WO1996013520A1

WO1996013520A1 - Genes encoding a family of potassium channels

Info

Publication number: WO1996013520A1
Application number: PCT/US1995/014364
Authority: WO
Inventors: Mark Henry Pausch; Laura Alicia Price
Original assignee: American Cyanamid Company
Priority date: 1994-10-31
Filing date: 1995-10-25
Publication date: 1996-05-09
Also published as: JPH10508473A; US5559026A; AU4146996A; EP0789712A1

Abstract

This invention relates generally to the potassium channel gene family. More particularly, the present invention relates to the cloning and characterization of potassium channel genes from Drosophila melanogaster and Caenorhabditis elegans. Other aspects of the present invention include methods of assaying substances to determine effects on cell growth. Also presented are methods of controlling nematode and insect pests by inhibiting potassium channels substantially homologous to those encoded by nucleotide sequences as described herein.

Description

GENES ENCODING A FAMILY OF POTASSIUM CHANNELS

Field of Invention

This invention relates generally to the potassium channel gene family. More particularly, the present invention relates to the cloning and

characterization of potassium channel genes from

Drosophila melanogaster and Caenorhabditis elegans.

Background of the Invention

Synthetic organic insecticides are primarily nerve poisons acting on the cholinergic system

(organophosphorus compounds and methylcarbamates), the voltage-gated sodium channel (pyrethroids and DDT), and the GABA-gated chloride channel (cyclodienes and other polychlorocycloalkanes). Potassium channels comprise a large and diverse group of integral

membrane proteins that determine the level of

excitability and repolarization properties of neurons and muscle fibers [B. Hille, Ionic Channels of

Excitable Membranes, Sinauer, Sunderland, MA (1984)]. The multiple essential functions encoded by the potassium channels make them excellent targets for new pesticides and animal and human therapeutics.

Potassium channel diversity in the fruitfly Drosophila melanogaster results from an extended gene family coding for homologous proteins. Six genes encoding potassium channels have been cloned from Drosophila melanogaster which account for a large part of the diversity of potassium currents observed in insect nervous tissue [A. Wei, M. Covarrubias, A. Butler, K. Baker, M. Pak, L. Salkoff, Science 248, 599-603

(1990), N.S. Atkinson, G.A. Robertson, B. Ganetzky, Science 253,551-555, (1991), J. Warmke , R. Drysdale, B. Ganetzky, Science 252, 1560-1564 (1991), A.

Bruggemann, L.A. Pardo, W. Stuhmer, 0. Pongs, Nature 365, 445-448 (1993)]. ShaJcer and Shal encode voltage- gated potassium channels with rapid current activation and inactivating properties. Shab and Shaw encode delayed rectifier channels, with slow inactivating (Shah) and non-inactivating (Shav) properties. Slo encodes a calcium-activated potassium channel and eag encodes a voltage-gated channel permeable to both potassium and calcium which is modulated by cyclic AMP.

Modulation of cardiac action potential by compounds that effect the behavior of potassium channels may be a useful treatment for serious heart conditions. In this regard, each of the potassium channels cloned from insects have corresponding versions in mammalian species, including,

specifically, a delayed rectifier potassium channel homolog, RAK, cloned from rat cardiac tissue [M.

Paulmichl, P. Νasmith, R. Hellmiss, K. Reed, W.A.

Boyle, J.M. Νerbonne, E.G. Peralta, D.E. Clapham, Proc. Natl. Acad. Sci USA 88, 7892-7895 (1991)].

Thus, the RAK channel represents an important target of new drugs for the control of heart failure. The delayed rectifier potassium current in heart cells regulates the duration of the plateau of the cardiac action potential by countering the depolarizing, inward calcium current. Delayed rectifier potassium currents characteristically are activated upon

depolarization from rest, display a sigmoidal or delayed onset, and have a nonlinear, or rectifying, current-voltage relation. Several types of delayed potassium conductances have been identified in cardiac cells based on measured single-channel conductances. Heart rate and contractility are regulated by second messenger modification of delayed rectifier potassium conductances, and species differences in the shape of the plateau may be influenced by the type and level of channel expression.

On the basis of predicted membrane spanning topology, potassium channels may be subdivided into two distinct classes: voltage-gated, calcium-activated, and cyclic nucleotide-gated potassium channels that are composed of six membrane spanning domains (S1-S6) and a single pore forming domain (H5), and inward rectifying potassium channels that pass through the membrane twice and also contain a single pore forming region [Y. Kubo, E. Reuveny, P.A.

Slesinger, Y.N. Jan, L.Y. Jan Nature 364, 802-806 (1993); Y. Kubo, T.J. Baldwin, Y.Ν. Jan, L.Y. Jan Nature 362, 127-133 (1993)]. Here, we report the cloning and functional expression in yeast of a novel Drosophila melanogaster potassium channel. Further, we identify a Caenorhabditis elegans homolog that constitutes the second member of a new family of potassium channels exhibiting a topological

configuration unique among the known classes of potassium channels.

The yeast Saccharomyces cerevisiae is utilized as a model eukaryotic organism for the purpose of studying potassium transport mechanisms. Due to the ease with which one can manipulate the genetic constitution of the yeast Saccharomyces cerevisiae, researchers have developed a detailed understanding of many complex biological pathways, including potassium transport. In yeast, high

affinity potassium uptake is performed by the product of the TBK1 gene [R.F. Gaber, CA. Styles, G.R. Fink Mol . Cell . Biol . 8 , 2848-2859 (1988)]. Mutant yeast strains lacking trk1 function are incapable of growing in medium lacking high concentrations of potassium. Since potassium transport mechanisms are present in organisms as divergent as yeast and man, one could predict that expression of heterologous potassium channels in mutant cells might replace trkl function, and support growth on medium containing low potassium concentration. In this regard, plant potassium channels were shown to function in yeast and represent important targets for new herbicides [J.A Anderson, S.S. Huprikar, L.V. Kochian, W.J. Lucas, R.F. Gaber, Proc. Natl . Acad. Sci USA 89, 3736-3740 (1992); H. Sentenac, N. Bonnaud, M. Minet, F. Lacroute, J.-M. Salmon, F. Gaynard, C. Grignon, Science 256, 663-665 (1992); D.P. Schachtman and J.I. Schroeder, Nature 370, 655-658]. Thus, we have employed this yeast expression system for cloning and expression of potassium channels from heterologous species, making it useful for discovery of new pesticides, and animal and human therapeutics. Discovery of such compounds will necessarily require screening assays of high specificity and throughput. For example, new

pesticides directed at potassium channels require high selectivity for insect channels and low activity against non-insect species. Screening assays

utilizing yeast strains genetically modified to accommodate functional expression of heterologous potassium channels offer significant advantages in this area. Summary of the Invention

A first aspect of the present invention is the discovery of a new subclass of potassium channel genes and proteins encoded thereby. Potassium

channels belonging to this new subclass comprise four hydrophobic domains capable of forming transmembrane helices, wherein a first pore-forming domain is interposed between the first and second transmembrane helices and a second pore-forming domain is interposed between the third and fourth transmembrane helices, and wherein each pore-forming domain contains a potassium selective peptide motif. In preferred embodiments, the peptide motif is selected from the group consisting of a Y/F-G dipeptide motif.

