WO1997039106A1 - Methods and tools for transformation of eukaryotic algae - Google Patents

Methods and tools for transformation of eukaryotic algae Download PDF

Info

Publication number
WO1997039106A1
WO1997039106A1 PCT/US1997/006021 US9706021W WO9739106A1 WO 1997039106 A1 WO1997039106 A1 WO 1997039106A1 US 9706021 W US9706021 W US 9706021W WO 9739106 A1 WO9739106 A1 WO 9739106A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
genetic fusion
dna
cells
algae
Prior art date
Application number
PCT/US1997/006021
Other languages
French (fr)
Inventor
F. C. Thomas Allnutt
David Kyle
Arthur R. Grossman
Kirk Apt
Original Assignee
Martek Biosciences Corporation
Carnegie Institution Of Washington
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Martek Biosciences Corporation, Carnegie Institution Of Washington filed Critical Martek Biosciences Corporation
Priority to US09/155,972 priority Critical patent/US6027900A/en
Publication of WO1997039106A1 publication Critical patent/WO1997039106A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers

Definitions

  • Algae have the potential to be used in high density photobioreactors (Lee et al , 1994, “High density algal photobioreactors using light emitting diodes” Biotech. Bioengineermg, 44, 1 161- 1 167, Chaumont, 1990, "Biotechnology of algal biomass production A review of systems for outdoor mass culture,” J. Appl.
  • a genetic fusion is provided The genetic fusion consists of a promoter of a photosynthetic algal light harvesting protein 5' and fused to a coding sequence of one or more additional proteins
  • a method of transforming eukaryotic algae comprises the steps of introducing DNA to eukaryotic algae, wherein the DNA contains a zeocin resistance determinant, and selecting for eukaryotic algae transformants by culturing in a medium comprising between about 10 and about 35 g/L salt and a concentration of zeocin or phleomycin which is inhibitory to untransformed eukaryotic algae
  • the present inventors have discovered that eukaryotic algae can be transformed with DNA using zeocin resistance as a selectable marker for transformants Use of this and related antibiotics is desirable because they can be used in the presence of salt water; other antibiotics and herbicides tested are not effective in the presence of concentrations of salt present in natural salt water.
  • the present inventors have also discovered that promoters for genes encoding light harvesting proteins can be used to drive expression of exogenous DNA introduced into algae. Because light harvesting proteins are expressed abundantly in photosynthetic algae, their promoters drive robust expression. Based on these discoveries, the present invention provides various embodiments which will be described in more detail below, and these embodiments, alone or in combination provide the art with means to genetically manipulate algae and various marine organisms to modify their properties in desirable ways.
  • Figure 1 presents a map of restriction enzyme sites in the fcp/ble gene fusion cassette.
  • the coding region ofthe sh ble gene was inserted between the EcoRV and Hindlll sites of the P. tricornutum fcpA gene.
  • the transcription start site of the endogenous fcpA is marked by an arrow.
  • the entire cassette is inserted into Bluescript SK- and designated pfcp/ble.
  • FIG 2 shows the results of Southern analysis of seven P. tricornutum zeocin resistant strains (A-G). Total DNA was digested with Bgl II, EcoRI or Sail to completion. The digested DNA was electrophoresed and blotted using standard procedures. The resulting DNA blot was probed with radioactive pfcp/ble. The hybridizing band containing the endogenous fcpA gene for each set of samples is marked by an arrow. Additional hybridizing bands indicate inserted copies of pfcp/ble into the genome. DNA from wild-type cells is not included on this blot.
  • Figure 3 shows the results of Western analysis of seven P. tricornutum zeocin-resistant strains (A-G).
  • a "chimeric DNA” is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the chimeric DNA encodes a protein segment, the segment coding sequence will be flanked by DNA that does not flank the coding sequence in any naturally occurring genome. Allelic variations or naturally occurring mutational events do not give rise to a chimeric DNA as defined herein.
  • a "coding sequence” is an in-frame sequence of codons that (in view ofthe genetic code) correspond to or encode a protein or peptide sequence. Two coding sequences correspond to each other if the sequences or their complementary sequences encode the same amino acid sequences. A coding sequence in association with appropriate regulatory sequences may be transcribed and translated into a polypeptide in vivo. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • a “promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • a coding sequence is "under the control" ofthe promoter sequence in a cell when RNA polymerase which binds the promoter sequence transcribes the coding sequence into mRNA which is then in turn translated into the protein encoded by the coding sequence.
  • the promoter sequence is bounded at its 3' terminus by the translation start codon of a coding sequence and extends upstream (5' direction) to include at least the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • promoter sequence Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S 1 ), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase Promoters will usually contain additional consensus sequences (promoter elements) for more efficient initiation and transcription of downstream genes.
  • a “genetic fusion” is a chimeric DNA containing a promoter and a coding sequence that are not associated in nature.
  • a “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control.
  • Vectors are used to introduce a foreign substance, such as DNA, RNA or protein, into an organism.
  • a "DNA vector” is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication ofthe attached segment.
  • a cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell wall.
  • Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome ofthe cell.
  • the exogenous DNA may be maintained on an extrachromosomal element (or replicon) such as a plasmid.
  • a stably transformed cell is one in which the exogenous DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability ofthe cell to establish cell lines or clones comprised entirely of a population of daughter cells containing the exogenous DNA.
  • Salt refers to an inorganic ionic compound which is commonly found in sea water or a mixture of such compounds.
  • concentration of salt is expressed herein as the amount of such compounds that provide the ionic equivalent to a given weight of sodium chloride.
  • the salt concentration of seawater is about 32-33 g/L.
  • Transformed cells are produced by introducing exogenous DNA into a population of target cells and selecting the cells which have taken up the exogenous DNA, usually by measuring expression of some determinant present on the exogenous DNA but missing from the untransformed cells. Transformation of algae and marine organisms is complicated by lack of selection systems which are effective in salt water media. The difficulty is overcome in accordance with this invention by using zeocin resistance as a selective marker, because resistance to zeocin (and related antibiotics) has been discovered to be maintained in high salt medium to a much greater extent than is observed for other antibiotic resistance genes. Thus, transformants containing exogenous DNA with a zeocin resistance determinant will grow in salt water in the presence of suitable concentrations of zeocin, while untransformed cells of marine organisms will not.
  • This invention is provides improved methods for transformation of cells and selection of transformants from marine organisms, which may be multicelled marine organisms, including marine plants, or marine microorganisms.
  • Marine microorganisms within the contemplation ofthis invention include marine bacteria, marine fungi, and marine algae, including marine diatoms.
  • this invention also contemplates use ofthe transformation system for transformation of halobacteria.
  • this invention provides particularly effective promoters for driving expression of foreign genes in cells of photosynthetic algae, including cells of marine algae.
  • the basic techniques used for transformation and expression in algal systems and marine organisms are the same as those commonly used for Escherichia coli, Saccharomyces cerevisiae and other species which are routinely transformed.
  • the upstream DNA sequences of a gene expressed under control of a suitable promoter may be restriction mapped and areas important for the expression ofthe protein characterized.
  • the exact location ofthe start codon ofthe gene is determined and, making use of this information and the restriction map, a vector may be designed for expression of a heterologous protein by removing the region responsible for encoding the gene's protein but leaving the upstream region found to contain the genetic material responsible for control ofthe gene's expression.
  • a synthetic oligonucleotide is preferably inserted in the location where the protein sequence once was, such that any additional gene could be cloned in using restriction endonuclease sites in the synthetic oligonucleotide (i.e., a multicloning site).
  • an unrelated gene (or coding sequence) inserted at this site would then be under the control of an extant start codon and upstream regulatory region that will drive expression of the foreign (i.e., not normally there) protein encoded by this gene.
  • the gene for the foreign protein Once the gene for the foreign protein is put into a cloning vector, it can be introduced into the host organism using any of several methods, some of which might be particular to the host organism. Variations on these methods are amply described in the general literature references above. Manipulation of conditions to optimize transformation for a particular host is within the skill ofthe art.
  • the promoter from a gene associated with photosynthesis in one photosynthetic species may be used to direct expression of a protein in transformed algal cells or cells of another photosynthetic marine organism.
  • Suitable promoters may be isolated from or synthesized based on known sequences from other photosynthetic organisms.
  • Preferred promoters are those for genes from other photosynthetic species, including other algae and cyanobacteria, which are homologous to the photosynthetic genes ofthe algal host to be transformed (see, e.g., Table 1).
  • homologous light harvesting gene For a particular algal host, it may be preferable to identify the homologous light harvesting gene from that host and isolate the homologous promoter from the host organism to get optimal expression.
  • foreign promoters give excellent or less restricted expression in the host relative to the homologous promoter of the host organism (Mermet-Bovier, et al., 1993, Curr. Microbiol., I ⁇ -.ll'S-'Sll).
