WO1989006701A1

WO1989006701A1 - Thiol-reactive oligonucleotide intermediates and processes for conjugation of oligonucleotides with enzymes

Info

Publication number: WO1989006701A1
Application number: PCT/US1989/000229
Authority: WO
Inventors: Todd M. Smith
Original assignee: Microprobe Corporation
Priority date: 1988-01-25
Filing date: 1989-01-20
Publication date: 1989-07-27
Also published as: AU3047889A

Abstract

This invention relates to thiol-reactive polynucleotide compounds and processes for use of these compounds to covalently conjugate an enzyme label to an oligonucleotide. Oligonucleotides are made thiol-reactive through a chemical modification which comprises the addition of a primary amine. The oligonucleotide so modified is then reacted with a hetero-bifunctional reagent in an acylation reaction, the hetero-bifunctional reagent having an amino-reactive and a thiol-reactive portion, such as an N-hydroxy succinimidyl (NHS) ester and an alpha-bromoacetamide, respectively. The enzyme is derivatized with a blocked, thiol-containing amino reactive reagent, such as dithio-bis-propionic acid N-hydroxysuccinimide ester. Conjugation is achieved under mild physiologic conditions through a specific reaction of the reactive moieties.

Description

THIOL-REACTIVE OLIGONUCLEOTIDE INTERMEDIATES AND PROCESSES FOR CONJUGATION OF OLIGONUCLEOTIDES WITH ENZYMES

BACKGROUND OF THE INVENTION

Field Of The Invention

This invention relates to thiol-reactive polynucleotide compounds and processes for use of these compounds to covalently conjugate an enzyme label to an oligonucleotide. Oligonucleotides are made thiol- reactive through a chemical modification which comprises the addition of a primary amine. The oligonucleotide so modified is then reacted with a hetero-bifunctional reagent in an acylation reaction, the hetero- bifunctional reagent having an amino-reactive and a thiol-reactive portion, such as an N-hydroxy succinimidyl (NHS) ester and an α-bromoacetamide, respectively. The enzyme is derivatized with a blocked, thiol-containing amino reactive reagent, such as dithio- bis-propionic acid N-hydroxysuccinimide ester. Conjugation is achieved under mild physiologic conditions through a specific reaction of the reactive moieties.

INFORMATION DISCLOSURE The use of enzymes for labeling nucleic acid probes is known (U.S. Patent No. 4,581,333). Methods of linking enzymes to polynucleotides have been reported (Jablonski, E. , et al., Preparation of Oligonucleotide- Alkaline Phosphatase Conjugates and Their Use as Hybridization Probes, Nuc. Acid Res., 14:6115-6128

(1986); Renz, M. and urz, C. , A Colorimetriσ Method for DNA Hybridization, Nucl. Acid Res., 12:3435-3444 (1984)). In Li, P., et al., Enzyme-linked Synthetic Oligonucleotide Probes: Non-radioactive Detection of Enterotoxigenic Escherichia Coli in Faecal Specimens, Nuσl. Acid Res., 15:5275-5287 (1987), hetero- bifunctional cross-linking agents were used to conjugate alkaline phosphatase with an oligonucleotide.

SUMMARY OF THE INVENTION This invention relates to polynucleotides and oligonucleotides covalently attached to a thiol reactive moiety. More specifically, this invention may be an oligonucleotide having a modified nucleotide of the formula:

wherein X is OH or H; wherein R is OH or an oligonucleotide; wherein A is -(P0₄)-R₂ where R₂ is a polynucleotide or when A is at the 5' terminus, R₂ is H or a thiol-reactive moiety covalently attached through a first linker arm; wherein B is adenine, guanine, thymine, or cytosine having a thiol-reactive moiety covalently attached through a second linker arm; with the further provision that the occurrence of modified nucleotide to natural nucleotides is less than or equal to one modified nucleotide per twenty natural nucleotides and only one thiol-reactive moiety is placed upon a modified nucleotide. More specifically, this invention is directed to a polynucleotide wherein A is at the 5' terminus and R₂ is a thiol-reactive moiety covalently attached through a linker arm. Preferably, R₂ is a radical of the formula -(CH₂)_n-Z-Y wherein Z is an -NH- or an -NHC:0(CH₂)_mNH-, Y is a thiol- reactive moiety, and n and m are the same or different and n and m are from 2 to 12 carbon atoms inclusive. The preferred range for n and m totaled are between 4 and 18, with between 6 and 10 being most preferred.