In certain preferred embodiments, the isolation and characterization of invertebrate (i.e. insect and nematode) potassium channel genes belonging to this new subclass is presented. In more preferred embodiments, the present invention provides for the isolation of complementary DMA fragments from

Drosophila melanogaster and Caenorhabditis elegans which encode conserved amino acid sequence elements unique to this potassium channel gene family. A yeast expression technology is employed to clone cDNAs from Drosophila melanogaster and C. elegans and a

hybridization approach is utilized to isolate

additional cDMAs from Caenorhabditis elegans .

A second aspect of the present invention is a method of assaying substances to determine effects on cell growth. Yeast cells of the kind described above are cultured in appropriate growth medium to cause expression of heterologous proteins, embedded in agar growth medium, and exposed to chemical compounds applied to the surface of the agar plates. Effects on the growth of embedded cells are found around

compounds that have effects on the heterologous potassium channel.

A third aspect of the present invention is a method of controlling nematode and insect pests by inhibiting potassium channels substantially homologous to those encoded by nucleotide sequences as presented herein. Brief Description of the Drawings

FIGURE 1. Growth of CY162 cells bearing pDmORF1.

CY162 cells transformed with plasmids isolated from survivors of a primary library screen for plasmids that support the growth of CY162 on medium contain low potassium concentration. Six individual transformants of each plasmid-bearing strain are cultured in patches on the indicated medium. CY162 cells bearing pDmORF1 are found in the upper left-hand corner of each plate while pKAT1 containing cells are found in the lower right hand corner.

FIGURE 2A and 2B. DNA sequence and deduced amino acid sequence of Dm ORF1 [SEQ ID NOS : 1 and 2]. The

nucleotide sequence of the 2.4 kb cDNA revealed a single long open reading frame proximal to the GAL1 promoter. Segments corresponding to putative

transmembrane (M1-M4) and pore-forming H5 domains in the predicted polypeptide are underlined. The single amino-terminal asparagine linked glycosylation site is indicated by a G.

FIGURE 3A and 3B. DNA sequence and deduced amino acid sequence of the F22b7.7 segment of the Caenorhabditis elegans genome [SEQ ID NO: 3]. Segments corresponding to putative transmembrane (M1-M4) and pore-forming H5 domains in the predicted polypeptide are underlined. FIGURE 4. Alignment of DmORF1 and F22b7.7 sequences. Protein-coding regions of DmORF1 [SEQ ID NO: 37] and F22b7.7 [SEQ ID NO: 38] (designated as CeORF-1 in this FIGURE) are compared using the protein sequence alignment algorithm in Genework DNA sequence analysis software. Identical amino acids are boxed.

FIGURE 5A. Comparison of the pore-forming domains of DmORF1 and F22b7.7. Amino acid sequences from the six cloned Drosophila melanogaster potassium channels and three inward rectifier channels [SEQ ID NOS: 7 through 21] are compared to DmORF1 and F22b7.7 within the pore-forming H5 regions. Amino acid identities are indicated by a vertical line and conserved

substitutions indicated by a dot. Amino acid

substitutions deemed acceptable are indicated.

FIGURE 5B. Hydropathy plot analysis of the DmORF1 and F22b7.7 polypeptide sequence. The Kyte-Doolittle hydropathy algorithm in the Geneworks DNA analysis software is used to predict the topology of DmORF1 and F22b7.7. The position of predicted membrane spanning domains (M1-M4) and pore-forming domains are

indicated. FIGURE 6. Predicted membrane spanning topology of DmORF1.

FIGURE 7. Heterologous potassium channel-dependent growth of plasmid bearing CY162 (trk1Δ) strains.

CY162 bearing pYES2, pKAT1, pDmORF1, and pRATRAK are cultured at 30°C for four days on arginine phosphate agar medium containing 0 mM, 0.2 mM, or 100 mM added KCl.

FIGURE 8. Inhibition of growth of yeast cells

containing heterologous potassium channels. CY162 cells (10⁵) bearing the indicated plasmids are plated in arginine phosphate agar medium containing 0.2 mM potassium chloride. Sterile filter disks were placed on the surface of the agar and saturated with 20 ml of a 1 M solution of potassium channel blocking compound. Clockwise from upper left-hand corner is BaCl₂, CsCl, TEA, and RbCl. KCl is applied to the center disk.

FIGURE 9A and 9B. DNA sequence and deduced amino acid sequence of CORK [SEQ ID NO: 36]. The nucleotide sequence of the 1.4 kb cDNA revealed a single long open reading frame proximal to the GAL1 promoter.

Segments corresponding to pore-forming H5 domains in the predicted polypeptide are underlined. Asparagine- linked glycosylation sites are indicated by a G.

Detailed Description of the Invention

Nucleotide bases are abbreviated herein as follows:

Ade;A-Adenine G-Guanine Ura; U-Uracil

C-Cytosine T-Thymine

Amino acid residues are abbreviated herein to either three letters or a single letter as follows:

Ala A-Alanine Leu;L-Leucine

Arg R-Arginine Lys;K-Lysine

Asn N-Asparagine Met;M-Methionine

Asp D-Aspartic acid Phe;F-Phenylalanine

Cys C-Cysteine Pro;P-Proline

Gln Q-Glutamine Ser;S-Serine

Glu E-Glutamic acid Thr;T-Threonine

Gly G-Glycine Trp;W-Tryptophan

His H-Histidine Tyr;Y-Tyrosine

Ile I-Isoleucine Val;V-Valine

The term "mammalian" as used herein refers to any mammalian species (e.g., human, mouse, rat, and monkey).

The term "heterologous" as used herein refers to DNA sequences, proteins, and other materials originating from organisms other than the organism used in the expression of the potassium channels or portions thereof, or described herein (e.g., mammalian, avian, amphibian, insect, plant), or combinations thereof not naturally found in yeast.

The terms "upstream" and "downstream" are used herein to refer to the direction of transcription and translation, with a sequence being transcribed or translated prior to another sequence being referred to as "upstream" of the latter.

