WO1997030108A1 - Characterized brca1 and brca2 proteins and screening and therapeutic methods based on characterized brca1 and brca2 proteins - Google Patents

Abstract

Genetic analysis of familial breast and ovarian cancer indicates that BRCA1 is a tumor suppressor gene. The BRCA1 gene encodes a 190 kDa protein with sequence homology and biochemical analogy to the granin family of proteins. Granins are secreted from endocrine cells via the regulated secretory pathway and are proteolytically cleaved to yield biologically active peptides. BRCA1 protein localises to secretory vesicles, and was demonstrated to be secreted. Gene transfer of BRCA1 inhibits growth and tumorigenesis of breast and ovarian cancer cells, but not colon or lung cancer cells or fibroplasts, suggesting that BRCA1 encodes a tissue-specific growth inhibitor. Thus, BRCA1 is a secreted growth inhibitor and functions by a mechanism not previously described for tumor suppressor genes. The BRCA2 breast and ovarian cancer gene encodes a protein that also includes a granin region, indicating that the BRCA2 protein is also a secreted tumor suppressor. Therapeutic methods using the BRCA1 and BRCA proteins and genes are also described. A method of screening for the receptors of the BRCA1 protein and BRCA2 proteins is also described.

Description

DESCRIPTION

CHARACTERIZED BRCAl AND BRCA2 PROTEINS AND SCREENING

AND THERAPEUTIC METHODS BASED ON CHARACTERIZED

BRCAl AND BRCA2 PROTEINS

TECHNICAL FIELD

The present invention relates generally to purified and isolated proteins and DNA molecules; to methods of screening for receptors; and to methods of treatment of ovarian and breast cancer, and more particularly to a purified and isolated BRCAl protein cleavage products; and to gene therapy methods using the BRCAl gene and the BRCA2 gene in the treatment of breast and ovarian cancer; and to methods for identifying the receptors of the BRCA 1 protein and the BRCA2 protein.

BACKGROUND OF THE INVENTION

The human breast and ovarian cancer susceptibility gene BRCAl is mutated in the germline and lost in tumor tissue in hereditary breast and ovarian cancer (Hall et al., 1990, Science 250, 1684-1689; Miki et al. , 1995 Science 266, 66-71; Smith et al., 1992; Cornelius et al., 1995, The Breast Cancer Linkage Consortium. Genes Chrom Cancer 13: 203-210).

Despite much excitement with the discovery of BRCAl, mutations were only found in the germline which accounts for only a small minority of breast cancers (Futreal et al., 1994, Science 266, 120-121). In addition, BRCAl was found to be expressed at the same levels in normal individuals and sporadic breast cancers (Miki et al., 1994, Science 266, 66-71). Thus, the initial excitement over BRCAl was followed by great disappointment.

The BRCA2 breast and ovarian cancer susceptibility gene has also recently been identified. (Wooster, R., et al., Nature 379: 789-792, 1995).

To date all tumor suppressors discovered encode proteins which are not secreted. Steeg, (review article), 1996, Nature Genetics 12:223. To treat the cancer associated with these tumor suppressors requires expressing the normal protein in the affected cell. Thus, these cancers have not been treatable with extracellular adrninistration of the normal protein encoded by the tumor suppressor gene. For this reason, gene therapy has been proposed as the most likely means to supply a normal functional tumor suppressor protein. This invention significantly modifies the state of the BRCA art by providing that the BRCAs are secreted and thus are amenable to direct therapy or prevention by contacting the BRCA receptor on the cell surface. In addition, the invention provides that BRCAl is indeed underexpressed in sporadic breast cancer and thus sporadic breast cancer is amendable to therapy and prevention by correcting the BRCA deficiency. Other embodiments are also provided.

DISCLOSURE OF THE INVENTION Both the BRCAl and BRCA2 proteins have been identified as inhibitors of the growth of breast and ovarian cancer cells and thus a DNA segment encoding the BRCAl protein and a DNA segment encoding the BRCA2 protein can be used in a gene therapy methods for the treatment of breast cancer and for the treatment of ovarian cancer. The discovery and purification of the BRCAl protein has broad utility.

The purified BRCAl protein can be used in treating breast or ovarian cancer.

Moreover, since it has been determined that the BRCAl protein is secreted, the BRCAl protein can be also be used to identify the BRCAl receptor. Once the BRCAl receptor is identified, BRCAl protein-mimetic agents which act on the receptor can be identified. Such agents are also useful in the treatment of breast and ovarian cancer.

The BRCA2 protein is also a secreted protein and can be used to identify the BRCA2 receptor. Once the BRCA2 receptor is identified, BRCA2 protein-mimetic agents which act on the receptor can be identified. Such agents are also useful in the treatment of breast and ovarian cancer.

The BRCAl gene product is an inhibitor of the growth and proliferation of human breast and ovarian cancer cells. The BRCAl gene product is a secreted protein, thus indicating that it acts on a receptor to produce this activity. The BRCA2 protein is an inhibitor of the growth and proliferation of human breast and ovarian cancer cells. The BRCA2 protein is a secreted protein, thus indicating that it acts on a receptor to produce this activity.

An aspect of this invention concerns a purified and isolated BRCAl cleavage protein; and biologically functional and structural equivalents thereof. Another aspect of this invention is that the BRCAl protein is a secreted tumor suppressor/growth inhibitor protein that exhibits tissue-specific tumor suppression/growth inhibition activity.

Important aspects of the present invention concern isolated DNA segments and recombinant vectors encoding the BRCAl and the BRCA2 proteins, and the creation and use of recombinant host cells through the application of DNA technology, which express the BRCAl and BRCA2 proteins.

The present invention concerns DNA segments, isolatable from human breast and ovarian tissue, which are free from genomic DNA and which are capable of conferring tumor suppressor/growth inhibitor activity in a recombinant host cell when incoφorated into the recombinant host cell. As used herein, the term "breast or ovarian tissue" refers to normal and cancerous ovarian breast tissues, as exemplified, but not limited to, by HMEC or MCF-7 cell lines. DNA segments capable of conferring tumor suppressor activity may encode complete BRCAl and BRCA2 proteins, cleavage products and biologically actively functional domains thereof.

As used herein, the term "DNA segment" refers to a DNA molecule which has been isolated free of total genomic DNA of a particular species. Furthermore, a DNA segment encoding a BRCAl protein or encoding a

BRCA2 protein refers to a DNA segment which contains BRCAl coding sequences or contains BRCA2 coding sequences, yet is isolated away from, or purified free from, total genomic DNA of Homo sapiens. Included within the term "DNA segment", are DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.

Similarly, a DNA segment comprising an isolated or purified BRCAl gene or BRCA2 gene refers to a DNA segment including BRCAl coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences or including BRCA2 coding sequences isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term "gene" is used for simplicity to refer to a functional protein, polypeptide or peptide encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences and cDNA sequences. "Isolated substantially away from other coding sequences" means that the gene of interest, in this case, the BRCAl gene or the BRCA2 gene, forms the significant part of the coding region of the DNA segment, and that the DNA segment does not contain large portions of naturally-occurring coding DNA, such as large chromosomal fragments or other functional genes or cDNA coding regions. Of course, this refers to the DNA segment as originally isolated, and does not exclude genes or coding regions later added to the segment by the hand of man.

In particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a BRCAl protein that includes within its amino acid sequence the amino acid sequence of SEQ ID NO:2. In other particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence the amino acid sequence of the BRCAl protein corresponding to human breast or ovarian tissue.

In particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a BRCA2 protein that includes within its amino acid sequence the amino acid sequence of SEQ ID NO:4. In other particular embodiments, the invention concerns isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence the amino acid sequence of the BRCA2 protein corresponding to human breast or ovarian tissue.

It will also be understood that this invention is not limited to the particular nucleic acid and amino acid sequences of SEQ ID NOS: 1, 2, 3 and 4. Recombinant vectors and isolated DNA segments may therefore variously include the BRCAl and BRCA2 encoding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides which nevertheless include BRCAl or BRCA2 encoding regions or may encode biologically functional equivalent proteins or peptides which have variant amino acid sequences. In certain embodiments, the invention concerns isolated DNA segments and recombinant vectors which encode a protein or peptide that includes within its amino acid sequence an amino acid sequence essentially as set forth in SEQ ID NO: 2 or SEQ ID NO:4, and methods of treating breast or ovarian cancer using these DNA segments. Naturally, where the DNA segment or vector encodes a full length BRCAl or BRCA2 protein, or is intended for use in expressing the BRCAl or BRCA2 protein, the most preferred sequences are those which are essentially as set forth in SEQ ID NO:l and SEQ ID NO:3 and which encode a protein that exhibits tumor suppressor activity in human breast and ovarian cancer cells, as may be determined by the breast and ovarian cancer cell growth inhibition experiments, as disclosed herein.

The term "a sequence essentially as set forth in SEQ ID NO:2" means that the sequence substantially corresponds to a portion of SEQ ID NO: 2 and has relatively few amino acids which are not identical to, or a biologically functional equivalent of, the amino acids of SEQ ID NO:2. The term

"biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, sequences which have between about 70% and about 80%; or more preferably, between about 81 % and about 90%; or even more preferably, between about 91 % and about 99% ; of amino acids which are identical or functionally equivalent to the amino acids of SEQ ID

NO:2 will be sequences which are "essentially as set forth in SEQ ID NO:2" .

The term "a sequence essentially as set forth in SEQ ID NO:4" has a similar meaning.

In particular embodiments, the invention concerns gene therapy methods that use isolated DNA segments and recombinant vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence an amino acid sequence in accordance with SEQ ID NO: 2 or in accordance with SEQ ID NO:4, SEQ ID NO:2 and SEQ ID NO:4 derived from breast or ovarian tissue from Homo sapiens. In other particular embodiments, the invention concerns isolated DNA sequences and recombinant DNA vectors incorporating DNA sequences which encode a protein that includes within its amino acid sequence the amino acid sequence of the BRCAl protein from human breast or ovarian tissue, or which encode a protein that includes within its amino acid sequence the amino acid sequence of the BRCA2 protein from human breast or ovarian tissue.

In certain other embodiments, the invention concerns isolated DNA segments and recombinant vectors that include within their sequence a nucleic acid sequence essentially as set forth in SEQ ID NO:l, or a nucleic acid sequence essentially as set forth in SEQ ID NO: 3, and methods of treating breast or ovarian cancer using these sequences. The term "essentially as set forth in SEQ ID NO:l" is used in the same sense as described above and means that the nucleic acid sequence substantially corresponds to a portion of SEQ ID NO:l, respectively, and has relatively few codons which are not identical, or functionally equivalent, to the codons of SEQ ID NO: l, respectively. Again, DNA segments which encode proteins exhibiting tumor suppression activity of the BRCAl and BRCA2 proteins will be most preferred. The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (see Fig. 2). The term "essentially as set forth in SEQ ID NO:3" has a similar meaning.

The nucleic acid segments of the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, nucleic acid fragments may be prepared which include a short stretch complementary to SEQ ID

NO: l or SEQ ID NO:3, such as about 10 nucleotides, and which are up to 10,000 or 5,000 base pairs in length, with segments of 3,000 being preferred in certain cases. DNA segments with total lengths of about 1,000, 500, 200, 100 and about 50 base pairs in length are also contemplated to be useful. The DNA segments of the present invention encompass biologically functional equivalent BRCAl and BRCA2 proteins and peptides. Such sequences may rise as a consequence of codon redundancy and functional equivalency which are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site- directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity of the protein or to test BRCAl and BRCA2 mutants in order to examine tumor suppression activity at the molecular level.

If desired, one may also prepare fusion proteins and peptides, e.g., where the BRCAl or BRCA2 coding regions are aligned within the same expression unit with other proteins or peptides having desired functions, such as for purification or immunodetection purposes (e.g., proteins which may be purified by affinity chromatography and enzyme label coding regions, respectively). Recombinant vectors form important further aspects of the present invention. Particularly useful vectors are contemplated to be those vectors in which the coding portion of the DNA segment is positioned under the control of a promoter. The promoter may be in the form of the promoter which is naturally associated with the BRCAl or BRCA2 gene(s), e.g., in breast or ovarian cancer cells, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment or exon, for example, using recombinant cloning and/or PCR technology, in connection with the compositions disclosed herein. In other embodiments, it is contemplated that certain advantages will be gained by positioning the coding DNA segment under the control of a recombinant, or heterologous, promoter. As used herein, a recombinant or heterologous promoter is intended to refer to a promoter that is not normally associated with a BRCAl or BRCA2 gene in its natural environment. Such promoters may include promoters isolated from bacterial, viral, eukaryotic, or mammalian cells. Naturally, it will be important to employ a promoter that effectively directs the expression of the DNA segment in the cell type chosen for expression. The use of promoter and cell type combinations for protein expression is generally known to those of skill in the art of molecular biology, for example, see Sambrook et al., 1989, Molecular Cloning Laboratory

Manual, 2d Edition. The promoters employed may be constitutive, or inducible, and can be used under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins or peptides. Appropriate promoter systems contemplated for use in high-level expression include, but are not limited to, a breast selective MMTV promoter and the LXSN promoter, which are more fully described below.

As mentioned above, in connection with expression embodiments to prepare recombinant BRCAl and BRCA2 proteins and peptides, it is contemplated that longer DNA segments will most often be used, with DNA segments encoding the entire BRCAl or BRCA2 protein, functional domains or cleavage products thereof, being most preferred. However, it will be appreciated that the use of shorter DNA segments to direct the expression of BRCAl and BRCA2 peptides or epitopic core regions, such as may be used to generate anti-BRCAl or anti-BRCA2 antibodies, also falls within the scope of the invention. DNA segments which encode peptide antigens from about 15 to about 50 amino acids in length, or more preferably, from about 15 to about 30 amino acids in length are contemplated to be particularly useful. DNA segments encoding peptides will generally have a minimum coding length in the order of about 45 to about 150, or to about 90 nucleotides. DNA segments encoding full length proteins may have a minimum coding length on the order of about 5,600 nucleotides for a protein in accordance with SEQ ID NO:2 or a minimum coding length on the order of about 10,300 nucleotides for a protein in accordance with SEQ ID NO:4. Naturally, the present invention also encompasses DNA segments which are complementary, or essentially complementary, to the sequence set forth in SEQ ID NO: l or the sequence set forth in SEQ ID NO:4. Nucleic acid sequences which are "complementary" are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. As used herein, the term "complementary sequences" means nucleic acid sequences which are substantially complementary, as may be assessed by the same nucleotide comparison set forth above, or as defined as being capable of base pairing to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (See Fig. 2).

It will also be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences which may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

Excepting intronic or flanking regions, and allowing for the degeneracy of the genetic code, sequences which have between about 20% and about 50%; or more preferably, between about 50% and about 70%; or even more preferably, between about 70% and about 99%; of nucleotides which are identical to the nucleotides of SEQ ID NO: l or to the nucleotides of SEQ ID

NO:3, will be sequences which are "essentially as set forth in SEQ ID NO: l " and will be sequences which are "essentially as set forth in SEQ ID NO:3". Sequences which are essentially the same as those set forth in SEQ ID NO: 1 or as those set forth in SEQ ID NO: 3 may also be functionally defined as sequences which are capable of hybridizing to a nucleic acid segment containing the complement of SEQ ID NO: l or to a nucleic acid segment containing the complement of SEQ ID NO: 3 under relatively stringent conditions. Suitable relatively stringent hybridization conditions will be well known to those of skill in the art (Sambrook et al, 1989, Molecular Cloning Laboratory Manual, 2d Edition).

List of Abbreviations

MCF-7 An immortalized cell line derived from a metastasis of human breast cancer HMEC A primary (non-immortalized) cell line derived from breast epithelial cells obtained during reduction mammoplasty MDA-MB-468 An immortalized cell line derived from a metastasis of human breast cancer Sf9 Insect cells widely used in the art with baculovirus vectors cDNA Complementary DNA obtained from an RNA template

DNA Deoxyribonucleic Acid

RT-PCR Reverse Transcriptase-Polymerase Chain Reaction

Figure 1 lists the C-terminal and N-terminal amino acid sequences

[SEQ ID NOs:5, 6, 7] used as antigens to generate antibodies for the purified and isolated BRCAl protein described herein.

Figure 2 is a table of the genetic code.

Figure 3 is a diagram showing structural features of the human BRCAl protein [SEQ ID NO:2] covering 1864 amino acids.

Figure 4 is a diagram showing sequence alignment of the granin region of selected granin family members compared with BRCAl .

Figure 5 is a diagram showing sequence alignment of the granin region of selected granin family members compared with BRCAl and BRCA2. Figure 6 is Table I, which shows inherited BRCAl mutations and type of cancer. Figure 7 is Table II, which shows effect of BRCAl Expression Vectors on growth.

Figure 8 is Table III, which shows inhibition of tumongenesis by BRCAl . Figure 9 is the sequence of the BRCA 1 gene [SEQ ID NO : 1 ] .

Figure 10 is the sequence of the BRCA2 gene [SEQ ID NO: 3].

Figure 11 is the sequence of the BRCA2 protein [SEQ ID NO:4].

Figure 12 is an immunoblot analysis of spleen and HMEC cell whole cell lysates probed with preimmune, immune, and immune plus peptide for C-19 antisera and C-20 affinity purified antibody and antibody plus peptide.

Figure 13 is an immunoprecipitation/immunoblot analysis of MDA-MB-468 cell lysates with C-19 antisera.

Figure 14 is a C-20 immunoblot analysis of recombinant Baculovirus produced BRCAl (marked by arrow) compared with uninfected Sf9 cells (Control).

Figure 15 is a V8 Protease Map of Native and Recombinant BRCAl .

Figure 16 is a Pulse-Chase Analysis of MDA-MB-468 Cells.

Figure 17 is an immunoblot analysis of nuclear, cytoplasmic and membrane fractions of HMEC cells paired with corresponding whole cell lysate and probed for BRCAl (C-19), c-myc, and PDGFR beta.

Figure 18 is an immunoblot analysis of nuclear, cytoplasmic and membrane fractions of HMEC cells paired with corresponding whole cell lysate and probed with D-20 N-terminal antibody plus and minus peptide.

Figure 19 is an immunoblot analysis of nuclear, cytoplasmic and membrane fractions of MDA-MB-468 cells paired with corresponding whole cell lysate probed with C-20 antibody.

Figure 20 depicts assay of MDA-MB-468 cell fractions produced by sucrose gradient for synaptophysin and BRCAl immunoreactivity.

Figure 21 depicts estrogen regulation of BRCAl protein. Figure 22 depicts N-Linked glycosylation of BRCAl protein.

Figure 23 depicts heat solubility of BRCAl protein.

Figure 24 is a Western blot of HMEC cell lysates: control; stimulated with 10 mM forskolin 0.5 hours post stimulation; and 48 hours post stimulation and also includes radioimmunoprecipitation of BRCAl From conditioned media (lane 4). BEST MODE FOR CARRYING OUT THE INVENTION

For the purposes of the subsequent description, the following definitions will be used: Nucleic acid sequences which are "complementary" are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, that the larger purines will always base pair with the smaller pyrimidines to form only combinations of Guanine paired with Cytosine (G:C) and Adenine paired with either Thymine (A:T) in the case of DNA or Adenine paired with Uracil (A:U) in the case of RNA.

"Hybridization techniques" refer to molecular biological techniques which involve the binding or hybridization of a probe to complementary sequences in a polynucleotide. Included among these techniques are northern blot analysis, southern blot analysis, nuclease protection assay, etc. "Hybridization" and "binding" in the context of probes and denatured

DNA are used interchangeably. Probes which are hybridized or bound to denatured DNA are aggregated to complementary sequences in the polynucleotide. Whether or not a particular probe remains aggregated with the polynucleotide depends on the degree of complementarity, the length of the probe, and the stringency of the binding conditions. The higher the stringency, the higher must be the degree of complementarity and/or the longer the probe.

"Probe" refers to an oligonucleotide or short fragment of DNA designed to be sufficiently complementary to a sequence in a denatured nucleic acid to be probed and to be bound under selected stringency conditions.

"Label" refers to a modification to the probe nucleic acid that enables the experimenter to identify the labeled nucleic acid in the presence of unlabeled nucleic acid. Most commonly, this is the replacement of one or more atoms with radioactive isotopes. However, other labels include covalently attached chromophores, fluorescent moieties, enzymes, antigens, groups with specific reactivity, chemiluminescent moieties, and electrochemically detectable moieties, etc.

"Tissuemizer" describes a tissue homogenization probe.

"PCR technique" describes a method of gene amplification which involves sequenced-based hybridization of primers to specific genes within a

DNA sample (or library) and subsequent amplification involving multiple rounds of annealing, elongation and denaturation using a heat-stable DNA polymerase.

"RT-PCR" is an abbreviation for reverse transcriptase-polymerase chain reaction. Subjecting mRNA to the reverse transcriptase enzyme results in the production of cDNA which is complementary to the base sequences of the mRNA. Large amounts of selected cDNA can then be produced by means of the polymerase chain reaction which relies on the action of heat-stable DNA polymerase produced by Thermus aquaticus for its amplification action.

"Nuclease protection assay" refers to a method of RNA quantitation which employs strand specific nucleases to identify specific RNAs by detection of duplexes.

"In situ hybridization of RNA" refers to the use of labeled DNA probes employed in conjunction with histological sections on which RNA is present and with which the labeled probe can hybridize allowing an investigator to visualize the location of the specific RNA within the cell.

"Cloning" describes separation and isolation of single genes.

"Sequencing" describes the determination of the specific order of nucleic acids in a gene or polynucleotide.

The term "BRCAl targeted growth inhibitor agent", as used herein and in the claims, is defined as the BRCAl protein characterized herein, whether isolated and purified directly from a natural source such as mammalian ovarian or breast cells, or produced using recombinant methods; the targeted growth inhibitor having the biological activity of tumor suppression and/or growth inhibition activity in mammalian breast or ovarian cancer cells and which binds the BRCAl receptor; and the term "BRCAl targeted growth inhibitor agent" also including biologically functional equivalents of the BRCAl protein characterized herein, the term biologically functional equivalent defined herein to include, among others, proteins and protein fragments in which biologically functionally equivalent amino acids have been inserted and peptidomimetics. The term "BRCA2 targeted growth inhibitor agent" is used herein as

"BRCAl targeted growth inhibitor agent" above but applies to BRCA2.

The term "homology" describes a mathematically based comparison of sequence similarities which is used to identify genes or proteins with similar functions or motifs. The term "cleavage product" is defined as a polypeptide fragment produced from the targeted growth inhibitor described above by natural proteolytic processes. Preferably such a cleavage product will have biological activity including, but not limited to, tumor suppression and/or growth inhibition activity in mammalian breast or ovarian cancer cells. This term also includes such polypeptide fragments when produced via recombinant techniques and also includes biological functional equivalents of such fragments, the term biologically functional equivalent defined herein to include, among others, proteins in which biologically functionally equivalent amino acids have been inserted and peptidomimetics.

The term "granin box domain" is defined as the consensus granin box domain of amino acids set forth in Figs. 3 and 5.

The term "recombinant host cell" is defined as a single cell or multiple cells within a cell line which are capable of undergoing genetic manipulation through well-known and art recognized techniques of transformation, transfection, transduction and the like. Examples of contemplated recombinant host cells include, but are not limited to, cell lines derived from normal or cancerous mammalian breast or ovarian tissue, other eukaryotic cells, and microorganisms. Specific examples of recombinant host cells described herein include Sf9 cells and HMEC cells.

The phrase "substantially identical to the carboxyl terminus of an amino acid sequence as essentially set forth in SEQ ID NO:2" is defined as an amino acid sequence including amino acids identical to the C-terminal amino acids in the amino acid sequence set forth in SEQ ID NO: 2, or biologically functional equivalents of these amino acids. Preferred examples of the amino acid sequences are set forth in Fig. 1.

EXAMPLE 1

BRCAl Encodes a 190 kDa Protein Expressed in Breast Epithelial Cells

As an initial step in the biochemical characterization of the BRCAl gene product, antibodies were developed and the expression, localization, and function of BRCAl protein were studied. These studies demonstrate that

BRCAl is a secreted, selectively growth inhibitory and represents a new member of the granin gene family.

To enable BRCAl protein expression studies a polyclonal rabbit antisera was raised against a peptide from the C-terrninal portion of the predicted BRCAl protein [SEQ ID NO: 2]. This peptide corresponded to the last 19 C-terminal amino acids (C-19) [SEQ ID NO: 5], which is listed in Fig. 1. The results produced by this antibody, which are more fully described below, were confirmed with antibodies against peptides from the last 20 C-terminal amino acids (C-20) [SEQ ID NO:6] and from the first 20 N-terminal amino acids (D-20) [SEQ ID NO: 7] of the predicted BRCAl protein [SEQ ID NO:2]. These antibodies were purchased from Santa Cruz

Biotechnology, Santa Cruz, CA, and the peptide sequences are also are listed in Fig. 1. A search of the SWISS PROT protein sequence database for the N-terminal and C-terminal 20 amino acid peptides at the 60% homology level revealed no entries other than BRCAl. Initially these antisera were screened using Western blot analysis of whole cell lysates from normal human mammary epithelial cells (HMEC-Clonetics, (Stampfer et al., 1980, Growth of Normal Human Mammary Cells in Culture. 16, 415-425)) and normal human spleen. Spleen was chosen as a negative control because Northern analysis demonstrated no expression of BRCAl in spleen (Miki et al. , 1994, Science 266, 66-71). The results of the experiments with the C-terrninal antibodies were obtained with an immunoblot analysis of spleen and HMEC cell whole cell lysates probed with preimmune, immune, and immune plus peptide for C-19 antisera and C-20 affinity purified antibody and antibody plus peptide (Fig. 12). An immunoreactive band that is blocked by the addition of corresponding peptide is present at 190 kDa in the HMEC cells for both the

C-19 and C-20 anti-peptide antisera. Note that the C-19 blot has been probed with immune serum diluted 1:200 and that the C-20 blot has been probed with affinity purified antibody. No specific immunoreactivity is detected in the C-19 preimmune sera, and as expected no specific bands are detected in the spleen whole cell lysate by either C-19 or C-20. Several non-specific bands are present in the immune sera that do not block with the addition of peptide, but affinity purified C-20 antibody exhibits minimal non-specific cross reactivity. A minor band at approximately 70 kDa is identified, but appears to block with peptide indicating that this band represents a processed C-terminal fragment of the 190 kDa band. Similar studies were performed on antisera from three separate rabbits, raised against the C-terrninal 19 peptide, and in each case, essentially similar results were seen, with some variation in the non-specific bands among individual rabbits, but all three react with a band at approximately 190 kDa that is not present in preimmune serum and is blocked with peptide.

A number of normal tissues and breast cancer cell lines were surveyed majority of other cells tested showed very low to absent (MCF-7, MB- 157, MB-361) levels of expression. To analyze the ability of the antisera to immunoprecipitate the 190 kDa protein, radiolabelled whole cell lysates from MDA-MB-468 cells were immunoprecipitated with C-20 antisera (Fig. 13). The 190 kDa and 70 kDa species in the HMEC lane are blocked with the addition of peptide, but a number of non-specific bands including a 220 kDa species (Chen, et al, 1995, Science 270:789-791) are not blocked. Immunoprecipitation of MDA-MB-468 cells demonstrates a 190 kDa protein that is not present in the peptide addition control. In addition, the 70 kDa species is immunoprecipitated with antibody and blocked by the addition of peptide. It is noted that several other bands are identified that are not blocked with peptide, in particular at 205 and 220 kDa. This indicates that despite the 207 kDa size predicted from the BRCAl coding sequence, the 205 kDa and 220 kDa bands do not represent BRCA 1. These results are consistent with the 185 kDa estrogen-regulated protein reported by Gudas (Gudas, et al. 1995,

Cancer Res. , 55:4561-4565) but differ from the 220 kDa ubiquitous protein reported by Chen, particularly because the 220 kDa protein does not block with peptide.

While these results strongly suggested that the antisera was specific for a 190 kDa protein present in breast epithelial cells, further experiments were performed to demonstrate that this protein corresponded to BRCAl . A concern was that the full length coding sequence for BRCAl predicts a protein of 207 kDa molecular weight and the protein that the antisera recognized was definitely less than 200 kDa, and approximately 190 kDa. Therefore to confirm that the antisera recognized BRCAl a full length

BRCAl cDNA was constructed and cloned into the baculovirus transfer vector pAcSG2 (PharMingen). This plasmid was subsequently utilized to produce recombinant BRCAl baculovirus by co-transfection and homologous recombination. The antisera was then tested for its ability to recognize baculovirus expressed recombinant BRCAl. The results of these experiments were that the antibodies recognize a 180 kDa band in the BRCAl recombinant virus infected cell lysates that is not present in the no infection control (Fig. 14). The recognition of this band is blocked by the addition of peptide and it is not present in the preimmune serum blot. To verify that the native 190 kDa protein and the recombinant 180 kDa protein were in fact the same protein, peptide mapping of the 190 kDa band from MDA-MB-468 cells and the 180 kDa protein from BRCAl recombinant Sf9 cell lysates was performed as described in the methods. The digests were loaded onto a 4-20% gradient SDS-PAGE gel and immunoblotted with C-20 (Fig. 16). In Fig. 15, Lanes 1 through 3 and 4 through 6 represent increasing concentrations of V8 protease. The arrows at right indicate four identical sized molecular weight bands in lanes 3 and 6 that document that recombinant BRCAl and the 190 kD band from MDA-MB-468 cells are identical proteins. This data confirmed that the antibodies are specific for BRCAl protein. The difference in molecular weight between the recombinant and native protein is likely to be due to differences in glycosylation. These experiments demonstrate that the immunoreactive band completely blocks with peptide and is not present in control wild type virus infected lysates.