The preferred polynucleotide size is between 15 and 50 nucleotides with only a single nucleotide linked to a thiol-reactive moiety, and most preferably, the thiol-reactive nucleotide is on the 5* terminus. The thiol-reactive moieties have thiol reactive groups which are preferably an halo-carbonyl, or an α, β- unsaturated carbonyl. The most preferred thiol- reactive moieties are a haloaceta idobenzoyl and 4-(N- maleimidomethyl) cyclohexane-1-carbonyl. Preferred halogens are iodine and bromine.

This invention is also directed to an enzyme covalently thiolated with a thiolate selected from the group consisting of dithiobispropionic acid-N- hydroxysuccinimide ester, N-succinimidyl 3-(2- pyridyldithio)propionate (SPDP) , iminothiolane and 2- (acetylmercapto) succinic. anhydride (SAMSA) . Preferred enzymes include alkaline phosphatase and horseradish peroxidase. Iminothiolane derivatives (mercaptol- butylamidate, -NH(HN: ) C.H-(CH₂) ₃SH) are preferred thiolates for use with horseradish peroxidase.

Also disclosed herein are processes for covalently conjugating an enzyme to a polynucleotide which comprises:

1) binding a thiol-reactive moiety covalently to the polynucleotide;

2) binding a thiolate moiety to the enzyme; and

3) reacting the polynucleotide bound with a thiol-reactive moiety of step 1) with the thiolated enzyme of step 2) to form a thiol ether linkage and covalently conjugate the polynucleotide to the enzyme. The preferred thiol-reactive moieties are as provided above. The preferred enzyme is alkaline phosphatase, and the preferred thiols are as provided above. DETAILED DESCRIPTION OF THE INVENTION The compositions of this invention are useful intermediates for direct conjugation of enzymes to oligonucleotides or polynucleotides. The term "polynucleotide" is meant to include short segments of nucleotides typically described as oligonucleotides. The described processes provide for significantly increased yields during conjugation. There is less aggregation of protein and a greater yield of conjugate when oligonucleotides are derivatized by the thiol- reactive reagents.

The polynucleotides of this invention are typically between about 10 nucleotides and about 100 nucleotides. Size is not a critical factor. For a practical level of hybridization specificity to exist, the nucleotide number should exceed 10. The upper limit does not influence hybridization specificity and can exceed several thousand nucleotides.

The activated oligonucleotides used as starting materials for this invention can be derived through several methods. A reactive amine group can be situated using conventional chemistry on the 5* hydroxyl group of an oligonucleotide. The reagents for attachment of primary linker arms terminating in an amine are commercially available. A primary amine is the preferred activating group, and its attachment via a hexyl linker arm is preferred. Starting materials suitable for use in this invention are described in PCT U.S. 86/01290, Nucl. Acid Res., 15:3131 (1987); Nucl. Acid Res., 15:2891 (1987); and Nucl. Acid Res., 14:7985 (1986) .

DNA bases can also be modified to become thiol reactive. In the case of cytosine, a more nucleophilic amine is linked to the 4-position of cytosine by a variety of chemistries. The amine can be added by treatment with hydrazine to generate N-4-aminocytosine (Sverdlov E.D., et al., FEBS Letters, 62, p. 212, Feb. 1976) . This reaction is catalyzed by bisulfite. Alternatively, an amine can be added to the 4-position by bisulfite catalyzed transa ination reactions where a diaminoalkane is added to the 4-position (Shapiro & Weisgras, Biochemical and Biophysical Research Communications, 40:839, 1970). Semicarbazide can also be used to add nucleophilic amines to the 4-position of cytosine (Hayatsu & Ukita, Biochemical and Biophysical Research Communications, 14:198, 1964). The base is then^"made thiol reactive through the reaction of the nucleophilic amine and a NHS ester of a carboxylic acid derivative substituted with a α, /3-unsaturated carbonyl, or α halo-carbonyls.