  • the promoter of an algal light harvesting protein such as a chlorophyll binding protein's promoter
  • a coding sequence whose expression is desired.
  • a fucoxanthin chlorophyll binding protein promoter is used.
  • a carotenoid chlorophyll binding protein promoter such as that of peridinin chlorophyll binding protein, can be used.
  • the promoter may come from any eukaryotic algae which has light harvesting protein complexes. For example, brown algae or diatoms may be the source ofthe promoter.
  • the Phaeodactylum tricornutum fcpA promoter is used. (Bhaya and Grossman (1993), "Characterization of gene clusters encoding the fucoxanthin chlorophyll proteins of the diatom Phaeodactylum tricornutum,” Nucleic Acids Research, 21 :4458-4464).
  • reporter genes can be linked to a promoter. The linked construct is inserted into the alga and the expression ofthe reporter is gauged. Any gene whose mRNA or protein product can be easily measured can be used. Downstream or 3' ofthe light harvesting protein promoter are fused one or more additional protein coding sequences.
  • Coding sequences for single proteins can be used, as well as coding sequences for fusions of two or more proteins
  • a selectable marker and another sequence which one desires to introduce may be introduced fused to and downstream of a single light harvesting protein promoter.
  • two protein coding sequences can be introduced, each under the control of a light harvesting promoter located on a single molecule
  • Sh ble gene which encodes the bleomycin binding protein from Streptoalloteichus hindustanus.
  • Zeocin and phleomycin have been found to be particularly potent in inhibition of the growth of eukaryotic algae, especially in the presence of high concentrations of salt, especially concentrations above 3 g/L
  • Typical salt concentrations in growth media for marine algae are between about 10 and about 35 g/L, and more preferably between about 15-34 g/L (Sea water contains about 32 to 33 g/L of salt )
  • the Sh ble protein confers zeocin resistance on algal cells Zeocin or phleomcyin or other related antibiotics can be used interchangeably for selection with this marker
  • the sh ble gene has been found to function as a resistance determinant in algae, and use ofthe sh ble gene on transforming DNA in combination with a zeocin or phleomycin-type selection affords a convenient selection
  • the sh ble gene is regulated by a promoter of a chlorophyll binding protein.
  • Suitable promoters include the fcpA, fcpB,fcpC, andfcpE promoters, as well as any Ihc promoter
  • Other promoters that may be used in genetic fusion constructs for transforming cells of photosynthetic organisms are listed in Table 1 Additional suitable promoters for use with these and other marine organisms are listed in Table 2, and other suitable promoters which are apparent to the skilled worker may be used in the selection system ofthis invention
  • nopaline synthase promoter and polyadenylation sequences from the Ti plasmid of Agrobacterium tumefaciens See Hall et al (1993) "Expression of a foreign gene in Chlamydomonas reinhardtii” Gene 124 75-81
  • the promoter region of the tubB2 gene from Chlamydomonas reinhardtii See Davies et al. (1992) "Expression ofthe arylsulfatase gene from the B2-tubuhn promoter in Chlamydomonas reinhardtii" Nucl.
  • hexose uptake protein HUP
  • glucose metabolism enzymes or other useful products made by the recipient or other donor organisms may be used.
  • the genes for glucuronidase or green fluorescent protein can be used as reporter genes.
  • the genetic fusion ofthe present invention may be introduced into cells of marine organisms or eukaryotic algae alone or as part of a DNA vector. Suitable vectors for use in marine organisms or eukaryotic algae are known in the art and any such vector may be used.
  • vectors which do not replicate in algae can be useful, if recombination between the vector and the genome occurs.
  • Any method for introduction ofthe fusion construct into marine organisms and algae may be used.
  • one particularly preferred method involves the use of DNA-coated particle bombardment.
  • Another useful method involves vigorous agitation in the presence of glass beads, which renders some of the algal cells permeable to nucleic acids.
  • the methods of the present invention are particularly useful for the modification of algae to render them more susceptible to labeling with compounds which are labeled with stable isotopes.
  • stable isotopically labeled amino acids, sugars, carboxylic acids, or other reduced carbon compounds can be used to label algae.
  • the uptake by the cells of these labeled compounds is inefficient.
  • the practice of the present invention will allow enhancement of the uptake of these labeled compounds by producing transformed photosynthetic algae having increased levels of transporter proteins specific for particular reduced carbon compounds, thereby improving the permeability of the cells to these compounds Incorporation of such labeled compounds into algal metabolites is useful for structural determinations ofthe metabolites.
  • Growth of algae in salt concentrations of between 10 and about 35 g/L is often necessary to maintain viability of non-habituated, salt water algae.
  • use of zeocin-type antibiotics for selection of transformants provides the art with a benefit, since the toxicity of other antibiotics decreases more rapidly with increasing salt concentration, and thus other antibiotic selections do not work in the presence of high salt.
  • Zeocin-based selection is particularly useful to avoid the need to habituate algae to low salt concentrations, as well as to allow selection of algae which cannot be habituated.
  • transformed algae produced according to the method of this invention may be fully adapted to growth in high salt media.
  • this invention provides a method for production of desired proteins in high salt medium by culture of algal cells transformed according to this invention with DNA containing the coding sequence ofthe desired protein under the control of a suitable promoter.
  • the desired proteins can be produced in cultures of algae grown under salt conditions more optimal for growth of the microbes and recovered by standard protein recovery methods suitable for the desired protein.
  • Phaeodactylum tricornutum was insensitive to most of the common antibiotics for which resistance genes are available, under the growth conditions utilized (Table 3). Some antibiotics such as puromycin and chloramphenicol required very high concentrations for cell death compared to other eukaryotic organisms and were thus not suitable for selection. No sensitivity was observed for any of the herbicides used in plant transformation even when used at 1000 times higher concentrations then needed to cause plant cell death. Only zeocin and phleomycin resulted in cell death at low concentrations. Zeocin was utilized for subsequent selection.
  • Phaeodactylum tricornutum Bohlin (University of Texas Culture Collection, strain 646) was grown at 24°C with continuous illumination at 100 ⁇ Em ' Y 1 on LDM media containing 1.2% agar. Liquid cultures were bubbled with air containing 1 % CO 2 and grown in f/2 media, supplemented with 2 times the normal levels of nitrate and phosphate.
  • Example 2 Use of a zeocin resistance gene as a selective marker.
  • this example also demonstrates the use of a promoter for a chlorophyll binding protein to drive exogenous gene expression.
  • Zeocin is a member ofthe phleomycin family of structurally related antibiotics isolated from Streptomyces (Berdy (1980), "Bleomycin-Type Antibiotics". In: Berdy, J (ed) Handbook of Antibiotic Compounds. Vol. IV, Part L Ammo acid and Peptide Antibiotics. CRC Press, Boca Raton, FL pp 459-497)
  • These antibiotics are small glycopeptides that differ by their terminal amine residues and are commonly chelated to copper in commercial preparations They are effective at low concentration against bacteria and a wide variety of eukaryotic organisms (a complete reference list of all known applications is available)
  • the mode by which these antibiotics cause cell death involves binding to and cleavage of DNA
  • the Sh ble protein (13 kDa) is a binding protein with a strong affinity for the phleomycin family of antibiotics When zeocin is bound by the Sh ble protein it is no longer active in cleaving the cellular DNA Upon introduction of this gene into P. tricornutum cells, it is possible to recover transformants that are able to grow on zeocin
  • the promoter and terminator regions of the fcpA, B, C, and E genes of P. tricornutum were fused onto the sh ble gene (Fig 1 )
  • the plasmid pfcpA was constructed by subcloning the fcpA PstlKpnl fragment (Bhaya and Grossman, 1993, supra) into Bluescript SK( Stratagene)
  • the sh ble gene was PCR amplified from p U T 3 6 2 ( C a y l a ) u s i n g p r i m e r s B l e - R 5
  • the fcpA/ble gene fusion was constructed by inserting the sh ble PCR generated fragment between the EcoRV and HindLU sites of the fcpA gene The entire 5' untranslated region ofthe resulting gene fusion was identical to the endogenous fcpA gene
  • the plasmid containing the chimeric gene was used to coat tungsten particles which were bombarded into the cells Super-coiled (S C ) or linear plasmid DNA (cut with Kpnl) from pfcp/ble was used for bombardments Cells were bombarded using the BIO-RAD BIOLISTIC PDS-1000/HETM particle delivery system fitted with 1,100, 1,350 or 1,500 psi rupture discs. Tungsten particles M5, M17 (0.4 or 1.1 ⁇ m median diameter, respectively) or gold particles (1.0 ⁇ m diameter) were coated with 0.8 ⁇ m plasmid DNA/bombardment using CaCl 2 and spermidine as described by the manufacturer.
  • the results obtained under different experimental conditions used for transformation are outlined in Table 4.
  • the largest number of resistant colonies was obtained by placing the petri dishes containing cells at level two ofthe BIOLISTICTM device. Only a small number of resistant colonies were obtained by placing the cells at level three.
  • the size of the particles has a significant effect on the number of resistant colonies recovered, with the larger Ml 7 tungsten particles (1.1 ⁇ m median diameter) being the best. Pressure effects were most pronounced with the smaller particles. Higher frequencies of transformation were observed with supercoiled DNA versus linear DNA. No resistant colonies were recovered or observed in the no DNA controls. TABLE 4. Recovery of resistant colonies using different transformation conditions.
  • the Sh ble protein was also present in all the resistant strains (A-G); it was undetectable in nontransformed cells (Fig. 3)
  • the level of Sh ble protein determined immunologically was extremely variable, ranging from ⁇ 1 ng to > 20 ng/10 ⁇ g total cell protein

Abstract

Genetic fusions for use in genetic engineering of eukaryotic algae employ a promoter from a light harvesting protein fused to a protein of interest. The fusions can be introduced and selected using an antibiotic resistance determinant. One gene useful for such selection is the sh ble gene encoding a bleomycin binding protein.

