WO1998012334A2 - Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin - Google Patents

Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin Download PDF

Info

Publication number
WO1998012334A2
WO1998012334A2 PCT/US1997/016123 US9716123W WO9812334A2 WO 1998012334 A2 WO1998012334 A2 WO 1998012334A2 US 9716123 W US9716123 W US 9716123W WO 9812334 A2 WO9812334 A2 WO 9812334A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
molecule
antibody
human
immunologic
Prior art date
Application number
PCT/US1997/016123
Other languages
French (fr)
Other versions
WO1998012334A9 (en
WO1998012334A3 (en
Inventor
Guy L. Reed
Linda Harris
Jurgen Bajorath
Gary Matsueda
Mei-Yin Hsu
Jiri Novotny
Original Assignee
The General Hospital Corporation
The President And Fellows Of Harvard College
Bristol-Myers Squibb Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The General Hospital Corporation, The President And Fellows Of Harvard College, Bristol-Myers Squibb Company filed Critical The General Hospital Corporation
Priority to AU44135/97A priority Critical patent/AU741338B2/en
Priority to CA002266339A priority patent/CA2266339A1/en
Priority to EP97942436A priority patent/EP0941345A2/en
Priority to JP10514756A priority patent/JP2001502895A/en
Publication of WO1998012334A2 publication Critical patent/WO1998012334A2/en
Publication of WO1998012334A3 publication Critical patent/WO1998012334A3/en
Publication of WO1998012334A9 publication Critical patent/WO1998012334A9/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/86—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood coagulating time or factors, or their receptors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/38—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against protease inhibitors of peptide structure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a composition and method of treatment for pulmonary embolism, myocardial infarction, thrombosis, and stroke in a patient, and more specifically to a therapy which enhances fibrinolysis comprising administering an alpha-2-antiplasmin-binding molecule.
  • the invention also relates to a treatment for enhancing fibrinolysis comprising administering an alpha-2- antiplasmin-binding molecule together with a thrombolytic agent.
  • Venous thrombosis and pulmonary embolism are major causes of morbidity and mortality in the United States, accounting for about 270,000 hospitalizations a year (Anderson, F.A., Jr. etal., Arch. Intern. Med. 757:933-938 (1991)). In addition, it is estimated that about 50,000-200,000 patients a year die from pulmonary embolism (Lilienfeld, D E. et al. , Chest 98: 1067- 1072 (1990)).
  • Clots are composed of fibrin and blood platelets in various ratios
  • the fundamental reaction in blood clotting involves the conversion of a soluble plasma protein (fibrinogen) into insoluble fibrin
  • fibrinogen a soluble plasma protein
  • fibrinogen a soluble plasma protein
  • thrombin a serine protease
  • Clot lysis is mediated by plasmin Under natural conditions, plasminogen is converted to plasmin by plasminogen activators Natural plasmin inhibitors include ⁇ 2-antiplasmin, ⁇ 2-macroglobulin and ⁇ -1-antitrypsin, all glycoproteins Alpha-2-antiplasmin has a much higher affinity for plasmin than ⁇ 2-macrogIobulin and binds specifically to plasmin in a 1 1 ratio The larger pool of ⁇ - macroglobulin acts as a reservoir inhibitor (Kane, K.K , Ann. Clm. Lab. Sci. 14 443-449 (1984)) Thus, clot lysis by the administration of t-PA is limited by the rapid and irreversible inactivation of plasmin by plasmin inhibitors.
  • Standard therapy for venous thromboembolism is heparin, which potentiates thrombin and factor Xa inhibition by antithrombin III (Goldhaber, S ,
  • plasminogen activators cause significant increases in the lysis of venous thromboemboli, but patients are frequently left with large amounts of residual thrombi in the lungs or deep veins immediately after therapy (Goldhaber, S.Z. et al, Lancet 2:886-889 (1986); "The Urokinase Pulmonary Embolism Trial," Circulation ⁇ 7:1-108 (1973); Goldhaber, S.Z. et al, Am. J. Med. 55:235-240 (1990); Goldhaber, S.Z. et al, Lancet 341:507-51 1
  • ⁇ 2AP is an ultrafast covalent inhibitor of plasmin (the enzyme that degrades thrombi)
  • plasmin the enzyme that degrades thrombi
  • ⁇ 2AP is a particularly likely cause of thrombus resistance (Collen, D., Eur. J. Biochem. 69:209-216 (1976); Moroi, M. and Aoki, N.,
  • ⁇ 2AP is the only fibrinolytic inhibitor that is covalently crosslinked to the fibrin surface (Sakata, Y. and Aoki, N., J. Clin. Invest. 69:536-542 (1982)). This crosslinking (by activated factor XIII) concentrates ⁇ 2AP on the fibrin surface, where it inhibits the initiation of fibrinolysis (Sakata, Y. and Aoki, N., J. Clin. Invest. 69:536-542 (1982)).
  • the clot may be dissolved through the use of agents capable of lysing the fibrin thrombus, and thereby permitting blood to again flow through the affected blood vessel.
  • agents include plasmin, anti-coagulants (such as, for example, heparin, hirudin and activated protein C), plasminogen activators (such as, for example, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, staphylokinase, and vampire bat plasminogen activator), and other such agents (Ganz, W. et al, J. Amer. Coll.
  • Alpha-2-antiplasmin (C.2AP) has three functional domains: the reactive site for plasmin, the plasmin(ogen) or LBS-binding site [complementary to the LBS (lysine-binding site) of plasmin(ogen)], and the crosslinking site for fibrin.
  • Mimuro et al. discloses antibodies to ⁇ 2AP, one of which (JPTI-1) was specific to the reactive site of ⁇ 2AP and prevented formation of ⁇ 2AP complexes, thereby inhibiting antiplasmin activity.
  • JPTI-1 was specific to the reactive site of ⁇ 2AP and prevented formation of ⁇ 2AP complexes, thereby inhibiting antiplasmin activity.
  • Mimuro et al. does not teach administration of the JPTI-1 antibody to enhance clot lysis.
  • Other antibodies specific for ⁇ 2AP are taught by Plow, E.F. etal, J. Biol. Chem. 255:2902-2906 (1980); Wimen, B. et al, Scan. J. Clin. Lab. Invest. 43:27-33 (1983); Hattey, E. et al, Thromb. Res. ⁇ 5.485-495 (1987); Collen, U.S. Patent No
  • the present invention relates to an improved thrombolytic therapy for the treatment of pulmonary embolism, myocardial infarction, thrombosis and stroke in patients.
  • the invention is directed to an immunologic molecule capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked ⁇ 2-antiplasmins.
  • the immunologic molecule is a chimeric antibody, a humanized antibody, or a single chain antibody.
  • the invention is also directed to a method for treating pulmonary embolism, myocardial infarction, thrombosis and stroke in a patient comprising administering an ⁇ 2-antiplasmin-binding molecule capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked o.2-antiplasmins.
  • the invention further provides a method of treatment for pulmonary embolism, myocardial infarction, thrombosis and stroke in a patient which comprises co-administrating to a patient in need of such treatment:
  • the invention provides a monoclonal antibody or fragment thereof wherein the monoclonal antibody is capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked ⁇ 2- antiplasmins.
  • the invention is monoclonal antibody 77A3.
  • the invention is monoclonal antibody 49C9. In another embodiment, the monoclonal antibody is 70B11.
  • the invention also provides a method of making the monoclonal antibody comprising: (a) immunizing an animal with ⁇ 2-antiplasmin or fragment thereof;
  • the invention provides a hybridoma cell line which produces the monoclonal antibody capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked ⁇ 2- antiplasmins.
  • the invention is hybridoma cell line 77 A3 (ATCC Accession No. HB-12192; Deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20862 on September 20, 1996).
  • the invention is directed to a method of making the hybridoma cell line comprising:
  • the invention also provides a method for treating a number of diseases and conditions, including pulmonary embolism, myocardial infarction, thrombosis and stroke in a patient comprising administering a therapeutically effective amount of an immunologic molecule which is capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked o.2-antiplasmins, thereby treating the patient.
  • the invention further provides a method of treatment for pulmonary embolism, myocardial infarction, thrombosis or stroke in a patient which comprises co-administering to a patient in need of such treatment:
  • the thrombolytic agent is plasmin, anticoagulant, or plasminogen activator.
  • the anti-coagulant is selected from the group consisting of heparin, hirudin and activated protein C.
  • the plasminogen activator is selected from the group consisting of staphylokinase, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, and vampire bat plasminogen activator.
  • inventions include, the immunologic molecule provided to the patient by an intravenous infusion, by an intravenously injected bolus, or with a first bolus containing the immunologic molecule (a) and a subsequently administered second bolus containing the thrombolytic agent (b). Further embodiments include, the immunologic molecule (a) provided to the patient at a dose of between 3 to 300 nmole per kg of patient weight; and the thrombolytic agent (b) provided to the patient at a dose of between 0.01 to 3.0 mg per kg of patient weight.
  • the invention provides a kit useful for carrying out the method of treatment for pulmonary embolism, myocardial infarction, thrombosis or stroke in a patient, being compartmentalized in close confinement to receive two or more container means therein, which comprises:
  • a first container containing a therapeutically effective amount of the immunologic molecule (a); and (2) a second container containing a therapeutically effective amount of the thrombolytic agent (b), wherein the immunologic molecule (a) is different from the thrombolytic agent (b).
  • the invention also provides nucleic acid molecules encoding immunologic molecules capable of binding to both (1) human and nonhuman circulating ⁇ 2- antiplasmins and (2) human and nonhuman fibrin crosslinked ⁇ 2-antiplasmins.
  • molecules comprising an amino acid sequence of the binding region of an immunologic molecule described herein.
  • FIG. 1 Comparison of binding to 125 I- ⁇ 2-antiplasmin of monoclonal antibodies 49C9, 70B11, 77 A3, RWR and anti-digoxin (control). Wells of a microtiter plate were coated with goat antimouse antibody The wells were incubated in duplicate with 49C9, 70B1 1, 77A3, RWR or a control (antidigoxin) MAb (Mudgett-Hunter, M. et al, Mol Immunol. 22:477-488 (1985)). After a wash, ,25 I- ⁇ 2AP (60,000 cpm) was added for an hour. The wells were rinsed and the amount of bound ,25 I- ⁇ 2AP was measured in a gamma counter.
  • FIG. 3 Comparison of amount of lysis by different monoclonal antibodies (or TBS alone) as a function of dose of urokinase. See Example 1, below, for detailed description of the method. The amount of lysis was determined by gamma counting. The percent lysis was defined at 100 x (total supernatant cpm ⁇ total clot cpm).
  • FIG. 1 Reduced SDS-polyacrylamide gel electrophoresis of 77 A3 purification. Ascites containing 77 A3 were harvested and purified. Lane 1, protein standards with molecular mass in kDa (left); lane 2, supernatant after precipitation with 40% ammonium sulfate; lane 3, purified 77 A3.
  • the reduced 77 A3 immunoglobulin consists of bands of -50 kDa, corresponding to the heavy chain, and -25 kDa, corresponding to the light chain.
  • FIG. 6 Effect of 77 A3 on the rate of lysis of ferret plasma clots in vitro.
  • Ferret plasma clots formed with trace amounts of 12S I-labeled human fibrinogen were incubated with 100 ⁇ l of TBS (control) or purified MAb (25 ⁇ g, 77A3 or RWR).
  • Clot lysis was initiated by adding 0.1 unit of rt-PA per tube. The clots were incubated at 37°C and the amount of lysis was determined by sampling for the release of radiolabeled fibrin degradation products into the supernatant as described (Reed, G.L. Ill et al, Proc. Natl. Acad. Sci. USA 57:1114-1118
  • FIG. 8 Effect of rt-PA and ⁇ 2AP inhibition on the lysis of pulmonary e boli in vivo.
  • Anesthetized ferrets were given a heparin bolus (100 U/kg) and 125 I-labeled fibrin clots were embolized into the lungs.
  • three groups of ferrets were given rt-PA (0, 1, or 2 mg/kg) over 2 hours intravenously (plain bars).
  • Two other groups of ferrets also received rt-PA (1 mg/kg) and a control MAb (antidigoxin, black bar, 22.5 mg/kg) or a MAb that inhibits ⁇ 2AP (77 A3, striped bar, same dose).
  • the graph shows the amount of lysis (mean ⁇ SD) for each treatment group. The number of ferrets in each treatment group is shown, and the P values for differences between groups are indicated.
  • FIG. 9 Residual fibrinogen levels in animals treated with heparin, rt-PA, and an 0.2AP inhibitor. Blood samples were collected (on EDTA with aprotinin) from ferrets before pulmonary embolization and at the end of the experiment. Residual fibrinogen levels were measured as described (Rampling,
  • the graph shows the mean ⁇ SD percentage residual fibrinogen level for animals receiving rt-PA alone (0, 1, or 2 mg/kg; plain bars) and those receiving rt-PA and the ⁇ 2AP inhibitor (striped bar).
  • Figure 10 The peptide sequences of the amino terminus of purified light chains from 49C9 (SEQ ID NO: 1) , 70B11 (SEQ ID NO:2) and 77A3 (SEQ ID NO: 3) are shown.
  • FIG 11. The cDNA sequence (SEQ ID NO:4) and corresponding deduced amino acid sequence of the signal peptide (amino acids -20 to -1 of SEQ LD NO:5) and light chain variable regions (amino acids 1 to 107 of SEQ LD NO:5) of 49C9 are shown.
  • Figure 12. The cDNA sequence (SEQ ID NO:6) and corresponding deduced amino acid sequence of the signal peptide (amino acids -20 to -1 of SEQ LD NO:7) and light chain variable regions (amino acids 1 to 107 of SEQ LD NO:7) of70Bl l are shown.
  • FIG. 13 The cDNA sequence (SEQ LD NO: 8) and corresponding deduced amino acid sequence of the signal peptide (amino acids -20 to -1 of SEQ LD NO:9) and light chain variable regions (amino acids 1 to 107 of SEQ LD NO:9) of77A3 are shown.
  • LD NO: 11 heavy chain variable regions (amino acids 1-1 19 of SEQ LD NO: 11) of 49C9 are shown.
  • Figure 15 The cDN A sequence (SEQ LD NO : 12) and corresponding deduced amino acid sequence of the signal peptide (amino acids -19 to -1 of SEQ LD NO: 13) and heavy chain variable regions (amino acids 1-1 19 of SEQ LD
  • FIG. 16 The cDNA sequence (SEQ LD NO: 14) and corresponding deduced amino acid sequence of the signal peptide (amino acids -19 to -1 of SEQ LD NO: 15) and heavy chain variable regions (amino acids 1-119 of SEQ LD NO: 15) of 77A3 are shown.
  • Figure 17 The cDNA sequence (SEQ LD NO: 16) and corresponding amino acid sequence (SEQ LD NO: 17) of humanized77A3-l and humanized 77 A3 -2 light chain. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders.
  • Figure 18 The cDNA sequence (SEQ LD NO: 18) and corresponding amino acid sequence (SEQ LD NO: 19) of humanized 77A3-1 heavy chain. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders.
  • FIG. 19 The cDNA sequence (SEQ LD NO:20) and corresponding amino acid sequence (SEQ LD NO:21) of humanized 77A3-2 heavy chain. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders.
  • Figure 20 Results of murine 77 A3 (X), chimeric 77 A3 (•) and humanized 77A3-1 ( ⁇ ) in the plasmin assay with chromogenic substrate are shown.
  • Figure 21 The amino acid sequences of the light chains are shown: h77A3-l and h77A3-2 (SEQ LD NO: 17); m77A3 (SEQ LD NO:9); m49C9 (SEQ LD NO:5); m70Bl 1 (SEQ LD NO:7); murine consensus (SEQ LD NO:75), which shows the consensus between m77A3, m49C9, and m70B l l ; 77A3/49C9 consensus (SEQ LD NO:76), which shows the consensus between 77A3 and 49C9; and all (SEQ LD NO:77), which shows the consensus between h77A3-l, h77A3-2, m77A3, m49C9, and m70Bl 1. Positions falling withing the CDR loops are shown enclosed within the boxes.
  • FIG. 22 The amino acid sequences of the heavy chains are shown.
  • h77A3-l SEQ LD NO: 19
  • H77A3-2 SEQ LD NO:21
  • m77A3 SEQ ID NO: 15
  • m49C9 SEQ LD NO: 11
  • m70B 11 SEQ LD NO: 13
  • humanized consensus SEQ ID NO:78
  • murine consensus SEQ LD NO: 79
  • 77A3/49C9 consensus SEQ LD NO:80
  • SEQ ID NO: 81 Positions falling withing the CDR loops are shown enclosed within the boxes.
  • Alpha-2-antiplasmin is a molecular mediator of the thrombus resistance in patients with pulmonary embolism.
  • a specific inhibitor of ⁇ 2AP is described which is used to determine the role played by ⁇ 2 AP in the regulation of fibrinolysis.
  • ⁇ 2AP-binding molecule includes antibodies (polyclonal or monoclonal), as well as ligands.
  • an "immunologic molecule” refers to polypeptides comprising the binding region of a monoclonal antibody.
  • monoclonal antibodies, antibody fragments, chimeric antibodies, humanized antibodies, and fusion proteins comprising antibody binding regions are "immunologic molecules”.
  • antibody or “monoclonal antibody” (MAb) is meant to include intact molecules as well as antibody fragments (such as, for example, Fv, Fab and F(ab') 2 fragments), single chain antigen-binding proteins, "humanized” antibodies, and chimeric antibodies which are capable of specifically binding to ⁇ 2AP.
  • Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less nonspecific tissue binding of an intact antibody (Wahl et al, J. Nud. Med. 24: 16-325 (1983)). Thus, these fragments are preferred.
  • an antibody is said to be “capable of binding” a molecule if it is capable of specifically reacting with the molecule to thereby bind the molecule to the antibody.
  • hapten is intended to refer to any molecule capable of being bound by an antibody.
  • epitope is meant to refer to that portion of a hapten which can be recognized and bound by an antibody.
  • a hapten or antigen may have one, or more than one epitope.
  • An "antigen” or “immunogen” is a hapten which is additionally capable of inducing an animal to produce antibody capable of binding to an epitope of that antigen.
  • the specific reaction referred to above is meant to indicate that the hapten will react, in a highly selective manner, with its corresponding antibody and not with the multitude of other antibodies which may be evoked by other antigens.
  • the antibodies of the present invention may be prepared by any of a variety of methods. For example, cells expressing ⁇ 2AP (or fractions, lysates, etc thereof) can be administered to an animal in order to induce the production of sera containing polyclonal antibodies that are capable of binding ⁇ 2AP.
  • a preparation of ⁇ 2AP of the present invention is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • the antibodies of the present invention may also be prepared using phage display technology. Methods of preparing antibodies using phage display are known in the art. See, for example, U.S. Patent No.
  • the im unogenic molecules of the present invention are monoclonal antibodies (or ⁇ 2AP binding molecules).
  • Such monoclonal antibodies can be prepared using hybridoma technology (Kohler et al, Nature 256:495 (1975); Kohler et al, Eur. J. Immunol.
  • Such procedures involve immunizing an animal (preferably a mouse) with the antigen or with a cell which expresses the antigen.
  • a preferred antigen is purified ⁇ 2AP.
  • the most preferred antigen is cc2AP fragment (fibrin binding region) obtained by trypsin digest of a plasma clot, then affinity purified with a SEPHAROSE-coupled monoclonal antibody, RWR (Reed, G.L.
  • Suitable cells can be recognized by their capacity to secrete anti- ⁇ 2AP antibody.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with
  • mice 10% fetal bovine serum (inactivated at about 56°C), and supplemented with about 10 ⁇ g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ⁇ g ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • the method of somatic cell fusion is described in Galfre, G. and Milstein, C, Meth. En ⁇ ymol 75:3-46 (1981).
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al, Gastroenterology 50:225- 232 (1981).
  • hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding ⁇ 2AP.
  • additional antibodies capable of binding to the ⁇ 2AP antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies.
  • Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody.
  • ⁇ 2AP-specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the ⁇ 2AP-specific antibody can be blocked by the ⁇ 2AP antigen.
  • Such antibodies comprise anti-idiotypic antibodies to the ⁇ 2AP-specific antibody and can be used to immunize an animal to induce formation of further ⁇ 2AP-specific antibodies.
  • Fab and F(ab') 2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
  • Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • ⁇ 2AP-binding fragments can be produced through the application of recombinant DNA technology, through synthetic chemistry, or biotinylation.
  • humanized or chimeric antibodies produced using genetic constructs derived from hybridoma cells producing the MAbs described above.
  • Humanized antibodies are antibodies in which the framework or other regions of the murine Ab is replaced with the homologous regions of a nonmurine antibody.
  • Chimeric antibodies are antibodies in which the murine constant region has been replaced with a non-murine constant region. Methods for production of chimeric antibodies are known in the art. See, for review: Morrison, Science, 229: 1202-1207 (1985); Oi et al, BioTechniques
  • single-chain antibodies capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked c 2-antiplasmins.
  • Methods of making single chain antibodies are well known in the art. See, for example, U.S. Patent No. 4,946,778; U.S. Patent No. 5,260,203; U.S. Patent No. 5,091,513; and U.S. Patent No. 5,455,030, all of which are herein incorporated by reference.
  • the present inventors have determined the nucleotide and amino acid sequence of several immunologic molecules capable of binding to both (1) human and nonhuman circulating ⁇ 2-antiplasmins and (2) human and nonhuman fibrin crosslinked «2-antiplasmins. Accordingly, the present invention provides for nucleic acid molecules comprising a nucleotide sequence encoding for an immunologic molecule of the present invention or fragment thereof.
  • DNA clones containing nucleotide sequences encoding the following antibody chains were deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20862 on September 19, 1997: light chain of 77 A3 (77A3 LC), ATCC Accession No. ; light chain of 49C9 (49C9 LC), ATCC Accession No. ; light chain of 70B11 (70B11 LC), ATCC
  • the nucleic acid molecules of the present invention include: nucleic acid molecules containing a nucleotide sequence encoding the mature light chain of
  • nucleic acid molecules containing a nucleotide sequence encoding the mature light chain of 49C9 as shown in SEQ LD NO: 5 or as encoded by the clone contained in ATCC Accession No. nucleic acid molecules containing a nucleotide sequence encoding the mature light chain of 70B 11 as shown in SEQ LD NO: 7 or as encoded by the clone contained in
  • nucleic acid molecules containing a nucleotide sequence encoding an antibody heavy chain including: nucleic acid molecules containing a nucleotide sequence encoding the mature heavy chain of 77 A3 as shown in SEQ LD NO: 15 or as encoded by the clone contained in ATCC Accession No. ; nucleic acid molecules containing a nucleotide sequence encoding the mature heavy chain of 49C9 as shown in SEQ LD NO: 11 or as encoded by the clone contained in ATCC Accession No. ; and nucleic acid molecules containing a nucleotide sequence encoding the mature heavy chain of 70B11 as shown in SEQ LD NO: 13 or as encoded by the clone contained in ATCC Accession No. .
  • nucleic acid molecules encoding humanized antibodies including: nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 of SEQ LD NO: 17; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 1 19 of SEQ ID NO: 19; and nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO:21.
  • nucleic acid molecules encoding "consensus" amino acid sequences of heavy and light chain of antibodies including: nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 of SEQ LD NO: 75; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 to of SEQ ID NO:76; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 of SEQ LD NO: 77; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO:78; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ ID NO: 79; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO: 80; and
  • Nucleic acid molecules encoding an immunologic molecule of the present invention can be used to express recombinant proteins.
  • a nucleic acid molecule encoding an immunologic molecule of the present invention can be inserted into a vector in accordance with conventional techniques.
  • a "vector” should be understood as a nucleic acid vehicle used for cloning or expressing a desired sequence in a host.
  • the recombinant vector is capable of expressing the immunologic molecule of the present invention.
  • a vector is said to be "capable of expressing" a polypeptide if it contains a nucleotide sequence that encodes for the polypeptide, as well as transcriptional and translational regulator information operably linked to the nucleotide sequence that encodes the polypeptide.
  • Two nucleotide sequences are said to be “operably linked” if the nature of the linkage between the two nucleotide sequences does not: result in the introduction of a frame-shift mutation; interfere with the ability of the promoter region sequence to direct the transcription of the desired sequence; or interfere with the ability of the desired sequence to be transcribed by the promoter region sequence.
  • a promoter region would be operably linked to a desired nucleotide sequence if the promoter were capable of effecting transcription of that nucleotide sequence.
  • the recombinant vector can be introduced into a host cell, either prokaryotic or eukaryotic, by a variety of conventional techniques including transfection, transduction, electroporation, calcium-phosphate precipitation, and microi ⁇ jection.
  • Prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, and Salmonella. The most preferred prokaryotic host is E. coli.
  • Eukaryotic hosts include yeast cells, insect cells, and mammalian cells, such as COS cells, CHO cells, and myeloma cells. In one embodiment of the invention, CHO cells are preferred.
  • a nucleic acid molecule comprising a nucleotide sequence encoding for the light chain of an antibody is introduced into a vector, and a nucleic acid molecule comprising a nucleotide sequence encoding for the heavy chain of an antibody is introducing into another vector.
  • Both vectors are introduced into the same host cell.
  • both chains could be introduced into the same vector.
  • the polypeptide can be readily isolated using standard techniques, including affinity chromatography.
  • molecules comprising an amino acid sequence of the binding region of an immunologic molecule described herein are also intended within the scope of the present invention.
  • Molecules comprising an amino acid sequence of the binding region of an immunologic molecule described herein include, but are not limited to, monoclonal antibodies, humanized antibodies, chimeric antibodies, fragments of any such antibodies, single chain antibodies, fusion proteins, and the like. Such molecules can be used in the assays and methods of treatment of the present invention described below.
  • the amino acid sequence of the binding region of the immunologic molecules of the present invention are shown in Figure 21 for the light chains and Figure 22 for the heavy chains.
  • the ⁇ 2AP is electrophoresed on a slab minigel under reducing and non-reducing conditions.
  • the gel is electroblotted to polyvinylidene difluoride membrane.
  • the blot is exposed to different hybridoma supernatants in the channels of a miniblotter apparatus. After washing, the bound antibody is detected by incubation with 125 I- goat antimouse antibody. After additional washing, the membrane is exposed in a phosphorimager (Molecular Devices, Sunnyvale, CA).