To characterize the 70 kDa species a pulse-chase experiment was performed that demonstrates that this band is a proteolytic fragment derived from the 190 kDa form. MDA-MB-468 cells were starved in cysteine and methionine deficient media and then pulsed with 35S labelled cysteine and methionine containing media with 3% dialyzed fetal bovine serum for three hours. The cells were then chased in L-15 media with 10% fetal bovine serum for increasing periods of time and harvested in lysis buffer. The lysates were immunoprecipitated, electrophoresed and the dried gel was autoradiographed

(Fig. 16). In this experiment, it was shown that BRCAl is initially synthesized as a 185 kDa form that is subsequently processed to a 190 kDa species. This represents glycosylation of the newly synthesized protein. Initially, no 70 kDa form is present, but co-incident with the appearance of the fully glycosylated form, the 70 kDa form appears. Subsequently, as the 190 kDa signal decreases with time post-labelling, the 70 kDa band increases in intensity. These findings indicate that the 70 kDa band is a proteolytic fragment, or cleavage product, of the 190 kDa protein. Other cleavage products were also isolated, including a 110 kDa species and a 130 kDa species.

Having demonstrated that the antibodies recognize BRCAl protein, immunohistochemical analysis on formalin fixed, paraffin-embedded normal breast tissue were performed to analyze the distribution of BRCAl within the breast. The results demonstrated that luminal epithelial cells (Page and Anderson, 1987, Nature Genetics 2, 128-131) within breast acini and ducts stain positively but myoepithelial cells and supporting stromal cells did not stain. No staining was observed when either primary antibody was deleted or peptide was added to the incubation. Staining was present diffusely throughout the cytoplasm and was not localized to the nucleus.

In summary, then, a 190 kDa protein was demonstrated to be the BRCAl gene product by a number of independent criteria: 1) three different antibodies directed against two different regions of the predicted gene product react specifically in western blots and are blocked by appropriate peptides; 2) The C-20 antibody specifically immunoprecipitates the protein; 3) The C-20 antibody specifically recognizes the recombinant protein expressed in baculovirus; 4) Peptide mapping experiments definitely demonstrate that the

190 kDa protein recognized in MDA-MB-468 cells and the recombinant virus infected Sf9 cells are the same. Immunohistochemical studies indicate that BRCAl protein is present in the luminal epithelial cells which are presumed be the cells of origin for the vast majority of hereditary and sporadic breast cancers.

EXAMPLE 2

BRCAl is Predominately Localized in the Membrane Fraction of Breast

Epithelial Cells

Due to the immunohistochemical studies, a series of experiments to determine more precisely the localization of BRCAl within the cell was initiated. The first such experiment was a cell fractionation experiment designed to segregate nuclear, cytoplasmic, and membrane compartments of HMEC cells. As shown in Fig. 17, the cell fractionation analysis included immunoblot analysis of nuclear, cytoplasmic and membrane fractions of HMEC cells paired with corresponding whole cell lysate and probed for

BRCAl (C-19 antibody), c-myc, and PDGFR beta; and identical fractions as above probed with D-20 N-terminal antibody plus and minus peptide (Fig. 18).

The cell fractionation analysis also included immunoblot analysis of nuclear, cytoplasmic and membrane fractions of MDA-MB-468 cells paired with corresponding whole cell lysate probed with C-20 antibody (Fig. 19). The results of this cell fractionation experiment clearly demonstrate that the 190 kDa species of BRCAl is present and greatly enriched for in the membrane fraction of HMEC cells. Essentially no 190 kDa BRCAl could be detected in either the nuclear or cytoplasmic fractions, although the 70 kDa protein is present in the nuclear fraction. As a control for the fractionation procedure parallel blots were probed with antisera for c-myc and platelet-derived growth factor receptor beta (PDGFR). These blots demonstrated that the nuclear fraction is greatly enriched for the 67 and 64 kDa c-myc proteins (Alexandrova et al., 1995, Mol. Cell. Biol. 15:5188-5195) and the cytosolic and membrane fractions show PDGFR as expected. These results were confirmed with the antibody to the N-terminal portion of BRCAl (D-20). This antibody detects the 190 kDa form of BRCAl and an additional 165 kDa species in HMEC cells. Both of these bands are blocked with the addition of peptide and are present in the membrane fraction exclusively. Note that this antibody does not detect the 70 kDa species identified in the C-terminal peptide blots.

To investigate the possibility that subcellular localization of BRCAl might be altered in malignant breast cells, fractionation studies on

MDA-MB-468 cells that express high levels of BRCAl protein were performed (Fig. 19). These studies demonstrated that in parallel with findings in HMEC cells the 190 kDa form of BRCAl is also greatly enriched in the membrane fraction of MDA-MB-468 cells. In contrast to HMEC cells however, there appears to be a small amount of the 190 kDa species in the nuclear fraction of MDA-MB-468 cells. It is also noted that in contrast to HMEC cells, the 70 kDa species is present exclusively in the cytosolic fraction of MDA-MB-468 cells.

To further investigate the precise subcellular localization of BRCAl confocal microscopy utilizing the affinity purified C-20 antisera was employed.

These experiments indicated that the C-20 antibody exhibits diffuse granular staining that is predominately localized in the cytoplasm of HMEC cells. The nucleus and Golgi compartment were localized in these experiments, and this provided the capability to identify co-localization of BRCAl in both the nucleus and Golgi complex. Simultaneous triple staining for the nucleus,

Golgi complex and BRCAl again demonstrated a predominant granular cytoplasmic distribution for BRCAl, with co-localization in both the nucleus and Golgi complex. These findings are in agreement with the cell fractionation studies of HMEC cells, despite the inability of those studies to detect the 190 kDa BRCAl form in the nucleus, because the 70 kDa form was present in the nuclear fraction and would be expected to be detected by C-terminal antibody.

In summary, then, the above studies demonstrate that the majority of BRCAl protein is non-nuclear and membrane-associated. Cell fractionation studies show the 190 kDa BRCAl protein resides primarily in the membrane-associated fraction, but the p70 protein is localized in the nucleus of normal breast cells and the cytoplasm of MB-486 breast cancer cells. The distinct membrane-associated and nuclear localization patterns result from the unprocessed and the 70 kDa processed form, respectively. There is definite co-localization with the 190 kDa BRCAl protein and the Golgi marker supporting the trafficking of BRCAl through the Golgi prior to its packaging into secretory granules.

EXAMPLE 3 BRCA 1 is a Member of the Granin Family of Secretory Proteins and Localizes to Secretory Vesicles

Having identified BRCA 1 as being present in the membrane fraction of breast epithelial cells and having a large granular cytoplasmic pattern of staining, a homology search of BRCAl was performed, focusing on motifs that might explain the apparent membrane localization of BRCA 1. A search on the SWISS PROT database of the MacDNAsis PRO v3.0 software package was performed and several features of biologic and functional importance were identified, as shown in Figure 3. In Figure 3, (-) and (+) mark location of charged residues and glyc shows potential N-linked glycosylation sites. RING finger and granin (amino acids 1214-1223) consensus are shown by open and closed boxes. Predicted protease cleavage sites for renin, kallikrein, thrombin, and trypsin are shown as thin lines. Regions deleted in the internal deletion mutants are shown as shaded boxes below (343-1081 and 515-1092).

The SWISS PROT search revealed that BRCAl has homology to the granin consensus site as shown in Figure 4. In Figure 4, consensus sequence is shown in bold at the bottom. Sequences are human unless otherwise stated.

The granin motif spans amino acids 1214-1223 of BRCAl. Note that human BRCAl completely satisfies the ten amino acid granin consensus and exhibits the other structural features of the family. The probability that BRCAl would exhibit a perfect granin consensus by chance alone is 0.0018 (or one in 555). The rationale for this calculation is given at the bottom of Figure 4.

To investigate the hypothesis that BRCAl behaves biochemically as a granin, the following series of experiments were executed. To document the presence of BRCAl in secretory vesicles, cell organelles from MDA-MB-468 cells were fractionated by sucrose gradient centrifugation and the fractions were assayed for synaptophysin (a highly specific marker for secretory vesicles) and BRCAl immunoreactivity. As seen in Fig. 20, coordinate expression of BRCAl and synaptophysin was noted, which indicates the co-localization of these proteins in secretory vesicles. These results document the co-localization of synaptophysin and BRCAl in fractions expected to contain secretory vesicles.

Since granins have been shown to be regulated by estrogens (Fischer-Colbrie et al., 1991, J. Neuroendocrinol. 121, 125-130) HMEC cells were stimulated with estrogen and tamoxifen and increased expression of BRCAl was demonstrated, as reported previously by others (Gudas, et al. 1995, Cancer Res. , 55:4561-4565; Marquis et al. , 1995, Nature Genetics 11, 17-26; Lane et al., 1995, Genes & Development 9, 2712-2722). The dose response was consistent with estrogen regulation of BRCAl expression. As presented in Fig. 21 , cell lysates from HMEC cells treated for 24 hours with tamoxifen (TAM), indicated concentrations of estrogen (E2), or ethanol control (ETOH). Note E2 dosage effect.

HMEC cell membrane fractions were then treated with sequential deglycosylation enzymes (NANase II > O-Glycosidase DS > PNGase F to remove a2-3 and a2-6 N-acetylneuraminic acid, serine/threonine glycosylation (Fig. 22). N-linked glycosylation). A shift of protein following PNGase F treatment was noted, confirming N-linked glycosylation. Thus, BRCAl exhibits N-linked glycosylation as predicted from the sequence analysis and shows little Ser/Thr glycosylation.

In addition, a heat stable fraction was prepared from recombinant baculovirus BRCAl in a modification of the procedure of Thompson et al. , (1992b), Mol. Brain Res. 12, 195-202, where cell pellets of infected Sf9 cells were sonicated, centrifuged, boiled for five minutes, and then centrifuged again. This heat soluble fraction was then analyzed by immunoblotting.

BRCAl remained soluble after boiling, which is characteristic of granins. As seen in Fig. 23, the immunoblots included cell lysates from uninfected Sf9 cells, wild-type infected cells (control), BRCAl infected cells, HMEC cells, and heat soluble fraction of Baculovirus produced recombinant BRCAl. Recombinant BRCAl remains soluble after boiling.

Additionally, HMEC cells were treated with 10 mM forskolin and a marked decrease in BRCAl levels in whole cell lysates after 0.5 hours of treatment and a return to normal levels 48 hours later was observed. This data is consistent with forskolin stimulated release of secretory granules and subsequent replenishment. As seen in Fig. 24, the Western blot of HMEC cell lysates included: control, stimulated with 10 rriM forskolin 0.5 hours post stimulation and 48 hours post stimulation. The Western blot also included a lane marked Media, which showed the results of radioimmunoprecipitation of 24 hour conditioned media from 35S-labelled MDA-MB-468 cells. These results indicate the presence of BRCAl protein at 190 kDa. Media was supplemented with aprotinin, PMSF, leupeptin, and pepstatin.

To confirm that BRCAl is in fact secreted MDA-MB-468 cells were metabolically labelled and the 190 kDa band was immunoprecipitated from a 24 hour collection of labelled conditioned media. Finally, immunogold electron microscopy was performed with C-20 antibody on MDA-MB-468 cells and it was demonstrated that BRCAl immunoreactivity localizes to secretory vesicles. These secretory vesicles were primarily located in the apical cytoplasm and were often found at the tips of microvilli extending into the extracellular space. A vesicle actively undergoing secretion was identified. These findings confirm that BRCAl is a member of the granin family of secretory proteins .

In summary, then, BRCAl has a granin box which shows 100% homology to the consensus (Huttner et al., 1991 , Trends Biochem. Sci. 16, 27-30) and has the expected number of acidic residues and predicted isoelectric point of granin family members. Additional evidence that BRCAl is a granin includes 1) Presence in secretory vesicle fractions; 2) Induction by estradiol; 3)

Glycosylation which occurs on secretory proteins as they are transported through the rough endoplasmic reticulum (Kornfeld & Kornfeld, 1985, Annu. Rev. Biochem. 54, 631-664); 4) Solubility of boiled protein, a biochemical feature of the granin family; 5) Release of BRCAl protein by forskolin induction of regulated secretion; and 6) localization in secretory vesicles by immunogold electron microscopy.

As more fully described below, internal deletions which eliminate key structural elements and glycosylation sites destroy growth inhibition and tumor suppression, thus indicating that BRCAl tumor suppression and growth inhibition are mediated through its granin-like properties.

EXAMPLE 4

Normal BRCAl inhibits growth of breast and ovarian cancer cells

Experiments to determine whether BRCAl could function as a growth inhibitor or tumor suppressor were performed. Analysis of BRCAl protein levels in human breast cancer cell lines indicated that MCF-7 cells had little or no BRCAl protein. Analysis of MCF-7 cells for allelic loss at markers in the BRCAl region indicates loss of at least 2 Mb including the BRCAl region on one chromosome 17q21, and that the coding sequence of the retained BRCAl allele was normal. Sal I linkered BRCAl cDNA was cloned into the unique Xho I site of the retroviral vector LXSN for transfection studies. To rule out trivial effects on localization or stability, two in-frame internal deletion mutants were constructed which eliminated much of the region of BRCAl containing acidic residues and putative glycosylation sites (D343-1081 and D515- 1092), but preserved the granin homology region. Two termination codon mutants were constructed which resulted in predicted proteins containing 1835 and 340 amino acids.

Table I shows that transfection of the LXSN vector or the internal deletion mutants resulted in similar numbers of G418-resistant stable clones in a number of human cell lines. Transfection of LXSN-BRCA1 into MCF-7 cells or Caov-4 ovarian cancer cells resulted in fewer clones which could not be expanded beyond 30 cells per clone. Some of these clones can be expanded in an enriched growth media containing GMSA, 10% fetal calf serum and 5 ng/ml EGF. This growth inhibitory effect of BRCAl was confined to these cell types since fibroblast, lung cancer cells, and colon cancer cells were not growth inhibited by LXSN-BRCA1. The 340-amino acid truncated protein did not inhibit growth of any cell line. However, the 1835 amino acid protein significantly inhibited growth of ovarian cancer cells but not breast cancer cells. This indicates that distinct mechanisms mediate growth inhibition of ovarian cancer cells and breast cancer cells and that this difference depends on the length of the truncated protein.

EXAMPLE 5

Ovarian cancer susceptibility is differentially associated with protein truncations 5' of the granin region To determine whether the differential effects of short versus long truncated proteins on Caov-4 ovarian cancer cells were paralleled in human patients, the relative frequency of ovarian versus breast cancer among 166 patients in a series inheriting BRCAl mutations was calculated (Table II). Mutations inherited by 19 patients were nonsense alterations leading to transcript instability and no mutant protein. Mutations inherited by 13 patients were missense alterations in the RING finger leading to complete but aberrant protein. All other mutations were protein-truncating mutations at sites throughout the gene. The difference in ovarian and breast cancer distribution between the two groups was statistically significant: ovarian cancer formed a significantly lower proportion (2%) of the cancers in patients with mutant proteins that would include the granin motif compared to the proportion (25%) of cancers in patients with more severely truncated proteins (X2 = 11.12, P

< 0.001). This result is consistent with the observation that the site of BRCAl mutation is associated with relative susceptibility to ovarian versus breast cancer (Gayther et al., 1995, Nature Genet 11 : 428-433). The analysis of Gayther et al., indicated that the correlation between genotype and phenotype was better described by a "change point" in the BRCAl sequence than by a linear trend in locale of mutation. The granin consensus motif at codons 1214-1223 is well within the confidence limit for the estimated location (codons 1235-1243) of the optimal change point in that analysis.

EXAMPLE 6

BRCAl Inhibits Breast but not Colon Tumorigenesis

BRCAl gene transfer into MCF-7 cells inhibits tumorigenesis employing retroviral gene transfer. Supernatants containing 5 x IO⁷ vector particles from LXSN and LXSN-BRCA1 PA317 producer clones were used to transduce 5 x 10⁷ MCF-7 cells or OK3 colon cancer cells in culture which were subsequently injected into the flanks of six nude mice for each vector. The cells were not treated with G418 before injection because prior G418 treatment inhibits tumorigenesis in this model, but southern blots have demonstrated that 70-80% of MCF-7 cells are transduced by this protocol. Four weeks after injection there were MCF-7 tumors in 5/6 LXSN control mice but no tumors in LXSN-BRCA1 mice. Retroviral transduction by BRCAl had no effect on colon tumor formation (Table III, Fig. 8). Tumors ultimately developed in all of the control mice and 4/6 LXSN-BRCA1 mice but the tumors in LXSN-BRCA1 mice were significantly smaller (LXSN: 569 grams +60; LXSN-BRCA1: 60 grams + 24) as illustrated in Table III, Fig.

8. Molecular analysis of tumor RNAs showed that the vector neo gene was present and expressed in all MCF tumors and that BRCAl was detectable only in the four LXSN-BRCA1 transduced tumors. Because the ex vivo transduction strategy could inhibit tumor establishment but not necessarily inhibit growth of already established tumors, whether in vivo injection of

LXSN-BRCA1 into established MCF-7 intraperitoneal tumors could inhibit the growth rate and improve survival was tested. This experimental approach results in retroviral vector integration into 20-40% of tumor cells. The results showed that while all five of the mice given the mutant BRCAl retrovirus died in less than two weeks, the five mice injected with LXSN-BRCA1 survived from 15-41 days because the injection decreased the size and sequelae of the intraperitoneal tumors (Table III, Fig. 8).

The above studies were confirmed with stable transfectants expressing BRCAl . Using an enriched growth media MCF-7 transfectants containing the transferred BRCAl gene were obtained. Although these clones grow at 1/3 the rate of mutant BRCAl transfected clones in vitro, whether they would form tumors in nude mice was determined. Three distinct clones transfected with D343-1081 and four distinct clones transfected with BRCAl (five mice per clone) were injected with the MCF-7 transfectants. The results show that 0/20 mice injected with BRCAl transfectants developed tumors while 13/15 mice injected with mutant BRCAl transfectants developed tumors, providing confirmation that BRCAl inhibits tumorigenesis in nude mice (Table III). RT-PCR analysis demonstrated that the transfectants expressed the expected transfected BRCAl or mutant BRCAl mRNA.

Lactation is the most important secretory process in the breast and is defining for mammals. Indeed, the human breast is unique in that it does not fully differentiate until the first pregnancy and active lactation is followed by involution (Battersby et al., 1994, Histopathology 15:415-433). Thus during each lactation, cell numbers must be increased with the end of proliferation coinciding with the gain of secretory function. Following cessation of lactation the cell numbers must decrease to allow breast involution. Pairing secretion feedback with cell proliferation and growth inhibition mechanisms is reasonable and to be expected in this setting. The identification of BRCAl as a member of the granin family of secreted proteins indicates that it functions as a novel type of tumor suppressor gene. Analysis of BRCAl mutations shows that near full-length proteins do not protect against breast cancer, but far less often lead to ovarian cancer (Table II). Analysis of transfection experiments shows that near full-length BRCAl proteins do not inhibit growth of breast cancer cells but do inhibit growth of ovarian cancer cells. This indicates that the mechanism of tumor suppression by BRCAl differs for breast versus ovarian cancer.

Pregnancy and lactation are important protective factors for breast cancer. Although the epidemiologic basis of this is well-demonstrated, molecular correlates are lacking. The demonstration that BRCAl mRNA is induced during mouse pregnancies and this work showing a secretory function for BRCAl link a tumor suppressor gene with a epidemiologically-defined tumor suppression activity, early pregnancy.

EXAMPLE 7

Method of Screening for BRCAl or BRCA2 Receptor

That BRCAl is secreted has important implications for lactation and growth regulation of normal and malignant breast cells. The secreted BRCAl protein acts on a cell surface receptor. The interaction between the BRCAl protein and the receptor produces the beneficial effects, i.e. tumor suppression, in the target breast or ovarian tissue. Methods for isolating the BRCAl receptor follow. The BRCA2 receptor can be similarly isolated. Baculovirus BRCAl can be purified from the insect cells with the C20 antibody and then labelled with radioactive iodine by standard methods. CysόlGly and termination codon mutant BRCAl proteins are prepared and labelled as a control. The labelled BRCAl can then be used to perform binding studies to identify cells with BRCAl receptors using Scatchard analysis; and to perform cross-linking studies which demonstrate the BRCAl receptor(s) on polyacrylamide gels. These initial characterization methods are used to identify cells with high and low numbers of BRCAl receptor(s) for purification and isolation studies. Once a cell line with high levels of BRCAl receptor has been identified, then the protein is purified by the following approaches:

Approach A: Biochemical purification

The cell line which expresses high levels of BRCAl receptor is lysed and the protein from cell lysates or membrane preparations is purified by gel filtration followed by purification of the receptor with a column containing the BRCAl ligand bound to a solid phase such as sepharose. The purified receptor protein can then be microsequenced and the gene cloned using degenerate oligonucleotides derived from the protein sequence. Approach B:

Ligand is radiolabeled with 1251 and then used to screen cell lines or tissues for specific binding by Scatchard analysis. Once such binding is identified, a cDNA library is constructed from that tissue or cell line and transfected into a cell line that does not exhibit specific binding. These transfected cells are then screened for newly acquired specific binding which indicates they have been transfected with a construct containing the gene for the BRCAl receptor. Plasmid DNA from positive clones is then isolated and sequenced for identification. This single construct is then transfected back into the null cells to verify that binding of ligand is mediated by the transfected gene. (Kluzen et al, Proc Natl Acad Sci USA 89:4618-4622 (1992).

Alternatively, chimeric BRCAl and immunoglobulin Fc molecules can be constructed. (LaRochelle et al, J Cell Biol 129:357-366 (1995)). These chimeric molecules are then be used to screen for binding to BRCAl receptor on whole cells via flow cytometry. Alternatively, due to the presence of the immunoglobulin component of the molecule, cell lysates are screened by immunoblotting or by immunoprecipitation of metabolically labelled cells. This technique can identify BRCAl binding proteins by a variety of different methods. Peptide digests of the identified proteins are then generated so that the peptides can be sequenced and the whole molecule cloned by a degenerative oligonucleotide approach.

EXAMPLE 8

Screen for BRCAl Protein Mimetic Agents Classical methods for identifying compounds which activate receptors are greatly facilitated by the prior identification of the receptor. However, knowledge of ligand structure domains and deletion and minimization methods allow the identification of active ligand mimetic drugs without first finding the receptor. As more fully described above, certain regions of the BRCAl gene have been deleted to show which regions are essential for growth inhibitory activity. These studies can be continued in a systematic manner, revealing the regions of the molecule needed for its key activities. Upon identification of a small protein that can produce growth inhibition, systematic structural and functional analysis of the minimal protein can be performed as per the methods described in Li, et al., Science 270: 1657, 1995. Drugs can then be screened for and/or synthesized which mimic the peptide structure and consequently produce the desired effect.

Thus, provided also is a method of screening a compound for tumor suppressor activity comprising contacting the compounds with the BRCAl or BRCA2 receptor, a compound which binds the receptor indicating a compound having potential tumor suppressor activity. Binding can be detected by well- known methods in the art, including, among others, radioimmunoassays and fluorescence assays.

Example 9 Therapy method for ovarian cancer using the BRCAl Gene.

Viral vectors containing a DNA sequence that codes for a protein having an amino acid sequence as essentially set forth in SEQ ID NO: 2 can be constructed using techniques that are well known in the art. This sequence includes the BRCAl protein. Viral vectors containing a DNA sequence essentially as set forth in SEQ ID NO: l (the BRCAl gene) can be also constructed using techniques that are well known in the art. Retroviral vectors such as the LXSN vector described above, adenoviral vectors, or adeno- associated viral vectors are all useful methods for delivering genes into ovarian cancer cells. The viral vector is constructed by cloning the DNA sequence essentially as set forth in SEQ ID:1 into a retroviral vector such as an ovarian selective vector. Most preferably, the full-length (coding region) cDNA for BRCAl is cloned into the retroviral vector. The retroviral vector would then be transfected into virus producing cells in the following manner: Viruses are prepared by transfecting PA317 cells with retroviral vector DNAs which are purified as described in Wong et al., 1988, Proceeding of the UCLA Symposia on Biology ofLeukemias and Lymphomas. , Golde D. (ed.), Alan R. Liss, Inc. 61:553-566. Following transfection, the PA317 cells are split and then treated with G418 until individual clones can be identified and expanded. Each clone is then screened for its titer by analyzing its ability to transfer G418 resistance (since the retroviral vector contains a Neomycin resistance gene). The clones which have the highest titer are then frozen in numerous aliquots and tested for sterility, presence of replication-competent retrovirus, and presence of mycoplasma. Methods generally employed for construction and production of retroviral vectors have been described above and in Miller, et al., 1990, Methods in Enzym. 217:581-599.

Once high titer viral vector producing clones have been identified, then patients with ovarian cancer can be treated by the following protocol: Viral vector expressing BRCAl is infused into either solid tumors or infused into malignant effusions as a means for altering the growth of the tumor (since it is shown above that the BRCAl protein decreases the growth rate of ovarian cancer cells). Because viral vectors can efficiently transduce a high percentage of cancer cells, the tumors will be growth inhibited

EXAMPLE 10

The protein encoded bv the BRCA2 breast and ovarian cancer susceptibility gene is a granin and a secreted tumor suppressor

The protein encoded by the BRCA2 breast and ovarian cancer susceptibility gene (Wooster, R., et al , Nature 379 789-792, 1995) includes a domain similar to the granin consensus at the C-terminus of the protein As seen in Fig 5, the sequence at amino acids 3334-3344 of Genbank locus HUS43746 matches six of the seven constrained sites of the granin consensus

BRCA2 and murine BRCAl differ from the consensus at the same site The granin motif in BRCA2 lies at the extreme C-terminal end of the protein, a locale characteristic of a known granin This indicates that the protein encoded by the BRCA2 gene is also a secreted growth inhibitor Use of both the BRCAl and BRCA2 genes offer the opportunity for a unified approach to the treatment of inherited and sporadic breast cancer Accordingly, the examples set forth above depicting the treatment of ovarian cancer, are equally applicable to the BRCA2 gene and the BRCA2 protein.

The identification of BRCAl and BRCA2 as granins indicated that there is a granin superfamily of which consists of the subfamilies of chromogranins (chromogranins A, B and C), secretogranins (secretogramns III-V) and the BROCAgranms (BRCAl, BRCA2 and other tumor suppressor genes) This classification of granins mto these subclasses is based on greater similarities within the subfamilies than with the superfamily as a whole For example, the chromogranins share an additional region of homology besides the granm consensus and exhibit similar expression patterns; the secretogranins show less homology to the granin consensus than either chromogranins or BROCAgranins; the BROCAgranins BRCAl and BRCA2 are cancer susceptibility genes, contain additional regions of homology, and are significantly larger (two-twenty times larger) than other granins described to date.

Thus, the invention provides in Example 3 and m this example a granin box consensus sequence shown m Figure 5. Thus, provided is a family of proteins which share the consensus sequence that are tumor suppressor genes. BRCAl and BRCA2 are members of this family. Other members may be identified and purified as tumor suppressor genes by genetic methods, by DNA-based searches for granin homology; or by cloning and characterization of granins in ovarian or breast cancer cells by biochemical methods. Such biochemical methods include the isolation and purification of proteins from secretory vesicles or Golgi by physical isolation methods, followed by development of antibodies to determine which proteins, followed by cloning of genes for secreted proteins after protein sequencing and cloning with degenerate oligonucleotide primers. A example of this method is described in Colomer et al., 1996, J. Biological Chemistry 271 :48-55. Thus, other BROCAgranins are contemplated to be within the scope of this invention.

EXAMPLE 11

Gene Therapy method using the BRCA2 Gene

Viral vectors containing a DNA sequence that codes for a protein having an amino acid sequence as essentially set forth in SEQ ID NO: 4 can be constructed using techniques that are well known in the art, and as are more fully described above. This sequence includes the BRCA2 protein. Viral vectors containing a DNA sequence essentially as set forth in SEQ ID NO:3 (the BRCA2 gene) can be also constructed using techniques that are well known in the art. Retroviral vectors, adenoviral vectors, or adeno-associated viral vectors are all useful methods for delivering genes into breast cancer cells. An excellent candidate for use in breast cancer gene therapy is a Moloney-based retroviral vector with a breast selective MMTV promoter

(Wong et al., 1988, Proceeding of the UCLA Symposia on Biology of

Leukemias and Lymphomas., Golde D. (ed.), Alan R. Liss, Inc. 61:553-566). The viral vector is constructed by cloning the DNA sequence essentially as set forth in SEQ ID NO: 3 into a retroviral vector such as a breast selective vector.

Most preferably, the full-length (coding region) cDNA for BRCA2 is cloned into the retroviral vector. The retroviral vector is then transfected into virus producing cells in the following manner: Viruses are prepared by transfecting PA317 cells with retroviral vector DNAs which are purified as described in

Wong et al. Following transfection, the PA317 cells are split and then treated with G418 until individual clones can be identified and expanded. Each clone is then screened for its titer by analyzing its ability to transfer G418 resistance (since the retroviral vector contains a Neomycin resistance gene). The clones which have the highest titer are then frozen in numerous aliquots and tested for sterility, presence of replication-competent retrovirus, and presence of mycoplasm. The methods generally employed for construction and production of retroviral vectors have been described above and in Miller, et al. , 1990, Methods in Enzym. 217:581-599.

Once high titer viral vector producing clones have been identified, then patients with breast cancer can be treated by the following protocol: Viral vector expressing BRCA2 protein is infused into either solid tumors or infused into malignant effusions as a means for altering the growth of the tumor. Because viral vectors can efficiently transduce a high percentage of cancer cells, the tumors will be growth inhibited.

EXAMPLE 12

Gene Transfer Using Liposomes

An alternative method of gene therapy using the BRCAl and BRCA2 gene includes the use of liposome to deliver the DNA into the cells. By this method, the above described LXSN-BRCA1 plasmid would be incubated with a liposome preparation such as cationic liposomes and then the DNA liposome mix is added to cells or injected into an animal or patient. Generally, the liposome transfection method is of a lower efficiency than viral gene transfer methods. This method is useful because the BRCAl and BRCA2 proteins are secreted proteins. Thus, if only a few percent of cells take up the DNA- liposome combination, it is likely that enough BRCA 1 or BRCA2 protein will be produced and secreted from these cells to growth inhibit other cells. Liposomal transfection of nucleic acids into host cells is described in U.S. Patent Nos. 5,279,833 and 5,286,634, the contents of each of which are herein incorporated by reference.