The potassium channels of the present invention possess properties in common with known potassium channels

including, voltage-gated channels, calcium activated

channels, cyclic nucleotide gated channels, inward rectifier channels, and the like, and especially with regard to electrophysiological properties. Certain preferred channels exhibit inward and outward currents that are affected by potassium concentration, particularly characteristic of voltage-gated channels. The term "channel" and the nucleotide sequences encoding same, is intended to encompass subtypes of the aforementioned classes of channels, and mutants, derivatives and homologs thereof.

The nucleotide sequences encoding the potassium

channels or parts thereof may be expressed recombinantly, and utilized for a variety of reasons, the most notable of which is for screening of substances that modulate the activity of the potassium ion channels. Such substances, especially inhibitors of the activity of the potassium channels of the present invention, may be utilized as insecticides, antihelmenthics, drugs suitable for the control of heart failure, and the like.

Heterologous DNA sequences are typically expressed in a host by means of an expression vector. An expression vector is a replicable DNA construct in which a DNA sequence encoding the heterologous DNA sequence is operably linked to suitable control sequences capable of affecting the

expression of a protein or protein subunit coded for by the heterologous DNA sequence in the intended host. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and (optionally) sequences which control the termination of transcription and translation. Vectors useful for

practicing the present invention include plasmids, viruses (including bacteriophage), and integratable DNA fragments (i.e., fragments integratable into the host genome by genetic recombination). The vector may replicate and function independently of the host genome, as in the case of a plasmid, or may integrate into the genome itself, as in the case of an integratable DNA fragment. Suitable vectors will contain replicon and control sequences which are derived from species compatible with the intended expression host. For example, a promoter operable in a host cell is one which binds the RNA polymerase of that cell, and a ribosomal binding site operable in a host cell is one which binds the endogenous ribosomes of that cell.

DNA regions are operably associated when they are functionally related to each other. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of leader sequences, contiguous and in reading phase.

Transformed host cells of the present invention are cells which have been transformed or transfected with the vectors constructed using recombinant DNA techniques and express the protein or protein subunit coded for by the heterologous DNA sequences. In preferred embodiments, the transformed host cells are yeast. A variety of yeast cultures, and suitable expression vectors for transforming yeast cells, are known. See e.g., U.S. Patent No.

4,745,057; U.S. Patent No. 4,797,359; U.S. Patent No.

4,615,974; U.S. Patent No. 4,880,734; U.S. Patent No.

4,711,844; and U.S. Patent No. 4,865,989. Saccharomyces cerevisiae is the most commonly used among the yeasts, although a number of other yeast species are commonly available. See. e.g., U.S. Patent No. 4,806,472

(Kluveromyces lactis and expression vectors therefore);

4,855,231 (Pichia pastoris and expression vectors

therefore). A heterologous potassium channel may permit a yeast strain unable to grow in medium containing low

potassium concentration to survive [CY162, for example, see J.A Anderson, S.S. Huprikar, L.V. Kochian, W.J. Lucas, R.F. Gaber, Proc. Natl . Acad. Sci USA 89, 3736-3740 (1992)].

Yeast vectors may contain an origin of replication from the endogenous 2 micron (2μ) yeast plasmid or an autonomously replicating sequence (ARS) which confer on the plasmid the ability to replicate at high copy number in the yeast cell, centromeric (CEN) sequences which limit the ability of the plasmid to replicate at only low copy number in the yeast cell, a promoter, DNA encoding the heterologous DNA

sequences, sequences for poly-adenylation and transcription termination, and a selectable marker gene. An exemplary plasmid is YRp7, (Stinchcomb et al., (1979) Nature 282, 39; Kingsman et al., (1979) Gene 7, 141; Tschemper et al.,

(1980) Gene 10, 157]. This plasmid contains the TRP1 gene, which provides a selectable marker for a mutant strain of yeast lacking the ability to grow in the absence tryptophan, for example ATCC No. 44076. The presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors include the promoters for metallothionein (YEp52), 3-phosphoglycerate kinase [pPGKH, Hitzeman et al., (1980) J. Biol. Chem. 255, 2073] or other glycolytic enzymes [pYSK153, Hess et al., (1968) J. Adv. Enzyme Reg. 7, 149]; and Holland et al., (1978) Biochemistry 17, 4900], such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phospho-fructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, trioseposphate isomerase, phosphoglucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO Publn. No. 73,657. Other promoters, which have the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol

dehydrogenase 2 (pAD4M), isocytochrome C, acid phosphates, degradative enzymes associated with nitrogen metabolism, and the aforementioned metallothionein and glyceraldehyde-3- phosphate dehydrogenase, as well as enzymes responsible for maltose and galactose (pYES2) utilization. Finally, in constructing suitable expression plasmids, the termination sequences associated with these genes may also be ligated into the expression vector 3' of the heterologous coding sequences to provide polyadenylation and termination of the mRNA.

In one embodiment of the present invention, a yeast expression system is described, wherein yeast cells bear heterologous potassium channels. In preferred embodiments, these channels are DmORF-1, CORK, or RAK. As noted above, transformed host cells of the present invention express the proteins or proteins subunit coded for by the heterologous DNA sequences. When expressed, the potassium channel is located in the host cell membrane (i.e., physically

positioned therein in proper orientation for both the stereoselective binding of ligands and passage of potassium ions).

In certain preferred screening embodiments of the present invention, a transformed yeast cell is presented, containing a heterologous DNA sequence which codes for a rat cardiac delayed rectifier potassium channel, RAK, cloned into a suitable expression vector. RAK is capable of complementing the potassium-dependent phenotvpe of

Saccharomyces cerevisiae strain CY162 on medium containing low potassium concentration.

The potassium channel subclass of the present invention is characterized in that the potassium channels have four hydrophobic domains capable of forming transmembrane

helices. These channels are further characterized in that they comprise two pore-forming domains, one of which is interposed between said first helix and said second helix, and the other of which is interposed between said third helix and said fourth helix. The pore-forming domains further contain a potassium selective motif which serves to confer upon the channel the ability to pass potassium ions to the exclusion of other ions, such as sodium, calcium, and the like. In certain preferred embodiments, this motif contains the peptide Y/G, and particularly in either a dipeptide or tripeptide motif, and frequently with Y/F-G bonding. In most preferred embodiments, the motif is

selected from the group consisting of G-V-G, G-L-G, G-Y-G, G-F-G, and G-I-G.

In certain embodiments of the present invention, the potassium channel is positioned within a cell membrane in such a manner as to allow it to function as a modulator of the flow of potassium ions into and out of the cell. To best regulate this activity, at least one pore-forming domain may be positioned proximal to a exterior portion of the cell membrane.