  • radioimmunoassays are also known.
  • the wells of a microtiter plate are coated with goat antimouse antibody.
  • the wells are washed and blocked with BSA.
  • the hybridoma supernatants are added to the empty wells.
  • the wells are washed and 125 I- ⁇ 2AP is added.
  • the wells are cut and the bound antibody is measured by gamma scintillation counting.
  • the wells of a microtiter plate are coated with a competing MAb.
  • the binding of MAbs to 125 I- ⁇ 2AP preferably, the fibrin binding region fragment of ⁇ 2 AP, obtained by binding to RWR
  • clot assays are also known (see, for example, Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 57: 1 114-1118 (1990).
  • plasma is mixed with 125 I-fibrinogen, then clotted by mixing with CaCl 2 and thrombin Clots are compressed and washed with T ⁇ s-buffered saline to remove unbound proteins The supernatant is removed and the clots counted in a gamma counter To each set of duplicate clots is added, various amounts of plasminogen activator, anti-coagulant, and Tris-buffered saline containing the
  • the clots are incubated and at various intervals, a portion of the solution is temporarily removed and gamma-counted to determine the amount of lysis
  • the percent lysis may be defined at 100X (total supernatant cpm/total clot cpm)
  • Fibrinogen assays are known. Blood samples and platelet-poor plasma are assayed for fib ⁇ nogen by, for example, the sodium sulfite method (Rampling, M W and Gaffhey, P J , Clin. C m. Ada. 6743-52 (1976))
  • Alpha-2-antiplasmin levels in plasma are assayed, for example, with a chromogenic substrate assay for plasmin inhibition (Stachrom kit) as described in Reed, G L , III et al. , Proc. Natl. Acad. Sci. USA 87 1114- 1118 ( 1990)
  • Statistical tests may be analyzed by, for example, a one way analysis of variance followed by a Bonferroni-Dunn procedure for multiple comparison testing
  • thromboembolism an in vitro blood or fibrin clot, or "thrombi” in a patient
  • Diseases treated according to the methods of his invention include, but are not limited to pulmonary thromboembolism, acute coronary syndrome, including unstable angina pectoris and non-Q-wave myocardial infarction, various forms of thrombosis, including venous thrombosis (e.g., deep venous thrombosis), and arterial thrombosis (e.g., renal, mesenteric, and limb thrombosis); and cerebral and thrombosis embolism; renal vein and peripheral arterial thrombosis, myocardial infarction, stroke, and other thromboses.
  • pulmonary thromboembolism an in vitro blood or fibrin clot, or "thrombi” in a patient
  • acute coronary syndrome including unstable angina pectoris and non-Q-wave myocardial infarction
  • various forms of thrombosis including ve
  • This method may also be used to treat thrombotic conditions secondary or concomitant to surgical procedures, including percutaneous transluminal coronary angioplasty, peripheral arterial angioplasty, bypass graft, and stent.
  • the "treating" or “treatment” is by, for example, inhibiting the formation of a thrombus, dissolving a thrombus, or by enhancing fibrinolysis.
  • co-administration is intended that each of the hapten-binding molecule and thrombolytic agent will be administered during a time frame wherein the respective periods of pharmacological activity overlap. The two agents may be administered simultaneously or sequentially.
  • the ⁇ 2AP-binding molecules of the present invention may be monoclonal antibodies or fragments thereof. It is preferable to employ the F(ab') 2 fragment of such an antibody for this purpose, in order to minimize any immunological reaction caused by the Fc portion of the immunoglobulin. Also preferred are single-chain antibodies, such as sFv. Procedures for preparing monoclonal antibodies are disclosed by Kaprowski, H. et al, United States Patent No. 4,172, 124, and Kohler et al, Nature 256:495-497 (1975). The preparation of monoclonal antibodies capable of preventing the inhibition of plasmin are taught by Mimuro, J. et al, Blood 69:446-453 (1987), and described in the examples section of the present application.
  • an "antigen” is a molecule capable of being bound by an antibody such as, for example, ⁇ 2AP.
  • the "antigen-binding molecule” must be capable of binding to a plasmin inhibitor and thereby prevent such an inhibitor from forming inhibitor- plasmin complexes. Any such antigen-binding molecule may be employed in accordance with the present invention.
  • a preferred embodiment is ⁇ 2AP-binding molecule which is capable of binding to ⁇ 2AP or fragment thereof.
  • An especially preferred o.2AP-binding molecule for this pu ose is a monoclonal antibody.
  • Preferred embodiments of the monoclonal antibody is 77 A3, 70B11 or 49C9, described more fully below.
  • the hybridoma producing MAb 77 A3 has been deposited under the terms of the Budapest Treaty with the International Depository Authority American Type Culture Collection, 12301 Parklawn Drive,
  • chimeric an humanized antibodies are also preferred.
  • An especially preferred chimeric antibody for this purpose is c77A3, described more fully below.
  • Especially preferred humanized antibodies for this purpose are h77A3-l and h77A3-2, described more fully below.
  • antibody fragments and single-chain antibodies including sFv77A3-l and sFv77A3-2, described below.
  • thrombolytic agent are meant to refer to any agent capable of either dissolving a fibrin and/or platelet clot (or thrombus), or inhibiting the formation of such a clot.
  • thrombolytic agents include fibrinolytic molecules, such as plasmin, plasminogen activator (for example, staphylokinase, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, and vampire bat plasminogen activator); anti-coagulants (for example, inhibitors of fibrin formation, such as heparin, hirudin and activated protein C; and anti-platelet agents, such as ticlopidine, aspirin, and clopidigrel and inhibitors of glycoprotein
  • tissue-type plasminogen activator as used herein is intended to include such hybrids, fragments and mutants, as well as both naturally derived and recombinantly derived tissue-type plasminogen activator.
  • the methods of the invention comprise the administration of the ⁇ 2AP-binding molecule alone or in combination with a thrombolytic agent.
  • the ⁇ 2AP-binding molecule When administered alone the molecule enhances endogenous fibrinolysis or thrombolysis by significantly augmenting clot lysis by endogenous plasminogen activators.
  • administration of the ⁇ 2AP-binding molecule does not increase fibrinogen consumption over that obtained with equivalent doses of t-PA alone.
  • the present method of clot-specific inhibition of cc2AP enhances the potency of the plasminogen activator and preserves its fibrin selectivity.
  • the ⁇ 2AP-binding molecule is administered with a thrombolytic agent.
  • the ⁇ 2AP-binding molecule and the thrombolytic agent of the present invention are intended to be co-administered to the recipient. It is preferable to provide the ⁇ 2AP-binding molecule to the patient prior to the administration of the thrombolytic agent.
  • the ⁇ 2AP-binding molecule of the present invention is provided for the purpose of preventing the inhibition of plasmin by a plasmin inhibitor. It has been discovered that coadministration of the ⁇ 2AP-binding molecule together with a thrombolytic agent causes a synergistic effect, and thereby enhances clot lysis (thrombolysis) to a greater extent than would be expected if the effects of ⁇ 2AP- binding molecule administration and thrombolytic agent administration was merely additive.
  • the ⁇ 2AP-binding molecule of the present invention encompasses clot- specific inhibitors of ⁇ 2AP. It is demonstrated that the combination of t-PA and the specific inhibitors, particularly monoclonal antibodies to oc2AP, does not increase fibrinogen consumption over that obtained with equipotent doses of plasminogen activator alone. Further, clot-specific inhibition of ⁇ 2AP enhances the potency of plasminogen activators and preserves fibrin selectivity. For agents such as urokinase, which is not selective for fibrin, inhibition of clot bound ⁇ 2AP would cause a similar, or more pronounced, enhancement in potency and lead to less fibrinogen consumption as well.
  • thrombolysis is significantly increased compared with the lysis achieved by equivalent doses of the thrombolytic agent alone. This increased lysis by the combination of the thrombolytic agent and ⁇ 2AP inhibitor occurs without decreasing circulating fibrinogen or ⁇ 2AP levels. The net result is a synergistic interaction between the two agents.
  • an amount of ⁇ 2AP-binding molecule capable of preventing inhibition of plasmin and thereby enhancing clot lysis when provided to a patient is a "therapeutically effective" amount.
  • a therapeutically effective amount In order to enhance clot lysis and prevent clot reformation, it is desirable to provide between 3 to 300 nmole of ⁇ 2AP -binding molecule per kilogram of patient weight. This dosage may be administered, in one embodiment, over a period of between 60 to 480 minutes, by continual intravenous infusion at a rate of 0.006 to 5 nmole/kg/min.
  • the ⁇ 2AP -binding molecule in an intravenously injectable bolus at a dose of between 3 to 600 nmole/kg, and most preferably between 30 to 60 nmole (of ⁇ 2AP-binding molecule) per kilogram of patient weight. If the ⁇ 2AP-binding molecule is provided in this manner, a single bolus is sufficient to prevent potential clot reformation.
  • the ⁇ 2AP-binding molecule of the present invention may be dissolved in any physiologically tolerated liquid in order to prepare an injectable bolus. It is preferable to prepare such a bolus by dissolving the C.2AP -binding molecule in normal saline.
  • ⁇ x2AP-binding molecule capable of preventing inhibition of plasmin When the ⁇ x2AP-binding molecule capable of preventing inhibition of plasmin is co-administered with a thrombolytic agent, it is desirable to provide 3 to 300 nmole of ⁇ 2AP-binding molecule per kilogram of patient weight. This dosage may be administered, in one embodiment, over a period of 60 to 480 minutes, by continuous intravenous infusion. Alternatively, it is possible to provide the ⁇ 2AP-binding molecule in an intravenously injectable bolus at a dose of between 3 to 600 nmole/kg, and most preferably between 30 to 60 nmole/kg of patient weight. An amount of thrombolytic agent capable of causing such lysis is a "therapeutically effective" amount.
  • the thrombolytic agent is provided over a prolonged period (i.e., from about 180 to about 1440 minutes).
  • the thrombolytic agent of the present invention is provided as an intravenously injected bolus containing between 0.5 to 1.0 mg/kg, and most preferably between 0.5 to 0.75 mg/kg.
  • the dosage of t-PA by continuous infusion is -100 mg for 2 hours (Goldhaber, S.C. et al, Lancet 341:507 (1993)).
  • thrombolytic agent of the present invention is generally known in the art (see, e.g., Hemostasis and Thrombosis: Basic Principles and Clinical Practice, 3rd ed. Philadelphia, PA (1994)).
  • the thrombolytic agent of the present invention may be dissolved in any physiologically tolerated liquid in order to prepare an injectable bolus. It is, however, preferable to prepare such a bolus by dissolving the thrombolytic agent in normal saline.
  • a patient treated according to the preferred embodiment will, therefore, receive an intravenously injected bolus of the ⁇ 2AP-binding molecule in combination with an intravenously injected bolus of the thrombolytic agent.
  • This preferred treatment rriinimizes the amount of t-PA required for thrombolysis, thus reducing the extent of fibrinogen breakdown and lessening any tendency for general hemorrhage.
  • the use of the preferred treatment results in the dissolution of the occluding thrombus at a rate which greatly exceeds the rate of thrombus dissolution when either the ⁇ 2AP-binding molecule or the thrombolytic agent is provided by infusion alone. Additionally, the risk of reocclusion is substantially reduced.
  • fibrin-bound ⁇ 2AP plays a critical role in determining the rate of lysis by any exogenous plasminogen activator.
  • the preferred embodiment therefore, provides a method of treatment in which the administration of a bolus of a ⁇ 2AP-binding molecule in combination with the administration of a bolus of a thrombolytic agent are capable of dissolving an occluding thrombus at a faster rate than can be obtained when either compound is administered alone. Moreover, the preferred embodiment accomplishes this goal while minimizing both fibrinogen breakdown and the risk of reocclusion. Thus, the combination of agents can significantly increase the potency and specificity of thrombolytic therapy.
  • the required dosage of the anti- ⁇ 2AP binding molecule or thrombolytic agent will depend upon the severity of the condition of the patient, and upon such criteria as the patient's height, weight, sex, age, and medical history.
  • the ⁇ 2AP-binding molecule or thrombolytic agent of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, such as by admixture with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their formulation are described, for example, in Remington's Pharmaceutical Sciences, 16th Ed., Osol, A, ed., Mack, Easton PA (1980).
  • a pharmaceutically acceptable composition suitable for effective administration such compositions will contain an effective amount of the ⁇ 2AP-binding molecule or thrombolytic agent, either alone, or with a suitable amount of carrier vehicle.
  • ControUed release preparations may be achieved by the use of polymers to complex or absorb the ⁇ 2AP-binding molecule or thrombolytic agents of the present invention.
  • the controlled delivery may be exercised by selecting appropriate macromolecules (for example, polyesters, polyamino acids, polyvinyl pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, or protamine sulfate).
  • the rate of drug release may also be controlled by altering the concentration of such macromolecules.
  • Another possible method for controlling the duration of action comprises incorporating the therapeutic agents into particles of a polymeric substance such as polyesters, polyamino acids, hydrogels, poly(lactic acid) or ethylene vinylacetate copolymers.
  • a polymeric substance such as polyesters, polyamino acids, hydrogels, poly(lactic acid) or ethylene vinylacetate copolymers.
  • Such teachings are disclosed in Remington's Pharmaceutical Sciences, 16th Ed., Osol, A, ed., Mack, Easton PA (1980).
  • the thrombolytic agent or ⁇ 2AP-binding molecule may be provided to a patient by means well known in the art. Such means of introduction include oral means, intranasal means, subcutaneous means, intramuscular means, intravenous means, intra-arterial means, or parenteral means.
  • a patient is provided with a bolus (intravenously injected) containing between 0.5 to 1.0 mg/kg of a thrombolytic agent.
  • an inhibitor particularly a monoclonal antibody
  • an inhibitor can be used to augment the catalytic function of an enzyme by neutralizing an inhibitor of that enzyme.
  • This approach can be applied to biological processes which are tightly governed by inhibitors. Because coagulation is a finely balanced system in which the effects of enzymes (generally serine proteases) are pitted against the effects of inhibitors, frequently serpins (serine protease inhibitors) pathological alterations in clotting can be treated by augmenting enzyme activity or by neutralizing an inhibitor.
  • mice Two Balb/C mice were immunized subcutaneously with 25 ⁇ g of purified human ⁇ 2AP fragments derived from the trypsin digest of a human plasma clot.
  • the cc2AP fragments were affinity purified with a SEPHAROSE-coupled monoclonal antibody, RWR (Reed, G.L. Ill et al, Trans. Assoc. Am. Phys. 707:250-256 (1988); U.S. Patent No. 5,372,812, issued December 13, 1994), against human ⁇ 2AP.
  • Mice were initially immunized with complete Freund's adjuvant and boosted 90 days later with 50 ⁇ g of ⁇ 2AP fragment in incomplete Freund's adjuvant.
  • the antisera titer was tested in a solid-phase radioimmunoassay (Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 57: 1114- 1118 (1990)) with ⁇ 2AP immobilized in the wells of a microtiter plate.
  • ⁇ 2AP immobilized in the wells of a microtiter plate.
  • the mouse with the highest titer of ⁇ 2AP antibody was hyperimmunized with 100 ⁇ g ⁇ 2AP intraperitoneally. Somatic cell fusion was performed as described (Galfre, G. and Milstein, C, Meth. Enzymol 75:3-46 (1981)).
  • Hybridomas were tested for the production of antibodies to the ⁇ 2AP fragment and for their ability to inhibit ⁇ 2AP as described in Reed, G.L. Ill et al. ,
  • BSA bovine albumin serum
  • Competition radioimmunoassays were performed by coating wells of a microtiter plate with 25 ⁇ l of purified MAb (70B1 1) in duplicate (10 ⁇ g/ml) for 1 hour. The wells were washed and blocked with 1% BSA for 1 hour. After washing, 25 ⁇ l of a competitor MAb, same MAb or negative control MAb was added to different wells (50 ⁇ g/ml) followed by 25 ⁇ l of 125 I- ⁇ 2-antiplasmin (100,000 cpm). After 1 hour incubation, the wells were washed, cut and the radioactivity was measured in a gamma scintillation counter.
  • the clots were placed in a 37°C water bath and at various intervals 100 ⁇ l of solution was temporarily removed and gamma-counted to determine the amount of lysis The percent lysis was defined at 100 x (total supernatant cpm - total clot cpm).
  • Figure 1 compares the binding of these MAbs to I25 I- ⁇ 2AP in a reverse solid-phase assay When compared to the original ⁇ 2AP inhibitor RWR, these MAbs bound with greater avidity
  • competition assays is shown for 70B1 1 in Figure 2 Compared to the negative control, anti-digoxin MAb, RWR had no significant inhibitory effects on the binding of 125 I- ⁇ 2AP to immobilized 70B 1 1
  • 70B 11 was used as a competitor, it completely inhibited the binding of 125 I- ⁇ 2AP to immobilized 70B 11 , as expected
  • 49C9 and 77A3 were also excellent competitors as well
  • the results of these assays are shown in tabular form in Table 1, below.
  • MAbs 49C9, 70B11, 77 A3 also fully inhibited the binding of each other to 125 I- ⁇ 2AP, but they had no inhibitory effects on the binding of RWR. The converse was also true, RWR as a competitor had no effect on the binding of 125 l- ⁇ 2AP to the other MAbs This indicated that MAbs 49C9, 70B 11 and 77 A3 competed for binding to the same epitope, while RWR appeared to bind to a separate region of ⁇ 2AP
  • FIG. 3 compares the amount of lysis achieved by 7 ⁇ g of different purified MAbs (or TBS alone) as a function of dose of urokinase. Compared to urokinase alone (TBS) or urokinase with the control antidigoxin MAb, RWR, 49C9, 70B 11 and 77A3 all accelerate clot lysis.
  • MAbs showed a broader species cross-reactivity and ability to inhibit nearly all primate and some non-primate ⁇ 2APs.
  • Clot lysis was initiated by adding 0.1 U of rt-PA per tube. The clots were incubated at 37°C for 5 hours and the amount of lysis was determined by sampling for the release of radiolabeled fibrin degradation products into the supernatant, as described (Reed, G.L. Ill et al, Proc. Natl. Acad. Sci. USA 57: 1114-1118 (1990)).
  • Clots were embolized into the lungs by injection through the internal jugular vein. Ferrets weighing less than 1 kg received three clots; those weighing 1 kg or more received four clots. Successful embolization was evidenced by the accumulation of radioactivity in the thorax. After the clots had been injected, the ferrets were turned on their sides to ease breathing.
  • the ⁇ 2AP inhibitor sterile-filtered, 14 mg/ml in saline
  • a purified control MAb antidigoxin
  • the rt-PA was given as a continuous infusion over 2 hours (1 or 2 mg/kg in 5 ml normal saline). Animals were observed for a total of four hours after pulmonary embolization and then killed by lethal injection of anesthesia or by CO 2 inhalation.
  • the thorax was dissected and all intrathoracic structures were removed for gamma counting to detect residual thrombi.
  • the percentage of clot lysis was determined for each ferret by dividing the total residual radioactivity in the thorax (cpm) by that in the initial thrombi.
  • the data were analyzed by a one way analysis of variance followed by a Bonferroni-Dunn procedure for multiple comparison testing.
  • Plasma samples were collected on K 3 EDTA (0.15% solution final) with aprotinin (50 kallikrein U/ml). Platelet-poor plasma was obtained by centrifugation of whole blood (Mustard, J.F. et al, Meth. En ⁇ ymol 769:3-1 1 (1989)) and assayed for fibrinogen by the sodium sulfite method (Rampling, M.W. and Gaffhey, P.J., Clin. Chim. Acta.67 A -52 (1976)).
  • the plasma was tested for functional ⁇ 2AP with a chromogenic substrate assay for plasmin inhibition (Stachrom kit) as described (Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 87: 1 1 14-1118 (1990)).
  • MAb 77 A3 a MAb that bound tightly to human ⁇ 2AP.
  • MAb 77 A3 was purified from mouse ascites by ion exchange chromatography, and its purity was confirmed by SDS-polyacrylamide gel analysis ( Figure 5).
  • Figure 5 SDS-polyacrylamide gel analysis
  • FIG. 6 compares the lytic effects of 77 A3 with those of another MAb inhibitor of human ⁇ 2AP, RWR (Reed, G.L III et al, Trans. Assoc. Am. Phys. 707.250-256 (1988), U.S Patent No 5,372,812, issued December 13, 1994), and with buffer alone Figure 6 shows that in comparison with the control (buffer alone), 77 A3 accelerated the lysis of ferret plasma clots induced by a low dose of rt-PA (0 1 unit). In contrast, RWR, which inhibits human ⁇ 2AP (Reed, G.L.
  • animals receiving rt-PA at 1 mg/kg and a control (antidigoxin) MAb showed 35.2 ⁇ 4 6% lysis
  • Ferrets treated with rt-PA at 2 mg/kg showed a minimal increase in lysis over those treated at 1 mg/kg (45 0 ⁇ 6 5% vs 38.5 ⁇ 6.3%, P ⁇ .05).
  • animals receiving rt-PA at 1 mg/kg together with the ⁇ 2AP inhibitor showed greater lysis (56.2 ⁇ 4.7%) than those receiving an equivalent dose of rt-PA alone ( ⁇ 01), with or without the control (antidigoxin) MAb (P ⁇ .01), or those receiving twice the dose of rt-PA alone (7 > ⁇ 05).
  • ⁇ 2AP is covalently crosslinked to fibrin by activated factor Xm (Sakata, Y. and Aoki, N., J Clin. Invest. 69:536-542 (1982)).
  • MAbs activated factor Xm
  • Studies in vitro indicate that when 0.2AP in the clot is absent or inhibited by MAbs, clots undergo spontaneous lysis (Aoki, N. et al, Blood 62: 1118-1122 (1983); Miles, LA etal, Blood 59: 1246-1251 (1982); Reed, G.L. Ill et al, Trans. Assoc. Am. Phys. 707:250-256 (1988); Reed, G.L. Ill et al, Proc.
  • a leading candidate is PAI-1, a serine protease inhibitor of t-PA and urinary-type plasminogen activator (u-PA or urokinase) (Stringer, H . and Pannekoek, H., J. Biol. Chem. 270: 11205-11208 (1995); Car eliet, P. et al, J. Clin. Invest. 92:2756-2760 (1993); Lang, I.M. et al,
  • PA1-1 -enriched clots can suppress the spontaneous lysis of pulmonary emboli in a canine model; however, the role of PAI-1 in the lysis of autologous thrombi was not investigated.
  • Pathologic studies of pulmonary emboli extracted by thrombectomy have suggested that PAI-1 expression increases in the endothelial cells at the margins of fresh thrombi but is not detectable in the thrombi themselves (Lang, I.M. et al, Circulation 59:2715-
  • Another potential cause of thrombus resistance in pulmonary embolism is activated factor XIII.
  • this coagulation enzyme renders the fibrin in clots more resistant to degradation by plasmin by crosslinking fibrin chains together and by crosslinking ⁇ 2AP to fibrin.
  • Monoclonal antibodies (49C9, 70B1 1 and 77 A3) were expanded into ascites and purified by ion exchange chromatography on DEAE Affigel Blue or by protein A agarose as described in Lukacova, D. et al, Biochemistry 50: 10164-10170 (1991).
  • the purified MAbs (15 ⁇ g) were subjected to SDS-PAGE on 10% minigels (BioRad, Hercules, CA).
  • the protein samples were electroblotted to PVDF membranes (Millipore, Bedford, MA) using semi-dry technique (Kyhse- Anderson, J., J. Biochem. Biophys. Meth.
  • Cloned hybridoma cell lines 49C9, 70B11 and 77A3 were grown in 150 mm tissue culture plates in 20% fetal bovine serum in Dulbecco's modified Eagle's medium with 4.5 g/1 of glucose and penicillin and streptomycin. The cells were harvested and centrifuged at 1200 rpm for 7 min. The cell pellet was resuspended in sterile phosphate buffered saline (pH 7.4) and re-centrifuged. Then 5 ml of RNAzol (Teltest, Friendswood, TX) was added and the pellet was homogenized for 2 min.
  • Chloroform 500 ⁇ l was added and the mixture was vortexed and left to incubate on ice for 15 min. The samples were centrifuged at 12,000 rpm for 15 min. The aqueous layer was mixed with 4.5 ml of isopropanol and vortexed. The mixture was precipitated at -70°C for 90 in. and recentrifuged at 12,000 rpm for 15 min. The pellet was washed in 2 ml of 70% ethanol in DEPC-treated water. After repeat centrifugation, the supernatant was removed and the pellet air-dried.
  • the pellet was dissolved in 200 ⁇ l of diethyl-pyrocarbonate (DEPC)-treated water and 20 ⁇ l of 3 M NaCl and 800 ⁇ l of ethanol were added. The mRNA was precipitated overnight at -70 °C and the pellet resuspended in DEPC-water.
  • DEPC diethyl-pyrocarbonate
  • the cDNA corresponding to the light and heavy chain sequences were isolated by primer guided reverse transcription followed by polymerase chain reaction as described (Gene Amp Thermostable rTth Reverse Transcriptase RNA
  • the light chain mRNA was primed for reverse transcription with a 3' primer (5' N6GAATTCACTGGATGG TGGGAAGATGGA 3' (SEQ LD NO:22)) corresponding to the constant region of the light chain ( Coloma, M.J., et al, Biotechniques 77:152-154, 156 (1991)) and the heavy chain was primed with a 3' primer (5 1 N6GAATTCA(TC)
  • CTCCACACACAGG(AG)(AG)CCAGTGGATAGAC 3' (SEQ LD NO:23)) corresponding to the constant region of the heavy chain (Coloma, M.J., et al, Biotechniques 77:152- 154, 156 ( 1991 )). Because the light chain amino terminal sequences were known, a specific primer corresponding to the likely 5' sense sequence was used (5 * ACTAGTCGACATGAGTGTGCTCACTCAGGTCCTGG
  • mice heavy chain variable primers 1-12 were used as described (Jones, S T., and Bendig, M.M., Bio/Technology 9:88-89 (Erratum) (1991)). All heavy chains amplified best with primer 9; though lesser amplification was also seen with primers 12, 10 and 6.
  • the PCR products were isolated by low melt agarose fractionation and ligated into a vector.
  • the light chain PCR product was ligated into PCR II vector (Invitrogen, San Diego, CA)
  • the heavy chain PCR product from primer 9 was ligated into PCR II.1 vector (Invitrogen, San Diego, CA).