EXAMPLE 13

Anti-Sense Inhibition of the Production of BRCAl Protein

The antisense inhibition of BRCAl is described as follows. Antisense methods were used to demonstrate that BRCAl expression inhibits cell growth. Unmodified 18 base deoxyribonucleotide complementary to the BRCAl translation initiation site were synthesized and added to cultures of primary mammary epithelial cells (Stampfer et al. 1980, In Vitro 16: 415-425 (1980)) or MCF-7 breast cancer cells (Soule and McGrath, 1980, Cancer Utters 10, 177-189 (1980)).

The morphologic appearance of the cell lines was not noticeably changed by addition of antisense oligonucleotide, but the proliferative rate was faster. Incubation of cells with 40 uM anti-BRCAl oligonucleotide produced accelerated growth of both normal and malignant mammary cells, but did not affect the growth of human retinal pigmented epithelial cells. An intermediate dose of anti-BRCAl oligonucleotide produced a less pronounced but significant increase in cell growth rate. This was not a toxic effect of the oligonucleotide since a control "sense" oligomer with the same GC content did not increase the proliferation rate, and because an addition of a 10 fold excess of sense oligomer to the anti-BRCAl oligomer reversed the growth activation. Thus, antisense inhibition of BRCAl accelerates the growth of breast cancer cells. Because chemotherapy is most effective in cancer cells which are rapidly dividing, it is possible then to treat breast or ovarian cancer by accelerating growth of cancer cells by antisense inhibition of BRCAl protein expression and by treating with chemotherapeutic drugs using standard chemotherapy protocols.

Example 14

Biological Functional Equivalent Proteins and Peptides

Modification and changes may be made in the structure of the BRCAl protein and the BRCA2 protein, or in cleavage products of these proteins, and still obtain a molecule having like or otherwise desirable characteristics. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules or receptors, specifically the BRCAl or

BRCA2 receptor. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid sequence substitutions can be made in a protein sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a protein with like (agonistic) properties. Equally, the same considerations may be employed to create a protein or polypeptide with counterveiling (e.g., antagonistic) properties. It is thus contemplated by the inventors that various changes may be made in the sequence of the BRCAl and BRCA2 proteins or peptides (or underlying DNA) without appreciable loss of their biological utility or activity. Two designations for amino acids are used interchangeably throughout this application, as is common practice in the art. Alanine = Ala (A); Arginine = Arg (R); Aspartate = Asp (D); Asparagine = Asn (N); Cysteine = Cys (C); Glutamate = Glu (E); Glutamine = Gin (Q); Glycine = Gly (G); Histidine = His (H); Isoleucine = He (I); Leucine = Leu (L); Lysine = Lys (K); Methionine = Met (M); Phenylalanine = Phe (F): Proline = Pro (P); Serine = Ser (S); Threonine = Thr (T); Tryptophan = Trp (W); Tyrosine = Tyr (Y); Valine = Val (V).

It is also well understood by the skilled artisan that, inherent in the definition of a biologically functional equivalent protein or peptide, is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule and still result in a molecule with an acceptable level of equivalent biological activity. Biologically functional equivalent peptides are thus defined herein as those peptides in which certain, not most or all, of the amino acids may be substituted. Of course, a plurality of distinct proteins/peptides with different substitutions may easily be made and used in accordance with this invention. It is also well understood that where certain residues are shown to be particularly important to the biological or structural properties of a protein or peptide, e.g., residues in active sites, such residues may not generally be exchanged. This is the case in the present invention where an exchange in the granin box domain may alter the fact that the BRCAl and BRCA2 proteins are secreted.

Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. An analysis of the size, shape and type of the amino acid side-chain substituents reveals that arginine, lysine, and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as biologically functional equivalents. In making such changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+ 1.9); alanine ( + 1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (- 3.9); and arginine (-4.5). The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte & Doolittle, 1982, incoφorated herein by reference). It is known that certain amino acids may be substituted for another amino acids having a similar hydropathic index or score and still retain a similar biological activity.

In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within + 1 are particularly preferred, and those within ±2 is preferred, those which are within ±0.5 are even more particularly preferred. It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity, particularly where the biological functional equivalent protein or peptide thereby created is intended for use in immunological embodiments. U.S. Patent 4,554, 101, incoφorated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a biological property of the protein. It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent protein. As detailed in U.S. Patent 4,554, 101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine ( + 3.0); aspartate ( + 3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (- 0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-

2.5); tryptophan (-3.4).

In making changes based upon similar hydrophilicity values, the substitution of amino acids hose hydrophilicity values are within +2 is preferred, those which are within ± 1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

As outlined above, amino acid substitutions are generally therefore based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. While discussion has focused on functionally equivalent polypeptides arising from amino acid changes, it will be appreciated that these changes may be effected by alteration of the encoding DNA; taking into consideration also that the genetic code is degenerate and that two or more codons may code for the same amino acid.

Kyte & Doolittle, J. Mol. Biol , 157: 105-132, 1982; Hopp, U.S. Patent 4,554,101

In addition to the peptidyl compounds described herein, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the peptide structure. Such compounds, which may be termed peptidomimetics, may be used in the same manner as the peptides of the invention and hence are also functional equivalents. The generation of a structural functional equivalent may be achieved by the techniques of modelling and chemical design known to those of skill in the art. It will be understood that all such sterically similar constructs fall within the scope of the present invention.

U.S. Patent 4,554,101 (Hopp, incoφorated herein by reference) teaches the identification and preparation of epitopes from primary amino acid sequences on the basis of hydrophilicity. Through identify epitopes from within an amino acid sequence such as the BRCAl and BRCA2 sequences disclosed herein (SEQ ID NOs:2, 4). These regions are also referred to as "epitopic core regions".

Numerous scientific publications have been devoted to the prediction of secondary structure, and to the identification of epitopes, from analyses of amino acid sequences (Chou & Fasman, 1974a,b; 1978a,b 1979). Any of these may be used, if desired, to supplement the teachings of Hopp in U.S. Patent 4,554,101. Moreover, computer programs are currently available to assist with predicting antigenic portions and epitopic core regions of proteins. Examples include those programs based upon the Jameson-Wolf analysis (Jameson & Wolf, 1998; Wolf et al., 1988), the program PepPlot^® (Brutlag et al., 1990; Weinberger et al., 1985), and other new programs for protein tertiary structure prediction (Fetrow & Bryant, 1993).

Example 15 Treatment of Breast or Ovarian Cancer using Purified BRCAl or BRCA2

Protein Alternatively, breast or ovarian cancer be treated by the administration of a therapeutically effective amount of the BRCA 1 or BRCA2 protein via an efficient method, such as injection into a tumor. A therapeutically effective amount can be determined by one having ordinary skill in the art using well- known protocols.

It is important to note that breast and ovarian cancer cells have surface receptors which must be contacted by the BRCAl or BRCA2. Thus, the BRCAl or BRCA2 protein, an active fragment, or a small molecule mimetic binds directly to a receptor on the surface of the breast or ovarian cancer cells.

Example 16

Method of Treating Breast or Ovarian Cancer Comprising Introducing the BRCAl Receptor Gene and the BRCAl protein into a Breast or Ovarian Cancer Cell The loss of the BRCAl receptor in breast and ovarian cancer cells will lead to the proliferation and tumorigenesis in these cells. Thus, breast and ovarian cancer can be treated by introducing the BRCAl receptor gene into breast or ovarian cancer cells using the gene therapy methods described above.

This step will be followed by the administration of a therapeutically effective amount of the BRCA 1 protein so that the BRCAl protein contacts a receptor on a surface of the breast or ovarian cells. A therapeutically effective amount can be determined by one having ordinary skill in the art using well-known protocols.

Example 17

Method of Preventing Breast or Ovarian Cancer using BRCAl or BRCA2 Protein

It is a well-established epidemiologic fact that parity and particularly early parity has a protective effect in regards to both breast and ovarian cancer risk. Because of various changes in the structure of society it is now quite common for women tυ delay childbirth and lose this natural protective effect. Since it is known that BRCAl is induced in pregnancy and lactation, and it is demonstrated herein that BRCAl is a secreted growth inhibitor that is specific for breast and ovarian cancer, the protective effect of pregnancy and lactation is due to BRCAl expression. BRCAl mediation of this effect for both breast and ovarian cancer presents a variety of strategies that are useful in decreasing breast and ovarian cancer risk, particularly in women that did not have a baby in their first twenty years and thus, were at a higher risk to develop breast or ovarian cancer. Thus, one can use a BRCA to prevent the first occurrence or a recurrence of breast and ovarian cancer. Examples of such strategies are presented below. While examples are provided, such strategies should not be limited to the examples.

BRCAl protein might be used a chemopreventive agent by introducing BRCAl directly into the peritoneal cavity of women as the whole protein, as a functional fragment, or as a functional cleavage product. In addition, compounds that induce expression of BRCAl or activate its receptor, e.g. a small molecule mimetic, could also be introduced. Since BRCAl is a secreted protein, the introduced BRCAl will decrease ovarian cancer risk in the same manner that BRCAl does normally when its expression is induced by pregnancy. The protective effect is also expected where BRCAl expression is mediated by gene therapy method by either directly or indirectly inducing expression of BRCA 1.

A similar rationale can be applied to breast cancer prevention. In this case, the whole BRCAl protein; a functional fragment or a functional cleavage product thereof; or a pharmacological mimic can be used. In addition, compounds that induce expression of BRCAl or activate its receptor, e.g. a small molecule mimetic, could also be used. Gene therapy approaches for increasing the expression of BRCAl in breast directly or indirectly could also be used. Systemic agents that induce expression of BRCAl , or that mimic function and can replace BRCAl, such a peptidomimetic agent, could also be used. The delivery of such agents could take place by directly instilling the agent within the breast by introducing via the nipple. Finally, an implantable time release capsule can be used in a prevention strategy, either by placing such a capsule in the peritoneum for ovarian cancer, by implant such a capsule into the breast for breast cancer.

Since the BRCA2 protein includes a granin sequences and is also a secreted tumor suppressor protein, similar prevention strategies can be applied using the BRCA2 gene and protein.

Experimental Procedures for Examples 1-6 Tissues and Cell Culture Cryopreserved primary cell lines (Passage 7) of normal human mammary epithelial (HMEC) cells, were obtained from Clonetics, Inc. The cryovial of HMEC was thawed and subcultured according to the instructions provided, which are a slight modification of published procedures (Stampfer et al, 1980, Growth of Normal Human Mammary Cells in Culture. 16, 415-425). Breast cancer cell lines were obtained from American Type Culture Collection (ATCC), Rockville, MD. Sf9 cells were obtained from ATCC.

Antibodies

C-terminal 19 peptide fragment was conjugated to keyhole limpet hemacyanin and injected into New Zealand white rabbits along with Freund's adjuvant according to standard protocols. C-20 and D-20 were provided by Santa Cruz Biotechnology, c-myc and PDGFR antibodies were provided by Steve Harm and William LaRochelle, respectively.

Cell Extracts, Immunoblotting, Immunoprecipitation, Northern blotting Cell lysates, immunoblotting, and immunoprecipitation assays were performed according to previously published methods (Jensen et al, 1992, Biochem. 31 :

10887-10892). RNA was isolated by published methods (Jensen et al, 1994, Proc Natl Acad Sci USA 91 , 9257-9261) and probed with the T7 labelled EcoRI- Kpn I fragment from exon 11.

Cell Fractionation Studies

Cell fractionations were performed according the method of Fazioli, et al (1993, Mol. Cell. Bio. 13, 5814-5828). Briefly, cells in T175 flasks were washed twice with cold PBS/0.5 mM sodium vanadate, followed by a single washing in cold isotonic fractionation buffer (FB). Then, cold FB + protease inhibitors (PI) are added to the plates. The plates are incubated for 10 min, scraped, and homogenized with a Dounce tissue homogenizer. The nuclei were gently pelleted (375g) at 4°C and the supernatant (cytosolic and plasma membrane fraction) was saved. After washing the nuclear pellet with four aliquots of cold FB + PI + 0.1 % NP40 followed by centrifugation at 4°C, the nuclei were resuspended in cold FB and 2X lysis buffer + PI. The cytosolic and plasma membrane fraction was then ultracentrifuged (35,000g) for 30 min at 4°C and the supernatant was saved as the cytosolic fraction. The pellet (plasma membrane fraction) was resuspended in FB + PI and solubilized in 2X lysis buffer with PI. Following this, the nuclear and plasma membrane fractions are sonicated on ice for 10 seconds three times. They were then spun at 10,000g at 4°C, and the supernatant was collected and saved as the soluble nuclear and plasma membrane fractions, respectively.

Confocal Imaging Studies HMEC cells were plated into 35 mm culture dishes with glass bottom cover slips (Mat-Tek) and allowed to grow to 70% confluency. The cells were then rinsed, fixed in 4.0% paraformaldehyde in phosphate buffered saline at 4°C (PBS, 0.01 M phosphate salts, and 0.15 M NaCl, pH 7.6) for ten minutes, and washed and permeabilized in PBS with 0.2% Triton X-100 for two minutes. Cells were blocked with 5% normal donkey serum in PBS. Primary antibodies were diluted in PBS containing 3.0% bovine serum albumin (BSA) and 0.1 % Triton X-100 and consisted of rabbit anti-BRCA-1 (vendor) diluted 1:200 and a mouse monoclonal to a Golgi complex antigen (Biogenex; clone 371-4) diluted 1: 10. No antibody and antibody to BRCA-1 pre-adsorbed with the peptide antigen were used as negative controls. Secondary antibodies were from Jackson Immunoresearch and consisted of extensively adsorbed, multiple-labeling grade donkey anti-rabbit-specific IgG conjugated to CY3 (diluted 1 : 1000) and donkey anti-mouse-specific IgG conjugated to either CY5 (diluted 1:500) or FITC (diluted 1:250). Nuclei were counterstained with YO-PRO1 (Molecular Probes, Inc.) diluted 1:500 for 20 minutes following immunostaining. Double-immunolabeling studies were carried out with all the necessary controls for staining specificity as outlined previously (Jetton et al., 1994, J. Biol. Chem. 269, 3641-3654). Following immunostaining, sections were mounted in Aqua-Polymount (Polysciences) and imaged using a Zeiss LSM 410 confocal microscope using the 488/647 and 543 nm lines of an

Ar-Kr and He-Ne laser, respectively. Images were optimized using Adobe Photoshop 3.0 then transferred as TIFF files to a Silicon Graphics Indigo where figures were assembled using SGI Showcase and printed using a Tektronix Phaser IISDX color printer.

Glycosylation Analysis

Glycosylation analysis was performed on aliquots of HMEC membrane fractions with the Enzymatic Deglycosylation Kit from Glyko, Inc. according to the manufacturer's recommended protocol, and the samples were immunoblotted and probed with C-20 antibody. Isolation of Secretory Vesicles

Secretory vesicles were isolated as described (Tooze and Huttner, 1990, Cell 60, 837-847) with minor modifications. All steps were performed at 4°C. MDA-MB-468 cells were washed with cold PBS containing protease inhibitors. After centrifugation at 700 x g for 5 min, the pellet was resuspended in homogenization buffer (0.25 M sucrose, 1 mM EDTA, 1 mM Mg acetate, 10 mM HEPES-KOH, pH 7.2) with protease inhibitors. and centrifuged at 1700 x g for 5 min. The pellet was resuspended in 5 times the cell volume of homogenization buffer with protease inhibitors. Cells were passed through a 22 gauge needle 10 times and homogenized with 50 strokes of a Pyrex homogenizer. Unbroken cells and nuclei were pelleted at 1000 x g for 10 min. One ml of the postnuclear supernatant was loaded onto a 0.3 M-l.2 M sucrose gradient (made in 10 mM HEPES-KOH, pH 7.2) with protease inhibitors and centrifuged at 25,000 φm in a Beckman SW41 rotor for 15 min. One ml fractions were collected from the bottom and fractions

9-12 were pooled and loaded onto a 0.5 M-2 M sucrose gradient. The gradient was centrifuged at 25,000 rpm in a Beckman SW41 rotor for 16 hours and fractions collected from the bottom. Fractions 4-12 were analyzed by Western blot analysis.

Expression of Recombinant Clones in the Baculovirus Expression System A full length BRCAl cDNA containing consensus translation initiation and stop sites was cloned into the baculovirus transfer vector pAcSG2 as a Sal I fragment. Recombinant baculovirus were produced by cotransfecting Sf9 cells with Baculogold (PharMingen) virus DNA and the recombinant vector DNA.

The resulting culture supernatants were harvested after four days, screened for homologous recombination by limiting dilution (Jensen et al., 1992, Biochem. 31: 10887-10892), and confirmed by dot-blot hybridization using the 32P-labeled, BRCAl cDNA probe. Recombinant protein was expressed by infecting with high titer virus at multiplicities of infection of 10: 1 or greater.

Peptide Mapping

Whole cell lysates from MDA-MB-468 cells and BRCAl recombinant virus infected Sf9 cells were electrophoresed and the 190 kDa MDA-MB-468 band and 180 kDa BRCAl recombinant protein were identified by removing one lane for immunoblotting with C-20 antibody. The bands of interest were then cut out of the gel, eluted on Microcon spin columns (Amicon), and digested with increasing amounts of V8 protease. The digests were re-electrophoresed on 4-20% gradient gels and immunoblotted with C-20.

Immunogold electron microscopy

MDA-MB-468 cells were trypsinized, washed in PBS, and fixed in 4.0% paraformaldehyde + 0.1 % glutaraldehyde/PBS (pH 7.4) for 10 minutes on ice. The cell pellet was washed in PBS, dehydrated in a graded series of alcohols, and embedded in LR White resin (medium grade; Polysciences, Inc.). Thin sections were mounted on nickel grids and blocked in PBS +

1.0% bovine serum albumin (BSA) for two hours at room temperature. The grids were then incubated overnight in 1.0% BSA supplemented with 0.05% Tween with or without the C-20 antibody at a final dilution of 1 :200. The grids were then washed in PBS/0.05% Tween and incubated in a 1 : 100 dilution of a goat anti-rabbit-gold conjugate (15 nm size; Electron Microscopy

Sciences) for one hour at room temperature. The grids were washed as above, rinsed in distilled water and lightly counterstained with saturated aqueous uranyl acetate and lead citrate, and imaged with a Hitachi H-800 transmission electron microscope.

Gene Transfer Methods and Nude Mice Studies

MCF-7 cells were transfected by calcium phosphate coprecipitation for cell growth studies, but were transduced with retroviral stocks from PA317 producer clones for the nude mice studies as described in the results. Cultured MCF-7 cells were transduced in vitro and then injected subcutaneously into the left flank of 4 week old female nu/nu mice containing slow-release estrogen pellets (Soule et al., 1980, Cancer Letters 10, 177-189). Tumor size was determined weekly and animals were autopsied at 8 weeks after injection for determination of tumor weight and RT-PCR analysis for gene expression (Thompson et al., 1995, Nature Genetics 9, 444-450). For evaluation of effects of BRCAl and mutant retroviral vectors on established tumors, 10⁷ MCF-7 cells were injected intraperitoneally and the animals were injected intraperitoneally with high titer retroviral vector stock (10⁷ virions) once palpable tumors were identified. Example 18

Phase I Trial of Retroviral BRCAl Gene Therapy in Ovarian Cancer

Summary

Methods. As an initial step towards gene replacement therapy for ovarian cancer a Phase I/II trial to assess the pharmacokinetics and toxicity of intraperitoneal vector therapy was conducted. Clinical grade retroviral vector was produced under cGMP (current Good Manufacturing

Practices) and tested for titer(5 x 107/ml), sterility, and in vitro efficacy. Following placement of an indwelling port-a-cath in patients, a dose escalation study was performed of four daily intraperitoneal infusions spanning doses from 3 mis to 300 mis at half-log intervals (23 cycles in 12 patients). Pharmacokinetics was assessed by PCR and southern blots detecting vector DNA and toxicity was evaluated by clinical exam and fluid analysis.

Results. Three of 12 patients developed an acute sterile peritonitis which spontaneously resolved within 48 hours. This presentation resembled that noted in immunocompetent mice given vector during oyster glycogen induced chronic peritonitis. Plasma antibodies to the retroviral envelope protein were detected in only 1 patient three months after initial treatment, but not in others despite repeat dosing for an interval of up to 4 months. PCR analysis of patient post-treatment peritoneal fluids revealed stable, transduction capable vector 24 hours after infusion. The presence of stable vector correlated inversely with peritoneal CH50 levels supporting the presumed link between complement activation and retroviral vector stability. Gene transfer was documented by PCR, southern blot, western blot, and immunohistochemistry. Eight patients showed disease stabilization for 4 to 16 weeks and three of these showed an objective response with diminished miliary tumor implants at reoperation (2 patients) and radiagraphic shrinkage of measurable disease (1 patient).

Conclusions. The vector-related complication of peritonitis was observed in three patients but resolved quickly as in preclinical mouse studies. Intraperitoneal infusion of retroviral vector produces stable vector, particularly in a subclass of patients with low peritoneal fluid CH50 levels. Inhibition Detailed Discussion

Retroviruses are known to be rapidly inactivated by complement present in human sera. Welsh R.M. , et al. Nature 257: 612-614, 1975; Ayesh S.K., et al. Blood S5: 3503-3509, 1995; Pensiero M.N. , et al. Human Gene Therapy 7: 1095-1101 , 1996; Rother R.P., et al., Hum. Gene Therapy 6: 429-435, 1995; but are considerably more stable in human compartments with lower complement levels, Arteaga, C.L. , et al. Cancer Research 56: 1098 1103,1996, suggesting that the peritoneal cavity may represent a favored site for retroviral vectors. Herein is reported a Phase I trial evaluating toxicity and pharmacokinetics in 12 patients with ovarian cancer who were intraperitoneally infused with 108- 1010/day of the BRCAl expressing retroviral vector, LXSN-BRCA1. METHODS Patient Selection and Eligibility Criteria

Patients with recurrent or persistent metastatic epithelial ovarian cancer previously treated with standard surgery and chemotherapy were considered for study. Inclusion criteria included measurable tumor in 2 dimensions confined to the peritoneal cavity, age > 18 and < 75, Gynecologic Oncology Group (GOG) performance status < 2, life expectancy of greater than 3 months, 4 week interval from previous surgery and/or cancer therapy, adequate hematological (WBC >4000/mm3), hepatic

(bilirubin < 2mg/dl, SGOT <2x normal), and renal (creatinine < 1.5mg/dl) functions.

Vector Production and Testing

Retroviral vector was manufactured under GMP (Good Manufacturing Practices) conditions employing a CellCube (Corning-Costar,Elmira, NY) apparatus perfused with Aim V media under continuous monitoring of pH and O₂. Once the lactate production or glucose consumption are consistent and appropriate, supernatant is collected as long as the lactate and glucose levels assure optimal vector production. The titer of the vector preparations was determined by quantitying the number of particles present which conferred G418 resistance to transduced MCF-7 cells, employing appropriate dilutions. Vector from this production lot tested negative for bacterial, mycoplasm, and viral contamination and was endotoxin negative. Replication-competent retroviruses could not be detected using PG4 indicator cells following amplification on Mus Dunni. Study Design Patients underwent initial placement of a peritoneal portacath for access to the peritoneal cavity followed by admission to the Clinical Research Center at Vanderbilt University Medical Center for treatment. Patients were treated for 4 consecutive days with intraperitoneal LXSN- BRCA1 gene therapy. Five dose levels were studied: 108, 3.3x108, 109, 3.3x109, and 1010 viral particles. Upon retreatment, patients were escalated to the next highest dose level activated by new patient accrual. Daily blood and peritoneal samples were collected to evaluate for viral uptake by cells, presence of apotosis, expression of BRCAl gene, and peritoneal fluid CH50 levels. At 4 week intervals patients were evaluated for response to therapy; if tumor measurements were stable or decreased, retreatment was allowed.

Patients who demonstrated tumor progression were evaluated at monthly intervals until death at which time autopsy was requested to evaluate for the systemic presence of retroviral particles and sites of tumor progression. Detection of vector stability and expression: DNA was prepared from cell samples by hypotonic lysis followed by digestion with pronase and SDS, followed by pheno/chloroform extraction and ethanol precipiation. DNA was prepared from tissue or tumor samples by freezing samples at -70 °C and then finely mincing cold samples with a blade, prior to treatment was proteinase K as described above. RNA was purified from both cells and tumors by lysis in guanidinium thiocyanate by our prior cited methods.

PCR primers specific for the neo sequences within the LXSN-BRCA1 vector were employed for determination of vector presence and stability within patient samples. The primers were 5' CCGGCCGCTTGGGTGGAGA 3' and 5'CAGGTAGCCGGATCAAGCGTATGC 3' and were amplified at the following conditions: initial denaturation at 95 °C for 2 minutes; followed by 20 cycles of 1 minute at 94 °C, 1 minute at 65 °C, and 30 seconds at

72°C. RT-PCR was performed by published methods using the following basic method: RNA samples was reverse transcribed for 1 hour at 37 °C using 2 ug of total RNA, 1 ug random hexamers (Boehringer Mannheim), IX first strand buffer(Gibco BRL), 0.01 M DTT, 0.5 mM each dATP, dCTP, dGTP, and dTTP and 200 U Superscript II RNaseH -reverse transcriptase (Gibco BRL). The RNA:DNA duplexes were used as templates for 20 cycle PCR reactions using the following conditions: denaturation 94°C, 20 seconds; annealing 52°C 45 seconds; elongation 75° C,90 seconds. The following primers were used for RT-PCR studies. LXSN- BRCAl primers designed to span the LXSN LTR and BRCAl sequences:

5' CCCTCCCTGGGTCAAGCCCTTTGTA 3' and

5 TCAACGCGAAGAGCAGATAAATCCAT 3' ; and control primers for GADPH with sequences: 5' CGCCAGCCGAGCCACATC 3' and 5' AGCCCCAGCCTTCTCCAT 3'. Southern blotting of Ava I digested DNA was performed with a human BRCAl probe which was directed exon 24, producing a different sized fragment from vector vis-a-vis noπnal genomic DNA. Percent transduction was calculated by quantitating hybridization with the phosphoimager and then comparing hybridization of the presumed haploid vector lower band to that of the diploid globin upper band (percent transduction = 2 X vector signal/globin signal. RESULTS

Twelve patients with recurrent or persistent epithelial ovarian cancer were treated with between 1 and 3 cycles of intraperitoneal vector. These patients included individuals with and without a family history of ovarian or breast cancer representing patients with potentially inherited as well as sporadic ovarian cancer. The clinical features of. individual patients are presented in Table IV .

Toxicity of Intraperitoneal LXSN-BRCA1 Infusion:

An animal model to predict toxicity of LXSN-BRCA1 in ovarian cancer patients was developed employing prior intraperitoneal oyster glycogen injection in an attempt to mimic peritoneal inflammation often found in malignant effusions. These studies demonstrated that intraperitoneal injection of the LXSN-BRCA1 vector itself produced a mild peritonitis and focal hepatocellular degeneration in Balb C mice which was dose dependent. However, intraperitoneal administration of LXSN-BRCA1 into oyster glycogen primed animals produced a severe acute peritonitis which killed 2/15 animals in the high dose group. Surviving animals showed rapid resolution of peritonitis over 48 hours with no residual inflammation at 2 weeks. This peritonitis appears to be unique for LXSN-BRCA1 retroviral vector since a different retroviral vector XM6:antifos, Arteaga, C.L., et al. Cancer Research 56:1098 1103, 1996, administered intraperitoneally at similar titer did not produce peritonitis or death in Balb C mice.

Because preclinical toxicity studies produced peritonitis in i munocompetent mice, the patients were carefully evaluated for clinical and laboratory signs of acute peritonitis. Three of the fifteen patients (patients 3, 5 and 9) developed peritonitis which resolved within 24 hours after treatment was stopped. Patient 3 was retreated with a lower dose of vector and showed no recurrence of peritonitis, even after dose escalation two further levels. In retrospect, patient 5 was an obese patient with a loculated peritoneal space and may have received a larger than anticipated local dose. Catheter placement is clearly an important consideration in intraperitoneal therapy since delivery of an agent into a confined space likely decreases efficacy and increases risk of local toxicity. Other toxicities in the trial included fever in 4 patients and nausea in 2 patients from the abdominal distension produced by the intraperitoneal infusion of vector. Pharmacokinetics of Intraperitoneal Vector Therapy

Recombinant DNA methods such as southern blotting and polymerase chain reaction (PCR) permit sensitive and specific detection of retroviral vectors in patient fluids and biopsied tissues. Multiple PCR analyses on plasma samples showed no detectable vector distribution to the systemic circulation, even in patients treated at the highest dose. Twenty-four hours after each infusion (just prior to the next dose) we sampled peritoneal fluid to assess stability and uptake of the retroviral vector. PCR detection of stable vector in peritoneal fluid samples from treated patients was shown. Fluid samples were centrifuged in order to obtain distinct samples for stable vector in peritoneal supernatant (PCR fluid) as well as vector which had entered cells within peritoneal fluid (PCR pellet). Because PCR fluid determinations were performed on 5 ul of peritoneal supernatant and PCR pellet determinations were performed on cells from as much as 10 mis of peritoneal fluid, the PCR pellet assay has greater sensitivity (can detect smaller quantities of vector). Because PCR analysis can detect either transduction- capable vector or degraded vector DNA, 200 ul of patient peritoneal fluid was assayed for the capacity to transduce MCF-7 target cells.

Results of this study demonstrate that LXSN-BRCA 1 vector is still transduction-capable 24 hours after infusion in some samples. Table V shows results from three different PCR-based methods for assessing vector stability and gene transfer. The results of these assays were quite consistent despite the fact that each measured something slightly different. It was consistently observed that vector assays were much more likely to be positive during the later days of treatment than during the early days of treatment (See Table V). Because complement is known to inactivate retroviruses and since vector stability did not correlate cleanly with vector dose, complement levels in patient fluid samples were assayed and were compared with the PCR- based stability results. These results show an apparent relationship between complement level and vector stability. Although there is no obvious correlation between initial CH50 or mean CH50 and vector stability in patients, samples with low CH50s are more likely to be positive than are those samples with higher CH50s (Table V).