Other nucleic acid bases with nucleophilic amines can be used for reactions with NHS esters of a carboxylic acid derivative substituted with α, β- unsaturated carbonyls, or α halo-carbonyls. For instance, 5-[N-(7-aminoheptyl)-l-acrylamido]-2'- deoxyuridine-5*-triphosphate (Calbiochem, La Jolla, CA) can be added to the 3 ' end of oligonucleotides in reactions with terminal deoxynucleotidyl transferase

("Molecular Cloning, A Laboratory Manual," T. Maniatis, et al. eds., Cold Spring Harbor Laboratory, p. 148, 1982) .

The activated oligonucleotide is covalently bound to a bifunctional reagent with one thiol-reactive group. The preferred thiol-reactive group is an α halo- carbonyl or an α, 3-unsaturated carbonyl. Preferred reagents have two different types of functional groups. These reagents typically have a thiol or sulfhydryl reactive group as the first functionality, and an N- hydroxysuccinimidyl (NHS) ester as a second functional group. The NHS ester acylates the free amine of the 5' end of the oligonucleotide. Acylating conditions are well known. The amide linkage, resulting from the acylation of the NHS group onto the oligonucleotide, resides at one end of the thiol-reactive moiety with the thiol-reactive group at the other end. The linkage or linker arm between the amide and the thiol-reactive group is a non-inventive and non-critical aspect of this invention. It is only necessary to recognize that the linker arms must not interfere with the thiol reactivity of the thiol-reactive group. The linkage can be aliphatic, an aryl, a cycloalkyl, or a combination of an aliphatic chain and a cyclic component. The total carbons should not exceed 20, with 12-6 being preferred. The aryl and cycloalkyls may be substituted with nitro, or halo substituents. The substituents should also not interfere with the reactivity of the thiol-reactive groups, and the overall size and polarity of the linkage should not affect the solubility of the oligonucleotide. A number of heterobifunctional compounds are commercially available.

The thiol-reactive group may be a maleimide, an activated disulfide such as a pyridyl disulfide, or a active halogen. The active halogens are typically α- haloacyl. Useful halogens include chlorine, bromine, iodine, and fluorine, with iodine and bromine being preferred. Reagents useful for this invention can be purchased from Pierce Chemical Co., Rockford, IL. Examples include:

N-Succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB) ,

N-Succinimidyl 3-(2-pyridyldithio)propionate (SPDP) , m-Maleimidobenzoyl N-hydroxysuccinimide ester (MBS) , m-Maleimidobenzoyl sulfosuccinimide ester

(Sulfo-MBS) ,

N-Succinimidyl 4-(iodoacetamido)benzoate (SIAB) ,

Succinimidyl 4-(N-maleimidomethyl)cyclohexane- 1-carboxylate (SMCC) ,

Sulfosuccinimidyl 4-(p- malei idophenyl)butyrate(Sulfo-SMPB) . Thiol-containing heterobifunctional reagents useful for this invention contain an activated acyl group for reaction with amines on the target protein, and a blocked sulfhydryl group. Such reagents include dithiobis(succinimidylpropionate) (DSP), 3,3'- dithiobis(sulfosuσcinimidylpropionate) (DTSSP) , iminothiolane and S-acetylmercaptosuccinic anhydride (SAMSA) .

The thiol reagents are cross-linked to available amines of a selected enzyme. Enzymes include those enzymes for which a colorimetric or fluorimetric reaction can be monitored. Typically, these enzymes include hydrolases, particularly esterases, glycosidases, and phosphatases, or oxidoreductases, such as peroxidase.

Alternatively, an enzyme can be thiolated with a 10-100 fold molar excess of iminothiolane in an aqueous buffer, pH 6-9. After an incubation period of 30 minutes to one hour, the unreacted material is removed by gel filtration chromatography.

1. Preparation of a Thiolated Enzyme

An enzyme can be derivatized with a 10-100 molar excess of DSP at 20-30°C in an aqueous buffer, pH 6-9. After incubation of 30 minutes to one hour, the reaction is reduced with a reducing agent, such as β- mercaptoethanol, dithioerythritol, dithiothreitol at a 10-fold molar excess with respect to the DSP. The reduction is carried out for 15-30 minutes at 20-30°C, and the unreacted material is separated by gel filtration chromatography.