  • the plasmid DNA was isolated and subjected to restriction digestion with EcoRI .
  • Two clones from each heavy and light chain were expanded and the DNA harvested. Both strands of the cDNA clones were sequenced using T7 and Ml 3 primers with an ABI Prism automated sequencing apparatus.
  • the cDNA sequences and deduced amino acid sequences are shown in Figures 11-16 (SEQ LD NOS:4-15).
  • a whole antibody may be made, or an antibody fragment (Fab and Fab'2) can be made.
  • the constant regions may be murine or human. It is an accepted practice to replace murine constant regions with human constant regions, thus forming a "chimeric" antibody. Chimeric antibodies are less immunogenic than murine antibodies and are thus more acceptable in the clinic.
  • the subclass of the antibody must also be considered. It is most common to express recombinant antibodies as IgGs, but within this class, one must choose amongst recombinant chimeric human IgGl, IgG2, IgG3, and IgG4. These subclasses have different biological properties. The present inventors took a conservative approach of using IgG2 because 1) the strong complement activating properties of IgGl and IgG3 were not needed for this antibody and 2) IgG2 may be more straightforward to manufacture than IgG4. Any of the other subclasses could be made with the same specificity following similar strategies. There are also parameters to consider in designing the variable region. The antibodies could be constructed to be chimeric or humanized.
  • the chimeric antibody (murine V region, human constant region) is a more conservative approach, and virtually guarantees very similar antigen-binding activity to the murine antibody. With humanization, there is the risk of reducing the affinity and or biological activity of the antibody, but it can be presumed that the antibody will be less immunogenic.
  • the present inventors have produced chimeric antibody as well as three forms of the humanized antibody.
  • humanization consists of choosing a human variable region to serve as a template, and then deciding which residues should be "human” and which "murine".
  • the choice of both the human template and which residues to maintain as human will affect the final sequence.
  • the strategy the present inventors have taken is to choose from among the human gerrnline variable region genes for the templates.
  • the rationale for the first strategy is that somatic mutations can introduce immunogenic epitopes, while gerrnline genes would have less potential for doing so.
  • the selection was further limited to gerrnline genes which are known to be rearranged and expressed as functional proteins in humans.
  • Variable regions were assembled from oligonucleotides and inserted into expression vectors containing the human gamma 2 constant region (for the VH region) and human kappa constant region (for the VL region).
  • Heavy and light chain vectors were verified by nucleotide sequence and ability to direct the synthesis of antigen binding immunoglobulin (Ig) in COS cells (transient expression). Selected heavy and light chain vectors were then cotransfected into CHO cells to produce stable cell lines expressing the chimeric and humanized antibodies.
  • Antibody was purified and tested for activity by antigen binding ELISA, ability to block the inhibitory activity of ⁇ 2-AP in a plasmin assay, and ability to facilitate lysis of human clots by urokinase.
  • a functional light chain variable region is formed by the rearrangement and juxtaposition of a V gene segment and J gene segment. Therefore, it was necessary to find the best match for each of these segments and combine them to form a human template.
  • a FASTA search using the Wisconsin Package Interface) of amino acids 1-95 (Kabat numbering system; V gene proper) of murine 77 A3 (m77A3) light chain against a database of human Vk gerrnline genes showed that m77A3 is clearly most similar to the human Vkl subgroup (69.2% - 71.6% identity vs less than 60% identity to sequences outside this subgroup)
  • the sequence with GenBank accession # X59312 (also known as the O2/O12 gene) was chosen as a likely candidate because of the match with structurally important positions and because of its prevalent expression in humans.
  • the human template for the light chain was completed by the addition of the human Jk2 sequence. This J region was chosen because of its high degree of similarity with the murine J region of 77 A3.
  • a functional heavy chain variable region is formed by the rearrangement and juxtaposition of a V gene segment, a D gene segment, and a J gene segment. Therefore, it was necessary to find the best match for each of these segments and combine them to form a human template.
  • a FASTA search using the Wisconsin
  • This sequence is very similar to 7-04.1 except for the H2 loop and FR3 region.
  • a human template for the D region was not considered because this region lies entirely within the H3 loop, the sequence of which is generally pivotal for antigen binding and therefore likely to entirely follow the murine sequence in a humanized antibody.
  • the human template for the heavy chain was completed by the addition of the human JH5 sequence. This J region was chosen because of its high degree of similarity with the murine J region of 77A3.
  • nucleotide sequence In order to prepare vectors encoding these chains, the amino acid sequence must be back translated into nucleotide sequence. For the most part, this was done simply by using the nucleotide sequence from the human template in cases where the amino acid residue is derived specifically from the human template; otherwise, the nucleotides from the murine sequence were used. At a few positions, silent substitutions were made in order to eliminate restriction sites.
  • signal peptides must be added to the sequence.
  • signal peptides corresponding to that of the murine 77 A3 light chain were used.
  • the same signal peptide as for the light chains was used.
  • signal peptides corresponding to that of murine 77 A3 VH or any other signal peptide can be used in the chimeric and humanized heavy chains.
  • h77A3-l Two humanized antibodies were created: h77A3-l and h77A3-2.
  • a third version of the humanized heavy chain was created by including an oligonucleotide designed for h77A3-l in the construction of h77A3-2. This resulted in a hybrid molecule that was identical to h77A3-2 except for amino acids Ser and Leu at positions 9 and 11 of the heavy chain.
  • Amino acid and nucleotide sequences of h77A3-l and h77A3-2 heavy and light chains are shown in Figures 17-19 (SEQ LD NOS: 16-21 ).
  • the common light chain is shown in Figure 17 (mature protein is amino acid residues 1 to 107 of SEQ LD NO: 17).
  • the heavy chain of h77A3-l is shown in Figure 18 (mature protein is amino acid residues 1 to 119 of SEQ LD NO: 19).
  • the heavy chain of h77A3-2 is shown in Figure 19 (mature protein is amino acid residues 1 to 123 of SEQ LD NO:21).
  • Expression vectors for chimeric and humanized 77 A3 light and heavy chains were prepared in three stages: (1) construction of cassettes containing human light or heavy chain constant region genes (pD16-hCka and pD20-h ⁇ 2a, respectively); (2) preparation of a PCR product containing the light or heavy chain variable region; and (3) insertion of the variable region into the appropriate expression cassette.
  • Plasmid pD13 was constructed and derived from the pcDNA3 plasmid (Invitrogen) in two steps.
  • the SV40 promoter/enhancer and neomycin resistance genes were removed from pcDNA3 by digestion with Nael and isolation of the 3.82 kb fragment. These genes were replaced by the SV40 promoter/enhancer and dhfr gene from pS V2-dhfr.
  • the DNA containing the pSV2-dhfr sequence was isolated as a 1.93 kb fragment after digestion with PvuII and BamHI.
  • the 3.82 and 1.93 kb fragments were ligated together and used to transform MCI 061 bacteria following filling in the protruding ends of the 1.93 kb fragment from pSV2-dhfr.
  • the correct product (designated pD12) was confirmed by the release of an 890 bp fragment following Hindlll digestion.
  • the polylinker was replaced with alternative restriction sites by digesting the resultant vector above with Asp718 and Bspl20I.
  • the following oligonucleotides were annealed to the vector and cloned by ExoIII cloning (K. Hsiao, Nucl. Acid. Res. 27:5528-5529 (1993)) to complete the plasmid pD13:
  • Plasmid pD16 was derived from the pcDNA3 plasmid (Invitrogen) in a series of steps which: add a polylinker sequence upstream of the CMV promoter for linearization; delete the SV40 promoter/enhancer and neomycin resistance gene and replace them with the histone H3 transcription termination sequence, the SV40 promoter (enhancer deleted) and DHFR gene; and insert the gastrin transcription termination sequence upstream of the CMV promoter.
  • pcDNA3 (Invitrogen) was digested with Bglll and annealed to the following oligonucleotides:
  • 5' primer 5'-GATCTGCTAGCCCGGGTGACCTGAGGCGCGCCTTTG GCGCC-3' (SEQ LD NO:27);and 3' primer: 3'-ACGATCGGGCCCACTGGACGCCGCGCGGAAACCGCGG CTAG-5' (SEQ LD NO:28).
  • Plasmid pcDNA3-LSI was then digested with NgoMI, Pvul and Bsml.
  • Plasmid pD12 (described above) was digested with Pvul and SphI to remove the SV40 enhancer and a 3.6 kb fragment was isolated.
  • the following oligonucleotides, encoding the histone H3 transcription termination sequence were annealed and then ligated with the 2.0 kb NgoMI-PvuI fragment and 3.6 kb PvuI-SphI fragment:
  • 5' primer 5'-CCGGGCCTCTCAAAAAAGGGAAAAAAAGCATG-3' (SEQ ID NO:
  • 3' primer 3'-CGGAGAGTTTTTTCCCTTTTTTTC-5' (SEQ LD NO:30).
  • the resulting plasmid pcTwD-LSl was confirmed by the production of 3.3, 0.95, 0.82 and 0.63 kb fragments after digestion with Nhel plus Neil and the production of 4.2, 1.0, 0.26 and 0.23 kb fragments after digestion with SphI plus BstEII.
  • Insertion of the gastrin transcription termination sequence to form plasmid pD16 was accomplished by digesting pcTwD-LSl with BssHII and Narl and isolating the 5.7 kb fragment and ligating with the following annealed oligonucleotides:
  • 5' primer 5'-CGCGCCGGCTTCGAATAGCCAGAGTAACCTTTTTTTTTAA TTTTATTTTATTTTATTTTTGAGATGGAGTTTGG-3' (SEQ LD NO 31); and 3' primer: 3'-GGCCGAAGCTTATCGGTCTCATTGGAAAAAAAAATTAAAAT
  • AAAAT AAAATAAAAACTCTACCTCAAACCGC-5' SEQ LD NO:32.
  • the product was used to transform competent E. coli MCI 061 and the correct construction was confirmed by the production of 4.8, 0.66 and 0.31 kb fragments after digestion with NgoMI plus Spel and the production of 3.3, 1.0, 0.82 and 0.67kb fragments following digestion with NgoMI plus Ncol.
  • Plasmid pD17 was derived from pD16 by the removal of the Nhel site from the linearization polylinker. This was accomplished by digestion of pD16 with Bstll and Nhel and filling the protruding ends using Klenow polymerase. The reaction mixture was self-ligated and used to transform competent E. coli DH5 ⁇ . pD 17 was digested with Asp7181 and Bsp 1201 to remove a polylinker which was replaced by the 113 bp Asp718I/Bspl20I polylinker from pD13. After ligation, the resulting intermediate plasmid pD20 had the Nhel site required for inserting heavy chain V genes.
  • pD20 was distinguished from pD17 by linearization with Nhel, and distinguished from pD13 by linearization with BssH II which cuts only once within the linearization site polylinkers of pD16, pD17 and pD20.
  • DNA sequencing was used to confirm the polylinker in pD20.
  • Construction of the light chain expression cassette was completed by removing the CK fragment along with the flanking polylinker sequences from pD13 and inserting it into pD16. Plasmid pD13-hCka was digested with Asp718I and Bspl20I to release the CK fragment and polylinker sequences. The same enzymes were used to linearize pD16 and the CK containing fragment was ligated into pD16 to form pD16-hCka. Following transformation of DH5 ⁇ E. coli and amplification, the correct construct was confirmed by the release of 2.9 kb fragment following digestion with Asp718I and Bspl20I and linearization following digestion with a restriction enzyme present in pD16, but not pD13. The nucleotide sequence was also confirmed by sequencing various regions of the construct.
  • Phage clone Phage 5A (Ellison and Hood, Proc. Natl. Acad Sci, 79: 1984-1988 (1982)), containing the human ⁇ 2 gene was digested with Hindlll and cloned into the Hindlll site of pUC18 to form the vector p ⁇ 2. In p ⁇ 2, the 5' end of the ⁇ 2 gene is adjacent to the polylinker region.
  • pG was derived from pSV2-gpt by digestion with Hind III and Bgl II,
  • pG ⁇ 2.2 contains a Bglll site 3' of the coding region that would interfere with later cloning steps. To remove this restriction site, pG ⁇ 2.2 was first digested with Bgl II , the sticky ends filled in by Klenow DNA polymerase I, then the plasmid religated. The resulting intermediate plasmid, pG ⁇ 2.3 was screened for lack of digestibility with Bgl II.
  • pUCh ⁇ 4 served as the template for a PCR reaction involving the following primers: sense primer: 5 ⁇ ATCGATGI ⁇ CcCACCAAGGGCCCA-3' (SEQ LD NO:33); and antisense primer: 5'-CTCGAGGGGTCACCACGCTGCTGA-3 ' (SEQ LD NO:34).
  • the sense primer contained a Clal site for subcloning the PCR product into pIC20R (Marsh J.L., etal, Gene 32: 481-485 (1984)) adjacent to a synthetic Nhel site (underlined). Note that the bases for the Nhel site can encode the first two amino acids (Alanine and Serine) for the human ⁇ 1, ⁇ 2, ⁇ 3 or ⁇ 4 CHI exon.
  • the antisense primer has an Xho I site for subcloning into pIC20R, next to a BstE II site
  • an EcoR I digest yielded appropriate fragment sizes of 6.3 Kb and 2.6 Kb.
  • pICh ⁇ 2.1 contained a duplication of the 5' portion of the human ⁇ 2/ ⁇ 4 CHI exon.
  • BstE II digested with BstE II giving fragment sizes of 4.0 Kb, 1.8 Kb, 1.6 Kb, 1.1 Kb, and 0.4 Kb.
  • the 4.0 Kb fragment was isolated from a 1.4% agarose gel, while the 1.6 Kb fragment was separated and isolated away from the 1.8 Kb fragment in 4% NuSieveTM GTG (FMC Bioproducts, Rockland, ME) agarose.
  • the sense primer is homologous to sequence 5' of the pIC20R EcoR I site that is adjacent to the Cla I site.
  • the antisense primer was chosen to be 500 bp downstream of the sense strand primer, and is homologous to sequence within the human ⁇ 2 CHI to CH2 intron.
  • visualization of a 500 bp PCR product in a 1.4% agarose gel confirmed that the hybrid human ⁇ 4- ⁇ 2 CHI exon formed and was oriented in a contiguous manner to the remainder of the locus.
  • pICh ⁇ 2.2 was digested with EcoR I to give the expected 2.6 Kb and 1.9 Kb fragments. The entire human ⁇ 2 CHI exon was confirmed by DNA sequencing.
  • the 1.8 Kb Nhe I + HinD m fragment containing the human ⁇ 2 gene locus was removed from pICh ⁇ 2.2 for ligation into plasmid pD20 opened by Nhe I + HinD III.
  • the resulting vector is the expression cassette pD20-h ⁇ 2a.
  • variable region (V) genes for both chimeric and humanized antibodies were synthesized by a modification of the non template specific PCR protocol
  • the PCR products included DNA encoding both the signal peptide and variable region proper as well as flanking sequences to facilitate insertion into the vector as well as correct splicing (light chain only).
  • the following primers were used:
  • AAACTATGGAATGAACTGGGT-3' (SEQ LD NO.40); LH5, anti-sense chimeric 77 A3 VH primer 4 (80 mer), 5'-TCTTGGTGTTTAT
  • AAGGCAAACCGTCCCTTGAA-3' (SEQ LD NO:43);
  • ATCTCCTTAGGTCTCGAG-3' SEQ LD NO:47
  • LH12 sense chimeric 77A3 VL primer 1(79 mer), 5'-ATTTAAATTGATATCTCC
  • CTCCACCGAACGTCCACGG-3' (SEQ LD NO:55); LH20, anti-sense chimeric 77A3 VL outer primer (30mer), 5'-TCGATTGA
  • CACTGCCACTGAACCTTGAT -3* (SEQ LD NO:72) LH25, sense humanized 77A3 VH -1 primer 1 (80 mer), 5'-CTTGCGGCCGCTTG
  • CAAACTATGGAATGAACTG -3' (SEQ LD NO:59);
  • GGCATAGGTCCCAGGTACCCATC -3' (SEQ LD NO:64);
  • Table 3 summarizes how the above primers were used in the non-template PCR protocol.
  • oligonucleotides which represent a synthetic light or heavy chain V gene are synthesized (VI -V8 in Table 3).
  • Four sense strand oligonucleotides alternate with 4 overlapping antisense strand oligonucleotides of 78-81 nt in length.
  • These PCR primers overlap each other by 24-27 nt.
  • oligonucleotide primers VI and V8 Table 3
  • their 5' end is designed to overlap with 15 -30 nt of the vector sequence, while their 3' end overlaps 48-65 nt of the signal peptide (VI) or the V gene sequence (V8).
  • the 8 oligonucleotide primers are all included in the same first round PCR.
  • Reaction conditions for this 1st round PCR were 0.125 picomoles of each primer, 10 ⁇ l of 10X Pfu buffer (Stratagene Inc., San Diego, CA), 10 nanomoles dNTP's (Boehringer Mannheim, Indianapolis, IN), 10% dimethylsulfoxide (DMSO), and 2.5 units cloned Pfu DNA polymerase I (Stratagene Inc., San Diego, CA) in a 100 ⁇ l reaction volume.
  • Reactants were first denatured at 95°C for 5 min, annealed at 45 °C for 5 min, and extended at 72 °C for 1 min, followed by 25 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 30 sec, and extension at 72 °C for 30 sec. The 25 cycles were followed by a final extension at 72 °C for 7 min in a Perkin-Elmer DNA Thermal Cycler (Norwalk, CT).
  • the amplified PCR product was electrophoresed through a 1.4% agarose gel and the smear of DNA running between approximately 350 bp - 500 bp was cut out prior to purification by the QiaexTM II gel extraction kit (Qiagen, Chatsworth, CA).
  • This purified non template specific PCR product served as the template for a 2nd round PCR.
  • two additional outer primers are utilized. These outer primers are homologous to 29 - 30 nt of the vector sequence that is either 5' (sense primer) or 3' (antisense primer) of the linearized cloning site within the mammalian expression cassette vector. This allowed for the amplified PCR product to be subcloned into the vector by bacterial homologous recombination (Jones, D.H. and Howard, B. H., BioTechniques 10: 62-66 (1991)).
  • reaction conditions for the 2nd round PCR were 0.125 picomoles each of outer sense and antisense primers, 10 ⁇ l of 10X Pfu buffer, 10 nanomoles dNTP's, 10% DMSO, 2.5 units Pfu DNA polymerase I, and approximately 100 ng of 1st round PCR template DNA.
  • the reactants underwent the same thermocycle program described above. Subsequently, the amplicand from this reaction was removed from a 1.4% agarose gel and purified with the QiagenTM II gel extraction kit.
  • 200ng - 1 OOOng of PCR product was mixed with an equal weight of linearized vector, and this mixture was used to transform 200 ml of competent E. coli DH5 ⁇ cells (GLBCO BRL/ Life Technologies, Gaithersburg, MD). Transformed cells were selected by 100 ⁇ g/ml ampicillin in LB agarose. Typically, pD16-hCka digested with Xho I was used for subcloning light chain V genes. pD20-hg2a digested with Nhe I served as the vehicle for heavy chain V gene constructs.
  • the primary screen was by PCR, while the secondary screen was by restriction digest. Each individual colony of bacteria was picked into 5 ml of T broth (GLBCO BRL/ Life Technologies, Gaithersburg, MD) containing 100 ⁇ g/ml ampicillin and grown 8 - 16 hr at 37 °C with shaking.
  • the conditions for the PCR screen were 0.125 picomoles of both outer primers (Table 3), 2 ml 10X Mg +2 buffer (Boehringer Mannheim, Indianapolis,
  • CA CA
  • Xho I VL genes
  • Nhe I VH genes
  • the above procedures were used to confirm the presence of a potentially correct insert. However, they were not specific enough to detect small errors in the sequence (insertions, deletions and substitutions).
  • each potentially positive heavy chain clone was cotransfected into COS cells with each potentially positive light chain clone. Culture supernatants were screened by ELISA for the presence of human IgG, and then for the presence of IgG binding to ⁇ 2-antiplasmin (see below).
  • DNA for COS transfections was derived from midi DNA preparations described above. COS tranfections were performed in 60 mm dishes. Complete details of the DEAE - dextran technique employed have been described (Linsley
  • V region inserts from the above clones were sequenced by the dideoxy nucleotide procedure.
  • the purification of the antibody was first performed using protein- A affinity chromatography.
  • a Pharmacia column sized so that 5 mg of antibody to be loaded per 1 ml of resin, was packed with Perseptive Biosystems Poros 50 A protein-A resin. The column was then sanitized according to the methods recommended by the resin supplier. The column was equilibrated with pyrogen free 10 mM sodium phosphate, 150 mM sodium chloride pH 7.0 (PBS). The cell culture supernatant was adjusted to pH of 7.0-7.5 and loaded on the column at a flow rate equal to 2 - 3 column volume/min (CV/min). The column was then washed with 15 CV pyrogen free PBS or until a stable base line has been achieved.
  • the antibody was eluted with 20 mM glycine/HCl pH 3.0 elution buffer.
  • the eluted peak was collected in a pyrogen free vessel that contained 1/20 CV of 1 M Tris base solution.
  • the pH of the eluted antibody solution was adjusted to pH 8.0 with 1M Tris base immediately.
  • the column was then cleaned with 5 CV 12 mM HCl solution.
  • the column was stored in 20% ethanol/water at 4.0°C.
  • the antibody was next purified using anion exchange chromatography.
  • a Pharmacia column sized so that 5 - 10 mg of antibody to be loaded per 1 ml of resin, was packed with Perseptive Biosystems Poros HQ 50 anion exchange resin. The column was then sanitized according to the methods recommended by the resin supplier. The column was equilibrated with pyrogen free 50 mM Tris/HCl, 50 mM NaCl, pH 8.0. The protein-A purified antibody adjusted to pH of 8.0 was loaded on the column with flow rate equal to 1 CV/min. The column was then washed with 5 CV pyrogen free 50 mM Tris HCl, IM NaCl pH 8.0. The antibody does not bind to this column under the running conditions and was present in the flowthrough fraction. The column was stored in 20% ethanol/water at 4.0°C. The antibody was then concentrated and diafiltered against PBS using a 3 OK cut off membrane.
  • This ELISA detects whole antibody (containing both heavy and light chain) and relies on a capture antibody specific for human IgG Fc region and a conjugate specific for human kappa chains.
  • Immunlon II flat bottom plates (Dynatech) were coated with goat anti-human IgG (Fc specific, adsorbed on mouse IgG) (Caltag, Inc. catalog #H10000) at 0.5 ⁇ g/ml in carb/bicarb buffer pH 9.6 and then blocked with PTB (PBS containing 0.05% Tween 20 and 1.0% BSA).
  • the assay was used for three purposes. First, to screen small COS transfections that were set up to qualify various heavy and light chain vectors. In this case, the presence or absence of a signal was sufficient and it was not necessary to quantify the amount of antibody present. Second, to determine which of many master wells from CHO transfections were producing the most antibody. In this case, culture supernatants were diluted so that relative signals could be compared and the master wells containing the most antibody could be distinguished and thus selected for cloning and expansion. Thirdly, to determine amounts of antibody, either in culture supernatants or following purification. In this case, a standard consisting of either a chimeric or human IgGl or a human myeloma IgG2 were used.
  • This ELISA relies on an antigen capture and a human kappa chain specific conjugate. It was used for two purposes. Initially, to qualify a vector, supernatants from COS transfections were screened for the ability of antibody to bind to antigen. Vectors passing this test were then submitted to DNA sequencing. Secondly, to determine relative antigen binding ability of the various chimeric and humanized antibodies. This ELISA is very similar to the non-specific IgG ELISA described above except that the plates were coated with ⁇ 2-antiplasmin (obtained from
  • the first known as the "plasmin assay with chromogenic substrate" is based on the ability of plasmin to convert
  • Active antibody is capable of blocking the inhibitory activity of ⁇ 2-antiplasmin.
  • the second assay, the clot lysis assay, is a measure of the ability of antibody along with urokinase to lyse preformed clots.
  • the plasmin assay with chromogenic substrate is designed based on the action of plasmin on its chromogenic substrate according to the reaction:
  • pNA The generation of pNA was monitored by the increase in absorption at 405 nm using a SpectraMax 250 spectrophotometer.
  • the addition of ⁇ 2-antiplasmin inhibits the plasmin activity and no increase in absorption at 405 nm will be observed.
  • Premixing of ⁇ 2-antiplasmin with functional antibody blocks the ability of ⁇ 2-antiplasmin to inhibit the plasmin activity. Plasmin activity was measured as the initial rate of color development. Assays are performed in 96 well microtiter plates.
  • the chromogenic substrate Spectrozyme PL, H-D-Nle-HHT-Lys-pNA.2AcOH, human plasmin, and human ⁇ 2-antiplasmin were purchased from American Diagnostica.
  • Stock and working solutions are prepared as follows: Spectrozyme PL stock solution - 10 mM in ILO; Spectrozyme PL working solution - 1 : 12.5 dilution of stock solution in H 2 O; human plasmin stock solution - 0.2 mg/ml in 50% glycerol, 50% 2 mM HCl; human plasmin working solution - 1 : 12.5 dilution of stock solution in 0.1 1 mM HCl, which must be prepared immediately before use; human ⁇ 2-antiplasmin stock solution - 0.2 mg/ml in PBS; and human ⁇ 2-antiplasmin working solution - 1 : 15 dilution of stock solution in PBS. Stock solutions were stored at -70 and should not be refrozen after thawing.
  • Reagents are added in the following order, with mixing after each addition: 80 ul antibody or PBS, 40 ul ⁇ 2 -antiplasmin working solution, 40 ul plasmin working solution, and 40 ul Spectrazyme PL working solution.
  • R is the rate of color development.
  • Rp which represents maximum plasmin activity, is determined in wells lacking both antibody and ⁇ 2-antiplasmin.
  • Ro which represents minimal plasmin activity, is determined in wells lacking antibody.
  • Rs is the rate of color development in the sample.
  • Antibody activity is calculated as (Rs - Ro)/(Rp - Ro)
  • Antibody activity was plotted vs. amount antibody (on a log scale). Curves generated by test antibody and standard (usually murine 77 A3) were compared.
  • the data for murine 77 A3, c77A3, and h77A3-l are shown in Figure 20.