Antibodies could also effect vector stabiility so patient sera and peritoneal fluid were tested for the development of antibodies to the amphotropic envelope. The majority of patients never developed detectable antibodies, but one patient (patient 3) developed antibodies after 3 months in both sera and peritoneal fluid. Antibodies did not eliminate vector from the peritoneal fluid since positive PCR samples occurred after the development of antibodies by this patient. Table V shows vector stability, complement levels, and plasma antibody results in treated patients.

Gene transfer into patient cells and tissues was analyzed by PCR, southern blot, and RT-PCR. DNA was purified from peritoneal fluid cells analyzed by PCR which demonstrated transfer of vector into cells within the malignant effusion. Because sampling cells within peritoneal fluid would not necessarily predict gene transfer into malignant or normal tissues, biopsies were obtained from patients who had laparotomies following intraperitoneal treatment. These results showed more efficient integration of vector into the tumor surface than into inner regions of the tumor, and show greater transduction into tumor tissue than into normal tissues. Estimation of transduction rate indicates that 5-10% of cells were transduced with vector in samples which exhibited the strongest signals. In order to assess expression of the retroviral vector, PCR primers were designed which would only detect transcripts which initiated in the retroviral vector and then employed RT- PCR as a semi-quantitative measure of BRCAl vector expression. These results showed comparatively strong expression of the vector in samples from patients with significant vector transduction who had been recently treated with vector.

Disease stabilization was noted in 8 patients with an objective response defined as a decrease in number of peritoneal miliary implants in 2 patients undergoing reoperation for complications related to their cancer and 1 patient demonstrating decrease in measurable tumor dimensions radiographically. Histologic examination of samples from the 2 patients showing a decrease in miliary implants showed tumor necrosis and granulation tissue in tumors within the peritoneum, but these effects were absent in tumor at distant sites obtained at the autopsy for patient 10. These results are compatible with a localized effect of LXSN-BRCA1 which cannot affect tumor growth by a systemic mechanism.

This Phase I study of LXSN-BRCA1 demonstrated that the retroviral vector was stable in peritoneal fluid and transferred the gene into cancer cells which expressed the vector. Peritonitis was observed in three patients but resolved rapidly and was analagous to the peritonitis observed in mouse preclinical models. Retreatment does not increase toxicity and does not effect vector stability. Vector inactivation by complement is present in vivo, but antibody development occurs rarely and does not eliminate the vector. Gene therapy has been heralded as disease-specific therapy with few side effects, but the identification of toxicities specifically associated with gene therapy should not be surprising. The LXSN-BRCA1 peritonitis observed in mice and in certain patients is rapidly reversible and appears to resolve without sequelae. The peritonitis is not clearly dose-related in patients to date although administration into larger numbers of patients may demonstrate a relationship with dose. The peritonitis does not reproducibly occur in a given patient since at least one patient with peritonitis was retreated without recurrence.

This protocol employed repeat administration in a number of patients for periods ranging 2-4 months. Antibody formation was rarely observed and neither antibody production nor repeat administration appeared to decrease vector stability. These data suggest that patients may be given repeat doses of retroviral vectors without development of tolerance or enhanced toxicity. Repeat administration increases the cumulative dose of retroviral vector which can be administered and ultimately increases the multiplicity of infection. The highest dose level employed 4 daily injections totalling 6 x 1010 vector particles each month. Since intraperitoneal tumor burdens may be as high as 1011 tumor cells (1012 cells is known to cause host death) in different patients, it may be very important to increase the dose since these studies appear to be employing a minimal multiplicity of infection.

Decreased levels of complement in peritoneal effusions appear to explain the relative stability of vector in this site, so it is important to consider that vector stability may be a function of both vector dose and complement activity within the patient's peritoneal cavity. One can envision a number of approaches to enhancing the stability of retroviral vectors including complement blockade with lectins or engineering vector envelopes resistant to complement, Rother R.P. , et al., J. Exp. Med. 182: 1345-1355,

1995; Rollins S.A., et al. Hum. Gene Ther. 7:619-626, 1996. These types of approaches could expand the population of patients with stable intraperitoneal vector and might permit stable vector in other sites as well.

Retroviral vector therapy with LXSN-BRCA1 is a rational therapeutic approach which attempts to attack a tumor with the appropriate tumor suppressor gene. Intraperitoneal therapy of ovarian cancer with LXSN- BRCA1 has a number of clinical advantages, including: l)natural history of ovarian cancer confinement to peritoneal cavity; 2) known active tumor suppressor gene; 2) peritoneal site permits high dose delivery and vector stability; 4) regional therapy for ovarian cancer is a well-described therapeutic modality 5) current treatment strategies have offered little improvement in survival from ovarian cancer. This human gene therapy model system should allow testing of improved vectors and approaches which may ultimately applied to a myriad of diseases.

50

TABLE IV

TABLE V

SEQUENCE LISTING

( 1 ) GENERAL INFORMATION : (i) APPLICANT: HOLT, JEFFREY T.

JENSEN, ROY A. PAGE, DAVID L.

KING, MARY-CLAIRE SZABO, CSILLA I. JETTON, THOMAS L. ROBINSON-BENION, CHERYL L. THOMPSON, MARILYN E.

(ii) TITLE OF INVENTION: CHARACTERIZED BRCAl AND

BRCA2 PROTEINS AND SCREENING AND THERAPEUTIC METHODS BASED ON

CHARACTERIZED BRCAl AND BRCA2 PROTEINS. (Hi) NUMBER OF SEQUENCES: 7

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: ARLES A. TAYLOR, JR.

(B) STREET: 414 UNION STREET, SUITE 2020

(C) CITY: NASHVILLE (D) STATE: TENNESSEE

(E) COUNTRY: USA

(F) ZIP: 37219

(v) COMPUTER READABLE FORM :

(A) MEDIUM TYPE: Diskette, 3.50 inch, 800 kB storage (B) COMPUTER: IBM PC/XT/ AT compatible

(C) OPERATING SYSTEM: Windows 95

(D) SOFTWARE: Microsoft Word 6.0 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: 08/603,753 (B) FILING DATE: 20 FEB 1996

(C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA :

(A) APPLICATION NUMBER: U.S. 08/373,799

(B) FILING DATE: 17 JAN 1995 (viii) ATTORNEY/ AGENT INFORMATION:

(A) NAME: ARLES A. TAYLOR, JR. (B) REGISTRATION NUMBER: 39,395

(C) REFERENCE/DOCKET NUMBER: 0216-9640 (ix) TELECOMMUNICATION INFORMATION (O):

(A) TELEPHONE: (615) 242-2400 (B) TELEFAX: (615) 242-2221

(C) TELEX:

(2) INFORMATION FOR SEQ ID NO : 1 : (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5712 (B) TYPE: nucleic acid

(C) STRANDEDNESS: double

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: no (iv) ANTI-SENSE: no

(v) ORIGINAL SOURCE

(A) ORGANISM: Homo sapiens

(C) INDIVIDUAL/ISOLATE:

(D) DEVELOPMENTAL STAGE: adult (F) TISSUE TYPE: female breast

(G) CELL TYPE: ductal carcinoma in situ, invasive breast cancer and normal breast tissue (H) CELL LINE: not derived from a cell line (I) ORGANELLE: no (vii) IMMEDIATE SOURCE:

(A) LIBRARY: cDNA library derived from human

(B) CLONE: obtained using published sequence

(viii) POSITION IN GENOME: (A) CHROMOSOME/SEGMENT: unknown

(B) MAP POSITION: unknown

(C) UNITS: unknown (ix) FEATURE:

(A) NAME/KEY: BRCAl (B) LOCATION: GenBank accession no. U 14680

(C) IDENTIFICATION METHOD: microscopically-directed sampling and nuclease protection assay

(D) OTHER INFORMATION: gene encoding BRCAl protein

(x) PUBLICATION INFORMATION. (A) AUTHORS: Miki, Y., et. al.

(B) TITLE: A strong candidate gene for the breast and ovarian cancer susceptibility gene BRCAl.

(C) JOURNAL: Science (D) VOLUME: 266

(E) PAGES: 66-71

(F) DATE: 1994

(K) RELEVANT RESIDUES IN SEQ ID NO : 1

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 :

agctcgctga gacttcctgg accccgcacc aggctgtggg gtttctcaga taactgggcc 60 cctgcgctca ggaggccttc accctctgct ctgggtaaag ttcattggaa cagaaagaa 119 atg gat tta tct g t ctt cgc gtt gaa gaa gta caa aat gtc att aat 167 Met Asp Leu Ser Ala Leu Arg Val Glu Glu Val Gin Asn Val lie Asn

1 5 10 15 get atg cag aaa ate tta gag tgt ccc ate tgt ctg gag ttg ate aag 215 Ala Met Gin Lys He Leu Glu Cys Pro lie Cys Leu Glu Leu lie Lys 20 25 30 gaa cct gtc tec aca aag tgt gac cac ata ttt tgc aaa ttt tgc atg 263 Glu Pro Val Ser Thr Lys Cys Asp His He Phe Cys Lys Phe Cys Met 35 40 45 ctg aaa ctt etc aac cag aag aaa ggg cct tea cag tgt cct tta tgt 311 Leu Lys Leu Leu Asn Gin Lys Lys Gly Pro Ser Gin Cys Pro Leu Cys 50 55 60 aag aat gat ata ace aaa agg age eta caa gaa agt acg aga ttt agt 359 Lys Asn Asp lie Thr Lys Arg Ser Leu Gin Glu Ser Thr Arg Phe Ser 65 70 75 80 caa ctt gtt gaa gag eta ttg aaa ate att tgt get ttt cag ctt gac 407

Gin Leu Val Glu Glu Leu Leu Lys He He Cys Ala Phe Gin Leu Asp

85 90 95 aca ggt ttg gag tat gca aac age tat aat ttt gca aaa aag gaa aat 455

Thr Gly Leu Glu Tyr Ala Asn Ser Tyr Asn Phe Ala Lys Lys Glu Asn 100 105 110 aac tct cct gaa cat eta aaa gat gaa gtt tct ate ate caa agt atg 503 Asn Ser Pro Glu His Leu Lys Asp Glu Val Ser He He Gin Ser Met 115 120 125 ggc tac aga aac cgt gee aaa aga ctt eta cag agt gaa ccc gaa aat 551 Gly Tyr Arg Asn Arg Ala Lys Arg Leu Leu Gin Ser Glu Pro Glu Asn 130 135 140 cct tec ttg cag gaa ace agt etc agt gtc caa etc tct aac ctt gga 599 Pro Ser Leu Gin Glu Thr Ser Leu Ser Val Gin Leu Ser Asn Leu Gly 145 150 155 160 act gtg aga act ctg agg aca aag cag egg ata caa cct caa aag acg 647 Thr Val Arg Thr Leu Arg Thr Lys Gin Arg He Gin Pro Gin Lys Thr 165 170 175

tct gtc tac att gaa ttg gga tct gat tct tct gaa gat ace gtt aat 695 Ser Val Tyr lie Glu Leu Gly Ser Asp Ser Ser Glu Asp Thr Val Asn 180 185 190 aag gca act tat tgc agt gtg gga gat caa gaa ttg tta caa ate ace 743 Lys Ala Thr Tyr Cys Ser Val Gly Asp Gin Glu Leu Leu Gin He Thr

195 200 205 cct caa gga ace agg gat gaa ate agt ttg gat tct gca aaa aag get 791 Pro Gin Gly Thr Arg Asp Glu He Ser Leu Asp Ser Ala Lys Lys Ala 210 215 220 get tgt gaa ttt tct gag acg gat gta aca aat act gaa cat cat caa 839

Ala Cys Glu Phe Ser Glu Thr Asp Val Thr Asn Thr Glu His His Gin 225 230 235 240 ccc agt aat aat gat ttg aac ace act gag aag cgt gca get gag agg 887

Pro Ser Asn Asn Asp Leu Asn Thr Thr Glu Lys Arg Ala Ala Glu Arg

245 250 255 cat cca gaa aag tat cag ggt agt tct gtt tea aac ttg cat gtg gag 935 His Pro Glu Lys Tyr Gin Gly Ser Ser Val Ser Asn Leu His Val Glu 260 265 270 cca tgt ggc aca aat act cat gee age tea tta cag cat gag aac age 983 Pro Cys Gly Thr Asn Thr His Ala Ser Ser Leu Gin His Glu Asn Ser 275 280 285 agt tta tta etc act aaa gac aga atg aat gta gaa aag get gaa ttc 1031 Ser Leu Leu Leu Thr Lys Asp Arg Met Asn Val Glu Lys Ala Glu Phe 290 295 300 tgt aat aaa age aaa cag cct ggc tta gca agg age caa cat aac aga 1079 Cys Asn Lys Ser Lys Gin Pro Gly Leu Ala Arg Ser Gin His Asn Arg 305 310 315 320 tgg get gga agt aag gaa aca tgt aat gat agg egg act ccc age aca 1127 Trp Ala Gly Ser Lys Glu Thr Cys Asn Asp Arg Arg Thr Pro Ser Thr 325 330 335 gaa aaa aag gta gat ctg aat get gat ccc ctg tgt gag aga aaa gaa 175 Glu Lys Lys Val Asp Leu Asn Ala Asp Pro Leu Cys Glu Arg Lys Glu 340 345 350 tgg aat aag cag aaa ctg cca tgc tea gag aat cct aga gat act gaa 1223 Trp Asn Lys Gin Lys Leu Pro Cys Ser Glu Asn Pro Arg Asp Thr Glu 355 360 365 gat gtt cct tgg ata aca eta aat age age att cag aaa gtt aat gag 1271 Asp Val Pro Trp He Thr Leu Asn Ser Ser He Gin Lys Val Asn Glu 370 375 380 tgg ttt tec aga agt gat gaa ctg tta ggt tct gat gac tea cat gat 1319 Trp Phe Ser Arg Ser Asp Glu Leu Leu Gly Ser Asp Asp Ser His Asp

385 390 395 400

999939 tct gaa tea aat gee aaa gta get gat gta ttg gac gtt eta 1367 Gly Glu Ser Glu Ser Asn Ala Lys Val Ala Asp Val Leu Asp Val Leu 405 410 415 aat gag gta gat gaa tat tct ggt tct tea gag aaa ata gac tta ctg 1415

Asn Glu Val Asp Glu Tyr Ser Gly Ser Ser Glu Lys He Asp Leu Leu 420 425 430 gee agt gat cct cat gag get tta ata tgt aaa agt gaa aga gtt cac 1463

Ala Ser Asp Pro His Glu Ala Leu He Cys Lys Ser Asp Arg Val His

435 440 445 tec aaa tea gta gag agt aat att gaa gac aaa ata ttt ggg aaa ace 1511

Ser Lys Ser Val Glu Ser Asp He Glu Asp Lys He Phe Gly Lys Thr 450 455 460 tat egg aag aag gca age etc ccc aac tta age cat gta act gaa aat 1559 Tyr Arg Lys Lys Ala Ser Leu Pro Asn Leu Ser His Val Thr Glu Asn

465 470 475 480 eta att ata gga gca ttt gtt act gag cca cag ata ata caa gag cgt 1607 Leu He He Gly Ala Phe Val Ser Glu Pro Gin He He Gin Glu Arg 485 490 495 ccc etc aca aat aaa tta aag cgt aaa agg aga cct aca tea ggc ctt 1655 Pro Leu Thr Asn Lys Leu Lys Arg Lys Arg Arg Pro Thr Ser Gly Leu 500 505 510 cat cct gag gat ttt ate aag aaa gca gat ttg gca gtt caa aag act 1703 His Pro Glu Asp Phe He Lys Lys Ala Asp Leu Ala Val Gin Lys Thr 515 520 525 cct gaa atg ata aat cag gga act aac caa acg gag cag aat ggt caa 1751

Pro Glu Met He Asn Gin Gly Thr Asn Gin Thr Glu Gin Asn Gly Gin

530 535 540 gtg atg aat att act aat agt ggt cat gag aat aaa aca aaa ggt gat 1799

Val Met Asn lie Thr Asn Ser Gly His Glu Asn Lys Thr Lys Gly Asp

545 550 555 560 tct att cag aat gag aaa aat cct aac cca ata gaa tea etc gaa aaa 1847 Ser He Gin Asn Glu Lys Asn Pro Asn Pro He Glu Ser Leu Glu Lys 565 570 575 gaa tct get ttc aaa acg aaa get gaa cct ata age age agt ata age 1895 Glu Ser Ala Phe Lys Thr Lys Ala Glu Pro He Ser Ser Ser He Ser 580 585 590 aat atg gaa etc gaa tta aat ate cac aat tea aaa gca cct aaa aag 1943 Asn Glu Leu Glu Leu Asn He Met His Asn Ser Lys Ala Pro Lys Lys 595 600 605 aat agg ctg agg agg aag tct tct ace agg cat att cat gcg ctt gaa 1991

Asn Arg Leu Arg Arg Lys Ser Ser Thr Arg His He His Ala Leu Glu 610 615 620 eta gta gtc agt aga aat eta age cca cct aat tgt act gaa ttg caa 2039

Leu Val Val Ser Arg Asn Leu Ser Pro Pro Asn Cys Thr Glu Leu Gin 625 630 635 640 att gat agt tgt tct age agt gaa gag ata aag aaa aaa aag tac aac 2087 He Asp Ser Cys Ser Ser Ser Glu Glu He Lys Lys Lys Lys Tyr Asn 645 650 655 caa atg cca gtc agg cac age aga aac eta caa etc atg gaa ggt aaa 2135 Gin Met Pro Val Arg His Ser Arg Asn Leu Gin Leu Met Glu Gly Lys

660 665 670 gaa cct gca act gga gee aag aag agt aac aag cca aat gaa cag aca 2183 Glu Pro Ala Thr Gly Ala Lys Lys Ser Asn Lys Pro Asn Glu Gin Thr 675 680 685 agt aaa aga cat gac age gat act ttc cca gag ctg aag tta aca aat 2231

Ser Lys Arg His Asp Ser Asp Thr Phe Pro Glu Leu Lys Leu Thr Asn 690 695 700 gca cct ggt tct ttt act aag tgt tea aat ace agt gaa ctt aaa gaa 2279

Ala Pro Gly Ser Phe Thr Lys Cys Ser Asn Thr Ser Glu Leu Lys Glu 705 710 715 720 ttt gtc aat cct age ctt cca aga gaa gaa aaa gaa gag aaa eta gaa 2327 Phe Val Asn Pro Ser Leu Pro Arg Glu Glu Lys Glu Glu Lys Leu Glu 725 730 735 aca gtt aaa gtg tct aat aat get gaa gac ccc aaa gat etc atg tta 2375 Thr Val Lys Val Ser Asn Asn Ata Glu Asp Pro Lys Asp Leu Met Leu 740 745 750 agt gga gaa agg gtt ttg caa act gaa aga tct gta gag agt age agt 2423 Ser Gly Glu Arg Val Leu Gin Thr Glu Arg Ser Val Glu Ser Ser Ser 755 760 765 att tea ttg gta cct ggt act gat tat ggc act cag gaa agt ate teg 2471 He Ser Leu Val Pro Gly Thr Asp Tyr Gly Thr Gin Glu Ser He Ser 770 775 780 tta ctg gaa gtt age act eta ggg aag gca aaa aca gaa cca aat aaa 2519 Leu Leu Glu Val Ser Thr Leu Gly Lys Ala Lys Thr Glu Pro Asn Lys 785 790 795 800 tgt gtg agt cag tgt gca gca ttt gaa aac ccc aag gga eta att cat 2567

Cys Val Ser Gin Cys Ala Ala Phe Glu Asn Pro Lys Gly Leu He His 805 810 815 ggt tgt tec aaa gat aat aga aat gac aca gaa ggc ttt aag tat cca 2615

Gly Cys Ser Lys Asp Asn Arg Asn Asp Thr Glu Gly Phe Lys Tyr Pro 820 825 830 ttg gga cat gaa gtt aac cac agt egg gaa aca age ata gaa atg gaa 2663

Leu Gly His Glu Val Asn His Ser Arg Glu Thr Ser He Glu Met Glu 835 840 845 gaa agt gaa ctt gat get cag tat ttg cag aat aca ttc aag gtt tea 2711 Glu Ser Glu Leu Asp Ala Gin Tyr Leu Gin Asn Thr Phe Lys Vat Ser

850 855 860 aag cge cag tea ttt get eeg ttt tea aat cca gga aat gca gaa gag 2759 Lys Arg Gin Ser Phe Ala Pro Phe Ser Asn Pro Gly Asn Ata Glu Glu 865 870 875 880 gaa tgt gca aca ttc tct gec cac tct ggg tec tta aag aaa caa agt 2807

Glu Cys Ala Thr Phe Ser Ala His Ser Gly Ser Leu Lys Lys Gin Ser

885 890 895 cca aaa gtc act ttt gaa tgt gaa caa aag gaa gaa aat caa gga aag 2855

Pro Lys Val Thr Phe Glu Cys Glu Gin Lys Glu Glu Asn Gin Gly Lys 900 905 910 aat gag tct aat ate aag cct gta cag aca gtt aat ate act gca ggc 2903

Asn Glu Ser Asn He Lys Pro Val Gin Thr Val Asn He Thr Ala Gly 915 920 925 ttt cct gtg gtt ggt cag aaa gat aag cca gtt gat aat gec aaa tgt 2951 Phe Pro Val Val Gly Gin Lys Asp Lys Pro Val Asp Asn Ala Lys Cys 930 935 940 agt ate aaa gga ggc tct agg ttt tgt eta tea tct cag ttc aga ggc 2999 Ser He Lys Gly Gly Ser Arg Phe Cys Leu Ser Ser Gin Phe Arg Gly 945 950 955 960 aac gaa act gga etc att act cca aat aaa cat gga ctt tta caa aac 3047 Asn Glu Thr Gly Leu He Thr Pro Asn Lys His Gly Leu Leu Gin Asn

965 970 975 cca tat cgt ata cca cca ctt ttt ccc ate aag tea ttt gtt aaa act 3095 Pro Tyr Arg He Pro Pro Leu Phe Pro He Lys Ser Phe Val Lys Thr 980 985 990 aaa tgt aag aaa aat ctg eta gag gaa aac ttt gag gaa cat tea atg 3143

Lys Cys Lys Lys Asn Leu Leu Glu Glu Asn Phe Glu Glu His Ser Met 995 1000 1005 tea cct gaa aga gaa atg gga aat gag aac att cca agt aca gtg age 3191

Ser Pro Glu Arg Glu Met Gly Asn Glu Asn He Pro Ser Thr Val Ser 1010 1015 1020 aca att age cgt aat aac att aga gaa aat gtt ttt aaa gaa gee age 3239 Thr He Ser Arg Asn Asn He Arg Glu Asn Val Phe Lys Glu Ala Ser 1025 1030 1035 1040 tea age aat att aat gaa gta ggt tec agt act aat gaa gtg gge tec 3287 Ser Ser Asn He Asn Glu Val Gly Ser Ser Thr Asn Glu Val Gly Ser

1045 1050 1055 agt att aat gaa ata ggt tec agt gat gaa aac att caa gca gaa eta 3335 Ser He Asn Glu He Gly Ser Ser Asp Glu Asn He Gin Ala Glu Leu 1060 1065 1070 ggt aga aac aga ggg cca aaa ttg aat get atg ctt aga tta ggg gtt 3383

Gly Arg Asn Arg Gly Pro Lys Leu Asn Ala Met Leu Arg Leu Gly Val 1075 1080 1085 ttg caa cct gag gtc tat aaa caa agt ctt cct gga agt aat tgt aag 3431

Leu Gin Pro Glu Val Tyr Lys Gin Ser Leu Pro Gly Ser Asn Cys Lys 1090 1095 1100 cat cct gaa ata aaa aag caa gaa tat gaa gaa gta gtt cag act gtt 3479 His Pro Glu He Lys Lys Gin Glu Tyr Glu Glu Val Vat Gin Thr Val 1105 1110 1115 1120 aat aca gat ttc tct cca tat ctg att tea gat aac tta gaa cag cct 3527 Asn Thr Asp Phe Ser Pro Tyr Leu He Ser Asp Asn Leu Glu Gin Pro

1125 1130 1135 atg gga agt agt cat gca tct cag gtt tgt tct gag aca cct gat gac 3575 Met Gly Ser Ser His Ala Ser Gin Val Cys Ser Glu Thr Pro Asp Asp 1140 1145 1150 ctg tta gat gat ggt gaa ata aag gaa gat act agt ttt get gaa aat 3623 Leu Leu Asp Asp Gly Glu He Lys Glu Asp Thr Ser Phe Ala Glu Asn 1155 1160 1165 gac att aag gaa agt tct get gtt ttt age aaa age gtc cag aaa gga 3671 Asp He Lys Glu Ser Ser Ala Val Phe Ser Lys Ser Val Gtn Lys Gly 1170 1175 1180 gag ctt age agg agt cct age cct ttc ace cat aca cat ttg get cag 3719 Glu Leu Ser Arg Ser Pro Ser Pro Phe Thr His Thr His Leu Ala Gin 1185 1190 1195 1200 ggt tac cga aga ggg gee aag aaa tta gag tec tea gaa gag aac tta 3767 Gly Tyr Arg Arg Gly Ala Lys Lys Leu Gtu Ser Ser Glu Glu Asn Leu 1205 1210 1215 tct agt gag gat gaa gag ctt ccc tgc ttc caa cac ttg tta ttt ggt 3815 Ser Ser Glu Asp Glu Glu Leu Pro Cys Phe Gin His Leu Leu Phe Gly 1220 1225 1230 aaa gta aac aat ata cct tct cag tct act agg cat age ace gtt get 3863 Lys Vat Asn Asn He Pro Ser Gin Ser Thr Arg His Ser Thr Val Ala

1235 1240 1245 ace gag tgt ctg tct aag aac aca gag gag aat tta tta tea ttg aag 3911 Thr Glu Cys Leu Ser Lys Asn Thr Glu Glu Asn Leu Leu Ser Leu Lys 1250 1255 1260 aat age tta aat gac tgc agt aac cag gta ata ttg gca aag gca tct 3959

Asn Ser Leu Asn Asp Cys Ser Asn Gin Val lie Leu Ala Lys Ala Ser

1265 1270 1275 1280 cag gaa cat cac ctt agt gag gaa aca aaa tgt tct get age ttg ttt 4007

Gin Gtu His His Leu Ser Glu Glu Thr Lys Cys Ser Ata Ser Leu Phe 1285 1290 1295 tct tea cag tgc agt gaa ttg gaa gac ttg act gca aat aca aac ace 4055

Ser Ser Gin Cys Ser Glu Leu Glu Asp Leu Thr Ala Asn Thr Asn Thr 1300 1305 1310 cag gat cct ttc ttg att ggt tct tec aaa caa atg agg cat cag tct 4103 Gtn Asp Pro Phe Leu He Gly Ser Ser Lys Gin Met Arg His Gin Ser

1315 1320 1325 gaa age cag gga gtt ggt ctg agt gac aag gaa ttg gtt tea gat gat 4151 Glu Ser Gin Gly Val Gly Leu Ser Asp Lys Glu Leu Val Ser Asp Asp 1330 1335 1340 gaa gaa aga gga acg ggc ttg gaa gaa aat aat caa gaa gag caa age 4199 Gtu Glu Arg Gly Thr Gly Leu Glu Glu Asn Asn Gin Glu Glu Gin Ser 1345 1350 1355 1360 atg gat tea aac tta ggt gaa gca gca tct ggg tgt gag agt gaa aca 4247 Met Asp Ser Asn Leu Gly Glu Ala Ala Ser Gly Cys Glu Ser Glu Thr 1365 1370 1375 age gtc tct gaa gac tgc tea ggg eta tec tct cag agt gac att tta 4295

Ser Val Ser Glu Asp Cys Ser Gly Leu Ser Ser Gin Ser Asp He Leu 1380 1385 1390 ace act cag cag agg gat ace atg caa cat aac ctg ata aag etc cag 4343

Thr Thr Gin Gin Arg Asp Thr Met Gin His Asn Leu He Lys Leu Gtn 1395 1400 1405 cag gaa atg get gaa eta gaa get gtg tta gaa cag cat ggg age cag 4391 Gin Glu Met Ala Glu Leu Glu Ala Val Leu Glu Gtn His Gly Ser Gin 1410 1415 1420 cct tct aac age tac cct tec ate ata agt gac tct tct gec ctt gag 4439 Pro Ser Asn Ser Tyr Pro Ser He He Ser Asp Ser Ser Ala Leu Glu 1425 1430 1435 1440 gac ctg cga aat cca gaa caa age aca tea gaa aaa gca gta tta act 4487 Asp Leu Arg Asn Pro Gtu Gtn Ser Thr Ser Glu Lys Val Leu Gin Thr 1445 1450 1455 tea cag aaa agt agt gaa tac cct ata age cag aat cca gaa ggc ctt 4535 Ser Gin Lys Ser Ser Glu Tyr Pro He Ser Gin Asn Pro Gtu Gly Xaa 1460 1465 1470 tct get gac aag ttt gag gtg tct gca gat agt tct ace agt aaa aat 4583 Ser Ala Asp Lys Phe Glu Val Ser Ata Asp Ser Ser Thr Ser Lys Asn 1475 1480 1485 aaa gaa cca gga gtg gaa agg tea tec cct tct aaa tgc cca tea tta 4631

Lys Glu Pro Gly Val Gtu Arg Ser Ser Pro Ser Lys Cys Pro Ser Leu 1490 1495 1500 gat gat agg tgg tac atg cac agt tgc tct ggg agt ctt cag aat aga 4679 Asp Asp Arg Trp Tyr Met His Ser Cys Ser Gly Ser Leu Gtn Asn Arg

1505 1510 1515 1520 aac tac cca tct caa gag gag etc att aag gtt gtt gat gtg gag gag 4727 Asn Tyr Pro Pro Gin Glu Glu Leu He Lys Vat Val Asp Vat Glu Glu 1525 1530 1535 caa cag ctg gaa gag tct ggg cca cac gat ttg acg gaa aca tct tac 4775