Description

METHODS AND TOOLS FOR TRANSFORMATION OF EUKARYOTIC ALGAE
BACKGROUND OF THE INVENTION The importance of algae as a resource for new products in both the present and the future cannot be overemphasized (Cannell, 1990, "Algal Biotechnology," Applied Biochemistry and Biotechnology, 26, 85-106) Algae have the potential to be used in high density photobioreactors (Lee et al , 1994, "High density algal photobioreactors using light emitting diodes" Biotech. Bioengineermg, 44, 1 161- 1 167, Chaumont, 1990, "Biotechnology of algal biomass production A review of systems for outdoor mass culture," J. Appl. Phycology 5, 593-604), bioreactors for sewage (Sawayama et al , 1994, "Continuous cultures of hydrocarbon-rich rrucroalga Botryococcus braunu in secondarily treated sewage," Appl. Micro. Biotech , 41, 729- 731, Lincoln, 1993, Bulletin De L'mstitut Oceangraphque (Monaco), 12, 109-115) and waste water treatments, elimination of heavy metals from contaminated water (Wilkinson, 1989, "Mercury accumulation and volatilization in immobilized algal cell systems," Biotech. Letters, 11, 861-864), the production of β-carotene (Yamaoka, 1994, Seώutsu-Kogaku Kaishi, 72, 111-114) and pharmaceutical compounds (Cannell, 1990), as nutritional supplements for both humans and animals (Becker, 1993, "Development of Spirulina research in a developing country India" Bulletin De L'mstitut Oceanographique (Monaco), 12, 141-155) and for the production of other compounds of nutritional value None of these areas has been adequately explored and exploited at this time The full potential of algae can only be fully developed with an increase in our ability to genetically tailor algae for specific purposes Genetic engineering can potentially be used to improve the productivity of algae Unfortunately, until recently most algae were refractory to any type of genetic manipulation, this especially true for the eukaryotic algae The molecular biological manipulation of algal systems has thus seriously lagged behind other systems Many ofthe techniques that have been developed for the introduction of DNA into bacterial, yeast, insect and animal cells have not been adapted to algal systems
Algal synthesis of valuable molecules on a large scale requires precise methods to enhance the quantity and quality of the product being made, either by changing what is being produced or producing more of a desirable substance The only way this can be accomplished, in an economical manner, is by molecular biological manipulation Previous academic investigations used a small number model algal species that have little possible use in a production mode (i e , Chlamydomonas reinhartii and Synechococcus sp. PCC 7942), their choice dictated by special characteristics that have little to do with commercial utility
Thus, there is a need for new methods and tools for use in the genetic engineering of eukaryotic algae in order to manufacture products SUMMARY OF THE INVENTION It is an object of the invention to provide a genetic fusion for selection or expression in algae
It is another object of the invention to provide DNA vectors and cells comprising the genetic fusions
It is yet another object ofthe invention to provide methods of transforming eukaryotic algae
These and other objects ofthe invention are provided by one or more ofthe following embodiments In one embodiment of the invention, a genetic fusion is provided The genetic fusion consists of a promoter of a photosynthetic algal light harvesting protein 5' and fused to a coding sequence of one or more additional proteins
In another embodiment ofthe invention a method of transforming eukaryotic algae is provided The method comprises the steps of introducing DNA to eukaryotic algae, wherein the DNA contains a zeocin resistance determinant, and selecting for eukaryotic algae transformants by culturing in a medium comprising between about 10 and about 35 g/L salt and a concentration of zeocin or phleomycin which is inhibitory to untransformed eukaryotic algae
The present inventors have discovered that eukaryotic algae can be transformed with DNA using zeocin resistance as a selectable marker for transformants Use of this and related antibiotics is desirable because they can be used in the presence of salt water; other antibiotics and herbicides tested are not effective in the presence of concentrations of salt present in natural salt water. The present inventors have also discovered that promoters for genes encoding light harvesting proteins can be used to drive expression of exogenous DNA introduced into algae. Because light harvesting proteins are expressed abundantly in photosynthetic algae, their promoters drive robust expression. Based on these discoveries, the present invention provides various embodiments which will be described in more detail below, and these embodiments, alone or in combination provide the art with means to genetically manipulate algae and various marine organisms to modify their properties in desirable ways.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 presents a map of restriction enzyme sites in the fcp/ble gene fusion cassette. The coding region ofthe sh ble gene was inserted between the EcoRV and Hindlll sites of the P. tricornutum fcpA gene. The transcription start site of the endogenous fcpA is marked by an arrow. The entire cassette is inserted into Bluescript SK- and designated pfcp/ble.
Figure 2 shows the results of Southern analysis of seven P. tricornutum zeocin resistant strains (A-G). Total DNA was digested with Bgl II, EcoRI or Sail to completion. The digested DNA was electrophoresed and blotted using standard procedures. The resulting DNA blot was probed with radioactive pfcp/ble. The hybridizing band containing the endogenous fcpA gene for each set of samples is marked by an arrow. Additional hybridizing bands indicate inserted copies of pfcp/ble into the genome. DNA from wild-type cells is not included on this blot. Figure 3 shows the results of Western analysis of seven P. tricornutum zeocin-resistant strains (A-G). Total cellular protein (10 μg) was electrophoresed and immunoblotted using standard techniques. The resulting protein blot was probed with a rabbit polyclonal antibody to the Sh ble protein (Cayla) and visualized with an alkaline phosphatase anti-rabbit IgG conjugate. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Definitions
In describing the present invention, the following terminology is used in accordance with the definitions set out below. A "chimeric DNA" is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the chimeric DNA encodes a protein segment, the segment coding sequence will be flanked by DNA that does not flank the coding sequence in any naturally occurring genome. Allelic variations or naturally occurring mutational events do not give rise to a chimeric DNA as defined herein.
A "coding sequence" is an in-frame sequence of codons that (in view ofthe genetic code) correspond to or encode a protein or peptide sequence. Two coding sequences correspond to each other if the sequences or their complementary sequences encode the same amino acid sequences. A coding sequence in association with appropriate regulatory sequences may be transcribed and translated into a polypeptide in vivo. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. A coding sequence is "under the control" ofthe promoter sequence in a cell when RNA polymerase which binds the promoter sequence transcribes the coding sequence into mRNA which is then in turn translated into the protein encoded by the coding sequence. For puφoses of defining the present invention, the promoter sequence is bounded at its 3' terminus by the translation start codon of a coding sequence and extends upstream (5' direction) to include at least the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined by mapping with nuclease S 1 ), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase Promoters will usually contain additional consensus sequences (promoter elements) for more efficient initiation and transcription of downstream genes.
A "genetic fusion" according to this invention is a chimeric DNA containing a promoter and a coding sequence that are not associated in nature. A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control.
Vectors are used to introduce a foreign substance, such as DNA, RNA or protein, into an organism. A "DNA vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication ofthe attached segment.
A cell has been "transformed" by exogenous DNA when such exogenous DNA has been introduced inside the cell wall. Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome ofthe cell. For example, the exogenous DNA may be maintained on an extrachromosomal element (or replicon) such as a plasmid. A stably transformed cell is one in which the exogenous DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability ofthe cell to establish cell lines or clones comprised entirely of a population of daughter cells containing the exogenous DNA.
"Salt" as used in herein refers to an inorganic ionic compound which is commonly found in sea water or a mixture of such compounds. The concentration of salt is expressed herein as the amount of such compounds that provide the ionic equivalent to a given weight of sodium chloride. The salt concentration of seawater is about 32-33 g/L.
Transformation Systems
Transformed cells are produced by introducing exogenous DNA into a population of target cells and selecting the cells which have taken up the exogenous DNA, usually by measuring expression of some determinant present on the exogenous DNA but missing from the untransformed cells. Transformation of algae and marine organisms is complicated by lack of selection systems which are effective in salt water media. The difficulty is overcome in accordance with this invention by using zeocin resistance as a selective marker, because resistance to zeocin (and related antibiotics) has been discovered to be maintained in high salt medium to a much greater extent than is observed for other antibiotic resistance genes. Thus, transformants containing exogenous DNA with a zeocin resistance determinant will grow in salt water in the presence of suitable concentrations of zeocin, while untransformed cells of marine organisms will not.
