WO1987002984A1 - Biogenetic cassette - Google Patents

Abstract

A method for genetically engineering microbial strains which produce amino acids and other specialty chemicals comprising the molecular cloning of DNA chromosome fragments of the total genes involved in the biosynthesis of said chemicals and by genetic engineering, and/or mutation, removal of all biochemical and genetic regulation controlling the synthesis of such chemicals. Use may be made of a vector DNA molecule capable of providing amplification of the hybrid DNA construct containing the genes required for the biosynthesis of said chemicals. The resulting hybrid DNA molecule or biogenetic cassette is useful for transforming cells of an appropriate recipient strain capable of increased productivity of said chemicals. Also disclosed is a method of making a biogenetic cassette for catabolic pathways, including methanol utilization. Combination biogenetic cassettes, permitting, for example, the biosynthesis of a particular amino acid using methanol as a feedstock are also disclosed.

Description

BIOGENETIC CASSETTE Background of the Invention The present invention relates to the biotechnology industry and, more specifically, it relates to a method for preparing strains which produce excess quantities of amino acids or other chemicals, and for preparing strains which can metabolize such unconventional feedstocks as methanol.

Amino acids produced by microorganisms find extensive use as feedstuff and food additives in the agriculture and food industry, as components of various nutrient mixtures for medical purposes and as reagents in the chemical and pharmaceutical industries.

Methods are known for preparing strains which produce amino acids such as L-lysine, L-threonine, L-isoleucine and the like by using various mutagens, such as ultraviolet light, ionizing radiation, and chemical mutagens. The resulting mutant strains of microorganisms have specific genetically preconditioned defects in regulating metabolism and, due to such defects, they secrete specific amino acids into the nutrient medium.

These mutant strains of microorganisms are identified and isolated by conventional methods based on the particular nutritive demand of a mutant (auxotrophy) or on resistance of a mutant to a structural analog of an amino acid that inhibits the growth of the parental strain (cf. British

Pat. Nos. 1,258,380; 1,186,988; 1,316,888; Japanese Pat.

No. 51-6237).

A method is also known for preparing mutants which produce amino acids on the basis of simultaneous resistance against an antimetabolite (such as an amino acid analog) and a co-inhibitor (a particular amino acid);

(cf. U.S. Patent No. 3,756,916).

In all the above-mentioned cases , mutant strains capable of producing amino acids are prepared by single or step-by-step induction of mutations in the genetic structure (genome) of a parental strain evolving the amino acid.

Also known are methods for constructing strains which produce amino acids comprising combining: (a) DNA chromosome fragments containing gene(s) controlling the synthesis of a selected amino acid and having a mutation conferring resistance to an amino acid analog destroying the negative regulation of the synthesis of this amino acid, with (b) a vector DNA molecule, to form a hybrid DNA molecule, capable of providing amplification of the presumed gene and therefore increased resistance to the amino acid analog resulting in increased secretion of the amino acid into the nutrient medium. These methods are based on random "shotgun cloning" of previously selected mutations, lacking defined insertion in an exact genomic configuration of genes involved in the biosynthesis of the amino acid, into a vector DNA molecule and amplification of this recombinant DNA molecule in contrast to directed methods for the purposeful cloning of the mutant gene. Most genetically engineered products are manufactured using glucose as the primary carbon source. Citric acid, penicillin, and ascorbic acid are just a few examples of microbially produced products using glucose as a feedstock. Glucose, however, is a relatively expensive feedstock.

In many instances, a major operating cost of production is that of the carbon source required. For example, microbially produced biopolymers, used as thickeners in the food and cosmetic industries or to enhance oil recovery, are currently produced using glucose as the major carbon source. Microbially produced biopolymers may also replace certain synthetic plastics in the near future. The competitiveness of these biomaterials is, to a large extent, dependent on the cost of the carbon source utilized. Methanol represents an alternative to glucose as a carbon source for microorganisms. Glucose sold in the United States is presently several times as expensive as methanol on a per pound basis. There is currently a billion gallon per year surplus capacity for producing methanol in the world. This surplus could grow to over two billion gallons per year in the near future. Although methanol can be made from crude oil, it is most easily made from natural gas and coal. As a feedstock, methanol is readily available, inexpensive, and likely to have greater long-term price stability than feedstocks based on crude oil. Many chemical manufacturers, in recognition of the competitive advantages of methanol as a feedstock, have developed new production facilities using it as the major source of carbon in many chemical processes.

Methylotrophic bacteria and yeasts, microorganisms which can obtain energy and carbon for growth frommethanol, exist in nature and have been commercially exploited. For example, industrial-scale conversion of methanol to single-cell protein, to be used as a replacement for fishmeal and soybean meal in poultry feedstuffs, has already begun. This process uses a hexulose pathway organism, Methylophilus methylotrophus. Unfortunately, expression of hexulose pathway genes in E . coli has, to date, proved impossible. Nevertheless, the potential importance of methanol in commercial production is readily apparent.

Methanol has a host of properties that make it an ideal candidate as a feedstock for biotechnology fermentation processes. Methanol is extremely soluble in water. This eliminates the phase transfer problem associated with hydrocarbons. Unlike methane, methanol is not associated with a high risk of explosion. Methanol is readily purified. The metabolism of methanol by microorganisms requires less oxygen and generates less heat than does the metabolism of methane. Accordingly, it is an object of the present invention to make possible the creation of organisms by genetic engineering techniques that have the ability to utilize methanol as a carbon source. Another object of the present invention is to provide a means whereby the methanol utilization ability of an engineered organism can readily be transferred to another organism.

Another object of the present invention is the creation of a biogenetic cassette for an unregulated biosynthetic pathway, such as amino acid biosynthesis.

Yet another object of the present invention is the creation of a combined biogenetic cassette for methanol utilization and amino acid biosynthesis.

In the context of the description of the present invention, the following expressions and terms are used:

The term "DNA" means deoxyribonucleic acid.

"Plasmids" are genetic elements reproducing in bacterial or yeasts cells irrespective of chromosomal DNA.

"Replication" means reproduction of genetic material. "Transformation" and "transfection" mean transfer of genetic material to a host cell by means of isolated DNA.

The term "vector molecules" denotes DNA molecules of plasmids and phages ensuring transfer of a foreign genetic material to a host cell and its amplification. The term "recombinant (hybrid) molecules" of DNA denotes a DNA molecule produced in vitro as a result of ligation, of different DNA molecules one of which is a vector molecule.

The term "clone" means genetically uniform progeny of one cell.

The term "cloning of genes" (molecular cloning) denotes preparation of clones of bacteria or yeasts containing said genes on a hybrid plasmid.

"Amplification" means increasing the number of genes in a cell. "Operon" means a jointly controlled DNA unit containing a group of genes. The term "catabolism" means the process of converting feedstuff compounds to intermediary metabolites. The term "repression" means switching off transcription of genes or operons resulting in the inhibition of synthesis of gene products.

The term "repressor" denotes a regulating protein which stops the function of genes in combination with repression co-factors (usually final products of the biosynthetic or catabolic pathway or their derivatives.)

The term "biogenetic cassette" means a plasmid, bacteriophage, virus, or other form of self-propagating DNA constructed to contain all the genes, in the absence of negative regulatory features, genetic and metabolic, required for a complete biochemical pathway(s) for the catabolism of a specific feedstock or for the production of a specific amino acid or other chemical, or both, contained on a single hybrid DNA vector molecule. Where more than one enzyme (isozyme) can perform a given reaction in the pathway, the biogenetic cassette is constructed to contain a gene for only one of those enzymes, wherein the presence of that single gene and the absence of the other genes of similar function increase the production of the desired amino acid or chemical.

Brief Description of the Invention

The present invention relates to the production of microbial strains characterized by increased production of amino acids, or other chemicals. These microorganisms contain multiple copies of the genes necessary for biosynthesis of the desired end product, or utilization of the desired feedstocks, or both, but lack all or substantially all of the negative metabolic and genetic regulatory mechanisms limiting its synthesis. The present invention also relates to the production of microbial strains having the ability to utilize methanol as a carbon source. These microorganisms may or may not contain multiple copies of genes necessary for utilization of methanol as a carbon source.