  • the curves for murine and chimeric 77A3 were superimposable.
  • the curve for h77A3-2 indicates a potential small loss in activity (20-30%).
  • the clot lysis assays were performed as follows. Test clots were formed in 96- well Corning #25805 microtiter plates by mixing 25 uL 16 mM CaCl 2 , 50 uL of pooled human plasma, and 25 uL of 4 NLH unit/ml of human alpha-thrombin (Sigma) in 30mM Hepes buffer, pH 7.40. Plates were incubated overnight at room temperature to allow clots to achieve maximum clot turbidities.
  • Clot lysis was initiated by adding 10 uL of antibody to give 5 or 10 ug/well and 100 uL of urokinase to give 1, 3 or 5 units of urokinase/well (Abbott Labs) at pH 7.40. Plates were mixed on a table top microplate vortexer for 30 sec before the initial reading at 405 nm to get values corresponding to 0% lysis. Plates were sealed with Corning sealing tape #430454 and incubated at 37°C. During the course of 24 hrs, the decrease of turbidity was measured at 405 nm to quantify the progress of clot lysis.
  • murine RWR a monoclonal antibody with a 10-fold lower affinity than murine 77A3
  • murine RWR causes no lysis at 10 ug per clot in the presence of 1 unit of urokinase and would give a lysis profile like buffer control.
  • the sFv fragment of an antibody is most commonly obtained by the tandem expression of the variable region of the antibody heavy chain along with the variable region of the antibody light chain spaced by a linker of 15-20 amino acids. sFv fragments are expected to have superior clot penetration to parent antibodies.
  • Two constructs, p53-6 and p52-12, were prepared using murine variable regions with a VH-(linker)-VL polarity using YPRSIYLRRRHPSPSLTT (SEQ LD NO:73) as linker 1 for sFv77A3-l and GGSGSGGSGSGGSGS (SEQ LD NO.74) as linker 2 for sFv77A3-2.
  • Idiotypic markers present on 77 A3 were probed with a sandwich ELISA using a biotinylated polyclonal reagent rendered specific by multiple immunoadsorbtion steps through columns bearing immunoglobulins from man, mouse, baboon and cynomologous monkey (P Stenzel-Johnson & D Yelton, Seattle). Microplate wells were coated with 77 A3 and 59D8 as controls along with sFv77A3-l and sFv77A3-2. It is evident that 77A3 control and both sFv fragments bear idiotypic markers at each dose tested indicating that the sFv fragments "look" like the parental 77A3.

Abstract

An immunologic molecule, wherein said immunologic molecule does not compete with monoclonal antibody RWR and is capable of binding to and inhibit both (1) human and nonhuman circulating alpha-2-antiplasmins and (2) human and nonhuman fibrin cross-linked alpha-2-antiplasmins selected from the group consisting of a chimeric antibody, a humanized antibody, and a single chain antibody. The invention further relates to nucleic acid molecules encoding said immunologic molecules.

Description

CHTMERIC, HUMANIZED AND SINGLE CHAIN ANπBODIES TO ALPHA-2-ANTTPLASM1N
Background of the Invention
Statement as to Rights to Inventions Made Under Federally-Sponsored Research and Development
This invention was made in part with Government support under Contract #HL-02348 awarded by the National Institutes of Health. The Government has certain rights in this invention.
Field of the Invention
The present invention relates to a composition and method of treatment for pulmonary embolism, myocardial infarction, thrombosis, and stroke in a patient, and more specifically to a therapy which enhances fibrinolysis comprising administering an alpha-2-antiplasmin-binding molecule. The invention also relates to a treatment for enhancing fibrinolysis comprising administering an alpha-2- antiplasmin-binding molecule together with a thrombolytic agent.
Description of Background Art
Venous thrombosis and pulmonary embolism are major causes of morbidity and mortality in the United States, accounting for about 270,000 hospitalizations a year (Anderson, F.A., Jr. etal., Arch. Intern. Med. 757:933-938 (1991)). In addition, it is estimated that about 50,000-200,000 patients a year die from pulmonary embolism (Lilienfeld, D E. et al. , Chest 98: 1067- 1072 (1990)).
In surprising contrast with the mortality rate for myocardial infarction, the mortality rate for pulmonary embolism (estimated at 9.2% in treated patients) has not improved in the last 30 years (Lilienfeld, D.E. et al, Chest 95: 1067-1072 (1990); Giuntini, C. et al., Chest 707:3S-9S (1995)). Moreover, survivors of venous thromboembolism are known to be at risk for recurrent thrombosis, postphlebitic syndrome, and pulmonary hypertension (Sutton, G C et al, Br. Heart J. 59.1135-1192 (1977); Salzman, E.W. and Hirsch, J , "The Epidemiology, Pathogenesis and Natural History of Venous Thrombosis," in Hemostasis and Thrombosis: Basic Principles and Clinical Practice, Coleman, R W et al, eds., 3rd ed. Philadelphia, PA (1994), pp. 1275-1296).
A. Mechanism of Clot Formation and Lysis
Clots (or thrombi in a patient) are composed of fibrin and blood platelets in various ratios The fundamental reaction in blood clotting involves the conversion of a soluble plasma protein (fibrinogen) into insoluble fibrin The conversion of fibrinogen into fibrin is catalyzed by the enzyme, thrombin, which is a serine protease
Clot lysis is mediated by plasmin Under natural conditions, plasminogen is converted to plasmin by plasminogen activators Natural plasmin inhibitors include α2-antiplasmin, α2-macroglobulin and α-1-antitrypsin, all glycoproteins Alpha-2-antiplasmin has a much higher affinity for plasmin than α2-macrogIobulin and binds specifically to plasmin in a 1 1 ratio The larger pool of α- macroglobulin acts as a reservoir inhibitor (Kane, K.K , Ann. Clm. Lab. Sci. 14 443-449 (1984)) Thus, clot lysis by the administration of t-PA is limited by the rapid and irreversible inactivation of plasmin by plasmin inhibitors.
B. Treatment for Venous Thrombosis and Pulmonary Embolism
Standard therapy for venous thromboembolism is heparin, which potentiates thrombin and factor Xa inhibition by antithrombin III (Goldhaber, S ,
Chest 107 45S-51S (1995)) Although heparin decreases new thrombus (clot) formation, clinical studies suggest that there is little early endogenous lysis of the large thrombi that often exist at the time of diagnosis in patients with venous thromboembolism (Goldhaber, S.Z. et al, Lancet 2:886-889 (1986); "The Urokinase Pulmonary Embolism Trial," Circulation ¥7: 1-108 (1973); Goldhaber, S.Z. et al, Am. J. Med 55:235-240 (1990); Goldhaber, S.Z. et al, Lancet 547:507-511 (1993)). Since large thrombi are associated with an increase in morbidity and mortality, several studies have examined the effects of plasminogen activators in patients with venous thromboembolism (Goldhaber, S.Z. et al, Lancet 2:886-889 (1986); "The Urokinase Pulmonary Embolism Trial," Circulation ¥7:1-108 (1973); Goldhaber, S.Z. et al, Am. J. Med. 55:235-240 (1990); Goldhaber, S.Z. et al, Lancet 341:501 '-511 (1993)). Compared with heparin alone, plasminogen activators cause significant increases in the lysis of venous thromboemboli, but patients are frequently left with large amounts of residual thrombi in the lungs or deep veins immediately after therapy (Goldhaber, S.Z. et al, Lancet 2:886-889 (1986); "The Urokinase Pulmonary Embolism Trial," Circulation ¥7:1-108 (1973); Goldhaber, S.Z. et al, Am. J. Med. 55:235-240 (1990); Goldhaber, S.Z. et al, Lancet 341:507-51 1
(1993)). None of the randomized, controlled trials of patients with pulmonary embolism have demonstrated a mortality benefit from plasminogen activators, although this may well be due to the small numbers of patients enrolled in these studies. Use of plasminogen activators for myocardial infarctions has shown that 45-70% of patients with coronary thrombosis have failed to achieve full 90 minutes reperfusion with these agents.
Why venous thromboemboli resist fibrinolysis is unknown. Physical characteristics such as size, retraction, exposure to blood flow, and age may affect the lysis of these large fibrin-rich thrombi (Prewitt, R.M., Chest 99: 157S-164S (1991)). However, it is also likely that the fibrinolytic resistance of these thrombi is regulated by specific molecular factors such as factor XIII, plasminogen activator inhibitor 1 (PAI-1), and alpha-2-antiplasmin (α2AP) (Collen, D., Eur. J. Biochem. 69:209-216 (1976); Moroi, M. and Aoki, N., J. Biol Chem. 257:5956-5965 (1976); Mullertz, S. and Clemmensen, I., Biochem. J. 759:545- 553 (1976); Sakata, Y. and Aoki, N., J. Clin. Invest. 69:536-542 (1982); Robbie, L.A. etal, Thromb. Haemostas. 70:301-306 (1993); Francis, C.W. and Marder, V.J., J. Clin. Invest. 50: 1459-1465 (1987); Jansen, J.W.C.M. et al, Thromb. Haemostas. 57:171-175 (1987); Reed, G.L. et al, Trans. Assoc. Am. Phys. 70¥:21-28 (1991); Stringer, H.A. and Pannekoek, H., J. Biol Chem. 270:11205- 11208 (1995); Carmeliet, P. et al, J. Clin. Invest. 92:2756-2760 (1993); Lang,
I.M. et al, Circulation 59:2715-2721 (1994); Marsh, J.J. et al, Circulation 90:3091-3097 (1994)).
Because α2AP is an ultrafast covalent inhibitor of plasmin (the enzyme that degrades thrombi), α2AP is a particularly likely cause of thrombus resistance (Collen, D., Eur. J. Biochem. 69:209-216 (1976); Moroi, M. and Aoki, N.,
J. Biol. Chem. 257:5956-5965 (1976); Mullertz, S. and Clemmensen, I., Biochem. J. 759:545-553 (1976)). Moreover, α2AP is the only fibrinolytic inhibitor that is covalently crosslinked to the fibrin surface (Sakata, Y. and Aoki, N., J. Clin. Invest. 69:536-542 (1982)). This crosslinking (by activated factor XIII) concentrates α2AP on the fibrin surface, where it inhibits the initiation of fibrinolysis (Sakata, Y. and Aoki, N., J. Clin. Invest. 69:536-542 (1982)). Previous in vitro studies have shown that clots from α2AP-deficient patients lyse spontaneously, suggesting that α2AP plays a critical role in thrombus resistance to endogenous plasminogen activators (Aoki, N. et al, Blood 62: 11 18-1122 (1983); Miles, L.A. et al, Blood 59:1246-1251 (1982)). These observations led to the hypothesis that α2AP is a molecular mediator of the thrombus resistance seen in patients with pulmonary embolism. To test this hypothesis, we generated a specific inhibitor of α2AP and used it to determine the role played by α2AP in the regulation of lysis of experimental pulmonary emboli. If an individual has formed a fibrin clot (thrombus) prior to the availability of medical assistance, the clot may be dissolved through the use of agents capable of lysing the fibrin thrombus, and thereby permitting blood to again flow through the affected blood vessel. Such agents include plasmin, anti-coagulants (such as, for example, heparin, hirudin and activated protein C), plasminogen activators (such as, for example, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, staphylokinase, and vampire bat plasminogen activator), and other such agents (Ganz, W. et al, J. Amer. Coll. Cardiol 7: 1247-1253 (1983); Rentrop, K.P. et al, Amer. J. Cardiol. 5¥:29E-31E (1984); Gold, H.K. etal, Amer. J. Cardiol. 55: 122C-125C (1984)). At present, treatment of pulmonary embolism, myocardial infarction, thrombosis, and stroke is partially achieved through the administration of thrombolytic agents. Use of such agents in therapy often results in incomplete lysis, and promotes the reformation of thrombi and reocclusion of the affected blood vessels. Hence, a need exists for an improvement in thrombolytic therapy which enhances fibrinolysis, while minimizing fibrinogen breakdown and preventing reformation of thrombi.
C Alpha- 2 antiplasmin Antibodies
Alpha-2-antiplasmin (C.2AP) has three functional domains: the reactive site for plasmin, the plasmin(ogen) or LBS-binding site [complementary to the LBS (lysine-binding site) of plasmin(ogen)], and the crosslinking site for fibrin.
Mimuro, J. et al, Blood 69:446-453 (1987). Mimuro et al. discloses antibodies to α2AP, one of which (JPTI-1) was specific to the reactive site of α2AP and prevented formation of α2AP complexes, thereby inhibiting antiplasmin activity. However, Mimuro et al. does not teach administration of the JPTI-1 antibody to enhance clot lysis. Other antibodies specific for α2AP are taught by Plow, E.F. etal, J. Biol. Chem. 255:2902-2906 (1980); Wimen, B. et al, Scan. J. Clin. Lab. Invest. 43:27-33 (1983); Hattey, E. et al, Thromb. Res. ¥5.485-495 (1987); Collen, U.S. Patent No. 4,346,029 (1980); and Collen, U.S. Patent No. 4,198,335 (1980). Summary of the Invention
The present invention relates to an improved thrombolytic therapy for the treatment of pulmonary embolism, myocardial infarction, thrombosis and stroke in patients. The invention is directed to an immunologic molecule capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins. In preferred embodiments, the immunologic molecule is a chimeric antibody, a humanized antibody, or a single chain antibody. The invention is also directed to a method for treating pulmonary embolism, myocardial infarction, thrombosis and stroke in a patient comprising administering an α2-antiplasmin-binding molecule capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked o.2-antiplasmins. The invention further provides a method of treatment for pulmonary embolism, myocardial infarction, thrombosis and stroke in a patient which comprises co-administrating to a patient in need of such treatment:
(a) a therapeutically effective amount of an immunologic molecule capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins; and
(b) a therapeutically effective amount of a thrombolytic agent, wherein the immunologic molecule (a) is different from the thrombolytic agent (b), thereby treating the patient.
The invention provides a monoclonal antibody or fragment thereof wherein the monoclonal antibody is capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2- antiplasmins. In one embodiment, the invention is monoclonal antibody 77A3.
In another embodiment, the invention is monoclonal antibody 49C9. In another embodiment, the monoclonal antibody is 70B11.
The invention also provides a method of making the monoclonal antibody comprising: (a) immunizing an animal with α2-antiplasmin or fragment thereof;
(b) fusing cells from the animal with tumor cells to make a hybridoma cell line;
(c) cloning the hybridoma cell line; (d) selecting for the monoclonal antibody capable of binding to both
(1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins; and (e) obtaining the monoclonal antibody.
The invention provides a hybridoma cell line which produces the monoclonal antibody capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2- antiplasmins. In one embodiment, the invention is hybridoma cell line 77 A3 (ATCC Accession No. HB-12192; Deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20862 on September 20, 1996).
The invention is directed to a method of making the hybridoma cell line comprising:
(a) immunizing an animal with α2-antiplasmin or fragment thereof;
(b) fusing the cells from the animal with tumor cells to make the hybridoma cell line; and
(c) obtaining the hybridoma cell line which produces the monoclonal antibody capable of binding to both (1) human and nonhuman circulating α2- antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins.
The invention also provides a method for treating a number of diseases and conditions, including pulmonary embolism, myocardial infarction, thrombosis and stroke in a patient comprising administering a therapeutically effective amount of an immunologic molecule which is capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked o.2-antiplasmins, thereby treating the patient. The invention further provides a method of treatment for pulmonary embolism, myocardial infarction, thrombosis or stroke in a patient which comprises co-administering to a patient in need of such treatment:
(a) a therapeutically effective amount of an immunologic molecule which is capable of binding to both (1) human and nonhuman circulating α2- antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins; and
(b) a therapeutically effective amount of a thrombolytic agent, wherein the immunologic molecule (a) is different from the thrombolytic agent (b), thereby treating the patient. In preferred embodiments, the thrombolytic agent is plasmin, anticoagulant, or plasminogen activator. In one embodiment, the anti-coagulant is selected from the group consisting of heparin, hirudin and activated protein C. In another embodiment, the plasminogen activator is selected from the group consisting of staphylokinase, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, and vampire bat plasminogen activator.
Other embodiments of the invention include, the immunologic molecule provided to the patient by an intravenous infusion, by an intravenously injected bolus, or with a first bolus containing the immunologic molecule (a) and a subsequently administered second bolus containing the thrombolytic agent (b). Further embodiments include, the immunologic molecule (a) provided to the patient at a dose of between 3 to 300 nmole per kg of patient weight; and the thrombolytic agent (b) provided to the patient at a dose of between 0.01 to 3.0 mg per kg of patient weight.
The invention provides a kit useful for carrying out the method of treatment for pulmonary embolism, myocardial infarction, thrombosis or stroke in a patient, being compartmentalized in close confinement to receive two or more container means therein, which comprises:
(1) a first container containing a therapeutically effective amount of the immunologic molecule (a); and (2) a second container containing a therapeutically effective amount of the thrombolytic agent (b), wherein the immunologic molecule (a) is different from the thrombolytic agent (b).
The invention also provides nucleic acid molecules encoding immunologic molecules capable of binding to both (1) human and nonhuman circulating α2- antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins.
Also provided are molecules comprising an amino acid sequence of the binding region of an immunologic molecule described herein.
Brief Description of the Figures
Figure 1. Comparison of binding to 125I-α2-antiplasmin of monoclonal antibodies 49C9, 70B11, 77 A3, RWR and anti-digoxin (control). Wells of a microtiter plate were coated with goat antimouse antibody The wells were incubated in duplicate with 49C9, 70B1 1, 77A3, RWR or a control (antidigoxin) MAb (Mudgett-Hunter, M. et al, Mol Immunol. 22:477-488 (1985)). After a wash, ,25I-α2AP (60,000 cpm) was added for an hour. The wells were rinsed and the amount of bound ,25I-α2AP was measured in a gamma counter.
Figure 2. Competition binding assays of monoclonal antibodies 49C9, 70B11, 77A3, RWR and anti-digoxin with immobilized 70B1 1 Competition radioimmunoassays were performed by coating wells of a microtiter plate with 25 μl of purified MAb (70B11) in duplicate (10 μg ml) for 1 hour The wells were washed and blocked with 1% BSA for 1 hour. After washing, 25 μl of a competitor MAb, same MAb or negative control MAb was added to different wells (50 μg/ml) followed by 25 μl of 125I-α2-antiplasmin (100,000 cpm). After 1 hour incubation, the wells were washed, cut and the radioactivity was measured in a gamma scintillation counter. Figure 3. Comparison of amount of lysis by different monoclonal antibodies (or TBS alone) as a function of dose of urokinase. See Example 1, below, for detailed description of the method. The amount of lysis was determined by gamma counting. The percent lysis was defined at 100 x (total supernatant cpm ÷ total clot cpm).
Figure 4. Dose response studies in the absence or presence of MAb 77 A3. Lysis by urokinase is increased approximately 100-fold by 77 A3.
Figure 5. Reduced SDS-polyacrylamide gel electrophoresis of 77 A3 purification. Ascites containing 77 A3 were harvested and purified. Lane 1, protein standards with molecular mass in kDa (left); lane 2, supernatant after precipitation with 40% ammonium sulfate; lane 3, purified 77 A3. The reduced 77 A3 immunoglobulin consists of bands of -50 kDa, corresponding to the heavy chain, and -25 kDa, corresponding to the light chain.
Figure 6. Effect of 77 A3 on the rate of lysis of ferret plasma clots in vitro. Ferret plasma clots formed with trace amounts of 12SI-labeled human fibrinogen were incubated with 100 μl of TBS (control) or purified MAb (25 μg, 77A3 or RWR). Clot lysis was initiated by adding 0.1 unit of rt-PA per tube. The clots were incubated at 37°C and the amount of lysis was determined by sampling for the release of radiolabeled fibrin degradation products into the supernatant as described (Reed, G.L. Ill et al, Proc. Natl. Acad. Sci. USA 57:1114-1118
(1990)).
Figure 7. Effect of in vivo administration of MAb 77 A3 on functional α2AP levels in ferrets. In dose finding experiments, two anesthetized ferrets (A,
B) were given 77 A3 intravenously (22.5 mg/kg) and the amount of functional α2AP was measured in citrated plasma samples drawn before (time 0) and 1 and 4 hours after infusion. The data represent the mean±SD inhibition of α2AP in plasma samples.
Figure 8. Effect of rt-PA and α2AP inhibition on the lysis of pulmonary e boli in vivo. Anesthetized ferrets were given a heparin bolus (100 U/kg) and 125I-labeled fibrin clots were embolized into the lungs. After embolization, three groups of ferrets were given rt-PA (0, 1, or 2 mg/kg) over 2 hours intravenously (plain bars). Two other groups of ferrets also received rt-PA (1 mg/kg) and a control MAb (antidigoxin, black bar, 22.5 mg/kg) or a MAb that inhibits α2AP (77 A3, striped bar, same dose). The graph shows the amount of lysis (mean±SD) for each treatment group. The number of ferrets in each treatment group is shown, and the P values for differences between groups are indicated.
Figure 9. Residual fibrinogen levels in animals treated with heparin, rt-PA, and an 0.2AP inhibitor. Blood samples were collected (on EDTA with aprotinin) from ferrets before pulmonary embolization and at the end of the experiment. Residual fibrinogen levels were measured as described (Rampling,
M.W. and Gaffney, P.J., Clin. Chim. Acta.67 A3 -52 (1976)). The graph shows the mean±SD percentage residual fibrinogen level for animals receiving rt-PA alone (0, 1, or 2 mg/kg; plain bars) and those receiving rt-PA and the α2AP inhibitor (striped bar).
Figure 10. The peptide sequences of the amino terminus of purified light chains from 49C9 (SEQ ID NO: 1) , 70B11 (SEQ ID NO:2) and 77A3 (SEQ ID NO: 3) are shown.
Figure 11. The cDNA sequence (SEQ ID NO:4) and corresponding deduced amino acid sequence of the signal peptide (amino acids -20 to -1 of SEQ LD NO:5) and light chain variable regions (amino acids 1 to 107 of SEQ LD NO:5) of 49C9 are shown. Figure 12. The cDNA sequence (SEQ ID NO:6) and corresponding deduced amino acid sequence of the signal peptide (amino acids -20 to -1 of SEQ LD NO:7) and light chain variable regions (amino acids 1 to 107 of SEQ LD NO:7) of70Bl l are shown.
Figure 13. The cDNA sequence (SEQ LD NO: 8) and corresponding deduced amino acid sequence of the signal peptide (amino acids -20 to -1 of SEQ LD NO:9) and light chain variable regions (amino acids 1 to 107 of SEQ LD NO:9) of77A3 are shown.
Figure 14. The cDNA sequence (SEQ LD NO: 10) and corresponding deduced amino acid sequence of the signal peptide (amino acids -19 to -1 of SEQ
LD NO: 11) and heavy chain variable regions (amino acids 1-1 19 of SEQ LD NO: 11) of 49C9 are shown.
Figure 15. The cDN A sequence (SEQ LD NO : 12) and corresponding deduced amino acid sequence of the signal peptide (amino acids -19 to -1 of SEQ LD NO: 13) and heavy chain variable regions (amino acids 1-1 19 of SEQ LD
NO:13) of 70B11 are shown.
Figure 16. The cDNA sequence (SEQ LD NO: 14) and corresponding deduced amino acid sequence of the signal peptide (amino acids -19 to -1 of SEQ LD NO: 15) and heavy chain variable regions (amino acids 1-119 of SEQ LD NO: 15) of 77A3 are shown.
Figure 17. The cDNA sequence (SEQ LD NO: 16) and corresponding amino acid sequence (SEQ LD NO: 17) of humanized77A3-l and humanized 77 A3 -2 light chain. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders. Figure 18. The cDNA sequence (SEQ LD NO: 18) and corresponding amino acid sequence (SEQ LD NO: 19) of humanized 77A3-1 heavy chain. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders.
Figure 19. The cDNA sequence (SEQ LD NO:20) and corresponding amino acid sequence (SEQ LD NO:21) of humanized 77A3-2 heavy chain. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders.
Figure 20. Results of murine 77 A3 (X), chimeric 77 A3 (•) and humanized 77A3-1 (■) in the plasmin assay with chromogenic substrate are shown.
Figure 21. The amino acid sequences of the light chains are shown: h77A3-l and h77A3-2 (SEQ LD NO: 17); m77A3 (SEQ LD NO:9); m49C9 (SEQ LD NO:5); m70Bl 1 (SEQ LD NO:7); murine consensus (SEQ LD NO:75), which shows the consensus between m77A3, m49C9, and m70B l l ; 77A3/49C9 consensus (SEQ LD NO:76), which shows the consensus between 77A3 and 49C9; and all (SEQ LD NO:77), which shows the consensus between h77A3-l, h77A3-2, m77A3, m49C9, and m70Bl 1. Positions falling withing the CDR loops are shown enclosed within the boxes.
Figure 22. The amino acid sequences of the heavy chains are shown. h77A3-l (SEQ LD NO: 19); H77A3-2 (SEQ LD NO:21); m77A3 (SEQ ID NO: 15); m49C9 (SEQ LD NO: 11); m70B 11 (SEQ LD NO: 13); humanized consensus (SEQ ID NO:78), which is the consensus between h77A3-l and h77A3-2; murine consensus (SEQ LD NO: 79), which is the consensus between m77A3, m49C9, and m70Bl l; 77A3/49C9 consensus (SEQ LD NO:80), which is the consensus between 77A3 and 49C9; and all (SEQ ID NO: 81), which is the consensus between h77A3-l, h77A3-2, m77A3, m49C9, and m70Bl l. Positions falling withing the CDR loops are shown enclosed within the boxes.
Detailed Description of the Preferred Embodiments
Alpha-2-antiplasmin (α2AP) is a molecular mediator of the thrombus resistance in patients with pulmonary embolism. A specific inhibitor of α2AP is described which is used to determine the role played by α2 AP in the regulation of fibrinolysis.
A. Immunologic Molecules
In the following description, reference will be made to various methodologies well-known to those skilled in the art of immunology. Standard reference works setting forth the general principles of immunology include Klein, J., Immunology: The Science of Cell-Noncell Discrimination, John Wiley & Sons, New York (1982); Kennett, R. et al, Monoclonal Antibodies, Hybridoma: A New Dimension in Biological Analyses, Plenum Press, New York (1980); Campbell, A., "Monoclonal Antibody Technology," in Laboratory Techniques in
Biochemistry and Molecular Biology, Vol. 13, Burdon, R., et al, eds., Elsevier, Amsterdam (1984); and Eisen, H.N., Microbiology, 3rd ed, Davis, B.D., et al, Harper & Row, Philadelphia (1980).
As used herein, α2AP-binding molecule includes antibodies (polyclonal or monoclonal), as well as ligands. As used herein, an "immunologic molecule" refers to polypeptides comprising the binding region of a monoclonal antibody. Thus, monoclonal antibodies, antibody fragments, chimeric antibodies, humanized antibodies, and fusion proteins comprising antibody binding regions are "immunologic molecules". The term "antibody" (Ab) or "monoclonal antibody" (MAb) is meant to include intact molecules as well as antibody fragments (such as, for example, Fv, Fab and F(ab')2 fragments), single chain antigen-binding proteins, "humanized" antibodies, and chimeric antibodies which are capable of specifically binding to α2AP. Fab and F(ab')2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less nonspecific tissue binding of an intact antibody (Wahl et al, J. Nud. Med. 24: 16-325 (1983)). Thus, these fragments are preferred.
An antibody is said to be "capable of binding" a molecule if it is capable of specifically reacting with the molecule to thereby bind the molecule to the antibody. As used herein, the term "hapten" is intended to refer to any molecule capable of being bound by an antibody. The term "epitope" is meant to refer to that portion of a hapten which can be recognized and bound by an antibody. A hapten or antigen may have one, or more than one epitope. An "antigen" or "immunogen" is a hapten which is additionally capable of inducing an animal to produce antibody capable of binding to an epitope of that antigen. The specific reaction referred to above is meant to indicate that the hapten will react, in a highly selective manner, with its corresponding antibody and not with the multitude of other antibodies which may be evoked by other antigens.
The antibodies of the present invention may be prepared by any of a variety of methods. For example, cells expressing α2AP (or fractions, lysates, etc thereof) can be administered to an animal in order to induce the production of sera containing polyclonal antibodies that are capable of binding α2AP. In a preferred method, a preparation of α2AP of the present invention is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity. The antibodies of the present invention may also be prepared using phage display technology. Methods of preparing antibodies using phage display are known in the art. See, for example, U.S. Patent No. 5,565,332; Clarkson et al, Nature 552:624-628 (1991); Huse, Science 246: 1275-1281 (1989); Kang, Proc. Natl. Acad. Sci. USA 55:11120-1 1123 (1993); Marks, J. Mol Biol. 222:581-597 (1991); and McCafferty et al, Nature 348:552-554 (1990). In one preferred method, the im unogenic molecules of the present invention are monoclonal antibodies (or α2AP binding molecules). Such monoclonal antibodies can be prepared using hybridoma technology (Kohler et al, Nature 256:495 (1975); Kohler et al, Eur. J. Immunol. 6:511 (1976); Kohler et al, Eur. J. Immunol. 6:292 (1976); Hammerling et al, in Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)). In general, such procedures involve immunizing an animal (preferably a mouse) with the antigen or with a cell which expresses the antigen. A preferred antigen is purified α2AP. The most preferred antigen is cc2AP fragment (fibrin binding region) obtained by trypsin digest of a plasma clot, then affinity purified with a SEPHAROSE-coupled monoclonal antibody, RWR (Reed, G.L. Ill et al, Trans. Assoc. Am. Phys. 707:250-256 (1988); U.S. Patent No. 5,372,812, issued December 13, 1994). Suitable cells can be recognized by their capacity to secrete anti-α2AP antibody. Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with
10% fetal bovine serum (inactivated at about 56°C), and supplemented with about 10 μg/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 μg ml of streptomycin. The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. The method of somatic cell fusion is described in Galfre, G. and Milstein, C, Meth. En∑ymol 75:3-46 (1981). After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al, Gastroenterology 50:225- 232 (1981). The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding α2AP. Alternatively, additional antibodies capable of binding to the α2AP antigen may be produced in a two-step procedure through the use of anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens, and that, therefore, it is possible to obtain an antibody which binds to a second antibody. In accordance with this method, α2AP-specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the α2AP-specific antibody can be blocked by the α2AP antigen. Such antibodies comprise anti-idiotypic antibodies to the α2AP-specific antibody and can be used to immunize an animal to induce formation of further α2AP-specific antibodies.
It will be appreciated that Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). Alternatively, α2AP-binding fragments can be produced through the application of recombinant DNA technology, through synthetic chemistry, or biotinylation.
Also intended within the scope of the present invention are humanized or chimeric antibodies, produced using genetic constructs derived from hybridoma cells producing the MAbs described above. Humanized antibodies are antibodies in which the framework or other regions of the murine Ab is replaced with the homologous regions of a nonmurine antibody. Chimeric antibodies are antibodies in which the murine constant region has been replaced with a non-murine constant region. Methods for production of chimeric antibodies are known in the art. See, for review: Morrison, Science, 229: 1202-1207 (1985); Oi et al, BioTechniques
4:214 (1986); see also, Cabilly et al. , U.S. Patent 4,816,567 (3/28/89); Taniguchi etal., EPl7l496 (2/19/86); Morrison etal, EP173494 (3/5/86); Neuberger et al , WO8601533 (3/13/86); Robinson et al, WO 8702671 (5/7/87); Boulianne et al, Nature 312:643-646 (1984); and Neuberger et al, Nature 14:268-270 (1985). Methods for production of humanized antibodies are known in the art. See, for example, U.S. Patent 5,585,089; Jones et al, Nature 527:522-525 (1986); and Kettleborough et al, Protein Engineering ¥:773-783 (1991).
Also provided in the present invention are single-chain antibodies capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked c 2-antiplasmins. Methods of making single chain antibodies are well known in the art. See, for example, U.S. Patent No. 4,946,778; U.S. Patent No. 5,260,203; U.S. Patent No. 5,091,513; and U.S. Patent No. 5,455,030, all of which are herein incorporated by reference.
Also intended within the scope of the present invention are variants of the monoclonal antibodies described above.
The present inventors have determined the nucleotide and amino acid sequence of several immunologic molecules capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked «2-antiplasmins. Accordingly, the present invention provides for nucleic acid molecules comprising a nucleotide sequence encoding for an immunologic molecule of the present invention or fragment thereof.
Due to the degeneracy of the genetic code, and to the fact that the genetic code is known, all other nucleotide sequences which encode the same amino acid sequence as the nucleotides of the present invention can be determined and used in the practice of the present invention.
DNA clones containing nucleotide sequences encoding the following antibody chains were deposited at the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland, 20862 on September 19, 1997: light chain of 77 A3 (77A3 LC), ATCC Accession No. ; light chain of 49C9 (49C9 LC), ATCC Accession No. ; light chain of 70B11 (70B11 LC), ATCC
Accession No. ; heavy chain of 77 A3 (77 A3 HC), ATCC Accession No. ; heavy chain of 49C9 (49C9 HC), ATCC Accession No. ; and heavy chain of 70B1 1 (70B1 1 HC), ATCC Accession No. .
The nucleic acid molecules of the present invention include: nucleic acid molecules containing a nucleotide sequence encoding the mature light chain of
77 A3 as shown in SEQ ID NO:9 or as encoded by the clone contained in the
ATCC Accession No. ; nucleic acid molecules containing a nucleotide sequence encoding the mature light chain of 49C9 as shown in SEQ LD NO: 5 or as encoded by the clone contained in ATCC Accession No. ; and nucleic acid molecules containing a nucleotide sequence encoding the mature light chain of 70B 11 as shown in SEQ LD NO: 7 or as encoded by the clone contained in
ATCC Accession No. .
Also included in the present invention are nucleic acid molecules containing a nucleotide sequence encoding an antibody heavy chain, including: nucleic acid molecules containing a nucleotide sequence encoding the mature heavy chain of 77 A3 as shown in SEQ LD NO: 15 or as encoded by the clone contained in ATCC Accession No. ; nucleic acid molecules containing a nucleotide sequence encoding the mature heavy chain of 49C9 as shown in SEQ LD NO: 11 or as encoded by the clone contained in ATCC Accession No. ; and nucleic acid molecules containing a nucleotide sequence encoding the mature heavy chain of 70B11 as shown in SEQ LD NO: 13 or as encoded by the clone contained in ATCC Accession No. .
Also included are nucleic acid molecules encoding humanized antibodies including: nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 of SEQ LD NO: 17; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 1 19 of SEQ ID NO: 19; and nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO:21.
Also intended within the scope of the invention are nucleic acid molecules encoding "consensus" amino acid sequences of heavy and light chain of antibodies, including: nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 of SEQ LD NO: 75; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 to of SEQ ID NO:76; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 107 of SEQ LD NO: 77; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO:78; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ ID NO: 79; nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO: 80; and nucleic acid molecules comprising a nucleotide sequence encoding for amino acid residues 1 to 119 of SEQ LD NO:81.
Nucleic acid molecules encoding an immunologic molecule of the present invention can be used to express recombinant proteins. A nucleic acid molecule encoding an immunologic molecule of the present invention can be inserted into a vector in accordance with conventional techniques. A "vector" should be understood as a nucleic acid vehicle used for cloning or expressing a desired sequence in a host.
In one embodiment, the recombinant vector is capable of expressing the immunologic molecule of the present invention. A vector is said to be "capable of expressing" a polypeptide if it contains a nucleotide sequence that encodes for the polypeptide, as well as transcriptional and translational regulator information operably linked to the nucleotide sequence that encodes the polypeptide. Two nucleotide sequences are said to be "operably linked" if the nature of the linkage between the two nucleotide sequences does not: result in the introduction of a frame-shift mutation; interfere with the ability of the promoter region sequence to direct the transcription of the desired sequence; or interfere with the ability of the desired sequence to be transcribed by the promoter region sequence. Thus, a promoter region would be operably linked to a desired nucleotide sequence if the promoter were capable of effecting transcription of that nucleotide sequence.
Once the recombinant vector is constructed, it can be introduced into a host cell, either prokaryotic or eukaryotic, by a variety of conventional techniques including transfection, transduction, electroporation, calcium-phosphate precipitation, and microiηjection. Prokaryotic hosts include bacteria such as E. coli, Bacillus, Streptomyces, and Salmonella. The most preferred prokaryotic host is E. coli. Eukaryotic hosts include yeast cells, insect cells, and mammalian cells, such as COS cells, CHO cells, and myeloma cells. In one embodiment of the invention, CHO cells are preferred.
In one embodiment of the invention, a nucleic acid molecule comprising a nucleotide sequence encoding for the light chain of an antibody is introduced into a vector, and a nucleic acid molecule comprising a nucleotide sequence encoding for the heavy chain of an antibody is introducing into another vector. Both vectors are introduced into the same host cell. Alternatively, both chains could be introduced into the same vector. Following expression in an appropriate host, the polypeptide can be readily isolated using standard techniques, including affinity chromatography.
Also intended within the scope of the present invention are molecules comprising an amino acid sequence of the binding region of an immunologic molecule described herein. Molecules comprising an amino acid sequence of the binding region of an immunologic molecule described herein include, but are not limited to, monoclonal antibodies, humanized antibodies, chimeric antibodies, fragments of any such antibodies, single chain antibodies, fusion proteins, and the like. Such molecules can be used in the assays and methods of treatment of the present invention described below. The amino acid sequence of the binding region of the immunologic molecules of the present invention are shown in Figure 21 for the light chains and Figure 22 for the heavy chains. In Figure 21, the amino acid sequence of the binding regions of the light chains of h77A3-l and h77A3-2 (amino acid residues 24 to 34, 50 to 56 and 89 to 97 of SEQ LD NO: 17), m77A3 (amino acid residues 24 to 34, 50 to 56 and 89 to 97 of SEQ LD NO:9), m44C9 (amino acid residues
24 to 34, 50 to 56 and 89 to 97 of SEQ LD NO: 5), m70Bl 1 (amino acid residues 24 to 34, 50 to 56 and 89 to 97 of SEQ LD NO:7), the murine consensus (amino acid residues 24 to 34, 50 to 56 and 89 to 97 of SEQ LD NO:75), the 77A3/49C9 consensus (amino acid residues 24 to 34, 50 to 56 and 89 to 97 of SEQ LD NO:76) and the consensus of all light chains (amino acid residues 24 to 34, 50 to
56 and 89 to 97 of SEQ LD NO:77) are shown in the larger boxes.
In Figure 22, the amino acid sequence of the binding regions of the heavy chains of h77A3-l (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ ID NO: 19), h77A3-2 (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO:21), m77A3 (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO: 15), m49C9 (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO: 11), m70Bl 1 (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO:13), the humanized consensus (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO:78), the murine consensus (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO:79), the 77A3/49C9 consensus (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO: 80), and the consensus of all the heavy chains (amino acid residues 26 to 35, 50 to 66 and 99 to 108 of SEQ LD NO:81) are shown in the overlapping boxes.
B. Assays
Methods for immunoblotting are known in the art (see, for example, Reed,
G.L. et al, J. Immunol 750:4407-4415 (1993)). In a preferred method, the α2AP is electrophoresed on a slab minigel under reducing and non-reducing conditions. The gel is electroblotted to polyvinylidene difluoride membrane. The blot is exposed to different hybridoma supernatants in the channels of a miniblotter apparatus. After washing, the bound antibody is detected by incubation with 125I- goat antimouse antibody. After additional washing, the membrane is exposed in a phosphorimager (Molecular Devices, Sunnyvale, CA).
Methods for radioimmunoassays are also known. For example, the wells of a microtiter plate are coated with goat antimouse antibody. The wells are washed and blocked with BSA. The hybridoma supernatants are added to the empty wells. After incubation, the wells are washed and 125I-α2AP is added. After washing, the wells are cut and the bound antibody is measured by gamma scintillation counting. For competition assays, the wells of a microtiter plate are coated with a competing MAb. In a preferred embodiment, the binding of MAbs to 125I-α2AP (preferably, the fibrin binding region fragment of α2 AP, obtained by binding to RWR) is assayed by reverse solid-phase radioimmunoassay.
Methods for clot assays are also known (see, for example, Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 57: 1 114-1118 (1990). In a preferred embodiment, plasma is mixed with 125I-fibrinogen, then clotted by mixing with CaCl2 and thrombin Clots are compressed and washed with Tπs-buffered saline to remove unbound proteins The supernatant is removed and the clots counted in a gamma counter To each set of duplicate clots is added, various amounts of plasminogen activator, anti-coagulant, and Tris-buffered saline containing the
MAb or no MAb The clots are incubated and at various intervals, a portion of the solution is temporarily removed and gamma-counted to determine the amount of lysis The percent lysis may be defined at 100X (total supernatant cpm/total clot cpm) Fibrinogen assays are known. Blood samples and platelet-poor plasma are assayed for fibπnogen by, for example, the sodium sulfite method (Rampling, M W and Gaffhey, P J , Clin. C m. Ada. 6743-52 (1976))
Alpha-2-antiplasmin levels in plasma are assayed, for example, with a chromogenic substrate assay for plasmin inhibition (Stachrom kit) as described in Reed, G L , III et al. , Proc. Natl. Acad. Sci. USA 87 1114- 1118 ( 1990)
Statistical tests may be analyzed by, for example, a one way analysis of variance followed by a Bonferroni-Dunn procedure for multiple comparison testing
In vivo pulmonary embolism experiments are described in Example 2, below
C Methods of Treatment
By "patient" is intended, human or nonhuman Nonhumans include, for example, baboon, green monkey, dog, cynamologus, marmoset, ferret, guinea pig, and gerbil By "clot" is intended, an in vitro blood or fibrin clot, or "thrombi" in a patient Diseases treated according to the methods of his invention include, but are not limited to pulmonary thromboembolism, acute coronary syndrome, including unstable angina pectoris and non-Q-wave myocardial infarction, various forms of thrombosis, including venous thrombosis (e.g., deep venous thrombosis), and arterial thrombosis (e.g., renal, mesenteric, and limb thrombosis); and cerebral and thrombosis embolism; renal vein and peripheral arterial thrombosis, myocardial infarction, stroke, and other thromboses. This method may also be used to treat thrombotic conditions secondary or concomitant to surgical procedures, including percutaneous transluminal coronary angioplasty, peripheral arterial angioplasty, bypass graft, and stent. The "treating" or "treatment" is by, for example, inhibiting the formation of a thrombus, dissolving a thrombus, or by enhancing fibrinolysis. By the term "co-administration" is intended that each of the hapten-binding molecule and thrombolytic agent will be administered during a time frame wherein the respective periods of pharmacological activity overlap. The two agents may be administered simultaneously or sequentially.
The α2AP-binding molecules of the present invention may be monoclonal antibodies or fragments thereof. It is preferable to employ the F(ab')2 fragment of such an antibody for this purpose, in order to minimize any immunological reaction caused by the Fc portion of the immunoglobulin. Also preferred are single-chain antibodies, such as sFv. Procedures for preparing monoclonal antibodies are disclosed by Kaprowski, H. et al, United States Patent No. 4,172, 124, and Kohler et al, Nature 256:495-497 (1975). The preparation of monoclonal antibodies capable of preventing the inhibition of plasmin are taught by Mimuro, J. et al, Blood 69:446-453 (1987), and described in the examples section of the present application.
As used herein, an "antigen" is a molecule capable of being bound by an antibody such as, for example, α2AP. In order to be used in accordance with the present invention, the "antigen-binding molecule" must be capable of binding to a plasmin inhibitor and thereby prevent such an inhibitor from forming inhibitor- plasmin complexes. Any such antigen-binding molecule may be employed in accordance with the present invention. A preferred embodiment is α2AP-binding molecule which is capable of binding to α2AP or fragment thereof. An especially preferred o.2AP-binding molecule for this pu ose is a monoclonal antibody. Preferred embodiments of the monoclonal antibody is 77 A3, 70B11 or 49C9, described more fully below. The hybridoma producing MAb 77 A3 has been deposited under the terms of the Budapest Treaty with the International Depository Authority American Type Culture Collection, 12301 Parklawn Drive,
Rockville, MD 20852, U.S.A., on September 20, 1996; the ATCC Accession No. is HB-12192.
Also preferred are chimeric an humanized antibodies. An especially preferred chimeric antibody for this purpose is c77A3, described more fully below. Especially preferred humanized antibodies for this purpose are h77A3-l and h77A3-2, described more fully below. Also preferred are antibody fragments and single-chain antibodies, including sFv77A3-l and sFv77A3-2, described below.
The terms "thrombolytic agent" are meant to refer to any agent capable of either dissolving a fibrin and/or platelet clot (or thrombus), or inhibiting the formation of such a clot. Examples of thrombolytic agents include fibrinolytic molecules, such as plasmin, plasminogen activator (for example, staphylokinase, streptokinase, prourokinase, urokinase, tissue-type plasminogen activator, and vampire bat plasminogen activator); anti-coagulants (for example, inhibitors of fibrin formation, such as heparin, hirudin and activated protein C; and anti-platelet agents, such as ticlopidine, aspirin, and clopidigrel and inhibitors of glycoprotein
LTb/IIIa function). Use of t-PA for these purposes is especially preferred. Although natural t-PA may be employed, it is preferable to employ recombinant t-PA (rt-PA). The invention may additionally employ hybrids, physiologically active fragments or mutant forms of the above thrombolytic agents. For example, the term "tissue-type plasminogen activator" as used herein is intended to include such hybrids, fragments and mutants, as well as both naturally derived and recombinantly derived tissue-type plasminogen activator.
As stated, the methods of the invention comprise the administration of the α2AP-binding molecule alone or in combination with a thrombolytic agent. When administered alone the molecule enhances endogenous fibrinolysis or thrombolysis by significantly augmenting clot lysis by endogenous plasminogen activators. Further, administration of the α2AP-binding molecule does not increase fibrinogen consumption over that obtained with equivalent doses of t-PA alone. Thus, the present method of clot-specific inhibition of cc2AP enhances the potency of the plasminogen activator and preserves its fibrin selectivity.
Alternatively, the α2AP-binding molecule is administered with a thrombolytic agent. In this embodiment, the α2AP-binding molecule and the thrombolytic agent of the present invention are intended to be co-administered to the recipient. It is preferable to provide the α2AP-binding molecule to the patient prior to the administration of the thrombolytic agent.
The α2AP-binding molecule of the present invention is provided for the purpose of preventing the inhibition of plasmin by a plasmin inhibitor. It has been discovered that coadministration of the α2AP-binding molecule together with a thrombolytic agent causes a synergistic effect, and thereby enhances clot lysis (thrombolysis) to a greater extent than would be expected if the effects of α2AP- binding molecule administration and thrombolytic agent administration was merely additive.
The α2AP-binding molecule of the present invention encompasses clot- specific inhibitors of α2AP. It is demonstrated that the combination of t-PA and the specific inhibitors, particularly monoclonal antibodies to oc2AP, does not increase fibrinogen consumption over that obtained with equipotent doses of plasminogen activator alone. Further, clot-specific inhibition of α2AP enhances the potency of plasminogen activators and preserves fibrin selectivity. For agents such as urokinase, which is not selective for fibrin, inhibition of clot bound α2AP would cause a similar, or more pronounced, enhancement in potency and lead to less fibrinogen consumption as well.
Thus, the inhibition of clot-bound α2AP enhances clot lysis by endogenous plasminogen activators. Further, when administered in combination with a thrombolytic agent, thrombolysis is significantly increased compared with the lysis achieved by equivalent doses of the thrombolytic agent alone. This increased lysis by the combination of the thrombolytic agent and α2AP inhibitor occurs without decreasing circulating fibrinogen or α2AP levels. The net result is a synergistic interaction between the two agents.
When used alone, an amount of α2AP-binding molecule capable of preventing inhibition of plasmin and thereby enhancing clot lysis when provided to a patient is a "therapeutically effective" amount. In order to enhance clot lysis and prevent clot reformation, it is desirable to provide between 3 to 300 nmole of α2AP -binding molecule per kilogram of patient weight. This dosage may be administered, in one embodiment, over a period of between 60 to 480 minutes, by continual intravenous infusion at a rate of 0.006 to 5 nmole/kg/min. Alternatively, it is possible to provide the α2AP -binding molecule in an intravenously injectable bolus at a dose of between 3 to 600 nmole/kg, and most preferably between 30 to 60 nmole (of α2AP-binding molecule) per kilogram of patient weight. If the α2AP-binding molecule is provided in this manner, a single bolus is sufficient to prevent potential clot reformation. The α2AP-binding molecule of the present invention may be dissolved in any physiologically tolerated liquid in order to prepare an injectable bolus. It is preferable to prepare such a bolus by dissolving the C.2AP -binding molecule in normal saline.
When the <x2AP-binding molecule capable of preventing inhibition of plasmin is co-administered with a thrombolytic agent, it is desirable to provide 3 to 300 nmole of α2AP-binding molecule per kilogram of patient weight. This dosage may be administered, in one embodiment, over a period of 60 to 480 minutes, by continuous intravenous infusion. Alternatively, it is possible to provide the α2AP-binding molecule in an intravenously injectable bolus at a dose of between 3 to 600 nmole/kg, and most preferably between 30 to 60 nmole/kg of patient weight. An amount of thrombolytic agent capable of causing such lysis is a "therapeutically effective" amount. It is desirable to provide between 0.01 to 3.0 mg per kilogram of patient weight. In one embodiment, the thrombolytic agent is provided over a prolonged period (i.e., from about 180 to about 1440 minutes). In a preferred embodiment, the thrombolytic agent of the present invention is provided as an intravenously injected bolus containing between 0.5 to 1.0 mg/kg, and most preferably between 0.5 to 0.75 mg/kg. For example, for pulmonary embolism, the dosage of t-PA by continuous infusion is -100 mg for 2 hours (Goldhaber, S.C. et al, Lancet 341:507 (1993)). The dosage to be used of thrombolytic agent of the present invention is generally known in the art (see, e.g., Hemostasis and Thrombosis: Basic Principles and Clinical Practice, 3rd ed. Philadelphia, PA (1994)).
The thrombolytic agent of the present invention may be dissolved in any physiologically tolerated liquid in order to prepare an injectable bolus. It is, however, preferable to prepare such a bolus by dissolving the thrombolytic agent in normal saline.
A patient treated according to the preferred embodiment will, therefore, receive an intravenously injected bolus of the α2AP-binding molecule in combination with an intravenously injected bolus of the thrombolytic agent. This preferred treatment rriinimizes the amount of t-PA required for thrombolysis, thus reducing the extent of fibrinogen breakdown and lessening any tendency for general hemorrhage. Importantly, the use of the preferred treatment results in the dissolution of the occluding thrombus at a rate which greatly exceeds the rate of thrombus dissolution when either the α2AP-binding molecule or the thrombolytic agent is provided by infusion alone. Additionally, the risk of reocclusion is substantially reduced.
In previous models of fibrinolysis (3), the chief role assigned to α2AP has been to inactivate circulating plasmin and prevent a systemic lytic state. Thus, it may be surprising that an α2AP inhibitor can increase clot lysis without increasing fibrinogenolysis. This marked amplification of thrombolysis by α2AP inhibitor underscores the importance of fibrin bound rx2AP in regulating fibrinolysis. Since the subject antibodies augment clot lysis by a fibrin-selective agent such as t-PA as well as that by the nonselective activators urokinase and streptokinase, it appears that fibrin-bound α2AP plays a critical role in determining the rate of lysis by any exogenous plasminogen activator. These unexpected findings are important because it had previously not been possible to accelerate the rate of clot lysis without increasing the tendency to hemorrhage. The preferred embodiment, therefore, provides a method of treatment in which the administration of a bolus of a α2AP-binding molecule in combination with the administration of a bolus of a thrombolytic agent are capable of dissolving an occluding thrombus at a faster rate than can be obtained when either compound is administered alone. Moreover, the preferred embodiment accomplishes this goal while minimizing both fibrinogen breakdown and the risk of reocclusion. Thus, the combination of agents can significantly increase the potency and specificity of thrombolytic therapy.
As would be apparent to one of ordinary skill in the art, the required dosage of the anti-α2AP binding molecule or thrombolytic agent will depend upon the severity of the condition of the patient, and upon such criteria as the patient's height, weight, sex, age, and medical history. The α2AP-binding molecule or thrombolytic agent of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, such as by admixture with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their formulation are described, for example, in Remington's Pharmaceutical Sciences, 16th Ed., Osol, A, ed., Mack, Easton PA (1980). In order to form a pharmaceutically acceptable composition suitable for effective administration, such compositions will contain an effective amount of the α2AP-binding molecule or thrombolytic agent, either alone, or with a suitable amount of carrier vehicle.