This invention is provides improved methods for transformation of cells and selection of transformants from marine organisms, which may be multicelled marine organisms, including marine plants, or marine microorganisms. Marine microorganisms within the contemplation ofthis invention include marine bacteria, marine fungi, and marine algae, including marine diatoms. In a particular embodiement, this invention also contemplates use ofthe transformation system for transformation of halobacteria. Additionally, this invention provides particularly effective promoters for driving expression of foreign genes in cells of photosynthetic algae, including cells of marine algae. The basic techniques used for transformation and expression in algal systems and marine organisms are the same as those commonly used for Escherichia coli, Saccharomyces cerevisiae and other species which are routinely transformed. Standard methods for construction of chimeric DNA and its use in transformation of cells are familiar to the skilled worker, and these methods have been described in a number to texts for standard molecular biological manipulation (see Packer & Glaser, 1988, "Cyanobacteria", Meth. Enzymol, Vol. 167; Weissbach & Weissbach, 1988, "Methods for plant molecular biology," Academic Press, New York; Sambrook, Fritsch & Maniatis, 1989, "Molecular Cloning: A laboratory manual," 2nd edition Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; and Clark MS, 1997, Plant Molecular Biology, Springer, New York). To summarize, the upstream DNA sequences of a gene expressed under control of a suitable promoter may be restriction mapped and areas important for the expression ofthe protein characterized. The exact location ofthe start codon ofthe gene is determined and, making use of this information and the restriction map, a vector may be designed for expression of a heterologous protein by removing the region responsible for encoding the gene's protein but leaving the upstream region found to contain the genetic material responsible for control ofthe gene's expression. A synthetic oligonucleotide is preferably inserted in the location where the protein sequence once was, such that any additional gene could be cloned in using restriction endonuclease sites in the synthetic oligonucleotide (i.e., a multicloning site). An unrelated gene (or coding sequence) inserted at this site would then be under the control of an extant start codon and upstream regulatory region that will drive expression of the foreign (i.e., not normally there) protein encoded by this gene. Once the gene for the foreign protein is put into a cloning vector, it can be introduced into the host organism using any of several methods, some of which might be particular to the host organism. Variations on these methods are amply described in the general literature references above. Manipulation of conditions to optimize transformation for a particular host is within the skill ofthe art.
Different promoters may be more or less effective in different host systems. For example, the promoter from a gene associated with photosynthesis in one photosynthetic species may be used to direct expression of a protein in transformed algal cells or cells of another photosynthetic marine organism. Suitable promoters may be isolated from or synthesized based on known sequences from other photosynthetic organisms. Preferred promoters are those for genes from other photosynthetic species, including other algae and cyanobacteria, which are homologous to the photosynthetic genes ofthe algal host to be transformed (see, e.g., Table 1). For a particular algal host, it may be preferable to identify the homologous light harvesting gene from that host and isolate the homologous promoter from the host organism to get optimal expression. However, it has been found for some organisms that foreign promoters give excellent or less restricted expression in the host relative to the homologous promoter of the host organism (Mermet-Bovier, et al., 1993, Curr. Microbiol., Iβ-.ll'S-'Sll).
A series of light harvesting promoters from the fucoxanthin chlorophyll binding proteins have now been identified and cloned from Phaeodactylum tricornutum by the present inventors (see Apt, et al. (1996) "Stable nuclear transformation of the diatom Phaeodactylum tricornutum," Mol. Gen. Genet. 252:572-579, incoφorated herein by reference). The use of fcp promoters for transformation of algae, especially photosynthetic diatoms, is described herein.
Genetic fusion constructs according to the invention can be made using standard techniques. In a preferred embodiment, the promoter of an algal light harvesting protein, such as a chlorophyll binding protein's promoter, is positioned on the 5' or upstream side of a coding sequence whose expression is desired. Preferably a fucoxanthin chlorophyll binding protein promoter is used. Alternatively, a carotenoid chlorophyll binding protein promoter, such as that of peridinin chlorophyll binding protein, can be used. The promoter may come from any eukaryotic algae which has light harvesting protein complexes. For example, brown algae or diatoms may be the source ofthe promoter. In one particularly preferred embodiment, the Phaeodactylum tricornutum fcpA promoter is used. (Bhaya and Grossman (1993), "Characterization of gene clusters encoding the fucoxanthin chlorophyll proteins of the diatom Phaeodactylum tricornutum," Nucleic Acids Research, 21 :4458-4464). In order to evaluate promoter strength in a particular alga, reporter genes can be linked to a promoter. The linked construct is inserted into the alga and the expression ofthe reporter is gauged. Any gene whose mRNA or protein product can be easily measured can be used. Downstream or 3' ofthe light harvesting protein promoter are fused one or more additional protein coding sequences. Coding sequences for single proteins can be used, as well as coding sequences for fusions of two or more proteins Thus both a selectable marker and another sequence which one desires to introduce may be introduced fused to and downstream of a single light harvesting protein promoter. Alternatively, two protein coding sequences can be introduced, each under the control of a light harvesting promoter located on a single molecule
One particularly useful selectable marker which may be used is the Sh ble gene which encodes the bleomycin binding protein from Streptoalloteichus hindustanus. Zeocin and phleomycin have been found to be particularly potent in inhibition of the growth of eukaryotic algae, especially in the presence of high concentrations of salt, especially concentrations above 3 g/L Typical salt concentrations in growth media for marine algae are between about 10 and about 35 g/L, and more preferably between about 15-34 g/L (Sea water contains about 32 to 33 g/L of salt ) In addition, the Sh ble protein confers zeocin resistance on algal cells Zeocin or phleomcyin or other related antibiotics can be used interchangeably for selection with this marker Thus, the sh ble gene has been found to function as a resistance determinant in algae, and use ofthe sh ble gene on transforming DNA in combination with a zeocin or phleomycin-type selection affords a convenient selection for transformants of eukaryotic algae This is particularly useful for diatoms
In a particularly preferred configuration, the sh ble gene is regulated by a promoter of a chlorophyll binding protein. Suitable promoters include the fcpA, fcpB,fcpC, andfcpE promoters, as well as any Ihc promoter Other promoters that may be used in genetic fusion constructs for transforming cells of photosynthetic organisms are listed in Table 1 Additional suitable promoters for use with these and other marine organisms are listed in Table 2, and other suitable promoters which are apparent to the skilled worker may be used in the selection system ofthis invention
Table 1. Light related promoters
cyanobacterial genes
(taken from Houmard, et al , 1988, Methods m En∑ymol. , vol 167, Chap 89) ape A allophycocyanin α subunit apcB allophycocyanin β subunit apcC linker polypeptide apcD allophycocyanin B apcE anchor polypeptide atpA coupling factor subunits atpB coupling factor subunits atpC coupling factor subunits atpD coupling factor subunits atpE coupling factor subunits
cpcA c-phycocyanin α subunit cpcB c-phycocyanin β subunit cpcC linker polypeptide cpcE linker polypeptide cpcF cpc accumulation factor cpcG linker polypeptide cpcH2 linker polypeptide cpcH3 linker polypeptide cpcI2 linker polypeptide cpcI3 linker polypeptide cpeA phycoerythrin α subunit cpeB phycoerythrin β subunit cit carotenoid-binding protein
psaA chl a binding protein photosystem I psaB chl a binding protein photosystem I psbAl Dl protein of PSII psbA2 Dl protein of PSII psbB CP47 chl a binding protein PSII psbC CP43 chl a binding protein PSII psbK a small PSII component (PBB-K) (see Ikeuchi et al. (1991) "Cloning ofthe psbK gene from Synechocystis sp. PCC6803 and characterization of the photosystem II in mutants lacking PSII-K," J. Biol. Chem. 266: 11 11 1- 11115.) pbsC2 CP43 induced on iron stress psbDl D2 protein of PSII psbD2 D2 protein of PSII psbE cytochrome b-559 psbF cytochrome b-559 psbl cytochrome b-559 psbj cytochrome b-559 psaD photosystem I subunit psaE photosystem I subunit rbcL ribulose-bisphosphate carboxylase large subunit rbcS ribulose-bisphosphate carboxylase small subunit woxA 33 -kDa Mn-stabilizing protein of PSII Non-cyanobacterial genes fcpA fucoxanthin chlorophyll binding protein fcpB fucoxanthin chlorophyll binding protein fcpC fucoxanthin chlorophyll binding protein fcpE fucoxanthin chlorophyll binding protein Ihc light harvesting chlorophyll binding protein gene(s) plus homologs of cyanobacterial genes, such as oee-I oxygen evolving enhancer protein, see Mayfield et al (1990) Proc Natl. Acad Sci USA 87 2087-2091 rbcL ribulose bisphospate oxygenase/carboxylase large subnit, see Blowers et al (1989) "Studies on Chlamydomonas chloroplast transformation Foreign DNA can be stably maintained in the chromosome" Plant Cell 1 123-132, Blowers et al (1990) "Transcriptional analysis of endogenous and foreign genes in chloroplast transformations of Chlamydomonas" Plant Cell 2 1059-
1070 atpA coupling factor subunit, see Blowers et al (1990) Plant Cell 2 1059-1070 atpB coupling factor subunit, see Blowers et al (1990) Plant Cell 2 1059-1070 cabll-l a light-harvesting chlorophyll a/b binding protein gene that is light regulated Blakenship et al (1992) "Expression of chimeric genes by the light-cabll- 1 promoter in Chlamydomonas reinhardtii A babl- I/nitl gene functions as a dominant selectable marker in a nit 1- nit 1- strain" Mol. Cell. Biol 12 5268-5279 Used an endogenous promoter to express a homologous gene in the same host (green algal)
Table 2. Non-light harvesting related promoters already used in some algal systems
The nopaline synthase promoter and polyadenylation sequences from the Ti plasmid of Agrobacterium tumefaciens See Hall et al (1993) "Expression of a foreign gene in Chlamydomonas reinhardtii" Gene 124 75-81 The promoter region of the tubB2 gene from Chlamydomonas reinhardtii See Davies et al. (1992) "Expression ofthe arylsulfatase gene from the B2-tubuhn promoter in Chlamydomonas reinhardtii" Nucl. Acids Res 20 2959-2965 The PL promoter from bacteriophage λ See Gruber et al ( 1991 ) "Escherichia coli and Anaycystis nidulans plasmid shuttle vectors containing the P-L promoter from bacteriophagac lambda" Current Micro 22 15-20 CaMV 35S promoter See Jarvis et al (1991) "Transient expression of firefly leuciferase in prototplasts ofthe green alga Chlorella ellψsodea" Current Genet 19 317-322 The bacterial tφ promoter See Kawata et al (1991) "Expression of salmon growth hormone in the cyanobacterium Agmenellum quadruplwatum Biotechnol Lett 13 851-856 Other useful protein coding sequences which may be fused to the upstream promoter include resistance determinants for herbicides, heavy metals, high pH or salt. Other useful protein coding sequences for fusion are those for transport proteins for reduced carbon compounds. Thus amino acid, carboxylic acid, and sugar transport proteins, such as the hexose uptake protein (HUP) of Chlorella kessleri, may be used conveniently. In addition, glucose metabolism enzymes or other useful products made by the recipient or other donor organisms may be used. The genes for glucuronidase or green fluorescent protein can be used as reporter genes. The genetic fusion ofthe present invention may be introduced into cells of marine organisms or eukaryotic algae alone or as part of a DNA vector. Suitable vectors