In accordance with one aspect of the present invention, a microorganism is prepared which produces an amino acid such as L-isoleucine. Fragments of E. coli chromosomal DNA containing all of the genes required for L-isoleucine biosynthesis are reconstructed in a configuration identical to their natural genomic configuration into a vector molecule of DNA, such as plasmid pBR322, to form a hybrid plasmid consisting of approximately 15 kilobases (kb) of DNA. The genes in this plasmid and their gene products are devoid of all negative metabolic and genetic regulation limiting L-isoleucine production.

Where more than one enzyme (isozyme) can perform a given reaction in the pathway, the biogenetic cassette may advantageously be constructed to contain a gene for only one of these isozymes. The presence of the single gene and the absence of the other isozymes in some instances may increase the production of the desired amino acid or chemical either by the nature of its metabolic or genetic regulation or by the nature of its substrate specificity. In the case of L-isoleucine and L-valine there exist three genes (ilvBN, ilvGM. and ilvHI) for the acetohydroxy acid synthetase isozymes (AHASI, AHASII, AHASIII). A preferred biogenetic cassette for the production of L-isoleucine contains only the ilvGM genes for the production of AHASII (which according to its substrate specificity favors the synthesis of L-isoleucine) whereas the ilvBN and ilvHI genes code for the AHAS isozymes that favor the synthesis of L-valine. Thus, in accordance with one aspect of the present invention, there is provided a recombinant DNA segment containing genes coding for at least one enzyme for each step in the biosynthetic or metabolic pathway for a desired biological product, wherein the pathway has at least two steps, and preferably at least three steps, and wherein in vivo transcription of at least one of the genes is ordinarily subject to regulation and wherein at least one of the genes codes for an enzyme that is ordinarily subject to feedback inhibition, wherein all transcriptional regulatory sequences have been removed from the segment, and wherein each gene in the segment that would otherwise code for a feedback-inhibited enzyme has been modified so that feedback inhibition has been removed, so that upon transcription of the segment and translation of the resulting RNA, the biosynthetic or metabolic pathway is unregulated. Where the biosynthetic pathway is a pathway for an amino acid, preferred products include L-isoleucine, L-valine, L-leucine, L-tryptophan, L-histidine, L-threonine, and L-phenylalanine.

. Where appropriate in light of the genetic regulatory mechanism, it is preferred that the genes in the segment are in natural chromosomal order.

One particularly preferred biogenetic cassette for L- isoleucine biosynthesis includes ilvpe^da^dG⁺MEDA^r and ilvYC, wherein p indicates a promoter sequence, e indicates a leader sequence, a indicates an attenuator sequence, ⁺ indicates activity, ^d indicates deletion, and ^r indicates resistance to feedback inhibition.

In accordance with another preferred embodiment of the present invention, the DNA segment or biogenetic cassette prepared in accordance with this invention is contained in a recombinant DNA transfer vector. Preferred vectors include phages, other viral vectors, and plasmids. The plasmid is preferably a multicopy plasmid.

In accordance with yet another preferred embodiment of the present invention, the biogenetic cassette includes genes for both a biosynthetic pathway and a catabolic pathway. One preferred catabolic pathway for methanol utilization requires a methanol oxidase encoding gene and a dihydroxyacetone synthase encoding gene.

In this preferred embodiment, transcriptional regulation may be removed by providing a promoter sequence for the methanol oxidase and dihydroxyacetone synthase encoding genes upstream from the methanol oxidase and the dihydroxyacetone synthase encoding genes, that is not subject to negative transcriptional regulation and is different from the wild-type promoter for the methanol oxidase encoding gene. The biogenetic cassette also preferably includes ribosome binding sites and a transcription terminator for the methanol oxidase and dihydroxyacetone synthase encoding genes. Still another preferred embodiment of the present invention is a combined biosynthetic and catabolic biogenetic cassette for lactose utilization, which includes a lac operon in which the wild-type promoter sequence has been replaced with a different promoter sequence. The lac repressor gene, laci , has preferably been removed from the lac operon by site-specific deletion.

Another embodiment of the present invention is a biogenetic cassette consisting of a recombinant DNA segment comprising a methanol oxidase encoding gene and a dihydroxyacetone synthase encoding gene, both of which genes have been obtained from a methylotropic organism, and a promoter sequence directing the transcription of the genes, wherein the promoter sequence is different from the promoter sequence for the genes in the organism from which those genes came.

The present invention also includes a method for assembling an unregulated biogenetic cassette containing DNA coding for a biosynthetic or metabolic pathway having at least two, and preferably three steps, that is ordinarily regulated by both transcriptional regulation and feedback inhibition, and wherein the cassette includes at least one gene for each step of the pathway. This method comprises the steps of obtaining a modified gene (such as a mutated or synthetic gene) for each enzyme in the pathway that is ordinarily subject to feedback inhibition, wherein the modification in each modified gene destroys the feedback inhibition, removing the DNA sequence or sequences responsible for negative transcriptional regulation of genes for the pathway to obtain a deattenuated or derepressed operon, assembling all of the genes coding for at least one of the enzymes for each step in the pathway, including the modified genes, into a single DNA segment, and cloning the resulting DNA segment. This method may also include the steps of removing a promoter sequence and inserting a different promoter sequence into the segment and inserting the segment into a plasmid and amplifying the segment in the plasmid in a microorganism. In a preferred embodiment, the product of the pathway is an amino acid, such as L-isoleucine, L-valine, L-leucine, L-tryptophan,

L-histidine, L-threonine, or L-phenylalanine. Other amino acids may also be selected.

One particularly preferred method for making a biogenetic cassette for the L-isoleucine biosynthetic pathway includes the steps of removing the attenuator sequence from an ilvGMEDA operon to form a deattenuated operon, replacing the wild-type ilvA with L-isoleucine- resistant ilvA^r, and assembling together in a single polymeric DNA molecule the deattenuated operon containing the ilvA^r and ilvYC to form a biogenetic cassette coding for the biosynthesis of L-isoleucine.

The methods of the present invention optionally include the step of incorporating into a biosynthetic biogenetic cassette genes coding for a catabolic pathway, such as a methanol oxidase encoding gene and a dihydroxyacetone synthase encoding gene, or a lac operon. Of course, the methods also may include obtaining expression of the biogenetic cassettes in a microorganism.

Further, the present invention comprehends a method for creating a biogenetic cassette for methanol utilization, comprising the steps of obtaining methanol oxidase and dihydroxyacetone synthase encoding genes from a methylotropic organism, removing the wild-type promoter sequence from the genes, creating a DNA segment containing the genes and a different promoter for the genes, and inserting the segment into a recombinant DNA transfer vector, such as a virus or plasmid.

Brief Description of the Drawings Figure 1 is a diagram of the biosynthetic pathway for synthesizing L-isoleucine.

Figures 2A and 2B diagram a cloning strategy for assembling the ilv genes into a deregulated biogenetic cassette for the synthesis of L-isoleucine. DNA sequences of genes are represented by bold lines above the gene letter, circles represent DNA vector sequences. Abbreviations for restriction endonuclease sites are: H, Hindlll; S, Smal; P, PvuII; K, Kpnl; Sa, Sail; X, Xhol; B, Bglll.

Figure 3 diagrams an alternative cloning strategy and steps for forming a deregulated biogenetic cassette for the synthesis of L-isoleucine. DNA sequences of genes are represented by bold lines above the gene letter, circles represent vector sequences. Abbreviations are: H,

Hindlll; Sa, Sail; Su, SauIIIA; T, TaqI; M, Mnll; Sp, SphI; Bg, Bglll; Hi, HincII; X, Xhol; B, BamHI; R, EcoRI.

Figures 4A and 4B illustrate the cloning strategy and steps for forming a biogenetic cassette for methanol utilization. DNA sequences of genes are represented by bold lines, circles represent DNA vector sequences. Abbreviations for restriction endonuclease sites are: B,

BamHI; H, Hindlll; P, PvuII; A, Alul; Hi, Hinfl; Sa, Sau3A; R, EcoRII; E, EcoRI; T, TaqI; Sp, SphI; Bs, BstEII;

Ba, Ball; Bg; Bglll; N, Ndel; Sm, Smal; X, Xbal.