Gin Gin Leu Glu Glu Ser Gty Pro His Asp Leu Thr Glu Thr Ser Tyr 1540 1545 1550 ttg cca agg caa gat eta gag gga ace cct tac ctg gaa tct gga ate 4823

Leu Pro Arg Gtn Asp Leu Glu Gly Thr Pro Tyr Leu Glu Ser Gly He

1555 1560 1565 age etc ttc tct gat gac cct gaa tct gat cct tct gaa gac aga gec 4871 Ser Leu Phe Ser Asp Asp Pro Glu Ser Asp Pro Ser Glu Asp Arg Ala 1570 1575 1580 cca gag tea get cgt gtt ggc aac ata cca tct tea ace tct gca ttg 4919 Pro Glu Ser Ala Arg Vat Gly Asn lie Pro Ser Ser Thr Ser Ata Leu 1585 1590 1595 1600

5 aaa gtt ccc caa ttg aaa gtt gca gaa tct gee cag agt cca get get 4967 Lys Val Pro Gin Leu Lys Val Ala Glu Ser Ata Gin Ser Pro Ala Ata 1605 1610 1615 get cat act act gat act get ggg tat aat gca atg gaa gaa agt gtg 5015 10 Ala His Thr Thr Asp Thr Ala Gly Tyr Asn Ala Met Gtu Glu Ser Val

1620 1625 1630 age agg gag aag cca gaa ttg aca get tea aca gaa agg gtc aac aaa 5063 Ser Arg Glu Lys Pro Glu Leu Thr Ala Ser Thr Glu Arg Val Asn Lys 15 1635 1640 1645 aga atg tec atg gtg gtg tct ggc ctg ace cca gaa gaa ttt atg etc 51 1

Arg Met Ser Met Vat Vat Ser Gly Leu Thr Pro Glu Glu Phe Met Leu 1650 1655 1660

20 gtg tac aag ttt gec aga aaa cac cac ate act tta act aat eta att 5159

Val Tyr Lys Phe Ala Arg Lys His His He Thr Leu Thr Asn Leu He

1665 1670 1675 1680

25 act gaa gag act act cat gtt gtt atg aaa aca gat get gag ttt gtg 5207 Thr Gtu Glu Thr Thr His Val Val Met Lys Thr Asp Ala Glu Phe Vat 1685 1690 1695 tgt gaa egg aca ctg aaa tat ttt eta gga att gcg gga gga aaa tgg 5255 30 Cys Glu Arg Thr Leu Lys Tyr Phe Leu Gly He Ata Gly Gly Lys Trp

1700 1705 1710 gta gtt age tat ttc tgg gtg ace cag tct att aaa gaa aga aaa atg 5303 Val Val Ser Tyr Phe Trp Val Thr Gtn Ser He Lys Glu Arg Lys Met 35 1715 1720 1725 ctg aat gag cat gat ttt gaa gtc aga gga gat gtg gtc aat gga aga 5351

Leu Asn Glu His Asp Phe Glu Val Arg Gly Asp Val Val Asn Gly Arg 1730 1735 1740

40 aac cac caa ggt cca aag cga gca aga gaa tec cag gac aga aag ate 5399

Asn His Gin Gly Pro Lys Arg Ala Arg Glu Ser Gin Asp Arg Lys He 1745 1750 1755 1760

4.^■> ttc agg ggg eta gaa ate tgt tgc tat ggg ccc ttc ace aac atg ccc 5447 Phe Arg Gly Leu Glu He Cys Cys Tyr Gty Pro Phe Thr Asn Met Pro 1765 1770 1775 aca gat caa ctg gaa tgg atg gta cag ctg tgt ggt get tct gtg gtg 5495 50 Thr Asp Gin Leu Glu Trp Met Val Gin Leu Cys Gly Ala Ser Val Vat

1780 1785 1790 aag gag ctt tea tea ttc ace ctt ggc aca ggt gtc cac cca att gtg 5543 Lys Gtu Leu Ser Ser Phe Thr Leu Gty Thr Gty Vat His Pro He Val 1795 1800 1805 gtt gtg cag cca gat gec tgg aca gag gac aat ggc ttc cat gca att 5591 Val Val Gin Pro Asp Ata Trp Thr Glu Asp Asn Gly Phe His Ala He 1810 1815 1820 ggg cag atg tgt gag gca cct gtg gtg ace cga gag tgg gtg ttg gac 5639 Gly Gin Met Cys Glu Ala Pro Val Vat Thr Arg Glu Trp Val Leu Asp 1825 1830 1835 1840 agt gta gca etc tac cag tgc cag gag ctg gac ace tac ctg ata ccc 5687 Ser Vat Ata Leu Tyr Gin Cys Gin Gtu Leu Asp Thr Tyr Leu He Pro 1845 1850 1855 cag ate ccc cac age cac tac tgat 5712

Gin He Pro His Ser His Tyr 1860

(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1863

(B) TYPE: amino acid (C) STRANDEDNESS: single

(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein

(iii) HYPOTHETICAL: no

(iv) ANTI-SENSE: no (v) ORIGINAL SOURCE

(A) ORGANISM: Homo sapiens sapiens

(C) INDIVIDUAL/ISOLATE:

(D) DEVELOPMENTAL STAGE: adult (F) TISSUE TYPE: female breast (G) CELL TYPE: normal breast tissue

(H) CELL LINE: not derived from a cell line (I) ORGANELLE: no (ix) FEATURE:

(A) NAME/KEY: BRCAl protein (B) LOCATION: 1 to 1863

(C) IDENTIFICATION METHOD: observation of mRNA and antisense inhibition of BRCAl gene (D) OTHER INFORMATION: BRCAl protein has a negative regulatory effect on growth of human mammary cells, (x) PUBLICATION INFORMATION:

(A) AUTHORS: Miki, Y., et. al. (B) TITLE: A strong candidate gene for the breast and ovarian cancer susceptibility gene BRCAl.

(C) JOURNAL: Science

(D) VOLUME: 266 (E) PAGES: 66-71

(F) DATE: 1994

(K) RELEVANT RESIDUES IN SEQ ID NO:2: granin box domain at amino acids 1214-1223

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Asp Leu Ser Ala Leu Arg Val Gtu Gtu Val Gtn Asn Val He Asn 1 5 10 15 Ala Met Gin Lys He Leu Gtu Cys Pro He Cys Leu Glu Leu He Lys

20 25 30

Glu Pro Val Ser Thr Lys Cys Asp His He Phe Cys Lys Phe Cys Met 35 40 45

Leu Lys Leu Leu Asn Gin Lys Lys Gly Pro Ser Gin Cys Pro Leu Cys 50 55 60

Lys Asn Asp He Thr Lys Arg Ser Leu Gin Gtu Ser Thr Arg Phe Ser 65 70 75 80

Gin Leu Val Glu Gtu Leu Leu Lys He He Cys Ata Phe Gin Leu Asp 85 90 95

Thr Gly Leu Glu Tyr Ala Asn Ser Tyr Asn Phe Ala Lys Lys Glu Asn 100 105 110

Asn Ser Pro Glu His Leu Lys Asp Glu Val Ser He He Gtn Ser Met 115 120 125

Gly Tyr Arg Asn Arg Ala Lys Arg Leu Leu Gtn Ser Gtu Pro Glu Asn 130 135 140

Pro Ser Leu Gin Glu Thr Ser Leu Ser Val Gtn Leu Ser Asn Leu Gly 145 150 155 160 Thr Val Arg Thr Leu Arg Thr Lys Gtn Arg He Gin Pro Gin Lys Thr 165 170 175

Ser Val Tyr He Glu Leu Gty Ser Asp Ser Ser Glu Asp Thr Val Asn 180 185 190

Lys Ata Thr Tyr Cys Ser Val Gly Asp Gin Glu Leu Leu Gtn He Thr 195 200 205

Pro Gin Gly Thr Arg Asp Glu He Ser Leu Asp Ser Ala Lys Lys Ala 210 215 220

Ala Cys Glu Phe Ser Glu Thr Asp Val Thr Asn Thr Gtu His His Gtn 225 230 235 240

Pro Ser Asn Asn Asp Leu Asn Thr Thr Glu Lys Arg Ala Ata Glu Arg 245 250 255

His Pro Glu Lys Tyr Gin Gly Ser Ser Val Ser Asn Leu His Val Glu 260 265 270

Pro Cys Gly Thr Asn Thr His Ata Ser Ser Leu Gin His Glu Asn Ser 275 280 285

Ser Leu Leu Leu Thr Lys Asp Arg Met Asn Val Glu Lys Ata Gtu Phe 290 295 300

Cys Asn Lys Ser Lys Gin Pro Gty Leu Ala Arg Ser Gin His Asn Arg 305 310 315 320

Trp Ala Gly Ser Lys Glu Thr Cys Asn Asp Arg Arg Thr Pro Ser Thr 325 330 335

Glu Lys Lys Val Asp Leu Asn Ala Asp Pro Leu Cys Glu Arg Lys Gtu 340 345 350

Trp Asn Lys Gin Lys Leu Pro Cys Ser Gtu Asn Pro Arg Asp Thr Glu 355 360 365 Asp Vat Pro Trp He Thr Leu Asn Ser Ser He Gin Lys Val Asn Glu

370 375 380

Trp Phe Ser Arg Ser Asp Glu Leu Leu Gly Ser Asp Asp Ser His Asp 385 390 395 400

Gly Glu Ser Gtu Ser Asn Ala Lys Vat Ala Asp Val Leu Asp Val Leu 405 410 415

Asn Glu Val Asp Glu Tyr Ser Gly Ser Ser Glu Lys He Asp Leu Leu 420 425 430

Ala Ser Asp Pro His Glu Ala Leu He Cys Lys Ser Asp Arg Val His 435 440 445 Ser Lys Ser Vat Glu Ser Asp He Glu Asp Lys He Phe Gly Lys Thr 450 455 460

Tyr Arg Lys Lys Ata Ser Leu Pro Asn Leu Ser His Vat Thr Glu Asn

465 470 475 480

Leu He He Gly Ala Phe Val Ser Glu Pro Gin He He Gin Gtu Arg

485 490 495

Pro Leu Thr Asn Lys Leu Lys Arg Lys Arg Arg Pro Thr Ser Gly Leu 500 505 510

His Pro Glu Asp Phe He Lys Lys Ala Asp Leu Ata Val Gtn Lys Thr 515 520 525

Pro Glu Met He Asn Gin Gly Thr Asn Gin Thr Glu Gin Asn Gly Gtn 530 535 540

Val Met Asn He Thr Asn Ser Gly His Glu Asn Lys Thr Lys Gly Asp 545 550 555 560

Ser He Gin Asn Gtu Lys Asn Pro Asn Pro He Glu Ser Leu Glu Lys 565 570 575

Glu Ser Ala Phe Lys Thr Lys Ala Glu Pro He Ser Ser Ser He Ser 580 585 590

Asn Glu Leu Glu Leu Asn He Met His Asn Ser Lys Ata Pro Lys Lys 595 600 605

Asn Arg Leu Arg Arg Lys Ser Ser Thr Arg His He His Ala Leu Glu 610 615 620 Leu Val Val Ser Arg Asn Leu Ser Pro Pro Asn Cys Thr Glu Leu Gin 625 630 635 640

He Asp Ser Cys Ser Ser Ser Glu Glu He Lys Lys Lys Lys Tyr Asn 645 650 655

Gin Met Pro Val Arg His Ser Arg Asn Leu Gtn Leu Met Glu Gty Lys 660 665 670

Glu Pro Ata Thr Gly Ala Lys Lys Ser Asn Lys Pro Asn Glu Gin Thr 675 680 685

Ser Lys Arg His Asp Ser Asp Thr Phe Pro Glu Leu Lys Leu Thr Asn

690 695 700 Ala Pro Gly Ser Phe Thr Lys Cys Ser Asn Thr Ser Glu Leu Lys Gtu

705 710 715 720

Phe Vat Asn Pro Ser Leu Pro Arg Glu Glu Lys Glu Glu Lys Leu Glu 725 730 735

Thr Val Lys Val Ser Asn Asn Ala Glu Asp Pro Lys Asp Leu Met Leu 740 745 750

Ser Gly Glu Arg Val Leu Gin Thr Glu Arg Ser Val Glu Ser Ser Ser 755 760 765

He Ser Leu Val Pro Gty Thr Asp Tyr Gly Thr Gin Gtu Ser He Ser 770 775 780

Leu Leu Glu Val Ser Thr Leu Gly Lys Ala Lys Thr Glu Pro Asn Lys 785 790 795 800 Cys Val Ser Gtn Cys Ala Ala Phe Glu Asn Pro Lys Gty Leu He His

805 810 815

Gly Cys Ser Lys Asp Asn Arg Asn Asp Thr Glu Gly Phe Lys Tyr Pro 820 825 830

Leu Gly His Glu Val Asn His Ser Arg Gtu Thr Ser He Glu Met Glu 835 840 845

Glu Ser Glu Leu Asp Ala Gin Tyr Leu Gin Asn Thr Phe Lys Val Ser 850 855 860

Lys Arg Gin Ser Phe Ala Pro Phe Ser Asn Pro Gly Asn Ala Glu Glu 865 870 875 880

Glu Cys Ata Thr Phe Ser Ala His Ser Gly Ser Leu Lys Lys Gtn Ser 885 890 895

Pro Lys Val Thr Phe Glu Cys Gtu Gin Lys Glu Glu Asn Gtn Gty Lys 900 905 910

Asn Glu Ser Asn He Lys Pro Val Gin Thr Val Asn He Thr Ala Gly 915 920 925

Phe Pro Val Val Gly Gin Lys Asp Lys Pro Val Asp Asn Ala Lys Cys 930 935 940

Ser He Lys Gty Gly Ser Arg Phe Cys Leu Ser Ser Gin Phe Arg Gly 945 950 955 960 Asn Glu Thr Gty Leu He Thr Pro Asn Lys His Gty Leu Leu Gin Asn

965 970 975

Pro Tyr Arg He Pro Pro Leu Phe Pro He Lys Ser Phe Val Lys Thr 980 985 990

Lys Cys Lys Lys Asn Leu Leu Gtu Glu Asn Phe Gtu Gtu His Ser Met 995 1000 1005 Ser Pro Glu Arg Gtu Met Gty Asn Glu Asn He Pro Ser Thr Val Ser 1010 1015 1020

Thr He Ser Arg Asn Asn He Arg Glu Asn Val Phe Lys Glu Ata Ser 1025 1030 1035 1040

Ser Ser Asn He Asn Gtu Vat Gly Ser Ser Thr Asn Glu Val Gly Ser 1045 1050 1055

Ser He Asn Glu He Gly Ser Ser Asp Gtu Asn He Gin Ala Glu Leu 1060 1065 1070

Gly Arg Asn Arg Gty Pro Lys Leu Asn Ala Met Leu Arg Leu Gly Val 1075 1080 1085

Leu Gin Pro Glu Val Tyr Lys Gin Ser Leu Pro Gly Ser Asn Cys Lys 1090 1095 1100

His Pro Glu He Lys Lys Gtn Glu Tyr Gtu Glu Val Vat Gin Thr Val 1105 1110 1115 1120

Asn Thr Asp Phe Ser Pro Tyr Leu He Ser Asp Asn Leu Gtu Gin Pro 1125 1130 1135

Met Gty Ser Ser His Ala Ser Gin Val Cys Ser Glu Thr Pro Asp Asp 1140 1145 1150

Leu Leu Asp Asp Gly Glu He Lys Glu Asp Thr Ser Phe Ala Glu Asn 1155 1160 1165

Asp He Lys Glu Ser Ser Ala Val Phe Ser Lys Ser Vat Gtn Lys Gty 1170 1175 1180

Glu Leu Ser Arg Ser Pro Ser Pro Phe Thr His Thr His Leu Ala Gin 1185 1190 1195 1200

Gly Tyr Arg Arg Gly Ala Lys Lys Leu Gtu Ser Ser Glu Glu Asn Leu 1205 1210 1215 Ser Ser Glu Asp Glu Glu Leu Pro Cys Phe Gin His Leu Leu Phe Gly

1220 1225 1230

Lys Val Asn Asn He Pro Ser Gin Ser Thr Arg His Ser Thr Val Ala 1235 1240 1245

Thr Glu Cys Leu Ser Lys Asn Thr Glu Glu Asn Leu Leu Ser Leu Lys 1250 1255 1260

Asn Ser Leu Asn Asp Cys Ser Asn Gin Val He Leu Ala Lys Ala Ser 1265 1270 1275 1280

Gin Glu His His Leu Ser Glu Gtu Thr Lys Cys Ser Ala Ser Leu Phe 1285 1290 1295 Ser Ser Gtn Cys Ser Glu Leu Glu Asp Leu Thr Ala Asn Thr Asn Thr 1300 1305 1310

Gin Asp Pro Phe Leu He Gly Ser Ser Lys Gin Met Arg His Gin Ser 1315 1320 1325

Gtu Ser Gin Gly Val Gly Leu Ser Asp Lys Glu Leu Val Ser Asp Asp 1330 1335 1340

Glu Gtu Arg Gly Thr Gly Leu Glu Glu Asn Asn Gin Glu Glu Gin Ser 1345 1350 1355 1360

Met Asp Ser Asn Leu Gly Glu Ala Ata Ser Gly Cys Glu Ser Glu Thr 1365 1370 1375

Ser Val Ser Glu Asp Cys Ser Gly Leu Ser Ser Gin Ser Asp He Leu 1380 1385 1390

Thr Thr Gtn Gin Arg Asp Thr Met Gin His Asn Leu He Lys Leu Gtn 1395 1400 1405

Gin Gtu Met Ala Glu Leu Glu Ala Val Leu Gtu Gin His Gly Ser Gin 1410 1415 1420

Pro Ser Asn Ser Tyr Pro Ser He He Ser Asp Ser Ser Ala Leu Glu 1425 1430 1435 1440

Asp Leu Arg Asn Pro Glu Gin Ser Thr Ser Glu Lys Val Leu Gin Thr 1445 1450 1455

Ser Gin Lys Ser Ser Glu Tyr Pro He Ser Gin Asn Pro Glu Gly Xaa 1460 1465 1470 Ser Ala Asp Lys Phe Glu Val Ser Ala Asp Ser Ser Thr Ser Lys Asn 1475 1480 1485

Lys Glu Pro Gly Val Glu Arg Ser Ser Pro Ser Lys Cys Pro Ser Leu 1490 1495 1500

Asp Asp Arg Trp Tyr Met His Ser Cys Ser Gly Ser Leu Gtn Asn Arg 1505 1510 1515 1520

Asn Tyr Pro Pro Gin Glu Glu Leu He Lys Val Vat Asp Val Glu Glu 1525 1530 1535

Gin Gin Leu Glu Glu Ser Gly Pro His Asp Leu Thr Gtu Thr Ser Tyr 1540 1545 1550 Leu Pro Arg Gin Asp Leu Glu Gly Thr Pro Tyr Leu Glu Ser Gly He

1555 1560 1565

Ser Leu Phe Ser Asp Asp Pro Glu Ser Asp Pro Ser Glu Asp Arg Ala 1570 1575 1580

Pro Gtu Ser Ala Arg Vat Gly Asn He Pro Ser Ser Thr Ser Ala Leu 1585 1590 1595 1600

Lys Val Pro Gtn Leu Lys Vat Ala Glu Ser Ala Gin Ser Pro Ala Ala 1605 1610 1615

Ala His Thr Thr Asp Thr Ala Gly Tyr Asn Ala Met Glu Gtu Ser Val 1620 1625 1630

Ser Arg Glu Lys Pro Glu Leu Thr Ala Ser Thr Glu Arg Val Asn Lys 1635 1640 1645 Arg Met Ser Met Vat Val Ser Gly Leu Thr Pro Glu Glu Phe Met Leu 1650 1655 1660

Val Tyr Lys Phe Ala Arg Lys His His He Thr Leu Thr Asn Leu He 1665 1670 1675 1680

Thr Glu Glu Thr Thr His Val Val Met Lys Thr Asp Ala Gtu Phe Val 1685 1690 1695

Cys Glu Arg Thr Leu Lys Tyr Phe Leu Gly He Ala Gly Gly Lys Trp 1700 1705 1710

Val Vat Ser Tyr Phe Trp Vat Thr Gin Ser He Lys Gtu Arg Lys Met 1715 1720 1725

Leu Asn Gtu His Asp Phe Glu Val Arg Gly Asp Val Val Asn Gly Arg 1730 1735 1740

Asn His Gin Gty Pro Lys Arg Ala Arg Glu Ser Gin Asp Arg Lys He 1745 1750 1755 1760

Phe Arg Gly Leu Glu He Cys Cys Tyr Gly Pro Phe Thr Asn Met Pro 1765 1770 1775

Thr Asp Gin Leu Glu Trp Met Val Gin Leu Cys Gly Ala Ser Vat Val 1780 1785 1790

Lys Glu Leu Ser Ser Phe Thr Leu Gty Thr Gty Val His Pro He Val 1795 1800 1805 Val Val Gin Pro Asp Ata Trp Thr Glu Asp Asn Gly Phe His Ala He 1810 1815 1820

Gly Gin Met Cys Glu Ala Pro Val Val Thr Arg Glu Trp Val Leu Asp 1825 1830 1835 1840

Ser Val Ata Leu Tyr Gin Cys Gin Glu Leu Asp Thr Tyr Leu He Pro 1845 1850 1855 Gin He Pro His Ser His Tyr 1860

(2) INFORMATION FOR SEQ ID NO : 3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11283

(B) TYPE: nucleic acid

(C) STRANDEDNESS: double (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: no

(iv) ANTI-SENSE: no

(v) ORIGINAL SOURCE (A) ORGANISM: Homo sapiens sapiens

(C) INDIVIDUAL/ISOLATE:

(D) DEVELOPMENTAL STAGE: adult

(F) TISSUE TYPE: female breast

(G) CELL TYPE: normal and cancerous breast cells (H) CELL LINE: MCF-7

(I) ORGANELLE: no (vii) IMMEDIATE SOURCE:

(A) LIBRARY: cDNA library derived from human

(B) CLONE: obtained using published sequence

(viii) POSITION IN GENOME:

(A) CHROMOSOME/SEGMENT: unknown

(B) MAP POSITION: unknown

(C) UNITS: unknown (ix) FEATURE:

(A) NAME/KEY: BRCA2

(B) LOCATION:

(C) IDENTIFICATION METHOD:

(D) OTHER INFORMATION: gene encoding BRCA2 protein

(x) PUBLICATION INFORMATION:

(A) AUTHORS: Wooster, R. et al. (B) TITLE: Identification of the breast cancer susceptability gene BRCA2

(C) JOURNAL: Nature

(D) VOLUME: 379

(E) PAGES: 789-792

(F) DATE: 1995

(K) RELEVANT RESIDUES IN SEQ ID NO: 3

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

ggeggagceg etgtggcact getgegcete tgctgcgcet egggtgtett ttgcggeggt 60 gggtcgecgc egggagaage gtgaggggac agatttgtga eeggcgeggt ttttgteage 120 ttactccggc caaaaaagaa ctgeacctet ggageggaet tatttaecaa gcattggagg 180 aatategtag gtaaaa 196 atg cct att gga tec aaa gag agg cca aca ttt ttt gaa att ttt aag 244 Met Pro He Gly Ser Lys Glu Arg Pro Thr Phe Phe Glu He Phe Lys

1 5 10 15 aca cge tgc aac aaa gca gat tta gga cca ata agt ctt aat tgg ttt 292

Thr Arg Cys Asn Lys Ala Asp Leu Gty Pro He Ser Leu Asn Trp Phe 20 25 30 gaa gaa ctt tct tea gaa get cca ccc tat aat tct gaa cct gca gaa 340

Gtu Glu Leu Ser Ser Glu Ata Pro Pro Tyr Asn Ser Glu Pro Ala Gtu 35 40 45 gaa tct gaa cat aaa aac aac aat tac gaa cca aac eta ttt aaa act 388

Gtu Ser Glu His Lys Asn Asn Asn Tyr Glu Pro Asn Leu Phe Lys Thr 50 55 60 cca caa agg aaa cca tct tat aat cag ctg get tea act cca ata ata 436

Pro Gin Arg Lys Pro Ser Tyr Asn Gin Leu Ala Ser Thr Pro He He 65 70 75 80 ttc aaa gag caa ggg ctg act ctg ccg ctg tac caa tct cct gta aaa 484 Phe Lys Glu Gin Gty Leu Thr Leu Pro Leu Tyr Gin Ser Pro Val Lys

85 90 95

gaa tta gat aaa ttc aaa tta gac tta gga agg aat gtt ccc aat agt 532 Glu Leu Asp Lys Phe Lys Leu Asp Leu Gly Arg Asn Val Pro Asn Ser 100 105 110

aga cat aaa agt ctt cge aca gtg aaa act aaa atg gat caa gca gat 580 Arg His Lys Ser Leu Arg Thr Val Lys Tyr Lys Met Asp Gtn Ala Asp 115 120 125 gat gtt tec tgt cca ctt eta aat tct tgt ctt agt gaa agt cct gtt 628 Asp Val Ser Cys Pro Leu Leu Asn Ser Cys Leu Ser Glu Ser Pro Val 130 135 140 gtt eta caa tgt aca cat gta aca cca caa aga gat aag tea gtg gta 676

Vat Leu Gin Cys Thr His Vat Thr Pro Gin Arg Asp Lys Ser Val Val 145 150 155 160 tgt ggg agt ttg ttt cat aca cca aag ttt gtg aag ggt cgt cag aca 724

Cys Gly Ser Leu Phe His Thr Pro Lys Phe Vat Lys Gly Arg Gin Thr 165 170 175 cca aaa cat att tct gaa agt eta gga get gag gtg gat cct gat atg 772

Pro Lys His He Ser Gtu Ser Leu Gly Ala Glu Val Asp Pro Asp Met 180 185 190 tct tgg tea agt tct tta get aca cca ccc ace ctt agt tct act gtg 820

Ser Trp Ser Ser Ser Leu Ala Thr Pro Pro Thr Leu Ser Ser Thr Val 195 200 205 etc ata gtc aga aat gaa gaa gca tct gaa act gta ttt cct cat gat 868 Leu He Val Arg Asn Glu Glu Ala Ser Glu Thr Val Phe Pro His Asp 210 215 220 act act get aat gtg aaa age tat ttt tec aat cat gat gaa agt ctg 916

Thr Thr Ala Asn Vat Lys Ser Tyr Phe Ser Asn His Asp Glu Ser Leu 225 230 235 240 aag aaa aat gat aga ttt ate get tct gtg aca gac agt gaa aac aca 964

Lys Lys Asn Asp Arg Phe He Ata Ser Val Thr Asp Ser Gtu Asn Thr 245 250 255 aat caa aga gaa get gca agt cat gga ttt gga aaa aca tea ggg aat 1012

Asn Gin Arg Glu Ala Ala Ser His Gly Phe Gly Lys Thr Ser Gly Asn 260 265 270 tea ttt aaa gta aat age tgc aaa gac cac att gga aag tea atg cca 1060

Ser Phe Lys Val Asn Ser Cys Lys Asp His He Gty Lys Ser Met Pro 275 280 285 aat gtc eta gaa gat gaa gta tat gaa aca gtt gta gat ace tct gaa 1108 Asn Val Leu Glu Asp Glu Val Tyr Glu Thr Val Val Asp Thr Ser Glu 290 295 300 gaa gat agt ttt tea tta tgt ttt tct aaa tgt aga aca aaa aat eta 1156

Glu Asp Ser Phe Ser Leu Cys Phe Ser Lys Cys Arg Thr Lys Asn Leu 305 310 315 320 caa aaa gta aga act age aag act agg aaa aaa att ttc cat gaa gca 1204

Gin Lys Val Arg Thr Ser Lys Thr Arg Lys Lys He Phe His Gtu Ala 325 330 335 aac get gat gaa tgt gaa aaa tct aaa aac caa gtg aaa gaa aaa tac 1252

Asn Ala Asp Glu Cys Glu Lys Ser Lys Asn Gin Val Lys Glu Lys Tyr 340 345 350 tea ttt gta tct gaa gtg gaa cca aat gat act gat cca tta gat tea 1300 Ser Phe Val Ser Glu Val Glu Pro Asn Asp Thr Asp Pro Leu Asp Ser 355 360 365 aat gta gca cat cag aag ccc ttt gag agt gga agt gac aaa ate tec 1348

Asn Val Ala His Gin Lys Pro Phe Glu Ser Gly Ser Asp Lys He Ser 370 375 380 aag gaa gtt gta ccg tct ttg gec tgt gaa tgg tct caa eta ace ctt 1396

Lys Glu Val Val Pro Ser Leu Ala Cys Glu Trp Ser Gin Leu Thr Leu 385 390 395 400 tea ggt eta aat gga gec cag atg gag aaa ata ccc eta ttg cat att 1444

Ser Gly Leu Asn Gly Ala Gin Met Glu Lys He Pro Leu Leu His He 405 410 415 tct tea tgt gac caa aat att tea gaa aaa gac eta tta gac aca gag 1492

Ser Ser Cys Asp Gin Asn He Ser Gtu Lys Asp Leu Leu Asp Thr Glu 420 425 430 aac aaa aga aag aaa gat ttt ctt act tea gag aat tct ttg cca cgt 1540 Asn Lys Arg Lys Lys Asp Phe Leu Thr Ser Glu Asn Ser Leu Pro Arg

435 440 445 att tct age eta cca aaa tea gag aag cca tta aat gag gaa aca gtg 1588 lie Ser Ser Leu Pro Lys Ser Glu Lys Pro Leu Asn Glu Glu Thr Val 450 455 460 gta aat aag aga gat gaa gag cag cat ctt gaa tct cat aca gac tgc 1636

Val Asn Lys Arg Asp Glu Gtu Gin His Leu Gtu Ser His Thr Asp Cys 465 470 475 480 att ctt gca gta aag cag gca ata tct gga act tct cca gtg get tct 1684

