCTGGCTACTGCTGTGGGCCGGGCT
HLRP3_His_primer2 (SEQ ID NO: 349)
TGGATATCTCAGTGGTGGTGGTGGTGGTGCTCGACATCCTCGGGGTCTTCCGG
G
HLRP3_ 5′_primer (49f) (SEQ ID NO: 350)
TAGAATTCGCCGCCACCATGGAGGCAGCGCCGCCC
B.) Mouse Lrp-3 cDNA primers.
The primers are numbered beginning at nucleotide 1 in FIG. 1 8(a).
13f(mulrp3 5f) (SEQ ID NO: 351)
GAGGCGGGAGCAAGAGG
68f(MucD 1f) (SEQ ID NO: 352)
GC Hind 3 CATGGAGCCCGAGTGAGC
69f(muex 1f) (SEQ ID NO: 353)
ATGGAGCCCGAGTGAGC
83r(muex 1r) (SEQ ID NO: 354)
TCACTCGGGCTCCATGG
171f(MucD 2f) (SEQ ID NO: 355)
TGCTGTACTGCAGCTTGGTC
300f(MucD 10F) (SEQ ID NO: 356)
ATGCAGCTGCTGTAGACTTCC
378r(mulrp3 3r) (SEQ ID NO: 357)
GTCTGTTTGATGGCCTCCTC
414r(MucD 7R) (SEQ ID NO: 358)
ATGTTCTGTGCAGCACCTCC
445r(mulrp3 4r) (SEQ ID NO: 359)
GCCATCAGGTGACACGAG
536f(MucD 11F) (SEQ ID NO: 360)
AAGGTTCTCTTCTGGCAGGAC
619r(MucD 12R) (SEQ ID NO: 361)
CCAGTCAGTCCAGTACATG
714f(museq 1f) (SEQ ID NO: 362)
TCGACCTGGAGGAACAGAAG
752f(mulrpAb 1f) (SEQ ID NO: 363)
AAGCTCAGCTTCATCCACCG
765r(MucD 8R) (SEQ ID NO: 364)
ATGAAGCTGAGCTTGGCATC
915f(MucD 12F) (SEQ ID NO: 365)
AGCAGAGGAAGGAGATCCTTAG
957r(MucD 9R) (SEQ ID NO: 366)
TCCATGGGTGAGTACAGAGC
1105r(museq 1r) (SEQ ID NO: 367)
ATTGTCCTGCAACTGCACAC
1232f(MucD 13F) (SEQ ID NO: 368)
GCCATTGCCATTGACTACG
1254r(MucD 10R) (SEQ ID NO: 369)
GGATCGTAGTCAATGGCAATG
1425f(MucD 14F) (SEQ ID NO: 370)
GAATTGAGGTGACTCGCCTC
1433r(MucD 18R) (SEQ ID NO: 371)
CCTCAATTCTGTAGTGCCTG
1501f(muxt 4f) (SEQ ID NO: 372)
TGTGTTGCACCCTGTGATG
1579r(MucD 11R) (SEQ ID NO: 373)
ATCTAGGTTGGCGCATTCG
1610r(MucD 13R) (SEQ ID NO: 374)
AGGTGTTCACCAGGACATG
1710r(mulrpAb 1r) (SEQ ID NO: 375)
GCGAGCTCCCGTCTATGTTGATCACCTCG
1868f(MucD 3f) (SEQ ID NO: 376)
GACCTGATGGGACTCAAAGC
2062r(MucD 2r) (SEQ ID NO: 377)
GCTGGTGAATACCAGGAAGG
2103f(MucD 4f) (SEQ ID NO: 378)
ACGATGTGGCTATCCCACTC
2422r(MucD 14R) (SEQ ID NO: 379)
AGTAGGATCCAGAGCCAGAG
2619f(MucD 5f) (SEQ ID NO: 380)
AGCGCATGGTGATAGCTGAC
2718r(MucD 3r) (SEQ ID NO: 381)
CGTTCAATGCTATGCAGGTTC
2892f(MucD 15F) (SEQ ID NO: 382)
GTGCTTCACACTACACGCTG
2959f(MucD 6f) (SEQ ID NO: 383)
CAGCCAGAAATTTGCCATC
3218r(MucD 4r) (SEQ ID NO: 384)
TCCGGCTGTAGATGTCAATG
3237f(MucD 7f) (SEQ ID NO: 385)
AGGCCACCAACACTATCAATG
3348r(MucD 52R) (SEQ ID NO: 386)
TACCCTCGCTCAGCATTGAC
3554f(MucD 8f) (SEQ ID NO: 387)
CTGGAAGATGCCAACATCG
3684r(MucD 5r) (SEQ ID NO: 388)
TGAACCCTAGTCCGCTTGTC
3848f(MucD 18F) (SEQ ID NO: 389)
CTGCAGAACCTGCTGACTTG
3973f(MucD 19F) (SEQ ID NO: 390)
CCAGAGTGATGAAGAAGGCTG
3981r(MucD 15R) (SEQ ID NO: 391)
TCACTCTGGTCAGCACACTC
4079f(MucD 16F) (SEQ ID NO: 392)
CAGGATCGCTCTGATGAAGC
4105r(MucD 53R) (SEQ ID NO: 393)
GCAGTTAGCTTCATCAGAGCG
4234f(MucD 9f) (SEQ ID NO: 394)
ACCCTCTGATGACATCCCAG
4270r(MucD 16R) (SEQ ID NO: 395)
AATGGCACTGCTGTGGGC
4497r(MucD 6r) (SEQ ID NO: 396)
AGGCTCATGGAGCTCATCAC
4589r(MucD 54R) (SEQ ID NO: 397)
ATAGTGTGGCCTTTGTGCTG
4703f(MucD 17F) (SEQ ID NO: 398)
GTCATTCGAGGTATGGCACC
4799r(MucD 17R) (SEQ ID NO: 399)
GGTAGTATTTGCTGCTCTTCC
5114r(MucD 1r) (SEQ ID NO: 400)
GC Xba I AAAGTTTCCCAGCCCTGCC
Soluble/adeno primers
3554f(MsolF) (SEQ ID NO: 401)
CTGGAAGATGCCAACATCG
4264r(MHiSR) (SEQ ID NO: 402)
GCTCTAGACTAGTGATGGTGATGGTGATGACTGCTGTGGGCTGGGATGTCATC
AGAGGGTGG

TABLE 10
Summary of Serum Chemistry Comparison of LRP3 treatment vs
control
Treatment
Mouse (% diff ± p-value
Variable Type SE) (Treatment)
triglycerides WT + KO −30 ± 14 0.025
alkaline WT + KO −49 ± 15 0.001
phosphatase#
total KO only −28 ± 15 0.073
cholesterol
total WT only 30 ± 13 0.080
cholesterol
AST# WT + KO 8 ± 66 0.912
ALT# WT + KO −34 ± 51 0.431
BUN WT + KO −19 ± 15 0.195
#statistically significantly higher baseline values for controls.

TABLE 11
Summary for Blood Chemistry Variables Pooled over Knockout and Wild-Type Mice
Treat Animal baseline post-treat % change p-value
Variable Group Type n (mean ± % CV) (mean ± % CV) t change (95% CI) (% chg)
trigly (mg/dL) Control POOLED 10 86 ± 13% 186 ± 35% 100 115% (61, 189) <0.001
trigly (mg/dL) LDL POOLED 9 92 ± 31%  81 ± 55% −12 −13% (−35, 17) 0.321
trigly (mg/dL) LRP3 POOLED 8 99 ± 24% 128 ± 36% 29 30% (−10, 86) 0.133
alkphos (U/L) Control POOLED 10 190 ± 19% 374 ± 30% 184 97% (68, 130) <0.001
alkphos (U/L) LDL POOLED 9 162 ± 12% 193 ± 29% 31 19% (−1, 43) 0.061
alkphos (U/L) LRP3 POOLED 8 154 ± 13% 146 ± 35% −8 −5% (−24, 19) 0.604
totchol (mg/dL) Control POOLED 10 116 ± 69% 176 ± 86% 60 51% (21, 89) 0.002
totchol (mg/dL) LDL POOLED 9 124 ± 58%  87 ± 68% −37 −30% (−41, −17) 0.001
totchol (mg/dL) LRP3 POOLED 8 127 ± 62% 166 ± 57% 39 30% (9, 56) 0.009
AST (U/L) Control POOLED 9 41 ± 22% 821 ± 69% 780 1894% (1142, 3101) <0.001
AST (U/L) LDL POOLED 8 41 ± 25% 362 ± 61% 320 772% (369, 1520) <0.001
AST (U/L) LRP3 POOLED 8 33 ± 21%  989 ± 129% 955 2888% (953, 8380) <0.001
ALT (U/L) Control POOLED 10 33 ± 15% 624 ± 59% 591 1798% (1203, 2665) <0.001
ALT (U/L) LDL POOLED 8 32 ± 36% 331 ± 42% 299 938% (447, 1872) <0.001
ALT (U/L) LRP3 POOLED 8 25 ± 35% 1020 ± 157% 994 3944% (861, 16921) <0.001
BUN (U/L) Control POOLED 8 29 ± 12%  23 ± 11% −5 −19% (−29, −7) 0.008
BUN (U/L) LDL POOLED 9 28 ± 19%  25 ± 14% −3 −12% (−22, 1) 0.062
BUN (U/L) LRP3 POOLED 8 28 ± 12%  19 ± 41% −9 −31% (−53, 2) 0.058
Note means given are geometric means.
p-value is from a 2-sided paired t-test.

TABLE 12
Regions of
Sequence Similarity
Between Human and
Mouse LRP-3
Location in Human Nucleotide Percent BLAST Exon
Sequence Length Identity Score Name
Contig 31
20235-20271 37 86 140
24410-24432 23 86 88
24464-24667 204 82 168, 223 6
24904-24995 52 82 179
25489-25596 108 81 360
26027-26078 52 80 170
26192-26261 70 84 251
26385-26486 102 87 393
28952-28993 42 85 156
41707-41903 197 90 823
42827-42898 66 81 222
43468-43585 117 85 316
50188-50333 146 86 550
54455-54494 40 80 128
54718-54750 33 87 129
59713-60123 411 87 1587 A
78536-78680 145 80 473 D
87496-87548 53 88 211
87598-87717 120 84 429
90772-90819 48 85 177
99457-99795 339 83 1182 E
103094-103281 188 83 661 F
116659-116954 296 81 985 G
119754-120089 336 83 1167 H
Contig 30
8920-9256 337 89 1026 K
11238-11353 116 84 *418 L
18394-18648 255 80 825 M
20020-20224 205 84 746 N
20926-21153 228 83 807 0
24955-25155 201 82 672 P
29126-19288 163 74 *437 Q
33874-34033 160 85 *593 S
35205-35340 136 86 509 T
41911—41911 55 80 *176 U
44629-44681 53 73 *249 V

455 5098 base pairs nucleic acid single linear 1 ATGGAGCCCG AGTGAGCGCG GCGCGGGCCC GTCCGGCCGC CGGACAACAT GGAGGCAGCG 60 CCGCCCGGGC CGCCGTGGCC GCTGCTGCTG CTGCTGCTGC TGCTGCTGGC GCTGTGCGGC 120 TGCCCGGCCC CCGCCGCGGC CTCGCCGCTC CTGCTATTTG CCAACCGCCG GGACGTACGG 180 CTGGTGGACG CCGGCGGAGT CAAGCTGGAG TCCACCATCG TGGTCAGCGG CCTGGAGGAT 240 GCGGCCGCAG TGGACTTCCA GTTTTCCAAG GGAGCCGTGT ACTGGACAGA CGTGAGCGAG 300 GAGGCCATCA AGCAGACCTA CCTGAACCAG ACGGGGGCCG CCGTGCAGAA CGTGGTCATC 360 TCCGGCCTGG TCTCTCCCGA CGGCCTCGCC TGCGACTGGG TGGGCAAGAA GCTGTACTGG 420 ACGGACTCAG AGACCAACCG CATCGAGGTG GCCAACCTCA ATGGCACATC CCGGAAGGTG 480 CTCTTCTGGC AGGACCTTGA CCAGCCGAGG GCCATCGCCT TGGACCCCGC TCACGGGTAC 540 ATGTACTGGA CAGACTGGGG TGAGACGCCC CGGATTGAGC GGGCAGGGAT GGATGGCAGC 600 ACCCGGAAGA TCATTGTGGA CTCGGACATT TACTGGCCCA ATGGACTGAC CATCGACCTG 660 GAGGAGCAGA AGCTCTACTG GGCTGACGCC AAGCTCAGCT TCATCCACCG TGCCAACCTG 720 GACGGCTCGT TCCGGCAGAA GGTGGTGGAG GGCAGCCTGA CGCACCCCTT CGCCCTGACG 780 CTCTCCGGGG ACACTCTGTA CTGGACAGAC TGGCAGACCC GCTCCATCCA TGCCTGCAAC 840 AAGCGCACTG GGGGGAAGAG GAAGGAGATC CTGAGTGCCC TCTACTCACC CATGGACATC 900 CAGGTGCTGA GCCAGGAGCG GCAGCCTTTC TTCCACACTC GCTGTGAGGA GGACAATGGC 960 GGCTGCTCCC ACCTGTGCCT GCTGTCCCCA AGCGAGCCTT TCTACACATG CGCCTGCCCC 1020 ACGGGTGTGC AGCTGCAGGA CAACGGCAGG ACGTGTAAGG CAGGAGCCGA GGAGGTGCTG 1080 CTGCTGGCCC GGCGGACGGA CCTACGGAGG ATCTCGCTGG ACACGCCGGA CTTTACCGAC 1140 ATCGTGCTGC AGGTGGACGA CATCCGGCAC GCCATTGCCA TCGACTACGA CCCGCTAGAG 1200 GGCTATGTCT ACTGGACAGA TGACGAGGTG CGGGCCATCC GCAGGGCGTA CCTGGACGGG 1260 TCTGGGGCGC AGACGCTGGT CAACACCGAG ATCAACGACC CCGATGGCAT CGCGGTCGAC 1320 TGGGTGGCCC GAAACCTCTA CTGGACCGAC ACGGGCACGG ACCGCATCGA GGTGACGCGC 1380 CTCAACGGCA CCTCCCGCAA GATCCTGGTG TCGGAGGACC TGGACGAGCC CCGAGCCATC 1440 GCACTGCACC CCGTGATGGG CCTCATGTAC TGGACAGACT GGGGAGAGAA CCCTAAAATC 1500 GAGTGTGCCA ACTTGGATGG GCAGGAGCGG CGTGTGCTGG TCAATGCCTC CCTCGGGTGG 1560 CCCAACGGCC TGGCCCTGGA CCTGCAGGAG GGGAAGCTCT ACTGGGGAGA CGCCAAGACA 1620 GACAAGATCG AGGTGATCAA TGTTGATGGG ACGAAGAGGC GGACCCTCCT GGAGGACAAG 1680 CTCCCGCACA TTTTCGGGTT CACGCTGCTG GGGGACTTCA TCTACTGGAC TGACTGGCAG 1740 CGCCGCAGCA TCGAGCGGGT GCACAAGGTC AAGGCCAGCC GGGACGTCAT CATTGACCAG 1800 CTGCCCGACC TGATGGGGCT CAAAGCTGTG AATGTGGCCA AGGTCGTCGG AACCAACCCG 1860 TGTGCGGACA GGAACGGGGG GTGCAGCCAC CTGTGCTTCT TCACACCCCA CGCAACCCGG 1920 TGTGGCTGCC CCATCGGCCT GGAGCTGCTG AGTGACATGA AGACCTGCAT CGTGCCTGAG 1980 GCCTTCTTGG TCTTCACCAG CAGAGCCGCC ATCCACAGGA TCTCCCTCGA GACCAATAAC 2040 AACGACGTGC CATCCCGCTC ACGGGCGTCA AGGAGGCCTC AGCCCTGGAC TTTGATGTGT 2100 CCAACAACCA CATCTACTGG ACAGACGTCA GCCTGAAGAC CATCAGCCGC GCCTTCATGA 2160 ACGGGAGCTC GGTGGAGCAC GTGGTGGAGT TTGGCCTTGA CTACCCCGAG GGCATGGCCG 2220 TTGACTGGAT GGGCAAGAAC CTCTACTGGG CCGACACTGG GACCAACAGA ATCGAAGTGG 2280 CGCGGCTGGA CGGGCAGTTC CGGCAAGTCC TCGTGTGGAG GGACTTGGAC AACCCGAGGT 2340 CGCTGGCCCT GGATCCCACC AAGGGCTACA TCTACTGGAC CGAGTGGGGC GGCAAGCCGA 2400 GGATCGTGCG GGCCTTCATG GACGGGACCA ACTGCATGAC GCTGGTGGAC AAGGTGGGCC 2460 GGGCCAACGA CCTCACCATT GACTACGCTG ACCAGCGCCT CTACTGGACC GACCTGGACA 2520 CCAACATGAT CGAGTCGTCC AACATGCTGG GTCAGGAGCG GGTCGTGATT GCCGACGATC 2580 TCCCGCACCC GTTCGGTCTG ACGCAGTACA GCGATTATAT CTACTGGACA GACTGGAATC 2640 TGCACAGCAT TGAGCGGGCC GACAAGACTA GCGGCCGGAA CCGCACCCTC ATCCAGGGCC 2700 ACCTGGACTT CGTGATGGAC ATCCTGGTGT TCCACTCCTC CCGCCAGGAT GGCCTCAATG 2760 ACTGTATGCA CAACAACGGG CAGTGTGGGC AGCTGTGCCT TGCCATCCCC GGCGGCCACC 2820 GCTGCGGCTG CGCCTCACAC TACACCCTGG ACCCCAGCAG CCGCAACTGC AGCCCGCCCA 2880 CCACCTTCTT GCTGTTCAGC CAGAAATCTG CCATCAGTCG GATGATCCCG GACGACCAGC 2940 ACAGCCCGGA TCTCATCCTG CCCCTGCATG GACTGAGGAA CGTCAAAGCC ATCGACTATG 3000 ACCCACTGGA CAAGTTCATC TACTGGGTGG ATGGGCGCCA GAACATCAAG CGAGCCAAGG 3060 ACGACGGGAC CCAGCCCTTT GTTTTGACCT CTCTGAGCCA AGGCCAAAAC CCAGACAGGC 3120 AGCCCCACGA CCTCAGCATC GACATCTACA GCCGGACACT GTTCTGGACG TGCGAGGCCA 3180 CCAATACCAT CAACGTCCAC AGGCTGAGCG GGGAAGCCAT GGGGGTGGTG CTGCGTGGGG 3240 ACCGCGACAA GCCCAGGGCC ATCGTCGTCA ACGCGGAGCG AGGGTACCTG TACTTCACCA 3300 ACATGCAGGA CCGGGCAGCC AAGATCGAAC GCGCAGCCCT GGACGGCACC GAGCGCGAGG 3360 TCCTCTTCAC CACCGGCCTC ATCCGCCCTG TGGCCCTGGT GGTAGACAAC ACACTGGGCA 3420 AGCTGTTCTG GGTGGACGCG GACCTGAAGC GCATTGAGAG CTGTGACCTG TCAGGGGCCA 3480 ACCGCCTGAC CCTGGAGGAC GCCAACATCG TGCAGCCTCT GGGCCTGACC ATCCTTGGCA 3540 AGCATCTCTA CTGGATCGAC CGCCAGCAGC AGATGATCGA GCGTGTGGAG AAGACCACCG 3600 GGGACAAGCG GACTCGCATC CAGGGCCGTG TCGCCCACCT CACTGGCATC CATGCAGTGG 3660 AGGAAGTCAG CCTGGAGGAG TTCTCAGCCC ACCCATGTGC CCGTGACAAT GGTGGCTGCT 3720 CCCACATCTG TATTGCCAAG GGTGATGGGA CACCACGGTG CTCATGCCCA GTCCACCTCG 3780 TGCTCCTGCA GAACCTGCTG ACCTGTGGAG AGCCGCCCAC CTGCTCCCCG GACCAGTTTG 3840 CATGTGCCAC AGGGGAGATC GACTGTATCC CCGGGGCCTG GCGCTGTGAC GGCTTTCCCG 3900 AGTGCGATGA CCAGAGCGAC GAGGAGGGCT GCCCCGTGTG CTCCGCCGCC CAGTTCCCCT 3960 GCGCGCGGGG TCAGTGTGTG GACCTGCGCC TGCGCTGCGA CGGCGAGGCA GACTGTCAGG 4020 ACCGCTCAGA CGAGGCGGAC TGTGACGCCA TCTGCCTGCC CAACCAGTTC CGGTGTGCGA 4080 GCGGCCAGTG TGTCCTATCA AACAGCAGTG CGACTCCTTC CCCGACTGTA TCGACGGCTC 4140 CGACGAGCTC ATGTGTGAAA TCACCAAGCC GCCCTCAGAC GACAGCCCGG CCCACAGCAG 4200 TGCCATCGGG CCCGTCATTG GCATCATCCT CTCTCTCTTC GTCATGGGTG GTGTCTATTT 4260 TGTGTGCCAG CGCGTGGTGT GCCAGCGCTA TGCGGGGGCC AACGGGCCCT TCCCGCACGA 4320 GTATGTCAGC GGGACCCCGC ACGTGCCCCT CAATTTCATA GCCCCGGGCG GTTCCCAGCA 4380 TGGCCCCTTC ACAGGCATCG CATGCGGAAA GTCCATGATG AGCTCCGTGA GCCTGATGGG 4440 GGGCCGGGGC GGGGTGCCCC TCTACGACCG GAACCACGTC ACAGGGGCCT CGTCCAGCAG 4500 CTCGTCCAGC ACGAAGGCCA CGCTGTACCC GCCGATCCTG AACCCGCCGC CCTCCCCGGC 4560 CACGGACCCC TCCCTGTACA ACATGGACAT GTTCTACTCT TCAAACATTC CGGCCACTGT 4620 GAGACCGTAC AGGCCCTACA TCATTCGAGG AATGGCGCCC CCGACGACGC CCTGCAGCAC 4680 CGACGTGTGT GACAGCGACT ACAGCGCCAG CCGCTGGAAG GCCAGCAAGT ACTACCTGGA 4740 TTTGAACTCG GACTCAGACC CCTATCCACC CCCACCCACG CCCCACAGCC AGTACCTGTC 4800 GGCGGAGGAC AGCTGCCCGC CCTCGCCCGC CACCGAGAGG AGCTACTTCC ATCTCTTCCC 4860 GCCCCCTCCG TCCCCCTGCA CGGACTCATC CTGACCTCGG CCGGGCCACT CTGGCTTCTC 4920 TGTGCCCCTG TAAATAGTTT TAAATATGAA CAAAGAAAAA AATATATTTT ATGATTTAAA 4980 AAATAAATAT AATTGGGATT TTAAAAACAT GAGAAATGTG AACTGTGATG GGGTGGGCAG 5040 GGCTGGGAGA ACTTTGTACA GTGGAACAAA TATTTATAAA CTTAATTTTG TAAAACAG 5098 4843 base pairs nucleic acid single linear 2 ATGGAGGCAG CGCCGCCCGG GCCGCCGTGG CCGCTGCTGC TGCTGCTGCT GCTGCTGCTG 60 GCGCTGTGCG GCTGCCCGGC CCCCGCCGCG GCCTCGCCGC TCCTGCTATT TGCCAACCGC 120 CGGGACGTAC GGCTGGTGGA CGCCGGCGGA GTCAAGCTGG AGTCCACCAT CGTGGTCAGC 180 GGCCTGGAGG ATGCGGCCGC AGTGGACTTC CAGTTTTCCA AGGGAGCCGT GTACTGGACA 240 GACGTGAGCG AGGAGGCCAT CAAGCAGACC TACCTGAACC AGACGGGGGC CGCCGTGCAG 300 AACGTGGTCA TCTCCGGCCT GGTCTCTCCC GACGGCCTCG CCTGCGACTG GGTGGGCAAG 360 AAGCTGTACT GGACGGACTC AGAGACCAAC CGCATCGAGG TGGCCAACCT CAATGGCACA 420 TCCCGGAAGG TGCTCTTCTG GCAGGACCTT GACCAGCCGA GGGCCATCGC CTTGGACCCC 480 GCTCACGGGT ACATGTACTG GACAGACTGG GGTGAGACGC CCCGGATTGA GCGGGCAGGG 540 ATGGATGGCA GCACCCGGAA GATCATTGTG GACTCGGACA TTTACTGGCC CAATGGACTG 600 ACCATCGACC TGGAGGAGCA GAAGCTCTAC TGGGCTGACG CCAAGCTCAG CTTCATCCAC 660 CGTGCCAACC TGGACGGCTC GTTCCGGCAG AAGGTGGTGG AGGGCAGCCT GACGCACCCC 720 TTCGCCCTGA CGCTCTCCGG GGACACTCTG TACTGGACAG ACTGGCAGAC CCGCTCCATC 780 CATGCCTGCA ACAAGCGCAC TGGGGGGAAG AGGAAGGAGA TCCTGAGTGC CCTCTACTCA 840 CCCATGGACA TCCAGGTGCT GAGCCAGGAG CGGCAGCCTT TCTTCCACAC TCGCTGTGAG 900 GAGGACAATG GCGGCTGCTC CCACCTGTGC CTGCTGTCCC CAAGCGAGCC TTTCTACACA 960 TGCGCCTGCC CCACGGGTGT GCAGCTGCAG GACAACGGCA GGACGTGTAA GGCAGGAGCC 1020 GAGGAGGTGC TGCTGCTGGC CCGGCGGACG GACCTACGGA GGATCTCGCT GGACACGCCG 1080 GACTTTACCG ACATCGTGCT GCAGGTGGAC GACATCCGGC ACGCCATTGC CATCGACTAC 1140 GACCCGCTAG AGGGCTATGT CTACTGGACA GATGACGAGG TGCGGGCCAT CCGCAGGGCG 1200 TACCTGGACG GGTCTGGGGC GCAGACGCTG GTCAACACCG AGATCAACGA CCCCGATGGC 1260 ATCGCGGTCG ACTGGGTGGC CCGAAACCTC TACTGGACCG ACACGGGCAC GGACCGCATC 1320 GAGGTGACGC GCCTCAACGG CACCTCCCGC AAGATCCTGG TGTCGGAGGA CCTGGACGAG 1380 CCCCGAGCCA TCGCACTGCA CCCCGTGATG GGCCTCATGT ACTGGACAGA CTGGGGAGAG 1440 AACCCTAAAA TCGAGTGTGC CAACTTGGAT GGGCAGGAGC GGCGTGTGCT GGTCAATGCC 1500 TCCCTCGGGT GGCCCAACGG CCTGGCCCTG GACCTGCAGG AGGGGAAGCT CTACTGGGGA 1560 GACGCCAAGA CAGACAAGAT CGAGGTGATC AATGTTGATG GGACGAAGAG GCGGACCCTC 1620 CTGGAGGACA AGCTCCCGCA CATTTTCGGG TTCACGCTGC TGGGGGACTT CATCTACTGG 1680 ACTGACTGGC AGCGCCGCAG CATCGAGCGG GTGCACAAGG TCAAGGCCAG CCGGGACGTC 1740 ATCATTGACC AGCTGCCCGA CCTGATGGGG CTCAAAGCTG TGAATGTGGC CAAGGTCGTC 1800 GGAACCAACC CGTGTGCGGA CAGGAACGGG GGGTGCAGCC ACCTGTGCTT CTTCACACCC 1860 CACGCAACCC GGTGTGGCTG CCCCATCGGC CTGGAGCTGC TGAGTGACAT GAAGACCTGC 1920 ATCGTGCCTG AGGCCTTCTT GGTCTTCACC AGCAGAGCCG CCATCCACAG GATCTCCCTC 1980 GAGACCAATA ACAACGACGT GGCCATCCCG CTCACGGGCG TCAAGGAGGC CTCAGCCCTG 2040 GACTTTGAGT GTCCAACAAC CACATCTACT GGACAGACGT CAGCCTGAAG ACCATCAGCC 2100 GCGCCTTCAT GAACGGGAGC TCGGTGGAGC ACGTGGTGGA GTTTGGCCTT GACTACCCCG 2160 AGGGCATGGC CGTTGACTGG ATGGGCAAGA ACCTCTACTG GGCCGACACT GGGACCAACA 2220 GAATCGAAGT GGCGCGGCTG GACGGGCAGT TCCGGCAAGT CCTCGTGTGG AGGGACTTGG 2280 ACAACCCGAG GTCGCTGGCC CTGGATCCCA CCAAGGGCTA CATCTACTGG ACCGAGTGGG 2340 GCGGCAAGCC GAGGATCGTG CGGGCCTTCA TGGACGGGAC CAACTGCATG ACGCTGGTGG 2400 ACAAGGTGGG CCGGGCCAAC GACCTCACCA TTGACTACGC TGACCAGCGC CTCTACTGGA 2460 CCGACCTGGA CACCAACATG ATCGAGTCGT CCAACATGCT GGGTCAGGAG CGGGTCGTGA 2520 TTGCCGACGA TCTCCCGCAC CCGTTCGGTC TGACGCAGTA CAGCGATTAT ATCTACTGGA 2580 CAGACTGGAA TCTGCACAGC ATTGAGCGGG CCGACAAGAC TAGCGGCCGG AACCGCACCC 2640 TCATCCAGGG CCACCTGGAC TTCGTGATGG ACATCCTGGT GTTCCACTCC TCCCGCCAGG 2700 ATGGCCTCAA TGACTGTATG CACAACAACG GGCAGTGTGG GCAGCTGTGC CTTGCCATCC 2760 CCGGCGGCCA CCGCTGCGGC TGCGCCTCAC ACTACACCCT GGACCCCAGC AGCCGCAACT 2820 GCAGCCCGCC CACCACCTTC TTGCTGTTCA GCCAGAAATC TGCCATCAGT CGGATGATCC 2880 CGGACGACCA GCACAGCCCG GATCTCATCC TGCCCCTGCA TGGACTGAGG AACGTCAAAG 2940 CCATCGACTA TGACCCACTG GACAAGTTCA TCTACTGGGT GGATGGGCGC CAGAACATCA 3000 AGCGAGCCAA GGACGACGGG ACCCAGCCCT TTGTTTTGAC CTCTCTGAGC CAAGGCCAAA 3060 ACCCAGACAG GCAGCCCCAC GACCTCAGCA TCGACATCTA CAGCCGGACA CTGTTCTGGA 3120 CGTGCGAGGC CACCAATACC ATCAACGTCC ACAGGCTGAG CGGGGAAGCC ATGGGGGTGG 3180 TGCTGCGTGG GGACCGCGAC AAGCCCAGGG CCATCGTCGT CAACGCGGAG CGAGGGTACC 3240 TGTACTTCAC CAACATGCAG GACCGGGCAG CCAAGATCGA ACGCGCAGCC CTGGACGGCA 3300 CCGAGCGCGA GGTCCTCTTC ACCACCGGCC TCATCCGCCC TGTGGCCCTG GTGGTAGACA 3360 ACACACTGGG CAAGCTGTTC TGGGTGGACG CGGACCTGAA GCGCATTGAG AGCTGTGACC 3420 TGTCAGGGGC CAACCGCCTG ACCCTGGAGG ACGCCAACAT CGTGCAGCCT CTGGGCCTGA 3480 CCATCCTTGG CAAGCATCTC TACTGGATCG ACCGCCAGCA GCAGATGATC GAGCGTGTGG 3540 AGAAGACCAC CGGGGACAAG CGGACTCGCA TCCAGGGCCG TGTCGCCCAC CTCACTGGCA 3600 TCCATGCAGT GGAGGAAGTC AGCCTGGAGG AGTTCTCAGC CCACCCATGT GCCCGTGACA 3660 ATGGTGGCTG CTCCCACATC TGTATTGCCA AGGGTGATGG GACACCACGG TGCTCATGCC 3720 CAGTCCACCT CGTGCTCCTG CAGAACCTGC TGACCTGTGG AGAGCCGCCC ACCTGCTCCC 3780 CGGACCAGTT TGCATGTGCC ACAGGGGAGA TCGACTGTAT CCCCGGGGCC TGGCGCTGTG 3840 ACGGCTTTCC CGAGTGCGAT GACCAGAGCG ACGAGGAGGG CTGCCCCGTG TGCTCCGCCG 3900 CCCAGTTCCC CTGCGCGCGG GGTCAGTGTG TGGACCTGCG CCTGCGCTGC GACGGCGAGG 3960 CAGACTGTCA GGACCGCTCA GACGAGGCGG ACTGTGACGC CATCTGCCTG CCCAACCAGT 4020 TCCGGTGTGC GAGCGGCCAG TGTGTCCTCA TCAAACAGCA GTGCGACTCC TTCCCCGACT 4080 GTATCGACGG CTCCGAGAGC TCATGTGTGA AATCACCAAG CCGCCCTCAG ACGACAGCCC 4140 GGCCCACAGC AGTGCCATCG GGCCCGTCAT TGGCATCATC CTCTCTCTCT TCGTCATGGG 4200 TGGTGTCTAT TTTGTGTGCC AGCGCGTGGT GTGCCAGCGC TATGCGGGGG CCAACGGGCC 4260 CTTCCCGCAC GAGTATGTCA GCGGGACCCC GCACGTGCCC CTCAATTTCA TAGCCCCGGG 4320 CGGTTCCCAG CATGGCCCCT TCACAGGCAT CGCATGCGGA AAGTCCATGA TGAGCTCCGT 4380 GAGCCTGATG GGGGGCCGGG GCGGGGTGCC CCTCTACGAC CGGAACCACG TCACAGGGGC 4440 CTCGTCCAGC AGCTCGTCCA GCACGAAGGC CACGCTGTAC CCGCCGATCC TGAACCCGCC 4500 GCCCTCCCCG GCCACGGACC CCTCCCTGTA CAACATGGAC ATGTTCTACT CTTCAAACAT 4560 TCCGGCCACT GTGAGACCGT ACAGGCCCTA CATCATTCGA GGAATGGCGC CCCCGACGAC 4620 GCCCTGCAGC ACCGACGTGT GTGACAGCGA CTACAGCGCC AGCCGCTGGA AGGCCAGCAA 4680 GTACTACCTG GATTTGAACT CGGACTCAGA CCCCTATCCA CCCCCACCCA CGCCCCACAG 4740 CCAGTACCTG TCGGCGGAGG ACAGCTGCCC GCCCTCGCCC GCCACCGAGA GGAGCTACTT 4800 CCATCTCTTC CCGCCCCCTC CGTCCCCCTG CACGGACTCA TCC 4843 1615 amino acids amino acid linear 3 Met Glu Ala Ala Pro Pro Gly Pro Pro Trp Pro Leu Leu Leu Leu Leu 1 5 10 15 Leu Leu Leu Leu Ala Leu Cys Gly Cys Pro Ala Pro Ala Ala Ala Ser 20 25 30 Pro Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu Val Asp Ala 35 40 45 Gly Gly Val Lys Leu Glu Ser Thr Ile Val Val Ser Gly Leu Glu Asp 50 55 60 Ala Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val Tyr Trp Thr 65 70 75 80 Asp Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn Gln Thr Gly 85 90 95 Ala Ala Val Gln Asn Val Val Ile Ser Gly Leu Val Ser Pro Asp Gly 100 105 110 Leu Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr Asp Ser Glu 115 120 125 Thr Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser Arg Lys Val 130 135 140 Leu Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala Leu Asp Pro 145 150 155 160 Ala His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Thr Pro Arg Ile 165 170 175 Glu Arg Ala Gly Met Asp Gly Ser Thr Arg Lys Ile Ile Val Asp Ser 180 185 190 Asp Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln Lys 195 200 205 Leu Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn Leu 210 215 220 Asp Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu Thr His Pro 225 230 235 240 Phe Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp Gln 245 250 255 Thr Arg Ser Ile His Ala Cys Asn Lys Arg Thr Gly Gly Lys Arg Lys 260 265 270 Glu Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu Ser 275 280 285 Gln Glu Arg Gln Pro Phe Phe His Thr Arg Cys Glu Glu Asp Asn Gly 290 295 300 Gly Cys Ser His Leu Cys Leu Leu Ser Pro Ser Glu Pro Phe Tyr Thr 305 310 315 320 Cys Ala Cys Pro Thr Gly Val Gln Leu Gln Asp Asn Gly Arg Thr Cys 325 330 335 Lys Ala Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp Leu 340 345 350 Arg Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu Gln 355 360 365 Val Asp Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu Glu 370 375 380 Gly Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg Ala 385 390 395 400 Tyr Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile Asn 405 410 415 Asp Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr Trp 420 425 430 Thr Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly Thr 435 440 445 Ser Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala Ile 450 455 460 Ala Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly Glu 465 470 475 480 Asn Pro Lys Ile Glu Cys Ala Asn Leu Asp Gly Gln Glu Arg Arg Val 485 490 495 Leu Val Asn Ala Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp Leu 500 505 510 Gln Glu Gly Lys Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile Glu 515 520 525 Val Ile Asn Val Asp Gly Thr Lys Arg Arg Thr Leu Leu Glu Asp Lys 530 535 540 Leu Pro His Ile Phe Gly Phe Thr Leu Leu Gly Asp Phe Ile Tyr Trp 545 550 555 560 Thr Asp Trp Gln Arg Arg Ser Ile Glu Arg Val His Lys Val Lys Ala 565 570 575 Ser Arg Asp Val Ile Ile Asp Gln Leu Pro Asp Leu Met Gly Leu Lys 580 585 590 Ala Val Asn Val Ala Lys Val Val Gly Thr Asn Pro Cys Ala Asp Arg 595 600 605 Asn Gly Gly Cys Ser His Leu Cys Phe Phe Thr Pro His Ala Thr Arg 610 615 620 Cys Gly Cys Pro Ile Gly Leu Glu Leu Leu Ser Asp Met Lys Thr Cys 625 630 635 640 Ile Val Pro Glu Ala Phe Leu Val Phe Thr Ser Arg Ala Ala Ile His 645 650 655 Arg Ile Ser Leu Glu Thr Asn Asn Asn Asp Val Ala Ile Pro Leu Thr 660 665 670 Gly Val Lys Glu Ala Ser Ala Leu Asp Phe Asp Val Ser Asn Asn His 675 680 685 Ile Tyr Trp Thr Asp Val Ser Leu Lys Thr Ile Ser Arg Ala Phe Met 690 695 700 Asn Gly Ser Ser Val Glu His Val Val Glu Phe Gly Leu Asp Tyr Pro 705 710 715 720 Glu Gly Met Ala Val Asp Trp Met Gly Lys Asn Leu Tyr Trp Ala Asp 725 730 735 Thr Gly Thr Asn Arg Ile Glu Val Ala Arg Leu Asp Gly Gln Phe Arg 740 745 750 Gln Val Leu Val Trp Arg Asp Leu Asp Asn Pro Arg Ser Leu Ala Leu 755 760 765 Asp Pro Thr Lys Gly Tyr Ile Tyr Trp Thr Glu Trp Gly Gly Lys Pro 770 775 780 Arg Ile Val Arg Ala Phe Met Asp Gly Thr Asn Cys Met Thr Leu Val 785 790 795 800 Asp Lys Val Gly Arg Ala Asn Asp Leu Thr Ile Asp Tyr Ala Asp Gln 805 810 815 Arg Leu Tyr Trp Thr Asp Leu Asp Thr Asn Met Ile Glu Ser Ser Asn 820 825 830 Met Leu Gly Gln Glu Arg Val Val Ile Ala Asp Asp Leu Pro His Pro 835 840 845 Phe Gly Leu Thr Gln Tyr Ser Asp Tyr Ile Tyr Trp Thr Asp Trp Asn 850 855 860 Leu His Ser Ile Glu Arg Ala Asp Lys Thr Ser Gly Arg Asn Arg Thr 865 870 875 880 Leu Ile Gln Gly His Leu Asp Phe Val Met Asp Ile Leu Val Phe His 885 890 895 Ser Ser Arg Gln Asp Gly Leu Asn Asp Cys Met His Asn Asn Gly Gln 900 905 910 Cys Gly Gln Leu Cys Leu Ala Ile Pro Gly Gly His Arg Cys Gly Cys 915 920 925 Ala Ser His Tyr Thr Leu Asp Pro Ser Ser Arg Asn Cys Ser Pro Pro 930 935 940 Thr Thr Phe Leu Leu Phe Ser Gln Lys Ser Ala Ile Ser Arg Met Ile 945 950 955 960 Pro Asp Asp Gln His Ser Pro Asp Leu Ile Leu Pro Leu His Gly Leu 965 970 975 Arg Asn Val Lys Ala Ile Asp Tyr Asp Pro Leu Asp Lys Phe Ile Tyr 980 985 990 Trp Val Asp Gly Arg Gln Asn Ile Lys Arg Ala Lys Asp Asp Gly Thr 995 1000 1005 Gln Pro Phe Val Leu Thr Ser Leu Ser Gln Gly Gln Asn Pro Asp Arg 1010 1015 1020 Gln Pro His Asp Leu Ser Ile Asp Ile Tyr Ser Arg Thr Leu Phe Trp 1025 1030 1035 1040 Thr Cys Glu Ala Thr Asn Thr Ile Asn Val His Arg Leu Ser Gly Glu 1045 1050 1055 Ala Met Gly Val Val Leu Arg Gly Asp Arg Asp Lys Pro Arg Ala Ile 1060 1065 1070 Val Val Asn Ala Glu Arg Gly Tyr Leu Tyr Phe Thr Asn Met Gln Asp 1075 1080 1085 Arg Ala Ala Lys Ile Glu Arg Ala Ala Leu Asp Gly Thr Glu Arg Glu 1090 1095 1100 Val Leu Phe Thr Thr Gly Leu Ile Arg Pro Val Ala Leu Val Val Asp 1105 1110 1115 1120 Asn Thr Leu Gly Lys Leu Phe Trp Val Asp Ala Asp Leu Lys Arg Ile 1125 1130 1135 Glu Ser Cys Asp Leu Ser Gly Ala Asn Arg Leu Thr Leu Glu Asp Ala 1140 1145 1150 Asn Ile Val Gln Pro Leu Gly Leu Thr Ile Leu Gly Lys His Leu Tyr 1155 1160 1165 Trp Ile Asp Arg Gln Gln Gln Met Ile Glu Arg Val Glu Lys Thr Thr 1170 1175 1180 Gly Asp Lys