for use in marine organisms or eukaryotic algae are known in the art and any such vector may be used. Even vectors which do not replicate in algae can be useful, if recombination between the vector and the genome occurs. Any method for introduction ofthe fusion construct into marine organisms and algae may be used. However, one particularly preferred method involves the use of DNA-coated particle bombardment. Another useful method involves vigorous agitation in the presence of glass beads, which renders some of the algal cells permeable to nucleic acids. The methods of the present invention are particularly useful for the modification of algae to render them more susceptible to labeling with compounds which are labeled with stable isotopes. For example, stable isotopically labeled amino acids, sugars, carboxylic acids, or other reduced carbon compounds can be used to label algae. However, often the uptake by the cells of these labeled compounds is inefficient. The practice of the present invention will allow enhancement of the uptake of these labeled compounds by producing transformed photosynthetic algae having increased levels of transporter proteins specific for particular reduced carbon compounds, thereby improving the permeability of the cells to these compounds Incorporation of such labeled compounds into algal metabolites is useful for structural determinations ofthe metabolites. Growth of algae in salt concentrations of between 10 and about 35 g/L is often necessary to maintain viability of non-habituated, salt water algae. Thus use of zeocin-type antibiotics for selection of transformants provides the art with a benefit, since the toxicity of other antibiotics decreases more rapidly with increasing salt concentration, and thus other antibiotic selections do not work in the presence of high salt. Zeocin-based selection is particularly useful to avoid the need to habituate algae to low salt concentrations, as well as to allow selection of algae which cannot be habituated. Furthermore, transformed algae produced according to the method of this invention may be fully adapted to growth in high salt media. Thus, this invention provides a method for production of desired proteins in high salt medium by culture of algal cells transformed according to this invention with DNA containing the coding sequence ofthe desired protein under the control of a suitable promoter. The desired proteins can be produced in cultures of algae grown under salt conditions more optimal for growth of the microbes and recovered by standard protein recovery methods suitable for the desired protein.
The following examples are provided for exemplification puφoses only and are not intended to limit the scope ofthe invention. EXAMPLES
Example 1. Antibiotic and herbicide sensitivities of Phaeodactylum tricornutum.
Phaeodactylum tricornutum was insensitive to most of the common antibiotics for which resistance genes are available, under the growth conditions utilized (Table 3). Some antibiotics such as puromycin and chloramphenicol required very high concentrations for cell death compared to other eukaryotic organisms and were thus not suitable for selection. No sensitivity was observed for any of the herbicides used in plant transformation even when used at 1000 times higher concentrations then needed to cause plant cell death. Only zeocin and phleomycin resulted in cell death at low concentrations. Zeocin was utilized for subsequent selection. When the salt concentration in the medium was decreased, toxicity of the various antibiotics generally increased In particular, G418, hygromycin, nourseothricin, and puromycin all show promise for selection of transformants under reduced salt conditions Resistance genes for use in selections based on these antibiotics are available from the American Type Culture Collection or can be obtained from the original organisms (e.g., nourseothricin: nat, see Krugel et al., 1993, Gene. 127:127-131, and sat, see Tietze, et al., 1990, Nucl. Acid Res. , 18: 1290, puromycin: pac, see Lecalle, et al., 1989, Gene, 79:375-380; hygromycin hyg, see Gritz, et al., 1983, Gene, 25:179-188; G418: neo, see Gruber, et al., 1993, in Glick, et al., eds, "Methods in Plant Molecular Biology and Biotechnology," CRC Press, Boca Raton, pp. 89-119).
TABLE 3. Sensitivity of P. tricornutum to antibiotics and plant herbicides for which resistance genes are available.
Figure imgf000017_0001
"No growth (-) or significant growth (+), at the highest concentration used or required for cell death.
Culture Conditions. Phaeodactylum tricornutum Bohlin (University of Texas Culture Collection, strain 646) was grown at 24°C with continuous illumination at 100 μEm'Y1 on LDM media containing 1.2% agar. Liquid cultures were bubbled with air containing 1 % CO2 and grown in f/2 media, supplemented with 2 times the normal levels of nitrate and phosphate.
Example 2. Use of a zeocin resistance gene as a selective marker.
While demonstrating the use of a zeocin resistance gene as a selective marker, this example also demonstrates the use of a promoter for a chlorophyll binding protein to drive exogenous gene expression.
Zeocin is a member ofthe phleomycin family of structurally related antibiotics isolated from Streptomyces (Berdy (1980), "Bleomycin-Type Antibiotics". In: Berdy, J (ed) Handbook of Antibiotic Compounds. Vol. IV, Part L Ammo acid and Peptide Antibiotics. CRC Press, Boca Raton, FL pp 459-497) These antibiotics are small glycopeptides that differ by their terminal amine residues and are commonly chelated to copper in commercial preparations They are effective at low concentration against bacteria and a wide variety of eukaryotic organisms (a complete reference list of all known applications is available) The mode by which these antibiotics cause cell death involves binding to and cleavage of DNA
The sh ble gene (400 bp) from the bacterium Streptoalloteichus hindustanus encodes the protein that confers resistance to zeocin and phleomycin (Drocourt et al , "Cassettes ofthe Streptoalloteichus hindustanus ble gene for transformation of lower and higher eukaryotes to phleomycin resistance" Nucleic Acids Research 18 4009 (1990)) The Sh ble protein (13 kDa) is a binding protein with a strong affinity for the phleomycin family of antibiotics When zeocin is bound by the Sh ble protein it is no longer active in cleaving the cellular DNA Upon introduction of this gene into P. tricornutum cells, it is possible to recover transformants that are able to grow on zeocin
The promoter and terminator regions of the fcpA, B, C, and E genes of P. tricornutum were fused onto the sh ble gene (Fig 1 ) The plasmid pfcpA was constructed by subcloning the fcpA PstlKpnl fragment (Bhaya and Grossman, 1993, supra) into Bluescript SK( Stratagene) The sh ble gene was PCR amplified from p U T 3 6 2 ( C a y l a ) u s i n g p r i m e r s B l e - R 5
(CTAGATATCAAGATGGCCAAGTTGACCAGT, and Ble-H3
(GATAAGCTTCAGTCCTGCTCCTCGG) which created EcoRV and Hindlll sites at the 5' and 3' regions of the reading frame The fcpA/ble gene fusion was constructed by inserting the sh ble PCR generated fragment between the EcoRV and HindLU sites of the fcpA gene The entire 5' untranslated region ofthe resulting gene fusion was identical to the endogenous fcpA gene
The plasmid containing the chimeric gene was used to coat tungsten particles which were bombarded into the cells Super-coiled (S C ) or linear plasmid DNA (cut with Kpnl) from pfcp/ble was used for bombardments Cells were bombarded using the BIO-RAD BIOLISTIC PDS-1000/HE™ particle delivery system fitted with 1,100, 1,350 or 1,500 psi rupture discs. Tungsten particles M5, M17 (0.4 or 1.1 μm median diameter, respectively) or gold particles (1.0 μm diameter) were coated with 0.8 μm plasmid DNA/bombardment using CaCl2 and spermidine as described by the manufacturer. Approximately 5 x 107 cells were spread on LDM agar medium 1 hr prior to bombardment and positioned at various levels within the chamber (as indicated in Table 2) ofthe Biolistic device. Bombarded cells were illuminated for 48 hr prior to resuspension in sterile seawater and 5 x IO6 cells were spread on fresh LDM agar medium containing 75 μg/ml Zeocin (In Vitrogen) The plates were placed under constant illumination (lOOμtEm "2 s'1 ) for 2-3 weeks, after which resistant colonies were easily visible.
After 2 weeks on selective medium, resistant colonies were readily visible. Each colony was restreaked on selective medium containing 100, 250 and 500 μg/ml zeocin. Restreaked cells that grew were scored as resistant colonies. All primary resistant colonies grew on the three concentrations of zeocin.
The results obtained under different experimental conditions used for transformation are outlined in Table 4. The largest number of resistant colonies was obtained by placing the petri dishes containing cells at level two ofthe BIOLISTIC™ device. Only a small number of resistant colonies were obtained by placing the cells at level three. The size of the particles has a significant effect on the number of resistant colonies recovered, with the larger Ml 7 tungsten particles (1.1 μ m median diameter) being the best. Pressure effects were most pronounced with the smaller particles. Higher frequencies of transformation were observed with supercoiled DNA versus linear DNA. No resistant colonies were recovered or observed in the no DNA controls. TABLE 4. Recovery of resistant colonies using different transformation conditions.
Figure imgf000020_0001
Example 3. Molecular analysis of the algal transformants obtained.
To determine whether resistant colonies obtained by bombardment contained DNA sequences derived from plasmid pfcp/ble, the DNA from 7 isolates (A-G) was analyzed by hybridization to the entire pfcp/ble plasmid. Hybridization with pfcp/ble revealed that all the resistant P. triconutum strains examined contained multiple hybridizing bands (Fig. 2), not including the endogenous fcpA gene which also hybridizes to the plasmid. A single common hybridizing band was present in DNA from all ofthe transformants digested with a specific restriction enzyme (Bglll, EcoRI or Sail, marked by arrow). These bands correspond exactly in size to the endogenous fragment of the fcpA gene present in wild type cells (Bhaya and Grossman, 1993, supra). All the resistant strains had 1 or more additional hybridizing bands of various sizes, indicating the presence of one or more copies of pfcp/ble in their genome.
As determined by immunoblots, the Sh ble protein was also present in all the resistant strains (A-G); it was undetectable in nontransformed cells (Fig. 3) The level of Sh ble protein determined immunologically was extremely variable, ranging from < 1 ng to > 20 ng/10 μg total cell protein
The principles, preferred embodiments and modes of operation ofthe present invention have been described in the foregoing specification. The invention which is intended to be protected herein, however, is not to be construed as limited to the particular forms disclosed, since they are to be regarded as illustrative rather than restrictive. Variations and changes may be made by those skilled in the art without departing from the spirit ofthe invention.
All publications and patent applications mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains. AU publications and patent applications are herein incoφorated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incoφorated by reference.