He Leu Ala Val Lys Gin Ala He Ser Gty Thr Ser Pro Val Ala Ser 485 490 495 tea ttt cag ggt ate aaa aag tct ata ttc aga ata aga gaa tea cct 1732

Ser Phe Gin Gly He Lys Lys Ser He Phe Arg He Arg Glu Ser Pro 500 505 510

aaa gag act ttc aat gca agt ttt tea ggt cat atg act gat cca aac 1780 Lys Glu Thr Phe Asn Ala Ser Phe Ser Gly His Met Thr Asp Pro Asn 515 520 525 ttt aaa aaa gaa act gaa gee tct gaa agt gga ctg gaa ata cat act 1828

Phe Lys Lys Glu Thr Gtu Ala Ser Glu Ser Gly Leu Glu He His Thr 530 535 540 gtt tgc tea cag aag gag gac tec tta tgt cca aat tta att gat aat 1876

Val Cys Ser Gin Lys Glu Asp Ser Leu Cys Pro Asn Leu He Asp Asn 545 550 555 560 gga age tgg cca gee ace ace aca cag aat tct gta get ttg aag aat 1924 Gly Ser Trp Pro Ala Thr Thr Thr Gin Asn Ser Val Ala Leu Lys Asn

565 570 575 gca ggt tta ata tec act ttg aaa aag aaa aca aat aag ttt att tat 1972

Ala Gly Leu He Ser Thr Leu Lys Lys Lys Thr Asn Lys Phe He Tyr 580 585 590 get ata cat gat gaa aca ttt tat aaa gga aaa aaa ata ccg aaa gac 2020

Ala He His Asp Gtu Thr Phe Tyr Lys Gly Lys Lys He Pro Lys Asp 595 600 605 caa aaa tea gaa eta att aac tgt tea gec cag ttt gaa gca aat get 2068

Gin Lys Ser Glu Leu He Asn Cys Ser Ala Gin Phe Glu Ala Asn Ala 610 615 620 ttt gaa gca cca ctt aca ttt gca aat get gat tea ggt tta ttg cat 2116

Phe Glu Ala Pro Leu Thr Phe Ala Asn Ata Asp Ser Gly Leu Leu His 625 630 635 640 tct tct gtg aaa aga age tgt tea cag aat gat tct gaa gaa cca act 2164 Ser Ser Val Lys Arg Ser Cys Ser Gin Asn Asp Ser Gtu Glu Pro Thr

645 650 655 ttg tec tta act age tct ttt ggg aca att ctg agg aaa tgt tct aga 2212

Leu Ser Leu Thr Ser Ser Phe Gly Thr He Leu Arg Lys Cys Ser Arg 660 665 670 aat gaa aca tgt tct aat aat aca gta ate tct cag gat ctt gat tat 2260

Asn Glu Thr Cys Ser Asn Asn Thr Val He Ser Gin Asp Leu Asp Tyr 675 680 685 aaa gaa gca aaa tgt aat aag gaa aaa eta cag tta ttt att ace cca 2308

Lys Glu Ala Lys Cys Asn Lys Glu Lys Leu Gin Leu Phe He Thr Pro

690 695 700 gaa get gat tct ctg tea tgc ctg cag gaa gga cag tgt gaa aat gat 2356

Glu Ala Asp Ser Leu Ser Cys Leu Gin Glu Gly Gin Cys Glu Asn Asp

705 710 715 720 cca aaa age aaa aaa gtt tea gat ata aaa gaa gag gtc ttg get gca 2404

Pro Lys Ser Lys Lys Val Ser Asp He Lys Gtu Glu Val Leu Ala Ala 725 730 735 gca tgt cac cca gta caa cat tea aaa gtg gaa tac agt gat act gac 2452

Ala Cys His Pro Val Gin His Ser Lys Val Glu Tyr Ser Asp Thr Asp 740 745 750 ttt caa tec cag aaa agt ctt tta tat gat cat gaa aat gec age act 2500

Phe Gin Ser Gin Lys Ser Leu Leu Tyr Asp His Glu Asn Ala Ser Thr 755 760 765 ctt att tta act cct act tec aag gat gtt ctg tea aac eta gtc atg 2548 Leu He Leu Thr Pro Thr Ser Lys Asp Val Leu Ser Asn Leu Val Met 770 775 780 att tct aga ggc aaa gaa tea tac aaa atg tea gac aag etc aaa ggt 2596

He Ser Arg Gty Lys Gtu Ser Tyr Lys Met Ser Asp Lys Leu Lys Gly 785 790 795 800 aac aat tat gaa tct gat gtt gaa tta ace aaa aat att ccc atg gaa 2644

Asn Asn Tyr Glu Ser Asp Val Gtu Leu Thr Lys Asn He Pro Met Glu 805 810 815 aag aat caa gat gta tgt get tta aat gaa aat tat aaa aac gtt gag 2692

Lys Asn Gin Asp Val Cys Ala Leu Asn Glu Asn Tyr Lys Asn Val Glu 820 825 830 ctg ttg cca cct gaa aaa tac atg aga gta gca tea cct tea aga aag 2740

Leu Leu Pro Pro Glu Lys Tyr Met Arg Val Ala Ser Pro Ser Arg Lys 835 840 845 gta caa ttc aac caa aac aca aat eta aga gta ate caa aaa aat caa 2788 Vat Gin Phe Asn Gtn Asn Thr Asn Leu Arg Val He Gin Lys Asn Gin

850 855 860 gaa gaa act act tea att tea aaa ata act gtc aat cca gac tct gaa 2836

Gtu Glu Thr Thr Ser He Ser Lys He Thr Val Asn Pro Asp Ser Glu 865 870 875 880 gaa ctt ttc tea gac aat gag aat aat ttt gtc ttc caa gta get aat 2884

Gtu Leu Phe Ser Asp Asn Glu Asn Asn Phe Val Phe Gin Val Ala Asn 885 890 895 gaa agg aat aat ctt get tta gga aat act aag gaa ctt cat gaa aca 2932

Glu Arg Asn Asn Leu Ala Leu Gly Asn Thr Lys Glu Leu His Gtu Thr 900 905 910 gac ttg act tgt gta aac gaa ccc att ttc aag aac tct ace atg gtt 2980

Asp Leu Thr Cys Val Asn Glu Pro He Phe Lys Asn Ser Thr Met Val 915 920 925 tta tat gga gac aca ggt gat aaa caa gca ace caa gtg tea att aaa 3028 Leu Tyr Gly Asp Thr Gly Asp Lys Gin Ala Thr Gin Vat Ser He Lys 930 935 940 aaa gat ttg gtt tat gtt ctt gca gag gag aac aaa aat agt gta aag 3076 Lys Asp Leu Vat Tyr Val Leu Ala Glu Glu Asn Lys Asn Ser Val Lys 945 950 955 960 cag cat ata aaa atg act eta ggt caa gat tta aaa teg gac ate tec 3124 Gin His He Lys Met Thr Leu Gly Gtn Asp Leu Lys Ser Asp He Ser

965 970 975 ttg aat ata gat aaa ata cca gaa aaa aat aat gat tac atg aac aaa 3172

Leu Asn He Asp Lys He Pro Glu Lys Asn Asn Asp Tyr Met Asn Lys 980 985 990 tgg gca gga etc tta ggt cca att tea aat cac agt ttt gga ggt age 3220

Trp Ala Gly Leu Leu Gly Pro He Ser Asn His Ser Phe Gly Gly Ser 995 1000 1005 ttc aga aca get tea aat aag gaa ate aag etc tct gaa cat aac att 3268

Phe Arg Thr Ala Ser Asn Lys Glu He Lys Leu Ser Glu His Asn He 1010 1015 1020 aag aag age aaa atg ttc ttc aaa gat att gaa gaa caa tat cct act 3316

Lys Lys Ser Lys Met Phe Phe Lys Asp He Glu Gtu Gin Tyr Pro Thr 1025 1030 1035 1040 agt tta get tgt gtt gaa att gta aat ace ttg gca tta gat aat caa 3364 Ser Leu Ala Cys Val Glu He Vat Asn Thr Leu Ala Leu Asp Asn Gin

1045 1050 1055 aag aaa ctg age aag cct cag tea att aat act gta tct gca cat tta 3412

Lys Lys Leu Ser Lys Pro Gin Ser He Asn Thr Val Ser Ala His Leu 1060 1065 1070

cag agt agt gta gtt gtt tct gat tgt aaa aat agt cat ata ace cct 3460

Gin Ser Ser Vat Val Val Ser Asp Cys Lys Asn Ser His He Thr Pro 1075 1080 1085 cag atg tta ttt tec aag cag gat ttt aat tea aac cat aat tta aca 3508

Gin Met Leu Phe Ser Lys Gtn Asp Phe Asn Ser Asn His Asn Leu Thr 1090 1095 1100 cct age caa aag gca gaa att aca gaa ctt tct act ata tta gaa gaa 3556

Pro Ser Gin Lys Ala Glu He Thr Glu Leu Ser Thr He Leu Gtu Glu 1105 1110 1115 1120 tea gga agt cag ttt gaa ttt act cag ttt aga aaa cca age tac ata 3604

Ser Gly Ser Gin Phe Gtu Phe Thr Gin Phe Arg Lys Pro Ser Tyr He 1125 1130 1135 ttg cag aag agt aca ttt gaa gtg cct gaa aac cag atg act ate tta 3652 Leu Gin Lys Ser Thr Phe Glu Val Pro Glu Asn Gin Met Thr He Leu

1140 1145 1150 aag ace act tct gag gaa tgc aga gat get gat ctt cat gtc ata atg 3700 Lys Thr Thr Ser Glu Gtu Cys Arg Asp Ala Asp Leu His Val He Met 1155 1160 1165 aat gee cca teg att ggt cag gta gac age age aag caa ttt gaa ggt 3748 Asn Ata Pro Ser He Gly Gin Val Asp Ser Ser Lys Gin Phe Gtu Gly 1170 1175 1180 aca gtt gaa att aaa egg aag ttt get ggc ctg ttg aaa aat gac tgt 3796

Thr Val Glu He Lys Arg Lys Phe Ala Gly Leu Leu Lys Asn Asp Cys 1185 1190 1195 1200 aac aaa agt get tct ggt tat tta aca gat gaa aat gaa gtg ggg ttt 3844

Asn Lys Ser Ala Ser Gty Tyr Leu Thr Asp Glu Asn Glu Val Gly Phe 1205 1210 1215 agg ggc ttt tat tct get cat ggc aca aaa ctg aat gtt tct act gaa 3892

Arg Gly Phe Tyr Ser Ala His Gly Thr Lys Leu Asn Val Ser Thr Glu 1220 1225 1230 get ctg caa aaa get gtg aaa ctg ttt agt gat att gag aat att agt 3940

Ata Leu Gin Lys Ala Val Lys Leu Phe Ser Asp He Glu Asn He Ser 1235 1240 1245 gag gaa act tct gca gag gta cat cca ata agt tta tct tea agt aaa 3988 Glu Glu Thr Ser Ala Glu Val His Pro He Ser Leu Ser Ser Ser Lys 1250 1255 1260 tgt cat gat tct gtt gtt tea atg ttt aag ata gaa aat cat aat gat 4036

Cys His Asp Ser Vat Val Ser Met Phe Lys He Glu Asn His Asn Asp 1265 1270 1275 1280 aaa act gta agt gaa aaa aat aat aaa tgc caa ctg ata tta caa aat 4084

Lys Thr Val Ser Glu Lys Asn Asn Lys Cys Gin Leu He Leu Gin Asn 1285 1290 1295 aat att gaa atg act act ggc act ttt gtt gaa gaa att act gaa aat 4132

Asn He Glu Met Thr Thr Gly Thr Phe Val Glu Glu He Thr Glu Asn 1300 1305 1310 tac aag aga aat act gaa aat gaa gat aac aaa tat act get gee agt 4180

Tyr Lys Arg Asn Thr Glu Asn Glu Asp Asn Lys Tyr Thr Ala Ala Ser 1315 1320 1325 aga aat tct cat aac tta gaa ttt gat ggc agt gat tea agt aaa aat 4228 Arg Asn Ser His Asn Leu Glu Phe Asp Gly Ser Asp Ser Ser Lys Asn 1330 1335 1340 gat act gtt tgt att cat aaa gat gaa acg gac ttg eta ttt act gat 4276

Asp Thr Val Cys He His Lys Asp Gtu Thr Asp Leu Leu Phe Thr Asp 1345 1350 1355 1360 cag cac aac ata tgt ctt aaa tta tct ggc cag ttt atg aag gag gga 4324

Gin His Asn He Cys Leu Lys Leu Ser Gly Gin Phe Met Lys Glu Gly 1365 1370 1375 aac act cag att aaa gaa gat ttg tea gat tta act ttt ttg gaa gtt 4372

Asn Thr Gin He Lys Glu Asp Leu Ser Asp Leu Thr Phe Leu Glu Val 1380 1385 1390 gcg aaa get caa gaa gca tgt cat ggt aat act tea aat aaa gaa cag 4420

Ala Lys Ala Gin Gtu Ata Cys His Gly Asn Thr Ser Asn Lys Gtu Gin 1395 1400 1405 tta act get act aaa acg gag caa aat ata aaa gat ttt gag act tct 4468

Leu Thr Ata Thr Lys Thr Glu Gtn Asn He Lys Asp Phe Glu Thr Ser 1410 1415 1420 gat aca ttt ttt cag act gca agt ggg aaa aat att agt gtc gec aaa 4516

Asp Thr Phe Phe Gin Thr Ala Ser Gly Lys Asn He Ser Vat Ala Lys 1425 1430 1435 1440 gag tta ttt aat aaa att gta aat ttc ttt gat cag aaa cca gaa gaa 4564 Gtu Leu Phe Asn Lys He Val Asn Phe Phe Asp Gtn Lys Pro Gtu Gtu

1445 1450 1455 ttg cat aac ttt tec tta aat tct gaa tta cat tct gac ata aga aag 4612

Leu His Asn Phe Ser Leu Asn Ser Glu Leu His Ser Asp He Arg Lys 1460 1465 1470 aac aaa atg gac att eta agt tat gag gaa aca gac ata gtt aaa cac 4660

Asn Lys Met Asp He Leu Ser Tyr Glu Glu Thr Asp He Val Lys His 1475 1480 1485 aaa ata ctg aaa gaa agt gtc cca gtt ggt act gga aat caa eta gtg 4708

Lys He Leu Lys Glu Ser Val Pro Val Gly Thr Gty Asn Gin Leu Val 1490 1495 1500 ace ttc cag gga caa ccc gaa cgt gat gaa aag ate aaa gaa cct act 4756

Thr Phe Gin Gly Gin Pro Glu Arg Asp Glu Lys He Lys Glu Pro Thr 1505 1510 1515 1520 ctg ttg ggt ttt cat aca get age gga aaa aaa gtt aaa att gca aag 4804 Leu Leu Gly Phe His Thr Ala Ser Gly Lys Lys Val Lys He Ala Lys

1525 1530 1535 gaa tct ttg gac aaa gtg aaa aac ctt ttt gat gaa aaa gag caa ggt 4852

Glu Ser Leu Asp Lys Val Lys Asn Leu Phe Asp Glu Lys Glu Gin Gly 1540 1545 1550 act agt gaa ate ace agt ttt age cat caa tgg gca aag ace eta aag 4900

Thr Ser Glu He Thr Ser Phe Ser His Gin Trp Ala Lys Thr Leu Lys 1555 1560 1565 tac aga gag gee tgt aaa gac ctt gaa tta gca tgt gag ace att gag 4948

Tyr Arg Glu Ala Cys Lys Asp Leu Glu Leu Ala Cys Gtu Thr He Glu 1570 1575 1580 ate aca get gec cca aag tgt aaa gaa atg cag aat tct etc aat aat 4996

He Thr Ala Ala Pro Lys Cys Lys Glu Met Gin Asn Ser Leu Asn Asn 1585 1590 1595 1600 gat aaa aac ctt gtt tct att gag act gtg gtg cca cct aag etc tta 5044

Asp Lys Asn Leu Vat Ser He Glu Thr Val Val Pro Pro Lys Leu Leu

1605 1610 1615 agt gat aat tta tgt aga caa act gaa aat etc aaa aca tea aaa agt 5092

Ser Asp Asn Leu Cys Arg Gin Thr Glu Asn Leu Lys Thr Ser Lys Ser 1620 1625 1630 ate ttt ttg aaa gtt aaa gta cat gaa aat gta gaa aaa gaa aca gca 5140 He Phe Leu Lys Val Lys Val His Glu Asn Val Gtu Lys Glu Thr Ala 1635 1640 1645 aaa agt cct gca act tgt tac aca aat cag tec cct tat tea gtc att 5188

Lys Ser Pro Ala Thr Cys Tyr Thr Asn Gin Ser Pro Tyr Ser Val He 1650 1655 1660 gaa aat tea gee tta get ttt tac aca agt tgt agt aga aaa act tct 5236

Gtu Asn Ser Ala Leu Ata Phe Tyr Thr Ser Cys Ser Arg Lys Thr Ser 1665 1670 1675 1680 gtg agt cag act tea tta ctt gaa gca aaa aaa tgg ctt aga gaa gga 5284

Val Ser Gtn Thr Ser Leu Leu Glu Ala Lys Lys Trp Leu Arg Glu Gly

1685 1690 1695 ata ttt gat ggt caa cca gaa aga ata aat act gca gat tat gta gga 5332

He Phe Asp Gly Gtn Pro Gtu Arg He Asn Thr Ala Asp Tyr Val Gly 1700 1705 1710 aat tat ttg tat gaa aat aat tea aac agt act ata get gaa aat gac 5380 Asn Tyr Leu Tyr Glu Asn Asn Ser Asn Ser Thr He Ala Glu Asn Asp 1715 1720 1725 aaa aat cat etc tec gaa aaa caa gat act tat tta agt aac agt age 5428

Lys Asn His Leu Ser Glu Lys Gin Asp Thr Tyr Leu Ser Asn Ser Ser 1730 1735 1740 atg tct aac age tat tec tac cat tct gat gag gta tat aat gat tea 5476

Met Ser Asn Ser Tyr Ser Tyr His Ser Asp Glu Vat Tyr Asn Asp Ser 1745 1750 1755 1760 gga tat etc tea aaa aat aaa ctt gat tct ggt att gag cca gta ttg 5524

Gly Tyr Leu Ser Lys Asn Lys Leu Asp Ser Gty He Glu Pro Val Leu 1765 1770 1775 aag aat gtt gaa gat caa aaa aac act agt ttt tec aaa gta ata tec 5572

Lys Asn Val Glu Asp Gin Lys Asn Thr Ser Phe Ser Lys Val He Ser 1780 1785 1790 aat gta aaa gat gca aat gca tac cca caa act gta aat gaa gat att 5620

Asn Val Lys Asp Ala Asn Ala Tyr Pro Gin Thr Val Asn Glu Asp He 1795 1800 1805 tgc gtt gag gaa ctt gtg act age tct tea ccc tgc aaa aat aaa aat 5668

Cys Val Glu Glu Leu Val Thr Ser Ser Ser Pro Cys Lys Asn Lys Asn 1810 1815 1820 gca gee att aaa ttg tec ata tct aat agt aat aat ttt gag gta ggg 5716 Ala Ala He Lys Leu Ser He Ser Asn Ser Asn Asn Phe Glu Val Gly 1825 1830 1835 1840 cca cct gca ttt agg ata gee agt ggt aaa ate cgt ttg tgt tea cat 5764

Pro Pro Ala Phe Arg He Ata Ser Gly Lys He Arg Leu Cys Ser His 1845 1850 1855 gaa aca att aaa aaa gtg aaa gac ata ttt aca gac agt ttc age aaa 5812

Gtu Thr He Lys Lys Val Lys Asp He Phe Thr Asp Ser Phe Ser Lys 1860 1865 1870 gta att aag gaa aac aac gag aat aaa tea aaa att tgc caa acg aaa 5860

Vat He Lys Glu Asn Asn Glu Asn Lys Ser Lys He Cys Gin Thr Lys 1875 1880 1885 att atg gca ggt tgt tac gag gca ttg gat gat tea gag gat att ctt 5908

He Met Ala Gly Cys Tyr Glu Ala Leu Asp Asp Ser Glu Asp He Leu 1890 1895 1900 cat aac tct eta gat aat gat gaa tgt age atg cat tea cat aag gtt 5956 His Asn Ser Leu Asp Asn Asp Gtu Cys Ser Met His Ser His Lys Val 1905 1910 1915 1920 ttt get gac att cag agt gaa gaa att tta caa cat aac caa aat atg 6004

Phe Ala Asp He Gin Ser Glu Gtu He Leu Gtn His Asn Gin Asn Met 1925 1930 1935 tct gga ttg gag aaa gtt tct aaa ata tea cct tgt gat gtt agt ttg 6052

Ser Gly Leu Glu Lys Val Ser Lys He Ser Pro Cys Asp Val Ser Leu 1940 1945 1950 gaa act tea gat ata tgt aaa tgt agt ata ggg aag ctt cat aag tea 6100

Glu Thr Ser Asp He Cys Lys Cys Ser He Gly Lys Leu His Lys Ser 1955 1960 1965 gtc tea tct gca aat act tgt ggg att ttt age aca gca agt gga aaa 6148

Val Ser Ser Ala Asn Thr Cys Gty He Phe Ser Thr Ala Ser Gly Lys 1970 1975 1980 tct gtc cag gta tea gat get tea tta caa aac gca aga caa gtg ttt 6196 Ser Val Gin Val Ser Asp Ala Ser Leu Gin Asn Ala Arg Gin Val Phe

1985 1990 1995 2000 tct gaa ata gaa gat agt ace aag caa gtc ttt tec aaa gta ttg ttt 6244 Ser Gtu He Glu Asp Ser Thr Lys Gtn Val Phe Ser Lys Val Leu Phe 2005 2010 2015 aaa agt aac gaa cat tea gac cag etc aca aga gaa gaa aat act get 6292 Lys Ser Asn Glu His Ser Asp Gin Leu Thr Arg Glu Glu Asn Thr Ala 2020 2025 2030 ata cgt act cca gaa cat tta ata tec caa aaa ggc ttt tea tat aat 6340

He Arg Thr Pro Glu His Leu He Ser Gin Lys Gly Phe Ser Tyr Asn 2035 2040 2045 gtg gta aat tea tct get ttc tct gga ttt agt aca gca agt gga aag 6388

Val Val Asn Ser Ser Ala Phe Ser Gly Phe Ser Thr Ala Ser Gly Lys 2050 2055 2060 caa gtt tec att tta gaa agt tec tta cac aaa gtt aag gga gtg tta 6436

Gin Val Ser He Leu Gtu Ser Ser Leu His Lys Val Lys Gly Val Leu 2065 2070 2075 2080 gag gaa ttt gat tta ate aga act gag cat agt ctt cac tat tea cct 6484

Glu Glu Phe Asp Leu He Arg Thr Glu His Ser Leu His Tyr Ser Pro 2085 2090 2095 acg tct aga caa aat gta tea aaa ata ctt cct cgt gtt gat aag aga 6532 Thr Ser Arg Gin Asn Val Ser Lys He Leu Pro Arg Val Asp Lys Arg

2100 2105 2110 aac cca gag cac tgt gta aac tea gaa atg gaa aaa ace tgc agt aaa 6580

Asn Pro Glu His Cys Vat Asn Ser Glu Met Gtu Lys Thr Cys Ser Lys 2115 2120 2125 gaa ttt aaa tta tea aat aac tta aat gtt gaa ggt ggt tct tea gaa 6628

Glu Phe Lys Leu Ser Asn Asn Leu Asn Vat Gtu Gty Gly Ser Ser Gtu 2130 2135 2140 aat aat cac tct att aaa gtt tct cca tat etc tct caa ttt caa caa 6676

Asn Asn His Ser He Lys Val Ser Pro Tyr Leu Ser Gin Phe Gin Gin 2145 2150 2155 2160 gac aaa caa cag ttg gta tta gga ace aaa gtc tea ctt gtt gag aac 6724

Asp Lys Gin Gtn Leu Val Leu Gly Thr Lys Val Ser Leu Val Glu Asn 2165 2170 2175 att cat gtt ttg gga aaa gaa cag get tea cct aaa aac gta aaa atg 6772 He His Val Leu Gly Lys Glu Gin Ala Ser Pro Lys Asn Val Lys Met

2180 2185 2190 gaa att ggt aaa act gaa act ttt tct gat gtt cct gtg aaa aca aat 6820

Glu He Gly Lys Thr Glu Thr Phe Ser Asp Val Pro Val Lys Thr Asn 2195 2200 2205 ata gaa gtt tgt tct act tac tec aaa gat tea gaa aac tac ttt gaa 6868

He Glu Val Cys Ser Thr Tyr Ser Lys Asp Ser Glu Asn Tyr Phe Glu 2210 2215 2220

aca gaa gca gta gaa att get aaa get ttt atg gaa gat gat gaa ctg 6916 Thr Glu Ala Val Glu He Ata Lys Ala Phe Met Glu Asp Asp Glu Leu 2225 2230 2235 2240 aca gat tct aaa ctg cca agt cat gee aca cat tct ctt ttt aca tgt 6964

Thr Asp Ser Lys Leu Pro Ser His Ala Thr His Ser Leu Phe Thr Cys 2245 2250 2255 ccc gaa aat gag gaa atg gtt ttg tea aat tea aga att gga aaa aga 7012

Pro Glu Asn Glu Glu Met Val Leu Ser Asn Ser Arg He Gly Lys Arg 2260 2265 2270 aga gga gag ccc ctt ate tta gtg gga gaa ccc tea ate aaa aga aac 7060

Arg Gly Glu Pro Leu He Leu Val Gly Glu Pro Ser He Lys Arg Asn 2275 2280 2285 tta tta aat gaa ttt gac agg ata ata gaa aat caa gaa aaa tec tta 7108

Leu Leu Asn Glu Phe Asp Arg He He Glu Asn Gin Glu Lys Ser Leu 2290 2295 2300 aag get tea aaa age act cca gat ggc aca ata aaa gat cga aga ttg 7156 Lys Ala Ser Lys Ser Thr Pro Asp Gly Thr He Lys Asp Arg Arg Leu 2305 2310 2315 2320 ttt atg cat cat gtt tct tta gag ccg att ace tgt gta ccc ttt cge 7204

Phe Met His His Val Ser Leu Gtu Pro He Thr Cys Val Pro Phe Arg 2325 2330 2335 aca act aag gaa cgt caa gag ata cag aat cca aat ttt ace gca cct 7252

Thr Thr Lys Glu Arg Gin Glu He Gin Asn Pro Asn Phe Thr Ala Pro 2340 2345 2350 ggt caa gaa ttt ctg tct aaa tct cat ttg tat gaa cat ctg act ttg 7300

Gly Gin Gtu Phe Leu Ser Lys Ser His Leu Tyr Glu His Leu Thr Leu 2355 2360 2365 gaa aaa tct tea age aat tta gca gtt tea gga cat cca ttt tat caa 7348

Glu Lys Ser Ser Ser Asn Leu Ala Val Ser Gly His Pro Phe Tyr Gin 2370 2375 2380 gtt tct get aca aga aat gaa aaa atg aga cac ttg att act aca ggc 7396 Val Ser Ala Thr Arg Asn Glu Lys Met Arg His Leu He Thr Thr Gly

2385 2390 2395 2400 aga cca ace aaa gtc ttt gtt cca cct ttt aaa act aaa tea cat ttt 7444

Arg Pro Thr Lys Val Phe Val Pro Pro Phe Lys Thr Lys Ser His Phe 2405 2410 2415 cac aga gtt gaa cag tgt gtt agg aat att aac ttg gag gaa aac aga 7492

His Arg Val Glu Gin Cys Val Arg Asn He Asn Leu Glu Glu Asn Arg 2420 2425 2430 caa aag caa aac att gat gga cat ggc tct gat gat agt aaa aat aag 7540

Gin Lys Gin Asn He Asp Gly His Gly Ser Asp Asp Ser Lys Asn Lys 2435 2440 2445 att aat gac aat gag att cat cag ttt aac aaa aac aac tec aat caa 75BB

He Asn Asp Asn Glu He His Gin Phe Asn Lys Asn Asn Ser Asn Gin 2450 2455 2460

gca gca get gta act ttc aca aag tgt gaa gaa gaa cct tta gat tta 7636

Ala Ata Ala Vat Thr Phe Thr Lys Cys Gtu Gtu Glu Pro Leu Asp Leu 2465 2470 2475 2480 att aca agt ctt cag aat gee aga gat ata cag gat atg cga att aag 7684

He Thr Ser Leu Gin Asn Ala Arg Asp He Gin Asp Met Arg He Lys 2485 2490 2495 aag aaa caa agg caa cge gtc ttt cca cag cca ggc agt ctg tat ctt 7732

Lys Lys Gin Arg Gin Arg Vat Phe Pro Gtn Pro Gly Ser Leu Tyr Leu 2500 2505 2510 gca aaa aca tec act ctg cct cga ate tct ctg aaa gca gca gta gga 7780 Ala Lys Thr Ser Thr Leu Pro Arg He Ser Leu Lys Ala Ala Val Gty

2515 2520 2525 ggc caa gtt ccc tct gcg tgt tct cat aaa cag ctg tat acg tat ggc 7828

Gly Gin Val Pro Ser Ala Cys Ser His Lys Gin Leu Tyr Thr Tyr Gly 2530 2535 2540 gtt tct aaa cat tgc ata aaa att aac age aaa aat gca gag tct ttt 7876

Val Ser Lys His Cys He Lys He Asn Ser Lys Asn Ata Glu Ser Phe

2545 2550 2555 2560 cag ttt cac act gaa gat tat ttt ggt aag gaa agt tta tgg act gga 7924

Gin Phe His Thr Glu Asp Tyr Phe Gly Lys Glu Ser Leu Trp Thr Gly 2565 2570 2575 aaa gga ata cag ttg get gat ggt gga tgg etc ata ccc tec aat gat 7972