Detailed Description of the Preferred Embodiments The present invention employs methods of in vitro preparation of hybrid DNA molecules capable of replication and amplification, followed by introduction of these molecules into a recipient strain, by means of transformation or transfection. The vector molecules used are plasmid DNA or DNA of temperate bacteriophages, viruses, or other self-propagating DNA. Many of these methods are described in detail in the following publications:

1. Cohen S.N., Chang A.C.Y., Boyer H.W. and Helling

R.B. (1973) Proc . Nat . Acad . Soi . USA , 70, 3240. 2. Green P.J., Betlach M.D., Boyer H.W., and Goodman

H.N. (1974) Methods in Molecular Biology, 7, 87.

3. Tanaka T., and Weisblum B. (1975) J . Bacteriol , 121, 354.

4. Clarke L., and Carbon J. (1975) Proc . Nat . Acad . Soi . USA , 72, 4361.

5. Bolivar F., Rodrigues R.L., Green P.J., Betlach M.C., Heyneker H.L., and Boyer H.W. (1977) Gene , 2, 95.

6. Kozlov J.I., Kalinina N.A., Gening L.V., Rebentish B.A., Strongin A.J., Bogush V.G., and Debabov V.G. (1977) Molec . Gen . Genetics , 150, 211.

The biosynthesis of branched chain amino acids isoleucine and valine in all organisms is accomplished by a complex biochemical and genetic system and in E. coli comprises four separate operons and eleven genes (Fig. 1). The regulation of the synthesis of these amino acids is affected by several processes, including attenuation (ilvGMEDA and ilvBN), repression (ilvHI , ilvY) , induction (ilvC) , catabolite repression (ilvBN), end product inhibition (threonine deaminase by L-isoleucine, acetohydroxy synthase I and III by L-valine, isopropylmalate synthetase by L-leucine), and end product activation (threonine deaminase by L-valine). For a recent review of amino acid synthesis and regulation, see Herrmann, K. and Summerville, R.L., eds., Amino Acid, Biosynthesis and Genetic Regulation (1983). In one biosynthetic pathway for the production of

L-isoleucine, the starting material is L-threonine. This pathway is shown in Figure 1. Threonine deaminase (coded for by the ilvA gene) removes the amino group and a molecule of H₂O to form alpha-ketobutyrate. Next, acetohydroxy acid synthetase II (ilvGM), condenses that compound with pyruvate to form alpha-aceto-beta- hydroxybutyrate. In the next step, acetohydroxy acid isomeroreductase (ilvC) converts this product to alpha, beta-dihydroxy-alpha-methylvalerate, which in turn is dehydrated by dihydroxy acid dehydratase (ilvD) to make alpha-keto-beta-methylvalerate. This product is converted to L-isoleucine by an amino acid aminotransf erase coded for by ilvE, all as shown in Figure 1. As mentioned above, transcription of the ilvGMEDA operon is controlled by an attenuator sequence.

Acetohydroxy acid synthetase I and III are subject to negative feedback regulation by L-valine. Wild-type E. coli K12 is acetohydroxy acid synthetase II negative (ilvG-). Threonine deaminase is similarly subject to feedback inhibition by L-isoleucine. Transcription of ilvC is induced by its substrates acetohydroxybutyrate and acetolactate, by complexing with a positive activator (the product of the ilvY gene).

Similarly, in other biosynthetic and catabolic pathways, repression, attenuation, positive activation and feedback inhibition of enzymes and other genetic and metabolic controls play an important role. For example, one catabolic operon, the lac operon of E. coli K12 responsible for the dissimilation of lactose, is genetically regulated by both repression and positive activation. In the absence of lactose in the nutrient medium, the lac repressor (the product of the lacl gene) binds to the operator site in the promoter-operator region and prevents the transcription of the three genes of the lao operon by RNA polymerase. In the presence of lactose in the nutrient medium, a form of the lactose molecule complexes with the lac repressor in such a way as to prevent it from binding to the lao promoter-operator region, thus allowing transcription of the lac operon by RNA polymerase. The lac operon is also regulated by catabolite repression, as are many other catabolic operons such as the arabinose operon, the ribose operon, etc. This regulation results from the fact that the transcription of these operons by RNA polymerase is activated by the binding of cyclic AMP receptor protein:cyclic AMP complex to the promoter region of these operons. In the presence of glucose in the nutrient medium, intracellular cyclic AMP levels are low, no CRP:cyclic AMP complex forms, and expression of these operons remains low (catabolite repression). In the absence of glucose and in the presence of other carbon sources (e.g., lactose, arabinose, ribose, etc.) cyclic AMP levels are high, CRP:cyclic AMP complexes form and the transcription of these operons is activated. Another example of a biosynthetic operon is the trp operon of E. coli K12. This operon is responsible for the biosynthesis of L-tryptophan and is genetically regulated by both repression (like the lac operon) and attenuation as well as by metabolic end product inhibition (like the ilv biosynthetic pathway).

Briefly stated, attenuation is the regulation of transcription termination at a site (the attenuator) preceding the structural gene(s) of an operon. Translation of the leader RNA preceding the attenuator determines whether a termination structure (G + C stemloop followed by a string of U residues) is formed in the RNA transcript to signal transcription termination or is pre-empted to allow read-through transcription into the structural genes. Under conditions where the intracellular concentration of the appropriate amino acid(s) or other end product(s) is sufficient, translation of the leader RNA favors the formation of the termination structure and RNA polymerase terminates transcription at the attenuator. Alternatively, if the amino acid(s) or other product (s) become limiting, the ribosomes stall in the leader region, the termination signal is pre-empted, and RNA polymerase continues transcription into the structural genes.

Further examples of gene regulatory mechanisms are numerous and include such examples as regulation, by antisense RNA (the ompF gene of E. coli K12), an ti termination of transcription (N gene product regulation of late gene expression in bacteriophage lambda) and regulatory protein binding to mRNA to control translation (the ribosome operons of E. coli K12) and, in eukaryotes, specific DNA sequences (enhancers) are often required for efficient gene expression.

In all of the above examples these gene regulatory mechanisms are specified by unique and discrete DNA sequences. In the present invention we precisely delete, mutate, or alter by recombinant. DNA methods these specific

DNA sequences to remove negative regulation.

In assembling the biogenetic cassette of the present invention, all of the genes necessary for the biosynthesis of the desired end product or metabolism of a desired substrate are assembled together, in chromosomal order where appropriate (as discussd in Section D below). The metabolic and negative transcriptional regulatory mechanisms present in wild-type organisms have been deleted, modified, mutated, or otherwise defeated in the biogenetic cassette. In the L-isoleucine cassette, an active ilvG⁺ replaces the wild-type inactive ilvG- in E. coli K12; the wild-type ilvA has been replaced by a feedback-resistant ilvA^r; the inducer ilvY is included with ilvC, and the ilvGMEDA attenuator is deleted, thereby producing a biogenetic cassette for the unregulated synthesis of L-isoleucine.

The specific steps necessary in assembling the biogenetic cassette will now be discussed in detail.

A. Removal of Allosteric Regulation Genes for feedback-resistant enzymes may be obtained from microorganisms that have undergone either spontaneous or induced mutagenesis. Mutations are induced, for example, through the use of ionizing radiation, such as X- rays or ultraviolet radiation; chemical mutagens, such as nitrous acid, hydroxyl amine, ethyl methane sulfonate, and N-methyl-N'-nitro-N-nitrosoguanidine, and the like.

The mutation in the ilvA gene which confers resistance to feedback inhibition by L-isoleucine on threonine deaminase is a spontaneous mutation originally identified by the exhibition of a higher than normal intracellular concentration of threonine deaminase. Further characterization of this mutant strain demonstrates that the mutation is located in the ilvA gene and that the ilvA gene product of this strain, threonine deaminase, is highly resistant to inhibition by L-isoleucine. (Calhoun, D.H., Kuskee, J.S. and Hatfield, G.W. (1974) J. Biol. Chem. 250, 127-131.