2. Preparation of a Thiol-Reactive Oligonucleotide

An oligonucleotide ("oligo") can be derivatized in water with a thiol-reactive group at the amine—linked ;to the 5' end of the oligo. The agent is added to the oligo in ^"aqueous conditions at a 10-100- fold molar excess. The pH is betwee*ϊ-_6-9 and the temperature is between 20-30°C. After a reaction period of 30 minutes to one hour, the excess reagent is removed by gel filtration chromatography.

3. Conjugation The thiolated-enzyme is reacted with the thiol-reactive oligo with the molar ratio of enzyme to oligo at 1.1-1:20 in an aqueous buffer of pH 7-8. After an incubation of 14-20 hours, the reaction is terminated with a 10-100-fold molar excess of N-ethylmaleimide, and the conjugate is separated from free oligo by chromatography on P-100. Free enzyme is then removed by chromatography on DEAE (B. Jablonski, et al.), Nucleic Acid Res., 14:6115-6128 (1986).

Once the oligonucleotide is cross-linked to the enzyme, it is useful as a probe in nucleic acid hybridization assays of all types. These assays have numerous applications in the medical and biological sciences, as well as in industrial and health related settings. A general review of these procedures can be found in Nucleic Acid Hybridization, A Practical

Approach, Ed. Hames, B.D. and Higgins, S.J., IRL Press, Wash., D.C. (1985); Hybridization of Nucleic Acids Immobilized on Solid Supports, Meinkoth, J. and Wahl, G., Anal. Biochem. , 238:267-284 (1984); U.S. Patent No. 4,358,535, which are incorporated herein by reference.

It is understood that hybridization conditions may need to be altered in accordance with the selected enzymes. Those enzymes which are sensitive to denaturing conditions may require hybridizing conditions that are less stringent than conditions that would not affect enzymes less susceptible to denaturing conditions. Alkaline phosphatase is a particularly hardy enzyme for general use in nucleic acid hybridization assays.

Example 1

Direct conjugation of alkaline phosphatase to short probe involves conjugation via heterobifunctional reagents. The first step is to modify a synthetic probe as described herein with a linker arm reagent attached to the terminal 5'-hydroxyl.

An aminohexyl linker arm with a terminal amino group is attached to the 5'-hydroxyl of the synthetic oligodeoxynucleotide on an automated DNA synthesizer as the last step in the synthesis. The reagent used for linker arm introduction is 6-(methoxytritylamino)hexyl 2-cyanoethyl N,N-diisopropylphosphoramidite, prepared from 6-aminohexanol in a manner similar to the synthesis of the 3-(methoxytritylamino)propyl methyl N,N- diisopropylphosphoramidite, as described by B.A.

Connolly, Nucl. Acids Res., 15:3131 (1987). The linker arm was attached to the probe, and the deprotected probe purified in a method similar to the methods described in the Connolly reference. The synthetic probe chosen for this example was designated HPV-16-2B. It has a 24 mer oligonucleotide having the following sequence: 5'GAAGCGTAGAGTCACACTTGCAAC3 ' . HPV-16-2B is selective for human papillo a virus type 16 {HPV} and is complementary to a region in the E7 viral gene having the coordinates of 694-717, where coordinate 1 is the first G in the Hpa site on the 5' side of the E gene.

Alkaline phosphatase ("AP") is thiolated with dithiobis(succinimidylpropionate) ("DSP") and the oligonucleotide is derivatized with the thiol-reactive agent N-succinimidyl (4-iodoacetyl)aminobenzoate ("SLAB") through the amino linker arm. SIAB- oligonucleotide is prepared by adding 1.2μg SIAB to 300μg of the oligonucleotide in 0.05M carbonate, pH 9.5, reacting for one hour at room temperature, and then desalting over a Sephadex G-25 column, in .02M sodium phosphate/5mM EDTA at pH 6.0. DSP-AP is prepared by adding 800μg DSP to 4mg alkaline phosphatase in 0.02M phosphate, pH 6.8. The reaction is allowed to proceed for 30 minutes at room temperature, and then is reduced with dithiothreitol for 15 minutes at room temperature and desalted over a

Sephadex G-25 column in .02M sodium phosphate/5mM EDTA at pH 6.0.