Claims

1. A method of transforming cells of an organism selected from the group consisting of marine organisms and eukaryotic algae comprising the steps of: introducing DNA into the cells, wherein the DNA contains a zeocin resistance determinant; and selecting for transformants by culturing the cells in a medium comprising a concentration of zeocin or phleomycin which is inhibitory to untransformed cells.
2. The method of claim 1, wherein growth ofthe organism is enhanced by the presence of salt in the medium, and the medium contains at least about 3 g/L salt.
3. The method of claim 2, wherein the medium contains between 10 and 35 g/L salt.
4. The method of claim 1, wherein the organism is a eukaryotic algae.
5. The method of claim 4, wherein the algae are diatoms.
6. The method of claim 5, wherein the algae are P. tricornutum.
1. The method of claim 1, wherein the antibiotic resistance determinant is sh ble (Streptoalloteichus hindustanus bleomycin binding protein).
8. The method of claim 1, wherein the antibiotic resistance determinant is regulated by a light harvesting protein promoter.
9. The method of claim 8, wherein the light harvesting protein is a chlorophyll binding protein.
10. The method of claim 9, wherein the chlorophyll binding protein is fucoxanthin chlorophyll binding protein.
11. The method of claim 4, wherein the DNA is introduced by means of particle bombardment or glass bead disruption.
12. A genetic fusion consisting of a promoter of a gene which encodes a protein involved in photosynthesis upstream from and fused to one or more protein coding sequences. 13 The method of claim 12, wherein the gene encodes a photosynthetic algal light harvesting protein
14 The method of claim 13, wherein the light harvesting protein is a chlorophyll binding protein 15 The genetic fusion of claim 14, wherein the chlorophyll binding protein is fucoxanthin chlorophyll binding protein
16 The genetic fusion of claim 12, wherein expression of the protein coding sequence confers antibiotic resistance on algal cells
17 The genetic fusion of claim 16, wherein the coding sequence which confers antibiotic resistance on algal cells encodes Sh ble
18 The genetic fusion of claim 16, wherein expression of the protein coding sequence confers resistance to nourseothricin
19 The genetic fusion of claim 12, wherein one of the protein coding sequences encodes a transporter protein of a reduced carbon compound 20 The genetic fusion of claim 19, wherein the transporter protein is a carboxylic acid transporter protein
21 The genetic fusion of claim 19, wherein the transporter protein is an amino acid transporter protein
22 The genetic fusion of claim 19, wherein the transporter protein is a sugar transporter protein.
23 The genetic fusion of claim 22, wherein the transporter protein is a hexose transporter protein
24 The genetic fusion of claim 23, wherein the transporter protein is a hexose uptake protein (HUP) of Chlorella. 25 The genetic fusion of claim 23, wherein the transporter protein is a hexose uptake protein (HUP) of Chlorella kesslen.
26 The genetic fusion of claim 12, wherein the light harvesting protein is from a diatom
27 The genetic fusion of claim 26, wherein the light harvesting protein is from Phaeodactylum tricornutum. 28 A DNA vector comprising the genetic fusion of any one of claims 12, 16, 19, 20, 21, or 25
29 An algal cell transformed with the DNA vector of claim 28
30 A method of producing a recombinant protein comprising culture of an algal cell transformed with a genetic fusion according to any one of claims 12, 16, 19, 20, 21, or 25, wherein the genetic fusion further contains a coding sequence encoding the recombinant protein under control of a promoter which functions in the algal cell
PCT/US1997/006021 1996-04-12 1997-04-11 Methods and tools for transformation of eukaryotic algae WO1997039106A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US09/155,972 US6027900A (en) 1996-04-12 1997-04-11 Methods and tools for transformation of eukaryotic algae

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1463496P 1996-04-12 1996-04-12
US60/014,634 1996-04-12

Publications (1)

Publication Number Publication Date
WO1997039106A1 true WO1997039106A1 (en) 1997-10-23

Family

ID=21766703

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/006021 WO1997039106A1 (en) 1996-04-12 1997-04-11 Methods and tools for transformation of eukaryotic algae

Country Status (2)