B. Removal of Attenuator Sequence and Other Transcriptional Regulatory Site

The attenuator sequence may be removed by two possible methods. In the first, short segments of the promoter region are isolated as specific restriction endonuclease fragments and religated in such a manner as to reconstitute a fragment retaining the functionality of transcription initiation but for which the attenuator has been removed. Alternatively, the attenuator sequence may be removed by site-directed mutagenesis generally as described by R.B. Wallace, et al ., (1980) Science 209, 1396-1400. In this method, a DNA fragment containing the attenuator region is cloned into the replicative form of the single stranded bacteriophage M13. A synthetic oligonucleotide, with sequences complementary to approximately 7 bases flanking the attenuator site to be deleted, is hybridized to the single stranded phage DNA and is used as a primer to direct the synthesis of DNA on this single-stranded circular DNA template. The synthetic oligonucleotide is thereby incorporated into the newly synthesized circular DNA molecule and the intervening attenuator sequences are eliminated in the newly synthesized strand of the heteroduplex DNA molecule. Transformatiσn into E. coli followed by DNA replication resolves this heteroduplex into mutant (attenuator deleted) and parental DNA sequences. The synthetic oligonucleotide used to synthesize the mutation may also be used in either a positive or negative hybridization assay to screen for clones containing the attenuator sequence deletion.

C. Assembly of Operons and Genes in Chromosomal Order The techniques used in assembling the genes into the biogenetic cassette are classical genetic engineering techniques, utilizing appropriate restriction endonucleases and ligases and cloning vectors. The strategy for assemblying the genes in a specified order into the cloning vector are unique for each set of genes to be cloned depending upon the position of unique restriction sites in the genes and in the cloning vector, for example, two strategies for assembling the genes of the L-isoleucine biogenetic cassette into the cloning vector pBR322 are depicted in Figures 2A and 2B and Figure

3 and described in detail in section E. In the case of the L-isoleucine biogenetic cassette it is necessary to reconstruct exactly the natural chromosomal order of the ilvGMEDA and ilvYC operons. This is due to the fact that the expression of the distal gene of the ilvGMEDA operon, ilvA, may be regulated by opposing transcription from the autoregulated ilvY gene. This regulation would be necessary to coordinate the flow of carbon from alpha-keto-butyrate and pyruvate through the L-isoleucine-L-valine biosynthetic pathway.

D. Introduction of Promoter Sequences

Different organisms, of course, recognize different promoter sequences. In accordance with the present invention, when the desired deregulated biogenetic cassette has been assembled, means are provided which facilitate removing the E. coli promoter sequences and introducing various new promoter sequences appropriate for different host bacteria or yeasts onto the biogenetic cassette into a unique site in the vector and for introducing the biogenetic cassette into a variety of cloning vectors. For example, in the case of the L- isoleucine cassette, the new promoter may be introduced via a BamHI site, derived during construction of pABC115 from the polylinker region of the vector pUC19, which is located where the attenuator deletion has occurred. This

BamHI site in the plasmid is useful for inserting any of a variety of appropriate host bacteria or yeast promoter sequences, such as, for example, those set forth in Table 1 and many others too numerous to list.

pombe gene promoter Nature (1983) 301,

167-169

ADH Russel , P. R. gene promoter Nature ( 1 983 ) 301 ,

167-1 69

For example, when using the organism Hansenula polymorpha , the promoter sequence may advantageously be that of the methanol oxidase gene of this organism:

ATTCTATGAGGCCATCTCGACGGTGTTCCTTGAGTGCGTACTCCACTCTGTAGCGACT GGACATCTCGAGACTGGGCTTGCTGTGCTGGATGCACCAATTAATTGTTGCCGCATGC ATCCTTGCACCGCAAGTTTTTAAAACCCACTCGCTTTAGCCGTCGCGTAAAACTTGTG AATCTGGCAACTCAGGGGGTTCTGCAGCCGCAACCGAACTTTTCGCTTCGAGGACGCA GCTGGATGGTGTCATGTGAGGCTCTGTTTGCTGGCGTAGCCTACAACGTGACCTTGCC TAACCGGACGGCGCTACCCACTGCTGTCTGTGCCTGCTACCAGAAAATCACCAGAGCA GCAGAGGGCCGATGTGGCAACTGGTGGGGTGTCGGACAGGCTGTTTCTCCACAGTGCA AATGCGGGTGAACCGGCCAGAAAGTAAATTCTTATGCTACCGTGCAGCGACTCCGACA TCCCCAGTTTTTGCCCTACTTGATCACAGATGGGGTCAGCGCTGCCGCTAAGTGTACC CAACCGTCCCCACACGGTCCATCTATAAATACTGCTGCCAGTGCACGGTGGTGACATC AATCTAAA.

As another example, for Eschericia coli the ilvP₁P₂ promoter sequence of the ilvGMEDA operon may be advantageously used:

AAATTGAATTTTTTTCACTCACTATTTTATTTTTAAAAAACAACAATTTATATTGA

AATTATTAAACGCATCATAAAAATCGGCCAAAAAATATCTTGTACTATTTACAAA

ACCTATGGTAACTCTTTAGGCATTCCTTCGAACAAGATGCAAGAAAAGACAAA.

Likewise, any of the promoter sequences of the genes listed in Table 1 might be advantageously used for expressing the genes of the biogenetic cassette in host organisms for which they are particularly suited.

Other microorganisms that may be used as host organisms for the present invention include bacteria such as Clostridium sp . , Serratia sp . , Enterobaoter sp . , Salmonella sp . , Klebsiella sp . , Rizhobium sp . , Rhodops eudomonas sp . (and other photosynthetic bacterial species), Xanthamonas sp . , and the various methylotropic bacterial species, etc, and yeast such as Candida sp . , other Saccharomyces sp . , Hansenula sp . , Mucor sp . (and other filamentous fungi), etc.

Moreover, since sufficient information is now available for the introduction and expression of foreign genes into plant and animal cells and even into mature plants and animals, it is possible to use the technology of the present invention to insert biogenetic cassettes into these systems.

E. Selection of Cloning Vector

Different plasmids suitable as cloning vectors for construction of biogenetic cassettes have different host organism compatabilities due, primarily, to their ability to adapt to the DNA replication machinery of a given host organism. Consequently, in choosing a DNA vector for the construction and expression of the genes of a biogenetic cassette, in a given host organism, it is necessary to choose a vector capable of replication in that host organism. These DNA vectors also contain antibiotic resistance or other phenotypically selectable genes, compatible with growth and physiological properties of the host organism, in order to propogate, amplify and maintain the biogenetic cassette. A large number of suitable plasmids are known and are readily available. For any particular organism, a person of ordinary skill in the art will recognize what plasmids are the most suitable.

F. Other Considerations In addition to efficient promotion of transcription and gene amplification for high level expression of a biogenetic cassette 'the economical use of the cellular transcription apparatus is favored by transcription of only those sequences required for the proper efficient translation of a messenger RNA. That is, proper transcription termination, messenger RNA processing, and messenger RNA translation signals must be engineered into the biogenetic cassette and these signals must be compatible with the metabolic machinery of the host organism. Furthermore, it has been demonstrated that transcription termination is an important factor for maintaining high copy numbers of plasmids since transcription through the origin of replication antagonizes plasmid replication (Adams and Hatfield, (1984) J . Biol . Chem , 259, 7399-7403). Examples of these signals and their proper utilization are described:

Transcription termination. In E. coli transcription termination signals are well defined. DNA sequences containing G + C rich inverted repeats followed by 6 or more Ts are known to be efficient transcription terminators. In examples which follow, the well characterized terminator of the ilvGMEDA attenuator will be used. Other well characterized, efficient transcription terminators could also be used. Transcription terminators in yeast are also well understood. In this case transcription termination is coupled to polyadenylation of the terminated mRNA transcript. An example of an efficient yeast transcription terminator is that of the CYCI locus of Saccharomyces cerevisea (Zaret and Sherman, (1982) Cel l 28, 563-573). In higher eukaryotic organisms the mechanism of transcription termination is less well understood; however, in vitro studies by Hatfield et al . ((1983) Mol . Cell . Biol . , 3, 1687-1693) have demonstrated that the bacteriophage lambda 4S terminator contains DNA sequences that are recognized by the eukaryotic RNA polymerase II, the polymerase that transcribes structural genes.

Messenger RNA processing. Current evidence suggests that polyadenylation of eukaryotic messenger RNAs in eukaryotic organisms is important for message stability and for the transport of the mRNA from the nucleus to the cytoplasm. The signals for polyadenylation, AATAAA together with nearby uncharacterized flanking sequences, have been documented for many eukaryotic genes. These sequences are found in structural genes immediately downstream of the amino acid coding region.