In other embodiments, the potassium channels of the present invention further comprise an amino-terminal

glycosylation site, and especially wherein that site is asparagine-linked.

Potassium channels belonging to the subclass as

presented herein may be derived from a wide variety of animal species, both vertebrate and invertebrate. Using the yeast expression technology and other teachings as set forth herein, the present inventors have isolated a single 2463 base pair cDNA fragment from an invertebrate source,

designated Dm ORF1 [SEQ ID NO: 1], by complementation of the potassium-dependent phenotype of Saccharomyces cerevisiae strain CY162 (trk1Δ) on medium containing low potassium concentration [J.A Anderson, S.S. Huprikar, L.V. Kochian,

W.J. Lucas, R.F. Gaber, Proc. Natl. Acad. Sci USA 89, 3736- 3740 (1992)]. Dm ORF1 contains a single long open reading frame encoding a protein of 618 amino acids [SEQ ID NO: 2] that exhibits substantial amino acid identity to the pore- forming regions of other potassium channels. The DmORF1 contains structural features that distinguish it from other classes of potassium channels, including four hydrophobic domains capable of forming transmembrane helices (M1-M4) and two putative pore forming H5 domains found between

transmembrane helices M1 and M2 , and M3 and M4. Each pore forming H5 domain contains the Y/F-G dipeptide motif

required for potassium selectivity [L. Heginbotham, T.

Abramson, R. MacKinnon, Science 258, 1152-1155, (1992)]. This work was expanded to clone a construct derived from C. elegans having a single open reading frame sufficient to encode a protein of 434 amino acids, designated pCORK.

A search of the GENBANK database for DNA and protein sequences similar to DmORF1 revealed several cloned

potassium channel sequences including a putative protein coding DNA sequence, F22b7.7, reported in the Caenorhabditis elegans genome sequencing project [R. Wilson, R. Ainscough, K Anderson, et al. Nature 368, 32-38 (1994)]. The DΝA sequence contained a single long open reading frame

sufficient to encode a protein of 336 amino acids (predicted MW 38.5 kDa) with substantial homoiogy to known potassium channel sequences.

Using the hybridization approach, a cDΝA sequence designated CeORFl [SEQ ID NO: 38] was isolated by probing a Caenorhabditis elegans cDNA library with oligonucleotides designed using F22b7.7 DNA sequences [T.N. Davis and J.

Thorner Meth . Enzymol . 139, 246-262 (1987)]. CeORFl

contains a single long open reading frame encoding a protein that exhibits substantial amino acid identity to pore-forming regions of other potassium channels.

CeORF1 and pCORK each contain structural features similar to DmORF1, including two putative pore forming H5 domains. Each pore forming H5 domain contains the Y/F-G dipeptide motif required for potassium selectivity [L. Heginbotham, T. Abramson, R. MacKinnon, Science 258, 1152-1155, (1992)]. These features form the basis of the designation of a new sub-family of potassium channels comprising DmORF1, CORK, and CeORF1.

Other aspects of the present invention relate to methods of modulating potassium channel activity, by

affecting the ability of such channel to allow the flow of ions into, through, or out of a cellular membrane, and particularly when these ions are potassium ions. Certain substances whether biological or chemical in nature, may be applied to cell membranes having as an integral part of their structure, one or more potassium channels comprising the amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 36, or RAK, in an amount and for a time sufficient to affect the ability of the potassium channel to so regulate the flow of ions. Substances that are potassium channel blockers will inhibit the ability of the channel to regulate the flow of such ions. Substances that enhance such ability may be considered potassium channel "activators."

Substances that modulate the activity of RAK may do so by modulation of cardiac action potential, upward or downward.

Application of such substances may take the form of in vitro, ex vivo, or in vivo application, each in a

formulation suitable to deliver the substance to the cell membrane and to sustain such delivery for a time sufficient to allow the substance to interact with the membrane.

Appropriate formulations, concentrations of substances, application time, and other relevant parameters may be established by utilizing, inter alia , known assays for measuring ion channel current flow. Another suitable endpoint one skilled in the art may utilize in optimizing these parameters, especially in the case of potassium channel blockers, is "cell death". Such assays may be performed in vitro and extrapolated to in vivo conditions, or in some cases may be easily established directly in vivo , as for example, by applying the substance directly to a test sample comprising the target insect pest (whole organism) and noting the appropriate parameters at which an acceptable per cent of insect death is attained.

In certain preferred embodiments, methods of

selectively inhibiting insect pests are presented by

applying to such insect pests a substance capable of

selectively inhibiting the activity of a potassium channel contained in the cells of such insect, and comprising the amino acid sequence of SEQ ID NO: 2, or a potassium channel substantially homologous thereto. In the most preferred embodiments, the inhibitor will inhibit the activity of the aforementioned potassium channel without inhibition of other, non-homologous potassium channels that may be present in species other than the targeted insect pest. It is envisioned that such other species may also be present at the site of application of the inhibitor, such as in a garden, crop, or other site wherein it is desired to control insect pests. In other preferred embodiments, methods of selectively inhibiting nematode pests are presented much in the same manner as discussed for control of insect pests, by applying to such pests a substance capable of selectively inhibiting the activity of a potassium channel contained in the cells of such pest, and comprising the the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 36, or potassium channels substantially homologous thereto.

The following Examples are provided to further

illustrate various aspects of the present invention. They are not to be construed as limiting the invention.

Example 1 Recombinant expression library screening. Saccharomyces cerevisiae strain CY162 is described in Anderson, J.A. et al. (1992) Proc. Natl. Adad. Sci. USA 89, 3736-3740]. Growth of bacterial strains and plasmid

manipulations are performed by standard methods (Maniatis T., Molecular Cloning. Cold Spring Harbor Laboratory Press, 1982). Media conditions for growth of yeast, isolation of plasmid DNA from yeast, and DNA-mediated transformation of yeast strains are as described (Rose M. D., Methods in yeast genetics, Cold Spring Harbor Laboratory Press, 1990). A multifunctional expression library constructed in pYES2 and containing cDNA made from 3rd instar male Drosophila

melanogaster mRNA is used as described [S.J. Elledge, J.T. Mulligan, S.W. Ramer, M. Spottswood, R.W. Davis Proc. Natl. Acad. Sci USA 88, 1731-1735 (1991)]. A multifunctional expression library constructed in pYES2 and containing cDNA made from mRNA obtained from all life stages of

Caenorhabditis elegans is custom-made by Invitrogen

Corporation.

Isolation of expression plasmids encoding heterologous potassium channels. CY162 cells are transformed with plasmid DNA from each library to give 3 × 10⁶ transformants from each library on SCD-ura (synthetic complete dextrose (2 %) medium containing all necessary nutritional supplements except uracil) containing 0.1 M KCl agar medium.

Transformants are replica-plated to SCG-ura (synthetic complete galactose (2 %) medium containing all necessary nutritional supplements except uracil) agar medium.

Colonies that grow on this selective agar medium are

transferred to SCG-ura agar medium to obtain single colonies clones and while reassaying suppression of the potassium-dependent phenotype. Plasmid DNA is isolated from surviving colonies and used to transform CY162. Six individual transformant strains containing one plasmid, pDmORF1 , that confers the potassium independent phenotype is cultured on SCD-ura and SCG-ura medium along with CY162 strains bearing pKAT1 , which encodes a plant inward rectifier potassium channel that supports the growth of CY162 on selective medium (FIGURE 1). The plasmid bearing strains exhibit potassium-independent growth on both dextrose and galactose containing medium. Growth on dextrose is likely due to basal level of transcription leading to sufficient potassium channel expression to support growth. Example 2

DNA sequence analysis of DmORF1. Plasmids that confer suppression of the potassium-dependent phenotype are

subjected to automated DNA sequence analysis performed by high temperature cycle sequencing (Applied Biosystems).

Geneworks DNA sequence analysis software (Intelligenetics) is used to align raw DNA sequence information and to

identify open reading frames. The DNA sequence of the 2.4 kb insert in pDmORF1 is displayed in FIGURE 2A and 2B [SEQ ID NO:l]. The 5' untranslated sequences of the cDNA contain long poly A and poly T tracts not likely to be found in protein coding regions. The first ATG proximal to the 5' end is present in a consensus Drosophila melanogaster translational initiation site [D.R. Cavener Nucleic Acids Res . , 15, 1353-1361 (1987)], consistent with the designation of this site as the translational start site. A single long open reading frame sufficient to encode a protein of 618 amino acids (predicted MW 68 kDa) is encoded in pDmORF1. A consensus polyadenylation site, AATCAA, occurs at position 2093-2098 in 3' untranslated sequences. The DmORF1 contains structural features that distinguish it from other classes of potassium channels, including four hydrophobic domains capable of forming transmembrane helices (M1-M4) and two pore forming H5 domains found between transmembrane helices M1 and M2 , and M3 and M4. Each pore forming H5 domain contains the Y/F-G dipeptide motif required for potassium selectivity [L. Heginbotham, T. Abramson, R. MacKinnon, Science 258, 1152-1155, (1992)].

Example 3

Identification of Caenorhabditis elegans sequences

homologous to DmORF1. A search of the GENBANK database protein sequences similar to DmORF1 reveals significant matches with several known potassium channel sequences. The closest match is to a putative protein coding DNA sequence, F22b7.7, reported in the Caenorhabditis elegans genome sequencing project [R. Wilson, R. Ainscough, K. Anderson, et al., Nature 368, 32-38 (1994)]. The DΝA sequence and predicted amino acid sequence assembled from putative exons recognized by a GEΝBAΝK exon identification algorithm is displayed in FIGURE 3A and 3B [SEQ ID ΝOS : 3 and 4]. The DΝA sequence contains a single long open reading frame

sufficient to encode a protein of 336 amino acids (predicted MW 38.5 kDa) with substantial homoiogy to known potassium channel sequences. The F22b7.7 sequence contains structural features that distinguish it from other classes of potassium channels, including three of four hydrophobic domains capable of forming transmembrane helices (M1-M4) identified in DmORF1 and two pore forming H5 domains found between transmembrane helices a predicted M1 and M2 , and M3 and M4. Each pore forming H5 domain contains the Y/F-G dipeptide motif required for potassium selectivity [L. Heginbotham, T. Abramson, R. MacKinnon, Science 258, 1152-1155, (1992)].

The lack of an amino terminal transmembrane domain

homologous to DmORF1 M1 in the F22b7.7 sequence may be due to failure of the search algorithm to identify exon(s) encoding the amino terminus. Alternatively, an amino terminal coding sequence may be added by trans-splicing, which occurs frequently in Caenorhabditis elegans . Example 4

Cloning and DNA sequence analysis of CeORF1.

Oligonucleotides corresponding to DNA sequences encoding the two pore forming domains of F22b7.7 are synthesized using an Applied Biosystems DNA synthesizer.

F22b7.7-H2-1:

5'TCCATTTTCTTTGCCGTAACCGTCGTCACTACCATCGGATACGGTAATCCA [SEQ ID NO:5]. F22b7.7-H2-2:

5'TCATTCTACTGGTCCTTCATTACAATGACTACTGTCGGGTTTGGCGACTTG [SEQ ID NO: 6]. The oligos were labelled at their 5' ends with ³²P using a 5'-end labelling kit according to manufacturers instructions (New England Nuclear). The labelled oligos are pooled and used to screen 6 × 10⁵ plaques from a λZAP-Caenorhabditis elegans cDNA library (obtained from

Clontech) by published methods [T.N. Davis and J. Thorner Meth . Enzymol . 139, 246-262 (1987)]. Hybridization is at 42°C for 16 hours. Positive clones are plaque-purified by twice repeating the hybridization screening process.

Plasmid DNAs , excised from phage DNA according to

manufacturers instructions, are subjected to automated DNA sequence analysis performed by high temperature cycle sequencing (Applied Biosystems). Geneworks DNA sequence analysis software (Intelligenetics) is used to align raw DNA sequence data and to identify open reading frames.

Example 5

Comparison of the putative proteins encoded by DmORF1 and F22b7.7. Predicted amino acid sequences of DmORF1 and F22b7.7 are aligned and displayed in FIGURE 4 [SEQ ID NOS: 37 and 38]. Only limited overall amino acid homoiogy is exhibited by these two proteins with regions of greatest homoiogy existing in the pore forming H2-1 and H2-2 domains. FIGURE 5A shows a comparison of the pore forming domains of DmORF1 and F22b7.7 with those of the known Drosophila melanogaster potassium channel and inward rectifier

sequences [SEQ ID NOS : 7 through 21]. Amino acid identities greater than 50 % are observed with all potassium channel sequences. FIGURE 5B shows hydropathy plot analysis of DmORF1 and F22b7.7. The two proteins, which show remarkable topological similiarity through their length, are predicted to be composed of four membrane-spanning hydrophobic domains (M1-M4), and two pore forming H2 domains. These data suggest the predicted topology shown in FIGURE 6. Both proteins are predicted to span the membrane four times with amino and carboxyl termini residing within the cell. This topology places the single amino-terminal asparagine-linked glycosylation site and H2 domains on the cell exterior permitting permeation of the membrane by the pore forming domains from the outside, an absolute requirement for the formation of a functional potassium channel.