The SIAB-oligonucleotide is mixed with the DSP-AP at 4:1 oligo:AP ratio. 5M NaCl is added to the reaction to bring the final NaCl to 3M, and the pH is brought to 7.5 with a 0.1 volume of 1M Tris pH 7.5. The reaction is allowed to proceed overnight (16 hours) and then stopped with N-ethylmaleimide (.02μl of lOmg/ml) . The conjugate is separated from free oligo by chromatography on a P-100 column (Bio-Rad, Richmond,

CA) , and free alkaline phosphatase is removed by anion exchange chromatography through a 1cm² DE52 column (Whatman, Clifton, NJ) .

Example 2 Comparative data indicates that the overall yield for the conjugation reaction, where the oligonucleotide is derivatized with SIAB and the alkaline phosphatase is derivatized with DSP, exceeds by 81% the comparable reaction, where the radioactively- labeled oligonucleotide is derivatized with DSP and the AP is derivatized with SIAB.

Stock solutions of DSP-HPV16-2B (6.19mg/ml), SMCC-HPV16-2B (7.08mg/ml) and SIAB-HPV16-2B (6.85mg/ml) were prepared. Stock solutions of AP derivatized with DSP (2.9mg/ml), SMCC (5.82mg/ml), or SIAB (3.18mg/ml) were prepared. Reactants (.25ml derivatized AP and .018ml derivatized oligo), which contained a blocked thio group, were reduced by adding a tenth volume of a 1M solution of dithiothreitol and incubating at room temperature for 30 minutes. Residual dithiothreitol was removed by running each reduced reactant through a G-25 spin column. Ultraviolet absorbance is used to determine the concentrations after the spin column. Four conjugation reactions were run:

(1) 140μg DSP-AP and 30μg SIAB-Oligo;

(2) 140μg DSP-AP and 30μg SMCC-Oligo; (3) 30μg DSP-Oligo and 140μg SIAB-AP; and

(4) 30μg DSP-Oligo and 140μg SMCC-AP. Each of the four reactions had 4 nmol oligo and 1 nmol alkaline phosphatase. The reactants were dried in a speed vacuum. 50μl of distilled water were added to reactions 1 and 2, and 20μl of distilled water were added to reactions 3 and 4.

The samples were incubated for 16 hours at room temperature in 3-5M NaCl, 0.01-O.lM phosphate, pH 7.5. Reactions 1 and 2 required more volume due to higher NaCl; prior to speed vacuuming, reactions 1 and 2 had a larger volume which contained more NaCl. The spin columns had 3M NaCl in them. Following overnight incubation, each sample was brought to lOOμl with distilled water. Ten miσroliters of samples 1-4 were loaded onto SDS-10% polyacrylamide gels, and the autoradiographic results interpreted using a densitometer. The densitometer readings compared relative density of the reactants and the conjugates. Those reactions having the protein thiolated had a conjugation efficiency of almost twice that of the reaction having the oligo thiolated. See Table 1.

Example 3

Conjugated AP-HPV-16 was used to detect HPV geno ic sequences in CaSki cells (ATCC CLR 1550) . The cells were maintained according to the subculturing procedures provided by the ATCC. The' cells can be grown directly upon a microscope^' slide. Approximately 10,000 CaSki cells are spotted on the glass slide in lOOμl of the culture media. The cells are cultured at 37°C for 12 hours. This allows for the generation of as many as 50,000 cells adhering to the glass surface. Prior to in situ hybridization, the slides are dipped twice into PBS solution, rinsed in 95% ethanol, fixed in Carnoy's B solution for three minutes, and then dipped once into 95% ethanol. The slides are then lightly blotted to remove excess solution, air-dried for ten minutes, and stored at- 20°C until used.

PBS is 0.01M sodium phosphate (pH 7.4), 0.13 M NaCl. Carony's B solution is 10% (v/v) acetic acid, 30% (v/v) chloroform, 60% (v/v) ethanol.

For the in situ assay, the cells are first pretreated with a blocking buffer of 1.0M ethanolamine pH 8.0. 0.2M HEPES, 5x Denhardts solution, 0.2mg/ml hydrolyzed yeast RNA, and 0.5% triton x-100. After 15 minutes at room temperature, this solution is aspirated. Denhardt's solution is 0.02% Ficoll 400, 0.02% polyvinylpyrolidone (MW 360,000), and 0.2% bovine serum albumin.