Messenger RNA translation. In E. coli it has been documented by Shine, J. and Daigarno, L. ((1975) Nature 254, 34-38) and many other investigators that a sequence complementary to the 3'-end of the 16S ribosomal RNA is located approximately 9-17 nucleotides prior to the translation initiation codon on the mRNA. In the examples that follow the well characterized translation initiation sequence for the leader polypeptide of the ilvGMEDA operon will be used. Any other well defined translation initiation sequence could also be used. Translation initiation is less well understood in eukaryotes; however, as a general rule, translation appears to initiate at the first initiation codon (Kozak, (1985) Micro . Rev . , 47, 1- 45). In addition to the large number of general and specific considerations set forth above, it must be recognized that the mechanisms of expression vary from organism to organism. Many of these mechanisms have been elucidated at this time. Many additional mechanisms are the subject of continuing research and will be understood more fully in the future. A person of ordinary skill in the art will understand, of course, what DNA sequences are needed to obtain expression of the biogenetic cassette of the present invention in any of the ever-expanding number of organisms in which expression of the biogenetic cassette may be desired. By use of the foregoing strategy and the steps discussed therein, the present invention can be applied to a wide range of biosynthetic or metabolic and catabolic pathways for production and/or utilization of both natural and altered biological products. The applicability of these steps is not limited to any particular type of biosynthetic or catabolic pathway, since the regulatory mechanisms and the genetics involved relate to and are applicable to an extremely broad range of natural systems. Thus, the following examples are not limiting, but rather are representative of the diversity of the pathways for which a biogenetic cassette can be constructed.

The present invention will now be described in great detail in the context of several biosynthetic and catabolic pathways. As has been discussed, there are a number of regulatory mechanisms involved in the biosynthesis of amino acids. Perhaps the most complex pathway, from a regulatory standpoint, is that for L-isoleucine.

Example I : L-isoleucine Biogenetic cas sette

We desc ribe here the con struction of a b iogenetic cassette contain ing all of the genes required for the biosynthe si s of L-isoleucine (ilvGMEDA , ilvYC) in their natural chromosomal orientation except having the ilvGMEDA attenuator removed by genetic engineering method s and having the wild type ilvA gene replaced by a gene whose product ( threonine deaminase) is resi stan t to end produc t inhibition by L- isoleucine because of mutation . All of the genes required for L-i soleuc ine bio synthesi s are obtained from the E. coli DNA chromosome by i solati on of appropriate chromosome re stric ti on endonuclease fragments in appropriate DNA vectors . The two alternative cloning strategies followed in thi s example are illustated in

Figures 2A and 2B and Figure 3. Construction of Clones for the Assembly of Biogenetic cassette

A 4.7 Kilobase (Kb) Hindlll fragment containing ilvpeaG-ME' (p=promoter, e=leader, a=attenuator) is cloned into the Hindlll site of plasmid pBR322 to yield plasmid pABC5. Plasmid pABC5 is described in the literature by

Lawther, et al., (1979) Nucl. Acids Res. 7,2289-2301, where it is given the designation pRL5. The preparation of this plasmid is described in detail in this article. A

4.8 Kb Hindlll-Bglll fragment containing ilv'EDAY' is used to replace the HindiII-BamHI fragment of pABC5 to yield pABC55 (ilvpeaG-MEDAY'-9.5 Kb). The active ilvG gene is obtained by intracellular genetic recombination by growing pABC5 for several generations in an L-valine resistant E. coli K12 strain to yield pABCI (ilvpeaG⁺ME').

The plasmid pABCI has been described by Lawther et al., (1981) Proc. Natl. Acad. Soi. USA 78, 922-925, where it is identified as pRL101. This article describes in detail the preparation of pRL101.

Plasmid pABC55 is maintained by the American Type

Culture Collection (ATCC) in Rockville, Maryland as a

Budapest Treaty deposit under accession number 67,228, and plasmid pABCI is maintained by ATCC as a Budapest Treaty deposit under accession number 67,230.

The Smal-Hindlll fragment from pABCI is inserted into the Smal-Hindlll sites of the replicative form of bacteriophage mp18 to yield the hybrid mABC102. The 32 bases of the altenuator are excised from mABC102 by the oligonucleotide site directed deletion method of R. B.

Wallace et al., ((1980) Soience 209, 1396-1400) to yield mABC102d.

In an alternative method for deleting the attenuator of the ilv promoter, a 384 bp SauIIIA-TaqI fragment is isolated from pABC55, filled in with the Klenow fragment of E. coli DNA polymerase I, and cloned into the Smal site of the vector ρUC19 to form pJGLP₁P₂. Subsequently an 800 bp Mnll-SphI fragment extending from immediately downstream of the attenuator region into the proximal portion of ilvG is isolated from pABCI and cloned into HincII-SphI digested pJGLP₁P₂ to form pP₁P₂att. This construction results in the incorporation of a BamHI site from the polylinker of pUC19 between the P₁P₂ promoters and the beginning of the ilvg gene for use in inserting alternative promoters, as described in Section D, supra. An Xhol fragment (4.4 Kb fragment located at approximately 84 min. on the E. coli chromosome) isolated from an E. coli K12 strain (CU18) containing a spontaneous mutation in threonine deaminase resulting in resistance to feedback inhibition by L-isoleucine, (Calhoun, D.H., Kuska, J.S. and Hatfield, G.W. (1974) J. Biol. Chem. 250,

127-131) is inserted into the unique Xhol site of pIC19R (Marsh, J.L., et al. (1984) Gene 32, 481-485) in an orientation, such that the threonine deaminase gene ilvA is transcribed from the lac promoter to yield pABC101 (ilvA^rYC). (CU18 is maintained by ATCC as a Budapest

Treaty deposit under accession number 53,549.) This clone is selected and isolated by its ability to complement an ilvA- E. coli strain CU623, described by Smith et al. (1979) Mol. Gen. Genet. 169, 229-314. Alternatively, any fragment from CU18 on which the feedback resistance mutation in ilvA is included could be ligated into any convenient vector and isolated by plasmid sizing and restriction enzyme analysis. For example, an alternative method is to clone a 3.9Kb Sall-Xhol fragment of CU18 into Sall-Xhol digested pIC19R to form pABC102.

Construction of L-isoleucine Biogenetic Cassette: Alternative 1:

The L-isoleucine producing cassette for E. ooli is assembled according to following steps, as ilustrated in Figures 2A and 2b: 1. A Smal-Hindlll DNA fragment is isolated from pABC5 and ligated into the PvuII-Hindlll sites of pBR322 to yield pABC103 which is screened and isolated by plasmid size and restriction analysis (note PvuII sites and Smal are sacrificed).

2. The resultant single PvuII fragment of pABC103 is replaced with the PvuII fragment from mABC102d to yield pABC104. This clone is selected by its ability to complement an AHAS- E. coli strain CU888, described by Baez, et al . , (1979) Moleo . Gen . Genet . 169, 289-297.

3. The Sail fragment of pABC55 is inserted into the Sail site of pABC104 to yield pABC105. pABC105 is selected by its ability to compliment E. coli ilvD- or i lvE- strains CU624, described by Smith, et al., (1976) Mol . Gen . Genet . 148 111-124; or CU692, described by Smith, et al . (1979) Mol . Gen . Genet . , 169, 299-314.

4. The Xhol fragment from pABC101 is ligated into the Xhol site of pABC105 to yield pABC106 (ilvpe^da^dG⁺MEDA^rYC). 5. The cassette is made "mobile" by placing a linker in the deleted attenuator region by partial digestion of the plasmid with EcoRII, followed by insertion of an 8 base BamHI linker in this site. A BamHI linker is also inserted at the Xhol site external to the operon by partial digestion. These are the only BamHI sites in pABC106. The upstream BamHI site is also used for insertion of novel or known promoter sequences.

Construction of L-isoleucine Biogenetic Cassette: Alternative 2:

In an alternative construction, the cassette may be assembled as illustrated in Figure 3, thus:

1. A 3.0 Kb Sall fragment is isolated from pABC55 and ligated into Sall digested pABCI which is screened for insertion of the Sall fragment in the appropriate orientation by restriction enzyme analysis to yield pABC111.