Example 6 Functional expression of a rat atrial delayed rectifier potassium channel in yeast. CY162 transformants containing plasmids pKAT1, which encodes a plant inward rectifier potassium channel, pRATRAK, which encodes a rat atrial delayed rectifier potassium channel, pDmORF1, and control plasmid pYES are cultured on arginine-phosphate-dextrose agar medium lacking ura medium [A. Rodriguez-Navarro and J. Ramos, J. Bacteriol . 159, 940-945, (1984)] containing various KCl concentrations (FIGURE 7). Strains containing pKAT1, pRATRAK, and pDmORF1 all support the growth of CY162 on medium containing a low concentration of potassium, while pYES2 containing CY162 cells only grow on medium containing a high potassium concentration, indicating that heterologous potassium channels of several different types function to provide high affinity potassium uptake.

pRATRAK is constructed by modifying the protein-coding sequences of RATRAK to add 5' HindIII and 3' Xbal sites using PCR. In addition, four A residues are added to the sequences immediately 5' proximal to the initiator ATG to provide a good yeast translational initiation site. The modified fragment is cloned into the Hindlll and Xbal sites in the yeast expression vector pYES2 (Invitrogen), forming pRATRAK. Example 7

Bioassay of functional expression of heterologous potassium channels

Yeast strains dependent on heterologous potassium channels for growth should be sensitive to non-specific potassium channel blocking compounds. To test the potassium channel blocking properties of several compounds, a

convenient agar plate bioassay is employed. Strains

containing pKAT1, pRATRAK, pDmORF1 , and pYES2 are plated in arginine-phosphate-dextrose agar medium lacking ura and containing various amounts of potassium chloride. Arginine-phosphate-dextrose medium is used to avoid interference from potassium and ammonium ions present in standard synthetic yeast culture medium. Sterile filter disks were placed on the surface of the agar and saturated with potassium channel blocking ions CsCl, BaCl₂, and TEA. The growth of

heterologous potassium channel containing strains is

inhibited by potassium channel blocking ions, in a channel dependent manner. DmORF1-dependent growth is blocked by BaCl₂ but not by CsCl or TEA. KAT-dependent growth is blocked by BaCl₂, CsCl and TEA. RATRAK-dependent growth is blocked by BaCl₂, CsCl and TEA to a much greater extent than pKAT1, reflecting in part a slower growth rate of pRATRAK-containing cells. These observations confirm that these channels support the growth of the mutant yeast cells and demonstrate the efficacy of the yeast bioassay for screening for compounds that block potassium channel function. The control pYES-containing strain grows only around applied KCl and RbCl, a congener of KCl.

Example 8

Identification of compounds that alter potassium channel activity

Yeast strains made capable of growing on medium

containing low potassium concentration by expression of heterologous potassium channels are used to screen

libraries of chemical compounds of diverse structure for those that interfere with channel function. CY162 cells containing pKAT1, pRATRAK, pDmORF1, pCeORF1 , and pYES2-TRK1 (10⁴/ml) are plated in 200 ml of arginine-phosphate-dextrose agar medium lacking ura and containing 0.2 mM potassium chloride in 500 cm² plates. The CY162 cells bearing pYES2-TRK1 are included in the assay as a control to identify compounds that have non-specific effects on the yeast strain and are therefore not specifically active against the heterologous potassium channels. Samples of chemical compounds of diverse structure (2 μl of 10 mg/ml solution in DMSO) are applied to the surface of the hardened agar medium in a 24 × 24 array. The plates are incubated for 2 days at 30°C during which time the applied compounds radially diffuse into the agar medium. The effects of applied compounds on strains bearing heterologous potassium channel genes are compared to the pYES2-TRK1 bearing strain.

Compounds that cause a zone of growth inhibition around the point of application that is larger on plates containing cells bearing the heterologous potassium channels than that observed around the pYES2-TRK1 bearing strains are

considered selective potassium channel blockers. Compounds that induce a zone of enhanced growth around the point of application that is larger on plates containing cells bearing the heterologous potassium channels than that observed around the pYES2-TRK1 bearing strains are

considered selective potassium channel openers.

Example 9 DmORF1-induced currents in X. laevis oocytes assayed by two- electrode voltage clamp

DNA sequence analysis of the pDmORF insert strongly suggest that the protein encoded by the single long ORF possesses properties in common with known potassium

channels. To test this hypothesis, the electrophysiological properties of the putative potassium channel encoded by DmORF was examined by expression in X. laevis oocytes.

Currents were measured by two-electrode whole-cell voltage clamp. DNA sequences encoding the open reading frame of DmORF1 were amplified by polymerase chain reaction (PCR) using the following oligonucleotides:

MPO23: ATAAAGCTTAAAAATGTCGCCGAATCGATGGAT [SEQ ID NO: 22] MPO24: AGCTCTAGACCTCCATCTGGAAGCCCATGT [SEQ ID NO: 23]

The full length PCR product was cloned into corresponding sites in pSP64 poly A (Promega), forming pMP147. Template DNA was linearized with EcoRI and RNA transcribed using the Message Machine (Ambion) in vitro transcription kit

according to manufacturers instructions. A sample of the RNA was resolved in a MOPS-acetate-formaldehyde agarose gel and RNA content was estimated by ethidium bromide staining. The remainder was stored on dry ice. X. laevis oocytes were isolated and injected with 50 nl of sterile TE containing 5-20 ng transcript according to published procedures. After three days, whole oocyte currents were recorded using a two- electrode voltage clamp. Electrodes contained 3M KCl and had resistances of 0.3-1.0 MΩ. Recordings were performed with constant perfusion at room temperature in the presence of either low (10 mM) or high (90 mM) potassium chloride. Two electrode voltage clamp analysis of the DmORF1 gene product expressed in X. laevis oocytes demonstrates

properties of a voltage- and potassium-dependent potassium channel. At low potassium concentrations, DmORF1 exhibited outward current at depolarizing potentials. At high

potassium concentration, DmORF1 exhibits both inward and outward currents. The DmORF1 channel displays a high preference for potassium and shows cation selectivity in the rank order K>Rb>NH₄>Cs>Na>Li. Potassium currents were greatly attenuated by BaCl₂.

Example 10

Developmental regulation of DmORF1 expression in D.

melanogaster determined by northern blotting analysis

Isolation of pDmORF1 from a D. melanogaster expression library strongly suggests that the insert contained within originated in mRNA from that species. Detailed

understanding of the developmental regulation of DmORF1 expression should aid in determining strategies for use of DmORF1 as a target for novel insecticides. To characterize DmORF1 expression, northern blotting analysis of poly A RNA from various stages of the D. melanogaster life cycle was carried out.

D. melanogaster poly A⁺ RNA from embryo, larvae and adult forms (Invitrogen, 5 μg) was resolved in a MOPS- acetate-formaldehyde agarose gel according to standard procedures. The gel was stained with ethidium bromide and photographed to mark the positions of 18 S and 28 S

ribosomal RNAs used as molecular weight markers. RNA was transferred by capillary action to nitrocellulose with 10 × SSPE. The blot was air-dried, baked for one hour at 80°C, and prehybridized in 4x SSPE, 1% SDS, 2x Denhardt's, 0.1 % single stranded DNA at 68 °C for 2 hours.

A 2.4 kb Xhol fragment of DmORF1 was isolated from pDmORF1 and labeled with α-³²P dCTP using the Ready-to-Go kit (Pharmacia) according to manufacturers instructions. The probe was denatured by heating to 100°C for 5 minutes followed by quenching in an ice water bath. The probe was added to the prehybridization solution and hybridization continued for 24 hours at 68 °C.

The blot was washed briefly with 2x SSPE, 0.1% SDS at room temperature followed by 0.5 × SSPE, 0.1 % SDS at 65 °C for 2 hours. The blot was air-dried and exposed to

Reflection X-ray film (NEN) using an intensifying screen at -70 °C for 48 hours.

Northern blotting analysis indicates that the DmORF1 probe hybridizes to an mRNA species of approximately 2.8 kb isolated from D. melanogaster embryo, larvae, and adult forms. The length of the DmORF1 mRNA corresponds well with the length of the predicted ORF. Thus, the DmORF is expressed at all developmental stages in the life cycle of D. melanogaster. Example 11

Expression of the DmORF1 gene product in vitro.

DNA sequence analysis of the pDmORF1 insert reveals a single long ORF with conserved amino acid sequence domains in common with known potassium channels. The DNA sequence predicts an ORF sufficient to encode a protein of 618 amino acid in length. The DmORF1 polypeptide contains four segments of at least 20 hydrophobic amino acids in length suggesting that the segments span the plasma membrane. In addition, the DmORF1 protein sequence contains a putative N- linked glycosylation site (Asn-Thr-Thr) at amino acids 58- 60. To confirm that a protein of the predicted size of DmORF is expressed from the insert in pDmORF1 and to test the proposition that DmORF1 is glycosylated, pDmORF1 was used as template to drive coupled in vitro

transcription/translation.

Plasmid pMP147 was used as template to produce ³⁵S-labeled DmORF gene product in vitro using a TnT coupled transcription-translation kit (Promega) according to

manufacturers instructions. Glycosylation of the nascent DmORF1 polypeptide was accomplished by addition of canine pancreatic microsomes (Promega) to the transcription-translation reaction. Samples of glycosylated DmORF protein were treated with endoglycosidase H to remove added

carbohydrate moieties. Aliquots were precipitated with TCA and collected on GF/C filters, washed with ethanol, dried and counted. Equivalent cpm's were resolved by SDS-PAGE. The gel was impregnated with soluble fluor Amplify

(Amersham) and dried onto Whatman 3MM paper. The dried gel was exposed to Reflection X-ray film at room temperature.

Translation of the DmORF1 gene product in vitro

produced a polypeptide of 68 kDa, consistent with the predicted molecular weight of the ORF. Translation of

DmORF1 in the presence of canine pancreatic microsomes results in synthesis of a protein with reduced

electrophoretic mobility, consistent with glycosylation of the nascent polypeptide. Treatment of glycosylated DmORF with EndoH increased its relative mobility as expected upon removal of carbohydrate moieties. Thus, the pDmORF1 insert is capable of directing the expression of a glycoprotein with the expected molecular weight. EndoH treatment removes carbohydrate residues consistent with the sugar added through N-linked glycosylation.

Example 12

High-affinity K⁺ uptake and selectivity of DmORF1 expressed in yeast.

Expression of DmORF permits CY162 cells to grow on medium containing a low concentration of potassium, implying that DmORF1 supplies high affinity potassium uptake

capacity. To characterize the potassium uptake properties of CY162 cells containing DmORF1, ⁸⁶Rb uptake studies were performed. Examination of the uptake of this potassium congener revealed important aspects of potassium uptake by DmORF1.

Yeast strains containing heterologous potassium- expression plasmids CY162-DmORF1, CY162-pKAT and the control strain CY162-pYES2 (Clontech) were cultured overnight in SC Gal-ura containing 0.1 M KCl. The cells were harvested, washed with sterile doubled distilled water and starved for K⁺ for 6 hours in Ca-MES buffer. Cells were washed again and distributed to culture tubes (10⁸ cells/tube) containing ⁸⁶RbCl in Ca-MES buffer. The tubes were incubated at room temperature, samples filtered at various time intervals and counted. ⁸⁶Rb uptake into cells was displayed. For Double Reciprocal analysis, ⁸⁶Rb was held constant and barium ions varied to determine Ki values.

The high-affinity potassium uptake capacity encoded by DmORF1 permits high-affinity uptake of the potassium

congener, ⁸⁶Rb, as well. Barium inhibited ⁸⁶Rb uptake with a Ki of μM as demonstrated in Double Reciprocal analysis. No high affinity ⁸⁶Rb uptake is observed in control CY162-pYES2 cells and ⁸⁶Rb uptake into CYl62-pKAT cells is consistent with its published properties.

Example 13

Expression of Drosophila melanogaster potassium channels in yeast.

Voltage-gated potassium channel diversity in the fruitfly Drosophila melanogaster is encoded in large part by six genes, Shaker, Shab, Shal, Shaw, Eag, and Slo.

Expression of these potassium channels in yeast will permit their introduction into screening assays for novel

insecticidal compounds and facilitate characterization of their ion channel properties and sensitivity to compounds with activating and inhibitory properties.

DNA sequences encoding Drosophila melanogaster

potassium channels were amplified by PCR using synthetic oligonucleotides that add 5' HindIII or Kpn I, sites and 3'

XbaI, SphI, or XhoI sites:

Plasmids used as templates for the PCR reactions were:

pBSc-DShakerH37, pBSc-dShab11, pBSc-dSha12+(A)₃₆, pBScMXT- dShaw [A. Wei, M. Covarrubias, A. Butler, K. Baker, M. Pak, L. Salkoff, Science 248, 599-603 (1990), provided by L.

Salkoff], pBScMXT-slo,v4 [N.S. Atkinson, G.A. Robertson, B. Ganetzky, Science 253,551-555, (1991), provided by L.