Country Link
US (1) US6027900A (en)
WO (1) WO1997039106A1 (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6027900A (en) * 1996-04-12 2000-02-22 Carnegie Institution Of Washington Methods and tools for transformation of eukaryotic algae
WO2001048185A2 (en) * 1999-12-27 2001-07-05 Universite De Geneve Transcription regulatory sequences derived from chlamydomonas reinhardtii
WO2001081603A2 (en) * 2000-04-21 2001-11-01 Martek Biosciences Corporation Trophic conversion of obligate phototrophic algae through metabolic engineering
WO2001098335A2 (en) * 2000-06-20 2001-12-27 Phycotransgenics, Llc Transgenic algae for delivering antigens to an animal
EP1780283A1 (en) 2000-04-21 2007-05-02 Martek Biosciences Corporation Trophic conversion of obligate photographic algae through metabolic engineering
US7256050B2 (en) 2000-06-16 2007-08-14 Martek Biosciences Corp. High fluorescent intensity cross-linked allophycocyanin
EP2298923A1 (en) 2009-09-18 2011-03-23 Université de Liège Method for the production of recombinant proteins by green microalgae
WO2011063284A1 (en) * 2009-11-19 2011-05-26 Sapphire Energy, Inc. Production of therapeutic proteins in photosynthetic organisms
WO2014030165A1 (en) 2012-08-23 2014-02-27 Transalgae Israel Ltd. Transgenic microalgae and use thereof for oral delivery of proteins
WO2015121863A1 (en) 2014-02-12 2015-08-20 Transalgae Israel Ltd. Algal based edible vaccines
US10781447B2 (en) 2015-07-14 2020-09-22 Transalgae Israel Ltd. Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules
US11490639B2 (en) 2009-01-22 2022-11-08 Solarvest BioEnergy Inc. Dental composition and method

Families Citing this family (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5583019A (en) * 1995-01-24 1996-12-10 Omegatech Inc. Method for production of arachidonic acid
ES2220800T3 (en) * 2000-08-10 2004-12-16 Ocean Nutrition Canada Ltd. CHLORELLA PREPARATIONS THAT SHOW IMMUNOMODULATING PROPERTIES.
US6696621B2 (en) 2001-02-23 2004-02-24 Paradigm Genetics, Inc. Selectable marker in plants
EP1381345B1 (en) * 2001-03-23 2008-07-09 Advanced Bionutrition Corporation Delivery of disease control in aquaculture using yeasts containing bioactive proteins
TWI324181B (en) * 2001-04-16 2010-05-01 Martek Biosciences Corp Product and process for transformation of thraustochytriales microorganisms
US20060120999A1 (en) * 2002-09-16 2006-06-08 Dhar Arun K Protein and peptide expression for passive immunity
WO2004046730A2 (en) * 2002-10-25 2004-06-03 Sense Proteomic Limited Uses of ble proteins and antibiotics from the bleomycin family
US20040194156A1 (en) * 2002-12-27 2004-09-30 Califa Llc Transgenic aquatic invertebrates as a bioreactor for production of recombinant polypeptides
US8936930B2 (en) * 2004-08-05 2015-01-20 Ben-Gurion University Of The Negev Research And Development Authority Red microalgae expressing exogenous polypeptides and methods of generating and utilizing same
DK3467096T3 (en) 2005-06-07 2022-03-28 Dsm Nutritional Products Ag EUKARYOTE MICRO-ORGANISMS FOR THE PRODUCTION OF LIPIDS AND ANTIOXIDANTS
US20090047722A1 (en) * 2005-12-09 2009-02-19 Bionavitas, Inc. Systems, devices, and methods for biomass production
EP1993565A2 (en) 2006-01-19 2008-11-26 Solazyme, Inc. Nutraceutical compositions from microalgae and related methods of production and administration
MX2009001346A (en) * 2006-08-01 2009-04-17 Ocean Nutrition Canada Ltd Oil producing microbes and methods of modification thereof.
US8338134B2 (en) 2007-02-09 2012-12-25 Centre National De La Recherche Scientifique - Cnrs Expression of polypeptides from the nuclear genome of Ostreococcus sp
WO2008131019A1 (en) * 2007-04-20 2008-10-30 Bionavitas, Inc. Systems, devices, and, methods for releasing biomass cell components
WO2008151149A2 (en) 2007-06-01 2008-12-11 Solazyme, Inc. Production of oil in microorganisms
US20090148931A1 (en) * 2007-08-01 2009-06-11 Bionavitas, Inc. Illumination systems, devices, and methods for biomass production
CA2704227A1 (en) 2007-11-10 2009-05-14 Joule Biotechnologies, Inc. Hyperphotosynthetic organisms
AU2008333824A1 (en) * 2007-12-04 2009-06-11 The Ohio State University Research Foundation Molecular approaches for the optimization of biofuel production
EP2090648A1 (en) * 2008-02-12 2009-08-19 Institut Francais de Recherche pour l'Exploitation de la Mere(Ifremer) Production of glycosylated polypeptides in microalgae
US20110126325A1 (en) * 2008-04-25 2011-05-26 Commonwealth Scientific Industrial Research Organisation Recombinant cells and methods for hydroxylating fatty acids
WO2009136296A2 (en) 2008-05-06 2009-11-12 Ocean Nutrition Canada Limited Compositions obtained from chlorella extract having immunomodulating properties
US8318482B2 (en) * 2008-06-06 2012-11-27 Aurora Algae, Inc. VCP-based vectors for algal cell transformation
US9090880B2 (en) * 2008-06-25 2015-07-28 Research Foundation Of The City University Of New York Regulating the production of long chain hydrocarbons
US20100022393A1 (en) * 2008-07-24 2010-01-28 Bertrand Vick Glyphosate applications in aquaculture
US8435790B2 (en) * 2008-07-25 2013-05-07 The Regents Of The University Of California Methods of modulating lipid concentrations in eukaryotic cells
EP2383337B1 (en) * 2009-01-23 2015-03-04 Kochi University Novel promoter for use in transformation of algae
US8314228B2 (en) 2009-02-13 2012-11-20 Aurora Algae, Inc. Bidirectional promoters in Nannochloropsis
CA2755667C (en) * 2009-03-16 2018-06-12 Martek Biosciences Corporation Protein production in microorganisms of the phylum labyrinthulomycota
US8308944B2 (en) * 2009-03-20 2012-11-13 Algal Scientific Corporation System and method for treating wastewater via phototactic heterotrophic microorganism growth
US8865468B2 (en) * 2009-10-19 2014-10-21 Aurora Algae, Inc. Homologous recombination in an algal nuclear genome
US8809046B2 (en) 2011-04-28 2014-08-19 Aurora Algae, Inc. Algal elongases
WO2011011463A2 (en) * 2009-07-20 2011-01-27 Aurora Biofuels, Inc. Manipulation of an alternative respiratory pathway in photo-autotrophs
EP2470665A4 (en) * 2009-08-28 2013-04-17 Phycal Inc Biofuel from recombinant oleginous algae using sugar carbon sources
CN102906270B (en) * 2009-12-28 2016-06-22 Dsmip资产公司 The restructuring thraustochytriale of growth and its compositions, Preparation method and use on xylose
CN103068984B (en) * 2009-12-28 2017-12-01 Dsm Ip资产公司 The production of hemagglutinin neuraminidase albumen in microalgae
WO2011103428A2 (en) * 2010-02-18 2011-08-25 Stc. Unm Production of cellulases and hemicellulases in algal biofuel feedstocks
EP2575486B1 (en) 2010-05-28 2021-09-01 Corbion Biotech, Inc. Food compositions comprising tailored oils
EP2580229A4 (en) * 2010-06-10 2013-12-25 Univ Ben Gurion D5 desaturase-defective mutant gene and use thereof
EP2444495A1 (en) * 2010-10-20 2012-04-25 Algenics Secretion of recombinant polypeptides in the extracellular medium of diatoms
WO2012082731A2 (en) * 2010-12-13 2012-06-21 J. Craig Venter Institute Engineered microalgae with enhanced lipid production
US8722359B2 (en) 2011-01-21 2014-05-13 Aurora Algae, Inc. Genes for enhanced lipid metabolism for accumulation of lipids
CA2829296C (en) 2011-03-07 2019-10-29 ShuoCheng ZHANG Engineering thraustochytrid microorganisms
MX2013012565A (en) 2011-04-28 2013-11-21 Aurora Algae Inc Algal desaturases.
WO2013166065A1 (en) 2012-04-30 2013-11-07 Aurora Algae, Inc. ACP Promoter
US10612034B2 (en) 2012-06-01 2020-04-07 Exxonmobil Research And Engineering Company Promoters and terminators for use in eukaryotic cells
EP2909304A4 (en) 2012-10-16 2016-09-21 Exxonmobil Res & Eng Co Dgat genes and methods of use for triglyceride production in recombinant microorganisms
BR112015011190A2 (en) * 2012-11-16 2017-10-03 Total Marketing Services DIRECTED MODIFICATION METHOD AND GENETICALLY MODIFIED ALGAE CELL
US8835149B2 (en) 2012-12-06 2014-09-16 Exxonmobil Research And Engineering Company DGAT genes comprising pleckstrin homology domains and methods of use for triglyceride production in recombinant microorganisms
US9567615B2 (en) 2013-01-29 2017-02-14 Terravia Holdings, Inc. Variant thioesterases and methods of use
US9816079B2 (en) 2013-01-29 2017-11-14 Terravia Holdings, Inc. Variant thioesterases and methods of use
EP2970926B1 (en) 2013-03-13 2018-01-31 DSM Nutritional Products AG Engineering microorganisms
US9783836B2 (en) 2013-03-15 2017-10-10 Terravia Holdings, Inc. Thioesterases and cells for production of tailored oils
US9290749B2 (en) 2013-03-15 2016-03-22 Solazyme, Inc. Thioesterases and cells for production of tailored oils
ES2772123T3 (en) 2014-07-24 2020-07-07 Corbion Biotech Inc Thioesterase variants and methods of use
CN107208103A (en) 2014-09-18 2017-09-26 泰拉瑞亚控股公司 Acyl group ACP thioesterases and its mutant
AR104042A1 (en) 2015-03-26 2017-06-21 Mara Renewables Corp HIGH-DENSITY PRODUCTION OF BIOMASS AND OIL USING GLUCEROL IN GROSS
AU2016293487B2 (en) 2015-07-13 2021-07-01 MARA Renewables Corporation Enhancing microalgal metabolism of xylose
US10851395B2 (en) 2016-06-10 2020-12-01 MARA Renewables Corporation Method of making lipids with improved cold flow properties
EP3544994A4 (en) 2016-11-27 2020-06-03 Triton Algae Innovations, Inc. Method of purification of recombinant osteopontin from microalgae