2. The 1.2 Kb EcoRI-SphI attenuator deleted promoter fragment from pP₁P₂att is cloned into EcoRI-SphI digested pABC111 to form pABC114, whose integrity is confirmed by analytical restriction enzyme analysis.

3. The 3.9 Kb Sall-Xhol fragment from pABC102 is cloned into partial Sail-digested pABC114 to yield pABC115 whose identity is confirmed by restriction enzyme analysis.

4. A BamHI linker is added to a unique Xmalll site located distal to ilvYC in order to "mobilize" the cassette. This provides a BamHI site in the former attenuator region and another at the operon's distal insert-vector junction.

The completed cassette can now be expressed in E. coli or other suitable organisms. Unlike mutant organisms which produce an excess of L-isoleucine in combination with L-valine, the selectivity of the (AHAS) isozyme at the branchpoints in the pathway used in the present biogenetic cassette greatly decrease the amount of L-valine produced, with respect to L-isoleucine, thereby facilitating the purification process and reducing costs. Any one of the genes of this pathway might be further mutated to enhance the selectivity of L-isoleucine substrates.

Example II: L-valine Biogenetic cassette

The biosynthetic or metabolic pathway of L-valine synthesis differs from that of L-isoleucine in that the first step in L-valine biosynthesis involves the condensation of two pyruvate molecules, whereas, the analagous step in L-isoleucine biosynthesis involves the condensation of one molecule of pyruvate with one molecule of alpha-ketobutyrate. This enzymatic step is catalyzed in E. coli by three isozymes, AHASI (ilvBN), AHASII (ilvGM), AHASIII (ilvHl). Of these isozymes, AHASII favors the synthesis of L-isoleucine whereas AHASI favors the synthesis of L-valine. Thus, the L-valine biogenetic cassette contains the ilvBN genes instead of the ilvGM genes. To remove the activity of the ilvGM gene and to avoid transcriptional polarity, pABC106 or pABC115 is digested at the unique SphI site in ilvG and deleted with Bal31 digestion, and religated. The correctly deleted plasmid is identified directly by plasmid sizing and restriction enzyme analysis of recombinant clones to create pABC108.

The ilvBN gene is inserted into the operon distal BamHI site of ρABC108 by the following method. The altenuator of ilvBN is deleted from pCH4 either by sitedirected oligoneucleotide mutagenesis after subcloning ilvBN into bacteriophage mp18 or by appropriate restriction fragment reconstruction of the promoter region, as described for the L-isoleucine biogenetic cassette. Plasmid pCH4 is described by Wek, R., Hauser, C.A. and Hatfield, G.W., (1985) Nucl. Acids Res. 13, 3995-

4010, and is maintained as a Budapest Treaty Deposit by ATCC under accession number 67,229. Into this is cloned a 1713 bp Nael-SacI fragment from the L-valine resistant ilvBN operon from E. Coli strain MF2324 (Sutton, et al. (1981) J. Bact. 148, 998-1001).

A 2.4 KB Rsal (on which has been ligated a BamHI linker) - Bell (partial digestion) fragment containing ilva^dB^rM is then inserted into the distal BamHI site of pABC108 to form pABC109. The pABC109 plasmid is selected by its ability to complement an AHAS- E. coli strain, CU888 or by directly sizing and restriction analysis. Since the distal BamHI site is sacrificed in the above construction, the L-valine cassette is mobile due to the fact that all of the genes are bounded by two unique BamHI sites. Example III: A Biogenetic Cassette for Methanol Utilization by E. coli

A pathway which includes dihydroxyacetone as a key intermediate for the assimilation of methanol into the cell constituents of E. coli is established by the introduction of a biogenetic cassette containing the methanol oxidase (MOX) and dihydroxyacetone synthase (DHAS) of methanol-utilizing yeast into this organism. The preferred methanol-utilizing yeast, Hansenula polymorpha, American Type Culture Collection Catalog No.

34438, produces a methanol oxidase enzyme (MOX) which converts methanol to formaldehyde. The formaldehyde, in turn, is used by the dihydroxyacetone synthase enzyme (DHAS) to convert xyulose-5-phosphate to dihydroxyacetone and glyceraldehyde-3-phosphate. These products, in turn, enter the glycolytic pathway and are used in cellular metabolism. The cloning strategy used in this example is graphically illustrated in Figures 4A and 4B.

Construction of Clones for Assembly of the MOX cassette

The MOX gene is isolated as a 2.9 Kb PvuII-Xbal fragment of genomic DNA, and is ligated into Smal-Xbal digested pUC18 to yield pABC201 whose identity is confirmed by restriction enzyme analysis and DNA sequence analyses of the 5' portion of the gene. The 3' untranslated region of the gene is deleted by digesting ρABC201 with Hindlll, limited digestion with Bal31, adding Hindlll linkers, and cloning a 575 bp BstEII-Hindlll fraction back into the BstEII-Hindlll 4.5 Kb fragment from pABC201. A number of clones are identified by restriction enzyme analysis, and the DNA sequence of the 3' portion of the MOX gene in these is obtained to determine the end point of the Bal31 deletion. One of these, pABC210, which terminates 6 bp downstream from the UAA termination codon, is used for subsequent manipulations. To delete the 5' untranslated region, a 1994 bp Ball-HindHI fragment from pABC210 is ligated to Smal-Hindlll pUC18, linear ligation products of 4.5 Kb are isolated, and ligation is continued in the presence of a synthetic Ndel linker having the sequence CCATATGG. In this manner, the 5' four nucleotides of the MOX coding region, which are deleted by the Ball digestion and include the initator methionine codon AUG required for translation, are reconstituted by the ATGG sequence in the synthetic oligomer. One of several appropriate clones identified by restriction enzyme analysis, pABC211, is then partially digested with Ndel, filled in with the Klenow fragment of E. coli DNA polymerase I, and ligated with BamHI linkers. A 2.0 Kb BamHI-Hindlll fragment is then isolated and ligated into BamHI/Hindlll-digested pUC18 to give pABC212.

The DHAS gene is isolated as a 3.2 Kb BamHI-Hindlll fragment of genomic DNA, is inserted into BamHI-Hindlll digested pUC18, and is identified by restriction enzyme analysis and DNA sequencing of the 5' end of the gene.

This clone is designated as pABC204. A 521 bp Alul fragment is isolated, redigested with Bglll, and the 358 bp Bglll-Alul fragment is inserted back into the 5.4Kb Bglll-BamHI fragment of pABC204 in which the BamHI site has been filled in with the Klenow fragment of E. coli DNA polymerase I. In this manner a BamHI site is maintained at the 3' end of the DHAS gene since the AluI/BamHI (Klenow) junction provides the full GGATCC recognition sequence. Several appropriate clones are identified, one of which, pABC214, is used in further manipulations.

To delete the 5' untranslated region of the DHAS gene, ρABC204 is digested with Hindlll, limit digested with Bal31, ligated with Hindlll linkers and digested with BstEII and Hindlll. A 380 bp BstEII-Hindlll fraction is isolated and ligated into the 4.7 Kb Hindlll-BstEII fragment of pABC204 and a number of clones are identified by restriction enzyme analysis. The Bal31 deletion in one of these clones, pABC215, is shown by DNA sequence analysis to terminate at position -1 where the A of the ATG methionine initiation codon is designated as +1. The 380 bp Hindlll-BstEII fragment from this clone is ligated to the BstEII-HindHI digested pABC214 to give pABC216.

For expression of MOX and DHAS in E. coli, E. coli promoter, terminator and ribosome binding sites are required. These are derived from the attenuator region of ilv. The terminator of the fragment is obtained as a 146 bp SauIIIA-Hinf I fragment, filled in with the Klenow fragment of E. coli DNA polymerase I, and cloned into the Hindi site of pUC19 to form pABC207. This sequence is transferred as a BamHI-SphI fragment from sites in the polylinker into BamHI-SphI digested pBR322 to form TpBR. The promoter and ribosome binding sites are obtained from an EcpRII 415 bp fragment filled in with Klenow and ligated into the Smal site of pUC19 to form pABC209. In order to eliminate the NH₄-terminal amino acid residues of the ilv leader peptide, pABC209 is digested with BamHI, treated with Bal31, ligated with BamHI linkers, and digested with EcoRI and BamHI. A 420 bp fraction is isolated and ligated into pBR322. A number of clones are isolated by restriction enzyme analysis and DNA sequencing, one of which (pABC219) has a Bal31 deletion end point 4 b.p. upstream of the methionine ATG initator codon of the ilv leader peptide. The 440 bp EcoRI-BamHI fragment of pABC219 is cloned into EcoRI-BamHI digested TpBR to give pABC220 in which a unique BamHI site is present between P₁P₂ and the terminator sequence.