Lys Gly He Gin Leu Ala Asp Gly Gly Trp Leu He Pro Ser Asn Asp 2580 2585 2590 gga aag get gga aaa gaa gaa ttt tat agg get ctg tgt gac act cca 8020 Gly Lys Ala Gly Lys Glu Glu Phe Tyr Arg Ala Leu Cys Asp Thr Pro

2595 2600 2605 ggt gtg gat cca aag ctt att tct aga att tgg gtt tat aat cac tat 8068

Gty Val Asp Pro Lys Leu He Ser Arg He Trp Val Tyr Asn His Tyr 2610 2615 2620 aga tgg ate ata tgg aaa ctg gca get atg gaa tgt gec ttt cct aag 8116

Arg Trp He He Trp Lys Leu Ala Ala Met Gtu Cys Ala Phe Pro Lys 2625 2630 2635 2640 gaa ttt get aat aga tgc eta age cca gaa agg gtg ctt ctt caa eta 8164

Glu Phe Ala Asn Arg Cys Leu Ser Pro Glu Arg Vat Leu Leu Gin Leu 2645 2650 2655 aaa tac aga tat gat acg gaa att gat aga age aga aga teg get ata 8212

Lys Tyr Arg Tyr Asp Thr Glu He Asp Arg Ser Arg Arg Ser Ata He 2660 2665 2670 aaa aag ata atg gaa agg gat gac aca get gca aaa aca ctt gtt etc 8260

Lys Lys He Met Glu Arg Asp Asp Thr Ala Ata Lys Thr Leu Vat Leu 2675 2680 2685 tgt gtt tct gac ata att tea ttg age gca aat ata tct gaa act tct 8308

Cys Val Ser Asp He He Ser Leu Ser Ala Asn He Ser Glu Thr Ser 2690 2695 2700 age aat aaa act agt agt gca gat ace caa aaa gtg gec att att gaa 8356 Ser Asn Lys Thr Ser Ser Ala Asp Thr Gin Lys Val Ala He He Glu 2705 2710 2715 2720 ctt aca gat ggg tgg tat get gtt aag gec cag tta gat cct ccc etc 8404

Leu Thr Asp Gly Trp Tyr Ala Val Lys Ala Gtn Leu Asp Pro Pro Leu 2725 2730 2735 tta get gtc tta aag aat ggc aga ctg aca gtt ggt cag aag att att 8452

Leu Ala Val Leu Lys Asn Gly Arg Leu Thr Val Gly Gin Lys He He 2740 2745 2750 ctt cat gga gca gaa ctg gtg ggc tct cct gat gee tgt aca cct ctt 8500

Leu His Gly Ala Glu Leu Val Gly Ser Pro Asp Ala Cys Thr Pro Leu

2755 2760 2765 gaa gee cca gaa tct ctt atg tta aag att tct get aac agt act egg 8548

Gtu Ala Pro Glu Ser Leu Met Leu Lys He Ser Ala Asn Ser Thr Arg 2770 2775 2780

cct get cge tgg tat ace aaa ctt gga ttc ttt cct gac cct aga cct 8596

Pro Ala Arg Trp Tyr Thr Lys Leu Gly Phe Phe Pro Asp Pro Arg Pro 2785 2790 2795 2800 ttt cct ctg ccc tta tea teg ctt ttc agt gat gga gga aat gtt ggt 8644 Phe Pro Leu Pro Leu Ser Ser Leu Phe Ser Asp Gly Gly Asn Val Gly

2805 2810 2815 tgt gtt gat gta att att caa aga gca tac cct ata cag egg atg gag 8692

Cys Val Asp Val He He Gin Arg Ata Tyr Pro He Gin Arg Met Glu 2820 2825 2830 aag aca tea tct gga tta tac ata ttt cge aat gaa aga gag gaa gaa 8740

Lys Thr Ser Ser Gly Leu Tyr He Phe Arg Asn Glu Arg Glu Glu Glu 2835 2840 2845 aag gaa gca gca aaa tat gtg gag gec caa caa aag aga eta gaa gec 8788

Lys Glu Ala Ala Lys Tyr Val Glu Ala GI" Gin Lys Arg Leu Glu Ala 2850 2855 2860 tta ttc act aaa att cag gag gaa ttt gaa gaa cat gaa gaa aac aca 8836

Leu Phe Thr Lys He GI" Glu Glu Phe Glu Glu His Glu Glu Asn Thr 2865 2870 2875 2880 aca aaa cca tat tta cca tea cgt gca eta aca aga cag caa gtt cgt 8884

Thr Lys Pro Tyr Leu Pro Ser Arg Ala Leu Thr Arg Gin Gin Vat Arg 2885 2890 2895 get ttg caa gat ggt gca gag ctt tat gaa gca gtg aag aat gca gca 8932

Ala Leu Gin Asp Gly Ala Glu Leu Tyr Glu Ala Vat Lys Asn Ala Ala 2900 2905 2910 gac cca get tac ctt gag ggt tat ttc agt gaa gag cag tta aga gee 8980 Asp Pro Ala Tyr Leu Glu Gly Tyr Phe Ser Glu Glu Gin Leu Arg Ala

2915 2920 2925 ttg aat aat cac agg caa atg ttg aat gat aag aaa caa get cag ate 9028

Leu Asn Asn His Arg Gin Met Leu Asn Asp Lys Lys Gin Ala Gin He 2930 2935 2940 cag ttg gaa att agg aag gee atg gaa tct get gaa caa aag gaa caa 9076

Gtn Leu Glu He Arg Lys Ata Met Glu Ser Ala Glu Gin Lys Glu Gin 2945 2950 2955 2960 ggt tta tea agg gat gtc aca ace gtg tgg aag ttg cgt att gta age 9124

Gly Leu Ser Arg Asp Val Thr Thr Vat Trp Lys Leu Arg He Vat Ser

2965 2970 2975 tat tea aaa aaa gaa aaa gat tea gtt ata ctg agt att tgg cgt cca 9172

Tyr Ser Lys Lys Glu Lys Asp Ser Val He Leu Ser He Trp Arg Pro 2980 2985 2990 tea tea gat tta tat tct ctg tta aca gaa gga aag aga tac aga att 9220 Ser Ser Asp Leu Tyr Ser Leu Leu Thr Glu Gly Lys Arg Tyr Arg He

2995 3000 3005 tat cat ctt gca act tea aaa tct aaa agt aaa tct gaa aga get aac 9268

Tyr His Leu Ala Thr Ser Lys Ser Lys Ser Lys Ser Glu Arg Ala Asn 3010 3015 3020

ata cag tta gca gcg aca aaa aaa act cag tat caa caa eta ccg gtt 9316

He Gtn Leu Ala Ata Thr Lys Lys Thr Gtn Tyr Gin Gin Leu Pro Val 3025 3030 3035 3040 tea gat gaa att tta ttt cag att tac cag cca egg gag ccc ctt cac 9364 Ser Asp Glu He Leu Phe Gin He Tyr Gin Pro Arg Glu Pro Leu His 3045 3050 3055 ttc age aaa ttt tta gat cca gac ttt cag cca tct tgt tct gag gtg 9412 Phe Ser Lys Phe Leu Asp Pro Asp Phe Gin Pro Ser Cys Ser Glu Val 3060 3065 3070 gac eta ata gga ttt gtc gtt tct gtt gtg aaa aaa aca gga ctt gec 9460

Asp Leu He Gly Phe Val Val Ser Val Val Lys Lys Thr Gly Leu Ala 3075 3080 3085 cct ttc gtc tat ttg tea gac gaa tgt tac aat tta ctg gca ata aag 9508

Pro Phe Val Tyr Leu Ser Asp Gtu Cys Tyr Asn Leu Leu Ala He Lys 3090 3095 3100 ttt tgg ata gac ctt aat gag gac att att aag cct cat atg tta att 9556

Phe Trp He Asp Leu Asn Glu Asp He He Lys Pro His Met Leu He 3105 3110 3115 3120 get gca age aac etc cag tgg cga cca gaa tec aaa tea ggc ctt ctt 9604

Ala Ala Ser Asn Leu Gtn Trp Arg Pro Gtu Ser Lys Ser Gly Leu Leu 3125 3130 3135 act tta ttt get gga gat ttt tct gtg ttt tct get agt cca aaa gag 9652 Thr Leu Phe Ala Gly Asp Phe Ser Val Phe Ser Ala Ser Pro Lys Glu 3140 3145 3150 ggc cac ttt caa gag aca ttc aac aaa atg aaa aat act gtt gag aat 9700

Gty His Phe Gtn Gtu Thr Phe Asn Lys Met Lys Asn Thr Val Glu Asn 3155 3160 3165 att gac ata ctt tgc aat gaa gca gaa aac aag ctt atg cat ata ctg 9748

He Asp He Leu Cys Asn Glu Ala Glu Asn Lys Leu Met His He Leu 3170 3175 3180 cat gca aat gat ccc aag tgg tec ace cca act aaa gac tgt act tea 9796

His Ala Asn Asp Pro Lys Trp Ser Thr Pro Thr Lys Asp Cys Thr Ser 3185 3190 3195 3200 ggg ccg tac act get caa ate att cct ggt aca gga aac aag ctt ctg 9844

Gty Pro Tyr Thr Ala Gin He He Pro Gly Thr Gly Asn Lys Leu Leu 3205 3210 3215 atg tct tct cct aat tgt gag ata tat tat caa agt cct tta tea ctt 9892 Met Ser Ser Pro Asn Cys Glu He Tyr Tyr Gin Ser Pro Leu Ser Leu 3220 3225 3230 tgt atg gec aaa agg aag tct gtt tec aca cct gtc tea gee cag atg 9940

Cys Met Ata Lys Arg Lys Ser Val Ser Thr Pro Val Ser Ala Gin Met 3235 3240 3245 act tea aag tct tgt aaa ggg gag aaa gag att gat gac caa aag aac 9988

Thr Ser Lys Ser Cys Lys Gly Glu Lys Glu He Asp Asp Gtn Lys Asn 3250 3255 3260 tgc aaa aag aga aga gee ttg gat ttc ttg agt aga ctg cct tta cct 10036 Cys Lys Lys Arg Arg Ala Leu Asp Phe Leu Ser Arg Leu Pro Leu Pro 3265 3270 3275 3280 cca cct gtt agt ccc att tgt aca ttt gtt tct ccg get gca cag aag 10084 Pro Pro Val Ser Pro He Cys Thr Phe Val Ser Pro Ala Ala Gin Lys 3285 3290 3295 gca ttt cag cca cca agg agt tgt ggc ace aaa tac gaa aca ccc ata 10132 Ata Phe Gin Pro Pro Arg Ser Cys Gly Thr Lys Tyr Glu Thr Pro He 3300 3305 3310 aag aaa aaa gaa ctg aat tct cct cag atg act cca ttt aaa aaa ttc 10180 Lys Lys Lys Glu Leu Asn Ser Pro Gin Met Thr Pro Phe Lys Lys Phe 3315 3320 3325 aat gaa att tct ctt ttg gaa agt aat tea ata get gac gaa gaa ctt 10228 Asn Glu He Ser Leu Leu Glu Ser Asn Ser He Ala Asp Glu Glu Leu 3330 3335 3340 gca ttg ata aat ace caa get ctt ttg tct ggt tea aca gga gaa aaa 10276 Ala Leu He Asn Thr Gin Ala Leu Leu Ser Gty Ser Thr Gly Gtu Lys 3345 3350 3355 3360

caa ttt ata tct gtc agt gaa tec act agg act get ccc ace agt tea 10324 Gtn Phe He Ser Val Ser Glu Ser Thr Arg Thr Ala Pro Thr Ser Ser 3365 3370 3375 gaa gat tat etc aga ctg aaa cga cgt tgt act aca tct ctg ate aaa 10372

Glu Asp Tyr Leu Arg Leu Lys Arg Arg Cys Thr Thr Ser Leu He Lys 3380 3385 3390 gaa cag gag agt tec cag gec agt acg gaa gaa tgt gag aaa aat aag 10420

Glu Gin Glu Ser Ser Gin Ala Ser Thr Glu Glu Cys Glu Lys Asn Lys

3395 3400 3405 cag gac aca att aca act aaa aaa tat ate taagcatttg caaaggegae 10470 Gin Asp Thr He Thr Thr Lys Lys Tyr He 3410 3415 aataaattat tgacgettaa ectttccagt ttataagact ggaatataat ttcaaaccae 10530

acattagtac ttatgttgcm caatgagaaa agaaattagt ttcaaattta cctcagcgtt 10590

tgtgtategg geaaaaateg ttttgecega ttecgtattg gtatactttt gcetcagttg 10650

catatcctaa aactaaatgt aatttattaa ctaateaaga aaaaeatett tggctgagct 10710 eggtggctca tgcetgtaat cecaacaett tgagaagetg aggtgggagg agtgcttgag 10770

gceaggagtt caagaceagc ctgggcaaea tagggagace ceatctttae gaagaaaaaa 10830

aaaaagggga aaagaaaatc ttttaaatet ttggatttca etacaagtat tattttacaa 10890

gtgaaataaa cataccattt tcttttagat tgtgtcatta aatggaatga ggtctcttag 10950

tacagttatt ttgatgeaga taattccttt tagtttagct actattttag gggatttttt 11010

ttagaggtaa ctcactatga aatagttccc ettaatgeaa atatgttggt tetgeaatag 11070

ttccatcctg ttcaaaartc rggrtgaawa tgaagagtgg tgttyccttt tgagcaattc 11130

tcatccttaa gtcagcrtga ttataagaaa aatagaaccc ycagtgtaac yctaattcct 11190

ttttrctatt ccagtgtgat ctctgaaakt aaattacttc mactaaaaat tcaaaaactt 11250

waamtcagaa rawttcawag t gatttatt ttt 11283

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 3418

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: protein (ϋi) HYPOTHETICAL: no (iv) ANTI-SENSE: no (v) ORIGINAL SOURCE

(A) ORGANISM: Homo sapiens sapiens (C) INDIVIDUAL/ISOLATE: (D) DEVELOPMENTAL STAGE: adult

(F) TISSUE TYPE: female breast

(G) CELL TYPE: normal breast tissue (H) CELL LINE: HMEC (I) ORGANELLE: no

(ix) FEATURE:

(A) NAME/KEY: BRCA2 protein

(B) LOCATION: 1 to 3418; Genbank locus HSU43746

(C) IDENTIFICATION METHOD: (D) OTHER INFORMATION: BRCA2 protein has a negative regulatory effect on growth of human mammary cells, (x) PUBLICATION INFORMATION:

(A) AUTHORS: Wooster, R. et al.

(B) TITLE: Identification of the breast cancer susceptability gene BRCA2

(C) JOURNAL: Nature

(D) VOLUME: 379

(E) PAGES: 789-792

(F) DATE: 1995 (K) RELEVANT RESIDUES IN SEQ ID NO:4: granin box domain at amino acids 3334-3344

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Met Pro He Gly Ser Lys Glu Arg Pro Thr Phe Phe Glu He Phe Lys

1 5 10 15

Thr Arg Cys Asn Lys Ala Asp Leu Gty Pro He Ser Leu Asn Trp Phe 20 25 30

Glu Glu Leu Ser Ser Glu Ala Pro Pro Tyr Asn Ser Glu Pro Ala Glu 35 40 45

Glu Ser Glu His Lys Asn Asn Asn Tyr Glu Pro Asn Leu Phe Lys Thr 50 55 60

Pro Gin Arg Lys Pro Ser Tyr Asn Gin Leu Ala Ser Thr Pro He He 65 70 75 80 Phe Lys Glu Gin Gly Leu Thr Leu Pro Leu Tyr Gin Ser Pro Val Lys

85 90 95 Glu Leu Asp Lys Phe Lys Leu Asp Leu Gly Arg Asn Val Pro Asn Ser 100 105 110

Arg His Lys Ser Leu Arg Thr Val Lys Tyr Lys Met Asp Gin Ata Asp 115 120 125

Asp Vat Ser Cys Pro Leu Leu Asn Ser Cys Leu Ser Glu Ser Pro Vat 130 135 140

Val Leu Gin Cys Thr His Val Thr Pro Gin Arg Asp Lys Ser Val Val 145 150 155 160

Cys Gty Ser Leu Phe His Thr Pro Lys Phe Val Lys Gly Arg Gtn Thr 165 170 175

Pro Lys His He Ser Glu Ser Leu Gly Ala Glu Val Asp Pro Asp Met 180 185 190

Ser Trp Ser Ser Ser Leu Ala Thr Pro Pro Thr Leu Ser Ser Thr Val 195 200 205

Leu He Val Arg Asn Glu Glu Ala Ser Glu Thr Vat Phe Pro His Asp 210 215 220

Thr Thr Ala Asn Val Lys Ser Tyr Phe Ser Asn His Asp Glu Ser Leu 225 230 235 240

Lys Lys Asn Asp Arg Phe He Ala Ser Val Thr Asp Ser Glu Asn Thr 245 250 255

Asn Gin Arg Glu Ala Ala Ser His Gly Phe Gty Lys Thr Ser Gty Asn 260 265 270

Ser Phe Lys Vat Asn Ser Cys Lys Asp His lie Gty Lys Ser Met Pro 275 280 285 Asn Val Leu Glu Asp Glu Vat Tyr Glu Thr Val Vat Asp Thr Ser Glu 290 295 300

Glu Asp Ser Phe Ser Leu Cys Phe Ser Lys Cys Arg Thr Lys Asn Leu 305 310 315 320

Gin Lys Val Arg Thr Ser Lys Thr Arg Lys Lys He Phe His Gtu Ata 325 330 335

Asn Ala Asp Glu Cys Gtu Lys Ser Lys Asn Gin Val Lys Glu Lys Tyr 340 345 350 Ser Phe Val Ser Glu Val Glu Pro Asn Asp Thr Asp Pro Leu Asp Ser 355 360 365

Asn Vat Ala His Gin Lys Pro Phe Glu Ser Gly Ser Asp Lys He Ser 370 375 380

Lys Glu Val Val Pro Ser Leu Ala Cys Glu Trp Ser Gin Leu Thr Leu 385 390 395 400

Ser Gly Leu Asn Gly Ala Gin Met Glu Lys He Pro Leu Leu His He 405 410 415

Ser Ser Cys Asp Gin Asn He Ser Glu Lys Asp Leu Leu Asp Thr Glu 420 425 430

Asn Lys Arg Lys Lys Asp Phe Leu Thr Ser Glu Asn Ser Leu Pro Arg 435 440 445

Ile Ser Ser Leu Pro Lys Ser Gtu Lys Pro Leu Asn Glu Glu Thr Vat 450 455 460

Val Asn Lys Arg Asp Glu Glu Gin His Leu Glu Ser His Thr Asp Cys 465 470 475 480

He Leu Ala Vat Lys Gtn Ala He Ser Gty Thr Ser Pro Val Ala Ser 485 490 495

Ser Phe Gin Gly He Lys Lys Ser He Phe Arg He Arg Glu Ser Pro

500 505 510

Lys Glu Thr Phe Asn Ala Ser Phe Ser Gly His Met Thr Asp Pro As" 515 520 525

Phe Lys Lys Glu Thr Glu Ala Ser Glu Ser Gly Leu Glu He His Thr 530 535 540

Val Cys Ser Gin Lys Glu Asp Ser Leu Cys Pro Asn Leu He Asp Asn 545 550 555 560

Gty Ser Trp Pro Ala Thr Thr Thr Gtn Asn Ser Val Ata Leu Lys Asn 565 570 575

Ala Gly Leu He Ser Thr Leu Lys Lys Lys Thr Asn Lys Phe He Tyr

580 585 590

Ala He His Asp Glu Thr Phe Tyr Lys Gly Lys Lys He Pro Lys^" Asp 595 600 605

Gtn Lys Ser Glu Leu He Asn Cys Ser Ata Gin Phe Glu Ala Asn Ala 610 615 620

Phe Glu Ala Pro Leu Thr Phe Ala Asn Ala Asp Ser Gty Leu Leu His 625 630 635 640

Ser Ser Vat Lys Arg Ser Cys Ser Gin Asn Asp Ser Glu Glu Pro Thr 645 650 655

Leu Ser Leu Thr Ser Ser Phe Gly Thr He Leu Arg Lys Cys Ser Arg 660 665 670

Asn Glu Thr Cys Ser Asn Asn Thr Val He Ser Gin Asp Leu Asp Tyr 675 680 685

Lys Glu Ala Lys Cys Asn Lys Glu Lys Leu Gin Leu Phe He Thr Pro 690 695 700

Glu Ala Asp Ser Leu Ser Cys Leu Gin Glu Gly Gin Cys Gtu Asn Asp 705 710 715 720

Pro Lys Ser Lys Lys Val Ser Asp He Lys Glu Glu Val Leu Ala Ala 725 730 735

Ala Cys His Pro Val Gin His Ser Lys Val Gtu Tyr Ser Asp Thr Asp 740 745 750

Phe Gin Ser Gin Lys Ser Leu Leu Tyr Asp His Glu Asn Ala Ser Thr 755 760 765

Leu He Leu Thr Pro Thr Ser Lys Asp Vat Leu Ser Asn Leu Vat Met 770 775 780

He Ser Arg Gly Lys Glu Ser Tyr Lys Met Ser Asp Lys Leu Lys Gly 785 790 795 800

sn Asn Tyr Glu Ser Asp Val Glu Leu Thr Lys Asn He Pro Met Glu 805 810 815 Lys Asn Gin Asp Val Cys Ala Leu Asn Glu Asn Tyr Lys Asn Val Gtu 820 825 830

Leu Leu Pro Pro Glu Lys Tyr Met Arg Val Ala Ser Pro Ser Arg Lys 835 840 845

Val Gin Phe Asn Gin Asn Thr Asn Leu Arg Val He Gin Lys Asn Gin 850 855 860

Glu Glu Thr Thr Ser He Ser Lys He Thr Val Asn Pro Asp Ser Glu 865 870 875 880

Gtu Leu Phe Ser Asp Asn Glu Asn Asn Phe Val Phe Gin Val Ala Asn 885 890 895

Glu Arg Asn Asn Leu Ala Leu Gty Asn Thr Lys Glu Leu His Glu Thr 900 905 910

Asp Leu Thr Cys Val Asn Glu Pro He Phe Lys Asn Ser Thr Met Val 915 920 925

Leu Tyr Gly Asp Thr Gly Asp Lys Gin Ala Thr Gin Val Ser He Lys 930 935 940

Lys Asp Leu Val Tyr Val Leu Ala Glu Glu Asn Lys Asn Ser Vat Lys 945 950 955 960

Gin His He Lys Met Thr Leu Gly Gin Asp Leu Lys Ser Asp He Ser 965 970 975

Leu Asn He Asp Lys He Pro Glu Lys Asn Asn Asp Tyr Met Asn Lys 980 985 990

Trp Ala Gty Leu Leu Gty Pro He Ser Asn His Ser Phe Gly Gty Ser 995 1000 1005

Phe Arg Thr Ala Ser Asn Lys Glu He Lys Leu Ser Glu His Asn He 1010 1015 1020 Lys Lys Ser Lys Met Phe Phe Lys Asp He Glu Gtu Gtn Tyr Pro Thr 1025 1030 1035 1040

Ser Leu Ala Cys Val Glu He Val As" Thr Leu Ala Leu Asp Asn Gin 1045 1050 1055

Lys Lys Leu Ser Lys Pro Gin Ser He Asn Thr Val Ser Ata His Leu 1060 1065 1070

Gin Ser Ser Val Val Vat Ser Asp Cys Lys Asn Ser His He Thr Pro 1075 1080 1085

Gin Met Leu Phe Ser Lys Gin Asp Phe Asn Ser Asn His Asn Leu Thr 1090 1095 1100

Pro Ser Gin Lys Ala Glu He Thr Glu Leu Ser Thr lie Leu Glu Gtu 1105 1110 1115 1120

Ser Gly Ser Gtn Phe Glu Phe Thr Gin Phe Arg Lys Pro Ser Tyr He 1125 1130 1135

Leu Gin Lys Ser Thr Phe Glu Val Pro Glu Asn Gin Met Thr He Leu 1140 1145 1150

Lys Thr Thr Ser Glu Glu Cys Arg Asp Ala Asp Leu His Val He Met 1155 1160 1165

Asn Ala Pro Ser He Gly Gtn Val Asp Ser Ser Lys Gin Phe Glu Gly 1170 1175 1180

Thr Val Gtu He Lys Arg Lys Phe Ala Gly Leu Leu Lys Asn Asp Cys 1185 1190 1195 1200

Asn Lys Ser Ala Ser Gly Tyr Leu Thr Asp Glu Asn Glu Vat Gty Phe 1205 1210 1215

Arg Gty Phe Tyr Ser Ala His Gly Thr Lys Leu Asn Val Ser Thr Glu

1220 1225 1230 Ala Leu Gin Lys Ala Val Lys Leu Phe Ser Asp He Gtu Asn He Ser 1235 1240 1245

Gtu Glu Thr Ser Ala Glu Vat His Pro He Ser Leu Ser Ser Ser Lys 1250 1255 1260

Cys His Asp Ser Val Val Ser Met Phe Lys He Glu Asn His Asn Asp 1265 1270 1275 1280

Lys Thr Val Ser Gtu Lys Asn Asn Lys Cys Gtn Leu He Leu Gin Asn 1285 1290 1295

Asn He Gtu Met Thr Thr Gly Thr Phe Val Glu Glu He Thr Gtu Asn 1300 1305 1310

Tyr Lys Arg Asn Thr Glu Asn Glu Asp Asn Lys Tyr Thr Ala Ala Ser 1315 1320 1325

Arg Asn Ser His Asn Leu Gtu Phe Asp Gly Ser Asp Ser Ser Lys Asn 1330 1335 1340

Asp Thr Val Cys He His Lys Asp Gtu Thr Asp Leu Leu Phe Thr Asp 1345 1350 1355 1360

Gin His Asn He Cys Leu Lys Leu Ser Gly Gin Phe Met Lys Gtu Gly 1365 1370 1375

Asn Thr Gtn He Lys Glu Asp Leu Ser Asp Leu Thr Phe Leu Glu Val 1380 1385 1390

Ala Lys Ala Gin Glu Ala Cys His Gly Asn Thr Ser Asn Lys Glu Gin 1395 1400 1405

Leu Thr Ata Thr Lys Thr Glu Gtn Asn He Lys Asp Phe Gtu Thr Ser 1410 1415 1420

Asp Thr Phe Phe Gin Thr Ala Ser Gly Lys Asn He Ser Vat Ala Lys 1425 1430 1435 1440 Glu Leu Phe Asn Lys He Val Asn Phe Phe Asp Gin Lys Pro Glu Glu 1445 1450 1455

Leu His Asn Phe Ser Leu Asn Ser Glu Leu His Ser Asp He Arg Lys 1460 1465 1470

Asn Lys Met Asp He Leu Ser Tyr Glu Glu Thr Asp He Val Lys His 1475 1480 1485

Lys He Leu Lys Glu Ser Vat Pro Val Gly Thr Gly Asn Gin Leu Vat 1490 1495 1500

Thr Phe Gtn Gly Gtn Pro Glu Arg Asp Glu Lys He Lys Gtu Pro Thr 1505 1510 1515 1520

Leu Leu Gly Phe His Thr Ata Ser Gty Lys Lys Val Lys He Ala Lys 1525 1530 1535

Glu Ser Leu Asp Lys Val Lys Asn Leu Phe Asp Glu Lys Glu Gin Gly 1540 1545 1550

Thr Ser Glu He Thr Ser Phe Ser His Gin Trp Ala Lys Thr Leu Lys 1555 1560 1565

Tyr Arg Glu Ala Cys Lys Asp Leu Glu Leu Ata Cys Gtu Thr He Glu 1570 1575 1580

He Thr Ala Ala Pro Lys Cys Lys Glu Met Gin Asn Ser Leu Asn Asn 1585 1590 1595 1600

Asp Lys Asn Leu Val Ser I le Glu Thr Val Vat Pro Pro Lys Leu Leu 1605 1610 1615

Ser Asp Asn Leu Cys Arg Gin Thr Glu Asn Leu Lys Thr Ser Lys Ser 1620 1625 1630

He Phe Leu Lys Val Lys Val His Gtu Asn Val Glu Lys Glu Thr Ala 1635 1640 1645 Lys Ser Pro Ala Thr Cys Tyr Thr Asn Gin Ser Pro Tyr Ser Vat lie 1650 1655 1660

Glu Asn Ser Ala Leu Ala Phe Tyr Thr Ser Cys Ser Arg Lys Thr Ser 1665 1670 1675 1680

Val Ser Gin Thr Ser Leu Leu Glu Ala Lys Lys Trp Leu Arg Glu Gly 1685 1690 1695

He Phe Asp Gty Gin Pro Glu Arg He Asn Thr Ala Asp Tyr Val Gly 1700 1705 1710

Asn Tyr Leu Tyr Glu Asn Asn Ser Asn Ser Thr He Ala Gtu Asn Asp 1715 1720 1725

Lys Asn His Leu Ser Gtu Lys Gin Asp Thr Tyr Leu Ser Asn Ser Ser 1730 1735 1740

Met Ser Asn Ser Tyr Ser Tyr His Ser Asp Glu Val Tyr Asn Asp Ser 1745 1750 1755 1760

Gly Tyr Leu Ser Lys Asn Lys Leu Asp Ser Gly He Gtu Pro Val Leu 1765 1770 1775

Lys Asn Val Glu Asp Gin Lys Asn Thr Ser Phe Ser Lys Val He Ser 1780 1785 1790

Asn Vat Lys Asp Ala Asn Ala Tyr Pro Gtn Thr Vat Asn Gtu Asp He 1795 1800 1805

Cys Val Glu Glu Leu Val Thr Ser Ser Ser Pro Cys Lys Asn Lys Asn 1810 1815 1820

Ala Ala He Lys Leu Ser He Ser Asn Ser Asn Asn Phe Glu Val Gly 1825 1830 1835 1840