Additional pharmaceutical methods may be employed to control the duration of action. ControUed release preparations may be achieved by the use of polymers to complex or absorb the α2AP-binding molecule or thrombolytic agents of the present invention. The controlled delivery may be exercised by selecting appropriate macromolecules (for example, polyesters, polyamino acids, polyvinyl pyrrolidone, ethylenevinylacetate, methylcellulose, carboxymethylcellulose, or protamine sulfate). The rate of drug release may also be controlled by altering the concentration of such macromolecules. Another possible method for controlling the duration of action comprises incorporating the therapeutic agents into particles of a polymeric substance such as polyesters, polyamino acids, hydrogels, poly(lactic acid) or ethylene vinylacetate copolymers. Alternatively, it is possible to entrap the therapeutic agents in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, by the use of hydroxymethylcellulose or gelatin-microcapsules or poly(methylmethacrylate) microcapsules, respectively, or in a colloid drug delivery system, for example, liposomes, albumin microspheres, microemulsions, nanoparticles, nanocapsules, or in macroemulsions. Such teachings are disclosed in Remington's Pharmaceutical Sciences, 16th Ed., Osol, A, ed., Mack, Easton PA (1980).
The thrombolytic agent or α2AP-binding molecule may be provided to a patient by means well known in the art. Such means of introduction include oral means, intranasal means, subcutaneous means, intramuscular means, intravenous means, intra-arterial means, or parenteral means. In one preferred method of treatment for pulmonary embolism, myocardial infarction, thrombosis or stroke, a patient is provided with a bolus (intravenously injected) containing between 0.5 to 1.0 mg/kg of a thrombolytic agent.
Generally, the results reported herein demonstrate that an inhibitor, particularly a monoclonal antibody, can be used to augment the catalytic function of an enzyme by neutralizing an inhibitor of that enzyme. This approach can be applied to biological processes which are tightly governed by inhibitors. Because coagulation is a finely balanced system in which the effects of enzymes (generally serine proteases) are pitted against the effects of inhibitors, frequently serpins (serine protease inhibitors) pathological alterations in clotting can be treated by augmenting enzyme activity or by neutralizing an inhibitor.
Having now generally described this invention, the same will be better understood by reference to certain specific examples which are included herein for purposes of illustration and are not intended as limiting. Example 1
Preparation of an Antibody Directed to Alpha-2-antiplasmin
Monoclonal Antibody Production, Purification and Characterization
Two Balb/C mice were immunized subcutaneously with 25 μg of purified human α2AP fragments derived from the trypsin digest of a human plasma clot. The cc2AP fragments were affinity purified with a SEPHAROSE-coupled monoclonal antibody, RWR (Reed, G.L. Ill et al, Trans. Assoc. Am. Phys. 707:250-256 (1988); U.S. Patent No. 5,372,812, issued December 13, 1994), against human α2AP. Mice were initially immunized with complete Freund's adjuvant and boosted 90 days later with 50 μg of α2AP fragment in incomplete Freund's adjuvant. The antisera titer was tested in a solid-phase radioimmunoassay (Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 57: 1114- 1118 (1990)) with α2AP immobilized in the wells of a microtiter plate. Four days before fusion, the mouse with the highest titer of α2AP antibody was hyperimmunized with 100 μg α2AP intraperitoneally. Somatic cell fusion was performed as described (Galfre, G. and Milstein, C, Meth. Enzymol 75:3-46 (1981)).
Hybridomas were tested for the production of antibodies to the α2AP fragment and for their ability to inhibit α2AP as described in Reed, G.L. Ill et al. ,
Proc. Natl. Acad. Sci. USA 87: 1114-1118 (1990). The binding of monoclonal antibodies (MAbs) to 125I-α2AP was tested in a solid-phase radioimmunoassay. Wells of a microtiter plate were coated with goat antimouse antibody (25 μl, 5 μg/ml) for 2 hours. The wells were rinsed and nonspecific protein binding sites were blocked with 1% bovine serum albumin in Tris-buffered saline, pH 7.4, for
1 hour. After a wash, 25 μl of hybridoma supernatant was added to the wells and incubated for 1 hour. The wells were rinsed and ,25I-α2AP was added (25 μl, 60,000 cpm) for 1 hour. The 125I-α2AP was then removed and the wells were rinsed and gamma-counted
Cloned hybridomas (limiting dilution) were expanded into ascites in pristane-primed Balb/C mice Antibodies were purified from filtered ascites by precipitation with 40% ammonium sulfate, dialysis into 10 mM KH2PO4, pH 7.2, and ion-exchange chromatography on DEAE-AFFIGEL BLUE SEPHAROSE
(BioRad, Hercules, CA) with a linear gradient from 0 to 100 mM NaCl
B. Immunoblotting
These were performed largely as described in Reed, G L et al, J. Immunol. 750 4407-4415 (1993). Purified human cc2AP (5 μg, American
Diagnostica, Greenwich, CT) was electrophoresed in a large single sample lane on a 12% slab minigel (BioRad, Hercules, CA) under reducing and non-reducing conditions The sample was electroblotted (Kyhse- Anderson, 1084) to polyvinylidene difluoride membranes (Millipore, Bedford, MA) and nonspecific protein binding sites were blocked with 5% dry milk The blots were exposed to different hybridomas supernatants for 1 hour in the channels of a miniblotter apparatus (Immunetics, Cambridge, MA) After washing, the bound antibody was detected by incubation with 125I-goat antimouse antibody (1 5 million cpm/membrane) After additional washing, the membranes were exposed in a phosphorimager (Molecular Devices, Sunnyvale, CA)
C. Radioimmunoassays
Wells of a microtiter plate were coated with goat antimouse antibody
(25 μl, 5 μl/ml) for 2 hours at 21°C They were washed and blocked with 1%
BSA (bovine albumin serum) for 1 hour To the empty wells in duplicate were added 25 μl of hybridoma supernatants After incubation for 1 hour the wells were washed and 25 μl of 12Sl-α2AP was added to the wells for another hour After washing the wells were cut and the bound antibody measured by gamma scintillation counting.
Competition radioimmunoassays were performed by coating wells of a microtiter plate with 25 μl of purified MAb (70B1 1) in duplicate (10 μg/ml) for 1 hour. The wells were washed and blocked with 1% BSA for 1 hour. After washing, 25 μl of a competitor MAb, same MAb or negative control MAb was added to different wells (50 μg/ml) followed by 25 μl of 125I-α2-antiplasmin (100,000 cpm). After 1 hour incubation, the wells were washed, cut and the radioactivity was measured in a gamma scintillation counter.
D. Plasma Clot Lysis Assays
These were performed largely as described in Reed, G.L. Ill et al, Proc. Natl. Acad. Sci. USA 57:1114-1118 (1990). Pooled fresh frozen plasma was obtained from 5 random donors to the Massachusetts General Hospital Blood Bank. The plasma was mixed with 125I-fibrinogen to achieve ~1 ,000 cpm/μl. The plasma was clotted for 1 hour at 37°C in a 12 x 65 mm test tube by mixing 50 μl with 50 μl of CaCl2 (5 mM final) and thrombin (1 U/ml). Clots were compressed and washed in 1 ml Tris-buffered saline (pH 7.4) to remove unbound proteins. The supernatant was removed and the clots were counted in a gamma counter. To each set of duplicate clots was added 100 μl containing various amounts of urokinase, 100 μl of pooled plasma containing 1 u/ml of hirudin and 100 μl of
Tris-buffered saline containing 7 μg (Figure 4) or 21 μg (Figure 5) of MAb or no MAb. The clots were placed in a 37°C water bath and at various intervals 100 μl of solution was temporarily removed and gamma-counted to determine the amount of lysis The percent lysis was defined at 100 x (total supernatant cpm - total clot cpm).
E. Results
Three hybridomas were selected that appeared to inhibit α2AP function in screening assays The serotypes of these MAbs were 49C9 (Igγ2aK), 70B11
(Igγ lK), and 77 A3 (Igγ2aK). Figure 1 compares the binding of these MAbs to I25I-α2AP in a reverse solid-phase assay When compared to the original α2AP inhibitor RWR, these MAbs bound with greater avidity To determine if the MAbs bound to the same epitopes, competition assays is shown for 70B1 1 in Figure 2 Compared to the negative control, anti-digoxin MAb, RWR had no significant inhibitory effects on the binding of 125I-α2AP to immobilized 70B 1 1 In contrast, when 70B 11 was used as a competitor, it completely inhibited the binding of 125I-α2AP to immobilized 70B 11 , as expected However, 49C9 and 77A3 were also excellent competitors as well The results of these assays are shown in tabular form in Table 1, below. MAbs 49C9, 70B11, 77 A3 also fully inhibited the binding of each other to 125I-α2AP, but they had no inhibitory effects on the binding of RWR. The converse was also true, RWR as a competitor had no effect on the binding of 125l-α2AP to the other MAbs This indicated that MAbs 49C9, 70B 11 and 77 A3 competed for binding to the same epitope, while RWR appeared to bind to a separate region of α2AP
To determine if the MAbs recognized a continuous or discontinuous epitope in α2AP, immunoblotting experiments were performed with denatured and reduced α2AP In these studies RWR bound well to denatured and reduced α2AP, indicating that it recognized an epitope which was not affected by boiling with SDS, nor reduction of disulfide bonds In contrast, MAbs 49C9, 70B 11 and
77A3 did not bind to denatured α2AP, suggesting that they recognize a conformation-dependent epitope Clot lysis assays were performed to examine the relative potency of these MAbs in amplifying the fibrinolysis by urokinase. Figure 3 compares the amount of lysis achieved by 7 μg of different purified MAbs (or TBS alone) as a function of dose of urokinase. Compared to urokinase alone (TBS) or urokinase with the control antidigoxin MAb, RWR, 49C9, 70B 11 and 77A3 all accelerate clot lysis.
However, 49C9, 70B 1 1 and 77 A3 appear to be significantly more potent than RWR in these assays. To examine the increase in fibrinolytic potency of urokinase achieved by one of these antibodies, dose response studies were performed in the absence or presence of MAb 77A3. Figure 4 shows that MAb 77 A3 markedly increases the potency of lysis of urokinase by roughly 100-fold.
As a means of further discriminating among the functional and epitope binding specificities of these MAbs, their ability to inhibit the α2AP from different animal species in plasma clot lysis assays was examined. The results of these assays are summarized in Table 2, below. In the different species of animal plasmas tested, RWR appeared to inhibit only human α2AP. In contrast, the other
MAbs showed a broader species cross-reactivity and ability to inhibit nearly all primate and some non-primate α2APs.
Figure imgf000038_0001
Figure imgf000038_0002
lysis, a "+" mdicated modest effects, and "++" indicates significant acceleration of plasma clot lysis (l e , significant functional crossreactivity) Example 2
In Vivo Study of Pulmonary Embolism
A. Materials
Materials were obtained from the following suppliers: rt-PA with a specific activity of 580,000 IU/mg, Genentech (South San Francisco, California); ketamine
(100 mg/ml), Fort Dodge Laboratories (Fort Dodge, Iowa); acepromazine maleate, Fermenta Animal Health Co. (Kansas City, MO); heparin (1000 U/ml), Elkins-Sinn Inc. (Cherry Hill, NJ); sodium iodide, Aldrich Chemical Co. (Milwaukee, WI); calcium chloride, Mallinckrodt (Paris, Kentucky); normal saline for intravenous use, Travenol Laboratories (Deerfield, IL); α2AP assay kit,
Stachrom (Asnieres, France); purified α2AP and fibrinogen, American Diagnostica (Greenwich, CT); goat antimouse antibody, Cappel Organon Technika (Durham, NC); human plasma pooled from random donors, Massachusetts General Hospital (Boston); bovine thrombin, Parke-Davis (Morris Plains, NJ); NaI25I, Dupont-NEN (Cambridge, MA); Bard Parker surgical blade, Becton Dickinson (Franklin Lake,
NJ); 4.0 silk sutures, American Cyanamid Co. (Danbury, CT); SURFLO IV catheter and 20 gauge 1-1/4-inch VENOJECT tubes with K3EDTA Terumo Medical Corp. (Elkton, MD); sterile three-way stopcock, Mallinckrodt Critical Care (Glens Falls, NY); auto syringe infusion pump, Baxter Health Care Corp. (Hooksett, NH); infusion pump tubing and microbore 60-inch extension set,
McGaw of Puerto Rico (Sabana Grand, Puerto Rico); surgical instruments, VWR (Boston); tubing, Namic (Glens Falls, NY); ferrets (-.8- 1 kg), Marshall Farms (New York, NY); aprotinin, Sigma (St. Louis, MO); and microcentrifuge tubes, National Scientific Supply Co. (San Rafael, CA). B. In Vitro Clot Lysis Assays
Pooled, fresh-frozen, citrated ferret plasma (1100 μl) was mixed with 15 μl of 125I-labeled human fibrinogen (-40,000 cpm/clot). Ferret plasma (35 μl) was mixed with 35 μl of Tris-buffered saline (TBS) containing 10 mM CaCl2 and thrombin (1 U/ml) in twelve 65-mm plastic tubes and clotted for 1 hour at 37°C.
The clots were washed in TBS, the supernatant was removed, and then 100 μl of TBS or 25 μg of purified MAb (RWR or 77 A3) was added to tubes in duplicate. Clot lysis was initiated by adding 0.1 U of rt-PA per tube. The clots were incubated at 37°C for 5 hours and the amount of lysis was determined by sampling for the release of radiolabeled fibrin degradation products into the supernatant, as described (Reed, G.L. Ill et al, Proc. Natl. Acad. Sci. USA 57: 1114-1118 (1990)).
C Pulmonary Embolism Experiments
Male ferrets were anesthetized by intramuscular injection (0.4 ml) of a mixture of ketamine and acepromazine (two parts acepromazine [10 mg/ml] to one part ketamine [100 mg/ml]). Intraperitoneal injections were repeated as necessary to keep the animals anesthetized. After an anterior midline incision had been made in the neck, the jugular vein and the carotid artery were exposed by blunt dissection and cannulated with 20G catheters that were secured at the proximal and distal ends with 4-0 silk sutures. The catheters were capped with three-way stopcocks.
Pooled, citrated human plasma was mixed with 125I-fibrinogen to achieve -1,000,000 cpm/rnl. Individual clots were formed by mixing 125I-fibrinogen- labeled plasma (45 μl) with 2.5 μl of bovine thrombin (100 U/ml) and 2.5 μl of calcium chloride (0.4 M). These clots were incubated at 37°C for 90 minutes, compressed, and washed thoroughly with saline three times to remove unbound proteins. The radioactive content of the clots was measured in a gamma counter immediately before clot injection. Blood samples were drawn at base line and at the end of the experiment. Sodium iodide (10 mg) was injected to block thyroid uptake. Clots were embolized into the lungs by injection through the internal jugular vein. Ferrets weighing less than 1 kg received three clots; those weighing 1 kg or more received four clots. Successful embolization was evidenced by the accumulation of radioactivity in the thorax. After the clots had been injected, the ferrets were turned on their sides to ease breathing.
All animals received weight-adjusted heparin at 100 U/kg (bolus), a dose sufficient to keep the activated partial thromboplastin time (aPTT) above 150 seconds throughout the procedure. The α2AP inhibitor (sterile-filtered, 14 mg/ml in saline) or a purified control MAb (antidigoxin) was given intravenously as a single dose (22.5 mg/kg). The rt-PA was given as a continuous infusion over 2 hours (1 or 2 mg/kg in 5 ml normal saline). Animals were observed for a total of four hours after pulmonary embolization and then killed by lethal injection of anesthesia or by CO2 inhalation. The thorax was dissected and all intrathoracic structures were removed for gamma counting to detect residual thrombi. The percentage of clot lysis was determined for each ferret by dividing the total residual radioactivity in the thorax (cpm) by that in the initial thrombi.
This experimental protocol was approved by the Harvard Medical Area Standing Committee on Animals. The Harvard Medical School animal management program is accredited by the American Association of Laboratory Animal Care, and the procedures were conducted in accordance with National Institutes of Health standards, as set forth in the Guide for the Care and Use of Laboratory Animals (DHHS Publication No. [NLH] 85-23, revised 1985), the Public Health Service Policy on the Humane Care and Use of Laboratory Animals by Awardee Institutions, and the NLH Principles for the Utilization and Care of Vertebrate Animals Used in Testing, Research, and Training. D. Statistical Tests
The data were analyzed by a one way analysis of variance followed by a Bonferroni-Dunn procedure for multiple comparison testing.
E. Fibrinogen Assays
Blood samples were collected on K3EDTA (0.15% solution final) with aprotinin (50 kallikrein U/ml). Platelet-poor plasma was obtained by centrifugation of whole blood (Mustard, J.F. et al, Meth. En∑ymol 769:3-1 1 (1989)) and assayed for fibrinogen by the sodium sulfite method (Rampling, M.W. and Gaffhey, P.J., Clin. Chim. Acta.67 A -52 (1976)).
F. a2- Antiplasmin Assays
To measure α2AP levels, we collected ferret blood on sodium citrate (1/10 volume) and centrifuged it to obtain plasma (Mustard, J.F. et al, Meth. Enzymol
769:3-11 (1989)). The plasma was tested for functional α2AP with a chromogenic substrate assay for plasmin inhibition (Stachrom kit) as described (Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 87: 1 1 14-1118 (1990)).
G. Results
From a panel of hybridomas we selected 77 A3, a MAb that bound tightly to human α2AP. MAb 77 A3 was purified from mouse ascites by ion exchange chromatography, and its purity was confirmed by SDS-polyacrylamide gel analysis (Figure 5). To study the role of α2AP in experimental pulmonary embolism in vivo, we tested purified 77 A3 in several different animal plasma clot lysis assays to determine whether it could bind and inhibit a non-human α2AP. Of various small animal plasmas tested (e.g. hamster, gerbil, guinea pig, rat, etc.), 77A3 significantly crossreacted with ferret plasma Figure 6 compares the lytic effects of 77 A3 with those of another MAb inhibitor of human α2AP, RWR (Reed, G.L III et al, Trans. Assoc. Am. Phys. 707.250-256 (1988), U.S Patent No 5,372,812, issued December 13, 1994), and with buffer alone Figure 6 shows that in comparison with the control (buffer alone), 77 A3 accelerated the lysis of ferret plasma clots induced by a low dose of rt-PA (0 1 unit). In contrast, RWR, which inhibits human α2AP (Reed, G.L. Ill et al, Trans. Assoc. Am. Phys. 707 250-256 (1988), U S Patent No 5,372,812, issued December 13, 1994) but does not crossreact with nonhuman α2AP, had no detectable effect This experiment indicated that 77 A3 inhibited ferret cc2AP and amplified ferret clot lysis in vitro
The cross-reactivity of 77A3 allowed us to investigate the role of α2 AP in a ferret model of pulmonary embolism In humans, pulmonary embolism is usually treated with heparin (Goldhaber, S , Chest 70745S-51S (1995)) Consequently, ferrets were treated with a weight-adjusted bolus dose of heparin at 100 U/kg This dose was sufficient to keep the aPTT above 150 seconds throughout the experiment (n=3) To investigate the effects of intravenous MAb 77 A3 on the activity of C.2AP in the blood, we selected a dose, 22 5 mg/kg, that was in molar excess to the level of ferret α2AP Our ex vivo measurements of ferret α2AP activity, 1 and 4 hours after intravenous dosing, showed that -75% of ferret α2AP activity was inhibited at this dose (Figure 7, n=2)
Using heparin at 100 U/kg and 77A3 at 22.5 mg/kg, we then investigated the effect of these agents and rt-PA on the lysis of pulmonary emboli (Figure 8) All animals received heparin. Control animals (n=8), which received no rt-PA showed 15.6±10.5% (mean±SD) lysis of their pulmonary emboli Animals receiving rt-PA at 1 mg/kg (n=4) over 2 hours showed 38.5±6 3% lysis, which was significantly greater than lysis obtained in those receiving heparin alone (P< 01). Similarly, animals receiving rt-PA at 1 mg/kg and a control (antidigoxin) MAb (n=3) showed 35.2±4 6% lysis Ferrets treated with rt-PA at 2 mg/kg (n=4) showed a minimal increase in lysis over those treated at 1 mg/kg (45 0±6 5% vs 38.5±6.3%, P<.05). However, animals receiving rt-PA at 1 mg/kg together with the α2AP inhibitor (n=4) showed greater lysis (56.2±4.7%) than those receiving an equivalent dose of rt-PA alone ( < 01), with or without the control (antidigoxin) MAb (P<.01), or those receiving twice the dose of rt-PA alone (7>< 05).
In addition to inhibiting plasmin on the thrombus surface, α2AP and other inhibitors inactivate plasmin in the blood (Collen, D., Eur. J. Biochem. 69:209-216 (1976); Moroi, M. and Aoki, N, J. Biol Chem. 257:5956-5965 (1976); Mullertz, S. and Clemmensen, I., Biochem J. 759:545-553 (1976)). We measured fibrinogen levels in the blood to determine if inhibition of α2AP led to nonspecific plasminolysis of a circulating clotting factor. Figure 9 shows residual fibrinogen levels expressed as a function of their initial values in four treatment groups. In animals that received no rt-PA, fibrinogen levels varied moderately but did not diminish during the experiment. Ferrets receiving 1 mg/kg and 2 mg/kg of rt-PA alone showed no significant change in fibrinogen level. Similarly, animals receiving the combination of rt-PA and the α2AP inhibitor showed no detectable change in circulating fibrinogen levels.
H. Discussion
Clinical and experimental studies suggest that pulmonary emboli and venous thrombi resist endogenous fibrinolysis and lysis induced by plasminogen activators (Goldhaber, S., Chest 707:45S-51S (1995); Goldhaber, S.Z. et al, Lancet 2:886-889 (1986); The Urokinase Pulmonary Embolism Trial, Circulation ¥7: 1-108 (1973); Goldhaber, S.Z. et al, Am. J. Med. 55:235-240 (1990); Goldhaber, S.Z. et al, Lancet 341:507-511 (1993)). This resistance to lysis is due in part to specific molecular factors in the thrombus that act to oppose fibrinolysis.
During thrombus formation, α2AP is covalently crosslinked to fibrin by activated factor Xm (Sakata, Y. and Aoki, N., J Clin. Invest. 69:536-542 (1982)). Studies in vitro indicate that when 0.2AP in the clot is absent or inhibited by MAbs, clots undergo spontaneous lysis (Aoki, N. et al, Blood 62: 1118-1122 (1983); Miles, LA etal, Blood 59: 1246-1251 (1982); Reed, G.L. Ill et al, Trans. Assoc. Am. Phys. 707:250-256 (1988); Reed, G.L. Ill et al, Proc. Natl Acad. Sci. USA 87: 1114-1118 (1990)). Conversely, when levels of α2AP in clots are increased by supplementation in vitro, fibrinolysis is inhibited (Sakata, Y. and Aoki, N., J.
Clin. Invest. 69:536-542 (1982)). In the present study we investigated the hypothesis that α2AP plays a major regulatory role in fibrinolysis and that it contributes to the thrombus resistance obtained in pulmonary embolism.
We measured the effect of rt-PA, with and without α2AP inhibition, on the net lysis of pulmonary emboli in ferrets. Because heparin is the established therapy for humans with pulmonary embolism, we considered animals treated with heparin alone as the control group. The weight-adjusted bolus dose of heparin given to the ferrets was sufficient to maintain a high level of anticoagulation throughout the experiment. In animals treated with rt-PA at a dose comparable to that used in humans (1 mg/kg), lysis of pulmonary emboli was enhanced significantly in comparison with lysis in animals treated with heparin alone. Increasing the dose of rt-PA to 2 mg/kg, a dose higher than is safe in humans, led to a minimal increase in lysis. A similar plateau in the dose response for t-PA-induced lysis has been noted in experimental studies of pulmonary embolism in dogs (Werier, J. et al, Chest. 700:464-469 (1991)). However, specific inhibition of α2AP markedly potentiated the lysis of experimental pulmonary emboli by rt-PA (1 mg/kg), causing significantly more lysis than was seen in ferrets treated with the same dose of rt-PA: alone or with a control MAb, the lysis achieved with α2AP inhibition was also greater than that achieved in ferrets treated with high-dose rt-PA (2 mg/kg). At the same time, despite the higher total lysis obtained in animals treated with the «2AP inhibitor, there was no significant consumption of circulating fibrinogen. In these studies of experimental pulmonary embolism, α2AP played an important role in thrombus resistance to lysis induced by rt-PA. Further studies will be necessary to establish the relative quantitative roles of circulating and thrombus bound α2AP in this process. Besides α2AP, other molecular factors may regulate the thrombus resistance of pulmonary emboli. A leading candidate is PAI-1, a serine protease inhibitor of t-PA and urinary-type plasminogen activator (u-PA or urokinase) (Stringer, H . and Pannekoek, H., J. Biol. Chem. 270: 11205-11208 (1995); Car eliet, P. et al, J. Clin. Invest. 92:2756-2760 (1993); Lang, I.M. et al,
Circulation 59:2715-2721 (1994); Marsh, J.J. et al, Circulation 90:3091-3097 (1994)). Unlike α2AP, PAI-1 is not specifically crosslinked to fibrin in the thrombus, although it has been shown to bind to fibrin in vitro (Stringer, HA. and Pannekoek, H., J. Biol. Chem. 270: 11205-11208 (1995)). By adding recombinant PA1-1 to developing thrombi, Marsh el al. (Marsh, J.J. et al, Circulation
90:3091-3097 (1994)) have shown that PA1-1 -enriched clots can suppress the spontaneous lysis of pulmonary emboli in a canine model; however, the role of PAI-1 in the lysis of autologous thrombi was not investigated. Pathologic studies of pulmonary emboli extracted by thrombectomy have suggested that PAI-1 expression increases in the endothelial cells at the margins of fresh thrombi but is not detectable in the thrombi themselves (Lang, I.M. et al, Circulation 59:2715-
2721 (1994)). Since PAI-1 -deficient mice (by gene deletion) are less likely than regular mice to develop venous thrombosis induced by endotoxin (Carmeliet, P. et al, J. Clin. Invest. 92:2756-2760 (1993)), the expression of PAI-1 in c endothelial cells at the margin of the developing thrombus may be functionally important. Nonetheless, the role of PAL-1 in thrombus resistance to pharmacologic plasminogen activators is less clear: in patients given t-PA, the inhibitory capacity of PAI-1 is overwhelmed completely (Lucore, CL. and Sobel,
B.E., Circulation 77:660-669 (1988)), and thrombus resistance is also observed in patients given streptokinase, against which PAI-1 has no effect.