Arg Thr Arg Ile Gln Gly Arg Val Ala His Leu Thr Gly 1185 1190 1195 1200 Ile His Ala Val Glu Glu Val Ser Leu Glu Glu Phe Ser Ala His Pro 1205 1210 1215 Cys Ala Arg Asp Asn Gly Gly Cys Ser His Ile Cys Ile Ala Lys Gly 1220 1225 1230 Asp Gly Thr Pro Arg Cys Ser Cys Pro Val His Leu Val Leu Leu Gln 1235 1240 1245 Asn Leu Leu Thr Cys Gly Glu Pro Pro Thr Cys Ser Pro Asp Gln Phe 1250 1255 1260 Ala Cys Ala Thr Gly Glu Ile Asp Cys Ile Pro Gly Ala Trp Arg Cys 1265 1270 1275 1280 Asp Gly Phe Pro Glu Cys Asp Asp Gln Ser Asp Glu Glu Gly Cys Pro 1285 1290 1295 Val Cys Ser Ala Ala Gln Phe Pro Cys Ala Arg Gly Gln Cys Val Asp 1300 1305 1310 Leu Arg Leu Arg Cys Asp Gly Glu Ala Asp Cys Gln Asp Arg Ser Asp 1315 1320 1325 Glu Ala Asp Cys Asp Ala Ile Cys Leu Pro Asn Gln Phe Arg Cys Ala 1330 1335 1340 Ser Gly Gln Cys Val Leu Ile Lys Gln Gln Cys Asp Ser Phe Pro Asp 1345 1350 1355 1360 Cys Ile Asp Gly Ser Asp Glu Leu Met Cys Glu Ile Thr Lys Pro Pro 1365 1370 1375 Ser Asp Asp Ser Pro Ala His Ser Ser Ala Ile Gly Pro Val Ile Gly 1380 1385 1390 Ile Ile Leu Ser Leu Phe Val Met Gly Gly Val Tyr Phe Val Cys Gln 1395 1400 1405 Arg Val Val Cys Gln Arg Tyr Ala Gly Ala Asn Gly Pro Phe Pro His 1410 1415 1420 Glu Tyr Val Ser Gly Thr Pro His Val Pro Leu Asn Phe Ile Ala Pro 1425 1430 1435 1440 Gly Gly Ser Gln His Gly Pro Phe Thr Gly Ile Ala Cys Gly Lys Ser 1445 1450 1455 Met Met Ser Ser Val Ser Leu Met Gly Gly Arg Gly Gly Val Pro Leu 1460 1465 1470 Tyr Asp Arg Asn His Val Thr Gly Ala Ser Ser Ser Ser Ser Ser Ser 1475 1480 1485 Thr Lys Ala Thr Leu Tyr Pro Pro Ile Leu Asn Pro Pro Pro Ser Pro 1490 1495 1500 Ala Thr Asp Pro Ser Leu Tyr Asn Met Asp Met Phe Tyr Ser Ser Asn 1505 1510 1515 1520 Ile Pro Ala Thr Val Arg Pro Tyr Arg Pro Tyr Ile Ile Arg Gly Met 1525 1530 1535 Ala Pro Pro Thr Thr Pro Cys Ser Thr Asp Val Cys Asp Ser Asp Tyr 1540 1545 1550 Ser Ala Ser Arg Trp Lys Ala Ser Lys Tyr Tyr Leu Asp Leu Asn Ser 1555 1560 1565 Asp Ser Asp Pro Tyr Pro Pro Pro Pro Thr Pro His Ser Gln Tyr Leu 1570 1575 1580 Ser Ala Glu Asp Ser Cys Pro Pro Ser Pro Ala Thr Glu Arg Ser Tyr 1585 1590 1595 1600 Phe His Leu Phe Pro Pro Pro Pro Ser Pro Cys Thr Asp Ser Ser 1605 1610 1615 1591 amino acids amino acid linear 4 Cys Pro Ala Pro Ala Ala Ala Ser Pro Leu Leu Leu Phe Ala Asn Arg 1 5 10 15 Arg Asp Val Arg Leu Val Asp Ala Gly Gly Val Lys Leu Glu Ser Thr 20 25 30 Ile Val Val Ser Gly Leu Glu Asp Ala Ala Ala Val Asp Phe Gln Phe 35 40 45 Ser Lys Gly Ala Val Tyr Trp Thr Asp Val Ser Glu Glu Ala Ile Lys 50 55 60 Gln Thr Tyr Leu Asn Gln Thr Gly Ala Ala Val Gln Asn Val Val Ile 65 70 75 80 Ser Gly Leu Val Ser Pro Asp Gly Leu Ala Cys Asp Trp Val Gly Lys 85 90 95 Lys Leu Tyr Trp Thr Asp Ser Glu Thr Asn Arg Ile Glu Val Ala Asn 100 105 110 Leu Asn Gly Thr Ser Arg Lys Val Leu Phe Trp Gln Asp Leu Asp Gln 115 120 125 Pro Arg Ala Ile Ala Leu Asp Pro Ala His Gly Tyr Met Tyr Trp Thr 130 135 140 Asp Trp Gly Glu Thr Pro Arg Ile Glu Arg Ala Gly Met Asp Gly Ser 145 150 155 160 Thr Arg Lys Ile Ile Val Asp Ser Asp Ile Tyr Trp Pro Asn Gly Leu 165 170 175 Thr Ile Asp Leu Glu Glu Gln Lys Leu Tyr Trp Ala Asp Ala Lys Leu 180 185 190 Ser Phe Ile His Arg Ala Asn Leu Asp Gly Ser Phe Arg Gln Lys Val 195 200 205 Val Glu Gly Ser Leu Thr His Pro Phe Ala Leu Thr Leu Ser Gly Asp 210 215 220 Thr Leu Tyr Trp Thr Asp Trp Gln Thr Arg Ser Ile His Ala Cys Asn 225 230 235 240 Lys Arg Thr Gly Gly Lys Arg Lys Glu Ile Leu Ser Ala Leu Tyr Ser 245 250 255 Pro Met Asp Ile Gln Val Leu Ser Gln Glu Arg Gln Pro Phe Phe His 260 265 270 Thr Arg Cys Glu Glu Asp Asn Gly Gly Cys Ser His Leu Cys Leu Leu 275 280 285 Ser Pro Ser Glu Pro Phe Tyr Thr Cys Ala Cys Pro Thr Gly Val Gln 290 295 300 Leu Gln Asp Asn Gly Arg Thr Cys Lys Ala Gly Ala Glu Glu Val Leu 305 310 315 320 Leu Leu Ala Arg Arg Thr Asp Leu Arg Arg Ile Ser Leu Asp Thr Pro 325 330 335 Asp Phe Thr Asp Ile Val Leu Gln Val Asp Asp Ile Arg His Ala Ile 340 345 350 Ala Ile Asp Tyr Asp Pro Leu Glu Gly Tyr Val Tyr Trp Thr Asp Asp 355 360 365 Glu Val Arg Ala Ile Arg Arg Ala Tyr Leu Asp Gly Ser Gly Ala Gln 370 375 380 Thr Leu Val Asn Thr Glu Ile Asn Asp Pro Asp Gly Ile Ala Val Asp 385 390 395 400 Trp Val Ala Arg Asn Leu Tyr Trp Thr Asp Thr Gly Thr Asp Arg Ile 405 410 415 Glu Val Thr Arg Leu Asn Gly Thr Ser Arg Lys Ile Leu Val Ser Glu 420 425 430 Asp Leu Asp Glu Pro Arg Ala Ile Ala Leu His Pro Val Met Gly Leu 435 440 445 Met Tyr Trp Thr Asp Trp Gly Glu Asn Pro Lys Ile Glu Cys Ala Asn 450 455 460 Leu Asp Gly Gln Glu Arg Arg Val Leu Val Asn Ala Ser Leu Gly Trp 465 470 475 480 Pro Asn Gly Leu Ala Leu Asp Leu Gln Glu Gly Lys Leu Tyr Trp Gly 485 490 495 Asp Ala Lys Thr Asp Lys Ile Glu Val Ile Asn Val Asp Gly Thr Lys 500 505 510 Arg Arg Thr Leu Leu Glu Asp Lys Leu Pro His Ile Phe Gly Phe Thr 515 520 525 Leu Leu Gly Asp Phe Ile Tyr Trp Thr Asp Trp Gln Arg Arg Ser Ile 530 535 540 Glu Arg Val His Lys Val Lys Ala Ser Arg Asp Val Ile Ile Asp Gln 545 550 555 560 Leu Pro Asp Leu Met Gly Leu Lys Ala Val Asn Val Ala Lys Val Val 565 570 575 Gly Thr Asn Pro Cys Ala Asp Arg Asn Gly Gly Cys Ser His Leu Cys 580 585 590 Phe Phe Thr Pro His Ala Thr Arg Cys Gly Cys Pro Ile Gly Leu Glu 595 600 605 Leu Leu Ser Asp Met Lys Thr Cys Ile Val Pro Glu Ala Phe Leu Val 610 615 620 Phe Thr Ser Arg Ala Ala Ile His Arg Ile Ser Leu Glu Thr Asn Asn 625 630 635 640 Asn Asp Val Ala Ile Pro Leu Thr Gly Val Lys Glu Ala Ser Ala Leu 645 650 655 Asp Phe Asp Val Ser Asn Asn His Ile Tyr Trp Thr Asp Val Ser Leu 660 665 670 Lys Thr Ile Ser Arg Ala Phe Met Asn Gly Ser Ser Val Glu His Val 675 680 685 Val Glu Phe Gly Leu Asp Tyr Pro Glu Gly Met Ala Val Asp Trp Met 690 695 700 Gly Lys Asn Leu Tyr Trp Ala Asp Thr Gly Thr Asn Arg Ile Glu Val 705 710 715 720 Ala Arg Leu Asp Gly Gln Phe Arg Gln Val Leu Val Trp Arg Asp Leu 725 730 735 Asp Asn Pro Arg Ser Leu Ala Leu Asp Pro Thr Lys Gly Tyr Ile Tyr 740 745 750 Trp Thr Glu Trp Gly Gly Lys Pro Arg Ile Val Arg Ala Phe Met Asp 755 760 765 Gly Thr Asn Cys Met Thr Leu Val Asp Lys Val Gly Arg Ala Asn Asp 770 775 780 Leu Thr Ile Asp Tyr Ala Asp Gln Arg Leu Tyr Trp Thr Asp Leu Asp 785 790 795 800 Thr Asn Met Ile Glu Ser Ser Asn Met Leu Gly Gln Glu Arg Val Val 805 810 815 Ile Ala Asp Asp Leu Pro His Pro Phe Gly Leu Thr Gln Tyr Ser Asp 820 825 830 Tyr Ile Tyr Trp Thr Asp Trp Asn Leu His Ser Ile Glu Arg Ala Asp 835 840 845 Lys Thr Ser Gly Arg Asn Arg Thr Leu Ile Gln Gly His Leu Asp Phe 850 855 860 Val Met Asp Ile Leu Val Phe His Ser Ser Arg Gln Asp Gly Leu Asn 865 870 875 880 Asp Cys Met His Asn Asn Gly Gln Cys Gly Gln Leu Cys Leu Ala Ile 885 890 895 Pro Gly Gly His Arg Cys Gly Cys Ala Ser His Tyr Thr Leu Asp Pro 900 905 910 Ser Ser Arg Asn Cys Ser Pro Pro Thr Thr Phe Leu Leu Phe Ser Gln 915 920 925 Lys Ser Ala Ile Ser Arg Met Ile Pro Asp Asp Gln His Ser Pro Asp 930 935 940 Leu Ile Leu Pro Leu His Gly Leu Arg Asn Val Lys Ala Ile Asp Tyr 945 950 955 960 Asp Pro Leu Asp Lys Phe Ile Tyr Trp Val Asp Gly Arg Gln Asn Ile 965 970 975 Lys Arg Ala Lys Asp Asp Gly Thr Gln Pro Phe Val Leu Thr Ser Leu 980 985 990 Ser Gln Gly Gln Asn Pro Asp Arg Gln Pro His Asp Leu Ser Ile Asp 995 1000 1005 Ile Tyr Ser Arg Thr Leu Phe Trp Thr Cys Glu Ala Thr Asn Thr Ile 1010 1015 1020 Asn Val His Arg Leu Ser Gly Glu Ala Met Gly Val Val Leu Arg Gly 1025 1030 1035 1040 Asp Arg Asp Lys Pro Arg Ala Ile Val Val Asn Ala Glu Arg Gly Tyr 1045 1050 1055 Leu Tyr Phe Thr Asn Met Gln Asp Arg Ala Ala Lys Ile Glu Arg Ala 1060 1065 1070 Ala Leu Asp Gly Thr Glu Arg Glu Val Leu Phe Thr Thr Gly Leu Ile 1075 1080 1085 Arg Pro Val Ala Leu Val Val Asp Asn Thr Leu Gly Lys Leu Phe Trp 1090 1095 1100 Val Asp Ala Asp Leu Lys Arg Ile Glu Ser Cys Asp Leu Ser Gly Ala 1105 1110 1115 1120 Asn Arg Leu Thr Leu Glu Asp Ala Asn Ile Val Gln Pro Leu Gly Leu 1125 1130 1135 Thr Ile Leu Gly Lys His Leu Tyr Trp Ile Asp Arg Gln Gln Gln Met 1140 1145 1150 Ile Glu Arg Val Glu Lys Thr Thr Gly Asp Lys Arg Thr Arg Ile Gln 1155 1160 1165 Gly Arg Val Ala His Leu Thr Gly Ile His Ala Val Glu Glu Val Ser 1170 1175 1180 Leu Glu Glu Phe Ser Ala His Pro Cys Ala Arg Asp Asn Gly Gly Cys 1185 1190 1195 1200 Ser His Ile Cys Ile Ala Lys Gly Asp Gly Thr Pro Arg Cys Ser Cys 1205 1210 1215 Pro Val His Leu Val Leu Leu Gln Asn Leu Leu Thr Cys Gly Glu Pro 1220 1225 1230 Pro Thr Cys Ser Pro Asp Gln Phe Ala Cys Ala Thr Gly Glu Ile Asp 1235 1240 1245 Cys Ile Pro Gly Ala Trp Arg Cys Asp Gly Phe Pro Glu Cys Asp Asp 1250 1255 1260 Gln Ser Asp Glu Glu Gly Cys Pro Val Cys Ser Ala Ala Gln Phe Pro 1265 1270 1275 1280 Cys Ala Arg Gly Gln Cys Val Asp Leu Arg Leu Arg Cys Asp Gly Glu 1285 1290 1295 Ala Asp Cys Gln Asp Arg Ser Asp Glu Ala Asp Cys Asp Ala Ile Cys 1300 1305 1310 Leu Pro Asn Gln Phe Arg Cys Ala Ser Gly Gln Cys Val Leu Ile Lys 1315 1320 1325 Gln Gln Cys Asp Ser Phe Pro Asp Cys Ile Asp Gly Ser Asp Glu Leu 1330 1335 1340 Met Cys Glu Ile Thr Lys Pro Pro Ser Asp Asp Ser Pro Ala His Ser 1345 1350 1355 1360 Ser Ala Ile Gly Pro Val Ile Gly Ile Ile Leu Ser Leu Phe Val Met 1365 1370 1375 Gly Gly Val Tyr Phe Val Cys Gln Arg Val Val Cys Gln Arg Tyr Ala 1380 1385 1390 Gly Ala Asn Gly Pro Phe Pro His Glu Tyr Val Ser Gly Thr Pro His 1395 1400 1405 Val Pro Leu Asn Phe Ile Ala Pro Gly Gly Ser Gln His Gly Pro Phe 1410 1415 1420 Thr Gly Ile Ala Cys Gly Lys Ser Met Met Ser Ser Val Ser Leu Met 1425 1430 1435 1440 Gly Gly Arg Gly Gly Val Pro Leu Tyr Asp Arg Asn His Val Thr Gly 1445 1450 1455 Ala Ser Ser Ser Ser Ser Ser Ser Thr Lys Ala Thr Leu Tyr Pro Pro 1460 1465 1470 Ile Leu Asn Pro Pro Pro Ser Pro Ala Thr Asp Pro Ser Leu Tyr Asn 1475 1480 1485 Met Asp Met Phe Tyr Ser Ser Asn Ile Pro Ala Thr Val Arg Pro Tyr 1490 1495 1500 Arg Pro Tyr Ile Ile Arg Gly Met Ala Pro Pro Thr Thr Pro Cys Ser 1505 1510 1515 1520 Thr Asp Val Cys Asp Ser Asp Tyr Ser Ala Ser Arg Trp Lys Ala Ser 1525 1530 1535 Lys Tyr Tyr Leu Asp Leu Asn Ser Asp Ser Asp Pro Tyr Pro Pro Pro 1540 1545 1550 Pro Thr Pro His Ser Gln Tyr Leu Ser Ala Glu Asp Ser Cys Pro Pro 1555 1560 1565 Ser Pro Ala Thr Glu Arg Ser Tyr Phe His Leu Phe Pro Pro Pro Pro 1570 1575 1580 Ser Pro Cys Thr Asp Ser Ser 1585 1590 432 base pairs nucleic acid single linear 5 ATGGAGCCCG AGTGAGCGCG GCGCGGGCCC GTCCGGCCGC CGGACAACAT GGAGGCAGCG 60 CCGCCCGGGC CGCCGTGGCC GCTGCTGCTG CTGCTGCTGC TGCTGCTGGC GCTGTGCGGC 120 TGCCCGGCCC CCGCCGCGGC CTCGCCGCTC CTGCTATTTG CCAACCGCCG GGACGTACGG 180 CTGGTGGACG CCGGCGGAGT CAAGCTGGAG TCCACCATCG TGGTCAGCGG CCTGGAGGAT 240 GCGGCCGCAG TGGACTTCCA GTTTTCCAAG GGAGCCGTGT ACTGGACAGA CGTGAGCGAG 300 GAGGCCATCA AGCAGACCTA CCTGAACCAG ACGGGGGCCG CCGTGCAGAA CGTGGTCATC 360 TCCGGCCTGG TCTCTCCCGA CGGCCTCGCC TGCGACTGGG TGGGCAAGAA GCTGTACTGG 420 ACGGACTCAG AG 432 443 base pairs nucleic acid single linear 6 ACCGCCGCCG CGCGCGCCAT GGAGCCCGAG TGAGCGCGCG GCGCTCCCGG CCGCCGGACG 60 ACATGGAAAC GGCGCCGACC CGGGCCCCTC CGCCGCCGCC GCCGCCGCTG CTGCTGCTGG 120 TGCTGTACTG CAGCTTGGTC CCCGCCGCGG CCTCACCGCT CCTGTTGTTT GCCAACCGCC 180 GGGATGTGCG GCTAGTGGAT GCCGGCGGAG TGAAGCTGGA GTCCACCATT GTGGCCAGTG 240 GCCTGGAGGA TGCAGCTGCT GTAGACTTCC AGTTCTCCAA GGGTGCTGTG TACTGGACAG 300 ATGTGAGCGA GGAGGCCATC AAACAGACCT ACCTGAACCA GACTGGAGGT GCTGCACAGA 360 ACATTGTCAT CTCGGGCCTC GTGTCACCTG ATGGCCTGGC CTGTGACTGG GTTGGCAAGA 420 AGCTGTACTG GACGGACTCC GAG 443 550 amino acids amino acid linear 7 Met Glu Ala Ala Pro Pro Gly Pro Pro Trp Pro Leu Leu Leu Leu Leu 1 5 10 15 Leu Leu Leu Leu Ala Leu Cys Gly Cys Pro Ala Pro Ala Ala Ala Ser 20 25 30 Pro Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu Val Asp Ala 35 40 45 Gly Gly Val Lys Leu Glu Ser Thr Ile Val Val Ser Gly Leu Glu Asp 50 55 60 Ala Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val Tyr Trp Thr 65 70 75 80 Asp Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn Gln Thr Gly 85 90 95 Ala Ala Val Gln Asn Val Val Ile Ser Gly Leu Val Ser Pro Asp Gly 100 105 110 Leu Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr Asp Ser Glu 115 120 125 Thr Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser Arg Lys Val 130 135 140 Leu Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala Leu Asp Pro 145 150 155 160 Ala His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Thr Pro Arg Ile 165 170 175 Glu Arg Ala Gly Met Asp Gly Ser Thr Arg Lys Ile Ile Val Asp Ser 180 185 190 Asp Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln Lys 195 200 205 Leu Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn Leu 210 215 220 Asp Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu Thr His Pro 225 230 235 240 Phe Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp Gln 245 250 255 Thr Arg Ser Ile His Ala Cys Asn Lys Arg Thr Gly Gly Lys Arg Lys 260 265 270 Glu Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu Ser 275 280 285 Gln Glu Arg Gln Pro Phe Phe His Thr Arg Cys Glu Glu Asp Asn Gly 290 295 300 Gly Cys Ser His Leu Cys Leu Leu Ser Pro Ser Glu Pro Phe Tyr Thr 305 310 315 320 Cys Ala Cys Pro Thr Gly Val Gln Leu Gln Asp Asn Gly Arg Thr Cys 325 330 335 Lys Ala Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp Leu 340 345 350 Arg Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu Gln 355 360 365 Val Asp Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu Glu 370 375 380 Gly Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg Ala 385 390 395 400 Tyr Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile Asn 405 410 415 Asp Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr Trp 420 425 430 Thr Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly Thr 435 440 445 Ser Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala Ile 450 455 460 Ala Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly Glu 465 470 475 480 Asn Pro Lys Ile Glu Cys Ala Asn Leu Asp Gly Gln Glu Arg Arg Val 485 490 495 Leu Val Asn Ala Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp Leu 500 505 510 Gln Glu Gly Lys Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile Glu 515 520 525 Val Ile Asn Val Asp Gly Thr Lys Arg Arg Thr Leu Leu Glu Asp Lys 530 535 540 Leu Pro His Ile Phe Gly 545 550 533 amino acids amino acid linear 8 Met Glu Thr Ala Pro Thr Arg Ala Pro Pro Pro Pro Pro Pro Pro Leu 1 5 10 15 Leu Leu Leu Val Leu Tyr Cys Ser Leu Val Pro Ala Ala Ala Ser Pro 20 25 30 Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu Val Asp Ala Gly 35 40 45 Gly Val Lys Leu Glu Ser Thr Ile Val Ala Ser Gly Leu Glu Asp Ala 50 55 60 Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val Tyr Trp Thr Asp 65 70 75 80 Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn Gln Thr Gly Gly 85 90 95 Ala Ala Gln Asn Ile Val Ile Ser Gly Leu Val Ser Pro Asp Gly Leu 100 105 110 Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr Asp Ser Glu Thr 115 120 125 Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser Arg Lys Val Leu 130 135 140 Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala Leu Asp Pro Ala 145 150 155 160 His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Ala Pro Arg Ile Glu 165 170 175 Arg Ala Gly Met Asp Gly Ser Thr Arg Lys Ile Ile Val Asp Ser Asp 180 185 190 Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln Lys Leu 195 200 205 Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn Leu Asp 210 215 220 Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu Thr His Pro Phe 225 230 235 240 Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp Gln Thr 245 250 255 Arg Ser Ile His Ala Cys Asn Lys Trp Thr Gly Glu Gln Arg Lys Glu 260 265 270 Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu Ser Gln 275 280 285 Glu Arg Gln Pro Pro Phe His Thr Pro Cys Glu Glu Asp Asn Gly Gly 290 295 300 Cys Ser His Leu Cys Leu Leu Ser Pro Arg Glu Pro Phe Tyr Ser Cys 305 310 315 320 Ala Cys Pro Thr Gly Val Gln Leu Gln Asp Asn Gly Lys Thr Cys Lys 325 330 335 Thr Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp Leu Arg 340 345 350 Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu Gln Val 355 360 365 Gly Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu Glu Gly 370 375 380 Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg Ala Tyr 385 390 395 400 Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile Asn Asp 405 410 415 Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr Trp Thr 420 425 430 Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly Thr Ser 435 440 445 Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala Ile Val 450 455 460 Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly Glu Asn 465 470 475 480 Pro Lys Ile Glu Cys Ala Asn Leu Asp Gly Arg Asp Arg His Val Leu 485 490 495 Val Asn Thr Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp Leu Gln 500 505 510 Glu Gly Lys Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile Glu Val 515 520 525 Ile Asn Ile Asp Gly 530 38 amino acids amino acid linear 9 Cys Glu Glu Asp Asn Gly Gly Cys Ser His Leu Cys Leu Leu Ser Pro 1 5 10 15 Ser Glu Pro Phe Tyr Thr Cys Ala Cys Pro Thr Gly Val Gln Leu Gln 20 25 30 Asp Asn Gly Arg Thr Cys 35 37 amino acids amino acid linear 10 Cys Lys Val Asn Asn Gly Gly Cys Ser Asn Leu Cys Leu Leu Ser Pro 1 5 10 15 Gly Gly Gly His Lys Cys Ala Cys Pro Thr Asn Phe Tyr Leu Gly Ser 20 25 30 Asp Gly Arg Thr Cys 35 41 amino acids amino acid linear 11 Gly Thr Asn Pro Cys Ala Asp Arg Asn Gly Gly Cys Ser His Leu Cys 1 5 10 15 Phe Phe Thr Pro His Ala Thr Arg Cys Gly Cys Pro Ile Gly Leu Glu 20 25 30 Leu Leu Ser Asp Met Lys Thr Cys Ile 35 40 41 amino acids amino acid linear 12 Gly Thr Asn Lys Cys Arg Val Asn Asn Gly Gly Cys Ser Ser Leu Cys 1 5 10 15 Leu Ala Thr Pro Gly Ser Arg Gln Cys Ala Cys Ala Glu Asp Gln Val 20 25 30 Leu Asp Ala Asp Gly Val Thr Cys Leu 35 40 40 amino acids amino acid linear 13 Gly Leu Asn Asp Cys Met His Asn Asn Gly Gln Cys Gly Gln Leu Cys 1 5 10 15 Leu Ala Ile Pro Gly Gly His Arg Cys Gly Cys Ala Ser His Tyr Thr 20 25 30 Leu Asp Pro Ser Ser Arg Asn Cys 35 40 40 amino acids amino acid linear 14 Gly Thr Asn Lys Cys Arg Val Asn Asn Gly Gly Cys Ser Ser Leu Cys 1 5 10 15 Leu Ala Thr Pro Gly Ser Arg Gln Cys Ala Cys Ala Glu Asp Gln Val 20 25 30 Leu Asp Ala Asp Gly Val Thr Cys 35 40 39 amino acids amino acid linear 15 His Pro Cys Ala Arg Asp Asn Gly Gly Cys Ser His Ile Cys Ile Ala 1 5 10 15 Lys Gly Asp Gly Thr Pro Arg Cys Ser Cys Pro Val His Leu Val Leu 20 25 30 Leu Gln Asn Leu Leu Thr Cys 35 39 amino acids amino acid linear 16 His Pro Cys Lys Val Asn Asn Gly Gly Cys Ser Asn Leu Cys Leu Leu 1 5 10 15 Ser Pro Gly Gly Gly His Lys Cys Ala Cys Pro Thr Asn Phe Tyr Leu 20 25 30 Gly Ser Asp Gly Arg Thr Cys 35 39 amino acids amino acid linear 17 Pro Thr Cys Ser Pro Asp Gln Phe Ala Cys Ala Thr Gly Glu Ile Asp 1 5 10 15 Cys Ile Pro Gly Ala Trp Arg Cys Asp Gly Phe Pro Glu Cys Asp Asp 20 25 30 Gln Ser Asp Glu Glu Gly Cys 35 37 amino acids amino acid linear 18 Pro Arg Cys Asp Met Asp Gln Phe Gln Cys Lys Ser Gly His Cys Ile 1 5 10 15 Pro Leu Arg Trp Arg Cys Asp Ala Asp Ala Asp Cys Met Asp Gly Ser 20 25 30 Asp Glu Glu Ala Cys 35 36 amino acids amino acid linear 19 Cys Ser Ala Ala Gln Phe Pro Cys Ala Arg Gly Gln Cys Val Asp Leu 1 5 10 15 Arg Leu Arg Cys Asp Gly Glu Ala Asp Cys Gln Asp Arg Ser Asp Glu 20 25 30 Ala Asp Cys Asp 35 36 amino acids amino acid linear 20 Cys Arg Pro Gly Gln Phe Gln Cys Ser Thr Gly Ile Cys Thr Asn Pro 1 5 10 15 Ala Phe Ile Cys Asp Gly Asp Asn Asp Cys Gln Asp Asn Ser Asp Glu 20 25 30 Ala Asn Cys Asp 35 35 amino acids amino acid linear 21 Cys Leu Pro Asn Gln Phe Arg Cys Ala Ser Gly Gln Cys Val Leu Ile 1 5 10 15 Lys Gln Gln Cys Asp Ser Phe Pro Asp Cys Ile Asp Gly Ser Asp Glu 20 25 30 Leu Met Cys 35 35 amino acids amino acid linear 22 Cys Asp Met Asp Gln Phe Gln Cys Lys Ser Gly His Cys Ile Pro Leu 1 5 10 15 Arg Trp Arg Cys Asp Ala Asp Ala Asp Cys Met Asp Gly Ser Asp Glu 20 25 30 Glu Ala Cys 35 5166 base pairs nucleic acid single linear 23 GAGAGGACAC CGCATTCTTC TTCTCCAGAG GATGCAGCAG CAAGGCGCCA TCTTGAAACC 60 AGAGACCAAA CCAACCAGCA WTTTTGTCTT GAACTTCCCA GCCTCCACAA CTAATATAAA 120 CCCCATGAGG GCAGAGGCGT TCAGCCTGAC TCCAGCCTGG CAAAGCTGTC ACAAATCTGG 180 AGGAACACAC ACGTTCACGG GCACTCAGTT CTGTGAGCCT CGCCGCTCCT GCTATTTGCC 240 AACCGCCGGG ACGTACGGCT GGTGGACGCC GGCGGAGTCA AGCTGGAGTC CACCATCGTG 300 GTCAGCGGCC TGGAGGATGC GGCCGCAGTG GACTTCCAGT TTTCCAAGGG AGCCGTGTAC 360 TGGACAGACG TGAGCGAGGA GGCCATCAAG CAGACCTACC TGAACCAGAC GGGGGCCGCC 420 GTGCAGAACG TGGTCATCTC CGGCCTGGTC TCTCCCGACG GCCTCGCCTG CGACTGGGTG 480 GGCAAGAAGC TGTACTGGAC GGACTCAGAG ACCAACCGCA TCGAGGTGGC CAACCTCAAT 540 GGCACATCCC GGAAGGTGCT CTTCTGGCAG GACCTTGACC AGCCGAGGGC CATCGCCTTG 600 GACCCCGCTC ACGGGTACAT GTACTGGACA GACTGGGGTG AGACGCCCCG GATTGAGCGG 660 GCAGGGATGG ATGGCAGCAC CCGGAAGATC ATTGTGGACT CGGACATTTA CTGGCCCAAT 720 GGACTGACCA TCGACCTGGA GGAGCAGAAG CTCTACTGGG CTGACGCCAA GCTCAGCTTC 780 ATCCACCGTG CCAACCTGGA CGGCTCGTTC CGGCAGAAGG TGGTGGAGGG CAGCCTGACG 840 CACCCCTTCG CCCTGACGCT CTCCGGGGAC ACTCTGTACT GGACAGACTG GCAGACCCGC 900 TCCATCCATG CCTGCAACAA GCGCACTGGG GGGAAGAGGA AGGAGATCCT GAGTGCCCTC 960 TACTCACCCA TGGACATCCA GGTGCTGAGC CAGGAGCGGC AGCCTTTCTT CCACACTCGC 1020 TGTGAGGAGG ACAATGGCGG CTGCTCCCAC CTGTGCCTGC TGTCCCCAAG CGAGCCTTTC 1080 TACACATGCG CCTGCCCCAC GGGTGTGCAG CTGCAGGACA ACGGCAGGAC GTGTAAGGCA 1140 GGAGCCGAGG AGGTGCTGCT GCTGGCCCGG CGGACGGACC TACGGAGGAT CTCGCTGGAC 1200 ACGCCGGACT TTACCGACAT CGTGCTGCAG GTGGACGACA TCCGGCACGC CATTGCCATC 1260 GACTACGACC CGCTAGAGGG CTATGTCTAC TGGACAGATG ACGAGGTGCG GGCCATCCGC 1320 AGGGCGTACC TGGACGGGTC TGGGGCGCAG ACGCTGGTCA ACACCGAGAT CAACGACCCC 1380 GATGGCATCG CGGTCGACTG GGTGGCCCGA AACCTCTACT GGACCGACAC GGGCACGGAC 1440 CGCATCGAGG TGACGCGCCT CAACGGCACC TCCCGCAAGA TCCTGGTGTC GGAGGACCTG 1500 GACGAGCCCC GAGCCATCGC ACTGCACCCC GTGATGGGCC TCATGTACTG GACAGACTGG 1560 GGAGAGAACC CTAAAATCGA GTGTGCCAAC TTGGATGGGC AGGAGCGGCG TGTGCTGGTC 1620 AATGCCTCCC TCGGGTGGCC CAACGGCCTG GCCCTGGACC TGCAGGAGGG GAAGCTCTAC 1680 TGGGGAGACG CCAAGACAGA CAAGATCGAG GTGATCAATG TTGATGGGAC GAAGAGGCGG 1740 ACCCTCCTGG AGGACAAGCT CCCGCACATT TTCGGGTTCA CGCTGCTGGG GGACTTCATC 1800 TACTGGACTG ACTGGCAGCG CCGCAGCATC GAGCGGGTGC ACAAGGTCAA GGCCAGCCGG 1860 GACGTCATCA TTGACCAGCT GCCCGACCTG ATGGGGCTCA AAGCTGTGAA TGTGGCCAAG 1920 GTCGTCGGAA CCAACCCGTG TGCGGACAGG AACGGGGGGT GCAGCCACCT GTGCTTCTTC 1980 ACACCCCACG CAACCCGGTG TGGCTGCCCC ATCGGCCTGG AGCTGCTGAG TGACATGAAG 2040 ACCTGCATGT GCCTGAGGCC TTCTTGGTCT TCACCAGCAG AGCCGCCATC CACAGGATCT 2100 CCCTCGAGAC CAATAACAAC GACGTGGCCA TCCCGCTCAC GGGCGTCAAG GAGGCCTCAG 2160 CCCTGGACTT TGATGTGTCC AACAACCACA TCTACTGGAC AGACGTCAGC CTGAAGACCA 2220 TCAGCCGCGC CTTCATGAAC GGGAGCTCGG TGGAGCACGT GGTGGAGTTT GGCCTTGACT 2280 ACCCCGAGGG CATGGCCGTT GACTGGATGG GCAAGAACCT CTACTGGGCC GACACTGGGA 2340 CCAACAGAAT CGAAGTGGCG CGGCTGGACG GGCAGTTCCG GCAAGTCCTC GTGTGGAGGG 2400 ACTTGGACAA CCCGAGGTCG CTGGCCCTGG ATCCCACCAA GGGCTACATC TACTGGACCG 2460 AGTGGGGCGG CAAGCCGAGG ATCGTGCGGG CCTTCATGGA CGGGACCAAC TGCATGACGC 2520 TGGTGGACAA GGTGGGCCGG GCCAACGACC TCACCATTGA CTACGCTGAC CAGCGCCTCT 2580 ACTGGACCGA CCTGGACACC AACATGATCG AGTCGTCCAA CATGCTGGGT CAGGAGCGGG 2640 TCGTGATTGC CGACGATCTC CCGCACCCGT TCGGTCTGAC GCAGTACAGC GATTATATCT 2700 ACTGGACAGA CTGGAATCTG CACAGCATTG AGCGGGCCGA CAAGACTAGC GGCCGGAACC 2760 GCACCCTCAT CCAGGGCCAC CTGGACTTCG TGATGGACAT CCTGGTGTTC CACTCCTCCC 2820 GCCAGGATGG CCTCAATGAC TGTATGCACA ACAACGGGCA GTGTGGGCAG CTGTGCCTTG 2880 CCATCCCCGG CGGCCACCGC TGCGGCTGCG CCTCACACTA CACCCTGGAC CCCAGCAGCC 2940 GCAACTGCAG CCCGCCCACC ACCTTCTTGC TGTTCAGCCA GAAATCTGCC ATCAGTCGGA 3000 TGATCCCGGA CGACCAGCAC AGCCCGGATC TCATCCTGCC CCTGCATGGA CTGAGGAACG 3060 TCAAAGCCAT CGACTATGAC CCACTGGACA AGTTCATCTA CTGGGTGGAT GGGCGCCAGA 3120 ACATCAAGCG AGCCAAGGAC GACGGGACCC AGCCCTTTGT TTTGACCTCT CTGAGCCAAG 3180 GCCAAAACCC AGACAGGCAG CCCCACGACC TCAGCATCGA CATCTACAGC CGGACACTGT 3240 TCTGGACGTG CGAGGCCACC AATACCATCA ACGTCCACAG GCTGAGCGGG GAAGCCATGG 3300 GGGTGGTGCT GCGTGGGGAC CGCGACAAGC CCAGGGCCAT CGTCGTCAAC GCGGAGCGAG 3360 GGTACCTGTA CTTCACCAAC ATGCAGGACC GGGCAGCCAA GATCGAACGC GCAGCCCTGG 3420 ACGGCACCGA GCGCGAGGTC CTCTTCACCA CCGGCCTCAT CCGCCCTGTG GCCCTGGTGG 3480 TAGACAACAC ACTGGGCAAG CTGTTCTGGG TGGACGCGGA CCTGAAGCGC ATTGAGAGCT 3540 GTGACCTGTC AGGGGCCAAC CGCCTGACCC TGGAGGACGC CAACATCGTG CAGCCTCTGG 3600 GCCTGACCAT CCTTGGCAAG CATCTCTACT GGATCGACCG CCAGCAGCAG ATGATCGAGC 3660 GTGTGGAGAA GACCACCGGG GACAAGCGGA CTCGCATCCA GGGCCGTGTC GCCCACCTCA 3720 CTGGCATCCA TGCAGTGGAG GAAGTCAGCC TGGAGGAGTT CTCAGCCCAC CCATGTGCCC 3780 GTGACAATGG TGGCTGCTCC CACATCTGTA TTGCCAAGGG TGATGGGACA CCACGGTGCT 3840 CATGCCCAGT CCACCTCGTG CTCCTGCAGA ACCTGCTGAC CTGTGGAGAG CCGCCCACCT 3900 GCTCCCCGGA CCAGTTTGCA TGTGCCACAG GGGAGATCGA CTGTATCCCC GGGGCCTGGC 3960 GCTGTGACGG CTTTCCCGAG TGCGATGACC AGAGCGACGA GGAGGGCTGC CCCGTGTGCT 4020 CCGCCGCCCA GTTCCCCTGC GCGCGGGGTC AGTGTGTGGA CCTGCGCCTG CGCTGCGACG 4080 GCGAGGCAGA CTGTCAGGAC CGCTCAGACA GGCGGACTGT GACGCCATCT GCCTGCCCAA 4140 CCAGTTCCGG TGTGCGAGCG GCCAGTGTGT CCTCATCAAA CAGCAGTGCG ACTCCTTCCC 4200 CGACTGTATC GACGGCTCCG ACGAGCTCAT GTGTGAAATC ACCAAGCCGC CCTCAGACGA 4260 CAGCCCGGCC CACAGCAGTG CCATCGGGCC CGTCATTGGC ATCATCCTCT CTCTCTTCGT 4320 CATGGGTGGT GTCTATTTTG TGTGCCAGCG CGTGGTGTGC CAGCGCTATG CGGGGGCCAA 4380 CGGGCCCTTC CCGCACGAGT ATGTCAGCGG GACCCCGCAC GTGCCCCTCA ATTTCATAGC 4440 CCCGGGCGGT TCCCAGCATG GCCCCTTCAC AGGCATCGCA TGCGGAAAGT CCATGATGAG 4500 CTCCGTGAGC CTGATGGGGG GCCGGGGCGG GGTGCCCCTC TACGACCGGA ACCACGTCAC 4560 AGGGGCCTCG TCCAGCAGCT CGTCCAGCAC GAAGGCCACG CTGTACCCGC CGATCCTGAA 4620 CCCGCCGCCC TCCCCGGCCA CGGACCCCTC CCTGTACAAC ATGGACATGT TCTACTCTTC 4680 AAACATTCCG GCCACTGTGA GACCGTACAG GCCCTACATC ATTCGAGGAA TGGCGCCCCC 4740 GACGACGCCC TGCAGCACCG ACGTGTGTGA CAGCGACTAC AGCGCCAGCC GCTGGAAGGC 4800 CAGCAAGTAC TACCTGGATT TGAACTCGGA CTCAGACCCC TATCCACCCC CACCCACGCC 4860 CCACAGCCAG TACCTGTCGG CGGAGGACAG CTGCCCGCCC TCGCCCGCCA CCGAGAGGAG 4920 CTACTTCCAT CTCTTCCCGC CCCCTCCGTC CCCCTGCACG GACTCATCCT GACCTCGGCC 4980 GGGCCACTCT GGCTTCTCTG TGCCCCTGTA AATAGTTTTA AATATGAACA AAGAAAAAAA 5040 TATATTTTAT GATTTAAAAA ATAAATATAA TTGGGATTTT AAAAACATGA GAAATGTGAA 5100 CTGTGATGGG GTGGGCAGGG CTGGGAGAAC TTTGTACAGT GGAACAAATA TTTATAAACT 5160 TAATTT 5166 4351 base pairs nucleic acid single linear 24 ATGTACTGGA CAGACTGGGG TGAGACGCCC CGGATTGAGC GGGCAGGGAT GGATGGCAGC 60 ACCCGGAAGA TCATTGTGGA CTCGGACATT TACTGGCCCA ATGGACTGAC CATCGACCTG 120 GAGGAGCAGA AGCTCTACTG GGCTGACGCC AAGCTCAGCT TCATCCACCG TGCCAACCTG 180 GACGGCTCGT TCCGGCAGAA GGTGGTGGAG GGCAGCCTGA CGCACCCCTT CGCCCTGACG 240 CTCTCCGGGG ACACTCTGTA CTGGACAGAC TGGCAGACCC GCTCCATCCA TGCCTGCAAC 300 AAGCGCACTG GGGGGAAGAG GAAGGAGATC CTGAGTGCCC TCTACTCACC CATGGACATC 360 CAGGTGCTGA GCCAGGAGCG GCAGCCTTTC TTCCACACTC GCTGTGAGGA GGACAATGGC 420 GGCTGCTCCC ACCTGTGCCT GCTGTCCCCA AGCGAGCCTT TCTACACATG CGCCTGCCCC 480 ACGGGTGTGC AGCTGCAGGA CAACGGCAGG ACGTGTAAGG CAGGAGCCGA GGAGGTGCTG 540 CTGCTGGCCC GGCGGACGGA CCTACGGAGG ATCTCGCTGG ACACGCCGGA CTTTACCGAC 600 ATCGTGCTGC AGGTGGACGA CATCCGGCAC GCCATTGCCA TCGACTACGA CCCGCTAGAG 660 GGCTATGTCT ACTGGACAGA TGACGAGGTG CGGGCCATCC GCAGGGCGTA CCTGGACGGG 720 TCTGGGGCGC AGACGCTGGT CAACACCGAG ATCAACGACC CCGATGGCAT CGCGGTCGAC 780 TGGGTGGCCC GAAACCTCTA CTGGACCGAC ACGGGCACGG ACCGCATCGA GGTGACGCGC 840 CTCAACGGCA CCTCCCGCAA GATCCTGGTG TCGGAGGACC TGGACGAGCC CCGAGCCATC 900 GCACTGCACC CCGTGATGGG CCTCATGTAC TGGACAGACT GGGGAGAGAA CCCTAAAATC 960 GAGTGTGCCA ACTTGGATGG GCAGGAGCGG CGTGTGCTGG TCAATGCCTC CCTCGGGTGG 1020 CCCAACGGCC TGGCCCTGGA CCTGCAGGAG GGGAAGCTCT ACTGGGGAGA CGCCAAGACA 1080 GACAAGATCG AGGTGATCAA TGTTGATGGG ACGAAGAGGC GGACCCTCCT GGAGGACAAG 1140 CTCCCGCACA TTTTCGGGTT CACGCTGCTG GGGGACTTCA TCTACTGGAC TGACTGGCAG 1200 CGCCGCAGCA TCGAGCGGGT GCACAAGGTC AAGGCCAGCC GGGACGTCAT CATTGACCAG 1260 CTGCCCGACC TGATGGGGCT CAAAGCTGTG AATGTGGCCA AGGTCGTCGG AACCAACCCG 1320 TGTGCGGACA GGAACGGGGG GTGCAGCCAC CTGTGCTTCT TCACACCCCA CGCAACCCGG 1380 TGTGGCTGCC CCATCGGCCT GGAGCTGCTG AGTGACATGA AGACCTGCAT CGTGCCTGAG 1440 GCCTTCTTGG TCTTCACCAG CAGAGCCGCC ATCCACAGGA TCTCCCTCGA GACCAATAAC 1500 AACGACGTGG CCATCCCGCT CACGGGCGTC AAGGAGGCCT CAGCCCTGGA CTTTGATGTG 1560 TCCAACAACC ACATCTACTG GACAGACGTC AGCCTGAAGA CCATCAGCCG CGCCTTCATG 1620 AACGGGAGCT CGGTGGAGCA CGTGGTGGAG TTTGGCCTTG ACTACCCCGA GGGCATGGCC 1680 GTTGACTGGA TGGGCAAGAA CCTCTACTGG GCCGACACTG GGACCAACAG AATCGAAGTG 1740 GCGCGGCTGG ACGGGCAGTT CCGGCAAGTC CTCGTGTGGA GGGACTTGGA CAACCCGAGG 1800 TCGCTGGCCC TGGATCCCAC CAAGGGCTAC ATCTACTGGA CCGAGTGGGG CGGCAAGCCG 1860 AGGATCGTGC GGGCCTTCAT GGACGGGACC AACTGCATGA CGCTGGTGGA CAAGGTGGGC 1920 CGGGCCAACG ACCTCACCAT TGACTACGCT GACCAGCGCC TCTACTGGAC CGACCTGGAC 1980 ACCAACATGA TCGAGTCGTC CAACATGCTG GGTCAGGAGC GGGTCGTGAT TGCCGACGAT 2040 CTCCCGCACC GTTCGGTCTG ACGCAGTACA GCGATTATAT CTACTGGACA GACTGGAATC 2100 TGCACAGCAT TGAGCGGGCC GACAAGACTA GCGGCCGGAA CCGCACCCTC ATCCAGGGCC 2160 ACCTGGACTT CGTGATGGAC ATCCTGGTGT TCCACTCCTC CCGCCAGGAT GGCCTCAATG 2220 ACTGTATGCA CAACAACGGG CAGTGTGGGC AGCTGTGCCT TGCCATCCCC GGCGGCCACC 2280 GCTGCGGCTG CGCCTCACAC TACACCCTGG ACCCCAGCAG CCGCAACTGC AGCCCGCCCA 2340 CCACCTTCTT GCTGTTCAGC CAGAAATCTG CCATCAGTCG GATGATCCCG GACGACCAGC 2400 ACAGCCCGGA TCTCATCCTG CCCCTGCATG GACTGAGGAA CGTCAAAGCC ATCGACTATG 2460 ACCCACTGGA CAAGTTCATC TACTGGGTGG ATGGGCGCCA GAACATCAAG CGAGCCAAGG 2520 ACGACGGGAC CCAGCCCTTT GTTTTGACCT CTCTGAGCCA AGGCCAAAAC CCAGACAGGC 2580 AGCCCCACGA CCTCAGCATC GACATCTACA GCCGGACACT GTTCTGGACG TGCGAGGCCA 2640 CCAATACCAT CAACGTCCAC AGGCTGAGCG GGGAAGCCAT GGGGGTGGTG CTGCGTGGGG 2700 ACCGCGACAA GCCCAGGGCC ATCGTCGTCA ACGCGGAGCG AGGGTACCTG TACTTCACCA 2760 ACATGCAGGA CCGGGCAGCC AAGATCGAAC GCGCAGCCCT GGACGGCACC GAGCGCGAGG 2820 TCCTCTTCAC CACCGGCCTC ATCCGCCCTG TGGCCCTGGT GGTAGACAAC ACACTGGGCA 2880 AGCTGTTCTG GGTGGACGCG GACCTGAAGC GCATTGAGAG CTGTGACCTG TCAGGGGCCA 2940 ACCGCCTGAC CCTGGAGGAC GCCAACATCG TGCAGCCTCT GGGCCTGACC ATCCTTGGCA 3000 AGCATCTCTA CTGGATCGAC CGCCAGCAGC AGATGATCGA GCGTGTGGAG AAGACCACCG 3060 GGGACAAGCG GACTCGCATC CAGGGCCGTG TCGCCCACCT CACTGGCATC CATGCAGTGG 3120 AGGAAGTCAG CCTGGAGGAG TTCTCAGCCC ACCCATGTGC CCGTGACAAT GGTGGCTGCT 3180 CCCACATCTG TATTGCCAAG GGTGATGGGA CACCACGGTG CTCATGCCCA GTCCACCTCG 3240 TGCTCCTGCA GAACCTGCTG ACCTGTGGAG AGCCGCCCAC CTGCTCCCCG GACCAGTTTG 3300 CATGTGCCAC AGGGGAGATC GACTGTATCC CCGGGGCCTG GCGCTGTGAC GGCTTTCCCG 3360 AGTGCGATGA CCAGAGCGAC GAGGAGGGCT GCCCCGTGTG CTCCGCCGCC CAGTTCCCCT 3420 GCGCGCGGGG TCAGTGTGTG GACCTGCGCC TGCGCTGCGA CGGCGAGGCA GACTGTCAGG 3480 ACCGCTCAGA CGAGGCGGAC TGTGACGCCA TCTGCCTGCC CAACCAGTTC CGGTGTGCGA 3540 GCGGCCAGTG TGTCCTCATC AAACAGCAGT GCGACTCCTT CCCCGACTGT ATCGACGGCT 3600 CCGACGAGCT CATGTGTGAA ATCACCAAGC CGCCCTCAGA CGACAGCCCG GCCCACAGCA 3660 GTGCCATCGG GCCCGTCATT GGCATCATCC TCTCTCTCTT CGTCATGGGT GGTGTCTATT 3720 TTGTGTGCCA GCGCGTGGTG TGCCAGCGCT ATGCGGGGGC CAACGGGCCC TTCCCGCACG 3780 AGTATGTCAG CGGGACCCCG CACGTGCCCC TCAATTTCAT AGCCCCGGGC GGTTCCCAGC 3840 ATGGCCCCTT CACAGGCATC GCATGCGGAA AGTCCATGAT GAGCTCCGTG AGCCTGATGG 3900 GGGGCCGGGG CGGGGTGCCC CTCTACGACC GGAACCACGT CACAGGGGCC TCGTCCAGCA 3960 GCTCGTCCAG CACGAAGGCC ACGCTGTACC CGCCGATCCT GAACCCGCCG CCCTCCCCGG 4020 CCACGGACCC CTCCCTGTAC AACATGGACA TGTTCTACTC TTCAAACATT CCGGCCACTG 4080 TGAGACCGTA CAGGCCCTAC ATCATTCGAG AATGGCGCCC CCGACGACGC CCTGCAGCAC 4140 CGACGTGTGT GACAGCGACT ACAGCGCCAG CCGCTGGAAG GCCAGCAAGT ACTACCTGGA 4200 TTTGAACTCG GACTCAGACC CCTATCCACC CCCACCCACG CCCCACAGCC AGTACCTGTC 4260 GGCGGAGGAC AGCTGCCCGC CCTCGCCCGC CACCGAGAGG AGCTACTTCC ATCTCTTCCC 4320 GCCCCCTCCG TCCCCCTGCA CGGACTCATC C 4351 1451 amino acids amino acid linear 25 Met Tyr Trp Thr Asp Trp Gly Glu Thr Pro Arg Ile Glu Arg Ala Gly 1 5 10 15 Met Asp Gly Ser Thr Arg Lys Ile Ile Val Asp Ser Asp Ile Tyr Trp 20 25 30 Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln Lys Leu Tyr Trp Ala 35 40 45 Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn Leu Asp Gly Ser Phe 50 55 60 Arg Gln Lys Val Val Glu Gly Ser Leu Thr His Pro Phe Ala Leu Thr 65 70 75 80 Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp Gln Thr Arg Ser Ile 85 90 95 His Ala Cys Asn Lys Arg Thr Gly Gly Lys Arg Lys Glu Ile Leu Ser 100 105 110 Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu Ser Gln Glu Arg Gln 115 120 125 Pro Phe Phe His Thr Arg Cys Glu Glu Asp Asn Gly Gly Cys Ser His 130 135 140 Leu Cys Leu Leu Ser Pro Ser Glu Pro Phe Tyr Thr Cys Ala Cys Pro 145 150 155 160 Thr Gly Val Gln Leu Gln Asp Asn Gly Arg Thr Cys Lys Ala Gly Ala 165 170 175 Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp Leu Arg Arg Ile Ser 180 185 190 Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu Gln Val Asp Asp Ile 195 200 205 Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu Glu Gly Tyr Val Tyr 210 215 220 Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg Ala Tyr Leu Asp Gly 225 230 235 240 Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile Asn Asp Pro Asp Gly 245 250 255 Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr Trp Thr Asp Thr Gly 260 265 270 Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly Thr Ser Arg Lys Ile 275 280 285 Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala Ile Ala Leu His Pro 290 295 300 Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly Glu Asn Pro Lys Ile 305 310 315 320 Glu Cys Ala Asn Leu Asp Gly Gln Glu Arg Arg Val Leu Val Asn Ala 325 330 335 Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp Leu Gln Glu Gly Lys 340 345 350 Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile Glu Val Ile Asn Val 355 360 365 Asp Gly Thr Lys Arg Arg Thr Leu Leu Glu Asp Lys Leu Pro His Ile 370 375 380 Phe Gly Phe Thr Leu Leu Gly Asp Phe Ile Tyr Trp Thr Asp Trp Gln 385 390 395 400 Arg Arg Ser Ile Glu Arg Val His Lys Val Lys Ala Ser Arg Asp Val 405 410 415 Ile Ile Asp Gln Leu Pro Asp Leu Met Gly Leu Lys Ala Val Asn Val 420 425 430 Ala Lys Val Val Gly Thr Asn Pro Cys Ala Asp Arg Asn Gly Gly Cys 435 440 445 Ser His Leu Cys Phe Phe Thr Pro His Ala Thr Arg Cys Gly Cys Pro 450 455 460 Ile Gly Leu Glu Leu Leu Ser Asp Met Lys Thr Cys Ile Val Pro Glu 465 470 475 480 Ala Phe Leu Val Phe Thr Ser Arg Ala Ala Ile His Arg Ile Ser Leu 485 490 495 Glu Thr Asn Asn Asn Asp Val Ala Ile Pro Leu Thr Gly Val Lys Glu 500 505 510 Ala Ser Ala Leu Asp Phe Asp Val Ser Asn Asn His Ile Tyr Trp Thr 515 520 525 Asp Val Ser Leu Lys Thr Ile Ser Arg Ala Phe Met Asn Gly Ser Ser 530 535 540 Val Glu His Val Val Glu Phe Gly Leu Asp Tyr Pro Glu Gly Met Ala 545 550 555 560 Val Asp Trp Met Gly Lys Asn Leu Tyr Trp Ala Asp Thr Gly Thr Asn 565 570 575 Arg Ile Glu Val Ala Arg Leu Asp Gly Gln Phe Arg Gln Val Leu Val 580 585 590 Trp Arg Asp Leu Asp Asn Pro Arg Ser Leu Ala Leu Asp Pro Thr Lys 595 600 605 Gly Tyr Ile Tyr Trp Thr Glu Trp Gly Gly Lys Pro Arg Ile Val Arg 610 615 620 Ala Phe Met Asp Gly Thr Asn Cys Met Thr Leu Val Asp Lys Val Gly 625 630 635 640 Arg Ala Asn Asp Leu Thr Ile Asp Tyr Ala Asp Gln Arg Leu Tyr Trp 645 650 655 Thr Asp Leu Asp Thr Asn Met Ile Glu Ser Ser Asn Met Leu Gly Gln 660 665 670 Glu Arg Val Val Ile Ala Asp Asp Leu Pro His Pro Phe Gly Leu Thr 675 680 685 Gln Tyr Ser Asp Tyr Ile Tyr Trp Thr Asp Trp Asn Leu His Ser Ile 690 695 700 Glu Arg Ala Asp Lys Thr Ser Gly Arg Asn Arg Thr Leu Ile Gln Gly 705 710 715 720 His Leu Asp Phe Val Met Asp Ile Leu Val Phe His Ser Ser Arg Gln 725 730 735 Asp Gly Leu Asn Asp Cys Met His Asn Asn Gly Gln Cys Gly Gln Leu 740 745 750 Cys Leu Ala Ile Pro Gly Gly His Arg Cys Gly Cys Ala Ser His Tyr 755 760 765 Thr Leu Asp Pro Ser Ser Arg Asn Cys Ser Pro Pro Thr Thr Phe Leu 770 775 780 Leu Phe Ser Gln Lys Ser Ala Ile Ser Arg Met Ile Pro Asp Asp Gln 785 790 795 800 His Ser Pro Asp Leu Ile Leu Pro Leu His Gly Leu Arg Asn Val Lys 805 810 815 Ala Ile Asp Tyr Asp Pro Leu Asp Lys Phe Ile Tyr Trp Val Asp Gly 820 825 830 Arg Gln Asn Ile Lys Arg Ala Lys Asp Asp Gly Thr Gln Pro Phe Val 835 840 845 Leu Thr Ser Leu Ser Gln Gly Gln Asn Pro Asp Arg Gln Pro His Asp 850 855 860 Leu Ser Ile Asp Ile Tyr Ser Arg Thr Leu Phe Trp Thr Cys Glu Ala 865 870 875 880 Thr Asn Thr Ile Asn Val His Arg Leu Ser Gly Glu Ala Met Gly Val 885 890 895 Val Leu Arg Gly Asp Arg Asp Lys Pro Arg Ala Ile Val Val Asn Ala 900 905 910 Glu Arg Gly Tyr Leu Tyr Phe Thr Asn Met Gln Asp Arg Ala Ala Lys 915 920 925 Ile Glu Arg Ala Ala Leu Asp Gly Thr Glu Arg Glu Val Leu Phe Thr 930 935 940 Thr Gly Leu Ile Arg Pro Val Ala Leu Val Val Asp Asn Thr Leu Gly 945 950 955 960 Lys Leu Phe Trp Val Asp Ala Asp Leu Lys Arg Ile Glu Ser Cys Asp 965 970 975 Leu Ser Gly Ala Asn Arg Leu Thr Leu Glu Asp Ala Asn Ile Val Gln 980 985 990 Pro Leu Gly Leu Thr Ile Leu Gly Lys His Leu Tyr Trp Ile Asp Arg 995 1000 1005 Gln Gln Gln Met Ile Glu Arg Val Glu Lys Thr Thr Gly Asp Lys Arg 1010 1015 1020 Thr Arg Ile Gln Gly Arg Val Ala His Leu Thr Gly Ile His Ala Val 1025 1030 1035 1040 Glu Glu Val Ser Leu Glu Glu Phe Ser Ala His Pro Cys Ala Arg Asp 1045 1050 1055 Asn Gly Gly Cys Ser His Ile Cys Ile Ala Lys Gly Asp Gly Thr Pro 1060 1065 1070 Arg Cys Ser Cys Pro Val His Leu Val Leu Leu Gln Asn Leu Leu Thr 1075 1080 1085 Cys Gly Glu Pro Pro Thr Cys Ser Pro Asp Gln Phe Ala Cys Ala Thr 1090 1095 1100 Gly Glu Ile Asp Cys Ile Pro Gly Ala Trp Arg Cys Asp Gly Phe Pro 1105 1110 1115 1120 Glu Cys Asp Asp Gln Ser Asp Glu Glu Gly Cys Pro Val Cys Ser Ala 1125 1130 1135 Ala Gln Phe Pro Cys Ala Arg Gly Gln Cys Val Asp Leu Arg Leu Arg 1140 1145 1150 Cys Asp Gly Glu Ala Asp Cys Gln Asp Arg Ser Asp Glu Ala Asp Cys 1155 1160 1165 Asp Ala Ile Cys Leu Pro Asn Gln Phe Arg Cys Ala Ser Gly Gln Cys 1170 1175 1180 Val Leu Ile Lys Gln Gln Cys Asp Ser Phe Pro Asp Cys Ile Asp Gly 1185 1190 1195 1200 Ser Asp Glu Leu Met Cys Glu Ile Thr Lys Pro Pro Ser Asp Asp Ser 1205 1210 1215 Pro Ala His Ser Ser Ala Ile Gly Pro Val Ile Gly Ile Ile Leu Ser 1220 1225 1230 Leu Phe Val Met Gly Gly Val Tyr Phe Val Cys Gln Arg Val Val Cys 1235 1240 1245 Gln Arg Tyr Ala Gly Ala Asn Gly Pro Phe Pro His Glu Tyr Val Ser 1250 1255 1260 Gly Thr Pro His Val Pro Leu Asn Phe Ile Ala Pro Gly Gly Ser Gln 1265 1270 1275 1280 His Gly Pro Phe Thr Gly Ile Ala Cys Gly Lys Ser Met Met Ser Ser 1285 1290 1295 Val Ser Leu Met Gly Gly Arg Gly Gly Val Pro Leu Tyr Asp Arg Asn 1300 1305 1310 His Val Thr Gly Ala Ser Ser Ser Ser Ser Ser Ser Thr Lys Ala Thr 1315 1320 1325 Leu Tyr Pro Pro Ile Leu Asn Pro Pro Pro Ser Pro Ala Thr Asp Pro 1330 1335 1340 Ser Leu Tyr Asn Met Asp Met Phe Tyr Ser Ser Asn Ile Pro Ala Thr 1345 1350 1355 1360 Val Arg Pro Tyr Arg Pro Tyr Ile Ile Arg Gly Met Ala Pro Pro Thr 1365 1370 1375 Thr Pro Cys Ser Thr Asp Val Cys Asp Ser Asp Tyr Ser Ala Ser Arg 1380 1385 1390 Trp Lys Ala Ser Lys Tyr Tyr Leu Asp Leu Asn Ser Asp Ser Asp Pro 1395 1400 1405 Tyr Pro Pro Pro Pro Thr Pro His Ser Gln Tyr Leu Ser Ala Glu Asp 1410 1415 1420 Ser Cys Pro Pro Ser Pro Ala Thr Glu Arg Ser Tyr Phe His Leu Phe 1425 1430 1435 1440 Pro Pro Pro Pro Ser Pro Cys Thr Asp Ser Ser 1445 1450 5125 base pairs nucleic acid single linear 26 TAAATGGCTT GGCAAAGGGA GTTCATTCCT TTTAGCGCTT CCATCTTCTG CAGTGAGAGG 60 ACACCGCATT CTTCTTCTCC AGAGGATGCA GCAGCAAGGC GCCATCTTGA AACCAGAGAC 120 CAAACCAACC AGCAACTTCG TCTTGAACTT CCCAGCCTCC ACAACTCCTC GCCGCTCCTG 180 CTATTTGCCA ACCGCCGGGA CGTACGGCTG GTGGACGCCG GCGGAGTCAA GCTGGAGTCC 240 ACCATCGTGG TCAGCGGCCT GGAGGATGCG GCCGCAGTGG ACTTCCAGTT TTCCAAGGGA 300 GCCGTGTACT GGACAGACGT GAGCGAGGAG GCCATCAAGC AGACCTACCT GAACCAGACG 360 GGGGCCGCCG TGCAGAACGT GGTCATCTCC GGCCTGGTCT CTCCCGACGG CCTCGCCTGC 420 GACTGGGTGG GCAAGAAGCT GTACTGGACG GACTCAGAGA CCAACCGCAT CGAGGTGGCC 480 AACCTCAATG GCACATCCCG GAAGGTGCTC TTCTGGCAGG ACCTTGACCA GCCGAGGGCC 540 ATCGCCTTGG ACCCCGCTCA CGGGTACATG TACTGGACAG ACTGGGGTGA GACGCCCCGG 600 ATTGAGCGGG CAGGGATGGA TGGCAGCACC CGGAAGATCA TTGTGGACTC GGACATTTAC 660 TGGCCCAATG GACTGACCAT CGACCTGGAG GAGCAGAAGC TCTACTGGGC TGACGCCAAG 720 CTCAGCTTCA TCCACCGTGC CAACCTGGAC GGCTCGTTCC GGCAGAAGGT GGTGGAGGGC 780 AGCCTGACGC ACCCCTTCGC CCTGACGCTC TCCGGGGACA CTCTGTACTG GACAGACTGG 840 CAGACCCGCT CCATCCATGC CTGCAACAAG CGCACTGGGG GGAAGAGGAA GGAGATCCTG 900 AGTGCCCTCT ACTCACCCAT GGACATCCAG GTGCTGAGCC AGGAGCGGCA GCCTTTCTTC 960 CACACTCGCT GTGAGGAGGA CAATGGCGGC TGCTCCCACC TGTGCCTGCT GTCCCCAAGC 1020 GAGCCTTTCT ACACATGCGC CTGCCCCACG GGTGTGCAGC TGCAGGACAA CGGCAGGACG 1080 TGTAAGGCAG GAGCCGAGGA GGTGCTGCTG CTGGCCCGGC GGACGGACCT ACGGAGGATC 1140 TCGCTGGACA CGCCGGACTT TACCGACATC GTGCTGCAGG TGGACGACAT CCGGCACGCC 1200 ATTGCCATCG ACTACGACCC GCTAGAGGGC TATGTCTACT GGACAGATGA CGAGGTGCGG 1260 GCCATCCGCA GGGCGTACCT GGACGGGTCT GGGGCGCAGA CGCTGGTCAA CACCGAGATC 1320 AACGACCCCG ATGGCATCGC GGTCGACTGG GTGGCCCGAA ACCTCTACTG GACCGACACG 1380 GGCACGGACC GCATCGAGGT GACGCGCCTC AACGGCACCT CCCGCAAGAT CCTGGTGTCG 1440 GAGGACCTGG ACGAGCCCCG AGCCATCGCA CTGCACCCCG TGATGGGCCT CATGTACTGG 1500 ACAGACTGGG GAGAGAACCC TAAAATCGAG TGTGCCAACT TGGATGGGCA GGAGCGGCGT 1560 GTGCTGGTCA ATGCCTCCCT CGGGTGGCCC AACGGCCTGG CCCTGGACCT GCAGGAGGGG 1620 AAGCTCTACT GGGGAGACGC CAAGACAGAC AAGATCGAGG TGATCAATGT TGATGGGACG 1680 AAGAGGCGGA CCCTCCTGGA GGACAAGCTC CCGCACATTT TCGGGTTCAC GCTGCTGGGG 1740 GACTTCATCT ACTGGACTGA CTGGCAGCGC CGCAGCATCG AGCGGGTGCA CAAGGTCAAG 1800 GCCAGCCGGG ACGTCATCAT TGACCAGCTG CCCGACCTGA TGGGGCTCAA AGCTGTGAAT 1860 GTGGCCAAGG TCGTCGGAAC CAACCCGTGT GCGGACAGGA ACGGGGGGTG CAGCCACCTG 1920 TGCTTCTTCA CACCCCACGC AACCCGGTGT GGCTGCCCCA TCGGCCTGGA GCTGCTGAGT 1980 GACATGAAGA CCTGCATCGT GCCTGAGGCC TTCTTGGTCT TCACCAGCAG AGCCGCCATC 2040 CACAGGATTC CCTCGAGACC AATAACAACG ACGTGGCCAT CCCGCTCACG GGCGTCAAGG 2100 AGGCCTCAGC CCTGGACTTT GATGTGTCCA ACAACCACAT CTACTGGACA GACGTCAGCC 2160 TGAAGACCAT CAGCCGCGCC TTCATGAACG GGAGCTCGGT GGAGCACGTG GTGGAGTTTG 2220 GCCTTGACTA CCCCGAGGGC ATGGCCGTTG ACTGGATGGG CAAGAACCTC TACTGGGCCG 2280 ACACTGGGAC CAACAGAATC GAAGTGGCGC GGCTGGACGG GCAGTTCCGG CAAGTCCTCG 2340 TGTGGAGGGA CTTGGACAAC CCGAGGTCGC TGGCCCTGGA TCCCACCAAG GGCTACATCT 2400 ACTGGACCGA GTGGGGCGGC AAGCCGAGGA TCGTGCGGGC CTTCATGGAC GGGACCAACT 2460 GCATGACGCT GGTGGACAAG GTGGGCCGGG CCAACGACCT CACCATTGAC TACGCTGACC 2520 AGCGCCTCTA CTGGACCGAC CTGGACACCA ACATGATCGA GTCGTCCAAC ATGCTGGGTC 2580 AGGAGCGGGT CGTGATTGCC GACGATCTCC CGCACCCGTT CGGTCTGACG CAGTACAGCG 2640 ATTATATCTA CTGGACAGAC TGGAATCTGC ACAGCATTGA GCGGGCCGAC AAGACTAGCG 2700 GCCGGAACCG CACCCTCATC CAGGGCCACC TGGACTTCGT GATGGACATC CTGGTGTTCC 2760 ACTCCTCCCG CCAGGATGGC CTCAATGACT GTATGCACAA CAACGGGCAG TGTGGGCAGC 2820 TGTGCCTTGC CATCCCCGGC GGCCACCGCT GCGGCTGCGC CTCACACTAC ACCCTGGACC 2880 CCAGCAGCCG CAACTGCAGC CCGCCCACCA CCTTCTTGCT GTTCAGCCAG AAATCTGCCA 2940 TCAGTCGGAT GATCCCGGAC GACCAGCACA GCCCGGATCT CATCCTGCCC CTGCATGGAC 3000 TGAGGAACGT CAAAGCCATC GACTATGACC CACTGGACAA GTTCATCTAC TGGGTGGATG 3060 GGCGCCAGAA CATCAAGCGA GCCAAGGACG ACGGGACCCA GCCCTTTGTT TTGACCTCTC 3120 TGAGCCAAGG CCAAAACCCA GACAGGCAGC CCCACGACCT CAGCATCGAC ATCTACAGCC 3180 GGACACTGTT CTGGACGTGC GAGGCCACCA ATACCATCAA CGTCCACAGG CTGAGCGGGG 3240 AAGCCATGGG GGTGGTGCTG CGTGGGGACC GCGACAAGCC CAGGGCCATC GTCGTCAACG 3300 CGGAGCGAGG GTACCTGTAC TTCACCAACA TGCAGGACCG GGCAGCCAAG ATCGAACGCG 3360 CAGCCCTGGA CGGCACCGAG CGCGAGGTCC TCTTCACCAC CGGCCTCATC CGCCCTGTGG 3420 CCCTGGTGGT AGACAACACA CTGGGCAAGC TGTTCTGGGT GGACGCGGAC CTGAAGCGCA 3480 TTGAGAGCTG TGACCTGTCA GGGGCCAACC GCCTGACCCT GGAGGACGCC AACATCGTGC 3540 AGCCTCTGGG CCTGACCATC CTTGGCAAGC ATCTCTACTG GATCGACCGC CAGCAGCAGA 3600 TGATCGAGCG TGTGGAGAAG ACCACCGGGG ACAAGCGGAC TCGCATCCAG GGCCGTGTCG 3660 CCCACCTCAC TGGCATCCAT GCAGTGGAGG AAGTCAGCCT GGAGGAGTTC TCAGCCCACC 3720 CATGTGCCCG TGACAATGGT GGCTGCTCCC ACATCTGTAT TGCCAAGGGT GATGGGACAC 3780 CACGGTGCTC ATGCCCAGTC CACCTCGTGC TCCTGCAGAA CCTGCTGACC TGTGGAGAGC 3840 CGCCCACCTG CTCCCCGGAC CAGTTTGCAT GTGCCACAGG GGAGATCGAC TGTATCCCCG 3900 GGGCCTGGCG CTGTGACGGC TTTCCCGAGT GCGATGACCA GAGCGACGAG GAGGGCTGCC 3960 CCGTGTGCTC CGCCGCCCAG TTCCCCTGCG CGCGGGGTCA GTGTGTGGAC CTGCGCCTGC 4020 GCTGCGACGG CGAGGCAGAC TGTCAGGACC GCTCAGACGA GGCGGACTGT GACGCCATCT 4080 GCCTGCCCAA CCAGTTCCGG TGTGCGAGCG GCAGTGTGTC CTCATCAAAC AGCAGTGCGA 4140 CTCCTTCCCC GACTGTATCG ACGGCTCCGA CGAGCTCATG TGTGAAATCA CCAAGCCGCC 4200 CTCAGACGAC AGCCCGGCCC ACAGCAGTGC CATCGGGCCC GTCATTGGCA TCATCCTCTC 4260 TCTCTTCGTC ATGGGTGGTG TCTATTTTGT GTGCCAGCGC GTGGTGTGCC AGCGCTATGC 4320 GGGGGCCAAC GGGCCCTTCC CGCACGAGTA TGTCAGCGGG ACCCCGCACG TGCCCCTCAA 4380 TTTCATAGCC CCGGGCGGTT CCCAGCATGG CCCCTTCACA GGCATCGCAT GCGGAAAGTC 4440 CATGATGAGC TCCGTGAGCC TGATGGGGGG CCGGGGCGGG GTGCCCCTCT ACGACCGGAA 4500 CCACGTCACA GGGGCCTCGT CCAGCAGCTC GTCCAGCACG AAGGCCACGC TGTACCCGCC 4560 GATCCTGAAC CCGCCGCCCT CCCCGGCCAC GGACCCCTCC CTGTACAACA TGGACATGTT 4620 CTACTCTTCA AACATTCCGG CCACTGCGAG ACCGTACAGG CCCTACATCA TTCGAGGAAT 4680 GGCGCCCCCG ACGACGCCCT GCAGCACCGA CGTGTGTGAC AGCGACTACA GCGCCAGCCG 4740 CTGGAAGGCC AGCAAGTACT ACCTGGATTT GAACTCGGAC TCAGACCCCT ATCCACCCCC 4800 ACCCACGCCC CACAGCCAGT ACCTGTCGGC GGAGGACAGC TGCCCGCCCT CGCCCGCCAC 4860 CGAGAGGAGC TACTTCCATC TCTTCCCGCC CCCTCCGTCC CCCTGCACGG ACTCATCCTG 4920 ACCTCGGCCG GGCCACTCTG GCTTCTCTGT GCCCCTGTAA ATAGTTTTAA ATATGAACAA 4980 AGAAAAAAAT ATATTTTATG ATTTAAAAAA TAAATATAAT TGGGATTTTA AAAACATGAG 5040 AAATGTGAAC TGTGATGGGG TGGGCAGGGC TGGGAGAACT TTGTACAGTG GAACAAATAT 5100 TTATAAACTT AATTTTGTAA AACAG 5125 167 base pairs nucleic acid single linear 27 TAAAATGGCT TGGCAAAGGG AGTTCATTCC TTTTAGCGCT TCCATCTTCT GCAGTGAGAG 60 GACACCGCAT TCTTCTTCTC CAGAGGATGC AGCAGCAAGG CGCCATCTTG AAACCAGAGA 120 CCAAACCAAC CAGCAACTTC GTCTTGAACT TCCCAGCCTC CACAACT 167 4915 base pairs nucleic acid single linear 28 ATGGCTTGGC AAAGGGAGTT CATTCCTTTT AGCGCTTCCA TCTTCTGCAG TGAGAGGACA 60 CCGCATTCTT CTTCTCCAGA GGATGCAGCA GCAAGGCGCC ATCTTGAAAC CAGAGACCAA 120 ACCAACCAGC AACTTCGTCT TGAACTTCCC AGCCTCCACA ACTCCTCGCC GCTCCTGCTA 180 TTTGCCAACC GCCGGGACGT ACGGCTGGTG GACGCCGGCG GAGTCAAGCT GGAGTCCACC 240 ATCGTGGTCA GCGGCCTGGA GGATGCGGCC GCAGTGGACT TCCAGTTTTC CAAGGGAGCC 300 GTGTACTGGA CAGACGTGAG CGAGGAGGCC ATCAAGCAGA CCTACCTGAA CCAGACGGGG 360 GCCGCCGTGC AGAACGTGGT CATCTCCGGC CTGGTCTCTC CCGACGGCCT CGCCTGCGAC 420 TGGGTGGGCA AGAAGCTGTA CTGGACGGAC TCAGAGACCA ACCGCATCGA GGTGGCCAAC 480 CTCAATGGCA CATCCCGGAA GGTGCTCTTC TGGCAGGACC TTGACCAGCC GAGGGCCATC 540 GCCTTGGACC CCGCTCACGG GTACATGTAC TGGACAGACT GGGGTGAGAC GCCCCGGATT 600 GAGCGGGCAG GGATGGATGG CAGCACCCGG AAGATCATTG TGGACTCGGA CATTTACTGG 660 CCCAATGGAC TGACCATCGA CCTGGAGGAG CAGAAGCTCT ACTGGGCTGA CGCCAAGCTC 720 AGCTTCATCC ACCGTGCCAA CCTGGACGGC TCGTTCCGGC AGAAGGTGGT GGAGGGCAGC 780 CTGACGCACC CCTTCGCCCT GACGCTCTCC GGGGACACTC TGTACTGGAC AGACTGGCAG 840 ACCCGCTCCA TCCATGCCTG CAACAAGCGC ACTGGGGGGA AGAGGAAGGA GATCCTGAGT 900 GCCCTCTACT CACCCATGGA CATCCAGGTG CTGAGCCAGG AGCGGCAGCC TTTCTTCCAC 960 ACTCGCTGTG AGGAGGACAA TGGCGGCTGC TCCCACCTGT GCCTGCTGTC CCCAAGCGAG 1020 CCTTTCTACA CATGCGCCTG CCCCACGGGT GTGCAGCTGC AGGACAACGG CAGGACGTGT 1080 AAGGCAGGAG CCGAGGAGGT GCTGCTGCTG GCCCGGCGGA CGGACCTACG GAGGATCTCG 1140 CTGGACACGC CGGACTTTAC CGACATCGTG CTGCAGGTGG ACGACATCCG GCACGCCATT 1200 GCCATCGACT ACGACCCGCT AGAGGGCTAT GTCTACTGGA CAGATGACGA GGTGCGGGCC 1260 ATCCGCAGGG CGTACCTGGA CGGGTCTGGG GCGCAGACGC TGGTCAACAC CGAGATCAAC 1320 GACCCCGATG GCATCGCGGT CGACTGGGTG GCCCGAAACC TCTACTGGAC CGACACGGGC 1380 ACGGACCGCA TCGAGGTGAC GCGCCTCAAC GGCACCTCCC GCAAGATCCT GGTGTCGGAG 1440 GACCTGGACG AGCCCCGAGC CATCGCACTG CACCCCGTGA TGGGCCTCAT GTACTGGACA 1500 GACTGGGGAG AGAACCCTAA AATCGAGTGT GCCAACTTGG ATGGGCAGGA GCGGCGTGTG 1560 CTGGTCAATG CCTCCCTCGG GTGGCCCAAC GGCCTGGCCC TGGACCTGCA GGAGGGGAAG 1620 CTCTACTGGG GAGACGCCAA GACAGACAAG ATCGAGGTGA TCAATGTTGA TGGGACGAAG 1680 AGGCGGACCC TCCTGGAGGA CAAGCTCCCG CACATTTTCG GGTTCACGCT GCTGGGGGAC 1740 TTCATCTACT GGACTGACTG GCAGCGCCGC AGCATCGAGC GGGTGCACAA GGTCAAGGCC 1800 AGCCGGGACG TCATCATTGA CCAGCTGCCC GACCTGATGG GGCTCAAAGC TGTGAATGTG 1860 GCCAAGGTCG TCGGAACCAA CCCGTGTGCG GACAGGAACG GGGGGTGCAG CCACCTGTGC 1920 TTCTTCACAC CCCACGCAAC CCGGTGTGGC TGCCCCATCG GCCTGGAGCT GCTGAGTGAC 1980 ATGAAGACCT GCATCGTGCC TGAGGCCTTC TTGGTCTTCA CCAGCAGAGC CGCCATCCAC 2040 AGGATCTCCT CGAGACCAAT AACAACGACG TGGCCATCCC GCTCACGGGC GTCAAGGAGG 2100 CCTCAGCCCT GGACTTTGAT GTGTCCAACA ACCACATCTA CTGGACAGAC GTCAGCCTGA 2160 AGACCATCAG CCGCGCCTTC ATGAACGGGA GCTCGGTGGA GCACGTGGTG GAGTTTGGCC 2220 TTGACTACCC CGAGGGCATG GCCGTTGACT GGATGGGCAA GAACCTCTAC TGGGCCGACA 2280 CTGGGACCAA CAGAATCGAA GTGGCGCGGC TGGACGGGCA GTTCCGGCAA GTCCTCGTGT 2340 GGAGGGACTT GGACAACCCG AGGTCGCTGG CCCTGGATCC CACCAAGGGC TACATCTACT 2400 GGACCGAGTG GGGCGGCAAG CCGAGGATCG TGCGGGCCTT CATGGACGGG ACCAACTGCA 2460 TGACGCTGGT GGACAAGGTG GGCCGGGCCA ACGACCTCAC CATTGACTAC GCTGACCAGC 2520 GCCTCTACTG GACCGACCTG GACACCAACA TGATCGAGTC GTCCAACATG CTGGGTCAGG 2580 AGCGGGTCGT GATTGCCGAC GATCTCCCGC ACCCGTTCGG TCTGACGCAG TACAGCGATT 2640 ATATCTACTG GACAGACTGG AATCTGCACA GCATTGAGCG GGCCGACAAG ACTAGCGGCC 2700 GGAACCGCAC CCTCATCCAG GGCCACCTGG ACTTCGTGAT GGACATCCTG GTGTTCCACT 2760 CCTCCCGCCA GGATGGCCTC AATGACTGTA TGCACAACAA CGGGCAGTGT GGGCAGCTGT 2820 GCCTTGCCAT CCCCGGCGGC CACCGCTGCG GCTGCGCCTC ACACTACACC CTGGACCCCA 2880 GCAGCCGCAA CTGCAGCCCG CCCACCACCT TCTTGCTGTT CAGCCAGAAA TCTGCCATCA 2940 GTCGGATGAT CCCGGACGAC CAGCACAGCC CGGATCTCAT CCTGCCCCTG CATGGACTGA 3000 GGAACGTCAA AGCCATCGAC TATGACCCAC TGGACAAGTT CATCTACTGG GTGGATGGGC 3060 GCCAGAACAT CAAGCGAGCC AAGGACGACG GGACCCAGCC CTTTGTTTTG ACCTCTCTGA 3120 GCCAAGGCCA AAACCCAGAC AGGCAGCCCC ACGACCTCAG CATCGACATC TACAGCCGGA 3180 CACTGTTCTG GACGTGCGAG GCCACCAATA CCATCAACGT CCACAGGCTG AGCGGGGAAG 3240 CCATGGGGGT GGTGCTGCGT GGGGACCGCG ACAAGCCCAG GGCCATCGTC GTCAACGCGG 3300 AGCGAGGGTA CCTGTACTTC ACCAACATGC AGGACCGGGC AGCCAAGATC GAACGCGCAG 3360 CCCTGGACGG CACCGAGCGC GAGGTCCTCT TCACCACCGG CCTCATCCGC CCTGTGGCCC 3420 TGGTGGTAGA CAACACACTG GGCAAGCTGT TCTGGGTGGA CGCGGACCTG AAGCGCATTG 3480 AGAGCTGTGA CCTGTCAGGG GCCAACCGCC TGACCCTGGA GGACGCCAAC ATCGTGCAGC 3540 CTCTGGGCCT GACCATCCTT GGCAAGCATC TCTACTGGAT CGACCGCCAG CAGCAGATGA 3600 TCGAGCGTGT GGAGAAGACC ACCGGGGACA AGCGGACTCG CATCCAGGGC CGTGTCGCCC 3660 ACCTCACTGG CATCCATGCA GTGGAGGAAG TCAGCCTGGA GGAGTTCTCA GCCCACCCAT 3720 GTGCCCGTGA CAATGGTGGC TGCTCCCACA TCTGTATTGC CAAGGGTGAT GGGACACCAC 3780 GGTGCTCATG CCCAGTCCAC CTCGTGCTCC TGCAGAACCT GCTGACCTGT GGAGAGCCGC 3840 CCACCTGCTC CCCGGACCAG TTTGCATGTG CCACAGGGGA GATCGACTGT ATCCCCGGGG 3900 CCTGGCGCTG TGACGGCTTT CCCGAGTGCG ATGACCAGAG CGACGAGGAG GGCTGCCCCG 3960 TGTGCTCCGC CGCCCAGTTC CCCTGCGCGC GGGGTCAGTG TGTGGACCTG CGCCTGCGCT 4020 GCGACGGCGA GGCAGACTGT CAGGACCGCT CAGACGAGGC GGACTGTGAC GCCATCTGCC 4080 TGCCCAACCA GTTCCGGTGT GCGAGCGGCA GTGTGTCCTC ATCAAACAGC AGTGCGACTC 4140 CTTCCCCGAC TGTATCGACG GCTCCGACGA GCTCATGTGT GAAATCACCA AGCCGCCCTC 4200 AGACGACAGC CCGGCCCACA GCAGTGCCAT CGGGCCCGTC ATTGGCATCA TCCTCTCTCT 4260 CTTCGTCATG GGTGGTGTCT ATTTTGTGTG CCAGCGCGTG GTGTGCCAGC GCTATGCGGG 4320 GGCCAACGGG CCCTTCCCGC ACGAGTATGT CAGCGGGACC CCGCACGTGC CCCTCAATTT 4380 CATAGCCCCG GGCGGTTCCC AGCATGGCCC CTTCACAGGC ATCGCATGCG GAAAGTCCAT 4440 GATGAGCTCC GTGAGCCTGA TGGGGGGCCG GGGCGGGGTG CCCCTCTACG ACCGGAACCA 4500 CGTCACAGGG GCCTCGTCCA GCAGCTCGTC CAGCACGAAG GCCACGCTGT ACCCGCCGAT 4560 CCTGAACCCG CCGCCCTCCC CGGCCACGGA CCCCTCCCTG TACAACATGG ACATGTTCTA 4620 CTCTTCAAAC ATTCCGGCCA CTGCGAGACC GTACAGGCCC TACATCATTC GAGGAATGGC 4680 GCCCCCGACG ACGCCCTGCA GCACCGACGT GTGTGACAGC GACTACAGCG CCAGCCGCTG 4740 GAAGGCCAGC AAGTACTACC TGGATTTGAA CTCGGACTCA GACCCCTATC CACCCCCACC 4800 CACGCCCCAC AGCCAGTACC TGTCGGCGGA GGACAGCTGC CCGCCCTCGC CCGCCACCGA 4860 GAGGAGCTAC TTCCATCTCT TCCCGCCCCC TCCGTCCCCC TGCACGGACT CATCC 4915 1639 amino acids amino acid linear 29 Met Ala Trp Gln Arg Glu Phe Ile Pro Phe Ser Ala Ser Ile Phe Cys 1 5 10 15 Ser Glu Arg Thr Pro His Ser Ser Ser Pro Glu Asp Ala Ala Ala Arg 20 25 30 Arg His Leu Glu Thr Arg Asp Gln Thr Asn Gln Gln Leu Arg Leu Glu 35 40 45 Leu Pro Ser Leu His Asn Ser Ser Pro Leu Leu Leu Phe Ala Asn Arg 50 55 60 Arg Asp Val Arg Leu Val Asp Ala Gly Gly Val Lys Leu Glu Ser Thr 65 70 75 80 Ile Val Val Ser Gly Leu Glu Asp Ala Ala Ala Val Asp Phe Gln Phe 85 90 95 Ser Lys Gly Ala Val Tyr Trp Thr Asp Val Ser Glu Glu Ala Ile Lys 100 105 110 Gln Thr Tyr Leu Asn Gln Thr Gly Ala Ala Val Gln Asn Val Val Ile 115 120 125 Ser Gly Leu Val Ser Pro Asp Gly Leu Ala Cys Asp Trp Val Gly Lys 130 135 140 Lys Leu Tyr Trp Thr Asp Ser Glu Thr Asn Arg Ile Glu Val Ala Asn 145 150 155 160 Leu Asn Gly Thr Ser Arg Lys Val Leu Phe Trp Gln Asp Leu Asp Gln 165 170 175 Pro Arg Ala Ile Ala Leu Asp Pro Ala His Gly Tyr Met Tyr Trp Thr 180 185 190 Asp Trp Gly Glu Thr Pro Arg Ile Glu Arg Ala Gly Met Asp Gly Ser 195 200 205 Thr Arg Lys Ile Ile Val Asp Ser Asp Ile Tyr Trp Pro Asn Gly Leu 210 215 220 Thr Ile Asp Leu Glu Glu Gln Lys Leu Tyr Trp Ala Asp Ala Lys Leu 225 230 235 240 Ser Phe Ile His Arg Ala Asn Leu Asp Gly Ser Phe Arg Gln Lys Val 245 250 255 Val Glu Gly Ser Leu Thr His Pro Phe Ala Leu Thr Leu Ser Gly Asp 260 265 270 Thr Leu Tyr Trp Thr Asp Trp Gln Thr Arg Ser Ile His Ala Cys Asn 275 280 285 Lys Arg Thr Gly Gly Lys Arg Lys Glu Ile Leu Ser Ala Leu Tyr Ser 290 295 300 Pro Met Asp Ile Gln Val Leu Ser Gln Glu Arg Gln Pro Phe Phe His 305 310 315 320 Thr Arg Cys Glu Glu Asp Asn Gly Gly Cys Ser His Leu Cys Leu Leu 325 330 335 Ser Pro Ser Glu Pro Phe Tyr Thr Cys Ala Cys Pro Thr Gly Val Gln 340 345 350 Leu Gln Asp Asn Gly Arg Thr Cys Lys Ala Gly Ala Glu Glu Val Leu 355 360 365 Leu Leu Ala Arg Arg Thr Asp Leu Arg Arg Ile Ser Leu Asp Thr Pro 370 375 380 Asp Phe Thr Asp Ile Val Leu Gln Val Asp Asp Ile Arg His Ala Ile 385 390 395 400 Ala Ile Asp Tyr Asp Pro Leu Glu Gly Tyr Val Tyr Trp Thr Asp Asp 405 410 415 Glu Val Arg Ala Ile Arg Arg Ala Tyr Leu Asp Gly Ser Gly Ala Gln 420 425 430 Thr Leu Val Asn Thr Glu Ile Asn Asp Pro Asp Gly Ile Ala Val Asp 435 440 445 Trp Val Ala Arg Asn Leu Tyr Trp Thr Asp Thr Gly Thr Asp Arg Ile 450 455 460 Glu Val Thr Arg Leu Asn Gly Thr Ser Arg Lys Ile Leu Val Ser Glu 465 470 475 480 Asp Leu Asp Glu Pro Arg Ala Ile Ala Leu His Pro Val Met Gly Leu 485 490 495 Met Tyr Trp Thr Asp Trp Gly Glu Asn Pro Lys Ile Glu Cys Ala Asn 500 505 510 Leu Asp Gly Gln Glu Arg Arg Val Leu Val Asn Ala Ser Leu Gly Trp 515 520 525 Pro Asn Gly Leu Ala Leu Asp Leu Gln Glu Gly Lys Leu Tyr Trp Gly 530 535 540 Asp Ala Lys Thr Asp Lys Ile Glu Val Ile Asn Val Asp Gly Thr Lys 545 550 555 560 Arg Arg Thr Leu Leu Glu Asp Lys Leu Pro His Ile Phe Gly Phe Thr 565 570 575 Leu Leu Gly Asp Phe Ile Tyr Trp Thr Asp Trp Gln Arg Arg Ser Ile 580 585 590 Glu Arg Val His Lys Val Lys Ala Ser Arg Asp Val Ile Ile Asp Gln 595 600 605 Leu Pro Asp Leu Met Gly Leu Lys Ala Val Asn Val Ala Lys Val Val 610 615 620 Gly Thr Asn Pro Cys Ala Asp Arg Asn Gly Gly Cys Ser His Leu Cys 625 630 635 640 Phe Phe Thr Pro His Ala Thr Arg Cys Gly Cys Pro Ile Gly Leu Glu 645 650 655 Leu Leu Ser Asp Met Lys Thr Cys Ile Val Pro Glu Ala Phe Leu Val 660 665 670 Phe Thr Ser Arg Ala Ala Ile His Arg Ile Ser Leu Glu Thr Asn Asn 675 680 685 Asn Asp Val Ala Ile Pro Leu Thr Gly Val Lys Glu Ala Ser Ala Leu 690 695 700 Asp Phe Asp Val Ser Asn Asn His Ile Tyr Trp Thr Asp Val Ser Leu 705 710 715 720 Lys Thr Ile Ser Arg Ala Phe Met Asn Gly Ser Ser Val Glu His Val 725 730 735 Val Glu Phe Gly Leu Asp Tyr Pro Glu Gly Met Ala Val Asp Trp Met 740 745 750 Gly Lys Asn Leu Tyr Trp Ala Asp Thr Gly Thr Asn Arg Ile Glu Val 755 760 765 Ala Arg Leu Asp Gly Gln Phe Arg Gln Val Leu Val Trp Arg Asp Leu 770 775 780 Asp Asn Pro Arg Ser Leu Ala Leu Asp Pro Thr Lys Gly Tyr Ile Tyr 785 790 795 800 Trp Thr Glu Trp Gly Gly Lys Pro Arg Ile Val Arg Ala Phe Met Asp 805 810 815 Gly Thr Asn Cys Met Thr Leu Val Asp Lys Val Gly Arg Ala Asn Asp 820 825 830 Leu Thr Ile Asp Tyr Ala Asp Gln Arg Leu Tyr Trp Thr Asp Leu Asp 835 840 845 Thr Asn Met Ile Glu Ser Ser Asn Met Leu Gly Gln Glu Arg Val Val 850 855 860 Ile Ala Asp Asp Leu Pro His Pro Phe Gly Leu Thr Gln Tyr Ser Asp 865 870 875 880 Tyr Ile Tyr Trp Thr Asp Trp Asn Leu His Ser Ile Glu Arg Ala Asp 885 890 895 Lys Thr Ser Gly Arg Asn Arg Thr Leu Ile Gln Gly His Leu Asp Phe 900 905 910 Val Met Asp Ile Leu Val Phe His Ser Ser Arg Gln Asp Gly Leu Asn 915 920 925 Asp Cys Met His Asn Asn Gly Gln Cys Gly Gln Leu Cys Leu Ala Ile 930 935 940 Pro Gly Gly His Arg Cys Gly Cys Ala Ser His Tyr Thr Leu Asp Pro 945 950 955 960 Ser Ser Arg Asn Cys Ser Pro Pro Thr Thr Phe Leu Leu Phe Ser Gln 965 970 975 Lys Ser Ala Ile Ser Arg Met Ile Pro Asp Asp Gln His Ser Pro Asp 980 985 990 Leu Ile Leu Pro Leu His Gly Leu Arg Asn Val Lys Ala Ile Asp Tyr 995 1000 1005 Asp Pro Leu Asp Lys Phe Ile Tyr Trp Val Asp Gly Arg Gln Asn Ile 1010 1015 1020 Lys Arg Ala Lys Asp Asp Gly Thr Gln Pro Phe Val Leu Thr Ser Leu 1025 1030 1035 1040 Ser Gln Gly Gln Asn Pro Asp Arg Gln Pro His Asp Leu Ser Ile Asp 1045 1050 1055 Ile Tyr Ser Arg Thr Leu Phe Trp Thr Cys Glu Ala Thr Asn Thr Ile 1060 1065 1070 Asn Val His Arg Leu Ser Gly Glu Ala Met Gly Val Val Leu Arg Gly 1075 1080 1085 Asp Arg Asp Lys Pro Arg Ala Ile Val Val Asn Ala Glu Arg Gly Tyr 1090 1095 1100 Leu Tyr Phe Thr Asn Met Gln Asp Arg Ala Ala Lys Ile Glu Arg Ala 1105 1110 1115 1120 Ala Leu Asp Gly Thr Glu Arg Glu Val Leu Phe Thr Thr Gly Leu Ile 1125 1130 1135 Arg Pro Val Ala Leu Val Val Asp Asn Thr Leu Gly Lys Leu Phe Trp 1140 1145 1150 Val Asp Ala Asp Leu Lys Arg Ile Glu Ser Cys Asp Leu Ser Gly Ala 1155 1160 1165 Asn Arg Leu Thr Leu Glu Asp Ala Asn Ile Val Gln Pro Leu Gly Leu 1170 1175 1180 Thr Ile Leu Gly Lys His Leu Tyr Trp Ile Asp Arg Gln Gln Gln Met 1185 1190 1195 1200 Ile Glu Arg Val Glu Lys Thr Thr Gly Asp Lys Arg Thr Arg Ile Gln 1205 1210 1215 Gly Arg Val Ala His Leu Thr Gly Ile His Ala Val Glu Glu Val Ser 1220 1225 1230 Leu Glu Glu Phe Ser Ala His Pro Cys Ala Arg Asp Asn Gly Gly Cys 1235 1240 1245 Ser His Ile Cys Ile Ala Lys Gly Asp Gly Thr Pro Arg Cys Ser Cys 1250 1255 1260 Pro Val His Leu Val Leu Leu Gln Asn Leu Leu Thr Cys Gly Glu Pro 1265 1270 1275 1280 Pro Thr Cys Ser Pro Asp Gln Phe Ala Cys Ala Thr Gly Glu Ile Asp 1285 1290 1295 Cys Ile Pro Gly Ala Trp Arg Cys Asp Gly Phe Pro Glu Cys Asp Asp 1300 1305 1310 Gln Ser Asp Glu Glu Gly Cys Pro Val Cys Ser Ala Ala Gln Phe Pro 1315 1320 1325 Cys Ala Arg Gly Gln Cys Val Asp Leu Arg Leu Arg Cys Asp Gly Glu 1330 1335 1340 Ala Asp Cys Gln Asp Arg Ser Asp Glu Ala Asp Cys Asp Ala Ile Cys 1345 1350 1355 1360 Leu Pro Asn Gln Phe Arg Cys Ala Ser Gly Gln Cys Val Leu Ile Lys 1365 1370 1375 Gln Gln Cys Asp Ser Phe Pro Asp Cys Ile Asp Gly Ser Asp Glu Leu 1380 1385 1390 Met Cys Glu Ile Thr Lys Pro Pro Ser Asp Asp Ser Pro Ala His Ser 1395 1400 1405 Ser Ala Ile Gly Pro Val Ile Gly Ile Ile Leu Ser Leu Phe Val Met 1410 1415 1420 Gly Gly Val Tyr Phe Val Cys Gln Arg Val Val Cys Gln Arg Tyr Ala 1425 1430 1435 1440 Gly Ala Asn Gly Pro Phe Pro His Glu Tyr Val Ser Gly Thr Pro His 1445 1450 1455 Val Pro Leu Asn Phe Ile Ala Pro Gly Gly Ser Gln His Gly Pro Phe 1460 1465 1470 Thr Gly Ile Ala Cys Gly Lys Ser Met Met Ser Ser Val Ser Leu Met 1475 1480 1485 Gly Gly Arg Gly Gly Val Pro Leu Tyr Asp Arg Asn His Val Thr Gly 1490 1495 1500 Ala Ser Ser Ser Ser Ser Ser Ser Thr Lys Ala Thr Leu Tyr Pro Pro 1505 1510 1515 1520 Ile Leu Asn Pro Pro Pro Ser Pro Ala Thr Asp Pro Ser Leu Tyr Asn 1525 1530 1535 Met Asp Met Phe Tyr Ser Ser Asn Ile Pro Ala Thr Ala Arg Pro Tyr 1540 1545 1550 Arg Pro Tyr Ile Ile Arg Gly Met Ala Pro Pro Thr Thr Pro Cys Ser 1555 1560 1565 Thr Asp Val Cys Asp Ser Asp Tyr Ser Ala Ser Arg Trp Lys Ala Ser 1570 1575 1580 Lys Tyr Tyr Leu Asp Leu Asn Ser Asp Ser Asp Pro Tyr Pro Pro Pro 1585 1590 1595 1600 Pro Thr Pro His Ser Gln Tyr Leu Ser Ala Glu Asp Ser Cys Pro Pro 1605 1610 1615 Ser Pro Ala Thr Glu Arg Ser Tyr Phe His Leu Phe Pro Pro Pro Pro 1620 1625 1630 Ser Pro Cys Thr Asp Ser Ser 1635 91 base pairs nucleic acid single linear 30 TATAAAATGG CTTGGCAAAG GGAGTTCATT CCTTTTAGCG CTTCCATCTT CTGCAGTGAG 60 AGGACACCGC ATTCTTCTTC TCCAGAGGAT G 91 5263 base pairs nucleic acid single linear 31 TAAGAGTATA AAGGGCTCCT GAGACCAAAA AGGTTGAGAA CCAGTGCTTT AAAGCTTGAT 60 GTTTCTCAGG GTTTCATCCT TTGTGGATTA ATGCCCATTA TAAAATGGCT TGGCAAAGGG 120 AGTTCATTCC TTTTAGCGCT TCCATCTTCT GCAGTGAGAG GACACCGCAT TCTTCTTCTC 180 CAGAGGATGC AGCAGCAAGG CGCCATCTTG AAACCAGAGA CCAAACCAAC CAGCAACTTC 240 GTCTTGAACT TCCCAGCCTC CACAACTCAG CAGTCTGTGC AGGACCCTGT GAGCAGAGCC 300 GCAGCCTCGC CGCTCCTGCT ATTTGCCAAC CGCCGGGACG TACGGCTGGT GGACGCCGGC 360 GGAGTCAAGC TGGAGTCCAC CATCGTGGTC AGCGGCCTGG AGGATGCGGC CGCAGTGGAC 420 TTCCAGTTTT CCAAGGGAGC CGTGTACTGG ACAGACGTGA GCGAGGAGGC CATCAAGCAG 480 ACCTACCTGA ACCAGACGGG GGCCGCCGTG CAGAACGTGG TCATCTCCGG CCTGGTCTCT 540 CCCGACGGCC TCGCCTGCGA CTGGGTGGGC AAGAAGCTGT ACTGGACGGA CTCAGAGACC 600 AACCGCATCG AGGTGGCCAA CCTCAATGGC ACATCCCGGA AGGTGCTCTT CTGGCAGGAC 660 CTTGACCAGC CGAGGGCCAT CGCCTTGGAC CCCGCTCACG GGTACATGTA CTGGACAGAC 720 TGGGGTGAGA CGCCCCGGAT TGAGCGGGCA GGGATGGATG GCAGCACCCG GAAGATCATT 780 GTGGACTCGG ACATTTACTG GCCCAATGGA CTGACCATCG ACCTGGAGGA GCAGAAGCTC 840 TACTGGGCTG ACGCCAAGCT CAGCTTCATC CACCGTGCCA ACCTGGACGG CTCGTTCCGG 900 CAGAAGGTGG TGGAGGGCAG CCTGACGCAC CCCTTCGCCC TGACGCTCTC CGGGGACACT 960 CTGTACTGGA CAGACTGGCA GACCCGCTCC ATCCATGCCT GCAACAAGCG CACTGGGGGG 1020 AAGAGGAAGG AGATCCTGAG TGCCCTCTAC TCACCCATGG ACATCCAGGT GCTGAGCCAG 1080 GAGCGGCAGC CTTTCTTCCA CACTCGCTGT GAGGAGGACA ATGGCGGCTG CTCCCACCTG 1140 TGCCTGCTGT CCCCAAGCGA GCCTTTCTAC ACATGCGCCT GCCCCACGGG TGTGCAGCTG 1200 CAGGACAACG GCAGGACGTG TAAGGCAGGA GCCGAGGAGG TGCTGCTGCT GGCCCGGCGG 1260 ACGGACCTAC GGAGGATCTC GCTGGACACG CCGGACTTTA CCGACATCGT GCTGCAGGTG 1320 GACGACATCC GGCACGCCAT TGCCATCGAC TACGACCCGC TAGAGGGCTA TGTCTACTGG 1380 ACAGATGACG AGGTGCGGGC CATCCGCAGG GCGTACCTGG ACGGGTCTGG GGCGCAGACG 1440 CTGGTCAACA CCGAGATCAA CGACCCCGAT GGCATCGCGG TCGACTGGGT GGCCCGAAAC 1500 CTCTACTGGA CCGACACGGG CACGGACCGC ATCGAGGTGA CGCGCCTCAA CGGCACCTCC 1560 CGCAAGATCC TGGTGTCGGA GGACCTGGAC GAGCCCCGAG CCATCGCACT GCACCCCGTG 1620 ATGGGCCTCA TGTACTGGAC AGACTGGGGA GAGAACCCTA AAATCGAGTG TGCCAACTTG 1680 GATGGGCAGG AGCGGCGTGT GCTGGTCAAT GCCTCCCTCG GGTGGCCCAA CGGCCTGGCC 1740 CTGGACCTGC AGGAGGGGAA GCTCTACTGG GGAGACGCCA AGACAGACAA GATCGAGGTG 1800 ATCAATGTTG ATGGGACGAA GAGGCGGACC CTCCTGGAGG ACAAGCTCCC GCACATTTTC 1860 GGGTTCACGC TGCTGGGGGA CTTCATCTAC TGGACTGACT GGCAGCGCCG CAGCATCGAG 1920 CGGGTGCACA AGGTCAAGGC CAGCCGGGAC GTCATCATTG ACCAGCTGCC CGACCTGATG 1980 GGGCTCAAAG CTGTGAATGT GGCCAAGGTC GTCGGAACCA ACCCGTGTGC GGACAGGAAC 2040 GGGGGGTGAG CCACCTGTGC TTCTTCACAC CCCACGCAAC CCGGTGTGGC TGCCCCATCG 2100 GCCTGGAGCT GCTGAGTGAC ATGAAGACCT GCATCGTGCC TGAGGCCTTC TTGGTCTTCA 2160 CCAGCAGAGC CGCCATCCAC AGGATCTCCC TCGAGACCAA TAACAACGAC GTGGCCATCC 2220 CGCTCACGGG CGTCAAGGAG GCCTCAGCCC TGGACTTTGA TGTGTCCAAC AACCACATCT 2280 ACTGGACAGA CGTCAGCCTG AAGACCATCA GCCGCGCCTT CATGAACGGG AGCTCGGTGG 2340 AGCACGTGGT GGAGTTTGGC CTTGACTACC CCGAGGGCAT GGCCGTTGAC TGGATGGGCA 2400 AGAACCTCTA CTGGGCCGAC ACTGGGACCA ACAGAATCGA AGTGGCGCGG CTGGACGGGC 2460 AGTTCCGGCA AGTCCTCGTG TGGAGGGACT TGGACAACCC GAGGTCGCTG GCCCTGGATC 2520 CCACCAAGGG CTACATCTAC TGGACCGAGT GGGGCGGCAA GCCGAGGATC GTGCGGGCCT 2580 TCATGGACGG GACCAACTGC ATGACGCTGG TGGACAAGGT GGGCCGGGCC AACGACCTCA 2640 CCATTGACTA CGCTGACCAG CGCCTCTACT GGACCGACCT GGACACCAAC ATGATCGAGT 2700 CGTCCAACAT GCTGGGTCAG GAGCGGGTCG TGATTGCCGA CGATCTCCCG CACCCGTTCG 2760 GTCTGACGCA GTACAGCGAT TATATCTACT GGACAGACTG GAATCTGCAC AGCATTGAGC 2820 GGGCCGACAA GACTAGCGGC CGGAACCGCA CCCTCATCCA GGGCCACCTG GACTTCGTGA 2880 TGGACATCCT GGTGTTCCAC TCCTCCCGCC AGGATGGCCT CAATGACTGT ATGCACAACA 2940 ACGGGCAGTG TGGGCAGCTG TGCCTTGCCA TCCCCGGCGG CCACCGCTGC GGCTGCGCCT 3000 CACACTACAC CCTGGACCCC AGCAGCCGCA ACTGCAGCCC GCCCACCACC TTCTTGCTGT 3060 TCAGCCAGAA ATCTGCCATC AGTCGGATGA TCCCGGACGA CCAGCACAGC CCGGATCTCA 3120 TCCTGCCCCT GCATGGACTG AGGAACGTCA AAGCCATCGA CTATGACCCA CTGGACAAGT 3180 TCATCTACTG GGTGGATGGG CGCCAGAACA TCAAGCGAGC CAAGGACGAC GGGACCCAGC 3240 CCTTTGTTTT GACCTCTCTG AGCCAAGGCC AAAACCCAGA CAGGCAGCCC CACGACCTCA 3300 GCATCGACAT CTACAGCCGG ACACTGTTCT GGACGTGCGA GGCCACCAAT ACCATCAACG 3360 TCCACAGGCT GAGCGGGGAA GCCATGGGGG TGGTGCTGCG TGGGGACCGC GACAAGCCCA 3420 GGGCCATCGT CGTCAACGCG GAGCGAGGGT ACCTGTACTT CACCAACATG CAGGACCGGG 3480 CAGCCAAGAT CGAACGCGCA GCCCTGGACG GCACCGAGCG CGAGGTCCTC TTCACCACCG 3540 GCCTCATCCG CCCTGTGGCC CTGGTGGTAG ACAACACACT GGGCAAGCTG TTCTGGGTGG 3600 ACGCGGACCT GAAGCGCATT GAGAGCTGTG ACCTGTCAGG GGCCAACCGC CTGACCCTGG 3660 AGGACGCCAA CATCGTGCAG CCTCTGGGCC TGACCATCCT TGGCAAGCAT CTCTACTGGA 3720 TCGACCGCCA GCAGCAGATG ATCGAGCGTG TGGAGAAGAC CACCGGGGAC AAGCGGACTC 3780 GCATCCAGGG CCGTGTCGCC CACCTCACTG GCATCCATGC AGTGGAGGAA GTCAGCCTGG 3840 AGGAGTTCTC AGCCCACCCA TGTGCCCGTG ACAATGGTGG CTGCTCCCAC ATCTGTATTG 3900 CCAAGGGTGA TGGGACACCA CGGTGCTCAT GCCCAGTCCA CCTCGTGCTC CTGCAGAACC 3960 TGCTGACCTG TGGAGAGCCG CCCACCTGCT CCCCGGACCA GTTTGCATGT GCCACAGGGG 4020 AGATCGACTG TATCCCCGGG GCCTGGCGCT GTGACGGCTT TCCCGAGTGC GATGACCAGA 4080 GCGACGAGGA GGGCTGCCCC GTGGCTCCGC CGCCCAGTTC CCCTGCGCGC GGGGTCAGTG 4140 TGTGGACCTG CGCCTGCGCT GCGACGGCGA GGCAGACTGT CAGGACCGCT CAGACGAGGC 4200 GGACTGTGAC GCCATCTGCC TGCCCAACCA GTTCCGGTGT GCGAGCGGCC AGTGTGTCCT 4260 CATCAAACAG CAGTGCGACT CCTTCCCCGA CTGTATCGAC GGCTCCGACG AGCTCATGTG 4320 TGAAATCACC AAGCCGCCCT CAGACGACAG CCCGGCCCAC AGCAGTGCCA TCGGGCCCGT 4380 CATTGGCATC ATCCTCTCTC TCTTCGTCAT GGGTGGTGTC TATTTTGTGT GCCAGCGCGT 4440 GGTGTGCCAG CGCTATGCGG GGGCCAACGG GCCCTTCCCG CACGAGTATG TCAGCGGGAC 4500 CCCGCACGTG CCCCTCAATT TCATAGCCCC GGGCGGTTCC CAGCATGGCC CCTTCACAGG 4560 CATCGCATGC GGAAAGTCCA TGATGAGCTC CGTGAGCCTG ATGGGGGGCC GGGGCGGGGT 4620 GCCCCTCTAC GACCGGAACC ACGTCACAGG GGCCTCGTCC AGCAGCTCGT CCAGCACGAA 4680 GGCCACGCTG TACCCGCGGA TCCTGAACCC GCCGCCCTCC CCGGCCACGG ACCCCTCCCT 4740 GTACAACATG GACATGTTCT ACTCTTCAAA CATTCCGGCC ACTGCGAGAC CGTACAGGCC 4800 CTACATCATT CGAGGAATGG CGCCCCCGAC GACGCCCTGC AGCACCGACG TGTGTGACAG 4860 CGACTACAGC GCCAGCCGCT GGAAGGCCAG CAAGTACTAC CTGGATTTGA ACTCGGACTC 4920 AGACCCCTAT CCACCCCCAC CCACGCCCCA CAGCCAGTAC CTGTCGGCGG AGGACAGCTG 4980 CCCGCCCTCG CCCGCCACCG AGAGGAGCTA CTTCCATCTC TTCCCGCCCC CTCCGTCCCC 5040 CTGCACGGAC TCATCCTGAC CTCGGCCGGG CCACTCTGGC TTCTCTGTGC CCCTGTAAAT 5100 AGTTTTAAAT ATGAACAAAG AAAAAAATAT ATTTTATGAT TTAAAAAATA AATATAATTG 5160 GGATTTTAAA AACATGAGAA ATGTGAACTG TGATGGGGTG GGCAGGGCTG GGAGAACTTT 5220 GTACAGTGGA ACAAATATTT ATAAACTTAA TTTTGTAAAA CAG 5263 5022 base pairs nucleic acid single linear 32 GGCTGGTCTT GAACTCCTGG CCTGAGATGA TCCTCTCTCC TCGGAAAGTG CTGGGATTAT 60 AGCCTCGCCG CTCCTGCTAT TTGCCAACCG CCGGGACGTA CGGCTGGTGG ACGCCGGCGG 120 AGTCAAGCTG GAGTCCACCA TCGTGGTCAG CGGCCTGGAG GATGCGGCCG CAGTGGACTT 180 CCAGTTTTCC AAGGGAGCCG TGTACTGGAC AGACGGAGCG AGGAGGCCAT CAAGCAGACC 240 TACCTGAACC AGACGGGGGC CGCCGTGCAG AACGTGGTCA TCTCCGGCCT GGTCTCTCCC 300 GACGGCCTCG CCTGCGACTG GGTGGGCAAG AAGCTGTACT GGACGGACTC AGAGACCAAC 360 CGCATCGAGG TGGCCAACCT CAATGGCACA TCCCGGAAGG TGCTCTTCTG GCAGGACCTT 420 GACCAGCCGA GGGCCATCGC CTTGGACCCC GCTCACGGGT ACATGTACTG GACAGACTGG 480 GGTGAGACGC CCCGGATTGA GCGGGCAGGG ATGGATGGCA GCACCCGGAA GATCATTGTG 540 GACTCGGACA TTTACTGGCC CAATGGACTG ACCATCGACC TGGAGGAGCA GAAGCTCTAC 600 TGGGCTGACG CCAAGCTCAG CTTCATCCAC CGTGCCAACC TGGACGGCTC GTTCCGGCAG 660 AAGGTGGTGG AGGGCAGCCT GACGCACCCC TTCGCCCTGA CGCTCTCCGG GGACACTCTG 720 TACTGGACAG ACTGGCAGAC CCGCTCCATC CATGCCTGCA ACAAGCGCAC TGGGGGGAAG 780 AGGAAGGAGA TCCTGAGTGC CCTCTACTCA CCCATGGACA TCCAGGTGCT GAGCCAGGAG 840 CGGCAGCCTT TCTTCCACAC TCGCTGTGAG GAGGACAATG GCGGCTGCTC CCACCTGTGC 900 CTGCTGTCCC CAAGCGAGCC TTTCTACACA TGCGCCTGCC CCACGGGTGT GCAGCTGCAG 960 GACAACGGCA GGACGTGTAA GGCAGGAGCC GAGGAGGTGC TGCTGCTGGC CCGGCGGACG 1020 GACCTACGGA GGATCTCGCT GGACACGCCG GACTTTACCG ACATCGTGCT GCAGGTGGAC 1080 GACATCCGGC ACGCCATTGC CATCGACTAC GACCCGCTAG AGGGCTATGT CTACTGGACA 1140 GATGACGAGG TGCGGGCCAT CCGCAGGGCG TACCTGGACG GGTCTGGGGC GCAGACGCTG 1200 GTCAACACCG AGATCAACGA CCCCGATGGC ATCGCGGTCG ACTGGGTGGC CCGAAACCTC 1260 TACTGGACCG ACACGGGCAC GGACCGCATC GAGGTGACGC GCCTCAACGG CACCTCCCGC 1320 AAGATCCTGG TGTCGGAGGA CCTGGACGAG CCCCGAGCCA TCGCACTGCA CCCCGTGATG 1380 GGCCTCATGT ACTGGACAGA CTGGGGAGAG AACCCTAAAA TCGAGTGTGC CAACTTGGAT 1440 GGGCAGGAGC GGCGTGTGCT GGTCAATGCC TCCCTCGGGT GGCCCAACGG CCTGGCCCTG 1500 GACCTGCAGG AGGGGAAGCT CTACTGGGGA GACGCCAAGA CAGACAAGAT CGAGGTGATC 1560 AATGTTGATG GGACGAAGAG GCGGACCCTC CTGGAGGACA AGCTCCCGCA CATTTTCGGG 1620 TTCACGCTGC TGGGGGACTT CATCTACTGG ACTGACTGGC AGCGCCGCAG CATCGAGCGG 1680 GTGCACAAGG TCAAGGCCAG CCGGGACGTC ATCATTGACC AGCTGCCCGA CCTGATGGGG 1740 CTCAAAGCTG TGAATGTGGC CAAGGTCGTC GGAACCAACC CGTGTGCGGA CAGGAACGGG 1800 GGGTGCAGCC ACCTGTGCTT CTTCACACCC CACGCAACCC GGTGTGGCTG CCCCATCGGC 1860 CTGGAGCTGC TGAGTGACAT GAAGACCTGC ATCGTGCCTG AGGCCTTCTT GGTCTTCACC 1920 AGCAGAGCCG CCATCCACAG GATCTCCCTC GAGACCAATA ACAACGACGT GGCCATCCCG 1980 CTCACGGGCG TCAAGGAGGC CTCAGCCCTG GACTTTGATG TGTCCAACAA CCACATCTAC 2040 TGGACAGACG TCAGCCTGAA GACCATCAGC CGCGCCTTCA TGAACGGGAG CTCGGTGGAG 2100 CACGTGGTGG AGTTTGGCCT TGACTACCCC GAGGGCATGG CCGTTGACTG GATGGGCAAG 2160 AACCTCTACT GGGCCGACAC TGGGACCAAC AGAATCGAAG TGGCGCGGCT GGACGGGCAG 2220 TTCCGGCAAG TCCTCGTGTG GAGGGACTTG GACAACCCGA GGTCGCTGGC CCTGGATCCC 2280 ACCAAGGGCT ACATCTACTG GACCGAGTGG GGCGGCAAGC CGAGGATCGT GCGGGCCTTC 2340 ATGGACGGGA CCAACTGCAT GACGCTGGTG GACAAGGTGG GCCGGGCCAA CGACCTCACC 2400 ATTGACTACG CTGACCAGCG CCTCTACTGG ACCGACCTGG ACACCAACAT GATCGAGTCG 2460 TCCAACATGC TGGGTCAGGA GCGGGTCGTG ATTGCCGACG ATCTCCCGCA CCCGTTCGGT 2520 CTGACGCAGT ACAGCGATTA TATCTACTGG ACAGACTGGA ATCTGCACAG CATTGAGCGG 2580 GCCGACAAGA CTAGCGGCCG GAACCGCACC CTCATCCAGG GCCACCTGGA CTTCGTGATG 2640 GACATCCTGG TGTTCCACTC CTCCCGCCAG GATGGCCTCA ATGACTGTAT GCACAACAAC 2700 GGGCAGTGTG GGCAGCTGTG CCTTGCCATC CCCGGCGGCC ACCGCTGCGG CTGCGCCTCA 2760 CACTACACCC TGGACCCCAG CAGCCGCAAC TGCAGCCCGC CCACCACCTT CTTGCTGTTC 2820 AGCCAGAAAT CTGCCATCAG TCGGATGATC CCGGACGACC AGCACAGCCC GGATCTCATC 2880 CTGCCCCTGC ATGGACTGAG GAACGTCAAA GCCATCGACT ATGACCCACT GGACAAGTTC 2940 ATCTACTGGG TGGATGGGCG CCAGAACATC AAGCGAGCCA AGGACGACGG GACCCAGCCC 3000 TTTGTTTTGA CCTCTCTGAG CCAAGGCCAA AACCCAGACA GGCAGCCCCA CGACCTCAGC 3060 ATCGACATCT ACAGCCGGAC ACTGTTCTGG ACGTGCGAGG CCACCAATAC CATCAACGTC 3120 CACAGGCTGA GCGGGGAAGC CATGGGGGTG GTGCTGCGTG GGGACCGCGA CAAGCCCAGG 3180 GCCATCGTCG TCAACGCGGA GCGAGGGTAC CTGTACTTCA CCAACATGCA GGACCGGGCA 3240 GCCAAGATCG AACGCGCAGC CCTGGACGGC ACCGAGCGCG AGGTCCTCTT CACCACCGGC 3300 CTCATCCGCC CTGTGGCCCT GGTGGTAGAC AACACACTGG GCAAGCTGTT CTGGGTGGAC 3360 GCGGACCTGA AGCGCATTGA GAGCTGTGAC CTGTCAGGGG CCAACCGCCT GACCCTGGAG 3420 GACGCCAACA TCGTGCAGCC TCTGGGCCTG ACCATCCTTG GCAAGCATCT CTACTGGATC 3480 GACCGCCAGC AGCAGATGAT CGAGCGTGTG GAGAAGACCA CCGGGGACAA GCGGACTCGC 3540 ATCCAGGGCC GTGTCGCCCA CCTCACTGGC ATCCATGCAG TGGAGGAAGT CAGCCTGGAG 3600 GAGTTCTCAG CCCACCCATG TGCCCGTGAC AATGGTGGCT GCTCCCACAT CTGTATTGCC 3660 AAGGGTGATG GGACACCACG GTGCTCATGC CCAGTCCACC TCGTGCTCCT GCAGAACCTG 3720 CTGACCTGTG GAGAGCCGCC CACCTGCTCC CCGGACCAGT TTGCATGTGC CACAGGGGAG 3780 ATCGACTGTA TCCCCGGGGC CTGGCGCTGT GACGGCTTTC CCGAGTGCGA TGACCAGAGC 3840 GACGAGGAGG GCTGCCCCGT GTGCTCCGCC GCCCAGTTCC CCTGCGCGCG GGGTCAGTGT 3900 GTGGACCTGC GCCTGCGCTG CGACGGCGAG GCAGACTGTC AGGACCGCTC AGACGAGGCG 3960 GACTGTGACG CCATCTGCCT GCCCAACCAG TTCCGGTGTG CGAGCGGCCA GTGTGTCCTC 4020 ATCAAACAGC AGTGCGACTC CTTCCCCGAC TGTATCGACG GCTCCGACGA GCTCATGTGT 4080 GAAATCACCA AGCCGCCCTC AGACGACAGC CCGGCCCACA GCAGTGCCAT CGGGCCCGTC 4140 ATTGGCATCA TCCTCTCTCT CTTCGTCATG GGTGGTGTCT ATTTTGTGTG CCAGCGCGTG 4200 GTGTGCCAGC GCTATGCGGG GGCCAACGGG CCCTTCCCGC ACGAGTATGT CAGCGGGACC 4260 CCGCACGTGC CCCTCAATTT CATAGCCCCG GGCGGTTCCC AGCATGGCCC CTTCACAGGC 4320 ATCGCATGCG GAAAGTCCAT GATGAGCTCC GTGAGCCTGA TGGGGGGCCG GGGCGGGGTG 4380 CCCCTCTACG ACCGGAACCA CGTCACAGGG GCCTCGTCCA GCAGCTCGTC CAGCACGAAG 4440 GCCACGCTGT ACCCGCCGAT CCTGAACCCG CCGCCCTCCC CGGCCACGGA CCCCTCCCTG 4500 TACAACATGG ACATGTTCTA CTCTTCAAAC ATTCCGGCCA CTGTGAGACC GTACAGGCCC 4560 TACATCATTC GAGGAATGGC GCCCCCGACG ACGCCCTGCA GCACCGACGT GTGTGACAGC 4620 GACTACAGCG CCAGCCGCTG GAAGGCCAGC AAGTACTACC TGGATTTGAA CTCGGACTCA 4680 GACCCCTATC CACCCCCACC CACGCCCCAC AGCCAGTACC TGTCGGCGGA GGACAGCTGC 4740 CCGCCCTCGC CCGCCACCGA GAGGAGCTAC TTCCATCTCT TCCCGCCCCC TCCGTCCCCC 4800 TGCACGGACT CATCCTGACC TCGGCCGGGC CACTCTGGCT TCTCTGTGCC CCTGTAAATA 4860 GTTTTAAATA TGAACAAAGA AAAAAATATA TTTTATGATT TAAAAAATAA ATATAATTGG 4920 GATTTTAAAA ACATGAGAAA TGTGAACTGT GATGGGGTGG GCAGGGCTGG GAGAACTTTG 4980 TACAGTGGAA CAAATATTTA TAAACTTAAT TTTGTAAAAC AG 5022 5162 base pairs nucleic acid single linear 33 AGGCTGGTCT CAAACTCCTG GCCTTAAGTG ATCTGCCCGC CTCGGCCTCC CAAAGTGCTG 60 AGATGACAGG TGTGAGCCAC CGTGCCCGGC CCAGAACTCT TTAATTCCCA CCTGAAACTT 120 GCCGCCTTAA GCAGGTCCCC AGTCTCCCTC CCCTAGTCCC TGGTCCCACC ATTCTGCTTT 180 CTGTCTCAAT GAATTTGCCT ACCCCTCGCC GCTCCTGCTA TTTGCCAACC GCCGGGACGT 240 ACGGCTGGTG GACGCCGGCG GAGTCAAGCT GGAGTCCACC ATCGTGGTCA GCGGCCTGGA 300 GGATGCGGCC GCAGTGGACT TCCAGTTTTC CAAGGGAGCC GTGTACTGGA CAGACGTGAG 360 CGAGGAGGCC ATCAAGCAGA CCTACCTGAA CCAGACGGGG GCCGCCGTGC AGAACGTGGT 420 CATCTCCGGC CTGGTCTCTC CCGACGGCCT CGCCTGCGAC TGGGTGGGCA AGAAGCTGTA 480 CTGGACGGAC TCAGAGACCA ACCGCATCGA GGTGGCCAAC CTCAATGGCA CATCCCGGAA 540 GGTGCTCTTC TGGCAGGACC TTGACCAGCC GAGGGCCATC GCCTTGGACC CCGCTCACGG 600 GTACATGTAC TGGACAGACT GGGGTGAGAC GCCCCGGATT GAGCGGGCAG GGATGGATGG 660 CAGCACCCGG AAGATCATTG TGGACTCGGA CATTTACTGG CCCAATGGAC TGACCATCGA 720 CCTGGAGGAG CAGAAGCTCT ACTGGGCTGA CGCCAAGCTC AGCTTCATCC ACCGTGCCAA 780 CCTGGACGGC TCGTTCCGGC AGAAGGTGGT GGAGGGCAGC CTGACGCACC CCTTCGCCCT 840 GACGCTCTCC GGGGACACTC TGTACTGGAC AGACTGGCAG ACCCGCTCCA TCCATGCCTG 900 CAACAAGCGC ACTGGGGGGA AGAGGAAGGA GATCCTGAGT GCCCTCTACT CACCCATGGA 960 CATCCAGGTG CTGAGCCAGG AGCGGCAGCC TTTCTTCCAC ACTCGCTGTG AGGAGGACAA 1020 TGGCGGCTGC TCCCACCTGT GCCTGCTGTC CCCAAGCGAG CCTTTCTACA CATGCGCCTG 1080 CCCCACGGGT GTGCAGCTGC AGGACAACGG CAGGACGTGT AAGGCAGGAG CCGAGGAGGT 1140 GCTGCTGCTG GCCCGGCGGA CGGACCTACG GAGGATCTCG CTGGACACGC CGGACTTTAC 1200 CGACATCGTG CTGCAGGTGG ACGACATCCG GCACGCCATT GCCATCGACT ACGACCCGCT 1260 AGAGGGCTAT GTCTACTGGA CAGATGACGA GGTGCGGGCC ATCCGCAGGG CGTACCTGGA 1320 CGGGTCTGGG GCGCAGACGC TGGTCAACAC CGAGATCAAC GACCCCGATG GCATCGCGGT 1380 CGACTGGGTG GCCCGAAACC TCTACTGGAC CGACACGGGC ACGGACCGCA TCGAGGTGAC 1440 GCGCCTCAAC GGCACCTCCC GCAAGATCCT GGTGTCGGAG GACCTGGACG AGCCCCGAGC 1500 CATCGCACTG CACCCCGTGA TGGGCCTCAT GTACTGGACA GACTGGGGAG AGAACCCTAA 1560 AATCGAGTGT GCCAACTTGG ATGGGCAGGA GCGGCGTGTG CTGGTCAATG CCTCCCTCGG 1620 GTGGCCCAAC GGCCTGGCCC TGGACCTGCA GGAGGGGAAG CTCTACTGGG GAGACGCCAA 1680 GACAGACAAG ATCGAGGTGA TCAATGTTGA TGGGACGAAG AGGCGGACCC TCCTGGAGGA 1740 CAAGCTCCCG CACATTTTCG GGTTCACGCT GCTGGGGGAC TTCATCTACT GGACTGACTG 1800 GCAGCGCCGC AGCATCGAGC GGGTGCACAA GGTCAAGGCC AGCCGGGACG TCATCATTGA 1860 CCAGCTGCCC GACCTGATGG GGCTCAAAGC TGTGAATGTG GCCAAGGTCG TCGGAACCAA 1920 CCCGTGTGCG GACAGGAACG GGGGGTGCAG CCACCTGTGC TTCTTCACAC CCCACGCAAC 1980 CCGGTGTGGC TGCCCCATCG GCCTGGAGCT GCTGAGTGAC ATGAAGACCT GCATCGTGCC 2040 TGAGGCCTCT TGGTCTTCAC CAGCAGAGCC GCCATCCACA GGATCTCCCT CGAGACCAAT 2100 AACAACGACG TGGCCATCCC GCTCACGGGC GTCAAGGAGG CCTCAGCCCT GGACTTTGAT 2160 GTGTCCAACA ACCACATCTA CTGGACAGAC GTCAGCCTGA AGACCATCAG CCGCGCCTTC 2220 ATGAACGGGA GCTCGGTGGA GCACGTGGTG GAGTTTGGCC TTGACTACCC CGAGGGCATG 2280 GCCGTTGACT GGATGGGCAA GAACCTCTAC TGGGCCGACA CTGGGACCAA CAGAATCGAA 2340 GTGGCGCGGC TGGACGGGCA GTTCCGGCAA GTCCTCGTGT GGAGGGACTT GGACAACCCG 2400 AGGTCGCTGG CCCTGGATCC CACCAAGGGC TACATCTACT GGACCGAGTG GGGCGGCAAG 2460 CCGAGGATCG TGCGGGCCTT CATGGACGGG ACCAACTGCA TGACGCTGGT GGACAAGGTG 2520 GGCCGGGCCA ACGACCTCAC CATTGACTAC GCTGACCAGC GCCTCTACTG GACCGACCTG 2580 GACACCAACA TGATCGAGTC GTCCAACATG CTGGGTCAGG AGCGGGTCGT GATTGCCGAC 2640 GATCTCCCGC ACCCGTTCGG TCTGACGCAG TACAGCGATT ATATCTACTG GACAGACTGG 2700 AATCTGCACA GCATTGAGCG GGCCGACAAG ACTAGCGGCC GGAACCGCAC CCTCATCCAG 2760 GGCCACCTGG ACTTCGTGAT GGACATCCTG GTGTTCCACT CCTCCCGCCA GGATGGCCTC 2820 AATGACTGTA TGCACAACAA CGGGCAGTGT GGGCAGCTGT GCCTTGCCAT CCCCGGCGGC 2880 CACCGCTGCG GCTGCGCCTC ACACTACACC CTGGACCCCA GCAGCCGCAA CTGCAGCCCG 2940 CCCACCACCT TCTTGCTGTT CAGCCAGAAA TCTGCCATCA GTCGGATGAT CCCGGACGAC 3000 CAGCACAGCC CGGATCTCAT CCTGCCCCTG CATGGACTGA GGAACGTCAA AGCCATCGAC 3060 TATGACCCAC TGGACAAGTT CATCTACTGG GTGGATGGGC GCCAGAACAT CAAGCGAGCC 3120 AAGGACGACG GGACCCAGCC CTTTGTTTTG ACCTCTCTGA GCCAAGGCCA AAACCCAGAC 3180 AGGCAGCCCC ACGACCTCAG CATCGACATC TACAGCCGGA CACTGTTCTG GACGTGCGAG 3240 GCCACCAATA CCATCAACGT CCACAGGCTG AGCGGGGAAG CCATGGGGGT GGTGCTGCGT 3300 GGGGACCGCG ACAAGCCCAG GGCCATCGTC GTCAACGCGG AGCGAGGGTA CCTGTACTTC 3360 ACCAACATGC AGGACCGGGC AGCCAAGATC GAACGCGCAG CCCTGGACGG CACCGAGCGC 3420 GAGGTCCTCT TCACCACCGG CCTCATCCGC CCTGTGGCCC TGGTGGTAGA CAACACACTG 3480 GGCAAGCTGT TCTGGGTGGA CGCGGACCTG AAGCGCATTG AGAGCTGTGA CCTGTCAGGG 3540 GCCAACCGCC TGACCCTGGA GGACGCCAAC ATCGTGCAGC CTCTGGGCCT GACCATCCTT 3600 GGCAAGCATC TCTACTGGAT CGACCGCCAG CAGCAGATGA TCGAGCGTGT GGAGAAGACC 3660 ACCGGGGACA AGCGGACTCG CATCCAGGGC CGTGTCGCCC ACCTCACTGG CATCCATGCA 3720 GTGGAGGAAG TCAGCCTGGA GGAGTTCTCA GCCCACCCAT GTGCCCGTGA CAATGGTGGC 3780 TGCTCCCACA TCTGTATTGC CAAGGGTGAT GGGACACCAC GGTGCTCATG CCCAGTCCAC 3840 CTCGTGCTCC TGCAGAACCT GCTGACCTGT GGAGAGCCGC CCACCTGCTC CCCGGACCAG 3900 TTTGCATGTG CCACAGGGGA GATCGACTGT ATCCCCGGGG CCTGGCGCTG TGACGGCTTT 3960 CCCGAGTGCG ATGACCAGAG CGACGAGGAG GGCTGCCCCG TGTGCTCCGC CGCCCAGTTC 4020 CCCTGCGCGC GGGGTCAGTG TGTGGACCTG CGCCTGCGCT GCGACGGCGA GGCAGACTGT 4080 CAGGACCGCT CAGACGAGGC GGACTGTGAC GCCATCGCCT GCCCAACCAG TTCCGGTGTG 4140 CGAGCGGCCA GTGTGTCCTC ATCAAACAGC AGTGCGACTC CTTCCCCGAC TGTATCGACG 4200 GCTCCGACGA GCTCATGTGT GAAATCACCA AGCCGCCCTC AGACGACAGC CCGGCCCACA 4260 GCAGTGCCAT CGGGCCCGTC ATTGGCATCA TCCTCTCTCT CTTCGTCATG GGTGGTGTCT 4320 ATTTTGTGTG CCAGCGCGTG GTGTGCCAGC GCTATGCGGG GGCCAACGGG CCCTTCCCGC 4380 ACGAGTATGT CAGCGGGACC CCGCACGTGC CCCTCAATTT CATAGCCCCG GGCGGTTCCC 4440 AGCATGGCCC CTTCACAGGC ATCGCATGCG GAAAGTCCAT GATGAGCTCC GTGAGCCTGA 4500 TGGGGGGCCG GGGCGGGGTG CCCCTCTACG ACCGGAACCA CGTCACAGGG GCCTCGTCCA 4560 GCAGCTCGTC CAGCACGAAG GCCACGCTGT ACCCGCGGAT CCTGAACCCG CCGCCCTCCC 4620 CGGCCACGGA CCCCTCCCTG TACAACATGG ACATGTTCTA CTCTTCAAAC ATTCCGGCCA 4680 CTGCGAGACC GTACAGGCCC TACATCATTC GAGGAATGGC GCCCCCGACG ACGCCCTGCA 4740 GCACCGACGT GTGTGACAGC GACTACAGCG CCAGCCGCTG GAAGGCCAGC AAGTACTACC 4800 TGGATTTGAA CTCGGACTCA GACCCCTATC CACCCCCACC CACGCCCCAC AGCCAGTACC 4860 TGTCGGCGGA GGACAGCTGC CCGCCCTCGC CCGCCACCGA GAGGAGCTAC TTCCATCTCT 4920 TCCCGCCCCC TCCGTCCCCC TGCACGGACT CATCCTGACC TCGGCCGGGC CACTCTGGCT 4980 TCTCTGTGCC CCTGTAAATA GTTTTAAATA TGAACAAAGA AAAAAATATA TTTTATGATT 5040 TAAAAAATAA ATATAATTGG GATTTTAAAA ACATGAGAAA TGTGAACTGT GATGGGGTGG 5100 GCAGGGCTGG GAGAACTTTG TACAGTGGAA CAAATATTTA TAAACTTAAT TTTGTAAAAC 5160 AG 5162 114 base pairs nucleic acid single linear 34 CAATGTCCAG TTCCGCTGCA GTTATAACAT CCCATTTTTT GATTTCTTTT TATTTTTTCC 60 TTTTTCTTTT TGAGATGGAG TCTCGCTCTG TCACCCAGGC TGGAGTGCAA TGGG 114 1711 base pairs nucleic acid single linear 35 GCCGCGGCGC CCGAGGCGGG AGCAAGAGGC GCCGGGAGCC GCGAGGATCC ACCGCCGCCG 60 CGCGCGCCAT GGAGCCCGAG TGAGCGCGCG GCGCTCCCGG CCGCCGGACG ACATGGAAAC 120 GGCGCCGACC CGGGCCCCTC CGCCGCCGCC GCCGCCGCTG CTGCTGCTGG TGCTGTACTG 180 CAGCTTGGTC CCCGCCGCGG CCTCACCGCT CCTGTTGTTT GCCAACCGCC GGGATGTGCG 240 GCTAGTGGAT GCCGGCGGAG TGAAGCTGGA GTCCACCATT GTGGCCAGTG GCCTGGAGGA 300 TGCAGCTGCT GTAGACTTCC AGTTCTCCAA GGGTGCTGTG TACTGGACAG ATGTGAGCGA 360 GGAGGCCATC AAACAGACCT ACCTGAACCA GACTGGAGGT GCTGCACAGA ACATTGTCAT 420 CTCGGGCCTC GTGTCACCTG ATGGCCTGGC CTGTGACTGG GTTGGCAAGA AGCTGTACTG 480 GACGGACTCC GAGACCAACC GCATTGAGGT TGCCAACCTC AATGGGACGT CCCGTAAGGT 540 TCTCTTCTGG CAGGACCTGG ACCAGCCAAG GGCCATTGCC CTGGATCCTG CACATGGGTA 600 CATGTACTGG ACTGACTGGG GGGAAGCACC CCGGATCGAG CGGGCAGGGA TGGATGGCAG 660 TACCCGGAAG ATCATTGTAG ACTCCGACAT TTACTGGCCC AATGGGCTGA CCATCGACCT 720 GGAGGAACAG AAGCTGTACT GGGCCGATGC CAAGCTCAGC TTCATCCACC GTGCCAACCT 780 GGACGGCTCC TTCCGGCAGA AGGTGGTGGA GGGCAGCCTC ACTCACCCTT TTGCCCTGAC 840 ACTCTCTGGG GACACACTCT ACTGGACAGA CTGGCAGACC CGCTCCATCC ACGCCTGCAA 900 CAAGTGGACA GGGGAGCAGA GGAAGGAGAT CCTTAGTGCT CTGTACTCAC CCATGGACAT 960 CCAAGTGCTG AGCCAGGAGC GGCAGCCTCC CTTCCACACA CCATGCGAGG AGGACAACGG 1020 TGGCTGTTCC CACCTGTGCC TGCTGTCCCC GAGGGAGCCT TTCTACTCCT GTGCCTGCCC 1080 CACTGGTGTG CAGTTGCAGG ACAATGGCAA GACGTGCAAG ACAGGGGCTG AGGAAGTGCT 1140 GCTGCTGGCT CGGAGGACAG ACCTGAGGAG GATCTCTCTG GACACCCCTG ACTTCACAGA 1200 CATAGTGCTG CAGGTGGGCG ACATCCGGCA TGCCATTGCC ATTGACTACG ATCCCCTGGA 1260 GGGCTACGTG TACTGGACCG ATGATGAGGT GCGGGCTATC CGCAGGGCGT ACCTAGATGG 1320 CTCAGGTGCG CAGACACTTG TGAACACTGA GATCAATGAC CCCGATGGCA TTGCTGTGGA 1380 CTGGGTCGCC CGGAACCTCT ACTGGACAGA TACAGGCACT GACAGAATTG AGGTGACTCG 1440 CCTCAACGGC ACCTCCCGAA AGATCCTGGT ATCTGAGGAC CTGGACGAAC CGCGAGCCAT 1500 TGTGTTGCAC CCTGTGATGG GCCTCATGTA CTGGACAGAC TGGGGGGAGA ACCCCAAAAT 1560 CGAATGCGCC AACCTAGATG GGAGAGATCG GCATGTCCTG GTGAACACCT CCCTTGGGTG 1620 GCCCAATGGA CTGGCCCTGG ACCTGCAGGA GGGCAAGCTG TACTGGGGGG ATGCCAAAAC 1680 TGATAAAATC GAGGTGATCA ACATAGACGG G 1711 200 base pairs nucleic acid single linear 36 GCCGCGGCGC CCGAGGCGGG AGCAAGAGGC GCCGGGAGCC GCGAGGATCC ACCGCCGCCG 60 CGCGCGCCAT GGAGCCCGAG TGAGCGCGCG GCGCTCCCGG CCGCCGGACG ACATGGAAAC 120 GGCGCCGACC CGGGCCCCTC CGCCGCCGCC GCCGCCGCTG CTGCTGCTGG TGCTGTACTG 180 CAGCTTGGTC CCCGCCGCGG 200 1599 base pairs nucleic acid single linear 37 ATGGAAACGG CGCCGACCCG GGCCCCTCCG CCGCCGCCGC CGCCGCTGCT GCTGCTGGTG 60 CTGTACTGCA GCTTGGTCCC CGCCGCGGCC TCACCGCTCC TGTTGTTTGC CAACCGCCGG 120 GATGTGCGGC TAGTGGATGC CGGCGGAGTG AAGCTGGAGT CCACCATTGT GGCCAGTGGC 180 CTGGAGGATG CAGCTGCTGT AGACTTCCAG TTCTCCAAGG GTGCTGTGTA CTGGACAGAT 240 GTGAGCGAGG AGGCCATCAA ACAGACCTAC CTGAACCAGA CTGGAGGTGC TGCACAGAAC 300 ATTGTCATCT CGGGCCTCGT GTCACCTGAT GGCCTGGCCT GTGACTGGGT TGGCAAGAAG 360 CTGTACTGGA CGGACTCCGA GACCAACCGC ATTGAGGTTG CCAACCTCAA TGGGACGTCC 420 CGTAAGGTTC TCTTCTGGCA GGACCTGGAC CAGCCAAGGG CCATTGCCCT GGATCCTGCA 480 CATGGGTACA TGTACTGGAC TGACTGGGGG GAAGCACCCC GGATCGAGCG GGCAGGGATG 540 GATGGCAGTA CCCGGAAGAT CATTGTAGAC TCCGACATTT ACTGGCCCAA TGGGCTGACC 600 ATCGACCTGG AGGAACAGAA GCTGTACTGG GCCGATGCCA AGCTCAGCTT CATCCACCGT 660 GCCAACCTGG ACGGCTCCTT CCGGCAGAAG GTGGTGGAGG GCAGCCTCAC TCACCCTTTT 720 GCCCTGACAC TCTCTGGGGA CACACTCTAC TGGACAGACT GGCAGACCCG CTCCATCCAC 780 GCCTGCAACA AGTGGACAGG GGAGCAGAGG AAGGAGATCC TTAGTGCTCT GTACTCACCC 840 ATGGACATCC AAGTGCTGAG CCAGGAGCGG CAGCCTCCCT TCCACACACC ATGCGAGGAG 900 GACAACGGTG GCTGTTCCCA CCTGTGCCTG CTGTCCCCGA GGGAGCCTTT CTACTCCTGT 960 GCCTGCCCCA CTGGTGTGCA GTTGCAGGAC AATGGCAAGA CGTGCAAGAC AGGGGCTGAG 1020 GAAGTGCTGC TGCTGGCTCG GAGGACAGAC CTGAGGAGGA TCTCTCTGGA CACCCCTGAC 1080 TTCACAGACA TAGTGCTGCA GGTGGGCGAC ATCCGGCATG CCATTGCCAT TGACTACGAT 1140 CCCCTGGAGG GCTACGTGTA CTGGACCGAT GATGAGGTGC GGGCTATCCG CAGGGCGTAC 1200 CTAGATGGCT CAGGTGCGCA GACACTTGTG AACACTGAGA TCAATGACCC CGATGGCATT 1260 GCTGTGGACT GGGTCGCCCG GAACCTCTAC TGGACAGATA CAGGCACTGA CAGAATTGAG 1320 GTGACTCGCC TCAACGGCAC CTCCCGAAAG ATCCTGGTAT CTGAGGACCT GGACGAACCG 1380 CGAGCCATTG TGTTGCACCC TGTGATGGGC CTCATGTACT GGACAGACTG GGGGGAGAAC 1440 CCCAAAATCG AATGCGCCAA CCTAGATGGG AGAGATCGGC ATGTCCTGGT GAACACCTCC 1500 CTTGGGTGGC CCAATGGACT GGCCCTGGAC CTGCAGGAGG GCAAGCTGTA CTGGGGGGAT 1560 GCCAAAACTG ATAAAATCGA GGTGATCAAC ATAGACGGG 1599 4959 base pairs nucleic acid double linear 38 CCTCGCCGCT CCTGCTATTT GCCAACCGCC GGGACGTACG GCTGGTGGAC GCCGGCGGAG 60 TCAAGCTGGA GTCCACCATC GTGGTCAGCG GCCTGGAGGA TGCGGCCGCA GTGGACTTCC 120 AGTTTTCCAA GGGAGCCGTG TACTGGACAG ACGTGAGCGA GGAGGCCATC AAGCAGACCT 180 ACCTGAACCA GACGGGGGCC GCCGTGCAGA ACGTGGTCAT CTCCGGCCTG GTCTCTCCCG 240 ACGGCCTCGC CTGCGACTGG GTGGGCAAGA AGCTGTACTG GACGGACTCA GAGACCAACC 300 GCATCGAGGT GGCCAACCTC AATGGCACAT CCCGGAAGGT GCTCTTCTGG CAGGACCTTG 360 ACCAGCCGAG GGCCATCGCC TTGGACCCCG CTCACGGGTA CATGTACTGG ACAGACTGGG 420 GTGAGACGCC CCGGATTGAG CGGGCAGGGA TGGATGGCAG CACCCGGAAG ATCATTGTGG 480 ACTCGGACAT TTACTGGCCC AATGGACTGA CCATCGACCT GGAGGAGCAG AAGCTCTACT 540 GGGCTGACGC CAAGCTCAGC TTCATCCACC GTGCCAACCT GGACGGCTCG TTCCGGCAGA 600 AGGTGGTGGA GGGCAGCCTG ACGCACCCCT TCGCCCTGAC GCTCTCCGGG GACACTCTGT 660 ACTGGACAGA CTGGCAGACC CGCTCCATCC ATGCCTGCAA CAAGCGCACT GGGGGGAAGA 720 GGAAGGAGAT CCTGAGTGCC CTCTACTCAC CCATGGACAT CCAGGTGCTG AGCCAGGAGC 780 GGCAGCCTTT CTTCCACACT CGCTGTGAGG AGGACAATGG CGGCTGCTCC CACCTGTGCC 840 TGCTGTCCCC AAGCGAGCCT TTCTACACAT GCGCCTGCCC CACGGGTGTG CAGCTGCAGG 900 ACAACGGCAG GACGTGTAAG GCAGGAGCCG AGGAGGTGCT GCTGCTGGCC CGGCGGACGG 960 ACCTACGGAG GATCTCGCTG GACACGCCGG ACTTTACCGA CATCGTGCTG CAGGTGGACG 1020 ACATCCGGCA CGCCATTGCC ATCGACTACG ACCCGCTAGA GGGCTATGTC TACTGGACAG 1080 ATGACGAGGT GCGGGCCATC CGCAGGGCGT ACCTGGACGG GTCTGGGGCG CAGACGCTGG 1140 TCAACACCGA GATCAACGAC CCCGATGGCA TCGCGGTCGA CTGGGTGGCC CGAAACCTCT 1200 ACTGGACCGA CACGGGCACG GACCGCATCG AGGTGACGCG CCTCAACGGC ACCTCCCGCA 1260 AGATCCTGGT GTCGGAGGAC CTGGACGAGC CCCGAGCCAT CGCACTGCAC CCCGTGATGG 1320 GCCTCATGTA CTGGACAGAC TGGGGAGAGA ACCCTAAAAT CGAGTGTGCC AACTTGGATG 1380 GGCAGGAGCG GCGTGTGCTG GTCAATGCCT CCCTCGGGTG GCCCAACGGC CTGGCCCTGG 1440 ACCTGCAGGA GGGGAAGCTC TACTGGGGAG ACGCCAAGAC AGACAAGATC GAGGTGATCA 1500 ATGTTGATGG GACGAAGAGG CGGACCCTCC TGGAGGACAA GCTCCCGCAC ATTTTCGGGT 1560 TCACGCTGCT GGGGGACTTC ATCTACTGGA CTGACTGGCA GCGCCGCAGC ATCGAGCGGG 1620 TGCACAAGGT CAAGGCCAGC CGGGACGTCA TCATTGACCA GCTGCCCGAC CTGATGGGGC 1680 TCAAAGCTGT GAATGTGGCC AAGGTCGTCG GAACCAACCC GTGTGCGGAC AGGAACGGGG 1740 GGTGCAGCCA CCTGTGCTTC TTCACACCCC ACGCAACCCG GTGTGGCTGC CCCATCGGCC 1800 TGGAGCTGCT GAGTGACATG AAGACCTGCA TCGTGCCTGA GGCCTTCTTG GTCTTCACCA 1860 GCAGAGCCGC CATCCACAGG ATCTCCCTCG AGACCAATAA CAACGACGTG GCCATCCCGC 1920 TCACGGGCGT CAAGGAGGCC TCAGCCCTGG ACTTTGATGT GTCCAACAAC CACATCTACT 1980 GGACAGACGT CAGCCTGAAG ACCATCAGCC GCGCCTTCAT GAACGGGAGC TCGGTGGAGC 2040 ACGTGGTGAG TTTGGCCTTG ACTACCCCGA GGGCATGGCC GTTGACTGGA TGGGCAAGAA 2100 CCTCTACTGG GCCGACACTG GGACCAACAG AATCGAAGTG GCGCGGCTGG ACGGGCAGTT 2160 CCGGCAAGTC CTCGTGTGGA GGGACTTGGA CAACCCGAGG TCGCTGGCCC TGGATCCCAC 2220 CAAGGGCTAC ATCTACTGGA CCGAGTGGGG CGGCAAGCCG AGGATCGTGC GGGCCTTCAT 2280 GGACGGGACC AACTGCATGA CGCTGGTGGA CAAGGTGGGC CGGGCCAACG ACCTCACCAT 2340 TGACTACGCT GACCAGCGCC TCTACTGGAC CGACCTGGAC ACCAACATGA TCGAGTCGTC 2400 CAACATGCTG GGTCAGGAGC GGGTCGTGAT TGCCGACGAT CTCCCGCACC CGTTCGGTCT 2460 GACGCAGTAC AGCGATTATA TCTACTGGAC AGACTGGAAT CTGCACAGCA TTGAGCGGGC 2520 CGACAAGACT AGCGGCCGGA ACCGCACCCT CATCCAGGGC CACCTGGACT TCGTGATGGA 2580 CATCCTGGTG TTCCACTCCT CCCGCCAGGA TGGCCTCAAT GACTGTATGC ACAACAACGG 2640 GCAGTGTGGG CAGCTGTGCC TTGCCATCCC CGGCGGCCAC CGCTGCGGCT GCGCCTCACA 2700 CTACACCCTG GACCCCAGCA GCCGCAACTG CAGCCCGCCC ACCACCTTCT TGCTGTTCAG 2760 CCAGAAATCT GCCATCAGTC GGATGATCCC GGACGACCAG CACAGCCCGG ATCTCATCCT 2820 GCCCCTGCAT GGACTGAGGA ACGTCAAAGC CATCGACTAT GACCCACTGG ACAAGTTCAT 2880 CTACTGGGTG GATGGGCGCC AGAACATCAA GCGAGCCAAG GACGACGGGA CCCAGCCCTT 2940 TGTTTTGACC TCTCTGAGCC AAGGCCAAAA CCCAGACAGG CAGCCCCACG ACCTCAGCAT 3000 CGACATCTAC AGCCGGACAC TGTTCTGGAC GTGCGAGGCC ACCAATACCA TCAACGTCCA 3060 CAGGCTGAGC GGGGAAGCCA TGGGGGTGGT GCTGCGTGGG GACCGCGACA AGCCCAGGGC 3120 CATCGTCGTC AACGCGGAGC GAGGGTACCT GTACTTCACC AACATGCAGG ACCGGGCAGC 3180 CAAGATCGAA CGCGCAGCCC TGGACGGCAC CGAGCGCGAG GTCCTCTTCA CCACCGGCCT 3240 CATCCGCCCT GTGGCCCTGG TGGTAGACAA CACACTGGGC AAGCTGTTCT GGGTGGACGC 3300 GGACCTGAAG CGCATTGAGA GCTGTGACCT GTCAGGGGCC AACCGCCTGA CCCTGGAGGA 3360 CGCCAACATC GTGCAGCCTC TGGGCCTGAC CATCCTTGGC AAGCATCTCT ACTGGATCGA 3420 CCGCCAGCAG CAGATGATCG AGCGTGTGGA GAAGACCACC GGGGACAAGC GGACTCGCAT 3480 CCAGGGCCGT GTCGCCCACC TCACTGGCAT CCATGCAGTG GAGGAAGTCA GCCTGGAGGA 3540 GTTCTCAGCC CACCCATGTG CCCGTGACAA TGGTGGCTGC TCCCACATCT GTATTGCCAA 3600 GGGTGATGGG ACACCACGGT GCTCATGCCC AGTCCACCTC GTGCTCCTGC AGAACCTGCT 3660 GACCTGTGGA GAGCCGCCCA CCTGCTCCCC GGACCAGTTT GCATGTGCCA CAGGGGAGAT 3720 CGACTGTATC CCCGGGGCCT GGCGCTGTGA CGGCTTTCCC GAGTGCGATG ACCAGAGCGA 3780 CGAGGAGGGC TGCCCCGTGT GCTCCGCCGC CCAGTTCCCC TGCGCGCGGG GTCAGTGTGT 3840 GGACCTGCGC CTGCGCTGCG ACGGCGAGGC AGACTGTCAG GACCGCTCAG ACGAGGCGGA 3900 CTGTGACGCC ATCTGCCTGC CCAACCAGTT CCGGTGTGCG AGCGGCCAGT GTGTCCTCAT 3960 CAAACAGCAG TGCGACTCCT TCCCCGACTG TATCGACGGC TCCGACGAGC TCATGTGTGA 4020 AATCACCAAG CCGCCCTCAG ACGACAGCCC GGCCCACAGC AGTGCCATCG GGCCCGTCAT 4080 TGGCATCATC CTCTCTCTCT TCGTCATGGG TGGTGTCTAT TTTGTGTGCC AGCGCGTGGT 4140 GTGCCAGCGC TATGCGGGGG CCAACGGCCC TTCCCGCACG AGTATGTCAG CGGGACCCCG 4200 CACGTGCCCC TCAATTTCAT AGCCCCGGGC GGTTCCCAGC ATGGCCCCTT CACAGGCATC 4260 GCATGCGGAA AGTCCATGAT GAGCTCCGTG AGCCTGATGG GGGGCCGGGG CGGGGTGCCC 4320 CTCTACGACC GGAACCACGT CACAGGGGCC TCGTCCAGCA GCTCGTCCAG CACGAAGGCC 4380 ACGCTGTACC CGCCGATCCT GAACCCGCCG CCCTCCCCGG CCACGGACCC CTCCCTGTAC 4440 AACATGGACA TGTTCTACTC TTCAAACATT CCGGCCACTG TGAGACCGTA CAGGCCCTAC 4500 ATCATTCGAG GAATGGCGCC CCCGACGACG CCCTGCAGCA CCGACGTGTG TGACAGCGAC 4560 TACAGCGCCA GCCGCTGGAA GGCCAGCAAG TACTACCTGG ATTTGAACTC GGACTCAGAC 4620 CCCTATCCAC CCCCACCCAC GCCCCACAGC CAGTACCTGT CGGCGGAGGA CAGCTGCCCG 4680 CCCTCGCCCG CCACCGAGAG GAGCTACTTC CATCTCTTCC CGCCCCCTCC GTCCCCCTGC 4740 ACGGACTCAT CCTGACCTCG GCCGGGCCAC TCTGGCTTCT CTGTGCCCCT GTAAATAGTT 4800 TTAAATATGA ACAAAGAAAA AAATATATTT TATGATTTAA AAAATAAATA TAATTGGGAT 4860 TTTAAAAACA TGAGAAATGT GAACTGTGAT GGGGTGGGCA GGGCTGGGAG AACTTTGTAC 4920 AGTGGAACAA ATATTTATAA ACTTAATTTT GTAAAACAG 4959 1584 amino acids amino acid linear 39 Ser Pro Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu Val Asp 1 5 10 15 Ala Gly Gly Val Lys Leu Glu Ser Thr Ile Val Val Ser Gly Leu Glu 20 25 30 Asp Ala Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val Tyr Trp 35 40 45 Thr Asp Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn Gln Thr 50 55 60 Gly Ala Ala Val Gln Asn Val Val Ile Ser Gly Leu Val Ser Pro Asp 65 70 75 80 Gly Leu Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr Asp Ser 85 90 95 Glu Thr Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser Arg Lys 100 105 110 Val Leu Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala Leu Asp 115 120 125 Pro Ala His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Thr Pro Arg 130 135 140 Ile Glu Arg Ala Gly Met Asp Gly Ser Thr Arg Lys Ile Ile Val Asp 145 150 155 160 Ser Asp Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln 165 170 175 Lys Leu Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn 180 185 190 Leu Asp Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu Thr His 195 200 205 Pro Phe Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp 210 215 220 Gln Thr Arg Ser Ile His Ala Cys Asn Lys Arg Thr Gly Gly Lys Arg 225 230 235 240 Lys Glu Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu 245 250 255 Ser Gln Glu Arg Gln Pro Phe Phe His Thr Arg Cys Glu Glu Asp Asn 260 265 270 Gly Gly Cys Ser His Leu Cys Leu Leu Ser Pro Ser Glu Pro Phe Tyr 275 280 285 Thr Cys Ala Cys Pro Thr Gly Val Gln Leu Gln Asp Asn Gly Arg Thr 290 295 300 Cys Lys Ala Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp 305 310 315 320 Leu Arg Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu 325 330 335 Gln Val Asp Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu 340 345 350 Glu Gly Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg 355 360 365 Ala Tyr Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile 370 375 380 Asn Asp Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr 385 390 395 400 Trp Thr Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly 405 410 415 Thr Ser Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala 420 425 430 Ile Ala Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly 435 440 445 Glu Asn Pro Lys Ile Glu Cys Ala Asn Leu Asp Gly Gln Glu Arg Arg 450 455 460 Val Leu Val Asn Ala Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp 465 470 475 480 Leu Gln Glu Gly Lys Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile 485 490 495 Glu Val Ile Asn Val Asp Gly Thr Lys Arg Arg Thr Leu Leu Glu Asp 500 505 510 Lys Leu Pro His Ile Phe Gly Phe Thr Leu Leu Gly Asp Phe Ile Tyr 515 520 525 Trp Thr Asp Trp Gln Arg Arg Ser Ile Glu Arg Val His Lys Val Lys 530 535 540 Ala Ser Arg Asp Val Ile Ile Asp Gln Leu Pro Asp Leu Met Gly Leu 545 550 555 560 Lys Ala Val Asn Val Ala Lys Val Val Gly Thr Asn Pro Cys Ala Asp 565 570 575 Arg Asn Gly Gly Cys Ser His Leu Cys Phe Phe Thr Pro His Ala Thr 580 585 590 Arg Cys Gly Cys Pro Ile Gly Leu Glu Leu Leu Ser Asp Met Lys Thr 595 600 605 Cys Ile Val Pro Glu Ala Phe Leu Val Phe Thr Ser Arg Ala Ala Ile 610 615 620 His Arg Ile Ser Leu Glu Thr Asn Asn Asn Asp Val Ala Ile Pro Leu 625 630 635 640 Thr Gly Val Lys Glu Ala Ser Ala Leu Asp Phe Asp Val Ser Asn Asn 645 650 655 His Ile Tyr Trp Thr Asp Val Ser Leu Lys Thr Ile Ser Arg Ala Phe 660 665 670 Met Asn Gly Ser Ser Val Glu His Val Val Glu Phe Gly Leu Asp Tyr 675 680 685 Pro Glu Gly Met Ala Val Asp Trp Met Gly Lys Asn Leu Tyr Trp Ala 690 695 700 Asp Thr Gly Thr Asn Arg Ile Glu Val Ala Arg Leu Asp Gly Gln Phe 705 710 715 720 Arg Gln Val Leu Val Trp Arg Asp Leu Asp Asn Pro Arg Ser Leu Ala 725 730 735 Leu Asp Pro Thr Lys Gly Tyr Ile Tyr Trp Thr Glu Trp Gly Gly Lys 740 745 750 Pro Arg Ile Val Arg Ala Phe Met Asp Gly Thr Asn Cys Met Thr Leu 755 760 765 Val Asp Lys Val Gly Arg Ala Asn Asp Leu Thr Ile Asp Tyr Ala Asp 770 775 780 Gln Arg Leu Tyr Trp Thr Asp Leu Asp Thr Asn Met Ile Glu Ser Ser 785 790 795 800 Asn Met Leu Gly Gln Glu Arg Val Val Ile Ala Asp Asp Leu Pro His 805 810 815 Pro Phe Gly Leu Thr Gln Tyr Ser Asp Tyr Ile Tyr Trp Thr Asp Trp 820 825 830 Asn Leu His Ser Ile Glu Arg Ala Asp Lys Thr Ser Gly Arg Asn Arg 835 840 845 Thr Leu Ile Gln Gly His Leu Asp Phe Val Met Asp Ile Leu Val Phe 850 855 860 His Ser Ser Arg Gln Asp Gly Leu Asn Asp Cys Met His Asn Asn Gly 865 870 875 880 Gln Cys Gly Gln Leu Cys Leu Ala Ile Pro Gly Gly His Arg Cys Gly 885 890 895 Cys Ala Ser His Tyr Thr Leu Asp Pro Ser Ser Arg Asn Cys Ser Pro 900 905 910 Pro Thr Thr Phe Leu Leu Phe Ser Gln Lys Ser Ala Ile Ser Arg Met 915 920 925 Ile Pro Asp Asp Gln His Ser Pro Asp Leu Ile Leu Pro Leu His Gly 930 935 940 Leu Arg Asn Val Lys Ala Ile Asp Tyr Asp Pro Leu Asp Lys Phe Ile 945 950 955 960 Tyr Trp Val Asp Gly Arg Gln Asn Ile Lys Arg Ala Lys Asp Asp Gly 965 970 975 Thr Gln Pro Phe Val Leu Thr Ser Leu Ser Gln Gly Gln Asn Pro Asp 980 985 990 Arg Gln Pro His Asp Leu Ser Ile Asp Ile Tyr Ser Arg Thr Leu Phe 995 1000 1005 Trp Thr Cys Glu Ala Thr Asn Thr Ile Asn Val His Arg Leu Ser Gly 1010 1015 1020 Glu Ala Met Gly Val Val Leu Arg Gly Asp Arg Asp Lys Pro Arg Ala 1025 1030 1035 1040 Ile Val Val Asn Ala Glu Arg Gly Tyr Leu Tyr Phe Thr Asn Met Gln 1045 1050 1055 Asp Arg Ala Ala Lys Ile Glu Arg Ala Ala Leu Asp Gly Thr Glu Arg 1060 1065 1070 Glu Val Leu Phe Thr Thr Gly Leu Ile Arg Pro Val Ala Leu Val Val 1075 1080 1085 Asp Asn Thr Leu Gly Lys Leu Phe Trp Val Asp Ala Asp Leu Lys Arg 1090 1095 1100 Ile Glu Ser Cys Asp Leu Ser Gly Ala Asn Arg Leu Thr Leu Glu Asp 1105 1110 1115 1120 Ala Asn Ile Val Gln Pro Leu Gly Leu Thr Ile Leu Gly Lys His Leu 1125 1130 1135 Tyr Trp Ile Asp Arg Gln Gln Gln Met Ile Glu Arg Val Glu Lys Thr 1140 1145 1150 Thr Gly Asp Lys Arg Thr Arg Ile Gln Gly Arg Val Ala His Leu Thr 1155 1160 1165 Gly Ile His Ala Val Glu Glu Val Ser Leu Glu Glu Phe Ser Ala His 1170 1175 1180 Pro Cys Ala Arg Asp Asn Gly Gly Cys Ser His Ile Cys Ile Ala Lys 1185 1190 1195 1200 Gly Asp Gly Thr Pro Arg Cys Ser Cys Pro Val His Leu Val Leu Leu 1205 1210 1215 Gln Asn Leu Leu Thr Cys Gly Glu Pro Pro Thr Cys Ser Pro Asp Gln 1220 1225 1230 Phe Ala Cys Ala Thr Gly Glu Ile Asp Cys Ile Pro Gly Ala Trp Arg 1235 1240 1245 Cys Asp Gly Phe Pro Glu Cys Asp Asp Gln Ser Asp Glu Glu Gly Cys 1250 1255 1260 Pro Val Cys Ser Ala Ala Gln Phe Pro Cys Ala Arg Gly Gln Cys Val 1265 1270 1275 1280 Asp Leu Arg Leu Arg Cys Asp Gly Glu Ala Asp Cys Gln Asp Arg Ser 1285 1290 1295 Asp Glu Ala Asp Cys Asp Ala Ile Cys Leu Pro Asn Gln Phe Arg Cys 1300 1305 1310 Ala Ser Gly Gln Cys Val Leu Ile Lys Gln Gln Cys Asp Ser Phe Pro 1315 1320 1325 Asp Cys Ile Asp Gly Ser Asp Glu Leu Met Cys Glu Ile Thr Lys Pro 1330 1335 1340 Pro Ser Asp Asp Ser Pro Ala His Ser Ser Ala Ile Gly Pro Val Ile 1345 1350 1355 1360 Gly Ile Ile Leu Ser Leu Phe Val Met Gly Gly Val Tyr Phe Val Cys 1365 1370 1375 Gln Arg Val Val Cys Gln Arg Tyr Ala Gly Ala Asn Gly Pro Phe Pro 1380 1385 1390 His Glu Tyr Val Ser Gly Thr Pro His Val Pro Leu Asn Phe Ile Ala 1395 1400 1405 Pro Gly Gly Ser Gln His Gly Pro Phe Thr Gly Ile Ala Cys Gly Lys 1410 1415 1420 Ser Met Met Ser Ser Val Ser Leu Met Gly Gly Arg Gly Gly Val Pro 1425 1430 1435 1440 Leu Tyr Asp Arg Asn His Val Thr Gly Ala Ser Ser Ser Ser Ser Ser 1445 1450 1455 Ser Thr Lys Ala Thr Leu Tyr Pro Pro Ile Leu Asn Pro Pro Pro Ser 1460 1465 1470 Pro Ala Thr Asp Pro Ser Leu Tyr Asn Met Asp Met Phe Tyr Ser Ser 1475 1480 1485 Asn Ile Pro Ala Thr Val Arg Pro Tyr Arg Pro Tyr Ile Ile Arg Gly 1490 1495 1500 Met Ala Pro Pro Thr Thr Pro Cys Ser Thr Asp Val Cys Asp Ser Asp 1505 1510 1515 1520 Tyr Ser Ala Ser Arg Trp Lys Ala Ser Lys Tyr Tyr Leu Asp Leu Asn 1525 1530 1535 Ser Asp Ser Asp Pro Tyr Pro Pro Pro Pro Thr Pro His Ser Gln Tyr 1540 1545 1550 Leu Ser Ala Glu Asp Ser Cys Pro Pro Ser Pro Ala Thr Glu Arg Ser 1555 1560 1565 Tyr Phe His Leu Phe Pro Pro Pro Pro Ser Pro Cys Thr Asp Ser Ser 1570 1575 1580 5117 base pairs nucleic acid single linear 40 GCCGCGGCGC CCGAGGCGGG AGCAAGAGGC GCCGGGAGCC GCGAGGATCC ACCGCCGCCG 60 CGCGCGCCAT GGAGCCCGAG TGAGCGCGCG GCGCTCCCGG CCGCCGGACG ACATGGAAAC 120 GGCGCCGACC CGGGCCCCTC CGCCGCCGCC GCCGCCGCTG CTGCTGCTGG TGCTGTACTG 180 CAGCTTGGTC CCCGCCGCGG CCTCACCGCT CCTGTTGTTT GCCAACCGCC GGGATGTGCG 240 GCTAGTGGAT GCCGGCGGAG TGAAGCTGGA GTCCACCATT GTGGCCAGTG GCCTGGAGGA 300 TGCAGCTGCT GTAGACTTCC AGTTCTCCAA GGGTGCTGTG TACTGGACAG ATGTGAGCGA 360 GGAGGCCATC AAACAGACCT ACCTGAACCA GACTGGAGCT GCTGCACAGA ACATTGTCAT 420 CTCGGGCCTC GTGTCACCTG ATGGCCTGGC CTGTGACTGG GTTGGCAAGA AGCTGTACTG 480 GACGGACTCC GAGACCAACC GCATTGAGGT TGCCAACCTC AATGGGACGT CCCGTAAGGT 540 TCTCTTCTGG CAGGACCTGG ACCAGCCAAG GGCCATTGCC CTGGATCCTG CACATGGGTA 600 CATGTACTGG ACTGACTGGG GGGAAGCACC CCGGATCGAG CGGGCAGGGA TGGATGGCAG 660 TACCCGGAAG ATCATTGTAG ACTCCGACAT TTACTGGCCC AATGGGCTGA CCATCGACCT 720 GGAGGAACAG AAGCTGTACT GGGCCGATGC CAAGCTCAGC TTCATCCACC GTGCCAACCT 780 GGACGGCTCC TTCCGGCAGA AGGTGGTGGA GGGCAGCCTC ACTCACCCTT TTGCCCTGAC 840 ACTCTCTGGG GACACACTCT ACTGGACAGA CTGGCAGACC CGCTCCATCC ACGCCTGCAA 900 CAAGTGGACA GGGGAGCAGA GGAAGGAGAT CCTTAGTGCT CTGTACTCAC CCATGGACAT 960 CCAAGTGCTG AGCCAGGAGC GGCAGCCTCC CTTCCACACA CCATGCGAGG AGGACAACGG 1020 TGGCTGTTCC CACCTGTGCC TGCTGTCCCC GAGGGAGCCT TTCTACTCCT GTGCCTGCCC 1080 CACTGGTGTG CAGTTGCAGG ACAATGGCAA GACGTGCAAG ACAGGGGCTG AGGAAGTGCT 1140 GCTGCTGGCT CGGAGGACAG ACCTGAGGAG GATCTCTCTG GACACCCCTG ACTTCACAGA 1200 CATAGTGCTG CAGGTGGGCG ACATCCGGCA TGCCATTGCC ATTGACTACG ATCCCCTGGA 1260 GGGCTACGTG TACTGGACCG ATGATGAGGT GCGGGCTATC CGCAGGGCGT ACCTAGATGG 1320 CTCAGGTGCG CAGACACTTG TGAACACTGA GATCAATGAC CCCGATGGCA TTGCTGTGGA 1380 CTGGGTCGCC CGGAACCTCT ACTGGACAGA TACAGGCACT GACAGAATTG AGGTGACTCG 1440 CCTCAACGGC ACCTCCCGAA AGATCCTGGT ATCTGAGGAC CTGGACGAAC CGCGAGCCAT 1500 TGTGTTGCAC CCTGTGATGG GCCTCATGTA CTGGACAGAC TGGGGGGAGA ACCCCAAAAT 1560 CGAATGCGCC AACCTAGATG GGAGAGATCG GCATGTCCTG GTGAACACCT CCCTTGGGTG 1620 GCCCAATGGA CTGGCCCTGG ACCTGCAGGA GGGCAAGCTG TACTGGGGGG ATGCCAAAAC 1680 TGATAAAATC GAGGTGATCA ACATAGACGG GACAAAGCGG AAGACCCTGC TTGAGGACAA 1740 GCTCCCACAC ATTTTTGGGT TCACACTGCT GGGGGACTTC ATCTACTGGA CCGACTGGCA 1800 GAGACGCAGT ATTGAAAGGG TCCACAAGGT CAAGGCCAGC CGGGATGTCA TCATTGATCA 1860 ACTCCCCGAC CTGATGGGAC TCAAAGCCGT GAATGTGGCC AAGGTTGTCG GAACCAACCC 1920 ATGTGCGGAT GGAAATGGAG GGTGCAGCCA TCTGTGCTTC TTCACCCCAC GTGCCACCAA 1980 GTGTGGCTGC CCCATTGGCC TGGAGCTGTT GAGTGACATG AAGACCTGCA TAATCCCCGA 2040 GGCCTTCCGG TATTCACCAG CAGAGCCACC ATCCACAGGA TCTCCCTGGA GACTAACAAC 2100 AACGATGTGG CTATCCCACT CACGGGTGTC AAAGAGGCCT CTGCACTGGA CTTTGATGTG 2160 TCCAACAATC ACATCTACTG GACTGATGTT AGCCTCAAGA CGATCAGCCG AGCCTTCATG 2220 AATGGGAGCT CAGTGGAGCA CGTGATTGAG TTTGGCCTCG ACTACCCTGA AGGAATGGCT 2280 GTGGACTGGA TGGGCAAGAA CCTCTATTGG GCGGACACAG GGACCAACAG GATTGAGGTG 2340 GCCCGGCTGG ATGGGCAGTT CCGGCAGGTG CTTGTGTGGA GAGACCTTGA CAACCCCAGG 2400 TCTCTGGCTC TGGATCCTAC TAAAGGCTAC ATCTACTGGA CTGAGTGGGG TGGCAAGCCA 2460 AGGATTGTGC GGGCCTTCAT GGATGGGACC AATTGTATGA CACTGGTAGA CAAGGTGGGC 2520 CGGGCCAACG ACCTCACCAT TGATTATGCC GACCAGCGAC TGTACTGGAC TGACCTGGAC 2580 ACCAACATGA TTGAGTCTTC CAACATGCTG GGTCAGGAGC GCATGGTGAT AGCTGACGAT 2640 CTGCCCTACC CGTTTGGCCT GACTCAATAT AGCGATTACA TCTACTGGAC TGACTGGAAC 2700 CTGCATAGCA TTGAACGGGC GGACAAGACC AGTGGGCGGA ACCGCACCCT CATCCAGGGT 2760 CACCTGGACT TCGTCATGGA CATCCTGGTG TTCCACTCCT CCCGTCAGGA TGGCCTCAAC 2820 GACTGCGTGC ACAGCAATGG CCAGTGTGGG CAGCTGTGCC TCGCCATCCC CGGAGGCCAC 2880 CGCTGTGGCT GTGCTTCACA CTACACGCTG GACCCCAGCA GCCGCAACTG CAGCCCGCCC 2940 TCCACCTTCT TGCTGTTCAG CCAGAAATTT GCCATCAGCC GGATGATCCC CGATGACCAG 3000 CTCAGCCCGG ACCTTGTCCT ACCCCTTCAT GGGCTGAGGA ACGTCAAAGC CATCAACTAT 3060 GACCCGCTGG ACAAGTTCAT CTACTGGGTG GACGGGCGCC AGAACATCAA GAGGGCCAAG 3120 GACGACGGTA CCCAGCCCTC CATGCTGACC TCTCCCAGCC AAAGCCTGAG CCCAGACAGA 3180 CAGCCACACG ACCTCAGCAT TGACATCTAC AGCCGGACAC TGTTCTGGAC CTGTGAGGCC 3240 ACCAACACTA TCAATGTCCA CCGGCTGGAT GGGGATGCCA TGGGAGTGGT GCTTCGAGGG 3300 GACCGTGACA AGCCAAGGGC CATTGCTGTC AATGCTGAGC GAGGGTACAT GTACTTTACC 3360 AACATGCAGG ACCATGCTGC CAAGATCGAG CGAGCCTCCC TGGATGGCAC AGAGCGGGAG 3420 GTCCTCTTCA CCACAGGCCT CATCCGTCCC GTGGCCCTTG TGGTGGACAA TGCTCTGGGC 3480 AAGCTCTTCT GGGTGGATGC CGACCTAAAG CGAATCGAAA GCTGTGACCT CTCTGGGGCC 3540 AACCGCCTGA CCCTGGAAGA TGCCAACATC GTACAGCCAG TAGGTCTGAC AGTGCTGGGC 3600 AGGCACCTCT ACTGGATCGA CCGCCAGCAG CAGATGATCG AGCGCGTGGA GAAGACCACT 3660 GGGGACAAGC GGACTAGGGT TCAGGGCCGT GTCACCCACC TGACAGGCAT CCATGCCGTG 3720 GAGGAAGTCA GCCTGGAGGA GTTCTCAGCC CATCCTTGTG CCCGAGACAA TGGCGGCTGC 3780 TCCCACATCT GTATCGCCAA GGGTGATGGA ACACCGCGCT GCTCGTGCCC TGTCCACCTG 3840 GTGCTCCTGC AGAACCTGCT GACTTGTGGT GAGCCTCCTA CCTGCTCCCC TGATCAGTTT 3900 GCATGTACCA CTGGTGAGAT CGACTGCATC CCCGGAGCCT GGCGCTGTGA CGGCTTCCCT 3960 GAGTGTGCTG ACCAGAGTGA TGAAGAAGGC TGCCCAGTGT GCTCCGCCTC TCAGTTCCCC 4020 TGCGCTCGAG GCCAGTGTGT GGACCTGCGG TTACGCTGCG ACGGTGAGGC CGACTGCCAG 4080 GATCGCTCTG ATGAAGTAAC TGCGATGCTG TCTGTCTGCC CAATCAGTTC CGGTGCACCA 4140 GCGGCCAGTG TGTCCTCATC AAGCAACAGT GTGACTCCTT CCCCGACTGT GCTGATGGGT 4200 CTGATGAGCT CATGTGTGAA ATCAACAAGC CACCCTCTGA TGACATCCCA GCCCACAGCA 4260 GTGCCATTGG GCCCGTCATT GGTATCATCC TCTCCCTCTT CGTCATGGGC GGGGTCTACT 4320 TTGTCTGCCA GCGTGTGATG TGCCAGCGCT ACACAGGGGC CAGTGGGCCC TTTCCCCACG 4380 AGTATGTTGG TGGAGCCCCT CATGTGCCTC TCAACTTCAT AGCCCCAGGT GGCTCACAGC 4440 ACGGTCCCTT CCCAGGCATC CCGTGCAGCA AGTCCGTGAT GAGCTCCATG AGCCTGGTGG 4500 GGGGGCGCGG CAGCGTGCCC CTCTATGACC GGAATCACGT CACTGGGGCC TCATCCAGCA 4560 GCTCGTCCAG CACAAAGGCC ACACTATATC CGCCGATCCT GAACCCACCC CCGTCCCCGG 4620 CCACAGACCC CTCTCTCTAC AACGTGGACG TGTTTTATTC TTCAGGCATC CCGGCCACCG 4680 CTAGACCATA CAGGCCCTAC GTCATTCGAG GTATGGCACC CCCAACAACA CCGTGCAGCA 4740 CAGATGTGTG TGACAGTGAC TACAGCATCA GTCGCTGGAA GAGCAGCAAA TACTACCTGG 4800 ACTTGAATTC GGACTCAGAC CCCTACCCCC CCCCGCCCAC CCCCCACAGC CAGTACCTAT 4860 CTGCAGAGGA CAGCTGCCCA CCCTCACCAG GCACTGAGAG GAGTTACTGC CACCTCTTCC 4920 CGCCCCCACC GTCCCCCTGC ACGGACTCGT CCTGACCTCG GCCGTCCACC CGGCCCTGCT 4980 GCCTCCCTGT AAATATTTTT AAATATGAAC AAAGGAAAAA TATATTTTAT GATTTAAAAA 5040 ATAAATATAA TTGGGGTTTT TAACAAGTGA GAAATGTGAG CGGTGAAGGG GTGGGCAGGG 5100 CTGGGAAACT TTTCTAG 5117 4843 base pairs nucleic acid single linear 41 ATGGAAACGG CGCCGACCCG GGCCCCTCCG CCGCCGCCGC CGCCGCTGCT GCTGCTGGTG 60 CTGTACTGCA GCTTGGTCCC CGCCGCGGCC TCACCGCTCC TGTTGTTTGC CAACCGCCGG 120 GATGTGCGGC TAGTGGATGC CGGCGGAGTG AAGCTGGAGT CCACCATTGT GGCCAGTGGC 180 CTGGAGGATG CAGCTGCTGT AGACTTCCAG TTCTCCAAGG GTGCTGTGTA CTGGACAGAT 240 GTGAGCGAGG AGGCCATCAA ACAGACCTAC CTGAACCAGA CTGGAGCTGC TGCACAGAAC 300 ATTGTCATCT CGGGCCTCGT GTCACCTGAT GGCCTGGCCT GTGACTGGGT TGGCAAGAAG 360 CTGTACTGGA CGGACTCCGA GACCAACCGC ATTGAGGTTG CCAACCTCAA TGGGACGTCC 420 CGTAAGGTTC TCTTCTGGCA GGACCTGGAC CAGCCAAGGG CCATTGCCCT GGATCCTGCA 480 CATGGGTACA TGTACTGGAC TGACTGGGGG GAAGCACCCC GGATCGAGCG GGCAGGGATG 540 GATGGCAGTA CCCGGAAGAT CATTGTAGAC TCCGACATTT ACTGGCCCAA TGGGCTGACC 600 ATCGACCTGG AGGAACAGAA GCTGTACTGG GCCGATGCCA AGCTCAGCTT CATCCACCGT 660 GCCAACCTGG ACGGCTCCTT CCGGCAGAAG GTGGTGGAGG GCAGCCTCAC TCACCCTTTT 720 GCCCTGACAC TCTCTGGGGA CACACTCTAC TGGACAGACT GGCAGACCCG CTCCATCCAC 780 GCCTGCAACA AGTGGACAGG GGAGCAGAGG AAGGAGATCC TTAGTGCTCT GTACTCACCC 840 ATGGACATCC AAGTGCTGAG CCAGGAGCGG CAGCCTCCCT TCCACACACC ATGCGAGGAG 900 GACAACGGTG GCTGTTCCCA CCTGTGCCTG CTGTCCCCGA GGGAGCCTTT CTACTCCTGT 960 GCCTGCCCCA CTGGTGTGCA GTTGCAGGAC AATGGCAAGA CGTGCAAGAC AGGGGCTGAG 1020 GAAGTGCTGC TGCTGGCTCG GAGGACAGAC CTGAGGAGGA TCTCTCTGGA CACCCCTGAC 1080 TTCACAGACA TAGTGCTGCA GGTGGGCGAC ATCCGGCATG CCATTGCCAT TGACTACGAT 1140 CCCCTGGAGG GCTACGTGTA CTGGACCGAT GATGAGGTGC GGGCTATCCG CAGGGCGTAC 1200 CTAGATGGCT CAGGTGCGCA GACACTTGTG AACACTGAGA TCAATGACCC CGATGGCATT 1260 GCTGTGGACT GGGTCGCCCG GAACCTCTAC TGGACAGATA CAGGCACTGA CAGAATTGAG 1320 GTGACTCGCC TCAACGGCAC CTCCCGAAAG ATCCTGGTAT CTGAGGACCT GGACGAACCG 1380 CGAGCCATTG TGTTGCACCC TGTGATGGGC CTCATGTACT GGACAGACTG GGGGGAGAAC 1440 CCCAAAATCG AATGCGCCAA CCTAGATGGG AGAGATCGGC ATGTCCTGGT GAACACCTCC 1500 CTTGGGTGGC CCAATGGACT GGCCCTGGAC CTGCAGGAGG GCAAGCTGTA CTGGGGGGAT 1560 GCCAAAACTG ATAAAATCGA GGTGATCAAC ATAGACGGGA CAAAGCGGAA GACCCTGCTT 1620 GAGGACAAGC TCCCACACAT TTTTGGGTTC ACACTGCTGG GGGACTTCAT CTACTGGACC 1680 GACTGGCAGA GACGCAGTAT TGAAAGGGTC CACAAGGTCA AGGCCAGCCG GGATGTCATC 1740 ATTGATCAAC TCCCCGACCT GATGGGACTC AAAGCCGTGA ATGTGGCCAA GGTTGTCGGA 1800 ACCAACCCAT GTGCGGATGG AAATGGAGGG TGCAGCCATC TGTGCTTCTT CACCCCACGT 1860 GCCACCAAGT GTGGCTGCCC CATTGGCCTG GAGCTGTTGA GTGACATGAA GACCTGCATA 1920 ATCCCCGAGG CCTTCCTGGT ATTCACCAGC AGAGCCACCA TCCACAGGAT CTCCCTGGAG 1980 ACTAACAACA ACGATGTGGC TATCCCACTC ACGGGTGTCA AAGAGGCCTC TGCACTGGAC 2040 TTTGATGTTC CAACAATCAC ATCTACTGGA CTGATGTTAG CCTCAAGACG ATCAGCCGAG 2100 CCTTCATGAA TGGGAGCTCA GTGGAGCACG TGATTGAGTT TGGCCTCGAC TACCCTGAAG 2160 GAATGGCTGT GGACTGGATG GGCAAGAACC TCTATTGGGC GGACACAGGG ACCAACAGGA 2220 TTGAGGTGGC CCGGCTGGAT GGGCAGTTCC GGCAGGTGCT TGTGTGGAGA GACCTTGACA 2280 ACCCCAGGTC TCTGGCTCTG GATCCTACTA AAGGCTACAT CTACTGGACT GAGTGGGGTG 2340 GCAAGCCAAG GATTGTGCGG GCCTTCATGG ATGGGACCAA TTGTATGACA CTGGTAGACA 2400 AGGTGGGCCG GGCCAACGAC CTCACCATTG ATTATGCCGA CCAGCGACTG TACTGGACTG 2460 ACCTGGACAC CAACATGATT GAGTCTTCCA ACATGCTGGG TCAGGAGCGC ATGGTGATAG 2520 CTGACGATCT GCCCTACCCG TTTGGCCTGA CTCAATATAG CGATTACATC TACTGGACTG 2580 ACTGGAACCT GCATAGCATT GAACGGGCGG ACAAGACCAG TGGGCGGAAC CGCACCCTCA 2640 TCCAGGGTCA CCTGGACTTC GTCATGGACA TCCTGGTGTT CCACTCCTCC CGTCAGGATG 2700 GCCTCAACGA CTGCGTGCAC AGCAATGGCC AGTGTGGGCA GCTGTGCCTC GCCATCCCCG 2760 GAGGCCACCG CTGTGGCTGT GCTTCACACT ACACGCTGGA CCCCAGCAGC CGCAACTGCA 2820 GCCCGCCCTC CACCTTCTTG CTGTTCAGCC AGAAATTTGC CATCAGCCGG ATGATCCCCG 2880 ATGACCAGCT CAGCCCGGAC CTTGTCCTAC CCCTTCATGG GCTGAGGAAC GTCAAAGCCA 2940 TCAACTATGA CCCGCTGGAC AAGTTCATCT ACTGGGTGGA CGGGCGCCAG AACATCAAGA 3000 GGGCCAAGGA CGACGGTACC CAGCCCTCCA TGCTGACCTC TCCCAGCCAA AGCCTGAGCC 3060 CAGACAGACA GCCACACGAC CTCAGCATTG ACATCTACAG CCGGACACTG TTCTGGACCT 3120 GTGAGGCCAC CAACACTATC AATGTCCACC GGCTGGATGG GGATGCCATG GGAGTGGTGC 3180 TTCGAGGGGA CCGTGACAAG CCAAGGGCCA TTGCTGTCAA TGCTGAGCGA GGGTACATGT 3240 ACTTTACCAA CATGCAGGAC CATGCTGCCA AGATCGAGCG AGCCTCCCTG GATGGCACAG 3300 AGCGGGAGGT CCTCTTCACC ACAGGCCTCA TCCGTCCCGT GGCCCTTGTG GTGGACAATG 3360 CTCTGGGCAA GCTCTTCTGG GTGGATGCCG ACCTAAAGCG AATCGAAAGC TGTGACCTCT 3420 CTGGGGCCAA CCGCCTGACC CTGGAAGATG CCAACATCGT ACAGCCAGTA GGTCTGACAG 3480 TGCTGGGCAG GCACCTCTAC TGGATCGACC GCCAGCAGCA GATGATCGAG CGCGTGGAGA 3540 AGACCACTGG GGACAAGCGG ACTAGGGTTC AGGGCCGTGT CACCCACCTG ACAGGCATCC 3600 ATGCCGTGGA GGAAGTCAGC CTGGAGGAGT TCTCAGCCCA TCCTTGTGCC CGAGACAATG 3660 GCGGCTGCTC CCACATCTGT ATCGCCAAGG GTGATGGAAC ACCGCGCTGC TCGTGCCCTG 3720 TCCACCTGGT GCTCCTGCAG AACCTGCTGA CTTGTGGTGA GCCTCCTACC TGCTCCCCTG 3780 ATCAGTTTGC ATGTACCACT GGTGAGATCG ACTGCATCCC CGGAGCCTGG CGCTGTGACG 3840 GCTTCCCTGA GTGTGCTGAC CAGAGTGATG AAGAAGGCTG CCCAGTGTGC TCCGCCTCTC 3900 AGTTCCCCTG CGCTCGAGGC CAGTGTGTGG ACCTGCGGTT ACGCTGCGAC GGTGAGGCCG 3960 ACTGCCAGGA TCGCTCTGAT GAAGCTAACT GCGATGCTGT CTGTCTGCCC AATCAGTTCC 4020 GGTGCACCAG CGGCCAGTGT GTCCTCATCA AGCAACAGTG TGACTCCTTC CCCGACTGTG 4080 CTGATGGGTC TGATGACTCA TGTGTGAAAT CAACAAGCCA CCCTCTGATG ACATCCCAGC 4140 CCACAGCAGT GCCATTGGGC CCGTCATTGG TATCATCCTC TCCCTCTTCG TCATGGGCGG 4200 GGTCTACTTT GTCTGCCAGC GTGTGATGTG CCAGCGCTAC ACAGGGGCCA GTGGGCCCTT 4260 TCCCCACGAG TATGTTGGTG GAGCCCCTCA TGTGCCTCTC AACTTCATAG CCCCAGGTGG 4320 CTCACAGCAC GGTCCCTTCC CAGGCATCCC GTGCAGCAAG TCCGTGATGA GCTCCATGAG 4380 CCTGGTGGGG GGGCGCGGCA GCGTGCCCCT CTATGACCGG AATCACGTCA CTGGGGCCTC 4440 ATCCAGCAGC TCGTCCAGCA CAAAGGCCAC ACTATATCCG CCGATCCTGA ACCCACCCCC 4500 GTCCCCGGCC ACAGACCCCT CTCTCTACAA CGTGGACGTG TTTTATTCTT CAGGCATCCC 4560 GGCCACCGCT AGACCATACA GGCCCTACGT CATTCGAGGT ATGGCACCCC CAACAACACC 4620 GTGCAGCACA GATGTGTGTG ACAGTGACTA CAGCATCAGT CGCTGGAAGA GCAGCAAATA 4680 CTACCTGGAC TTGAATTCGG ACTCAGACCC CTACCCCCCC CCGCCCACCC CCCACAGCCA 4740 GTACCTATCT GCAGAGGACA GCTGCCCACC CTCACCAGGC ACTGAGAGGA GTTACTGCCA 4800 CCTCTTCCCG CCCCCACCGT CCCCCTGCAC GGACTCGTCC TGA 4843 1614 amino acids amino acid linear 42 Met Glu Thr Ala Pro Thr Arg Ala Pro Pro Pro Pro Pro Pro Pro Leu 1 5 10 15 Leu Leu Leu Val Leu Tyr Cys Ser Leu Val Pro Ala Ala Ala Ser Pro 20 25 30 Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu Val Asp Ala Gly 35 40 45 Gly Val Lys Leu Glu Ser Thr Ile Val Ala Ser Gly Leu Glu Asp Ala 50 55 60 Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val Tyr Trp Thr Asp 65 70 75 80 Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn Gln Thr Gly Ala 85 90 95 Ala Ala Gln Asn Ile Val Ile Ser Gly Leu Val Ser Pro Asp Gly Leu 100 105 110 Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr Asp Ser Glu Thr 115 120 125 Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser Arg Lys Val Leu 130 135 140 Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala Leu Asp Pro Ala 145 150 155 160 His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Ala Pro Arg Ile Glu 165 170 175 Arg Ala Gly Met Asp Gly Ser Thr Arg Lys Ile Ile Val Asp Ser Asp 180 185 190 Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu Glu Gln Lys Leu 195 200 205 Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg Ala Asn Leu Asp 210 215 220 Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu Thr His Pro Phe 225 230 235 240 Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr Asp Trp Gln Thr 245 250 255 Arg Ser Ile His Ala Cys Asn Lys Trp Thr Gly Glu Gln Arg Lys Glu 260 265 270 Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln Val Leu Ser Gln 275 280 285 Glu Arg Gln Pro Pro Phe His Thr Pro Cys Glu Glu Asp Asn Gly Gly 290 295 300 Cys Ser His Leu Cys Leu Leu Ser Pro Arg Glu Pro Phe Tyr Ser Cys 305 310 315 320 Ala Cys Pro Thr Gly Val Gln Leu Gln Asp Asn Gly Lys Thr Cys Lys 325 330 335 Thr Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg Thr Asp Leu Arg 340 345 350 Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile Val Leu Gln Val 355 360 365 Gly Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp Pro Leu Glu Gly 370 375 380 Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile Arg Arg Ala Tyr 385 390 395 400 Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr Glu Ile Asn Asp 405 410 415 Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn Leu Tyr Trp Thr 420 425 430 Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu Asn Gly Thr Ser 435 440 445 Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro Arg Ala Ile Val 450 455 460 Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp Trp Gly Glu Asn 465 470 475 480 Pro Lys Ile Glu Cys Ala Asn Leu Asp Gly Arg Asp Arg His Val Leu 485 490 495 Val Asn Thr Ser Leu Gly Trp Pro Asn Gly Leu Ala Leu Asp Leu Gln 500 505 510 Glu Gly Lys Leu Tyr Trp Gly Asp Ala Lys Thr Asp Lys Ile Glu Val 515 520 525 Ile Asn Ile Asp Gly Thr Lys Arg Lys Thr Leu Leu Glu Asp Lys Leu 530 535 540 Pro His Ile Phe Gly Phe Thr Leu Leu Gly Asp Phe Ile Tyr Trp Thr 545 550 555 560 Asp Trp Gln Arg Arg Ser Ile Glu Arg Val His Lys Val Lys Ala Ser 565 570 575 Arg Asp Val Ile Ile Asp Gln Leu Pro Asp Leu Met Gly Leu Lys Ala 580 585 590 Val Asn Val Ala Lys Val Val Gly Thr Asn Pro Cys Ala Asp Gly Asn 595 600 605 Gly Gly Cys Ser His Leu Cys Phe Phe Thr Pro Arg Ala Thr Lys Cys 610 615 620 Gly Cys Pro Ile Gly Leu Glu Leu Leu Ser Asp Met Lys Thr Cys Ile 625 630 635 640 Ile Pro Glu Ala Phe Leu Val Phe Thr Ser Arg Ala Thr Ile His Arg 645 650 655 Ile Ser Leu Glu Thr Asn Asn Asn Asp Val Ala Ile Pro Leu Thr Gly 660 665 670 Val Lys Glu Ala Ser Ala Leu Asp Phe Asp Val Ser Asn Asn His Ile 675 680 685 Tyr Trp Thr Asp Val Ser Leu Lys Thr Ile Ser Arg Ala Phe Met Asn 690 695 700 Gly Ser Ser Val Glu His Val Ile Glu Phe Gly Leu Asp Tyr Pro Glu 705 710 715 720 Gly Met Ala Val Asp Trp Met Gly Lys Asn Leu Tyr Trp Ala Asp Thr 725 730 735 Gly Thr Asn Arg Ile Glu Val Ala Arg Leu Asp Gly Gln Phe Arg Gln 740 745 750 Val Leu Val Trp Arg Asp Leu Asp Asn Pro Arg Ser Leu Ala Leu Asp 755 760 765 Pro Thr Lys Gly Tyr Ile Tyr Trp Thr Glu Trp Gly Gly Lys Pro Arg 770 775 780 Ile Val Arg Ala Phe Met Asp Gly Thr Asn Cys Met Thr Leu Val Asp 785 790 795 800 Lys Val Gly Arg Ala Asn Asp Leu Thr Ile Asp Tyr Ala Asp Gln Arg 805 810 815 Leu Tyr Trp Thr Asp Leu Asp Thr Asn Met Ile Glu Ser Ser Asn Met 820 825 830 Leu Gly Gln Glu Arg Met Val Ile Ala Asp Asp Leu Pro Tyr Pro Phe 835 840 845 Gly Leu Thr Gln Tyr Ser Asp Tyr Ile Tyr Trp Thr Asp Trp Asn Leu 850 855 860 His Ser Ile Glu Arg Ala Asp Lys Thr Ser Gly Arg Asn Arg Thr Leu 865 870 875 880 Ile Gln Gly His Leu Asp Phe Val Met Asp Ile Leu Val Phe His Ser 885 890 895 Ser Arg Gln Asp Gly Leu Asn Asp Cys Val His Ser Asn Gly Gln Cys 900 905 910 Gly Gln Leu Cys Leu Ala Ile Pro Gly Gly His Arg Cys Gly Cys Ala 915 920 925 Ser His Tyr Thr Leu Asp Pro Ser Ser Arg Asn Cys Ser Pro Pro Ser 930 935 940 Thr Phe Leu Leu Phe Ser Gln Lys Phe Ala Ile Ser Arg Met Ile Pro 945 950 955 960 Asp Asp Gln Leu Ser Pro Asp Leu Val Leu Pro Leu His Gly Leu Arg 965 970 975 Asn Val Lys Ala Ile Asn Tyr Asp Pro Leu Asp Lys Phe Ile Tyr Trp 980 985 990 Val Asp Gly Arg Gln Asn Ile Lys Arg Ala Lys Asp Asp Gly Thr Gln 995 1000 1005 Pro Ser Met Leu Thr Ser Pro Ser Gln Ser Leu Ser Pro Asp Arg Gln 1010 1015 1020 Pro His Asp Leu Ser Ile Asp Ile Tyr Ser Arg Thr Leu Phe Trp Thr 1025 1030 1035 1040 Cys Glu Ala Thr Asn Thr Ile Asn Val His Arg Leu Asp Gly Asp Ala 1045 1050 1055 Met Gly Val Val Leu Arg Gly Asp Arg Asp Lys Pro Arg Ala Ile Ala 1060 1065 1070 Val Asn Ala Glu Arg Gly Tyr Met Tyr Phe Thr Asn Met Gln Asp His 1075 1080 1085 Ala Ala Lys Ile Glu Arg Ala Ser Leu Asp Gly Thr Glu Arg Glu Val 1090 1095 1100 Leu Phe Thr Thr Gly Leu Ile Arg Pro Val Ala Leu Val Val Asp Asn 1105 1110 1115 1120 Ala Leu Gly Lys Leu Phe Trp Val Asp Ala Asp Leu Lys Arg Ile Glu 1125 1130 1135 Ser Cys Asp Leu Ser Gly Ala Asn Arg Leu Thr Leu Glu Asp Ala Asn 1140 1145 1150 Ile Val Gln Pro Val Gly Leu Thr Val Leu Gly Arg His Leu Tyr Trp 1155 1160 1165 Ile Asp Arg Gln Gln Gln Met Ile Glu Arg Val Glu Lys Thr Thr Gly 1170 1175 1180 Asp Lys Arg Thr Arg Val Gln Gly Arg Val Thr His Leu Thr Gly Ile 1185 1190 1195 1200 His Ala Val Glu Glu Val Ser Leu Glu Glu Phe Ser Ala His Pro Cys 1205 1210 1215 Ala Arg Asp Asn Gly Gly Cys Ser His Ile Cys Ile Ala Lys Gly Asp 1220 1225 1230 Gly Thr Pro Arg Cys Ser Cys Pro Val His Leu Val Leu Leu Gln Asn 1235 1240 1245 Leu Leu Thr Cys Gly Glu Pro Pro Thr Cys Ser Pro Asp Gln Phe Ala 1250 1255 1260 Cys Thr Thr Gly Glu Ile Asp Cys Ile Pro Gly Ala Trp Arg Cys Asp 1265 1270 1275 1280 Gly Phe Pro Glu Cys Ala Asp Gln Ser Asp Glu Glu Gly Cys Pro Val 1285 1290 1295 Cys Ser Ala Ser Gln Phe Pro Cys Ala Arg Gly Gln Cys Val Asp Leu 1300 1305 1310 Arg Leu Arg Cys Asp Gly Glu Ala Asp Cys Gln Asp Arg Ser Asp Glu 1315 1320 1325 Ala Asn Cys Asp Ala Val Cys Leu Pro Asn Gln Phe Arg Cys Thr Ser 1330 1335 1340 Gly Gln Cys Val Leu Ile Lys Gln Gln Cys Asp Ser Phe Pro Asp Cys 1345 1350 1355 1360 Ala Asp Gly Ser Asp Glu Leu Met Cys Glu Ile Asn Lys Pro Pro Ser 1365 1370 1375 Asp Asp Ile Pro Ala His Ser Ser Ala Ile Gly Pro Val Ile Gly Ile 1380 1385 1390 Ile Leu Ser Leu Phe Val Met Gly Gly Val Tyr Phe Val Cys Gln Arg 1395 1400 1405 Val Met Cys Gln Arg Tyr Thr Gly Ala Ser Gly Pro Phe Pro His Glu 1410 1415 1420 Tyr Val Gly Gly Ala Pro His Val Pro Leu Asn Phe Ile Ala Pro Gly 1425 1430 1435 1440 Gly Ser Gln His Gly Pro Phe Pro Gly Ile Pro Cys Ser Lys Ser Val 1445 1450 1455 Met Ser Ser Met Ser Leu Val Gly Gly Arg Gly Ser Val Pro Leu Tyr 1460 1465 1470 Asp Arg Asn His Val Thr Gly Ala Ser Ser Ser Ser Ser Ser Ser Thr 1475 1480 1485 Lys Ala Thr Leu Tyr Pro Pro Ile Leu Asn Pro Pro Pro Ser Pro Ala 1490 1495 1500 Thr Asp Pro Ser Leu Tyr Asn Val Asp Val Phe Tyr Ser Ser Gly Ile 1505 1510 1515 1520 Pro Ala Thr Ala Arg Pro Tyr Arg Pro Tyr Val Ile Arg Gly Met Ala 1525 1530 1535 Pro Pro Thr Thr Pro Cys Ser Thr Asp Val Cys Asp Ser Asp Tyr Ser 1540 1545 1550 Ile Ser Arg Trp Lys Ser Ser Lys Tyr Tyr Leu Asp Leu Asn Ser Asp 1555 1560 1565 Ser Asp Pro Tyr Pro Pro Pro Pro Thr Pro His Ser Gln Tyr Leu Ser 1570 1575 1580 Ala Glu Asp Ser Cys Pro Pro Ser Pro Gly Thr Glu Arg Ser Tyr Cys 1585 1590 1595 1600 His Leu Phe Pro Pro Pro Pro Ser Pro Cys Thr Asp Ser Ser 1605 1610 1591 amino acids amino acid linear 43 Cys Pro Ala Pro Ala Ala Ala Ser Pro Leu Leu Leu Phe Ala Asn Arg 1 5 10 15 Arg Asp Val Arg Leu Val Asp Ala Gly Gly Val Lys Leu Glu Ser Thr 20 25 30 Ile Val Val Ser Gly Leu Glu Asp Ala Ala Ala Val Asp Phe Gln Phe 35 40 45 Ser Lys Gly Ala Val Tyr Trp Thr Asp Val Ser Glu Glu Ala Ile Lys 50 55 60 Gln Thr Tyr Leu Asn Gln Thr Gly Ala Ala Val Gln Asn Val Val Ile 65 70 75 80 Ser Gly Leu Val Ser Pro Asp Gly Leu Ala Cys Asp Trp Val Gly Lys 85 90 95 Lys Leu Tyr Trp Thr Asp Ser Glu Thr Asn Arg Ile Glu Val Ala Asn 100 105 110 Leu Asn Gly Thr Ser Arg Lys Val Leu Phe Trp Gln Asp Leu Asp Gln 115 120 125 Pro Arg Ala Ile Ala Leu Asp Pro Ala His Gly Tyr Met Tyr Trp Thr 130 135 140 Asp Trp Gly Glu Thr Pro Arg Ile Glu Arg Ala Gly Met Asp Gly Ser 145 150 155 160 Thr Arg Lys Ile Ile Val Asp Ser Asp Ile Tyr Trp Pro Asn Gly Leu 165 170 175 Thr Ile Asp Leu Glu Glu Gln Lys Leu Tyr Trp Ala Asp Ala Lys Leu 180 185 190 Ser Phe Ile His Arg Ala Asn Leu Asp Gly Ser Phe Arg Gln Lys Val 195 200 205 Val Glu Gly Ser Leu Thr His Pro Phe Ala Leu Thr Leu Ser Gly Asp 210 215 220 Thr Leu Tyr Trp Thr Asp Trp Gln Thr Arg Ser Ile His Ala Cys Asn 225 230 235 240 Lys Arg Thr Gly Gly Lys Arg Lys Glu Ile Leu Ser Ala Leu Tyr Ser 245 250 255 Pro Met Asp Ile Gln Val Leu Ser Gln Glu Arg Gln Pro Phe Phe His 260 265 270 Thr Arg Cys Glu Glu Asp Asn Gly Gly Cys Ser His Leu Cys Leu Leu 275 280 285 Ser Pro Ser Glu Pro Phe Tyr Thr Cys Ala Cys Pro Thr Gly Val Gln 290 295 300 Leu Gln Asp Asn Gly Arg Thr Cys Lys Ala Gly Ala Glu Glu Val Leu 305 310 315 320 Leu Leu Ala Arg Arg Thr Asp Leu Arg Arg Ile Ser Leu Asp Thr Pro 325 330 335 Asp Phe Thr Asp Ile Val Leu Gln Val Asp Asp Ile Arg His Ala Ile 340 345 350 Ala Ile Asp Tyr Asp Pro Leu Glu Gly Tyr Val Tyr Trp Thr Asp Asp 355 360 365 Glu Val Arg Ala Ile Arg Arg Ala Tyr Leu Asp Gly Ser Gly Ala Gln 370 375 380 Thr Leu Val Asn Thr Glu Ile Asn Asp Pro Asp Gly Ile Ala Val Asp 385 390 395 400 Trp Val Ala Arg Asn Leu Tyr Trp Thr Asp Thr Gly Thr Asp Arg Ile 405 410 415 Glu Val Thr Arg Leu Asn Gly Thr Ser Arg Lys Ile Leu Val Ser Glu 420 425 430 Asp Leu Asp Glu Pro Arg Ala Ile Ala Leu His Pro Val Met Gly Leu 435 440 445 Met Tyr Trp Thr Asp Trp Gly Glu Asn Pro Lys Ile Glu Cys Ala Asn 450 455 460 Leu Asp Gly Gln Glu Arg Arg Val Leu Val Asn Ala Ser Leu Gly Trp 465 470 475 480 Pro Asn Gly Leu Ala Leu Asp Leu Gln Glu Gly Lys Leu Tyr Trp Gly 485 490 495 Asp Ala Lys Thr Asp Lys Ile Glu Val Ile Asn Val Asp Gly Thr Lys 500 505 510 Arg Arg Thr Leu Leu Glu Asp Lys Leu Pro His Ile Phe Gly Phe Thr 515 520 525 Leu Leu Gly Asp Phe Ile Tyr Trp Thr Asp Trp Gln Arg Arg Ser Ile 530 535 540 Glu Arg Val His Lys Val Lys Ala Ser Arg Asp Val Ile Ile Asp Gln 545 550 555 560 Leu Pro Asp Leu Met Gly Leu Lys Ala Val Asn Val Ala Lys Val Val 565 570 575 Gly Thr Asn Pro Cys Ala Asp Arg Asn Gly Gly Cys Ser His Leu Cys 580 585 590 Phe Phe Thr Pro His Ala Thr Arg Cys Gly Cys Pro Ile Gly Leu Glu 595 600 605 Leu Leu Ser Asp Met Lys Thr Cys Ile Val Pro Glu Ala Phe Leu Val 610 615 620 Phe Thr Ser Arg Ala Ala Ile His Arg Ile Ser Leu Glu Thr Asn Asn 625 630 635 640 Asn Asp Val Ala Ile Pro Leu Thr Gly Val Lys Glu Ala Ser Ala Leu 645 650 655 Asp Phe Asp Val Ser Asn Asn His Ile Tyr Trp Thr Asp Val Ser Leu 660 665 670 Lys Thr Ile Ser Arg Ala Phe Met Asn Gly Ser Ser Val Glu His Val 675 680 685 Val Glu Phe Gly Leu Asp Tyr Pro Glu Gly Met Ala Val Asp Trp Met 690 695 700 Gly Lys Asn Leu Tyr Trp Ala Asp Thr Gly Thr Asn Arg Ile Glu Val 705 710 715 720 Ala Arg Leu Asp Gly Gln Phe Arg Gln Val Leu Val Trp Arg Asp Leu 725 730 735 Asp Asn Pro Arg Ser Leu Ala Leu Asp Pro Thr Lys Gly Tyr Ile Tyr 740 745 750 Trp Thr Glu Trp Gly Gly Lys Pro Arg Ile Val Arg Ala Phe Met Asp 755 760 765 Gly Thr Asn Cys Met Thr Leu Val Asp Lys Val Gly Arg Ala Asn Asp 770 775 780 Leu Thr Ile Asp Tyr Ala Asp Gln Arg Leu Tyr Trp Thr Asp Leu Asp 785 790 795 800 Thr Asn Met Ile Glu Ser Ser Asn Met Leu Gly Gln Glu Arg Val Val 805 810 815 Ile Ala Asp Asp Leu Pro His Pro Phe Gly Leu Thr Gln Tyr Ser Asp 820 825 830 Tyr Ile Tyr Trp Thr Asp Trp Asn Leu His Ser Ile Glu Arg Ala Asp 835 840 845 Lys Thr Ser Gly Arg Asn Arg Thr Leu Ile Gln Gly His Leu Asp Phe 850 855 860 Val Met Asp Ile Leu Val Phe His Ser Ser Arg Gln Asp Gly Leu Asn 865 870 875 880 Asp Cys Met His Asn Asn Gly Gln Cys Gly Gln Leu Cys Leu Ala Ile 885 890 895 Pro Gly Gly His Arg Cys Gly Cys Ala Ser His Tyr Thr Leu Asp Pro 900 905 910 Ser Ser Arg Asn Cys Ser Pro Pro Thr Thr Phe Leu Leu Phe Ser Gln 915 920 925 Lys Ser Ala Ile Ser Arg Met Ile Pro Asp Asp Gln His Ser Pro Asp 930 935 940 Leu Ile Leu Pro Leu His Gly Leu Arg Asn Val Lys Ala Ile Asp Tyr 945 950 955 960 Asp Pro Leu Asp Lys Phe Ile Tyr Trp Val Asp Gly Arg Gln Asn Ile 965 970 975 Lys Arg Ala Lys Asp Asp Gly Thr Gln Pro Phe Val Leu Thr Ser Leu 980 985 990 Ser Gln Gly Gln Asn Pro Asp Arg Gln Pro His Asp Leu Ser Ile Asp 995 1000 1005 Ile Tyr Ser Arg Thr Leu Phe Trp Thr Cys Glu Ala Thr Asn Thr Ile 1010 1015 1020 Asn Val His Arg Leu Ser Gly Glu Ala Met Gly Val Val Leu Arg Gly 1025 1030 1035 1040 Asp Arg Asp Lys Pro Arg Ala Ile Val Val Asn Ala Glu Arg Gly Tyr 1045 1050 1055 Leu Tyr Phe Thr Asn Met Gln Asp Arg Ala Ala Lys Ile Glu Arg Ala 1060 1065 1070 Ala Leu Asp Gly Thr Glu Arg Glu Val Leu Phe Thr Thr Gly Leu Ile 1075 1080 1085 Arg Pro Val Ala Leu Val Val Asp Asn Thr Leu Gly Lys Leu Phe Trp 1090 1095 1100 Val Asp Ala Asp Leu Lys Arg Ile Glu Ser Cys Asp Leu Ser Gly Ala 1105 1110 1115 1120 Asn Arg Leu Thr Leu Glu Asp Ala Asn Ile Val Gln Pro Leu Gly Leu 1125 1130 1135 Thr Ile Leu Gly Lys His Leu Tyr Trp Ile Asp Arg Gln Gln Gln Met 1140 1145 1150 Ile Glu Arg Val Glu Lys Thr Thr Gly Asp Lys Arg Thr Arg Ile Gln 1155 1160 1165 Gly Arg Val Ala His Leu Thr Gly Ile His Ala Val Glu Glu Val Ser 1170 1175 1180 Leu Glu Glu Phe Ser Ala His Pro Cys Ala Arg Asp Asn Gly Gly Cys 1185 1190 1195 1200 Ser His Ile Cys Ile Ala Lys Gly Asp Gly Thr Pro Arg Cys Ser Cys 1205 1210 1215 Pro Val His Leu Val Leu Leu Gln Asn Leu Leu Thr Cys Gly Glu Pro 1220 1225 1230 Pro Thr Cys Ser Pro Asp Gln Phe Ala Cys Ala Thr Gly Glu Ile Asp 1235 1240 1245 Cys Ile Pro Gly Ala Trp Arg Cys Asp Gly Phe Pro Glu Cys Asp Asp 1250 1255 1260 Gln Ser Asp Glu Glu Gly Cys Pro Val Cys Ser Ala Ala Gln Phe Pro 1265 1270 1275 1280 Cys Ala Arg Gly Gln Cys Val Asp Leu Arg Leu Arg Cys Asp Gly Glu 1285 1290 1295 Ala Asp Cys Gln Asp Arg Ser Asp Glu Ala Asp Cys Asp Ala Ile Cys 1300 1305 1310 Leu Pro Asn Gln Phe Arg Cys Ala Ser Gly Gln Cys Val Leu Ile Lys 1315 1320 1325 Gln Gln Cys Asp Ser Phe Pro Asp Cys Ile Asp Gly Ser Asp Glu Leu 1330 1335 1340 Met Cys Glu Ile Thr Lys Pro Pro Ser Asp Asp Ser Pro Ala His Ser 1345 1350 1355 1360 Ser Ala Ile Gly Pro Val Ile Gly Ile Ile Leu Ser Leu Phe Val Met 1365 1370 1375 Gly Gly Val Tyr Phe Val Cys Gln Arg Val Val Cys Gln Arg Tyr Ala 1380 1385 1390 Gly Ala Asn Gly Pro Phe Pro His Glu Tyr Val Ser Gly Thr Pro His 1395 1400 1405 Val Pro Leu Asn Phe Ile Ala Pro Gly Gly Ser Gln His Gly Pro Phe 1410 1415 1420 Thr Gly Ile Ala Cys Gly Lys Ser Met Met Ser Ser Val Ser Leu Met 1425 1430 1435 1440 Gly Gly Arg Gly Gly Val Pro Leu Tyr Asp Arg Asn His Val Thr Gly 1445 1450 1455 Ala Ser Ser Ser Ser Ser Ser Ser Thr Lys Ala Thr Leu Tyr Pro Pro 1460 1465 1470 Ile Leu Asn Pro Pro Pro Ser Pro Ala Thr Asp Pro Ser Leu Tyr Asn 1475 1480 1485 Met Asp Met Phe Tyr Ser Ser Asn Ile Pro Ala Thr Val Arg Pro Tyr 1490 1495 1500 Arg Pro Tyr Ile Ile Arg Gly Met Ala Pro Pro Thr Thr Pro Cys Ser 1505 1510 1515 1520 Thr Asp Val Cys Asp Ser Asp Tyr Ser Ala Ser Arg Trp Lys Ala Ser 1525 1530 1535 Lys Tyr Tyr Leu Asp Leu Asn Ser Asp Ser Asp Pro Tyr Pro Pro Pro 1540 1545 1550 Pro Thr Pro His Ser Gln Tyr Leu Ser Ala Glu Asp Ser Cys Pro Pro 1555 1560 1565 Ser Pro Ala Thr Glu Arg Ser Tyr Phe His Leu Phe Pro Pro Pro Pro 1570 1575 1580 Ser Pro Cys Thr Asp Ser Ser 1585 1590 1586 amino acids amino acid linear 44 Ala Ala Ser Pro Leu Leu Leu Phe Ala Asn Arg Arg Asp Val Arg Leu 1 5 10 15 Val Asp Ala Gly Gly Val Lys Leu Glu Ser Thr Ile Val Ala Ser Gly 20 25 30 Leu Glu Asp Ala Ala Ala Val Asp Phe Gln Phe Ser Lys Gly Ala Val 35 40 45 Tyr Trp Thr Asp Val Ser Glu Glu Ala Ile Lys Gln Thr Tyr Leu Asn 50 55 60 Gln Thr Gly Ala Ala Ala Gln Asn Ile Val Ile Ser Gly Leu Val Ser 65 70 75 80 Pro Asp Gly Leu Ala Cys Asp Trp Val Gly Lys Lys Leu Tyr Trp Thr 85 90 95 Asp Ser Glu Thr Asn Arg Ile Glu Val Ala Asn Leu Asn Gly Thr Ser 100 105 110 Arg Lys Val Leu Phe Trp Gln Asp Leu Asp Gln Pro Arg Ala Ile Ala 115 120 125 Leu Asp Pro Ala His Gly Tyr Met Tyr Trp Thr Asp Trp Gly Glu Ala 130 135 140 Pro Arg Ile Glu Arg Ala Gly Met Asp Gly Ser Thr Arg Lys Ile Ile 145 150 155 160 Val Asp Ser Asp Ile Tyr Trp Pro Asn Gly Leu Thr Ile Asp Leu Glu 165 170 175 Glu Gln Lys Leu Tyr Trp Ala Asp Ala Lys Leu Ser Phe Ile His Arg 180 185 190 Ala Asn Leu Asp Gly Ser Phe Arg Gln Lys Val Val Glu Gly Ser Leu 195 200 205 Thr His Pro Phe Ala Leu Thr Leu Ser Gly Asp Thr Leu Tyr Trp Thr 210 215 220 Asp Trp Gln Thr Arg Ser Ile His Ala Cys Asn Lys Trp Thr Gly Glu 225 230 235 240 Gln Arg Lys Glu Ile Leu Ser Ala Leu Tyr Ser Pro Met Asp Ile Gln 245 250 255 Val Leu Ser Gln Glu Arg Gln Pro Pro Phe His Thr Pro Cys Glu Glu 260 265 270 Asp Asn Gly Gly Cys Ser His Leu Cys Leu Leu Ser Pro Arg Glu Pro 275 280 285 Phe Tyr Ser Cys Ala Cys Pro Thr Gly Val Gln Leu Gln Asp Asn Gly 290 295 300 Lys Thr Cys Lys Thr Gly Ala Glu Glu Val Leu Leu Leu Ala Arg Arg 305 310 315 320 Thr Asp Leu Arg Arg Ile Ser Leu Asp Thr Pro Asp Phe Thr Asp Ile 325 330 335 Val Leu Gln Val Gly Asp Ile Arg His Ala Ile Ala Ile Asp Tyr Asp 340 345 350 Pro Leu Glu Gly Tyr Val Tyr Trp Thr Asp Asp Glu Val Arg Ala Ile 355 360 365 Arg Arg Ala Tyr Leu Asp Gly Ser Gly Ala Gln Thr Leu Val Asn Thr 370 375 380 Glu Ile Asn Asp Pro Asp Gly Ile Ala Val Asp Trp Val Ala Arg Asn 385 390 395 400 Leu Tyr Trp Thr Asp Thr Gly Thr Asp Arg Ile Glu Val Thr Arg Leu 405 410 415 Asn Gly Thr Ser Arg Lys Ile Leu Val Ser Glu Asp Leu Asp Glu Pro 420 425 430 Arg Ala Ile Val Leu His Pro Val Met Gly Leu Met Tyr Trp Thr Asp 435 440 445 Trp Gly Glu Asn Pro Lys Ile Glu Cys Ala Asn Leu Asp Gly Arg Asp 450 455 460 Arg His Val Leu Val Asn Thr Ser Leu Gly Trp Pro Asn Gly Leu Ala 465 470 475 480 Leu Asp Leu Gln Glu Gly Lys Leu Tyr Trp Gly Asp Ala Lys Thr Asp 485 490 495 Lys Ile Glu Val Ile Asn Ile Asp Gly Thr Lys Arg Lys Thr Leu Leu 500 505 510 Glu Asp Lys Leu Pro His Ile Phe Gly Phe Thr Leu Leu Gly Asp Phe 515 520 525 Ile Tyr Trp Thr Asp Trp Gln Arg Arg Ser Ile Glu Arg Val His Lys 530 535 540 Val Lys Ala Ser Arg Asp Val Ile Ile Asp Gln Leu Pro Asp Leu Met 545 550 555 560 Gly Leu Lys Ala Val Asn Val Ala Lys Val Val Gly Thr Asn Pro Cys 565 570 575 Ala Asp Gly Asn Gly Gly Cys Ser His Leu Cys Phe Phe Thr Pro Arg 580 585 590 Ala Thr Lys Cys Gly Cys Pro Ile Gly Leu Glu Leu Leu Ser Asp Met 595 600 605 Lys Thr Cys Ile Ile Pro Glu Ala Phe Leu Val Phe Thr Ser Arg Ala 610 615 620 Thr Ile His Arg Ile Ser Leu Glu Thr Asn Asn Asn Asp Val Ala Ile 625 630 635 640 Pro Leu Thr Gly Val Lys Glu Ala Ser Ala Leu Asp Phe Asp Val Ser 645 650 655 Asn Asn His Ile Tyr Trp Thr Asp Val Ser Leu Lys Thr Ile Ser Arg 660 665 670 Ala Phe Met Asn Gly Ser Ser Val Glu His Val Ile Glu Phe Gly Leu 675 680 685 Asp Tyr Pro Glu Gly Met Ala Val Asp Trp Met Gly Lys Asn Leu Tyr 690 695 700 Trp Ala Asp Thr Gly Thr Asn Arg Ile Glu Val Ala Arg Leu Asp Gly 705 710 715 720 Gln Phe Arg Gln Val Leu Val Trp Arg Asp Leu Asp Asn Pro Arg Ser 725 730 735 Leu Ala Leu Asp Pro Thr Lys Gly Tyr Ile Tyr Trp Thr Glu Trp Gly 740 745 750 Gly Lys Pro Arg Ile Val Arg Ala Phe Met Asp Gly Thr Asn Cys Met 755 760 765 Thr Leu Val Asp Lys Val Gly Arg Ala Asn Asp Leu Thr Ile Asp Tyr 770 775 780 Ala Asp Gln Arg Leu Tyr Trp Thr Asp Leu Asp Thr Asn Met Ile Glu 785 790 795 800 Ser Ser Asn Met Leu Gly Gln Glu Arg Met Val Ile Ala Asp Asp Leu 805 810 815 Pro Tyr Pro Phe Gly Leu Thr Gln Tyr Ser Asp Tyr Ile Tyr Trp Thr 820 825 830 Asp Trp Asn Leu His Ser Ile Glu Arg Ala Asp Lys Thr Ser Gly Arg 835 840 845 Asn Arg Thr Leu Ile Gln Gly His Leu Asp Phe Val Met Asp Ile Leu 850 855 860 Val Phe His Ser Ser Arg Gln Asp Gly Leu Asn Asp Cys Val His Ser 865 870 875 880 Asn Gly Gln Cys Gly Gln Leu Cys Leu Ala Ile Pro Gly Gly His Arg 885 890 895 Cys Gly Cys Ala Ser His Tyr Thr Leu Asp Pro Ser Ser Arg Asn Cys 900 905 910 Ser Pro Pro Ser Thr Phe Leu Leu Phe Ser Gln Lys Phe Ala Ile Ser 915 920 925 Arg Met Ile Pro Asp Asp Gln Leu Ser Pro Asp Leu Val Leu Pro Leu 930 935 940 His Gly Leu Arg Asn Val Lys Ala Ile Asn Tyr Asp Pro Leu Asp Lys 945 950 955 960 Phe Ile Tyr Trp Val Asp Gly Arg Gln Asn Ile Lys Arg Ala Lys Asp 965 970 975 Asp Gly Thr Gln Pro Ser Met Leu Thr Ser Pro Ser Gln Ser Leu Ser 980 985 990 Pro Asp Arg Gln Pro His Asp Leu Ser Ile Asp Ile Tyr Ser Arg Thr 995 1000 1005 Leu Phe Trp Thr Cys Glu Ala Thr Asn Thr Ile Asn Val His Arg Leu 1010 1015 1020 Asp Gly Asp Ala Met Gly Val Val Leu Arg Gly Asp Arg Asp Lys Pro 1025 1030 1035 1040 Arg Ala Ile Ala Val Asn Ala Glu Arg Gly Tyr Met Tyr Phe Thr Asn 1045 1050 1055 Met Gln Asp His Ala Ala Lys Ile Glu Arg Ala Ser Leu Asp Gly Thr 1060 1065 1070 Glu Arg Glu Val Leu Phe Thr Thr Gly Leu Ile Arg Pro Val Ala Leu 1075 1080 1085 Val Val Asp Asn Ala Leu Gly Lys Leu Phe Trp Val Asp Ala Asp Leu 1090 1095 1100 Lys Arg Ile Glu Ser Cys Asp Leu Ser Gly Ala Asn Arg Leu Thr Leu 1105 1110 1115 1120 Glu Asp Ala Asn Ile Val Gln Pro Val Gly Leu Thr Val Leu Gly Arg 1125 1130 1135 His Leu Tyr Trp Ile Asp Arg Gln Gln Gln Met Ile Glu Arg Val Glu 1140 1145 1150 Lys Thr Thr Gly Asp Lys Arg Thr Arg Val Gln Gly Arg Val Thr His 1155 1160 1165 Leu Thr Gly Ile His Ala Val Glu Glu Val Ser Leu Glu Glu Phe Ser 1170 1175 1180 Ala His Pro Cys Ala Arg Asp Asn Gly Gly Cys Ser His Ile Cys Ile 1185 1190 1195 1200 Ala Lys Gly Asp Gly Thr Pro Arg Cys Ser Cys Pro Val His Leu Val 1205 1210 1215 Leu Leu Gln Asn Leu Leu Thr Cys Gly Glu Pro Pro Thr Cys Ser Pro 1220 1225 1230 Asp Gln Phe Ala Cys Thr Thr Gly Glu Ile Asp Cys Ile Pro Gly Ala 1235 1240 1245 Trp Arg Cys Asp Gly Phe Pro Glu Cys Ala Asp Gln Ser Asp Glu Glu 1250 1255 1260 Gly Cys Pro Val Cys Ser Ala Ser Gln Phe Pro Cys Ala Arg Gly Gln 1265 1270 1275 1280 Cys Val Asp Leu Arg Leu Arg Cys Asp Gly Glu Ala Asp Cys Gln Asp 1285 1290 1295 Arg Ser Asp Glu Ala Asn Cys Asp Ala Val Cys Leu Pro Asn Gln Phe 1300 1305 1310 Arg Cys Thr Ser Gly Gln Cys Val Leu Ile Lys Gln Gln Cys Asp Ser 1315 1320 1325 Phe Pro Asp Cys Ala Asp Gly Ser Asp Glu Leu Met Cys Glu Ile Asn 1330 1335 1340 Lys Pro Pro Ser Asp Asp Ile Pro Ala His Ser Ser Ala Ile Gly Pro 1345 1350 1355 1360 Val Ile Gly Ile Ile Leu Ser Leu Phe Val Met Gly Gly Val Tyr Phe 1365 1370 1375 Val Cys Gln Arg Val Met Cys Gln Arg Tyr Thr Gly Ala Ser Gly Pro 1380 1385 1390 Phe Pro His Glu Tyr Val Gly Gly Ala Pro His Val Pro Leu Asn Phe 1395 1400 1405 Ile Ala Pro Gly Gly Ser Gln His Gly Pro Phe Pro Gly Ile Pro Cys 1410 1415 1420 Ser Lys Ser Val Met Ser Ser Met Ser Leu Val Gly Gly Arg Gly Ser 1425 1430 1435 1440 Val Pro Leu Tyr Asp Arg Asn His Val Thr Gly Ala Ser Ser Ser Ser 1445 1450 1455 Ser Ser Ser Thr Lys Ala Thr Leu Tyr Pro Pro Ile Leu Asn Pro Pro 1460 1465 1470 Pro Ser Pro Ala Thr Asp Pro Ser Leu Tyr Asn Val Asp Val Phe Tyr 1475 1480 1485 Ser Ser Gly Ile Pro Ala Thr Ala Arg Pro Tyr Arg Pro Tyr Val Ile 1490 1495 1500 Arg Gly Met Ala Pro Pro Thr Thr Pro Cys Ser Thr Asp Val Cys Asp 1505 1510 1515 1520 Ser Asp Tyr Ser Ile Ser Arg Trp Lys Ser Ser Lys Tyr Tyr Leu Asp 1525 1530 1535 Leu Asn Ser Asp Ser Asp Pro Tyr Pro Pro Pro Pro Thr Pro His Ser 1540 1545 1550 Gln Tyr Leu Ser Ala Glu Asp Ser Cys Pro Pro Ser Pro Gly Thr Glu 1555 1560 1565 Arg Ser Tyr Cys His Leu Phe Pro Pro Pro Pro Ser Pro Cys Thr Asp 1570 1575 1580 Ser Ser 1585 4 amino acids amino acid linear 45 Asn Pro Xaa Tyr 1 4 amino acids amino acid linear 46 Tyr Trp Thr Asp 1 4 amino acids amino acid linear 47 Asn Gly Gly Cys 1 4 amino acids amino acid linear 48 Val Pro Leu Tyr 1 17 base pairs nucleic acid single linear 49 ATGGAGCCCG AGTGAGC 17 20 base pairs nucleic acid single linear 50 ATGGTGGACT CCAGCTTGAC 20 19 base pairs nucleic acid single linear 51 TTCCAGTTTT CCAAGGGAG 19 20 base pairs nucleic acid single linear 52 AAAACTGGAA GTCCACTGCG 20 18 base pairs nucleic acid single linear 53 GGTCTGCTTG ATGGCCTC 18 19 base pairs nucleic acid single linear 54 GTGCAGAACG TGGTCATCT 19 20 base pairs nucleic acid single linear 55 AGTCCACAAT GATCTTCCGG 20 20 base pairs nucleic acid single linear 56 CCAATGGACT GACCATCGAC 20 20 base pairs nucleic acid single linear 57 GTCGATGGTC AGTCCATTGG 20 19 base pairs nucleic acid single linear 58 TTGTCCTCCT CACAGCGAG 19 20 base pairs nucleic acid single linear 59 GGACTTCATC TACTGGACTG 20 20 base pairs nucleic acid single linear 60 CAGTCTGTCC AGTACATGAG 20 20 base pairs nucleic acid single linear 61 GCCTTCTTGG TCTTCACCAG 20 20 base pairs nucleic acid single linear 62 GGACCAACAG AATCGAAGTG 20 17 base pairs nucleic acid single linear 63 GTCAATGGTG AGGTCGT 17 20 base pairs nucleic acid single linear 64 ACACCAACAT GATCGAGTCG 20 20 base pairs nucleic acid single linear 65 ACAAGTTCAT CTACTGGGTG 20 20 base pairs nucleic acid single linear 66 CGGACACTGT TCTGGACGTG 20 20 base pairs nucleic acid single linear 67 CACGTCCAGA ACAGTGTCCG 20 20 base pairs nucleic acid single linear 68 TCCAGTAGAG ATGCTTGCCA 20 20 base pairs nucleic acid single linear 69 ATCGAGCGTG TGGAGAAGAC 20 20 base pairs nucleic acid single linear 70 TCCTCATCAA ACAGCAGTGC 20 19 base pairs nucleic acid single linear 71 CGGCTTGGTG ATTTCACAC 19 21 base pairs nucleic acid single linear 72 GTGTGTGACA GCGACTACAG C 21 21 base pairs nucleic acid single linear 73 GCTGTAGTCG CTGTCACACA C 21 20 base pairs nucleic acid single linear 74 GTACAAAGTT CTCCCAGCCC 20 20 base pairs nucleic acid single linear 75 TCTTCTCAG AGGATGCAGC 20 20 base pairs nucleic acid single linear 76 TTCGTCTTGA ACTTCCCAGC 20 21 base pairs nucleic acid single linear 77 TCTTCTTCTC CAGAGGATGC A 21 20 base pairs nucleic acid single linear 78 AGGCTGGTCT CAAACTCCTG 20 20 base pairs nucleic acid single linear 79 GGGGATGTGC TGCAAGGCGA 20 22 base pairs nucleic acid single linear 80 CCAGGGTTTT CCCAGTCACG AC 22 25 base pairs nucleic acid single linear 81 TTGTGTGGAA TTGTGAGCGG ATAAC 25 25 base pairs nucleic acid single linear 82 CCCAGGCTTT ACACTTTATG CTTCC 25 20 base pairs nucleic acid single linear 83 CAGGGTTTCA TCCTTTGTGG 20 38 base pairs nucleic acid single linear 84 TGTAAAACGA CGGCCAGTCA GGGTTTCATC CTTTGTGG 38 40 base pairs nucleic acid single linear 85 GCTATGACCA TGATTACGCC CAGGGTTTCA TCCTTTGTGG 40 20 base pairs nucleic acid single linear 86 TGACGGGAAG AGTTCCTCAG 20 40 base pairs nucleic acid single linear 87 GCTATGACCA TGATTACGCC TGACGGGAAG AGTTCCTCAG 40 20 base pairs nucleic acid single linear 88 TCTGCTCTTC CTGAACTGCC 20 38 base pairs nucleic acid single linear 89 TGTAAAACGA CGGCCAGTTC TGCTCTTCCT GAACTGCC 38 20 base pairs nucleic acid single linear 90 TTGAGTCCTT CAACAAGCCC 20 40 base pairs nucleic acid single linear 91 GCTATGACCA TGATTACGCC TTGAGTCCTT CAACAAGCCC 40 38 base pairs nucleic acid single linear 92 TGTAAAACGA CGGCCAGTTT CCCCACTCAT AGAGGCTC 38 38 base pairs nucleic acid single linear 93 GCTATGACCA TGATTACGCC GCTCCCAACT CGCCAAGT 38 36 base pairs nucleic acid single linear 94 TGTAAAACGA CGGCCAGTGG TCAACATGGA GGCAGC 36 38 base pairs nucleic acid single linear 95 GCTATGACCA TGATTACGCC CAGGTGTCAG TCCGCTTG 38 35 base pairs nucleic acid single linear 96 TGTAAAACGA CGGCCAGTGC AGAGAAGTTC TGAGC 35 39 base pairs nucleic acid single linear 97 GCTATGACCA TGATTACGCC CACTTGGCCA GCCATACTC 39 38 base pairs nucleic acid single linear 98 TGTAAAACGA CGGCCAGTCA AGCAAGCCTC TTGCTACC 38 40 base pairs nucleic acid single linear 99 GCTATGACCA TGATTACGCC ACTGCAATGA GGTGAAAGGC 40 38 base pairs nucleic acid single linear 100 TGTAAAACGA CGGCCAGTCA GGTGAGAACA AGTGTCCG 38 38 base pairs nucleic acid single linear 101 GCTATGACCA TGATTACGCC GCTGCCTCCA TGTTGACC 38 37 base pairs nucleic acid single linear 102 TGTAAAACGA CGGCCAGTTG TGCCTGGGTG AGATTCT 37 40 base pairs nucleic acid single linear 103 GCTATGACCA TGATTACGCC TGTGGAGCCT CTATGAGTGG 40 37 base pairs nucleic acid single linear 104 TGTAAAACGA CGGCCAGTGG GTGACAGGTG GCAGTAG 37 40 base pairs nucleic acid single linear 105 GCTATGACCA TGATTACGCC GGAAGGAAGG ACACTTGAGC 40 38 base pairs nucleic acid single linear 106 TGTAAAACGA CGGCCAGTCC TGGTGTGTTT GAGAACCC 38 39 base pairs nucleic acid single linear 107 GCTATGACCA TGATTACGCC CAATGGGAAG CCAGGCTAG 39 20 base pairs nucleic acid single linear 108 ATCTTGCTGG CTTAGCCAGT 20 38 base pairs nucleic acid single linear 109 TGTAAAACGA CGGCCAGTAT CTTGCTGGCT TAGCCAGT 38 40 base pairs nucleic acid single linear 110 GCTATGACCA TGATTACGCC ATCTTGCTGG CTTAGCCAGT 40 21 base pairs nucleic acid single linear 111 GCTCATGCAA ATTCGAGAGA G 21 41 base pairs nucleic acid single linear 112 GCTATGACCA TGATTACGCC GCTCATGCAA ATTCGAGAGA G 41 21 base pairs nucleic acid single linear 113 CCTGTTGGTT ATTTCCGATG G 21 39 base pairs nucleic acid single linear 114 TGTAAAACGA CGGCCAGTCC TGTTGGTTAT TTCCGATGG 39 41 base pairs nucleic acid single linear 115 GCTATGACCA TGATTACGCC CCTGTTGGTT ATTTCCGATG G 41 21 base pairs nucleic acid single linear 116 CCTGAGTTAA GAAGGAACGC C 21 41 base pairs nucleic acid single linear 117 GCTATGACCA TGATTACGCC CCTGAGTTAA GAAGGAACGC C 41 19 base pairs nucleic acid single linear 118 AATTGGGTCA GCAGCAATG 19 39 base pairs nucleic acid single linear 119 GCTATGACCA TGATTACGCC AATTGGGTCA GCAGCAATG 39 19 base pairs nucleic acid single linear 120 AATTGGGTCA GCAGCAATG 19 37 base pairs nucleic acid single linear 121 TGTAAAACGA CGGCCAGTAA TTGGGTCAGC AGCAATG 37 20 base pairs nucleic acid single linear 122 TTGGATCGCT AGAGATTGGG 20 40 base pairs nucleic acid single linear 123 GCTATGACCA TGATTACGCC TTGGATCGCT AGAGATTGGG 40 19 base pairs nucleic acid single linear 124 GCACCCTAAT TGGCACTCA 19 39 base pairs nucleic acid single linear 125 GCTATGACCA TGATTACGCC GCACCCTAAT TGGCACTCA 39 20 base pairs nucleic acid single linear 126 TGACGGTCCT CTTCTGGAAC 20 40 base pairs nucleic acid single linear 127 GCTATGACCA TGATTACGCC TGACGGTCCT CTTCTGGAAC 40 20 base pairs nucleic acid single linear 128 CGAGGCAGGA TGTGACTCAT 20 38 base pairs nucleic acid single linear 129 TGTAAAACGA CGGCCAGTCG AGGCAGGATG TGACTCAT 38 40 base pairs nucleic acid single linear 130 GCTATGACCA TGATTACGCC CGAGGCAGGA TGTGACTCAT 40 19 base pairs nucleic acid single linear 131 AGTGGATCAT TTCGAACGG 19 39 base pairs nucleic acid single linear 132 GCTATGACCA TGATTACGCC AGTGGATCAT TTCGAACGG 39 20 base pairs nucleic acid single linear 133 CCAACTCAGC TTCCCGAGTA 20 40 base pairs nucleic acid single linear 134 GCTATGACCA TGATTACGCC CCAACTCAGC TTCCCGAGTA 40 20 base pairs nucleic acid single linear 135 TGGCTGAGTA TTTCCCTTGC 20 38 base pairs nucleic acid single linear 136 TGTAAAACGA CGGCCAGTTG GCTGAGTATT TCCCTTGC 38 40 base pairs nucleic acid single linear 137 GCTATGACCA TGATTACGCC TGGCTGAGTA TTTCCCTTGC 40 19 base pairs nucleic acid single linear 138 TTTAACAAGC CCTCCTCCG 19 39 base pairs nucleic acid single linear 139 GCTATGACCA TGATTACGCC TTTAACAAGC CCTCCTCCG 39 19 base pairs nucleic acid single linear 140 CAACGCCAGC ATCTACTGA 19 37 base pairs nucleic acid single linear 141 TGTAAAACGA CGGCCAGTCA ACGCCAGCAT CTACTGA 37 39 base pairs nucleic acid single linear 142 GCTATGACCA TGATTACGCC CAACGCCAGC ATCTACTGA 39 20 base pairs nucleic acid single linear 143 CAAATAGCAG AGCACAGGCA 20 40 base pairs nucleic acid single linear 144 GCTATGACCA TGATTACGCC CAAATAGCAG AGCACAGGCA 40 19 base pairs nucleic acid single linear 145 TGAAGTTGCT GCTCTTGGG 19 37 base pairs nucleic acid single linear 146 TGTAAAACGA CGGCCAGTTG AAGTTGCTGC TCTTGGG 37 39 base pairs nucleic acid single linear 147 GCTATGACCA TGATTACGCC TGAAGTTGCT GCTCTTGGG 39 21 base pairs nucleic acid single linear 148 CACTTCCTCC TCATGCAAGT C 21 41 base pairs nucleic acid single linear 149 GCTATGACCA TGATTACGCC CACTTCCTCC TCATGCAAGT C 41 21 base pairs nucleic acid single linear 150 AGACTGGAGC CTCTGTGTTC G 21 39 base pairs nucleic acid single linear 151 TGTAAAACGA CGGCCAGTAG ACTGGAGCCT CTGTGTTCG 39 41 base pairs nucleic acid single linear 152 GCTATGACCA TGATTACGCC AGACTGGAGC CTCTGTGTTC G 41 20 base pairs nucleic acid single linear 153 TGTGTGTCTA CCGGACTTGC 20 40 base pairs nucleic acid single linear 154 GCTATGACCA TGATTACGCC TGTGTGTCTA CCGGACTTGC 40 21 base pairs nucleic acid single linear 155 GAACAGAGGC AAGGTTTTCC C 21 41 base pairs nucleic acid single linear 156 GCTATGACCA TGATTACGCC GAACAGAGGC AAGGTTTTCC C 41 19 base pairs nucleic acid single linear 157 AGAATCGCTT GAACCCAGG 19 39 base pairs nucleic acid single linear 158 GCTATGACCA TGATTACGCC AGAATCGCTT GAACCCAGG 39 20 base pairs nucleic acid single linear 159 GCTGGTTCCT AAAATGTGGC 20 38 base pairs nucleic acid single linear 160 TGTAAAACGA CGGCCAGTGC TGGTTCCTAA AATGTGGC 38 40 base pairs nucleic acid single linear 161 GCTATGACCA TGATTACGCC GCTGGTTCCT AAAATGTGGC 40 22 base pairs nucleic acid single linear 162 CATACGAGGT GAACACAAGG AC 22 42 base pairs nucleic acid single linear 163 GCTATGACCA TGATTACGCC CATACGAGGT GAACACAAGG AC 42 20 base pairs nucleic acid single linear 164 TGAAGAGGTG GGGACAGTTG 20 40 base pairs nucleic acid single linear 165 GCTATGACCA TGATTACGCC TGAAGAGGTG GGGACAGTTG 40 21 base pairs nucleic acid single linear 166 CTTGTGCCTT CCAGCTACAT C 21 39 base pairs nucleic acid single linear 167 TGTAAAACGA CGGCCAGTCT TGTGCCTTCC AGCTACATC 39 41 base pairs nucleic acid single linear 168 GCTATGACCA TGATTACGCC CTTGTGCCTT CCAGCTACAT C 41 20 base pairs nucleic acid single linear 169 AGTCCTGGCA CAGGGATTAG 20 40 base pairs nucleic acid single linear 170 GCTATGACCA TGATTACGCC AGTCCTGGCA CAGGGATTAG 40 20 base pairs nucleic acid single linear 171 ATAACTGCAG CAAAGGCACC 20 40 base pairs nucleic acid single linear 172 GCTATGACCA TGATTACGCC ATAACTGCAG CAAAGGCACC 40 20 base pairs nucleic acid single linear 173 GCTTCAGTGG ATCTTGCTGG 20 38 base pairs nucleic acid single linear 174 TGTAAAACGA CGGCCAGTGC TTCAGTGGAT CTTGCTGG 38 40 base pairs nucleic acid single linear 175 GCTATGACCA TGATTACGCC GCTTCAGTGG ATCTTGCTGG 40 20 base pairs nucleic acid single linear 176 TGTGCAGTGC ACAACCTACC 20 40 base pairs nucleic acid single linear 177 GCTATGACCA TGATTACGCC TGTGCAGTGC ACAACCTACC 40 20 base pairs nucleic acid single linear 178 GTTGTCGAGT GGCGTGCTAT 20 38 base pairs nucleic acid single linear 179 TGTAAAACGA CGGCCAGTGT TGTCGAGTGG CGTGCTAT 38 40 base pairs nucleic acid single linear 180 GCTATGACCA TGATTACGCC GTTGTCGAGT GGCGTGCTAT 40 20 base pairs nucleic acid single linear 181 AAAAGTCCTG TGGGGTCTGA 20 40 base pairs nucleic acid single linear 182 GCTATGACCA TGATTACGCC AAAAGTCCTG TGGGGTCTGA 40 20 base pairs nucleic acid single linear 183 AGAAGTGTGG CCTCTGCTGT 20 38 base pairs nucleic acid single linear 184 TGTAAAACGA CGGCCAGTAG AAGTGTGGCC TCTGCTGT 38 40 base pairs nucleic acid single linear 185 GCTATGACCA TGATTACGCC AGAAGTGTGG CCTCTGCTGT 40 21 base pairs nucleic acid single linear 186 GTGAAAGAGC CTGTGTTTGC T 21 41 base pairs nucleic acid single linear 187 GCTATGACCA TGATTACGCC GTGAAAGAGC CTGTGTTTGC T 41 21 base pairs nucleic acid single linear 188 AGACCCTGCT TCCAAATAAG C 21 39 base pairs nucleic acid single linear 189 TGTAAAACGA CGGCCAGTAG ACCCTGCTTC CAAATAAGC 39 41 base pairs nucleic acid single linear 190 GCTATGACCA TGATTACGCC AGACCCTGCT TCCAAATAAG C 41 20 base pairs nucleic acid single linear 191 ACTCATTTTC TGCCTCTGCC 20 40 base pairs nucleic acid single linear 192 GCTATGACCA TGATTACGCC ACTCATTTTC TGCCTCTGCC 40 20 base pairs nucleic acid single linear 193 TGGCAGTCCT GTCAACCTCT 20 38 base pairs nucleic acid single linear 194 TGTAAAACGA CGGCCAGTTG GCAGTCCTGT CAACCTCT 38 40 base pairs nucleic acid single linear 195 GCTATGACCA TGATTACGCC TGGCAGTCCT GTCAACCTCT 40 20 base pairs nucleic acid single linear 196 CACACAGGAT CTTGCACTGG 20 40 base pairs nucleic acid single linear 197 GCTATGACCA TGATTACGCC CACACAGGAT CTTGCACTGG 40 20 base pairs nucleic acid single linear 198 AGGGCCAGTT CTCATGAGTT 20 38 base pairs nucleic acid single linear 199 TGTAAAACGA CGGCCAGTAG GGCCAGTTCT CATGAGTT 38 40 base pairs nucleic acid single linear 200 GCTATGACCA TGATTACGCC AGGGCCAGTT CTCATGAGTT 40 20 base pairs nucleic acid single linear 201 GGGCAAAGGA AGACACAATC 20 40 base pairs nucleic acid single linear 202 GCTATGACCA TGATTACGCC GGGCAAAGGA AGACACAATC 40 20 base pairs nucleic acid single linear 203 CAACTTCTGC TTTGAAGCCC 20 38 base pairs nucleic acid single linear 204 TGTAAAACGA CGGCCAGTCA ACTTCTGCTT TGAAGCCC 38 40 base pairs nucleic acid single linear 205 GCTATGACCA TGATTACGCC CAACTTCTGC TTTGAAGCCC 40 20 base pairs nucleic acid single linear 206 GACAGACTTG GCAATCTCCC 20 40 base pairs nucleic acid single linear 207 GCTATGACCA TGATTACGCC GACAGACTTG GCAATCTCCC 40 21 base pairs nucleic acid single linear 208 TCTGCTCTCT GTTTGGAGTC C 21 39 base pairs nucleic acid single linear 209 TGTAAAACGA CGGCCAGTTC TGCTCTCTGT TTGGAGTCC 39 41 base pairs nucleic acid single linear 210 GCTATGACCA TGATTACGCC TCTGCTCTCT GTTTGGAGTC C 41 20 base pairs nucleic acid single linear 211 CCCTAAACTC CACGTTCCTG 20 40 base pairs nucleic acid single linear 212 GCTATGACCA TGATTACGCC CCCTAAACTC CACGTTCCTG 40 20 base pairs nucleic acid single linear 213 GGGTTAATGT TGGCCACATC 20 40 base pairs nucleic acid single linear 214 GCTATGACCA TGATTACGCC GGGTTAATGT TGGCCACATC 40 19 base pairs nucleic acid single linear 215 TTGGCAGGGA TGTGTTGAG 19 37 base pairs nucleic acid single linear 216 TGTAAAACGA CGGCCAGTTT GGCAGGGATG TGTTGAG 37 39 base pairs nucleic acid single linear 217 GCTATGACCA TGATTACGCC TTGGCAGGGA TGTGTTGAG 39 20 base pairs nucleic acid single linear 218 GTCTGCCACA TGTGCAAGAG 20 40 base pairs nucleic acid single linear 219 GCTATGACCA TGATTACGCC GTCTGCCACA TGTGCAAGAG 40 20 base pairs nucleic acid single linear 220 TGGTCTGAGT CTCGTGGGTA 20 38 base pairs nucleic acid single linear 221 TGTAAAACGA CGGCCAGTTG GTCTGAGTCT CGTGGGTA 38 40 base pairs nucleic acid single linear 222 GCTATGACCA TGATTACGCC TGGTCTGAGT CTCGTGGGTA 40 21 base pairs nucleic acid single linear 223 GAGGTGGATT TGGGTGAGAT T 21 41 base pairs nucleic acid single linear 224 GCTATGACCA TGATTACGCC GAGGTGGATT TGGGTGAGAT T 41 20 base pairs nucleic acid single linear 225 AGCCCTCTCT GCAAGGAAAG 20 38 base pairs nucleic acid single linear 226 TGTAAAACGA CGGCCAGTAG CCCTCTCTGC AAGGAAAG 38 40 base pairs nucleic acid single linear 227 GCTATGACCA TGATTACGCC AGCCCTCTCT GCAAGGAAAG 40 20 base pairs nucleic acid single linear 228 CAGAACGTGG AGTTCTGCTG 20 40 base pairs nucleic acid single linear 229 GCTATGACCA TGATTACGCC CAGAACGTGG AGTTCTGCTG 40 20 base pairs nucleic acid single linear 230 TACCGAATCC CACTCCTCTG 20 38 base pairs nucleic acid single linear 231 TGTAAAACGA CGGCCAGTTA CCGAATCCCA CTCCTCTG 38 40 base pairs nucleic acid single linear 232 GCTATGACCA TGATTACGCC TACCGAATCC CACTCCTCTG 40 20 base pairs nucleic acid single linear 233 CATGGTAGAG GTGGGACCAT 20 38 base pairs nucleic acid single linear 234 TGTAAAACGA CGGCCAGTCA TGGTAGAGGT GGGACCAT 38 40 base pairs nucleic acid single linear 235 GCTATGACCA TGATTACGCC CATGGTAGAG GTGGGACCAT 40 20 base pairs nucleic acid single linear 236 GATATCCACC TCTGCCCAAG 20 40 base pairs nucleic acid single linear 237 GCTATGACCA TGATTACGCC GATATCCACC TCTGCCCAAG 40 20 base pairs nucleic acid single linear 238 TTACAGGGGC ACAGAGAAGC 20 40 base pairs nucleic acid single linear 239 GCTATGACCA TGATTACGCC TTACAGGGGC ACAGAGAAGC 40 20 base pairs nucleic acid single linear 240 GCAACAGAGC AAGACCCTGT 20 40 base pairs nucleic acid single linear 241 GCTATGACCA TGATTACGCC GCAACAGAGC AAGACCCTGT 40 19 base pairs nucleic acid single linear 242 AAATTAGCCA GGCATGGTG 19 39 base pairs nucleic acid single linear 243 GCTATGACCA TGATTACGCC AAATTAGCCA GGCATGGTG 39 38 base pairs nucleic acid single linear 244 TGTAAAACGA CGGCCAGTGC AACAGAGCAA GACCCTGT 38 20 base pairs nucleic acid single linear 245 CCTGCAGAAG GAAACCTGAC 20 40 base pairs nucleic acid single linear 246 GCTATGACCA TGATTACGCC CCTGCAGAAG GAAACCTGAC 40 19 base pairs nucleic acid single linear 247 CTGCATCTTT GCCACCATG 19 39 base pairs nucleic acid single linear 248 GCTATGACCA TGATTACGCC CTGCATCTTT GCCACCATG 39 38 base pairs nucleic acid single linear 249 TGTAAAACGA CGGCCAGTCC TGCAGAAGGA AACCTGAC 38 20 base pairs nucleic acid single linear 250 TTCCCAGGAG GCAAGTTATG 20 40 base pairs nucleic acid single linear 251 GCTATGACCA TGATTACGCC TTCCCAGGAG GCAAGTTATG 40 20 base pairs nucleic acid single linear 252 TGGGCTTAGG TGATCCTCAC 20 40 base pairs nucleic acid single linear 253 GCTATGACCA TGATTACGCC TGGGCTTAGG TGATCCTCAC 40 38 base pairs nucleic acid single linear 254 TGTAAAACGA CGGCCAGTTT CCCAGGAGGC AAGTTATG 38 20 base pairs nucleic acid single linear 255 ACCAAGCCCA ACTAATCAGC 20 40 base pairs nucleic acid single linear 256 GCTATGACCA TGATTACGCC ACCAAGCCCA ACTAATCAGC 40 20 base pairs nucleic acid single linear 257 ATGCCTGTAA TCCCAGCACT 20 40 base pairs nucleic acid single linear 258 GCTATGACCA TGATTACGCC ATGCCTGTAA TCCCAGCACT 40 38 base pairs nucleic acid single linear 259 TGTAAAACGA CGGCCAGTAC CAAGCCCAAC TAATCAGC 38 20 base pairs nucleic acid single linear 260 ACTGCAAGCC CTCTCTGAAC 20 20 base pairs nucleic acid single linear 261 CGAAGACTGC GAAACAGACA 20 20 base pairs nucleic acid single linear 262 CTAGTGCCGT GCAGAATGAG 20 20 base pairs nucleic acid single linear 263 GGCCACTGCA ATGAGATACA 20 20 base pairs nucleic acid single linear 264 GAGAAACAGT TCCAGGGTGG 20 40 base pairs nucleic acid single linear 265 GCTATGACCA TGATTACGCC GAGAAACAGT TCCAGGGTGG 40 20 base pairs nucleic acid single linear 266 AAACTGAGGC TGGGAGAGGT 20 40 base pairs nucleic acid single linear 267 GCTATGACCA TGATTACGCC AAACTGAGGC TGGGAGAGGT 40 20 base pairs nucleic acid single linear 268 TGTTCTTCCT CACAGGGAGG 20 40 base pairs nucleic acid single linear 269 GCTATGACCA TGATTACGCC TGTTCTTCCT CACAGGGAGG 40 20 base pairs nucleic acid single linear 270 TCCCCAAATC TGTCCAGTTC 20 40 base pairs nucleic acid single linear 271 GCTATGACCA TGATTACGCC TCCCCAAATC TGTCCAGTTC 40 20 base pairs nucleic acid single linear 272 CATACCTGGA GGGATGCTTG 20 40 base pairs nucleic acid single linear 273 GCTATGACCA TGATTACGCC CATACCTGGA GGGATGCTTG 40 20 base pairs nucleic acid single linear 274 TAGGTTGCTG TGTGGCTTCA 20 40 base pairs nucleic acid single linear 275 GCTATGACCA TGATTACGCC TAGGTTGCTG TGTGGCTTCA 40 20 base pairs nucleic acid single linear 276 CTTCTGACAA AGCAGAGGCC 20 40 base pairs nucleic acid single linear 277 GCTATGACCA TGATTACGCC CTTCTGACAA AGCAGAGGCC 40 20 base pairs nucleic acid single linear 278 GCTGTTAGGG TTACCATCGC 20 40 base pairs nucleic acid single linear 279 GCTATGACCA TGATTACGCC GCTGTTAGGG TTACCATCGC 40 20 base pairs nucleic acid single linear 280 CCACAGGGTG ATATGCTGTC 20 40 base pairs nucleic acid single linear 281 GCTATGACCA TGATTACGCC CCACAGGGTG ATATGCTGTC 40 20 base pairs nucleic acid single linear 282 CGCCTGGCTA CTTTGGTACT 20 40 base pairs nucleic acid single linear 283 GCTATGACCA TGATTACGCC CGCCTGGCTA CTTTGGTACT 40 19 base pairs nucleic acid single linear 284 CCAAATGAAC CTGGGCAAC 19 39 base pairs nucleic acid single linear 285 GCTATGACCA TGATTACGCC CCAAATGAAC CTGGGCAAC 39 20 base pairs nucleic acid single linear 286 GTCTTGGCTC ACTGCAACCT 20 40 base pairs nucleic acid single linear 287 GCTATGACCA TGATTACGCC GTCTTGGCTC ACTGCAACCT 40 20 base pairs nucleic acid single linear 288 GCCAAGACTG TGCTACTGCA 20 20 base pairs nucleic acid single linear 289 CAGGGAGCAG ATCTTACCCA 20 20 base pairs nucleic acid single linear 290 TGGGATTAAC TAGGGAGGGG 20 40 base pairs nucleic acid single linear 291 GCTATGACCA TGATTACGCC TGGGATTAAC TAGGGAGGGG 40 20 base pairs nucleic acid single linear 292 TGCTGCTGTC TCCATCTCTG 20 40 base pairs nucleic acid single linear 293 GCTATGACCA TGATTACGCC TGCTGCTGTC TCCATCTCTG 40 21 base pairs nucleic acid single linear 294 ACAGACCAGC AGTGAAACCT G 21 41 base pairs nucleic acid single linear 295 GCTATGACCA TGATTACGCC ACAGACCAGC AGTGAAACCT G 41 20 base pairs nucleic acid single linear 296 GTTCACTGCA ACCTCTGCCT 20 40 base pairs nucleic acid single linear 297 GCTATGACCA TGATTACGCC GTTCACTGCA ACCTCTGCCT 40 21 base pairs nucleic acid single linear 298 GTTCTCGTAG ATGCTTGCAG G 21 41 base pairs nucleic acid single linear 299 GCTATGACCA TGATTACGCC GTTCTCGTAG ATGCTTGCAG G 41 20 base pairs nucleic acid single linear 300 GAGGCAGGAG GATCACTTGA 20 40 base pairs nucleic acid single linear 301 GCTATGACCA TGATTACGCC GAGGCAGGAG GATCACTTGA 40 20 base pairs nucleic acid single linear 302 TGAGCTGAGA TCACACCGCT 20 40 base pairs nucleic acid single linear 303 GCTATGACCA TGATTACGCC TGAGCTGAGA TCACACCGCT 40 20 base pairs nucleic acid single linear 304 AGTTGACACT TTGCTGGCCT 20 40 base pairs nucleic acid single linear 305 GCTATGACCA TGATTACGCC AGTTGACACT TTGCTGGCCT 40 20 base pairs nucleic acid single linear 306 CTCTGCATGG CTTAGGGACA 20 40 base pairs nucleic acid single linear 307 GCTATGACCA TGATTACGCC CTCTGCATGG CTTAGGGACA 40 20 base pairs nucleic acid single linear 308 GGCTGCTCTC TGCATTCTCT 20 40 base pairs nucleic acid single linear 309 GCTATGACCA TGATTACGCC GGCTGCTCTC TGCATTCTCT 40 21 base pairs nucleic acid single linear 310 CTGGCTTTAG CTTGCATTTC C 21 41 base pairs nucleic acid single linear 311 GCTATGACCA TGATTACGCC CTGGCTTTAG CTTGCATTTC C 41 21 base pairs nucleic acid single linear 312 TGCCTCAGTT TTCTCACCTG T 21 41 base pairs nucleic acid single linear 313 GCTATGACCA TGATTACGCC TGCCTCAGTT TTCTCACCTG T 41 20 base pairs nucleic acid single linear 314 CAAACAGCCA CTGAGCATGT 20 40 base pairs nucleic acid single linear 315 GCTATGACCA TGATTACGCC CAAACAGCCA CTGAGCATGT 40 20 base pairs nucleic acid single linear 316 TCCTCCTGTA GATGCCCAAG 20 40 base pairs nucleic acid single linear 317 GCTATGACCA TGATTACGCC TCCTCCTGTA GATGCCCAAG 40 22 base pairs nucleic acid single linear 318 GCCGAGAATT GTCATCTTAA CT 22 22 base pairs nucleic acid single linear 319 GGATTGAAAG CTGCAAACTA CA 22 20 base pairs nucleic acid single linear 320 GGAGCCACCA CATCCAGTTA 20 18 base pairs nucleic acid single linear 321 TGGAGGGATT GCTTGAGG 18 20 base pairs nucleic acid single linear 322 AGGTGTACAC CACCATGCCT 20 19 base pairs nucleic acid single linear 323 TGGTGCCAAT TATTGCTGC 19 22 base pairs nucleic acid single linear 324 AGATCTTATA CACATGTGCG CG 22 21 base pairs nucleic acid single linear 325 AGGTGACATC ACTTACAGCG G 21 18 base pairs nucleic acid single linear 326 ATTACCCAGG CATGGTGC 18 20 base pairs nucleic acid single linear 327 CAGGCACTTC TTCCAGGTCT 20 20 base pairs nucleic acid single linear 328 AGGGTTACAC TGGAGTTTGC 20 25 base pairs nucleic acid single linear 329 AAACCTTCAA TGTGTTCATT AAAAC 25 20 base pairs nucleic acid single linear 330 TCAACTTTAT TGGGGGTTTA 20 20 base pairs nucleic acid single linear 331 AAGGTAAAAG TCCAAAATGG 20 21 base pairs nucleic acid single linear 332 GGACAGTCAG TTATTGAAAT G 21 20 base pairs nucleic acid single linear 333 TTTCCTCTCT GGGAGTCTCT 20 20 base pairs nucleic acid single linear 334 TCAAGCTGGA GTCCACCATC 20 19 base pairs nucleic acid single linear 335 CACTCGCTGT GAGGAGGAC 19 20 base pairs nucleic acid single linear 336 ACAACGGCAG GACGTGTAAG 20 19 base pairs nucleic acid single linear 337 ATTGCCATCG ACTACGACC 19 20 base pairs nucleic acid single linear 338 TGGTCAACAC CGAGATCAAC 20 20 base pairs nucleic acid single linear 339 AACCTCTACT GGACCGACAC 20 19 base pairs nucleic acid single linear 340 CTCATGTACT GGACAGACT 19 20 base pairs nucleic acid single linear 341 GAGACGCCAA GACAGACAAG 20 20 base pairs nucleic acid single linear 342 CAGTCCAGTA GATGAAGTCC 20 20 base pairs nucleic acid single linear 343 GTGAAGAAGC ACAGGTGGCT 20 20 base pairs nucleic acid single linear 344 TCATGTCACT CAGCAGCTCC 20 20 base pairs nucleic acid single linear 345 CCGTTGTTGT GCATACAGTC 20 20 base pairs nucleic acid single linear 346 GTGGCACATG CAAACTGGTC 20 28 base pairs nucleic acid single linear 347 GCTCTAGAGT ACAAAGTTCT CCCAGCCC 28 54 base pairs nucleic acid single linear 348 ATCCTCGGGG TCTTCCGGGG CGAGTTCTGG CTGGCTACTG CTGTGGGCCG GGCT 54 54 base pairs nucleic acid single linear 349 TGGATATCTC AGTGGTGGTG GTGGTGGTGC TCGACATCCT CGGGGTCTTC CGGG 54 35 base pairs nucleic acid single linear 350 TAGAATTCGC CGCCACCATG GAGGCAGCGC CGCCC 35 17 base pairs nucleic acid single linear 351 GAGGCGGGAG CAAGAGG 17 26 base pairs nucleic acid single linear 352 GCAAGCTTCA TGGAGCCCGA GTGAGC 26 17 base pairs nucleic acid single linear 353 ATGGAGCCCG AGTGAGC 17 17 base pairs nucleic acid single linear 354 TCACTCGGGC TCCATGG 17 20 base pairs nucleic acid single linear 355 TGCTGTACTG CAGCTTGGTC 20 21 base pairs nucleic acid single linear 356 ATGCAGCTGC TGTAGACTTC C 21 20 base pairs nucleic acid single linear 357 GTCTGTTTGA TGGCCTCCTC 20 20 base pairs nucleic acid single linear 358 ATGTTCTGTG CAGCACCTCC 20 18 base pairs nucleic acid single linear 359 GCCATCAGGT GACACGAG 18 21 base pairs nucleic acid single linear 360 AAGGTTCTCT TCTGGCAGGA C 21 19 base pairs nucleic acid single linear 361 CCAGTCAGTC CAGTACATG 19 20 base pairs nucleic acid single linear 362 TCGACCTGGA GGAACAGAAG 20 20 base pairs nucleic acid single linear 363 AAGCTCAGCT TCATCCACCG 20 20 base pairs nucleic acid single linear 364 ATGAAGCTGA GCTTGGCATC 20 22 base pairs nucleic acid single linear 365 AGCAGAGGAA GGAGATCCTT AG 22 20 base pairs nucleic acid single linear 366 TCCATGGGTG AGTACAGAGC 20 20 base pairs nucleic acid single linear 367 ATTGTCCTGC AACTGCACAC 20 19 base pairs nucleic acid single linear 368 GCCATTGCCA TTGACTACG 19 21 base pairs nucleic acid single linear 369 GGATCGTAGT CAATGGCAAT G 21 20 base pairs nucleic acid single linear 370 GAATTGAGGT GACTCGCCTC 20 20 base pairs nucleic acid single linear 371 CCTCAATTCT GTAGTGCCTG 20 19 base pairs nucleic acid single linear 372 TGTGTTGCAC CCTGTGATG 19 19 base pairs nucleic acid single linear 373 ATCTAGGTTG GCGCATTCG 19 19 base pairs nucleic acid single linear 374 AGGTGTTCAC CAGGACATG 19 29 base pairs nucleic acid single linear 375 GCGAGCTCCC GTCTATGTTG ATCACCTCG 29 20 base pairs nucleic acid single linear 376 GACCTGATGG GACTCAAAGC 20 20 base pairs nucleic acid single linear 377 GCTGGTGAAT ACCAGGAAGG 20 20 base pairs nucleic acid single linear 378 ACGATGTGGC TATCCCACTC 20 20 base pairs nucleic acid single linear 379 AGTAGGATCC AGAGCCAGAG 20 20 base pairs nucleic acid single linear 380 AGCGCATGGT GATAGCTGAC 20 21 base pairs nucleic acid single linear 381 CGTTCAATGC TATGCAGGTT C 21 20 base pairs nucleic acid single linear 382 GTGCTTCACA CTACACGCTG 20 19 base pairs nucleic acid single linear 383 CAGCCAGAAA TTTGCCATC 19 20 base pairs nucleic acid single linear 384 TCCGGCTGTA GATGTCAATG 20 21 base pairs nucleic acid single linear 385 AGGCCACCAA CACTATCAAT G 21 20 base pairs nucleic acid single linear 386 TACCCTCGCT CAGCATTGAC 20 19 base pairs nucleic acid single linear 387 CTGGAAGATG CCAACATCG 19 20 base pairs nucleic acid single linear 388 TGAACCCTAG TCCGCTTGTC 20 20 base pairs nucleic acid single linear 389 CTGCAGAACC TGCTGACTTG 20 21 base pairs nucleic acid single linear 390 CCAGAGTGAT GAAGAAGGCT G 21 20 base pairs nucleic acid single linear 391 TCACTCTGGT CAGCACACTC 20 20 base pairs nucleic acid single linear 392 CAGGATCGCT CTGATGAAGC 20 21 base pairs nucleic acid single linear 393 GCAGTTAGCT TCATCAGAGC G 21 20 base pairs nucleic acid single linear 394 ACCCTCTGAT GACATCCCAG 20 18 base pairs nucleic acid single linear 395 AATGGCACTG CTGTGGGC 18 20 base pairs nucleic acid single linear 396 AGGCTCATGG AGCTCATCAC 20 20 base pairs nucleic acid single linear 397 ATAGTGTGGC CTTTGTGCTG 20 20 base pairs nucleic acid single linear 398 GTCATTCGAG GTATGGCACC 20 21 base pairs nucleic acid single linear 399 GGTAGTATTT GCTGCTCTTC C 21 27 base pairs nucleic acid single linear 400 GCTCTAGAAA AGTTTCCCAG CCCTGCC 27 19 base pairs nucleic acid single linear 401 CTGGAAGATG CCAACATCG 19 62 base pairs nucleic acid single linear 402 GCTCTAGACT AGTGATGGTG ATGGTGATGA CTGCTGTGGG CTGGGATGTC ATCAGAGGGT 60 GG 62 17 amino acids amino acid linear 403 Ser Tyr Phe His Leu Phe Pro Pro Pro Pro Ser Pro Cys Thr Asp Ser 1 5 10 15 Ser 15 amino acids amino acid linear 404 Val Asp Gly Arg Gln Asn Ile Lys Arg Ala Lys Asp Asp Gly Thr 1 5 10 15 18 amino acids amino acid linear 405 Glu Val Leu Phe Thr Thr Gly Leu Ile Arg Pro Val Ala Leu Val Val 1 5 10 15 Asp Asn 16 amino acids amino acid linear 406 Ile Gln Gly His Leu Asp Phe Val Met Asp Ile Leu Val Phe His Ser 1 5 10 15 27 base pairs nucleic acid single linear 407 CCATCCTAAT ACGACTCACT ATAGGGC 27 23 base pairs nucleic acid single linear 408 ACTCACTATA GGGCTCGAGC GGC 23 18 base pairs nucleic acid single linear 409 TGTAAAACGA CGGCCAGT 18 20 base pairs nucleic acid single linear 410 GCTATGACCA TGATTACGCC 20 16 base pairs nucleic acid double linear 411 CCGGGTCAAC ATGGAG 16 16 base pairs nucleic acid double linear 412 CCGCGGGTAG GTGGGC 16 16 base pairs nucleic acid double linear 413 TGCCCCACAG CCTCGC 16 16 base pairs nucleic acid double linear 414 TCACGGGTAA ACCCTG 16 16 base pairs nucleic acid double linear 415 CCCGTCACAG GTACAT 16 16 base pairs nucleic acid double linear 416 GTTCCGGTAG GTACCC 16 16 base pairs nucleic acid double linear 417 CTGACTGCAG GCAGAA 16 16 base pairs nucleic acid double linear 418 CTTTCTGTGA GTGCCG 16 16 base pairs nucleic acid double linear 419 GTTTTCCCAG TCCACA 16 16 base pairs nucleic acid double linear 420 AGGCAGGTGA GGCGGT 16 16 base pairs nucleic acid double linear 421 GTCTCCACAG GAGCCG 16 16 base pairs nucleic acid double linear 422 GATGGGGTAA GACGGG 16 16 base pairs nucleic acid double linear 423 TCTTCTCCAG CCTCAT 16 16 base pairs nucleic acid double linear 424 ATCGAGGTGA GGCTCC 16 16 base pairs nucleic acid double linear 425 CGTCCTGCAG GTGATC 16 16 base pairs nucleic acid double linear 426 TCGTCGGTGA GTCCGG 16 16 base pairs nucleic acid double linear 427 TCGCTTCCAG GAACCA 16 16 base pairs nucleic acid double linear 428 CTGAAGGTAG CGTGGG 16 16 base pairs nucleic acid double linear 429 CTGCTGCCAG ACCATC 16 16 base pairs nucleic acid double linear 430 CAAGGGGTAA GTGTTT 16 16 base pairs nucleic acid double linear 431 TGCCTTCCAG CTACAT 16 16 base pairs nucleic acid double linear 432 TGCTGGGTGA GGGCCG 16 16 base pairs nucleic acid double linear 433 GTTCATGCAG GTCAGG 16 16 base pairs nucleic acid double linear 434 GCAGCCGTAA GTGCCT 16 16 base pairs nucleic acid double linear 435 CCTCCTCTAG CGCCCA 16 16 base pairs nucleic acid double linear 436 ACCCAGGCAG GTGCCC 16 16 base pairs nucleic acid double linear 437 TGTCTTACAG CCCTTT 16 16 base pairs nucleic acid double linear 438 GCGAGGGTAG GAGGCC 16 16 base pairs nucleic acid double linear 439 CCTCCCGCAG GTACCT 16 16 base pairs nucleic acid double linear 440 TGTCAGGTAA GGGGCC 16 16 base pairs nucleic acid double linear 441 CTGCTTGCAG GGGCCA 16 16 base pairs nucleic acid double linear 442 AGTTCTGTAC GTGGGG 16 16 base pairs nucleic acid double linear 443 GTCTTTGCAG CAGCCC 16 16 base pairs nucleic acid double linear 444 GTGGAGGTAG GTGTGA 16 16 base pairs nucleic acid double linear 445 CCTCCCCCAG AGCCGC 16 16 base pairs nucleic acid double linear 446 GTGACGGTGA GGCCCT 16 16 base pairs nucleic acid double linear 447 TCCCTTGCAG CCATCT 16 16 base pairs nucleic acid double linear 448 TGTGTGGTGA GCCAGC 16 16 base pairs nucleic acid double linear 449 TCTCTGGCAG AAATCA 16 16 base pairs nucleic acid double linear 450 TCACAGGTAA GGAGCC 16 16 base pairs nucleic acid double linear 451 TCCCTGCCAG GCATCG 16 16 base pairs nucleic acid double linear 452 CCGCCGGTGA GGGGCG 16 16 base pairs nucleic acid double linear 453 CTCTCCTCAG ATCCTG 16 16 base pairs nucleic acid double linear 454 GTACAGGTAG GACATC 16 16 base pairs nucleic acid double linear 455 TCCCTTTCAG GCCCTA 16

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US5474796 *May 27, 1993Dec 12, 1995Protogene Laboratories, Inc.Immobilization
US5639616 *Nov 18, 1994Jun 17, 1997Arch Development CorporationIsolated nucleic acid encoding a ubiquitous nuclear receptor
WO1995030774A1Apr 24, 1995Nov 16, 1995Beckman Instruments IncOligonucleotide repeat arrays
WO2001077327A1Jun 21, 2000Oct 18, 2001John P CarulliTHE HIGH BONE MASS GENE OF 11q13.3
Non-Patent Citations
Reference
1Davies, J. et al, "A genome-wide Search For Human Type 1 Diabetes Susceptibility Genes" Nature vol. 371, Sep. 8, 1994, pp. 130-136, XP002076215.
2 *Genabnk Alignments.*
3 *Genbank Accession No. AL022324, "Human DNA sequence from clone CTA-246H3 on chromosome 22". Dec. 1999.*
4Gong et al, 2001 "LDL Receptor Related Protein (LRP5) Affects Bone Accrual and Eye Development" Cell, vol. 107, pp. 513-523.
5Hillier, L. et al., "The WashU-Merck EST project, AC AA203279" EMBL Database, Jan. 30, 1997.
6Little et al, 2002 "A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait", Am. J. Hum. Genet 7-(1): pp. 11-19.
7Luo, D.: "Confirmation of three susceptibility genes to insulin-dependent diabetes mellitus: IDDM5, and IDDM8" Human Molecular Genetics, vol. 5, No. 5, 1996, pp. 693-698, XP02076216.
8 *Reiger. R. et al. Glossary of Genetics and Cytogenetics, Classical and Molecular, Fourth Edition, Springer-Verlag, Berlin Heidelberg, New York, pp. 16-19, 1976.*
9Ribozyme Pharm Inc.: "AC T52084" EMBL Database Mar. 24, 1997, XP002076213 Heidelberg.
10Todd, J. and Farrall, M.: "Panning for gold: genome-wide scanning for linkage in type 1 diabetes" Human Molecular Genetics, vol. 5, 1996, pp. 1443-1448, XP002076217.
11Todd, J. and Farrall, M.: "Panning for gold: genome-wide scanning for linkage in type 1 diabetes" Human Molecular Genetics, vol. 5, 1996, pp. 1443-1448, XP00202076217.
12Univ Leicester: "PCR primer WG2G4B, AC Q95283", EMBL Database, Feb. 9, 1996, XP002076212 Heidelberg.
13Van Der Zee, A. et al. Genomic cloning of the mouse LDL receptor related protein/alpha 2-macroglubulin receptor.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US6770461Apr 5, 2000Aug 3, 2004Genome Therapeutics CorporationHigh bone mass gene of 11q13.3
US6780609Apr 5, 2000Aug 24, 2004Genome Therapeutics CorporationHigh bone mass gene of 1.1q13.3
US7244577 *Dec 31, 2002Jul 17, 2007Merck & Co., Inc.Method of screening for modulator of LRP5 activity
US7285400Dec 10, 2003Oct 23, 2007Genome Therapeutics CorporationHigh bone mass gene of 11q13.3
US7416849May 13, 2002Aug 26, 2008Oscient Pharmaceuticals CorporationHBM variants that modulate bone mass and lipid levels
US7514594Oct 8, 2003Apr 7, 2009WyethSomatic and/or germ cells comprising a nucleic acid with promoter capable of directing protein expression; use in treating, diagnosing and preventing osteoporosis
Classifications
U.S. Classification536/23.1, 435/69.1, 536/23.5, 536/23.4, 536/24.3, 435/6.16
International ClassificationA61K38/00, A61K48/00, C12N15/09, A61P13/12, A61P19/10, A61P25/28, C12N15/12, A61K39/395, A61P31/12, A61P43/00, C12Q1/68, A61P37/02, A61P3/10, C07K16/28, A61P3/06, C07K14/705
Cooperative ClassificationC07K14/705, A61K48/00, A61K38/00
European ClassificationC07K14/705
Legal Events
DateCodeEventDescription
Aug 29, 2012ASAssignment
Effective date: 20120502
Free format text: CHANGE OF NAME;ASSIGNOR:SCHERING CORPORATION;REEL/FRAME:028866/0511
Owner name: MERCK SHARP & DOHME CORP., NEW JERSEY
Aug 27, 2012ASAssignment
Free format text: MERGER;ASSIGNOR:MERCK SHARP & DOHME CORP.;REEL/FRAME:028850/0515
Owner name: SCHERING CORPORATION, NEW JERSEY
Effective date: 20120426
Sep 22, 2010FPAYFee payment
Year of fee payment: 8
Jan 28, 2010ASAssignment
Owner name: MERCK SHARP & DOHME CORP., NEW JERSEY
Free format text: CHANGE OF NAME;ASSIGNOR:MERCK & CO., INC.;REEL/FRAME:023861/0349
Effective date: 20091102
Sep 26, 2006FPAYFee payment
Year of fee payment: 4
Feb 2, 2005ASAssignment
Owner name: MERCK & CO., INC., NEW JERSEY
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:THE WELLCOME TRUST LIMITED AS TRUSTEE FOR THE WELLCOME TRUST;REEL/FRAME:015629/0718
Effective date: 20030312
Owner name: MERCK & CO., INC. 126 EAST LINCOLN AVE. RY60-30RAH
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:THE WELLCOME TRUST LIMITED AS TRUSTEE FOR THE WELLCOME TRUST /AR;REEL/FRAME:015629/0718
Apr 1, 2003ASAssignment
Owner name: MERCK & CO., NEW JERSEY
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:CASKEY, C. THOMAS;GERHOLD, DAVID L.;HAMMOND, HOLLY A.;AND OTHERS;REEL/FRAME:013911/0052;SIGNING DATES FROM 20001004 TO 20001012
Owner name: WELLCOME TRUST LIMITED AS TRUSTEE FOR THE WELLCOME
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TODD, JOHN ANDREW;COX, ROGER DAVID;TWELLS, REBECCA CHRISTIAN JOAN;AND OTHERS;REEL/FRAME:013911/0062;SIGNING DATES FROM 20030131 TO 20030219
Owner name: MERCK & CO. 126 LINCOLN AVENUERAHWAY, NEW JERSEY,