Construction of the MOX Biogenetic Cassette.

1) The translated portions of the MOX and DHAS genes are joined by ligating Hindlll digested pABC212 and pABC216, digesting the ligation mixture with BamHI, and isolating the 4.2 Kb BamHI MOX- DHAS fusion fragment which is subsequently cloned into the BamHI site of pBRHindIII^d (pBR322 in which the Hindlll site has been deleted) to give pABC217.

2) The ribosome binding site contained on a 30 b.p. Klenow treated Taql-BamHI fragment from pABC219 is cloned into Hindlll-digested, Klenow filled pABC217 to give pABC221, in which the appropriate orientation of the ribosome binding site is confirmed by DNA sequence analysis. 3) The BamHI 4.3 Kb MOX-rbs-DHAS fragment from pABC221 is cloned into BamHI-digested pABC220 to form pABC230.

Thus, a methanol utilizing operon complete with a promoter, two ribosome binding sites, the two structural genes required for methanol utilization and a transcription terminator are contained in the plasmid pABC230, facilitating the expression of these genes in E. coli.

The promoter for the MOX gene is ordinarily positively regulated by methanol and negatively regulated by glucose. Because the naturally-occurring MOX promoter has been replaced with the ilvGMEDA promoter, all known negative transcriptional regulation has been removed from the resulting biogenetic cassette.

Example IV: Biogenetic Cassette for the S10 Operon of E. coli K12

Previous studies have shown that ribosomal protein L4 specifically inhibits the expression of its own operon, the 11-gene S10 operon of E. coli K12 (Lindahl, L., et al. (1983) Cell, 33, 241-248). In the presence of excess L4, transcription of the S10 operon is terminated 140 bases past the transcription initiation site. This attenuation of S10 operon expression by L4 ensures a constant but limited synthesis of operon products. The S10 operon is also transcriptionally regulated by a growth rate control mechanism exerted at the level of transcription initiation. Using the same techniques as set forth in Examples 1-3 a biogenetic cassette for the deregulated expression of the products of the S10 operon is constructed by producing a DNA fragment containing the 11 genes of the operon with the attenuator site deleted (as in the construction of the L-isoleucine biogenetic cassette, Example I) and with a new, strong promoter sequence replacing the S10 promoter (e.g. trpP , tacP , or ilvP₁P₂) and inserting this fragment into an amplifiable plasmid vector. Since no metabolic controls are known for this operon this construction would represent a biogenetic cassette containing all 11 genes of the S10 operon, on a single DNA fragment, inserted into a single plasmid, completely devoid of all known negative regulation. In order to maintain the integrity of the biogenetic cassette on the plasmid, a recombination-deficient (E . coli ) host should be used.

Example V: Biogenetic Cassette for Lactose Utilization

Using the same techniques as set forth in Examples 1-

3, a genetic cassette for the deregulated expression of the lac operon (Jacob F. and Monod J. (1961) J . Mol . Biol .

3, 318-365) of E . coli K12 is prepared as follows: The lac I gene, which encodes the lac repressor, is removed by site specific deletion. A DNA fragment containing the lacZ, lacY and lacA genes of the lac operon with the natural lac operator-promoter region replaced with a strong constitutive promoter sequence is placed into an amplifiable high copy plasmid vector. This genetic cassette containing all the genes of the lac operon devoid of negative regulation for the efficient catabolism of lactose can also be prepared (as in Example 1) with a unique restriction site(s) at the promoter site for the insertion of host specific promoter and vector sequences so that this cassette can be functional in any host for which specific promoter and vector sequences are now, or later become, available.

Example VI : Catabolic and Biosynthetic Cassette Example 1 and 2 describe biogenetic cassettes for the biosynthesis of the natural products, L-isoleucine and L-valine, respectively. Example 3 and 5 describe biogenetic cassettes for the catabolism of natural products, methanol and lactose, respectively. A genetic cassette for the conversion of a specific natural product into another specific natural product can be constructed by combining a catabolic operon with a biosynthetic operon in the same plasmid vector. In the above cases it is possible, for example, to construct biogenetic cassettes for the production of L-isoleucine or L-valine from either methanol or lactose. This same strategy can be employed to produce any number of natural products from a wide variety of starting materials in appropriate host organisms by combining the genes of any given catabolic and biosynthetic pathways in the same biogenetic cassette.

Example VII: L-leucine Biogenetic Cassette

The biosynthesis of L-leucine is regulated at the level of transcription by attenuation of the leuABCD operon and by end-product inhibition of the first enzyme of the L-leucine pathway (alpha-isopropylmalate synthase, leuA). No other repression or induction mechanism is utilized by the leu operon. Using the same techniques as set forth in Examples 1-3 a biogenetic cassette for the deregulated expression of the leu operon of E. coli K12 is prepared as follows: The leuABCD attenuator is removed by procedures similar to those described in Example 1 using site specific deletion. A DNA fragment, from 2 min. on the E. coli chromosome, containing the leuABCD genes of the leu operon, in which the natural leu promoter region has been replaced with a strong constitutive promoter sequence, is placed into an amplifiable high copy plasmid vector. The gene coding for alpha-isopropylmalate synthase (leuA) is replaced with a gene coding for a feedback resistant alpha-isopropylmalate synthase. This biogenetic cassette, containing all of the genes of the leu operon devoid of negative regulation for the efficient biosynthesis of L-leucine can also be prepared (as in Example 1) with a unique restriction site(s) at the promoter site for the insertion of host specific promoter and vector sequences so that this cassette can be functional in any host for which specific promoter and vector sequences are now, or become, available.

Example VIV: L-tryptophan Biogenetic Cassette The biosynthesis of L-tryptophan is regulated at the level of transcription by attenuation of the trpEDCBA operon as well as by repression of the operon by the trp repressor and by end-product inhibition of the first enzyme of the L-tryptophan pathway, anthrinilate synthetase (trpE). Using the same techniques as set forth in Examples 1-3, a biogenetic cassette for the deregulated expression of the trp operon of E. coli K12 is prepared as follows: The trp attenuator is removed by procedures similar to those describes in Example 1 using site specific deletion. A DNA fragment containing the trpEDCBA genes of the trp operon in which the natural trp repressor-promoter region has been replaced with a strong constitutive promoter sequence is placed into an amplifiable high copy plasmid vector. The gene coding for anthrinilate synthetase (trpE) is replaced with a feedback resistant anthrinilate synthetase trpE gene. This biogenetic cassette, containing all of the genes of the trp operon devoid of negative regulation for the efficient biosynthesis of L-tryptophan, can also be prepared (as in Example 1) with a unique restriction site(s) at the promoter site for the insertion of host specific promoter and vector sequences so that this cassette can be functional in any host for which specific promoter and vector sequences are now, or become, available.

Example IX: L-histidine Biogenetic Cassette

The biosynthesis of L-histidine is regulated at the level of transcription by attenuation of the his GDCBHAFIE operon and by end-product inhibition of the first enzyme of the L-histidine pathway, (hisG). Using the same techniques as set forth in Examples 1-3, a biogenetic cassette for the deregulated expression of the his operon of E. coli K12 is prepared as follows: The his GDCBHAFIE attenuator is removed by procedures similar to those described in Example 1 using site specific deletion. A DNA fragment, from 44 min. on the E. coli chromosome, containing the his GDCBHAFIE genes of the his operon with the natural his attenuator-promoter region replaced with astrong constitutive promoter sequence is placed into an amplifiable high copy plasmid vector. The wild-type hisG gene is replaced with a hisG gene coding for a feed-back resistant hisG gene product. This biogenetic cassette, containing all of the genes of the his operon devoid of negative regulation for the efficient biosynthesis of L-histidine, can also be prepared (as in Example 1) with a unique restriction site(s) at the promoter site for the insertion of host specific promoter and vector sequences so that this cassette can be functional in any host for which specific promoter and vector sequences are now, or later become, available.