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5100792A (en) * 1984-11-13 1992-03-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL70022A0 (en) * 1982-11-08 1984-01-31 Standard Oil Co Method for introducing foreign genes into green algae cells utilizing t-dna of agrobacterium
JPH0376583A (en) * 1989-08-16 1991-04-02 Hagiwara Yoshihide Manifestation of human protein in blue-green algae
US5661017A (en) * 1993-09-14 1997-08-26 Dunahay; Terri Goodman Method to transform algae, materials therefor, and products produced thereby
US6027900A (en) * 1996-04-12 2000-02-22 Carnegie Institution Of Washington Methods and tools for transformation of eukaryotic algae

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5100792A (en) * 1984-11-13 1992-03-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JOURNAL OF EXPERIMENTAL BOTANY, May 1995, Volume 46, (Suppl.), STEVENS et al., "Development of a Dominant Selectable Marker for Nuclear Transformation of Chlamydomonas Reinhardtii", page 37, Abstract No. P6.43. *
MOLECULAR AND GENERAL GENETICS, 1991, Volume 225, MATSUOKA et al., "Expression of Photosynthetic Genes from the C4 Plant, Maize, in Tobacco", pages 411-419. *

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6027900A (en) * 1996-04-12 2000-02-22 Carnegie Institution Of Washington Methods and tools for transformation of eukaryotic algae
WO2001048185A3 (en) * 1999-12-27 2002-05-02 Univ Geneve Transcription regulatory sequences derived from chlamydomonas reinhardtii
WO2001048185A2 (en) * 1999-12-27 2001-07-05 Universite De Geneve Transcription regulatory sequences derived from chlamydomonas reinhardtii
EP1114867A1 (en) * 1999-12-27 2001-07-11 Universite De Geneve Transcription regulatory sequences derived from Chlamydomonas reinhardtii
JP2004500839A (en) * 2000-04-21 2004-01-15 マーテック・バイオサイエンシーズ・コーポレーション Nutritional conversion of obligate phototrophic algae through metabolic genetic manipulation
WO2001081603A3 (en) * 2000-04-21 2002-05-23 Martek Biosciences Corp Trophic conversion of obligate phototrophic algae through metabolic engineering
US8008061B2 (en) 2000-04-21 2011-08-30 Martek Biosciences Corporation Trophic conversion of obligate phototrophic algae through metabolic engineering
EP1780283A1 (en) 2000-04-21 2007-05-02 Martek Biosciences Corporation Trophic conversion of obligate photographic algae through metabolic engineering
WO2001081603A2 (en) * 2000-04-21 2001-11-01 Martek Biosciences Corporation Trophic conversion of obligate phototrophic algae through metabolic engineering
US7939710B1 (en) 2000-04-21 2011-05-10 Martek Biosciences Corporation Trophic conversion of obligate phototrophic algae through metabolic engineering
US7256050B2 (en) 2000-06-16 2007-08-14 Martek Biosciences Corp. High fluorescent intensity cross-linked allophycocyanin
WO2001098335A2 (en) * 2000-06-20 2001-12-27 Phycotransgenics, Llc Transgenic algae for delivering antigens to an animal
WO2001098335A3 (en) * 2000-06-20 2002-05-16 Phycotransgenics Llc Transgenic algae for delivering antigens to an animal
US7410637B2 (en) 2000-06-20 2008-08-12 Phycotransgenics, Llc Transgenic algae for delivering antigens to an animal
US8282915B2 (en) 2000-06-20 2012-10-09 Phyterra Bio Inc. Transgenic algae for delivering antigens to an animal
US11490639B2 (en) 2009-01-22 2022-11-08 Solarvest BioEnergy Inc. Dental composition and method
EP2298923A1 (en) 2009-09-18 2011-03-23 Université de Liège Method for the production of recombinant proteins by green microalgae
WO2011033061A2 (en) 2009-09-18 2011-03-24 Universite De Liege Method for the production of recombinant proteins by green microalgae
WO2011063284A1 (en) * 2009-11-19 2011-05-26 Sapphire Energy, Inc. Production of therapeutic proteins in photosynthetic organisms
WO2014030165A1 (en) 2012-08-23 2014-02-27 Transalgae Israel Ltd. Transgenic microalgae and use thereof for oral delivery of proteins
US9827280B2 (en) 2012-08-23 2017-11-28 Transalgae Israel Ltd. Transgenic microalgae and use thereof for oral delivery of proteins
US11344590B2 (en) 2012-08-23 2022-05-31 Transalgae Israel Ltd. Transgenic microalgae and use thereof for oral delivery of proteins
WO2015121863A1 (en) 2014-02-12 2015-08-20 Transalgae Israel Ltd. Algal based edible vaccines
US10480002B2 (en) 2014-02-12 2019-11-19 Transalgae Israel Ltd. Algal based edible vaccines
US10781447B2 (en) 2015-07-14 2020-09-22 Transalgae Israel Ltd. Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules
US11939576B2 (en) 2015-07-14 2024-03-26 Transalgae Israel Ltd. Transgenic microalgae and use thereof as a feed for delivery of interfering RNA molecules

Also Published As

Publication number Publication date
US6027900A (en) 2000-02-22

Similar Documents

Publication Publication Date Title
US6027900A (en) Methods and tools for transformation of eukaryotic algae
US9487790B2 (en) Nuclear based expression of genes for production of biofuels and process co-products in algae
US5034322A (en) Chimeric genes suitable for expression in plant cells
US5661017A (en) Method to transform algae, materials therefor, and products produced thereby
Kumar et al. Evaluating nuclear transgene expression systems in Chlamydomonas reinhardtii
Tran et al. Achievements and challenges of genetic engineering of the model green alga Chlamydomonas reinhardtii
CA3003188A1 (en) Protein production in microorganisms of the phylum labyrinthulomycota
CA2619989A1 (en) Regulation of heterologous recombinant protein expression in methylotrophic and methanotrophic bacteria
US11162106B2 (en) Inducible expression of genes in algae
CN114555812A (en) Materials and methods for protein production
Koh et al. Advanced multigene expression system for Nannochloropsis salina using 2A self-cleaving peptides
US20140234904A1 (en) Method for harvesting photosynthetic unicells using genetically induced flotation
US20220145313A1 (en) Targeting Nuclear-Encoded Recombinant Proteins to the Chloroplast in Microalgae
US20190024101A1 (en) Multigene expression in microalgae
KR20190047914A (en) Recombinant vector for microalgae transformation comprising sequence derived from nitrate reductase and uses thereof
US20160186196A1 (en) Method and composition for generating programmed cell death resistant algal cells
MX2013010872A (en) Regulated gene expression systems and constructs thereof.
Cui et al. Plastid Engineering of a Marine Alga, Nannochloropsis gaditana, for Co‐Expression of Two Recombinant Peptides
KR102211740B1 (en) Novel promoter HASP1 of Phaeodactylum tricornutum and signal peptide thereof and uses thereof
CN102212546B (en) Integrative Candida maltose gene expression system and applications thereof
AU2018252745A1 (en) Method of improving resistance to substrate analog of nitric acid in microalga
KR102617091B1 (en) Promoter from Pyropia yezoensis U6 gene and uses thereof
Li et al. Efficient expressions of reporter genes in the industrial filamentous fungus Sclerotium rolfsii mediated by Agrobacterium tumefaciens
US20230348917A1 (en) Expression vector for use in methanotroph
Weber et al. Factors affecting homologus overexpression of the Sacchromyces cerevisiae Lanosterol 14α‐demethylase gene

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 09155972

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 97537227

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase