Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberUS7285541 B2
Publication typeGrant
Application numberUS 10/646,391
Publication dateOct 23, 2007
Filing dateAug 21, 2003
Priority dateAug 21, 2002
Fee statusPaid
Also published asCA2494764A1, CA2494764C, DE60333839D1, EP1530636A1, EP1530636B1, US20040082534, WO2004018675A1
Publication number10646391, 646391, US 7285541 B2, US 7285541B2, US-B2-7285541, US7285541 B2, US7285541B2
InventorsMartin Gleave, Burkhard Jansen
Original AssigneeThe University Of British Columbia
Export CitationBiBTeX, EndNote, RefMan
External Links: USPTO, USPTO Assignment, Espacenet
Treatment of melanoma by reduction in clusterin levels
US 7285541 B2
Abstract
Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells is administered to the subject. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin. bcl-xL in a subject or cell line can also be regulated by administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis.
Images(2)
Previous page
Next page
Claims(12)
1. A method for treatment of melanoma in a mammalian subject, comprising the step of administering to the subject a therapeutic agent effective to reduce the amount of clusterin in the melanoma cells, wherein the therapeutic agent is an oligonucleotide that targets clusterin and that has a sequence complementary to clusterin-encoding mRNA.
2. The method of claim 1, wherein the therapeutic agent is an antisense oligodeoxynucleotide.
3. The method of claim 2, wherein the antisense oligodeoxynucleotide spans either the translation initiation site or the termination site.
4. The method of claim 3, wherein the antisense oligodeoxynucleotide is modified to enhance in vivo stability relative to an unmodified oligodeoxynucleotide of the same sequence.
5. The method of claim 4, wherein the modification is a 2′-0-(2-methoxyethyl) modification.
6. The method of claim 5, wherein the antisense oligodeoxynucleotide consists essentially of an oligodeoxynucleotide selected from the group consisting of Seq. ID. Nos. 2 to 12.
7. The method of claim 6, wherein the antisense oligodeoxynucleotide consists essentially of an oligodeoxynucleotide consisting of Seq. ID. No. 4.
8. The method of claim 7, wherein the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21, the “wings”, bear 2′-O-methoxyethyl modifications and the remaining nucleotides are 2′-deoxynucleotides.
9. The method of claim 2, wherein the antisense oligodeoxynucleotide consists essentially of an oligodeoxynucleotide selected from the group consisting of Seq. ID. Nos. 2 to 12.
10. The method of claim 9, wherein the antisense oligodeoxynucleotide consists essentially of an oligodeoxynucleotide consisting of Seq. ID. No. 4.
11. The method of claim 1 wherein the therapeutic agent is an RNA molecule effective to reduce the amount of clusterin in the melanoma cells by an RNAi mechanism.
12. The method of claim 11, wherein the RNA molecule consists essentially of an oligodeoxynucleotide selected from the group consisting of Seq. ID. Nos.20 to 25.
Description

This application claims the benefit and priority of U.S. Provisional Applications Nos. 60/405,193 filed Aug. 21, 2002, 60/408,152 filed Sep. 3, 2002, 60/319,748 filed Dec. 2, 2002, and 60/472,387, filed May 20, 2003 all of which are incorporated herein by reference.

BACKGROUND OF THE INVENTION

This application relates to antisense treatments for melanoma by inhibition of clusterin, also known as testosterone-repressed prostate message-2 (TRPM-2), for example by the administration of antisense oligonucleotides specific for clusterin.

Clusterin or TRPM-2 is a ubiquitous protein, with a diverse range of proposed activities. In prostate epithelial cells, expression of Clusterin increases immediately following castration, reaching peak levels in rat prostate cells at 3 to 4 days post castration, coincident with the onset of massive cell death. These results have led some researchers to the conclusion that clusterin is a marker for cell death, and a promoter of apoptosis. On the other hand, the observation that Sertoli cells and some epithelial cells express high levels of clusterin without increased levels of cell death, raises questions as to whether this conclusion is correct. Sensibar et al., Cancer Research 55: 2431-2437 (1995) reported on in vitro experiments performed to more clearly elucidate the role of clusterin in prostatic cell death. They utilized LNCaP cells transfected with a gene encoding clusterin and observed whether expression of this protein altered the effects of tumor necrosis factor α (TNFα), to which LNCaP cells are very sensitive, with cell death normally occurring within about 12 hours. Treatment of the transfected LNCaP cells with TNFα was shown to result in a transient increase in clusterin levels for a period of a few hours, but these levels had dissipated by the time DNA fragmentation preceding cell death was observed. Using an antisense molecule corresponding to the bases 1-21 of the clusterin sequence, but not other clusterin antisense oligonucleotides, resulted in a substantial reduction in expression of clusterin, and an increase in apoptotic cell death in LNCaP cells exposed to TNFα. This led Sensibar et al. to the hypothesis that overexpression of clusterin could protect cells from the cytotoxic effect of TNF, and that clusterin depletion is responsible for the onset of cell death, although the mechanism of action remains unclear.

PCT Publication WO00/049937, which is incorporated herein by reference in all jurisdictions permitting such incorporation, describes the use of antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer of prostate cancer, renal cell cancer and some breast cancers. Furthermore, combined use of antisense clusterin plus cytotoxic chemotherapy (e.g. taxanes) synergistically enhances chemosensitivity in hormone refractory prostate cancer. Radiation sensitivity is also enhanced when cells expressing clusterin are treated with antisense clusterin oligodeoxynucleotides (ODN).

SUMMARY OF THE INVENTION

The present application relates to the treatment of melanoma through reduction in the effective amount of clusterin. Thus, in accordance with one aspect of the invention, there is provided a method for treatment of melanoma in a mammalian subject, preferably a human, comprising the step of administering to the subject a therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells. The therapeutic agent may be, for example, an antisense ODN or small inhibitory RNA (siRNA) compound targeted to clusterin.

The present invention also provides a method for regulating expression of bcl-xL in a subject or cell line comprising administering to the subject or cell line an agent effective to modulate the amount of clusterin expression. In particular, in clusterin expressing cells, the expression of bcl-xL is down-regulated when the effective amount of clusterin is reduced. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis. See for example U.S. Pat. No. 6,172,216 which is incorporated herein by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the results when 607B melanoma cells were treated with either the antisense oligonucleotide at concentrations of 100, 250 or 500 nM, or a scrambled mismatch control at a concentration of 100 nM on two consecutive days.

FIG. 2 provides a graphic representations of clusterin expression in 518A2 cells after treatment with cisplatin and either an antisense oligonucleotide or a scrambled, mismatch control.

FIG. 3 shows cell survival of Mel Juso melanoma cells stably transfected with either an empty control vector (Neo) or a vector directing overexpression of clusterin were grown in medium containing 10 μM cisplatin.

DESCRIPTION OF THE INVENTION

As used in the specification and claims of this application, the term “clusterin” refers to the glycoprotein originally derived from rat testes, and to homologous proteins derived from other mammalian species, including humans, whether denominated as clusterin or an alternative name. The sequences of numerous clusterin species are known. For example, the sequence of human clusterin is reported by Wong et al., Eur. J. Biochem. 221 (3), 917-925 (1994), and in NCBI sequence accession number NM001831 and is set forth in the Sequence Listing as Seq. ID. No. 1. In this sequence, the coding sequence spans bases 48 to 1397.

The present invention provides a therapeutic composition, and methods for using such a composition for treatment of melanoma, particularly in humans. The therapeutic compositions and methods of the invention achieve a reduction in the effective amount of clusterin present in the individual being treated. As used in this application, the “effective amount of clusterin” is the amount of clusterin which is present in a form which is functional to provide anti-apoptotic protection. The effective amount of clusterin may be reduced by decreasing the expression rate of clusterin, increasing the rate of clusterin degradation, or by modifying clusterin (for example by binding with an antibody) such that it is rendered inactive.

Antisense ODN Therapeutics

In one embodiment of the invention, reduction in the effective amount of clusterin may be accomplished by the administration of antisense ODNs, particularly antisense ODNs which are complementary to a region of the clusterin mRNA spanning either the translation initiation site or the termination site. Exemplary sequences which can be employed as antisense molecules in the method of the invention are disclosed in PCT Patent Publication WO 00/49937, US Patent Publication US-2002-0128220-A1, and U.S. Pat. No. 6,383,808, all of which are incorporated herein by reference in those jurisdictions where such incorporation is permitted. Specific antisense sequences are set forth in the present application as Seq. ID Nos.: 2 to 12.

The ODNs employed may be modified to increase the stability of the ODN in vivo. For example, the ODNs may be employed as phosphorothioate derivatives (replacement of a non-bridging phosphoryl oxygen atoms with a sulfur atom) which have increased resistance to nuclease digestion. MOE (2′-O-(2-methoxyethyl) modification (ISIS backbone) is also effective. Construction of such modified ODN is described in detail in U.S. patent application Ser. No. 10/080,794 which is incorporated herein by reference in those jurisdictions permitting such incorporation. A particularly preferred composition is a 21mer oligonucleotide (cagcagcagagtcttcatcat; SEQ ID NO: 4) targeted to the translation initiation codon and next 6 codons of the human clusterin sequence (Genbank accession no: NM001831) with a 2′-MOE modification. This oligonucleotide has a phosphorothioate backbone throughout. The sugar moieties of nucleotides 1-4 and 18-21 (the “wings”) bear 2′-O-methoxyethyl modifications and the remaining nucleotides (nucleotides 5-17; the “deoxy gap”) are 2′-deoxynucleotides. Cytosines in the wings (i.e., nucleotides 1, 4 and 19) are 5-methylcytosines.

Administration of antisense ODNs can be carried out using the various mechanisms known in the art, including naked administration and administration in pharmaceutically acceptable lipid carriers. For example, lipid carriers for antisense delivery are disclosed in U.S. Pat. Nos. 5,855,911 and 5,417,978 which are incorporated herein by reference. In general, the antisense is administered by intravenous, intraperitoneal, subcutaneous or oral routes, or direct local tumor injection.

The amount of antisense ODN administered is one effective to inhibit the expression of Clusterin in melanoma cells. It will be appreciated that this amount will vary both with the effectiveness of the antisense ODN employed, and with the nature of any carrier used. The determination of appropriate amounts for any given composition is within the skill in the art, through standard series of tests designed to assess appropriate therapeutic levels.

RNAi Therapeutics

Reduction in the effective amount of clusterin can also be achieved using RNAi therapy. RNA interference or “RNAi” is a term initially coined by Fire and co-workers to describe the observation that double-stranded RNA (dsRNA) can block gene expression when it is introduced into worms (Fire et al. (1998) Nature 391, 806-811, incorporated herein by reference). dsRNA directs gene-specific, post-transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function. RNAi involves mRNA degradation, but many of the biochemical mechanisms underlying this interference are unknown. The use of RNAi has been further described in Carthew et al. (2001) Current Opinions in Cell Biology 13, 244-248, and Elbashir et al. (2001) Nature 411, 494-498, both of which are incorporated herein by reference.

In the present invention, isolated RNA molecules mediate RNAi. That is, the isolated RNA molecules of the present invention mediate degradation or block expression of mRNA that is the transcriptional product of the gene, which is also referred to as a target gene. For convenience, such mRNA may also be referred to herein as mRNA to be degraded. The terms RNA, RNA molecule(s), RNA segment(s) and RNA fragment(s) may be used interchangeably to refer to RNA that mediates RNA interference. These terms include double-stranded RNA, single-stranded RNA, isolated RNA (partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA), as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the RNA or internally (at one or more nucleotides of the RNA). Nucleotides in the RNA molecules of the present invention can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. Collectively, all such altered RNAi molecules are referred to as analogs or analogs of naturally-occurring RNA. RNA of the present invention need only be sufficiently similar to natural RNA that it has the ability to mediate RNAi. As used herein the phrase “mediate RNAi” refers to and indicates the ability to distinguish which mRNA are to be affected by the RNAi machinery or process. RNA that mediates RNAi interacts with the RNAi machinery such that it directs the machinery to degrade particular mRNAs or to otherwise reduce the expression of the target protein. In one embodiment, the present invention relates to RNA molecules that direct cleavage of specific mRNA to which their sequence corresponds. It is not necessary that there be perfect correspondence of the sequences, but the correspondence must be sufficient to enable the RNA to direct RNAi inhibition by cleavage or blocking expression of the target mRNA.

As noted above, the RNA molecules of the present invention in general comprise an RNA portion and some additional portion, for example a deoxyribonucleotide portion. The total number of nucleotides in the RNA molecule is suitably less than 49 in order to be effective mediators of RNAi. In preferred RNA molecules, the number of nucleotides is 16 to 29, more preferably 18 to 23, and most preferably 21-23. Suitable sequences are set forth in the present application as Seq. ID Nos. 20 to 43.

The siRNA molecules of the invention are used in therapy to treat patients, including human patients, that have cancers or other diseases of a type where a therapeutic benefit is obtained by the inhibition of expression of the targeted protein. siRNA molecules of the invention are administered to patients by one or more daily injections (intravenous, subcutaneous or intrathecal) or by continuous intravenous or intrathecal administration for one or more treatment cycles to reach plasma and tissue concentrations suitable for the regulation of the targeted mRNA and protein.

Additional Therapeutic Agents

The method for treating melanoma in accordance with the invention may further include administration of chemotherapy agents or other agents useful in melanoma therapy and/or additional antisense ODNs directed at different targets in combination with the therapeutic effective to reduce the amount of active clusterin. For example, antisense clusterin ODN increases sensitivity to conventional chemotherapy agents as taxanes (paclitaxel or docetaxel), mitoxanthrone, and gemcitabine. Other agents likely to show synergistic activity include other cytotoxic agents (e.g. cyclophosphamide, decarbazine, topoisomerase inhibitors), angiogenesis inhibitors, differentiation agents and signal transduction inhibitors. Similarly, combinations of clusterin antisense with other antisense species such as antisense Bcl-2, Bcl-xl and c-myc ODN to provide greater effectiveness.

Method of Regulating Bcl-xL Expression

While chaperone-like function has been proposed for the clusterin protein, the specific molecular mechanism responsible for clusterin's role in apoptosis remains elusive. In the human melanoma cell line that expressed clusterin at a very low levels, over-expression of clusterin by stable transfection not only led to a marked increase in resistance to a cytotoxic treatment (FIG. 3), but led also to an up-regulation of the anti-apoptotic bcl-2 family member bcl-xL as shown by Western blotting. Conversely treatment of clusterin-expressing melanoma cells led to a marked down-regulation of bcl-xL thus providing a possible mechanism for the antiapoptotic potency of clusterin. Neither clusterin overexpression by transfection nor clusterin antisense treatment altered the expression of other Bcl-2 family members tested in human melanoma cells. Thus, clusterin regulates the anti-apoptotic bcl-2 family member bcl-xL. Such inhibition is significant because bcl-xL is known to act as an inhibitor of apoptosis (See U.S. Pat. No. 6,182,216 which is incorporated herein by reference in those jurisdictions permitting such incorporation).

The invention will now be further described with reference to the following, non-limiting examples.

EXAMPLE 1

Expression of clusterin in two different batches of normal human melanocytes (NHEM 6083 and 2489) and four human melanoma cell lines (518A2, SKMEL-28, Mel-Juso and 607B). Cells were grown in 6 cm dishes and harvested when they were 80-90% confluent. 30 μg of protein per lane was applied onto a 10% SDS-Page gel and probed with a polyclonal goat anti-clusterin antibody. Panceau red stain and an antibody directed against β-actin were used as a loading control. In each case, the antisense inhibitor of clusterin used is based on the advanced antisense chemistry 2′MOE as described in U.S. patent application Ser. No. 10/080,794 and has the sequence of Seq. ID. NO. 4.

FIG. 1 shows the results when 607B melanoma cells were treated with either the antisense oligonucleotide at concentrations of 100, 250 or 500 nM, or a scrambled control at a concentration of 100 nM on two consecutive days. Lipofectin™ (lip) without oligonucleotide was used as a control. Cells numbers in 96 well plates were measured photometrically using MTS (Cell Titer 96™, Pierce). As shown, cell counts in the presence of antisense treated wells at 250 and 500 nM are significantly reduced.

FIG. 2 provides a graphic representations of clusterin expression in 518A2 cells after treatment with cisplatin and either an antisense oligonucleotide or a scrambled control. Lip is a Lipofectin control without oligonucleotide. Detection was performed using an antibody directed against clusterin.

The results in showed that in human melanoma cells clusterin is expressed at significantly higher levels than in human melanocytes in all but one cell line tested. The antisense inhibitor (MOE modification of Seq. ID. NO. 4) led to a dose dependent down-regulation of clusterin as shown by RT-PCR on the mRNA level and by western-blot on the protein level as compared to the scrambled mismatch control. This down-regulation led to an increase in apoptotic cell death by antisense treatment alone. In one melanoma cell line (607B) this alone was sufficient to lead to complete cell death. (FIG. 1) In another melanoma cell line the surviving cells showed increased sensitivity to an consecutive treatment with the cytotoxic drug cisplatin as compared to cells treated with a control-mismatch oligonucleotide (FIG. 2).

EXAMPLE 2

Mel Juso melanoma cells stably tranfected with either an empty control vector (Neo) or a vector directing overepression of clusterin were grown in medium containing 10 μM cisplatin. Cell survival was measured using the Cell-titer 96 kits from Promega. The results are summarized in FIG. 3. As shown, overexpression of clusterin dramatically enhanced cell survival, or said differently, reduced the effectiveness of the chemotherapy agent.