Salkoff], and pBIMCH20 Eag [CH20] [J. Warmke, R. Drysdale, B. Ganetzky, Science 252, 1560-1564 (1991), A. Bruggemann, L.A. Pardo, W. Stuhmer, O. Pongs, Nature 365, 445-448

(1993), provided by B. Ganetzky].

Amplified fragments were digested with the appropriate restriction endonucleases, purified using GeneClean (Bio 101), and ligated into corresponding sites in pYES2

(Invitrogen). CY162 cells were transformed with assembled Drosophila melanogaster potassium channel expression

plasmids by the LiCl method and plated on SCD-ura containing 0.1M KCl agar medium. Selected transformants were tested for growth on arginine-phosphate-galactose (2 %) /sucrose (0.2 %)-ura agar medium containing 1-5 mM KCl. CY162 cells containing pKAT1 or pDmORF1 were cultured as positive controls and CY162 cells containing pYES2 were grown to provide a negative control.

CY162 cells bearing Drosophila melanogaster potassium channel expression plasmids survive under conditions in which growth is dependent on functional potassium channel expression. At potassium ion concentrations between 1-3 mM, negative control CY162 cells containing pYES2 grow poorly. Expression of the Drosophila melanogaster potassium channels Shal, Shaw and Eag substantially improve growth of CY162. These results are consistent with the Drosophila

melanogaster potassium channels providing high-affinity potassium uptake capacity. This capacity is apparently sufficient to replace the native high-affinity potassium transport capacity encoded by TRKl which is lacking in CY162 ( trk1 trk2) cells.

Example 14

Cloning of a novel C. elegans sequence with homology to potassium channels.

In order to expand the applicability of this technology to discover compounds with novel anhelmenthic activity, CY162 cells were transformed with a pYES2-based yeast expression library constructed using cDNA synthesized from C. elegans mRNA (Invitrogen). Plasmid DNA isolated from yeast cells that survived the selection scheme described in EXAMPLE 1 were subjected to automated DNA sequence analysis performed by high temperature cycle sequencing (Applied Biosystems). Geneworks DNA sequence analysis software

(Intelligenetics) is used to align raw DNA sequence

information and to identify open reading frames. The DNA sequence of the 1.4 kb insert in pCORK is displayed in

FIGURE 9A and 9B. The 5' untranslated sequences of the cDNA are present in this construct. A single long open reading frame sufficient to encode a protein of 434 amino acids (predicted MW 48 kDa) is predicted in pCORK [SEQ ID NO:38]. A consensus polyadenylation site, AATAAA, occurs at position 1359-1364 in 3' untranslated sequences and is followed by a tract of 15 consecutive A residues. The CORK ORF contains structural features that resemble pore forming H5 domains found in potassium channels. Two putative pore forming H5 domains (residues 76-39 and 150-162) contain the G-Y/F-G tripeptide motif required for potassium selectivity [L. Heginbotham, T. Abramson, R. MacKinnon, Science 258, 1152-1155, (1992)].

Claims

What is claimed is:

1. A potassium channel comprising four hydrophobic domains capable of forming transmembrane helices, wherein

(i) a first pore-forming domain is interposed between a first and a second transmembrane helix; and

(ii) a second pore-forming domain is interposed between a third and a fourth transmembrane helix.

2. The potassium channel of claim 1 wherein each pore-forming domain comprises a potassium selective peptide motif.

3. The potassium channel of claim 2 wherein the peptide motif is selected from the group consisting of a Y/F-G dipeptide motif and a G-Y/F-G tripeptide motif.

4. The potassium channel of claim 3 wherein at least one pore-forming domain is positioned proximal to an exterior portion of a cell membrane.

5. The potassium channel of claim 4 further comprising an amino-terminal glycosylation site.

6. The potassium channel of claim 5 wherein said

glycosylation site is asparagine-linked.

7. The potassium channel of claim 6 characterized in that it belongs to a class of invertebrates.

8. The potassium channel of claim 7 characterized in that it is insect-derived.

9. The potassium channel of claim 7 characterized in that it is nematode-derived.

10. An isolated nucleotide sequence capable of encoding DmORF-1.

11. The isolated nucleotide sequence of Claim 10 comprising the nucleotide sequence depicted in Seq. I.D. No. 1.

12. An isolated nucleotide sequence capable of encoding CORK.

13. The isolated nucleotide sequence of Claim 12 encoding for the protein depicted in Sequence I.D. No. 36.

14. An expression vector capable of expressing a

heterologous potassium channel in a cell membrane of a yeast cell comprising the nucleotide sequence of Claim 10.

15. An expression vector capable of expressing a

heterologous, potassium channel in a cell membrane of a yeast cell comprising the nucleotide sequence of Claim 11.

16. An expression vector capable of expressing a

heterologous potassium channel in a cell membrane of a yeast cell comprising the nucleotide sequence of Claim 12.

17. An expression vector capable of expressing a

heterologous potassium channel in a cell membrane of a yeast cell wherein the potassium channel comprises the amino acid sequence of Claim 13.

18. A transformed yeast cell comprising the nucleotide sequences of Claims 10, 11, 12 or 13.

19. A transformed yeast cell comprising the expression vector of claims 14, 15, 16 or 17.

20. A method of assaying substances to determine effects on cell growth, the method comprising the steps of: a. preparing cultures of yeast cells in liquid medium lacking uracil, the liquid medium consisting of a concentration of KCl adequate to support growth of potassium-dependent mutant strains; b. plating the yeast cells in uracil-free agar

medium, the agar medium consisting of sufficient KCl to selectively support growth of potassium- dependent mutant strains containing a heterologous potassium channel of claim 1; c. applying substances to the agar plate; d. incubating the agar plate to permit growth; and e. identifying zones of growth around the substances, wherein the level of growth indicates whether or not activity of the heterologous potassium channel has been modulated as compared to control.

21. The yeast cell of Claim 20 further comprising a

nucleotide sequence encoding RAK, or a nucleotide sequence of Claim 10, 11, 12 or 13.

22. The method of claim 20, wherein said effect on cell growth is modulated by activation of the potassium channel.

23. The method of claim 20, wherein said effect on cell growth is modulated by inhibition of said potassium

channel.

24. A method of selectively inhibiting insect pests by applying to such insect pests a substance capable of inhibiting a potassium channel substantially homologous to that encoded by the nucleotide sequence of claim 10.

25. A method of selectively inhibiting nematode pests by applying to such pests a substance capable of inhibiting a potassium channel substantially homologous to that encoded by the nucleotide sequence of claim 12.

26. A method of modulating the activity of a potassium channel positioned in a cellular membrane and comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 36, by

contacting said cellular membrane with a substance, in an amount and for a period of time sufficient to inhibit the ability of potassium ions to pass through said channel.