Following target denaturation in 0.2N NaOH for one minute, the denaturation solution is removed by aspiration, the probe-enzyme (conjugate) is added to the hybridization solution, and hybridized to the target.

The probe is at a concentration of 50ng/ml in 5% Dextran sulfate, .5% Triton X-100, 0.02M HEPES pH 7.5, 5X Denhardts, 0.2mg/ml hydrolyzed yeast RNA. Following hybridization for 30 minutes at room temperature, the cells are washed twice in 0.1M Tris/0.1% Triton-X-100 for 5 minutes at room temperature and once in 0.1M Tris (pH.8.5), 0.1M NaCl and 0.05 M MgCl₂ for 5 minutes_# Signal is then developed in 0.1M Tris pH 8.5, 50mM MgCl , 0.1M NaCl containing 33mg/ml nitrobluetetrazolium (NBT) and 25μg/ml BCIP (5-Bromo-4-chloro-3-indolyl phosphate) .

Example 4

Conjugated AP-HPV16 was used to detect less than l.Ong of HPV16 plasmid DNA on filters. The filters were prepared by adding lOOμl from dilutions of denatured target DNA on nitrocellulose filters. The target was diluted from 2.Oμg/ml by 10-fold dilution in 0.4N NaOH. Salmon sperm carrier DNA was added to keep the total DNA at 2.Oμg/ml. The denatured DNA was neutralized with an equal volume of 2M NH.OAc, 0.1ml of each dilution was applied to the filters and slot blot apparatus (Schleicher and Schuell, Keene, NJ) , and the filters were baked at 80°C for one hour and stored at room temperature. Prior to hybridization, the filter was prehybridized in hybridization buffer (30% formamide, .6M NaCl, 0.09M Tris pH 8.0, 0.01M EDTA, .5% SDS, 5x Denhardts) , for 15 minutes at room temperature. After prehybridization, probe was added to a final concentration of 50ng/ml and the hybridization was carried out for one hour at room temperature. After hybridization, the filters were washed two times for 10 minutes each at 55°C in wash buffer (.45M NaCl, 0.045M

Tris, 3mM EDTA, 0.1% SDS pH 8.0), followed by a wash for five minutes at room temperature in .1M Tris pH 8.5/.1M NaCl/.05M MgCl_. The color was developed for six hours in 1M Tris pH 8.5/.1M NaCl/.05M MgCl containing 0.33mg/ml NBT and 0.166 mg/ml BCIP.

Example 5

The thiol reactive oligo is conjugated to horseradish peroxidase [HRP] by a method similar to that described for alkaline phosphatase. To 20 mg. HRP in 0.5 ml of 0.1M borate pH 8.5, 5 mg iminothiolane is added. The reaction is incubated at room temperature for 30 minutes and is then passed over a PD-10 column (Pharmacia, Piscataway, NJ) in water. The HRP solution is concentrated in a centricon-30 (A icon, Danvers, MA) to 100 mg/ml.

To every 0.05 mg of lyophilized thiol-reactive oligo, 0.25 mg of SH-HRP from the above concentrated solution is added, along with 0.1 volume of 1.0M Tris pH 8.0. The reaction is then incubated for 16 hrs. at room temperature in the dark. Prior to purification, the reaction is quenched with N-ethylmaleide, which is added to a final concentration of lOmM. The free oligo and HRP are then removed by HPLC on a zorbax GF-250 (Dupont, Wilmington, DE) size exclusion column in a O.IM tris/l.OM buffer.

TABLE 1

Relative Conjugation Efficiency

Relative O.D. of the Reaction Integrated Peaks % Conjugation Total O.D.

Conjugate Oligo

1 4.61 2.27 67 6.88

2 4.81 2.35 67.2 7.16

3 3.29 5.50 37.4 8.79

4 3.28 5.15 38.9 8.43

Claims

WE CLAIM:

1. A polynucleotide having at least one modified nucleotide having a thiol-reactive moiety, said nucleotide having the formula: A

CH₂ B

wherein

X is OH or H; R is OH or a nucleotide; A is -(P0₄)-R₂ where R₂ is a polynucleotide or when A is at the 5' terminus, R₂ is H or a thiol-reactive moiety covalently attached through a first linker arm;

B is purine, adenine, guanine, thymine, or cytosine having a thiol-reactive moiety covalently attached, through a second linker arm; with the provision that the occurrence of modified nucleotide to natural nucleotides is less than or equal to one modified nucleotide for every twenty natural nucleotides, and only one thiol-reactive moiety is placed upon a modified nucleotide.