Patent Citations
Cited PatentFiling datePublication dateApplicantTitle
US5646042Jan 13, 1995Jul 8, 1997Ribozyme Pharmaceuticals, Inc.C-myb targeted ribozymes
US5789389Mar 17, 1995Aug 4, 1998Board Of Trustees Of University Of IllinoisBCL2 derived genetic elements associated with sensitivity to chemotherapeutic drugs
US5801154 *Apr 8, 1997Sep 1, 1998Isis Pharmaceuticals, Inc.Antisense oligonucleotide modulation of multidrug resistance-associated protein
US5929040Jul 6, 1995Jul 27, 1999Royal Children's Hospital Research FoundationMethod for the prophylaxis and/or treatment of proliferative and/or inflammatory skin disorders
US5998148Apr 8, 1999Dec 7, 1999Isis Pharmaceuticals Inc.Antisense modulation of microtubule-associated protein 4 expression
US6111094 *Apr 17, 1998Aug 29, 2000Isis Pharmaceuticals Inc.Enhanced antisense modulation of ICAM-1
US6172216Oct 7, 1998Jan 9, 2001Isis Pharmaceuticals Inc.Antisense modulation of BCL-X expression
US6335194Feb 2, 2000Jan 1, 2002Isis Pharmaceuticals, Inc.Antisense modulation of survivin expression
US6383808Sep 11, 2000May 7, 2002Isis Pharmaceuticals, Inc.Antisense inhibition of clusterin expression
US20020128220 *Aug 30, 2001Sep 12, 2002Martin GleaveTRPM-2 antisense therapy
US20030158130Sep 28, 2001Aug 21, 2003Martin GleaveChemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides
US20040053874 *Sep 10, 2001Mar 18, 2004Monia Brett P.Antisense modulation of clusterin expression
US20040220131 *Apr 19, 2004Nov 4, 2004The University Of British ColumbiaMethod for treatment of cancerous angiogenic disorders
WO1999051259A2 *Apr 2, 1999Oct 14, 1999University Of Iowa Research FoundationMethods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
WO2000034469A1Dec 10, 1999Jun 15, 2000The Research Foundation Of State University Of New York At AlbanyCompositions and methods for altering cell migration
WO2000049937A2 *Feb 25, 2000Aug 31, 2000The University Of British ColumbiaTrpm-2 antisense therapy
WO2001046455A2Dec 21, 2000Jun 28, 2001Yale UniversitySurvivin promotion of angiogenesis
WO2002022635A1Sep 10, 2001Mar 21, 2002Isis Pharmaceuticals, Inc.Antisense modulation of clusterin expression
WO2003062421A1Jan 17, 2003Jul 31, 2003The University Of British ColumbiaBispecific antisense olignucleotides that inhibit igfbp-2 and igfbp-5 and methods of using same
WO2003072591A1Feb 20, 2003Sep 4, 2003The University Of British ColumbiaTrpm-2 antisense therapy using an oligonucleotide having 2'-o-(2-methoxyl)ethyl modifications
WO2004018675A1Aug 21, 2003Mar 4, 2004The University Of British ColumbiaTreatment of melanoma by reduction in clusterin levels
WO2004018676A2Aug 21, 2003Mar 4, 2004The University Of British ColumbiaRnai probes targeting cancer-related proteins
Non-Patent Citations
Reference
1Agrawal et al., Antisense Therapeutics: is it as simple as complementary base recognition, Molecular Medicine Today, 2000, pp. 72-81, vol. 6, Publisher: Elsevier Science Ltd.
2Andrea D. Branch, A good antisense molecule is hard to find, TIBS, 1998, pp. 45-50, Publisher: Elsevier Science Ltd.
3Aoki et al., RNA Intereference may be more potent than antisense RNA in human cancer cell lines, Clinical and Experimental Pharmacology and Physiology, 2003, pp. 96-102.
4 *Aoki et al., RNA Interference May be More Potent Than Antisense RNA in Human Cancer Cell Lines, 2003, Clinical and Experimental Pharmacology and Physiology, 30, pp. 96-102.
5Benner et al., Combination of Antisense Oligonucleotide and Low-Dose Chemotherapy in Hematological Malignancies, Journal of Pharmacological and Toxicological Methods, 1997, pp. 229-235, Publisher: Elsevier Science Inc.
6Boral et al., Clinical evaluation of biologically targeted drugs: obstacles and opportunities, Cancer Chemother Pharmacol, 1998, pp. S3-S21, Publisher: Springer-Verlag.
7 *Branch, A good antisense molecule is hard to find, TIBS, Feb. 1998, pp. 45-50.
8Bruchovsky et al., Control of Tumor Progression by Maintenance of Apoptosis, www.prostatepointers.org, 1996, Publisher: Wiley-Liss, Inc.
9Buttyan et al., Induction of the TRPM-2 Gene in Cells Undergoing Programmed Death, Molecular and Cellular Biology, 1989, pp. 3473-3481, vol. 9, No. 8, Publisher: American Society for Microbiology.
10Cox et al., Angiogenesis and non-small cell lung cancer, Lung Cancer, 2000, pp. 81-100, Publisher: Elsevier.
11Crooke et al., Basic principles of antisense therapeutics, Antisense Research and Application, 2004, pp. 1-50, Chapter 1, Publisher: Springer.
12 *Crooke, Antisense Research and Application, Chapter 1, Springer-Verlag, New York, 1998.
13Darby et al., Vascular Expression of Clusterin in Experimental Cyclosporine Nephrotoxicity, Exp Nephrol, 1995, pp. 234-239, Publisher: S. Karger AG.
14Diemer et al., Expression of Porcine Complement Cytolysis Inhibitor mRNA in Cultured Aortic Smooth Muscle Cells, The Journal of Biological Chemistry, Mar. 15, 1992, pp. 5257-5264, vol. 207, No. 8, Publisher: The AMerican Society for Biochemistry and Molecular Biology, Inc.
15Genta, New Data Realfirm Genta's Molecular Target as Critical Factor for Enhancing Anticancer Treatment, www.genta.com, 2001.
16Gleave et al., Antisense Targets to Enhance Hormone and Cytotoxic Therapies in Advanced Prostate Cancer, Current Drug Targets, 2003, pp. 209-221, vol. 4, XP-009021409.
17Gleave et al., Antisense therapy: Current status in prostate cancer and other malignancies, Cancer and Metastasis Reviews, 2002, pp. 79-92, vol. 21.
18Gleave et al., Targeting anti-apoptotic genes upregulated by androgen withdrawal using antisense oligonucleotides to enhance androgen- and chemo-sensitivity in prostate cancer, Investigational New Drugs, 2002, pp. 145-158, vol. 20.
19Gleave et al., Use of Antisense Oligonucleotides Targeting the Antiapoptotic Gene, Clusterin/Testosterone-Repressed Prostate Message 2, To Enhance Androgen Sensitivity and Chemosensitivity in Prostate Cancer, Urology, 2001, pp. 39-49, vol. 58, XP-002262320.
20 *Green et al., Antisense Oligonucleotides: An Evolving Technology for the Modulation of Gene Expression in Human Disease, J Am Coll Surg, Jul. 2000, vol. 191, No. 1, pp. 93-105.
21Jen et al., Suppression of Gene Expression by Targeted Disruption of Messenger RNA: Available Options and Current Strategies, Stem Cells 2000, 2000, pp. 307-319, vol. 18.
22 *Jen et al., Suppression of Gene Expression by Targeted Disruption of Messenger RNA: Available Options and Current Strategies, Stem Cells, 2000, 18:307-319.
23Jones et al., Molecules in focus: Clusterin, The International Journal of Biochemistry & Cell Biology, 2002, pp. 427-431, vol. 34.
24Kadomatsu et al., Expression of sulfated glycoprotein 2 is associated with carcinogenesis induced by N-nitroso-N-methylurea in rat prostate . . . , Cancer Res, Apr. 1, 1993, pp. 1480-1483, vol. 53, No. 7, abstract only.
25Kirby et al, Bartonella-associated endothelial proliferation depends on inhibition of apoptosis, PNAS, Apr. 2, 2002, pp. 4656-4661, vol. 99, No. 7.
26Kyprianou et al., bcl-2 over-expression delays radiation-induced apoptosis without affecting the clonogenic survival of human prostate , International Journal of Cancer, Jan. 27, 1997, pp. 341-348, vol. 70, No. 3, abstract only.
27Lee et al., In Vitro Models of Prostate Apoptosis: Clusterin as an Antiapoptotic Mediator, The Prostate Supplement, 2000, pp. 21-24, vol. 9, Publisher: Wiley-Liss, Inc.
28Millar et al., Localization of mRNAs by in-situ hybridization to the residual body at stages IX-X of the cycle of the rat seminiferous , International Journal of Andrology, 1994, pp. 149-160, vol. 17.
29Millis et al., Clusterin Regulates Vascular Smooth Muscle Cell Nodule Formation and Migration, Journal of Cellular Physiology, 2001, pp. 210-219, vol. 186, Publisher: Wiley-Liss, Inc.
30Milner et al., Selecting effective antisense reagents on combinatorial oligonucleotide arrays, Nature Biotechnology, 1997, pp. 537-541, vol. 15.
31Miyake et al., Antisense TRPM-2 Oligodeoxynucleotides Chemosensitize Human Androgen-independent PC-3 Prostate Cancer Cells Both in Vitro and in Vivo, Clinical Cancer Research, 2000, pp. 1655-1663, vol. 6, XP-000960694.
32Miyake et al., Novel therapeutic strategy for advanced prostate cancer using antisense oligodeoxynucleotides targeting antiapoptotic genes upregulated after androgen withdrawal to delay androgen-independent progression and enhance chemosensitivity, International Journal of Urology, 2001 , pp. 337-349, vol. 8, XP-002262321.
33Miyake et al., Synergistic Chemsensitization and Inhibition of Tumor Growth and Metastasis by the Antisense Oligodeoxynucleotide Targeting Clusterin Gene in a Human Bladder Cancer Model, Clinical Cancer Research, 2001, pp. 4245-4252, vol. 7, XP-002263075.
34Miyake et al., Testosterone-repressed Prostate Message-2 Is an Antiapoptotic Gene Involved in Progression to Androgen Independence in Prostate Cancer, Cancer Research, 2000, pp. 170-176, vol. 60, XP-002907064.
35Nör et al., Engineering and Characterization of Functional Human Microvessels in Immunodeficient Mice, Laboratory Investigation, 2001, pp. 453-463, vol. 81, No. 4.
36Nör et al., Up-Regulation of Bcl-2 in Microvascular Endothelial Cells Enhances Intratumoral Angiogenesis and Accelerates Tumor Growth, Mar. 1, 2001, pp. 2183-2188, vol. 61.
37Opalinska et al., Nucleic-acid therapeutics: Basic principles and recent applications, Nature Reviews, 2002, pp. 503-514, vol. 1.
38Rosenberg et al., Clusterin: Physiologic and Pathophysiologic Considerations, Int. J. Biochem. Cell Biol., 1995, pp. 633-645, vol. 27, No. 7, XP-001002844.
39 *Saijo et al., Pharmokinetics, Tissue Distribution, and Stability of Anitisense Oligodeoxynucleotide Phosphorothioate ISIS 3466 in Mice, 1994, Oncology Research, vol. 6, No. 6, pp. 243-249.
40Sensibar et al., Prevention of Cell Death Induced by Tumor Necrosis Factor a in LNCaP Cells by Overexpression of Sulfated Glycoprotein-2 (Clusterin) , Cancer Research, 1995, pp. 2431-2437, vol. 55, XP-002930082.
41Steven Brem, MD, Angiogenesis and Cancer Control: From Concept to Therapeutic Trial, Cancer Control Journal, 1999, vol. 6, No. 5, Publisher: H. Lee Moffitt Cancer Center & Research Institute.
42Tran et al., A role for survivin in chemoresistance of endothelial cells mediated by VEGF, PNAS, Apr. 2, 2002, pp. 4349-4354, vol. 99, No. 7.
43Trougakos et al., Silencing Expression of the Clusterin/Apolipoprotein J Gene in Human Cancer Cells Using Small Interfering RNA Induces, Cancer Research, Mar. 1, 2004, pp. 1834-1842, vol. 64.
44Vickers et al., Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents, The Journal of Biological Chemistry, Feb. 28, 2003, pp. 7103-7118, vol. 278, No. 9.
45Wilson et al., Clusterin is a secreted mammalian chaperone, TIBS, 2000, pp. 95-97, vol. 25.
46Wong et al., Molecular characterization of human TRPM-2/clusterin, a gene associated with sperm maturation, apoptosis and neurodegeneration, Eur. J. Biochem, 1994, pp. 917-925, vol. 91, XP-001146404.
47Wright et al., A ribonucleotide reductase inhibitor, MDL 101,731, induces apoptosis and elevates TRPM-2 mRNA levels in human prostate , Experimental Cell Research, Jan. 10, 1996, pp. 54-60, vol. 222, No. 1, abstract only.
48Yang et al., Nuclear clusterin/XIP8, an x-ray-induced Ku70-binding protein that signals cell death, PNAS, May 23, 2000, pp. 5907-5912, vol. 97, No. 11.