Pro Pro Ala Phe Arg He Ala Ser Gly Lys He Arg Leu Cys Ser His 1845 1850 1855

Glu Thr He Lys Lys Val Lys Asp He Phe Thr Asp Ser Phe Ser Lys 1860 1865 1870

Val He Lys Gtu Asn Asn Glu Asn Lys Ser Lys He Cys Gin Thr Lys 1875 1880 1885

He Met Ala Gly Cys Tyr Glu Ala Leu Asp Asp Ser Glu Asp He Leu 1890 1895 1900

His Asn Ser Leu Asp Asn Asp Glu Cys Ser Met His Ser His Lys Vat 1905 1910 1915 1920

Phe Ata Asp He Gtn Ser Glu Glu He Leu Gtn His Asn Gtn Asn Met 1925 1930 1935

Ser Gly Leu Glu Lys Val Ser Lys He Ser Pro Cys Asp Val Ser Leu 1940 1945 1950

Glu Thr Ser Asp He Cys Lys Cys Ser He Gly Lys Leu His Lys Ser 1955 1960 1965

Val Ser Ser Ala Asn Thr Cys Gly He Phe Ser Thr Ala Ser Gly Lys 1970 1975 1980

Ser Val Gtn Vat Ser Asp Ala Ser Leu Gtn Asn Ata Arg Gin Val Phe 1985 1990 1995 2000

Ser Gtu He Glu Asp Ser Thr Lys Gtn Val Phe Ser Lys Val Leu Phe 2005 2010 2015

Lys Ser Asn Glu His Ser Asp Gin Leu Thr Arg Glu Glu Asn Thr Ala 2020 2025 2030

He Arg Thr Pro Glu His Leu He Ser Gtn Lys Gly Phe Ser Tyr Asn 2035 2040 2045 Vat Val Asn Ser Ser Ata Phe Ser Gty Phe Ser Thr Ala Ser Gly Lys 2050 2055 2060

Gin Val Ser He Leu Gtu Ser Ser Leu His Lys Val Lys Gly Val Leu 2065 2070 2075 2080

Glu Glu Phe Asp Leu He Arg Thr Gtu His Ser Leu His Tyr Ser Pro 2085 2090 2095

Thr Ser Arg Gtn Asn Val Ser Lys He Leu Pro Arg Vat Asp Lys Arg 2100 2105 2110

Asn Pro Glu His Cys Vat Asn Ser Gtu Met Glu Lys Thr Cys Ser Lys 2115 2120 2125

Glu Phe Lys Leu Ser Asn Asn Leu Asn Val Glu Gty Gly Ser Ser Glu 2130 2135 2140

Asn Asn His Ser He Lys Val Ser Pro Tyr Leu Ser Gin Phe Gin Gtn 2145 2150 2155 2160

Asp Lys Gin Gtn Leu Vat Leu Gty Thr Lys Vat Ser Leu Val Glu Asn 2165 2170 2175

He His Val Leu Gly Lys Glu Gin Ala Ser Pro Lys Asn Vat Lys Met 2180 2185 2190

Glu He Gly Lys Thr Glu Thr Phe Ser Asp Val Pro Val Lys Thr Asn 2195 2200 2205

He Glu Vat Cys Ser Thr Tyr Ser Lys Asp Ser Glu Asn Tyr Phe Glu 2210 2215 2220

Thr Glu Ala Val Gtu He Ata Lys Ala Phe Met Glu Asp Asp Glu Leu 2225 2230 2235 2240

Thr Asp Ser Lys Leu Pro Ser His Ala Thr His Ser Leu Phe Thr Cys 2245 2250 2255

Pro Glu Asn Glu Glu Met Val Leu Ser Asn Ser Arg He Gly Lys Arg 2260 2265 2270

Arg Gly Glu Pro Leu He Leu Val Gly Glu Pro Ser He Lys Arg Asn 2275 2280 2285

Leu Leu Asn Glu Phe Asp Arg He He Gtu Asn Gin Glu Lys Ser Leu 2290 2295 2300

Lys Ala Ser Lys Ser Thr Pro Asp Gty Thr I le Lys Asp Arg Arg Leu 2305 2310 2315 2320

Phe Met His His Val Ser Leu Gtu Pro He Thr Cys Val Pro Phe Arg 2325 2330 2335

Thr Thr Lys Gtu Arg Gtn Glu He Gin Asn Pro Asn Phe Thr Ala Pro 2340 2345 2350

Gly Gin Glu Phe Leu Ser Lys Ser His Leu Tyr Glu His Leu Thr Leu 2355 2360 2365

Glu Lys Ser Ser Ser Asn Leu Ala Val Ser Gly His Pro Phe Tyr Gin 2370 2375 2380

Val Ser Ala Thr Arg Asn Glu Lys Met Arg His Leu He Thr Thr Gty 2385 2390 2395 2400

Arg Pro Thr Lys Vat Phe Val Pro Pro Phe Lys Thr Lys Ser His Phe 2405 2410 2415

His Arg Val Glu Gtn Cys Vat Arg Asn He Asn Leu Glu Glu Asn Arg 2420 2425 2430

Gin Lys Gin Asn He Asp Gly His Gly Ser Asp Asp Ser Lys Asn Lys 2435 2440 2445

He Asn Asp Asn Glu He His Gin Phe Asn Lys Asn Asn Ser Asn Gin 2450 2455 2460

Ata Ata Ata Vat Thr Phe Thr Lys Cys Glu Glu Glu Pro Leu Asp Leu 2465 2470 2475 2480 He Thr Ser Leu Gin Asn Ala Arg Asp He Gin Asp Met Arg He Lys 2485 2490 2495

Lys Lys Gin Arg Gin Arg Val Phe Pro Gtn Pro Gly Ser Leu Tyr Leu 2500 2505 2510

Ala Lys Thr Ser Thr Leu Pro Arg He Ser Leu Lys Ata Ata Vat Gly 2515 2520 2525

Gly Gin Val Pro Ser Ala Cys Ser His Lys Gin Leu Tyr Thr Tyr Gly 2530 2535 2540

Val Ser Lys His Cys He Lys He Asn Ser Lys Asn Ala Glu Ser Phe 2545 2550 2555 2560

Gin Phe His Thr Glu Asp Tyr Phe Gty Lys Glu Ser Leu Trp Thr Gty 2565 2570 2575

Lys Gty He Gin Leu Ala Asp Gly Gly Trp Leu He Pro Ser Asn Asp 2580 2585 2590

Gly Lys Ala Gly Lys Glu Glu Phe Tyr Arg Ala Leu Cys Asp Thr Pro 2595 2600 2605

Gty Val Asp Pro Lys Leu He Ser Arg He Trp Val Tyr Asn His Tyr 2610 2615 2620

Arg Trp He He Trp Lys Leu Ala Ala Met Glu Cys Ala Phe Pro Lys 2625 2630 2635 2640

Glu Phe Ala Asn Arg Cys Leu Ser Pro Glu Arg Val Leu Leu Gtn Leu 2645 2650 2655

Lys Tyr Arg Tyr Asp Thr Glu He Asp Arg Ser Arg Arg Ser Ala He 2660 2665 2670

Lys Lys He Met Glu Arg Asp Asp Thr Ala Ala Lys Thr Leu Val Leu 2675 2680 2685 Cys Val Ser Asp He He Ser Leu Ser Ala Asn He Ser Glu Thr Ser 2690 2695 2700

Ser Asn Lys Thr Ser Ser Ala Asp Thr Gin Lys Val Ala He He Glu 2705 2710 2715 2720

Leu Thr Asp Gly Trp Tyr Ala Val Lys Ala Gin Leu Asp Pro Pro Leu 2725 2730 2735

Leu Ala Val Leu Lys Asn Gly Arg Leu Thr Val Gly Gin Lys He He 2740 2745 2750

Leu His Gly Ala Glu Leu Val Gly Ser Pro Asp Ala Cys Thr Pro Leu 2755 2760 2765

Glu Ala Pro Gtu Ser Leu Met Leu Lys He Ser Ala Asn Ser Thr Arg 2770 2775 2780

Pro Ala Arg Trp Tyr Thr Lys Leu Gly Phe Phe Pro Asp Pro Arg Pro 2785 2790 2795 2800

Phe Pro Leu Pro Leu Ser Ser Leu Phe Ser Asp Gty Gly Asn Val Gly 2805 2810 2815

Cys Vat Asp Val He He Gin Arg Ala Tyr Pro He Gin Arg Met Glu 2820 2825 2830

Lys Thr Ser Ser Gly Leu Tyr He Phe Arg Asn Glu Arg Glu Glu Glu 2835 2840 2845

Lys Glu Ala Ata Lys Tyr Val Glu Ala Gin Gtn Lys Arg Leu Glu Ala 2850 2855 2860

Leu Phe Thr Lys He Gin Glu Gtu Phe Gtu Glu His Glu Gtu Asn Thr 2865 2870 2875 2880

Thr Lys Pro Tyr Leu Pro Ser Arg Ala Leu Thr Arg Gin Gin Val Arg

2885 2890 2895 Ala Leu Gtn Asp Gly Ala Glu Leu Tyr Glu Ala Val Lys Asn Ala Ata 2900 2905 2910

Asp Pro Ala Tyr Leu Glu Gly Tyr Phe Ser Glu Glu Gin Leu Arg Ala 2915 2920 2925

Leu Asn Asn His Arg Gin Met Leu Asn Asp Lys Lys Gin Ala Gin He 2930 2935 2940

Gtn Leu Glu He Arg Lys Ala Met Glu Ser Ala Glu Gin Lys Glu Gin 2945 2950 2955 2960

Gly Leu Ser Arg Asp Val Thr Thr Val Trp Lys Leu Arg He Val Ser 2965 2970 2975

Tyr Ser Lys Lys Gtu Lys Asp Ser Val He Leu Ser He Trp Arg Pro 2980 2985 2990

Ser Ser Asp Leu Tyr Ser Leu Leu Thr Glu Gly Lys Arg Tyr Arg He 2995 3000 3005

Tyr His Leu Ala Thr Ser Lys Ser Lys Ser Lys Ser Glu Arg Ata Asn 3010 3015 3020

He Gin Leu Ala Ala Thr Lys Lys Thr Gin Tyr Gin Gin Leu Pro Val 3025 3030 3035 3040

Ser Asp Glu He Leu Phe Gin He Tyr Gin Pro Arg Glu Pro Leu His

3045 3050 3055

Phe Ser Lys Phe Leu Asp Pro Asp Phe Gtn Pro Ser Cys Ser Gtu Val 3060 3065 3070

Asp Leu He Gly Phe Val Val Ser Val Val Lys Lys Thr Gly Leu Ala 3075 3080 3085

Pro Phe Val Tyr Leu Ser Asp Glu Cys Tyr Asn Leu Leu Ala He Lys 3090 3095 3100 Phe Trp He Asp Leu Asn Glu Asp He He Lys Pro His Met Leu He 3105 3110 3115 3120

Ala Ala Ser Asn Leu Gin Trp Arg Pro Gtu Ser Lys Ser Gly Leu Leu 3125 3130 3135

Thr Leu Phe Ala Gly Asp Phe Ser Val Phe Ser Ala Ser Pro Lys Glu 3140 3145 3150

Gly His Phe Gin Glu Thr Phe Asn Lys Met Lys Asn Thr Val Glu Asn 3155 3160 3165

He Asp He Leu Cys Asn Gtu Ata Gtu Asn Lys Leu Met His He Leu 3170 3175 3180

His Ala Asn Asp Pro Lys Trp Ser Thr Pro Thr Lys Asp Cys Thr Ser 3185 3190 3195 3200

Gly Pro Tyr Thr Ala Gin He He Pro Gly Thr Gly Asn Lys Leu Leu 3205 3210 3215

Met Ser Ser Pro Asn Cys Gtu He Tyr Tyr Gin Ser Pro Leu Ser Leu 3220 3225 3230

Cys Met Ala Lys Arg Lys Ser Vat Ser Thr Pro Vat Ser Ala Gin Met 3235 3240 3245

Thr Ser Lys Ser Cys Lys Gly Glu Lys Glu He Asp Asp Gtn Lys Asn 3250 3255 3260

Cys Lys Lys Arg Arg Ala Leu Asp Phe Leu Ser Arg Leu Pro Leu Pro 3265 3270 3275 3280

Pro Pro Vat Ser Pro He Cys Thr Phe Val Ser Pro Ala Ala Gin Lys 3285 3290 3295

Ala Phe Gin Pro Pro Arg Ser Cys Gly Thr Lys Tyr Gtu Thr Pro He 3300 3305 3310 Lys Lys Lys Glu Leu Asn Ser Pro Gtn Met Thr Pro Phe Lys Lys Phe 3315 3320 3325

Asn Glu He Ser Leu Leu Glu Ser Asn Ser He Ala Asp Glu Gtu Leu 3330 3335 3340

Ala Leu He Asn Thr Gin Ata Leu Leu Ser Gty Ser Thr Gly Glu Lys 3345 3350 3355 3360

Gin Phe He Ser Val Ser Gtu Ser Thr Arg Thr Ala Pro Thr Ser Ser 3365 3370 3375

Glu Asp Tyr Leu Arg Leu Lys Arg Arg Cys Thr Thr Ser Leu He Lys 3380 3385 3390

Glu Gin Gtu Ser Ser Gin Ata Ser Thr Gtu Glu Cys Glu Lys Asn Lys 3395 3400 3405

Gin Asp Thr He Thr Thr Lys Lys Tyr He 3410 3415

(2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19

(B) TYPE: amino acid (C) STRANDEDNESS: single

(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: no

(iv) ANTI-SENSE: no (v) ORIGINAL SOURCE

(A) ORGANISM: Homo sapiens sapiens

(C) INDIVIDUAL/ISOLATE:

(D) DEVELOPMENTAL STAGE: adult (F) TISSUE TYPE: female breast (G) CELL TYPE: normal breast tissue

(H) CELL LINE: HMEC (I) ORGANELLE: no (ix) FEATURE:

(A) NAME/KEY: BRCAl C-19 antigen

(B) LOCATION: 1845 to 1863 (C) IDENTIFICATION METHOD:

(D) OTHER INFORMATION: (x) PUBLICATION INFORMATION:

(A) AUTHORS:

(B) TITLE: (C) JOURNAL:

(D) VOLUME:

(E) PAGES:

(F) DATE:

(K) RELEVANT RESIDUES IN SEQ ID NO:5

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Tyr Gin Cys Gtn Glu Leu Asp Thr Tyr Leu He Pro Gin He Pro His 1 5 10 15

Ser His Tyr

(2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (iii) HYPOTHETICAL: no

(iv) ANTI-SENSE: no

(v) ORIGINAL SOURCE

(A) ORGANISM: Homo sapiens sapiens (C) INDIVIDUAL/ISOLATE: (D) DEVELOPMENTAL STAGE: adult

(F) TISSUE TYPE: female breast

(G) CELL TYPE: normal breast tissue (H) CELL LINE: HMEC (I) ORGANELLE: no (ix) FEATURE:

(A) NAME/KEY: BRCAl C-20 antigen

(B) LOCATION: 1844 to 1863 (C) IDENTIFICATION METHOD:

(D) OTHER INFORMATION: (x) PUBLICATION INFORMATION:

(A) AUTHORS:

(B) TITLE: (C) JOURNAL:

(D) VOLUME:

(E) PAGES:

(F) DATE:

(K) RELEVANT RESIDUES IN SEQ ID NO:6

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Leu Tyr Gin Cys Gtn Glu Leu Asp Thr Tyr Leu He Pro Gin He Pro 1 5 10 15

Hi s Ser Hi s Tyr 20

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20

(B) TYPE: amino acid

(C) STRANDEDNESS: single (D) TOPOLOGY: unknown

(ii) MOLECULE TYPE: peptide

(iii) HYPOTHETICAL: no

(iv) ANTI-SENSE: no

(v) ORIGINAL SOURCE (A) ORGANISM: Homo sapiens sapiens

(C) INDIVIDUAL/ISOLATE:

(D) DEVELOPMENTAL STAGE: adult (F) TISSUE TYPE: female breast (G) CELL TYPE: normal breast tissue (H) CELL LINE: HMEC (I) ORGANELLE: no (ix) FEATURE: (A) NAME/KEY: BRCAl D-20 antigen

(B) LOCATION: 1 to 20

(C) IDENTIFICATION METHOD:

(D) OTHER INFORMATION: (x) PUBLICATION INFORMATION: (A) AUTHORS:

(B) TITLE:

(C) JOURNAL:

(D) VOLUME:

(E) PAGES: (F) DATE:

(K) RELEVANT RESIDUES IN SEQ ID NO: 7

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Met Asp Leu Ser Ala Leu Arg Val Glu Glu Val Gin Asn Val He Asn

1 5 10 15

Ala Met Gin Lys 20

Thus, although there have been described particular embodiments of the present invention of a new and useful Characterized BRCAl and BRCA2 Proteins and Screening and Therapeutic Methods Based on Characterized BRCAl and BRCA2 Proteins, it is not intended that such references be construed as limitations upon the scope of this invention except as set forth in the following claims. Further, although there have been described certain examples used in the preferred embodiment, it is not intended that such examples be construed as limitations upon the scope of this invention except as set forth in the following claims.

Claims

CLAIMS What is claimed is:

1. A method for isolating a receptor for the BRCAl protein, the method comprising the steps of:

5 (a) contacting cells or cell lysates having the BRCAl receptor with

BRCAl; and

(b) isolating the receptor which binds with BRCAl .

2. The method according to claim 1 wherein the cells having the BRCAl receptor are identified by the steps of: o (a) labelling the BRCA 1 ;

(b) screening cell cultures with the labelled BRCAl ; and

(c) isolating cells that bind an elevated amount of the labelled BRCAl.

3. The method according to claim 2 wherein the BRCAl receptor 5 is isolated by lysing the cells and passing the cell lysate over a column containing the BRCAl bound to a solid phase matrix within the column.

4. The method according to claim 2 wherein the BRCAl receptor is isolated by constructing a cDNA library from the cells binding the BRCAl receptor; transfecting the cDNA library into a cell line that does not exhibit 0 binding of the BRCAl receptor; screening the cell line for newly acquired specific binding; isolating DNA from cells exhibiting specific binding; and sequencing the isolated DNA to determine the DNA sequence for the BRCAl receptor.

5. The method according to claim 2 wherein the BRCAl is labelled by binding the BRCAl to a immunoglobulin.

6. The method according to claim 5 wherein the BRCAl receptor is isolated by immunoprecipitation of the BRCAl receptor-BRCAl- immunoglobulin complex.

7. The method according to claim 5 wherein the BRCAl receptor is isolated using flow cytometry.

8. A method of treating breast or ovarian cancer in a patient, the method comprising the step of administering a therapeutically effective amount of a BRCAl targeted growth inhibitor agent so that the agent contacts a receptor on the surface of breast or ovarian cancer cells in the patient.

9. A method of treating breast or ovarian cancer in a patient, the method comprising the steps of: (a) ligating a gene that encodes the BRCAl receptor with a promoter capable of inducing expression of the gene in a breast or ovarian cancer cell;

(b) introducing the ligated gene into a breast or ovarian cancer cell in the patient; and

(c) administering a therapeutically effective amount of a targeted growth inhibitor agent so that the agent contacts a BRCAl receptor on a surface of the breast or ovarian cancer cells in the patient.

10. A method of treating breast or ovarian cancer in a patient, the method comprising the steps of:

(a) isolating a gene that encodes the BRCAl receptor;

(b) ligating the gene that encodes the BRCAl receptor with a promoter capable of inducing expression of the gene in a breast or ovarian cancer cell; (c) introducing the ligated gene into a breast or ovarian cancer cell in the patient; and

(d) administering a therapeutically effective amount of a targeted growth inhibitor agent so that the agent contacts a BRCAl receptor on a surface of the breast or ovarian cancer cells in the patient.

11. A method for identifying compounds which mimic a peptide structure of a BRCAl protein comprising a carboxy terminal sequence substantially identical to the carboxy teπrύnal sequence of an amino acid sequence as essentially set forth in SEQ ID NO: 2 and having the following characteristic: molecular weight of substantially 190 kDa as determined by non-reduced sodium dodecylsulfate polyacrylamide gel electrophoresis, the method comprising the steps of: a. determining domains of the protein that are essential for growth inhibitor activity; b. analyzing structure and function of the domains of the protein that are essential for growth inhibitor activity; c. comparing the structure and function of the domains of the protein that are essential for growth inhibitor activity to other compounds; and d. deterπύning which compounds have structure so as to mimic the structure and function of the agent.

12. A method of treating ovarian cancer in a patient comprising the steps of ligating a gene that encodes a protein having an amino acid sequence as essentially set forth in SEQ ID NO:2 with a promoter capable of inducing expression of the gene in a ovarian cancer cell and introducing the ligated gene into a ovarian cancer cell.

13. The method of treating ovarian cancer described in claim 12 wherein the gene has a DNA sequence selected from among:

(a) the DNA sequence as essentially set forth in SEQ ID NO: l or its complementary strands;

(b) a DNA sequence which hybridizes to SEQ ID NO: l or fragments thereof; and (c) DNA sequences which but for the degeneracy of the genetic code would hybridize to the DNA sequences defined in (a) and (b).

14. The method of treating ovarian cancer described in claim 12 wherein the gene has a DNA sequence having 20-99% homology with SEQ ID NO: l.

15. The method according to claim 12 wherein the ligated gene is introduced into the cell in a viral expression vector.

16. The method according to claim 12 wherein the ovarian cancer is gene-linked hereditary ovarian cancer.

17. The method described in claim 12 wherein the ovarian cancer is sporadic ovarian cancer.

18. A method of treating breast cancer in a patient comprising the steps of ligating a gene that encodes a protein having an amino acid sequence as essentially set forth in SEQ ID NO: 4 with a promoter capable of inducing expression of the gene in a breast cancer cell and introducing the ligated gene into a breast cancer cell.

19. The method of treating breast cancer described in claim 18 wherein the gene has a DNA sequence selected from among:

(a) the DNA sequence as essentially set forth in SEQ ID NO: 3 or its complementary strands;

(b) a DNA sequence which hybridizes to SEQ ID NO: 3 or fragments thereof; and

(c) DNA sequences which but for the degeneracy of the genetic code would hybridize to the DNA sequences defined in (a) and (b).

20. The method of treating breast cancer described in claim 18 wherein the gene has a DNA sequence having 20-99% homology with SEQ ID NO:3.

21. The method according to claim 18 wherein the ligated gene is introduced into the cell in a viral expression vector.

22. The method according to claim 18 wherein the breast cancer is gene-linked hereditary breast cancer.

23. The method described in claim 18 wherein the breast cancer is sporadic breast cancer.

24. A method of treating ovarian cancer in a patient comprising the steps of ligating a gene that encodes a protein having an amino acid sequence as essentially set forth in SEQ ID NO: 4 with a promoter capable of inducing expression of the gene in a ovarian cancer cell and introducing the ligated gene into a ovarian cancer cell.

25. The method of treating ovarian cancer described in claim 24 wherein the gene has a DNA sequence selected from among: (a) the DNA sequence as essentially set forth in SEQ ID NO: 3 or its complementary strands;

(b) a DNA sequence which hybridizes to SEQ ID NO: 3 or fragments thereof; and

(c) DNA sequences which but for the degeneracy of the genetic code would hybridize to the DNA sequences defined in (a) and

(b).

26. The method of treating ovarian cancer described in claim 24 wherein the gene has a DNA sequence having 20-99% homology with SEQ ID NO:3.

27. The method according to claim 24 wherein the ligated gene is introduced into the cell in a viral expression vector.

28. The method according to claim 24 wherein the ovarian cancer is gene-linked hereditary ovarian cancer.

29. The method described in claim 24 wherein the ovarian cancer is sporadic ovarian cancer.

30. A method of treating breast or ovarian cancer comprising the steps of:

(a) incubating a liposome preparation with a DNA segment that encodes the protein as essentially set forth in SEQ ID NO: 2 or with a DNA segment that encodes the protein as essentially set forth in SEQ ID NO:4; (b) transfecting a breast or ovarian cancer cell with the DNA liposome complex of step (a).

31. The method according to claim 30 wherein the liposome preparation is a cationic liposome preparation. 5

32. A method of treating breast or ovarian cancer comprising the steps of:

(a) delivering anti-sense BRCAl DNA or anti-sense BRCA2 DNA to breast or ovarian cancer cells within a patient; and

(b) administering a therapeutically effective amount of a o chemotherapeutic drug to the patient.

33. A method for isolating a cellular receptor for the BRCA2 protein, the method comprising the steps of:

(a) contacting cells and cell lysates having the BRCA2 receptor with a protein having an amino acid sequence as essentially set forth in SEQ 5 ID NO:4; and

(b) isolating the receptor that binds the protein.

34. The method according to claim 33 wherein cells having the BRCA2 receptor are identified by the steps of:

(a) labelling the protein as essentially set forth in SEQ ID NO:4; 0 (b) screening cell cultures with the labelled protein; and

(d) isolating cells that bind an elevated amount of the labelled protein.

35. The method according to claim 34 wherein the BRCA2 receptor is isolated by lysing the cells and isolating the BRCA2 receptor by passing the cell lysate over a column containing the protein as essentially set forth in SEQ

ID NO: 4 bound to a solid phase matrix within the column.

36. The method according to claim 34 wherein the BRCA2 receptor is isolated by constructing a cDNA library from the cells expressing high levels of BRCA2 receptor; transfecting the cDNA library into a cell line that does not exhibit binding of the protein as essentially set forth in SEQ ID NO: 4 to a receptor; screening the cell line for newly acquired specific binding; isolating DNA from cells exhibiting specific binding; and sequencing the isolated DNA to determine the DNA sequence for the BRCA2 receptor.

37. The method according to claim 34 wherein the protein is labelled by binding the protein to a immunoglobulin.

38. The method according to claim 37 wherein the BRCA2 receptor is isolated by immunoprecipitation of the BRCA2 receptor-protein- immunoglobulin complex.

39. The method according to claim 37 wherein the BRCA2 receptor is isolated using flow cytometry.

40. A cleavage product of BRCAl wherein the cleavage product comprises a carboxy terminal sequence substantially identical to the carboxy terminal sequence of a protein having an amino acid sequence as essentially set forth in SEQ ID NO:2 and has the following characteristic: molecular weight of substantially 70 kDa as determined by non-reduced sodium dodecylsulfate polyacrylamide gel electrophoresis.

41. The cleavage product according to claim 40 having the following additional characteristics:

(a) cross-reacts with antisera against the protein having an amino acid sequence as essentially set forth in SEQ ID NO:2, and

(b) addition of a peptide derived from the carboxy terminal sequence of the protein having an amino acid sequence as essentially set forth in SEQ ID NO: 2 blocks cross-reaction with antisera against the protein having an amino acid sequence as essentially set forth in SEQ ID NO.2.

42. The cleavage product according to claim 40 where the cleavage product has a amino acid sequence that includes a granin box domain.

43. The cleavage product according to claim 40 wherein the cleavage product has the following additional characteristic: is localized in the nuclear fraction of breast epithelial cells.

44. An expression vector comprising a DNA segment encoding the cleavage product in claim 40.

45. A process for the production of a recombinant host cell comprising inserting therein the expression vector according to claim 45.

46. A recombinant host cell produced by the process of claim 45.

47. A process for producing a BRCAl cleavage product which comprises culturing a recombinant host cell, said recombinant host cell including the expression vector described in claim 44, in a suitable nutrient medium until the targeted growth inhibitor agent is formed and thereafter isolating the agent.

48. The method of claim 8, wherein the breast or ovarian cancer is sporadic breast or ovarian cancer.

49. The method of claim 8, wherein the BRCAl targeted growth inhibitor agent is BRCAl as essentially set forth in SEQ ID NO: 2.

50. A purified and isolated receptor which occurs on the surface of breast or ovarian epithelial cells and which is bound by BRCAl .

51. A method of screening a compound for tumor suppressor activity comprising contacting the compounds with the receptor of claim 50, a compound which binds the receptor indicating a compound having potential tumor suppressor activity.

52. The method of claim 51, wherein the compound is a BRCAl cleavage fragment.

53. The method of claim 51, wherein the receptor is expressed on the surface of a cell.

54. A purified and isolated receptor which occurs on the surface of breast or ovarian epithelial cells and which is bound by BRCA2.

55. A method of screening a compound for tumor suppressor activity comprising contacting the compounds with the receptor of claim 54, a compound which binds the receptor indicating a compound having potential tumor suppressor activity.

56. The method of claim 55, wherein the compound is a BRCA2 cleavage product.

57. The method of claim 55, wherein the receptor is expressed on the surface of a cell.

58. A protein having tumor suppressor activity and comprising a granin box consensus sequence shown in figure 5 wherein the protein is not the BRCAl or BRCA2.

59. The protein of claim 58, wherein the tumor suppressor activity is specific for breast and ovarian cancer.

60. A method of preventing sporadic breast or ovarian cancer in a patient, the method comprising administering a prophylactically effective amount of a BRCAl or BRCA2 targeted growth inhibitor agent so that the agent contacts a receptor on the surface of breast or ovarian cancer cells in the patient and prevents sporadic breast or ovarian cancer.

61. The method of claim 60, wherein the cancer is prevented by administering a BRCAl targeted growth inhibitor agent.

62. The method of claim 61, wherein the BRCAl targeted growth inhibitor agent is BRCAl as essentially set forth in SEQ ID NO: 2.

63. The method of claim 60, wherein the cancer is prevented by administering a BRCA2 targeted growth inhibitor agent.

64. The method of claim 63, wherein the BRCA2 targeted growth inhibitor agent is BRCA2 as essentially set forth in SEQ ID NO: 4.

65. A method of treating breast or ovarian cancer in patient, the method comprising the step of administering a therapeutically effective amount of a BRCA2 targeted growth inhibitor agent so that the agent contacts a receptor on the surface of breast or ovarian cancer cells in the patient.

66. The method of claim 65, wherein the breast or ovarian cancer is sporadic breast or ovarian cancer.

67. The method of claim 65, wherein the BRCA2 targeted growth inhibitor agent is BRCA2 as essentially set forth in SEQ ID NO: 4.

68. A method of treating breast or ovarian cancer in a patient, the method comprising the step of administering a therapeutically effective amount of a compound which binds the receptor for either BRCAl or BRCA2 and acts as an agonist of the tumor suppressor activity.