Another potential cause of thrombus resistance in pulmonary embolism is activated factor XIII. Several studies in vitro suggest that this coagulation enzyme renders the fibrin in clots more resistant to degradation by plasmin by crosslinking fibrin chains together and by crosslinking α2AP to fibrin. (Sakata, Y. and Aoki, N., J. Clin. Invest. 69:536-542 (1982); Robbie, L.X. et al, Thromb. Haemostas. 70:301-306 (1993); Francis, C.W. and Marder, V.J., J. Clin. Invest. 50:1459-1465 (1987); Jansen, J.W.C.M. et al, Thromb. Haemostas. 57: 171-175 (1987); Reed, G.L. etal, Trans. Assoc. Am. Phys. 104:21-2% (1991)) However, little is known about activated factor XIII and thrombus resistance in vivo. This is probably due to the fact that a potent inhibitor of factor XIII function has only recently become available (Reed, G.L. and Lukacova, D., Thromb. Haemostas. 74: 680-685 (1995)). One study has suggested that when factor XIII is partially inhibited, coronary thrombi lyse at accelerated rates in response to t-PA (Shebuski, R.J. etal, Blood 75: 1455-1459 (1990)). This observation argues that factor XLH, through its effects on fibrin-fibrin and α2AP-fibrin crosslinking, also contributes to thrombus resistance.
Improving the lysis of thrombi in patients with pulmonary embolism and deep venous thrombosis remains a challenge. Unfortunately, increasing the dose of plasminogen activators is not a promising approach. High dose t-PA has been associated with an unacceptable increase in the risk of cerebral bleeding
(Passamani, E. et al, J. Am. Coll. Cardiol 70:51B-64B (1987)). In addition, in the present study and others (Werier, J. et al, Chest. 100.464-469 (1991)), high-dose t-PA (>2 mg/kg) produced only minimal increases in net lysis. The current FDA-approved doses of urokinase and streptokinase cause plasminogen "depletion"; thus, increasing the doses of these agents is also not likely to have an effect on net lysis (Onundarson, P.T. et al, J. Lab. Clin. Med. 720:120-128 (1992)). Several potent inhibitors of thrombin generation and activity are under development. Although these agents may further reduce the formation of new thrombi, they will not directly improve lysis of the large thrombi that typically exist in patients at the time they are diagnosed. These considerations suggest that fundamental insights into the molecular factors that oppose physiologic or pharmacologic lysis in thrombi will be necessary to spark improved treatments for venous thromboembolism. The results of the present study indicate that α2AP is a major contributor to thrombus resistance in experimental pulmonary embolism, and they suggest that inhibiting α2AP might improve lysis in patients with thrombotic disease.
Example 3
Cloning and Sequencing of Antibody cDNA
A. Amino Terminal Sequences of Antibodies
Monoclonal antibodies (49C9, 70B1 1 and 77 A3) were expanded into ascites and purified by ion exchange chromatography on DEAE Affigel Blue or by protein A agarose as described in Lukacova, D. et al, Biochemistry 50: 10164-10170 (1991). The purified MAbs (15 μg) were subjected to SDS-PAGE on 10% minigels (BioRad, Hercules, CA). The protein samples were electroblotted to PVDF membranes (Millipore, Bedford, MA) using semi-dry technique (Kyhse- Anderson, J., J. Biochem. Biophys. Meth. 70:203-209 (1984)) at 4 °C for 2 hrs at 75 milliamps (Millipore electroblotter). The bands were stained with Ponceau Dye (Sigma, St. Louis) and excised. The amino terminal sequences of the light chain of the antibodies are shown in Figure 10 (SEQ ID
NOS: 1-3).
B. Molecular Cloning of Antibody cDNA
Cloned hybridoma cell lines 49C9, 70B11 and 77A3 were grown in 150 mm tissue culture plates in 20% fetal bovine serum in Dulbecco's modified Eagle's medium with 4.5 g/1 of glucose and penicillin and streptomycin. The cells were harvested and centrifuged at 1200 rpm for 7 min. The cell pellet was resuspended in sterile phosphate buffered saline (pH 7.4) and re-centrifuged. Then 5 ml of RNAzol (Teltest, Friendswood, TX) was added and the pellet was homogenized for 2 min. Chloroform (500 μl) was added and the mixture was vortexed and left to incubate on ice for 15 min. The samples were centrifuged at 12,000 rpm for 15 min. The aqueous layer was mixed with 4.5 ml of isopropanol and vortexed. The mixture was precipitated at -70°C for 90 in. and recentrifuged at 12,000 rpm for 15 min. The pellet was washed in 2 ml of 70% ethanol in DEPC-treated water. After repeat centrifugation, the supernatant was removed and the pellet air-dried. The pellet was dissolved in 200 μl of diethyl-pyrocarbonate (DEPC)-treated water and 20 μl of 3 M NaCl and 800 μl of ethanol were added. The mRNA was precipitated overnight at -70 °C and the pellet resuspended in DEPC-water.
The cDNA corresponding to the light and heavy chain sequences were isolated by primer guided reverse transcription followed by polymerase chain reaction as described (Gene Amp Thermostable rTth Reverse Transcriptase RNA
PCR kit (Perkin-Elmer Cetus, San Francisco, CA). The light chain mRNA was primed for reverse transcription with a 3' primer (5' N6GAATTCACTGGATGG TGGGAAGATGGA 3' (SEQ LD NO:22)) corresponding to the constant region of the light chain ( Coloma, M.J., et al, Biotechniques 77:152-154, 156 (1991)) and the heavy chain was primed with a 3' primer (51 N6GAATTCA(TC)
CTCCACACACAGG(AG)(AG)CCAGTGGATAGAC 3' (SEQ LD NO:23)) corresponding to the constant region of the heavy chain (Coloma, M.J., et al, Biotechniques 77:152- 154, 156 ( 1991 )). Because the light chain amino terminal sequences were known, a specific primer corresponding to the likely 5' sense sequence was used (5* ACTAGTCGACATGAGTGTGCTCACTCAGGTCCTGG
(GQGTTG 3' (SEQ LD NO:24); Jones, S.T., and Bendig, M M., Bio/Technology 9:88-89 (Erratum) (1991)) for cDNA amplification. For cloning of the heavy chain, mouse heavy chain variable primers 1-12 were used as described (Jones, S T., and Bendig, M.M., Bio/Technology 9:88-89 (Erratum) (1991)). All heavy chains amplified best with primer 9; though lesser amplification was also seen with primers 12, 10 and 6. The PCR products were isolated by low melt agarose fractionation and ligated into a vector. The light chain PCR product was ligated into PCR II vector (Invitrogen, San Diego, CA) The heavy chain PCR product from primer 9 was ligated into PCR II.1 vector (Invitrogen, San Diego, CA). After transformation, the plasmid DNA was isolated and subjected to restriction digestion with EcoRI . Two clones from each heavy and light chain were expanded and the DNA harvested. Both strands of the cDNA clones were sequenced using T7 and Ml 3 primers with an ABI Prism automated sequencing apparatus. The cDNA sequences and deduced amino acid sequences are shown in Figures 11-16 (SEQ LD NOS:4-15).
Example 4
Preparation and Characterization of Chimeric and Humanized Antibodies
In designing the sequence for a chimeric or humanized antibody, there are many parameters to consider. In the constant regions, a whole antibody may be made, or an antibody fragment (Fab and Fab'2) can be made. The constant regions may be murine or human. It is an accepted practice to replace murine constant regions with human constant regions, thus forming a "chimeric" antibody. Chimeric antibodies are less immunogenic than murine antibodies and are thus more acceptable in the clinic.
The subclass of the antibody must also be considered. It is most common to express recombinant antibodies as IgGs, but within this class, one must choose amongst recombinant chimeric human IgGl, IgG2, IgG3, and IgG4. These subclasses have different biological properties. The present inventors took a conservative approach of using IgG2 because 1) the strong complement activating properties of IgGl and IgG3 were not needed for this antibody and 2) IgG2 may be more straightforward to manufacture than IgG4. Any of the other subclasses could be made with the same specificity following similar strategies. There are also parameters to consider in designing the variable region. The antibodies could be constructed to be chimeric or humanized. The chimeric antibody (murine V region, human constant region) is a more conservative approach, and virtually guarantees very similar antigen-binding activity to the murine antibody. With humanization, there is the risk of reducing the affinity and or biological activity of the antibody, but it can be presumed that the antibody will be less immunogenic. The present inventors have produced chimeric antibody as well as three forms of the humanized antibody.
Depending upon the strategy taken, humanization of any particular antibody can result in many different variable regions. At the simplest level, humanization consists of choosing a human variable region to serve as a template, and then deciding which residues should be "human" and which "murine". Thus, the choice of both the human template and which residues to maintain as human will affect the final sequence. In general, the strategy the present inventors have taken is to choose from among the human gerrnline variable region genes for the templates. Alternatively, one can choose from rearranged variable region genes, both those which have and have not undergone somatic mutation. The rationale for the first strategy is that somatic mutations can introduce immunogenic epitopes, while gerrnline genes would have less potential for doing so. The selection was further limited to gerrnline genes which are known to be rearranged and expressed as functional proteins in humans.
The choice of which gerrnline gene to use as template is governed by the overall sequence similarity between the murine sequence and the human sequence; the structural similarities between the two sequences (Chothia and Lesk, J. Mol.
Biol. 796:901 (1987)); the anticipated ability of the chosen heavy chain template to pair with the chosen light chain template; and the presence of the gerrnline gene in the majority of humans. The choice of which residues should be murine is governed by which residues are thought to come in contact with antigen and which are necessary to maintain the positioning and orientation of those residues which might contact antigen.
Variable regions were assembled from oligonucleotides and inserted into expression vectors containing the human gamma 2 constant region (for the VH region) and human kappa constant region (for the VL region). Heavy and light chain vectors were verified by nucleotide sequence and ability to direct the synthesis of antigen binding immunoglobulin (Ig) in COS cells (transient expression). Selected heavy and light chain vectors were then cotransfected into CHO cells to produce stable cell lines expressing the chimeric and humanized antibodies. Antibody was purified and tested for activity by antigen binding ELISA, ability to block the inhibitory activity of α2-AP in a plasmin assay, and ability to facilitate lysis of human clots by urokinase.
A. Construction of Chimeric and Humanized A ntibody Vectors
A functional light chain variable region is formed by the rearrangement and juxtaposition of a V gene segment and J gene segment. Therefore, it was necessary to find the best match for each of these segments and combine them to form a human template. A FASTA search (using the Wisconsin Package Interface) of amino acids 1-95 (Kabat numbering system; V gene proper) of murine 77 A3 (m77A3) light chain against a database of human Vk gerrnline genes showed that m77A3 is clearly most similar to the human Vkl subgroup (69.2% - 71.6% identity vs less than 60% identity to sequences outside this subgroup)
From among the Vk I sequences, the sequence with GenBank accession # X59312 (also known as the O2/O12 gene) was chosen as a likely candidate because of the match with structurally important positions and because of its prevalent expression in humans. The human template for the light chain was completed by the addition of the human Jk2 sequence. This J region was chosen because of its high degree of similarity with the murine J region of 77 A3.
A functional heavy chain variable region is formed by the rearrangement and juxtaposition of a V gene segment, a D gene segment, and a J gene segment. Therefore, it was necessary to find the best match for each of these segments and combine them to form a human template. A FASTA search (using the Wisconsin
Package Interface) of amino acids 1-94 (Kabat numbering system; V gene proper) of murine 77 A3 heavy chain against a database of human VH gerrnline genes showed that m77A3 is clearly most similar to the human VH7 family (77 % identity) with the human VH1 family having the next best match (about 60 % identity). The human VH7 family is mostly composed of pseudogenes; the only active gene (7-04.1 , Accession # X62110) is polymorphic in the human population (i.e. not all people have it) and therefore, in some people, this V gene could be more immunogenic than others. As an alternative human template for the heavy chain, the V gene with accession number Z 12316 (1-18 gene) was chosen. This sequence is very similar to 7-04.1 except for the H2 loop and FR3 region. A human template for the D region was not considered because this region lies entirely within the H3 loop, the sequence of which is generally pivotal for antigen binding and therefore likely to entirely follow the murine sequence in a humanized antibody. The human template for the heavy chain was completed by the addition of the human JH5 sequence. This J region was chosen because of its high degree of similarity with the murine J region of 77A3.
Following the selection of human templates for the heavy and light chain variable regions, it was necessary to determine which positions should follow the murine sequence vs which positions should follow the human sequence. The following criteria were used in selecting positions to follow the murine sequence: all positions falling within the CDR loops; all positions known to influence the conformation and/or spatial position of CDR loops (so called structural determinants; Chothia and Lesk, J. Mol. Biol. 796:901 (1987), Lesk and
Tramontano, in: Antibody Engineering, W.H. Freeman and Co., pp.7-38 (1992)); residues which were close enough to interact with residues in the CDR loops; and residues at or proximal to the VH-VL domain interface. All other residues followed the human sequence. These items are discussed in greater detail below. Positions falling within the CDR loops are shown enclosed within the boxes with solid borders and structural determinants are marked with an * in the row below the position number in Figures 17-19.
In order to determine which residues were close enough to interact with the CDR loops, it was necessary to generate an approximate molecular model of the Fv region of murine 77A3. The molecular model was built based on the combined variable light chain of an anti-lysozyme mAb (D1.3) and the variable heavy chain of an anti-neuraminidase mAb (lncca) as structural template. CDR loop sequences were assigned to canonical loop conformations and a possible conformation for CDR H3 was extracted form the Protein Data Bank. The modeling building protocol followed procedures described by Bajorath & Novotny
(Therapeutic Immunol. 2:95-105 (1995)). Likewise, residues at or proximal to the VH-VL domain interface were identified and the murine residues were used for the humanized antibody. In all, for h77A3-l heavy chain, h77A3-2 heavy chain, and for the common light chain there were 7, 18, and 1 1 murine residues, respectively, used outside of the CDR loops.
In order to prepare vectors encoding these chains, the amino acid sequence must be back translated into nucleotide sequence. For the most part, this was done simply by using the nucleotide sequence from the human template in cases where the amino acid residue is derived specifically from the human template; otherwise, the nucleotides from the murine sequence were used. At a few positions, silent substitutions were made in order to eliminate restriction sites.
Finally, signal peptides must be added to the sequence. For both the chimeric and humanized light chains, signal peptides corresponding to that of the murine 77 A3 light chain were used. For the chimeric and humanized heavy chains, the same signal peptide as for the light chains was used. Alternatively, signal peptides corresponding to that of murine 77 A3 VH or any other signal peptide can be used in the chimeric and humanized heavy chains.
Two humanized antibodies were created: h77A3-l and h77A3-2. A third version of the humanized heavy chain was created by including an oligonucleotide designed for h77A3-l in the construction of h77A3-2. This resulted in a hybrid molecule that was identical to h77A3-2 except for amino acids Ser and Leu at positions 9 and 11 of the heavy chain. One chimeric antibody, c77A3, was generated.
Amino acid and nucleotide sequences of h77A3-l and h77A3-2 heavy and light chains are shown in Figures 17-19 (SEQ LD NOS: 16-21 ). The common light chain is shown in Figure 17 (mature protein is amino acid residues 1 to 107 of SEQ LD NO: 17). The heavy chain of h77A3-l is shown in Figure 18 (mature protein is amino acid residues 1 to 119 of SEQ LD NO: 19). The heavy chain of h77A3-2 is shown in Figure 19 (mature protein is amino acid residues 1 to 123 of SEQ LD NO:21).
Expression vectors for chimeric and humanized 77 A3 light and heavy chains were prepared in three stages: (1) construction of cassettes containing human light or heavy chain constant region genes (pD16-hCka and pD20-hγ2a, respectively); (2) preparation of a PCR product containing the light or heavy chain variable region; and (3) insertion of the variable region into the appropriate expression cassette.
Plasmid pD13 was constructed and derived from the pcDNA3 plasmid (Invitrogen) in two steps. The SV40 promoter/enhancer and neomycin resistance genes were removed from pcDNA3 by digestion with Nael and isolation of the 3.82 kb fragment. These genes were replaced by the SV40 promoter/enhancer and dhfr gene from pS V2-dhfr. The DNA containing the pSV2-dhfr sequence was isolated as a 1.93 kb fragment after digestion with PvuII and BamHI. The 3.82 and 1.93 kb fragments were ligated together and used to transform MCI 061 bacteria following filling in the protruding ends of the 1.93 kb fragment from pSV2-dhfr. The correct product (designated pD12) was confirmed by the release of an 890 bp fragment following Hindlll digestion.
The polylinker was replaced with alternative restriction sites by digesting the resultant vector above with Asp718 and Bspl20I. The following oligonucleotides were annealed to the vector and cloned by ExoIII cloning (K. Hsiao, Nucl. Acid. Res. 27:5528-5529 (1993)) to complete the plasmid pD13:
5' TAGGGAGACCCAAGCTTGGTACCAATTTAAATTGATATCTCCTT AG GTCTCGAGTCTCTAGATAACCGGTCAATCGATTGGGATTCTT 3' (SEQ LD NO:25) and 5' GACACTATAGAATAGGGCCCTTCCGCGGTTGGATCCAACACGT GAAGCTAGCAAGCGGCCGCAAGAATTCCAATCGATTGACCGGTTA 3' (SEQ LD NO:26). The resulting plasmid was used to transform competent E. coli DH5α and the correct product was confirmed by sequencing the polylinker region.
Plasmid pD16 was derived from the pcDNA3 plasmid (Invitrogen) in a series of steps which: add a polylinker sequence upstream of the CMV promoter for linearization; delete the SV40 promoter/enhancer and neomycin resistance gene and replace them with the histone H3 transcription termination sequence, the SV40 promoter (enhancer deleted) and DHFR gene; and insert the gastrin transcription termination sequence upstream of the CMV promoter. pcDNA3 (Invitrogen) was digested with Bglll and annealed to the following oligonucleotides:
5' primer: 5'-GATCTGCTAGCCCGGGTGACCTGAGGCGCGCCTTTG GCGCC-3' (SEQ LD NO:27);and 3' primer: 3'-ACGATCGGGCCCACTGGACGCCGCGCGGAAACCGCGG CTAG-5' (SEQ LD NO:28).
The plasmid was then ligated. After ligation, the resulting plasmid (pcDNA3-LSI) was used to transform competent E. coli DH5α and the correct construct was confirmed by release of a 230 bp fragment following restriction enzyme digestion with Nhel and Nrul. Plasmid pcDNA3-LSI was then digested with NgoMI, Pvul and Bsml.
Following digestion, a 2.0 kb NgoMI-PvuI fragment was isolated. Plasmid pD12 (described above) was digested with Pvul and SphI to remove the SV40 enhancer and a 3.6 kb fragment was isolated. The following oligonucleotides, encoding the histone H3 transcription termination sequence were annealed and then ligated with the 2.0 kb NgoMI-PvuI fragment and 3.6 kb PvuI-SphI fragment:
5' primer: 5'-CCGGGCCTCTCAAAAAAGGGAAAAAAAGCATG-3' (SEQ ID
NO:29); and
3' primer: 3'-CGGAGAGTTTTTTCCCTTTTTTTC-5' (SEQ LD NO:30). The resulting plasmid pcTwD-LSl was confirmed by the production of 3.3, 0.95, 0.82 and 0.63 kb fragments after digestion with Nhel plus Neil and the production of 4.2, 1.0, 0.26 and 0.23 kb fragments after digestion with SphI plus BstEII.
Insertion of the gastrin transcription termination sequence to form plasmid pD16 was accomplished by digesting pcTwD-LSl with BssHII and Narl and isolating the 5.7 kb fragment and ligating with the following annealed oligonucleotides:
5' primer: 5'-CGCGCCGGCTTCGAATAGCCAGAGTAACCTTTTTTTTTAA TTTTATTTTATTTTATTTTTGAGATGGAGTTTGG-3' (SEQ LD NO 31); and 3' primer: 3'-GGCCGAAGCTTATCGGTCTCATTGGAAAAAAAAATTAAAAT
AAAAT AAAATAAAAACTCTACCTCAAACCGC-5' (SEQ LD NO:32). After ligation, the product was used to transform competent E. coli MCI 061 and the correct construction was confirmed by the production of 4.8, 0.66 and 0.31 kb fragments after digestion with NgoMI plus Spel and the production of 3.3, 1.0, 0.82 and 0.67kb fragments following digestion with NgoMI plus Ncol.
Plasmid pD17 was derived from pD16 by the removal of the Nhel site from the linearization polylinker. This was accomplished by digestion of pD16 with Bstll and Nhel and filling the protruding ends using Klenow polymerase. The reaction mixture was self-ligated and used to transform competent E. coli DH5α. pD 17 was digested with Asp7181 and Bsp 1201 to remove a polylinker which was replaced by the 113 bp Asp718I/Bspl20I polylinker from pD13. After ligation, the resulting intermediate plasmid pD20 had the Nhel site required for inserting heavy chain V genes. pD20 was distinguished from pD17 by linearization with Nhel, and distinguished from pD13 by linearization with BssH II which cuts only once within the linearization site polylinkers of pD16, pD17 and pD20. Finally,
DNA sequencing was used to confirm the polylinker in pD20.
A 2.9 kb EcoRI fragment was isolated from pGk. l 1 (Walls et al, Nucl. Acid. Res. 27:2921-2929 (1993)) and this was ligated into the plasmid pD13 (described above) previously digested with EcoRI. This construct (pD13-hCka) containing the human CK exon and flanking intron sequences was used to transform E. coli DH5α and the correct product was confirmed by restriction digestion. Digestion with EcoRI resulted in fragments of 5.7, 2.8 and 0.3 kb and digestion with Sad resulted in fragments of 7.1, 1.1 and 0.5 kb.
Construction of the light chain expression cassette was completed by removing the CK fragment along with the flanking polylinker sequences from pD13 and inserting it into pD16. Plasmid pD13-hCka was digested with Asp718I and Bspl20I to release the CK fragment and polylinker sequences. The same enzymes were used to linearize pD16 and the CK containing fragment was ligated into pD16 to form pD16-hCka. Following transformation of DH5α E. coli and amplification, the correct construct was confirmed by the release of 2.9 kb fragment following digestion with Asp718I and Bspl20I and linearization following digestion with a restriction enzyme present in pD16, but not pD13. The nucleotide sequence was also confirmed by sequencing various regions of the construct.
A genomic DNA fragment encoding the human γ2 gene was preassembled in pIC, and then transferred into pD20 as follows. Phage clone Phage 5A (Ellison and Hood, Proc. Natl. Acad Sci, 79: 1984-1988 (1982)), containing the human γ2 gene was digested with Hindlll and cloned into the Hindlll site of pUC18 to form the vector pγ2. In pγ2, the 5' end of the γ2 gene is adjacent to the polylinker region. pG was derived from pSV2-gpt by digestion with Hind III and Bgl II,
Klenow fill in, and religation. This served to remove a 121 bp Hind III-Bgl II fragment. pγ2 was then digested with BamH 1 and inserted into the BamH I site of pG to form pGγ2.2. pGγ2.2 contains a Bglll site 3' of the coding region that would interfere with later cloning steps. To remove this restriction site, pGγ2.2 was first digested with Bgl II , the sticky ends filled in by Klenow DNA polymerase I, then the plasmid religated. The resulting intermediate plasmid, pGγ2.3 was screened for lack of digestibility with Bgl II.
For purposes of later cloning in variable region genes, it was important to provide a restriction site in the γ2 containing cassette. This is conveniently done by mutating the nucleotides encoding the first two amino acids of the CHI exon to encode an Nhe I site (Coloma M.J. et al, J. Immunological Methods 752:89-104(1992)). Previously, an Nhe I to Bst E II fragment from the human γ4 gene was cloned. In this region, human γ2 and human γ4 genes encode identical amino acids. Thus, the γ4 containing vector (pIChγ4.1) could serve as a source for the 5' end of the γ2 gene. This vector was obtained as follows: The 8.6 kb BamH
I fragment from Phage 5D (Ellison, J. et alDNA 7:1 1-18 (1981)), containing the human γ4 gene, was subcloned into pUC, resulting in the plasmid pUChγ4. pUChγ4 served as the template for a PCR reaction involving the following primers: sense primer: 5^ATCGATGI ΔCcCACCAAGGGCCCA-3' (SEQ LD NO:33); and antisense primer: 5'-CTCGAGGGGTCACCACGCTGCTGA-3 ' (SEQ LD NO:34).
The sense primer contained a Clal site for subcloning the PCR product into pIC20R (Marsh J.L., etal, Gene 32: 481-485 (1984)) adjacent to a synthetic Nhel site (underlined). Note that the bases for the Nhel site can encode the first two amino acids (Alanine and Serine) for the human γ 1, γ2, γ3 or γ4 CHI exon. The antisense primer has an Xho I site for subcloning into pIC20R, next to a BstE II site
(underlined) which is in the CHI exon of the human γ4 and γ2 gene. The PCR product formed was restricted with Cla I + Xho I then ligated into pIC20R which had been digested by the same enzymes, to generate the intermediate pIChγ4.1. pGγ2.3 was digested with BamH I and HinD III and a 6.1 Kb fragment including the human γ2 gene locus was isolated from a 1.4% agarose gel for purification by the Qiaex™ gel extraction kit (Qiagen, Chatsworth, CA). The 2.9 Kb pIChγ4.1 plasmid was treated in a similar manner, and the two fragments were ligated together to form the intermediate vector pIChγ2.1. To screen, an EcoR I digest yielded appropriate fragment sizes of 6.3 Kb and 2.6 Kb. pIChγ2.1 contained a duplication of the 5' portion of the human γ2/γ4 CHI exon. In order to remove the duplicated region, it was digested with BstE II giving fragment sizes of 4.0 Kb, 1.8 Kb, 1.6 Kb, 1.1 Kb, and 0.4 Kb. The 4.0 Kb fragment was isolated from a 1.4% agarose gel, while the 1.6 Kb fragment was separated and isolated away from the 1.8 Kb fragment in 4% NuSieve™ GTG (FMC Bioproducts, Rockland, ME) agarose. Both fragments were purified by Qiagen gel extraction prior to ligating them together to prepare pIChγ2.2. In order to confirm the proper orientation of the two fragments the following primers were used to determine that the 3' portion of the human γ4 CHI exon's BstE II sticky end had joined with the 5' end of the human γ2 CHI exon (thus forming a contiguous human γ2 locus in pIC20R): sense primer: 5'-AACAGCTATGACCATGATTAC-3' (SEQ LD NO:35); and antisense primer: 5'-CACCCAGCCTGTGCCTGCCTG-3' (SEQ LD NO 36). The sense primer is homologous to sequence 5' of the pIC20R EcoR I site that is adjacent to the Cla I site. The antisense primer was chosen to be 500 bp downstream of the sense strand primer, and is homologous to sequence within the human γ2 CHI to CH2 intron. Thus, visualization of a 500 bp PCR product in a 1.4% agarose gel confirmed that the hybrid human γ4- γ2 CHI exon formed and was oriented in a contiguous manner to the remainder of the locus. pIChγ2.2 was digested with EcoR I to give the expected 2.6 Kb and 1.9 Kb fragments. The entire human γ2 CHI exon was confirmed by DNA sequencing.