49Zangemeister-Wittke et al., A Novel Bispecific Antisense Oligonucleotide Inhibiting Both bcl-2 and bcl-xL Expression Efficiently Induces Apoptosis in Tumor Cells, Clinical Cancer Research, 2000, pp. 2547-2555, Volumbe 6, XP-002241562.
50Zellweger et al., Antitumor Activity of Antisense Clusterin Oligonucleotides is Improved in Vitro and in Vivo by Incorporation of 2'O'(2-Methoxy)Ethyl Chemistry, The Journal of Pharmacology and Experimental Therapeutics, 2001, pp. 934-940, vol. 298, No. 3, XP-002262318.
51Zellweger et al., Chemosensitization of Human Renal Cell Cancer Using Antisense Oligonucleotides Targeting the Antiapoptotic Gene Clusterin, Neoplasia, 2001, pp. 360-367, XP-009004604.
52Zwain et al., Clusterin Protects Granulosa Cells from Apoptotic Cell Death during Follicular Atresia, Experimental Cell Research, 2000, pp. 101-110, vol. 257, Publisher: Academic Press.
Referenced by
Citing PatentFiling datePublication dateApplicantTitle
US8044179Sep 13, 2006Oct 25, 2011National Research Council Of CanadaMethods and compositions for modulating tumor cell activity
US8173615Apr 5, 2010May 8, 2012Teva Pharmaceuticals Industries, Ltd.TRPM-2 antisense therapy
US8361981Apr 29, 2009Jan 29, 2013The University Of British ColumbiaChemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides
US8426562Jul 29, 2010Apr 23, 2013National Research Council Of CanadaMethods and compositions for modulating tumor cell activity
US8536149May 4, 2012Sep 17, 2013Teva Pharmaceutical Industries Ltd.TRPM-2 antisense therapy
US8710020Apr 4, 2005Apr 29, 2014The University Of British ColumbiaClusterin antisense therapy for treatment of cancer
US8802826Nov 24, 2010Aug 12, 2014Alethia Biotherapeutics Inc.Anti-clusterin antibodies and antigen binding fragments and their use to reduce tumor volume
US9095602Jan 9, 2013Aug 4, 2015The University Of British ColumbiaChemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides
US9200285Apr 8, 2014Dec 1, 2015The University Of British ColumbiaClusterin antisense therapy for treatment of cancer
US9359606Mar 12, 2014Jun 7, 2016Oncogenex Technologies Inc.Anti-clusterin monotherapy for cancer treatment
US9457045Mar 12, 2012Oct 4, 2016The University Of British ColumbiaCombination of anti-clusterin oligonucleotide with Hsp90 inhibitor for the treatment of prostate cancer
US9487777 *Feb 24, 2012Nov 8, 2016The University Of British ColumbiaRNAi probes targeting cancer-related proteins
US9512211Jun 23, 2014Dec 6, 2016Alethia Biotherapeutics Inc.Anti-clusterin antibodies and antigen binding fragments and their use to reduce tumor volume
US20080119425 *Apr 4, 2005May 22, 2008The University Of British ColumbiaClusterin Antisense Therapy for Treatment of Cancer
US20110033471 *Jul 29, 2010Feb 10, 2011National Research Council Of CanadaMethods and compositions for modulating tumor cell activity
US20110142827 *Sep 20, 2010Jun 16, 2011The University Of British ColumbiaTreatment of cancer with a combination of an agent that perturbs the egf signaling pathway and an oligonucleotide that reduces clusterin levels
WO2014159775A1 *Mar 12, 2014Oct 2, 2014Teva Pharmaceutical Industries Ltd.Anti-clusterin monotherapy for cancer treatment
Classifications
U.S. Classification514/44.00A, 536/24.5, 536/23.1
International ClassificationA61K38/00, C12N15/113, C07H21/04, A61K48/00, C07H21/02, A61K31/712
Cooperative ClassificationC12N2310/341, C12N2310/346, A61K38/00, A61K31/712, C12N2310/315, C12N2310/321, C12N15/113
European ClassificationC12N15/113, A61K31/712
Legal Events
DateCodeEventDescription
Dec 4, 2003ASAssignment
Owner name: THE UNIVERSITY OF BRITISH COLUMBIA, CANADA
Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:GLEAVE, MARTIN;JANSEN, BURKHARD;REEL/FRAME:014171/0966;SIGNING DATES FROM 20030926 TO 20030929
Apr 15, 2011FPAYFee payment
Year of fee payment: 4
Jun 14, 2011SULPSurcharge for late payment
Apr 16, 2015FPAYFee payment
Year of fee payment: 8