Example X: L-threonine Biogenetic Cassette

The biosynthesis of L-threonine is regulated at the level of transcription by attenuation of the thrABC operon and by end-product inhibition of the first enzyme of the threonine pathway, homoserine dehydrogenase (thrA). Using the same techniques as set forth in Examples 1-3, a biogenetic cassette for the deregulated expression of the thr operon of E. ooli K12 is prepared as follows: The thrABC attenuator is removed by procedures similar to those described in Example 1 using site specific deletion. A DNA fragment, from 0 min. on the E. coli chromosome, containing the thrABC genes of the thr operon, with the natural thr attenuator-promoter region replaced with a strong constitutive promoter sequence, is placed into an amplifiable high copy plasmid vector. The gene coding for homoserine dehydrogenase (thrA) is replaced with a feed-back resistant homoserine dehydrogenase. This biogenetic cassette containing all of the genes of the thr operon devoid of negative regulation for the efficient biosynthesis of L-threonine can also be prepared (as in Example 1) with a unique restriction site(s) at the promoter site for the insertion of host specific promoter and vector sequences so that this cassette can be functional in any host for which specific promoter and vector sequences are now, or later become, available.

Example XI: L-phenylalanine Biogenetic Cassette

The biogenetic cassettes described in Examples 1-10 involve biosynthetic or catabolic pathways that can be inserted in host organisms with only minor perturbations of tributory metabolic pathways. Many other examples of biogenetic cassettes can be envisioned which for maximum utilization and efficiency would require further genetic engineering of the host organism. For example, the biosynthesis of L-phenylalanine is regulated at the level of transcription by attenuation of the phe operon and by end-product inhibition of the first enzyme of the L- phenylalanine pathway. Using the same techniques as set forth in Examples 1-3, a biogenetic cassette for the deregulated expression of the phe operon of E. coli K12 is prepared as follows: The phe attenuator is removed by procedures similar to those described in Example 1 using site specific deletion. A DNA fragment, from 56 min. on the E. coli chromosome, containing the genes of the phe operon with the natural phe attenuator-promoter region replaced with a strong constitutive promoter sequence, is placed into an amplifiable high copy plasmid vector. The gene coding for the feed-back resistant first enzyme of the phe pathway is replaced with a gene encoding a feedback resistant enzyme. This biogenetic cassette containing all of the genes of the phe operon devoid of negative regulation for the efficient biosynthesis of L- phenylalanine can also be prepared (as in Example 1) with a unique restriction site or sites in the promoter site for the insertion of host specific promoter and vector sequences so that this cassette can be functional in any host for which specific promoter and vector sequences are now, or become, available. However, since L-phenylalanine is but one member of the aromatic amino acid family (L-phenylalanine, L-tryptophan and L-tyrosine) and since all of these amino acids are synthesized from a common branch point intermediate (chorismic acid) which is synthesized by a pathway subject to regulation by all of the aromatic amino acids, deregulation of this common pathway would also be important for the efficient production of L-phenylalanine. For example it would be advantageous in this case to replace one or two of the three genes for the feed-back sensitive DHAP synthase isozymes in the chorismic acid pathway with genes for feed-back insensitive DHAP synthases.

Although the invention has been described with reference to specific examples, many other embodiments fall within the scope and spirit of the present invention. Accordingly, it is intended that the protection afforded by this patent be limited only by the scope of the following claims, and reasonable equivalents thereof.

Claims

WHAT IS CLAIMED IS:

1. A recombinant DNA segment containing genes coding for at least one enzyme for each step in the biosynthetic or metabolic pathway for a desired biological product, wherein said pathway has at least two steps, and wherein i n vivo transcription of at least one of said genes is ordinarily subject to regulation and wherein at least one of said genes codes for an enzyme that is ordinarily subject to feedback inhibition, wherein all transcriptional regulatory sequences have been inactivated or removed from said segment, and wherein each gene in said segment that would otherwise code for a feedback- inhibited enzyme has been modified so that feedback inhibition has been removed, so that upon transcription of said segment and translation of the resulting RNA, said biosynthetic or metabolic pathway is unregulated, said segment having a first restriction site and a second restriction site with said genes located between said first and second restriction sites, wherein said first and second restriction sites do not occur elsewhere in said segment.

2. The segment of Claim 1, coding for the biosynthetic pathway for an amino acid.

3. The segment of Claim 2, wherein said amino acid is L-isoleucine.

4. The segment of Claim 2, wherein said amino acid is L-valine.

5. The segment of any of Claims 1-4, wherein said genes are in natural chromosomal order.

6. The segment of Claim 3, wherein said segment comprises ilvpe^da^dG⁺MEDA^rYC, wherein p indicates a promoter sequence, e indicates a leader sequence, a indicates an attenuator sequence, ⁺ indicates activity, ^d indicates deletion, and ^r indicates resistance to feedback inhibition.

7. The segment of Claim 1, wherein said pathway is a biosynthetic pathway, further comprising a lac operon in which the wild-type promoter sequence has been replaced with a different promoter sequence, and from which the lac repressor has been removed by site-specific deletion.

8. A recombinant DNA segment, comprising a methanol oxidase encoding gene and a dihydroxyacetone synthase encoding gene, both of which genes have been obtained from a methylotropic organism, and a promoter sequence directing the transcription of said genes, wherein said promoter sequence is different from the promoter sequence for said genes in said organism.

9. The DNA segment of Claim 8, further comprising a terminator site and a ribosome binding site for said genes.

10. The segment of any of Claims 1-7, wherein said segment further comprises the segment of Claim 8 or 9.

11. The segment of any of Claims 1-10 contained in a recombinant DNA vector.

12. A method for assembling a first unregulated biogenetic cassette containing DNA coding for a biosynthetic or metabolic pathway having at least two steps that is ordinarily regulated by both transcriptional regulation and feedback inhibition, wherein said cassette includes at least one gene for each step of said pathway, comprising the steps of: obtaining a modified gene for each enzyme in said pathway that is ordinarily subject to feedback inhibition, wherein the modification in each of said modified genes destroys said inhibition; removing the DNA sequence or sequences responsible for negative transcriptional regulation of genes for said pathway to obtain a deattenuated or derepressed operon; assembling all of the genes coding for at least one of the enzymes for each step in said pathway, including said modified genes, into a single DNA segment; providing a first restriction site on the 5' side of said genes and a second restriction site on the 3' side of said genes wherein said first and second restriction sites do not occur elsewhere in said segment; and cloning said DNA segment.

13. The method of Claim 12, further comprising: removing a promoter sequence and inserting a different promoter sequence for said genes into said segment.

14. The method of Claim 12 or 13, wherein the product of said pathway is an amino acid.

15. The method of Claim 14, wherein said amino acid is L-isoleucine.

16. The method of Claim 14, wherein said amino acid is L-valine.

17. The method of Claim 15, wherein said removing and assembling steps comprise:

(a) removing the attenuator sequence from an iluGMEDA operon to form a deattenuated operon; (b) replacing the wild-type i lvA with L-isoleucine- resistant ilvA^r; and

(c) assembling together in a single polymeric DNA molecule the deattenuated operon of step (a) containing the i lvA^r of step (b) and i lvYC to form a biogenetic cassette coding for the biosynthesis of L-isoleucine.

18. A method for creating a biogenetic cassette for methanol utilization, comprising the steps of: obtaining methanol oxidase and dihydroxyacetone synthase encoding genes from a methylotropic organism; removing the wild-type promoter sequence from said genes; creating a DNA segment containing said genes and a different promoter for said genes; and inserting said segment into a recombinant DNA transfer vector.

19. The method of Claim 18, further comprising the step of including ribosome binding and terminator sites in said segment.

20. The method of any of Claims 12-17, further comprising the step of combining said first biogenetic cassette with the biogenetic cassette of Claim 18 or 19.

21. The method of any of Claims 12-20, further comprising the step of expressing said genes in a microorganism.

h

f

\ /

s

0 N P

w