2. The polynucleotide of claim 1 wherein A is at the 5' terminus and R is a thiol-reactive. moiety covalently attached through a linker arm.

3. The polynucleotide of claim 2 wherein R₂ is a thiol-reactive moiety covalently attached through a linker arm such that R₂ is -(CH )_n-Z-Y where Z is -NH- or -NHC:O(CH₂)_mNH-, Y is a thiol reactive moiety, m is 2-12 inclusive, and n is 2-12 inclusive.

4. A. polynucleotide of claim 3 where n is six and Z is -NH-.

5. The polynucleotide of claim 4 wherein the number of bases is between 15 and 50, and wherein only a single base is modified to have a thiol-reactive moiety.

6. The polynucleotide of claim 1 wherein the reactive group upon the thiol-reactive moiety is an halo-carbonyl or an α, 3-unsaturated carbonyl.

7. The polynucleotide of claim 6 wherein the thiol-reactive moiety is selected from the group comprising haloacetamidobenzoyl^"and 4-(N- maleimidomethyl)-cyclohexane-1-carbonyl.

8. The polynucleotide of claim 3 wherein the reactive group upon,the thiol-reactive moiety is an a halo-carbonyl or an a , /3-unsaturated carbonyl.

9. The polynucleotide of claim 8 wherein the thiol-reactive moiety is selected from the group comprising haloacetamidobenzoyl and 4-(N— maleimidomethyl)cyclohexane-1-carbonyl.

10. A polynucleotide according to claim 4, wherein the thiol-reactive moiety is selected from the group comprising haloacetamidobenzoyl and 4-(N- aleimidomethyl)-cyclohexane-1-carbonyl.

11. A polynucleotide covalently attached to a thiol-reactive moiety.

12. A polynucleotide according to claim 5 wherein the thiol-reactive moiety is selected from the group comprising haloacetamidobenzoyl and 4-(N- maleimidomethyl)cyclohexane-1-carbonyl.

13. A polynucleotide according to claim 12 wherein the thiol-reactive moiety is iodoacetamidobenzoyl.

14. A polynucleotide according to claim 12 wherein the thiol-reactive moiety is bromoacεtylamidobenzoyl.

15. Alkaline phosphatase covalently thiolated with a blocked thiol selected from the group consisting of dithio-bis-propionic acid-N-hydroxysuccimide ester, N-succinimidyl 3-(2-pyridyldithio)propionate and 2- (acetyl ercapto) succinic anhydride.

16. The alkaline phosphatase according to claim 15 wherein the thiol is dithio-bis-propionic acid- N-hydroxysuccimide ester.

17. A process for covalently conjugating an enzyme to a polynucleotide which comprises:

(a) binding a thiol-reactive moiety covalently to the polynucleotide;

(b) binding a thiolate moiety to the enzyme; and

(c) reacting the polynucleotide bound to a thiol-reactive moiety of step (a) with the thiolated enzyme of step (b) to covalently conjugate the polynucleotide to the enzyme.

18. The process according to claim 17 wherein the polynucleotide is bound to a thiol reactive moiety selected from the group consisting of haloacetamidobenzoyl and 4-(N- maleimidomethyl) cyclohexane-1-carbonyl.

19. A process according to claim 18 wherein the thiol-reactive moiety is iodoacetamidobenzoyl.

20. A process according to claim 19 wherein the enzyme is alkaline phosphatase.

21. A process according to claim 20 wherein the blocked thiol moiety is selected from the group consisting of dithio-bis-propionic acid-N- hydroxysuccimide ester, N-succinimidyl 3-(2- pyridyldithio)propionate, and 2-(acetyl- mercapto)succinic anhydride.

22. A process according to claim 17 wherein the enzyme is horseradish peroxidase.

23. A process according to claim 22 wherein the thiolate moiety is mercaptol-butylamidate.