The 1.8 Kb Nhe I + HinD m fragment containing the human γ2 gene locus was removed from pIChγ2.2 for ligation into plasmid pD20 opened by Nhe I + HinD III. The resulting vector is the expression cassette pD20-hγ2a.
The variable region (V) genes for both chimeric and humanized antibodies were synthesized by a modification of the non template specific PCR protocol
(Prodromou C, and Pearl L. H., Protein Eng. 5: 827 -829 (1992)). The PCR products included DNA encoding both the signal peptide and variable region proper as well as flanking sequences to facilitate insertion into the vector as well as correct splicing (light chain only). The following primers were used:
LHl, sense chimeric 77 A3 VH outer primer (30mer), 5'-CGATTGGAATTCTTG CGGCCGCTTGCTAGC-3' (SEQ LD NO:37); LH2, sense chimeric 77A3 VH primer 1 (80 mer), 5'-CTTGCGGCCGCTTGCTA
GCATGGATTGGGTGTGGAACTTGCTATTCCTGATGGCAGCTGCCCAA
AGTATCCAAGCACAGA-3' (SEQ LD NO:38);
LH3, anti-sense chimeric 77A3 VH primer 2 (80 mer), 5'-CTTGACTGTTTC TCCAGGCTTCTTCAGCTCAGGTCCAGACTGCACCAACTGGATCTGTGC
TTGGATACTTTGGGCAGCTG-3' (SEQ LD NO:39);
LH4, sense chimeric 77A3 VH primer 3 (80 mer), 5 -CTGAAGAAGCCT
GGAGAAACAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCAC
AAACTATGGAATGAACTGGGT-3' (SEQ LD NO.40); LH5, anti-sense chimeric 77 A3 VH primer 4 (80 mer), 5'-TCTTGGTGTTTAT
CCAGCCCATCCACTTTAAACCCTTTCCTGGAGCCTGCTTCACCCAGTT
CATTCCATAGTTTGTGAAG-3' (SEQ LD NO:41);
LH6, sense chimeric 77A3 VH primer 5 (80 mer), 5'-AGTGGATGGGCT
GGATAAACACCAAGAGTGGAGAGCCAACATATGCTGAAGAGTTCAA GGGACGGTTTGCCTTCTCTTTG-3' (SEQ LD NO:42);
LH7, anti-sense chimeric 77 A3 VH primer 6 (80 mer), 5'-TCCTCATTTTTGA
GGTTCTTGATCTGCAAATTGGCAGTGCTGGCAGAGGTTTCCAAAGAG
AAGGCAAACCGTCCCTTGAA-3' (SEQ LD NO:43);
LH8, sense chimeric 77A3 VH primer 7 (80 mer), 5'-GCAGATCAAGAACC TCAAAAATGAGGACACGGCTACATATTTCTGTGCAAGATGGGTACCT
GGGACCTATGCCATGGACT-3' (SEQ LD NO.44);
LH9, anti-sense chimeric 77 A3 VH primer 8 (80 mer), 5'-TGGGCCCTTGGTGC
TAGCTGAGGAGACGGTGACTGAGGTTCCTTGACCCCAGTAGTCCATG
GCATAGGTCCCAGGTACCC-3' (SEQ LD NO:45); LH10, anti-sense murine 77 A3 VH outer primer (29 mer),
5'-GGGAAGACGGATG GGCCCTTGGTGCTAGC-3' (SEQ ID NO:46);
LH11, sense chimeric 77 A3 VL outer primer (30mer), 5'-ATTTAAATTGAT
ATCTCCTTAGGTCTCGAG-3' (SEQ LD NO:47); LH12, sense chimeric 77A3 VL primer 1(79 mer), 5'-ATTTAAATTGATATCTCC
TTAGGTCTCGAGATGAGTGTGCTCACTCAGGTCCTGGCGTTGCTGCT
GCTGTGGCTTACAG-3' (SEQ LD NO:48);
LHl 3, anti-sense chimeric 77A3 VL primer 2 (78 mer), 5*-AGATGCAGATAGG GAGGCTGGAGACTGAGTCATCTGGATGTCACATCTGGCACCTGTAAG
CCACAGCAGCAGCAACGC-3' (SEQ LD NO:49);
LH14, sense chimeric 77 A3 VL primer 3 (78 mer), 5'-GTCTCCAGCCTCCCTA
TCTGCATCTGTGGGAGAAACTGTCACCATCACATGTCGAGCAAGTGG
GAATATTCACAATTA-3' (SEQ LD NO:50); LHl 5, anti-sense chimeric 77 A3 VL primer 4 (78 mer), 5'-TATAGACCAG
GAGCTGAGGAGATTTTCCCTGTTTCTGCTGATACCATGCTAAATAATT
GTGAATATTCCCACTTGCTC-3' (SEQ LD NO:51);
LHl 6, sense chimeric 77 A3 VL primer 5 (78 mer), 5-AAATCTCCTCAGCT
CCTGGTCTATAATGCAAAAACCTTAGCAGATGGTGTGCCATCAAGGT TCAGTGGCAGTGGATCA-3' (SEQ LD NO:52);
LHl 7, anti-sense chimeric 77 A3 VL primer 6 (78 mer); 5 -CTCCCAAAATCT
TCAGGCTGCAGGCTGTTGATCCTGAGAGAAAATTGTGTTCCTGATCC
ACTGCCACTGAACCTTGAT-3' (SEQ LD NO: 53);
LHl 8, sense chimeric 77A3 VL primer 7 (78 mer), 5'-GCCTGCAGCCTGAAGATTTTGGGAGTCATTACTGTCAACATTTTTG
GACCACTCCGTGGACGTTCGGTGGAGGCACCA-3' (SEQ LD NO:54);
LH19, anti-sense chimeric 77 A3 VL primer 8 (81 mer), 5'-TTCCAATCGATTGA
CCGGTTATCTAGAGACTCGAGACTTACGTTTGATTTCCAGCTTGGTGC
CTCCACCGAACGTCCACGG-3' (SEQ LD NO:55); LH20, anti-sense chimeric 77A3 VL outer primer (30mer), 5'-TCGATTGA
CCGGTTATCTAGAGACTCGAGA-3' (SEQ LD NO:56);
LH21, anti-sense humanized 77 A3 VL primer 2 (78 mer), 5'-AGATGCAGATA
GGGAGGATGGAGACTGAGTCATCTGGATGTCACATCTGGCACCTGTA
AGCCACAGCAGCAGCAACGC-3' (SEQ LD NO:69) LH22, sense humanized 77 A3 VL primer 3 (78 mer), 5'-GTCTCCATCCTCC
CTATCTGCATCTGTGGGAGACAGAGTCACCATCACATGTCGAGCAAG
TGGGAATATTCACAATTA -3' (SEQ LD NO:70)
LH23, sense humanized 77 A3 VL primer 5 (78 mer), 5'-AAATCTCCTCAA CTCCTGGTCTATAATGCAAAAACCTTAGCAAGTGGTGTGCCATCAAG
GTTCAGTGGCAGTGGATCA -3' (SEQ LD NO:71)
LH24, anit-sense humanized 77 A3 VL primer 6 (78 mer), 5'-CTCCCAAAATC
TTCAGGCTGCAGGCTGCTGATGGTGAGAGTAAAATCTGTTCCTGATC
CACTGCCACTGAACCTTGAT -3* (SEQ LD NO:72) LH25, sense humanized 77A3 VH -1 primer 1 (80 mer), 5'-CTTGCGGCCGCTTG
CTAGCATGAGTGTGCTCACTCAGGTCCTGGCGTTGCTGCTGCTGTGG
CTTACAGGTGCCAGATGTC -3' (SEQ LD NO:57);
LH26, anti-sense humanized 77 A3 VH -1 primer 2 (80 mer); 5'-GACTGAGGCT
CCAGGCTTCTTCAGCTCAGATCCAGACTGCACCAACTGGATCTGACA TCTGGCACCTGTAAGCCACAGCA -3' (SEQ LD NO: 58);
LH27, sense humanized 77A3 VH -1 primer 3 (80 mer), 5'-GAGCTGAAGAAGC
CTGGAGCCTCAGTCAAGATCTCCTGCAAGGCTTCTGGGTATACCTTCA
CAAACTATGGAATGAACTG -3' (SEQ LD NO:59);
LH28, anti-sense humanized 77 A3 VH -1 primer 4 (80 mer) 5 -TGGTGTTTATC CAGCCCATCCACTCTAAACCTTGTCCTGGAGCCTGTCGCACCCAGTTC
ATTCCATAGTTTGTGAAGGTA -3' (SEQ LD NO:60);
LH29, sense humanized 77 A3 VH -1 primer 5 (80 mer), 5'-TAGAGTGGATGGG
CTGGATAAACACCAAGAGTGGAGAGCCAACATATGCTGAAGAGTTCA
AGGGACGGTTTGTCTTCTCT -3' (SEQ LD NO:61); LH30, anti-sense humanized 77 A3 VH -1 primer 6 (80 mer), 5 -TCAGCTTTGAGG
CTGCTGATCTGCAAATAGGCAGTGCTGACAGAGGTGTCCAAAGAGAA
GACA AACCGTCCCTTGAACTC -3' (SEQ LD NO:62);
LH31, sense humanized 77 A3 VH -1 primer 7 (80 mer), 5'-TTTGCAGATCAG
CAGCCTCAAAGCTGAGGACACGGCTGTGTATTTCTGTGCAAGATGGG TACCTGGGACCTATGCCATGG -3' (SEQ LD NO:63); LH32, anti-sense humanized 77 A3 VH -1 primer 8 (80 mer), 5'-GCCCTTGGTG
CTAGCTGAGGAGACGGTGACCGTGGTTCCTTGACCCCAGTAGTCCAT
GGCATAGGTCCCAGGTACCCATC -3' (SEQ LD NO:64);
LH33, anti-sense humanized 77 A3 VH -2 primer 2 (80 mer), 5'-TGCTGTGGCT TACAGGTGCCAGATGTCAGATCCAGTTGGTGCAGTCTGGAGCTGAGG
TGAAGAAGCCTGGAGCCTCAGTC -3' (SEQ LD NO:65); LH34, sense humanized 77A3 VH -2 primer 5 (80 mer), 5 -TAGAGTGGATGGGC TGGATAAACACCAAGAGTGGAGAGCCAACATATGCTGAAGAGTTCAA GGGACGGTTTACCTTCACC -3' (SEQ LD NO:66); LH35, anti-sense humanized 77 A3 VH -2 primer 6 (80 mer), 5'-TCAGATCTGAG
GCTCCTGATCTCCAAATAGGCAGTGCTCGTAGAGGTGTCCAAGGTGA AGGTAAACCGTCCCTTGAACTC -3' (SEQ LD NO:67); and LH36, sense humanized 77A3 VH -2 primer 7 (80 mer, 5'-TTTGGAGATC AGGAGCCTCAGATCTGACGACACGGCTGTGTATTTCTGTGCAAGATG GGTACCTGGGACCTATGCCATGG -3' (SEQ ID NO:68).
Table 3 summarizes how the above primers were used in the non-template PCR protocol.
Figure imgf000065_0001
Briefly, 8 adjacent oligonucleotides which represent a synthetic light or heavy chain V gene are synthesized (VI -V8 in Table 3). Four sense strand oligonucleotides alternate with 4 overlapping antisense strand oligonucleotides of 78-81 nt in length. These PCR primers overlap each other by 24-27 nt. Note that for oligonucleotide primers VI and V8 (Table 3), their 5' end is designed to overlap with 15 -30 nt of the vector sequence, while their 3' end overlaps 48-65 nt of the signal peptide (VI) or the V gene sequence (V8). The 8 oligonucleotide primers are all included in the same first round PCR. Reaction conditions for this 1st round PCR were 0.125 picomoles of each primer, 10 μl of 10X Pfu buffer (Stratagene Inc., San Diego, CA), 10 nanomoles dNTP's (Boehringer Mannheim, Indianapolis, IN), 10% dimethylsulfoxide (DMSO), and 2.5 units cloned Pfu DNA polymerase I (Stratagene Inc., San Diego, CA) in a 100 μl reaction volume. Reactants were first denatured at 95°C for 5 min, annealed at 45 °C for 5 min, and extended at 72 °C for 1 min, followed by 25 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 30 sec, and extension at 72 °C for 30 sec. The 25 cycles were followed by a final extension at 72 °C for 7 min in a Perkin-Elmer DNA Thermal Cycler (Norwalk, CT).
The amplified PCR product was electrophoresed through a 1.4% agarose gel and the smear of DNA running between approximately 350 bp - 500 bp was cut out prior to purification by the Qiaex™ II gel extraction kit (Qiagen, Chatsworth, CA). This purified non template specific PCR product served as the template for a 2nd round PCR. To complete the 2nd round PCR, two additional outer primers are utilized. These outer primers are homologous to 29 - 30 nt of the vector sequence that is either 5' (sense primer) or 3' (antisense primer) of the linearized cloning site within the mammalian expression cassette vector. This allowed for the amplified PCR product to be subcloned into the vector by bacterial homologous recombination (Jones, D.H. and Howard, B. H., BioTechniques 10: 62-66 (1991)).
Thus, the reaction conditions for the 2nd round PCR were 0.125 picomoles each of outer sense and antisense primers, 10 μl of 10X Pfu buffer, 10 nanomoles dNTP's, 10% DMSO, 2.5 units Pfu DNA polymerase I, and approximately 100 ng of 1st round PCR template DNA. The reactants underwent the same thermocycle program described above. Subsequently, the amplicand from this reaction was removed from a 1.4% agarose gel and purified with the Qiagen™ II gel extraction kit.
200ng - 1 OOOng of PCR product was mixed with an equal weight of linearized vector, and this mixture was used to transform 200 ml of competent E. coli DH5α cells (GLBCO BRL/ Life Technologies, Gaithersburg, MD). Transformed cells were selected by 100 μg/ml ampicillin in LB agarose. Typically, pD16-hCka digested with Xho I was used for subcloning light chain V genes. pD20-hg2a digested with Nhe I served as the vehicle for heavy chain V gene constructs.
In order to confirm that the V gene of interest had been inserted into the expression vector, two screens were performed. The primary screen was by PCR, while the secondary screen was by restriction digest. Each individual colony of bacteria was picked into 5 ml of T broth (GLBCO BRL/ Life Technologies, Gaithersburg, MD) containing 100 μg/ml ampicillin and grown 8 - 16 hr at 37 °C with shaking. The conditions for the PCR screen were 0.125 picomoles of both outer primers (Table 3), 2 ml 10X Mg+2 buffer (Boehringer Mannheim, Indianapolis,
IN), 10 nanomoles dNTP's (Boehringer Mannheim, Indianapolis, IN), 1 unit Taq DNA polymerase I (Boehringer Mannheim, Indianapolis, IN), and 1 μl of the liquid culture growth (which served as the source of DNA template since the cells lysed at high temperature) in a 20 μl volume. Reactants first underwent denaturation at 94 °C for 5 min, followed by 25 cycles of denaturation at 94 °C for 25 sec, annealing at 45 °C for 25 sec, and extension at 72 °C for 12 sec. The cycles were followed by a final extension at 72 °C for 7 min. Positives were determined by size comparison relative to a DNA standard marker after electrophoresis through a 1.4% agarose gel. For the secondary screen, midi DNA preparations (Qiagen, Chatsworth,
CA) were made from bacterial pellets and a portion was digested with either Xho I (VL genes) or Nhe I (VH genes). Again, after electrophoresis through a 1.4% agarose gel, size comparison of the fragment released due to enzyme digestion served to identify potentially positive clones. The above procedures were used to confirm the presence of a potentially correct insert. However, they were not specific enough to detect small errors in the sequence (insertions, deletions and substitutions). To determine which clones contained DNA encoding complete Ig genes, each potentially positive heavy chain clone was cotransfected into COS cells with each potentially positive light chain clone. Culture supernatants were screened by ELISA for the presence of human IgG, and then for the presence of IgG binding to α2-antiplasmin (see below).
DNA for COS transfections was derived from midi DNA preparations described above. COS tranfections were performed in 60 mm dishes. Complete details of the DEAE - dextran technique employed have been described (Linsley
P.S. et al, J. Exp. Med. 173: 721-730 (1991)). Typically, 1.5 μg - 6 μg of whole antibody is derived from small scale COS transfections
As a final confirmation, the V region inserts from the above clones were sequenced by the dideoxy nucleotide procedure.
B. Production of Humanized and Chimeric Antibodies
Once heavy and light chain vectors encoding each of the desired antibodies were qualified, sufficient quantities of chimeric and humanized antibody for testing in functional assays were needed. This was first done as a scale-up of the COS transfections using the selected vectors. Finally, stable cell lines were prepared by high copy number electroporation. The electroporation protocol of Barsoum
(Barsoum, DNA and Cell Biology 9:293-300 (1990)) was followed with the exception that 100 μg each of the heavy and light chain vector were used (following restriction with BssHII) and the electroporation was performed in PFCHO media (PX-CELL PFCHO media, JRH Biosciences, Lenexa, Kansas). Transfected cells were selected in media containing either 20 nM or 100 nM methotrexate (MTX). Culture supernatants were assayed for the presence of whole antibody using the non-specific IgG ELISA. Cells from master wells containing the most antibody in the supernatant were expanded into larger volumes. In some cases, the methotrexate concentration was also increased in order to amplify the vector in the cell lines. The vector pairs in Table 4 were electroporated into DG44
CHO cells.
Figure imgf000069_0001
Purification of Humanized and Chimeric Antibodies
The purification of the antibody was first performed using protein- A affinity chromatography. A Pharmacia column, sized so that 5 mg of antibody to be loaded per 1 ml of resin, was packed with Perseptive Biosystems Poros 50 A protein-A resin. The column was then sanitized according to the methods recommended by the resin supplier. The column was equilibrated with pyrogen free 10 mM sodium phosphate, 150 mM sodium chloride pH 7.0 (PBS). The cell culture supernatant was adjusted to pH of 7.0-7.5 and loaded on the column at a flow rate equal to 2 - 3 column volume/min (CV/min). The column was then washed with 15 CV pyrogen free PBS or until a stable base line has been achieved. The antibody was eluted with 20 mM glycine/HCl pH 3.0 elution buffer. The eluted peak was collected in a pyrogen free vessel that contained 1/20 CV of 1 M Tris base solution. The pH of the eluted antibody solution was adjusted to pH 8.0 with 1M Tris base immediately. The column was then cleaned with 5 CV 12 mM HCl solution. The column was stored in 20% ethanol/water at 4.0°C.
The antibody was next purified using anion exchange chromatography. A Pharmacia column, sized so that 5 - 10 mg of antibody to be loaded per 1 ml of resin, was packed with Perseptive Biosystems Poros HQ 50 anion exchange resin. The column was then sanitized according to the methods recommended by the resin supplier. The column was equilibrated with pyrogen free 50 mM Tris/HCl, 50 mM NaCl, pH 8.0. The protein-A purified antibody adjusted to pH of 8.0 was loaded on the column with flow rate equal to 1 CV/min. The column was then washed with 5 CV pyrogen free 50 mM Tris HCl, IM NaCl pH 8.0. The antibody does not bind to this column under the running conditions and was present in the flowthrough fraction. The column was stored in 20% ethanol/water at 4.0°C. The antibody was then concentrated and diafiltered against PBS using a 3 OK cut off membrane.
D. Non-specific IgG ELISA to detect presence of antibody
This ELISA detects whole antibody (containing both heavy and light chain) and relies on a capture antibody specific for human IgG Fc region and a conjugate specific for human kappa chains. In this assay, Immunlon II flat bottom plates (Dynatech) were coated with goat anti-human IgG (Fc specific, adsorbed on mouse IgG) (Caltag, Inc. catalog #H10000) at 0.5 μg/ml in carb/bicarb buffer pH 9.6 and then blocked with PTB (PBS containing 0.05% Tween 20 and 1.0% BSA). Sample was added (either undiluted or diluted in PTB or Genetic Systems specimen diluent), the plates were incubated o/n at 4°C or for a few hours at room temperature. After washing, conjugate (goat anti-human kappa conjugated with horseradish peroxidase from Southern Biotech) was added at 1 :10000 in PTB. After approximately 1 hour incubation at room temperature, plates were washed and 100 μl chromagen/substrate was added (Genetic Systems chromagen diluted
1:100 into Genetic Systems substrate). After sufficient color development (usually 5 to 15 minutes) 100 μl 1 N H2SO4 was added to stop the reaction. Optical densities were determined using a Biotek plate reader set at 450 and 630 nm wavelengths. In the occasional case that none of the samples from small COS transfections showed the presence of whole antibody, similar ELISAs were performed to determine whether any light chain was being secreted. In this case, the plates were coated with a goat anti-human kappa chain at 1 μg/ml. The rest of the assay was done exactly as above.
The assay was used for three purposes. First, to screen small COS transfections that were set up to qualify various heavy and light chain vectors. In this case, the presence or absence of a signal was sufficient and it was not necessary to quantify the amount of antibody present. Second, to determine which of many master wells from CHO transfections were producing the most antibody. In this case, culture supernatants were diluted so that relative signals could be compared and the master wells containing the most antibody could be distinguished and thus selected for cloning and expansion. Thirdly, to determine amounts of antibody, either in culture supernatants or following purification. In this case, a standard consisting of either a chimeric or human IgGl or a human myeloma IgG2 were used. Both standard and sample were serially diluted (2x) across a plate and sample concentration relative to standard was determined by comparing position of the curves. The concentrations thus determined were used for following antibody production during the cloning and amplification process and for determining specific activity in the antigen binding ELISA and any of the functional assays.
E. ELISAs to show that antibody is capable of binding to antigen
This ELISA relies on an antigen capture and a human kappa chain specific conjugate. It was used for two purposes. Initially, to qualify a vector, supernatants from COS transfections were screened for the ability of antibody to bind to antigen. Vectors passing this test were then submitted to DNA sequencing. Secondly, to determine relative antigen binding ability of the various chimeric and humanized antibodies. This ELISA is very similar to the non-specific IgG ELISA described above except that the plates were coated with α2-antiplasmin (obtained from
American Diagnostica) at 1 μg/ml in PBS.
To determine relative antigen binding ability of various antibodies, scatter plots were used with log antibody concentration along the X axis and optical density along the Y axis. Antigen concentration was determined either from the non-specific ELISA or based on optical density of purified preparations. All three forms of humanized antibody (h77A3-l, -2, and -3) show antigen binding similar to that of the chimeric antibody. Comparisons were not made with the murine antibody (m77A3) because the m77A3 cannot be detected in the assay as described
(the antibody-conjugate used in the second step recognizes only human constant regions).
. Functional Assays
Two functional assays were performed. The first, known as the "plasmin assay with chromogenic substrate" is based on the ability of plasmin to convert
Spectrozyme PL, H-D-Nle-HHT-Lys-pNA.2AcOH into pNA, which absorbs light at 405 nm. If unblocked α2-antiplasmin is present, little or no conversion occurs.
Active antibody is capable of blocking the inhibitory activity of α2-antiplasmin. The second assay, the clot lysis assay, is a measure of the ability of antibody along with urokinase to lyse preformed clots.
The plasmin assay with chromogenic substrate is designed based on the action of plasmin on its chromogenic substrate according to the reaction:
Plasmin H-D-Nle-HHT-Lys-pNA.2AcOH ► H-D-Nle-HHT-Lys-OH + pNA
Plasmin Chromogenic Substrate
The generation of pNA was monitored by the increase in absorption at 405 nm using a SpectraMax 250 spectrophotometer. The addition of α2-antiplasmin inhibits the plasmin activity and no increase in absorption at 405 nm will be observed. Premixing of α2-antiplasmin with functional antibody blocks the ability of α2-antiplasmin to inhibit the plasmin activity. Plasmin activity was measured as the initial rate of color development. Assays are performed in 96 well microtiter plates. The chromogenic substrate Spectrozyme PL, H-D-Nle-HHT-Lys-pNA.2AcOH, human plasmin, and human α2-antiplasmin were purchased from American Diagnostica. Stock and working solutions are prepared as follows: Spectrozyme PL stock solution - 10 mM in ILO; Spectrozyme PL working solution - 1 : 12.5 dilution of stock solution in H2O; human plasmin stock solution - 0.2 mg/ml in 50% glycerol, 50% 2 mM HCl; human plasmin working solution - 1 : 12.5 dilution of stock solution in 0.1 1 mM HCl, which must be prepared immediately before use; human α2-antiplasmin stock solution - 0.2 mg/ml in PBS; and human α2-antiplasmin working solution - 1 : 15 dilution of stock solution in PBS. Stock solutions were stored at -70 and should not be refrozen after thawing.
Reagents are added in the following order, with mixing after each addition: 80 ul antibody or PBS, 40 ul α2 -antiplasmin working solution, 40 ul plasmin working solution, and 40 ul Spectrazyme PL working solution. R is the rate of color development. Rp, which represents maximum plasmin activity, is determined in wells lacking both antibody and α2-antiplasmin. Ro, which represents minimal plasmin activity, is determined in wells lacking antibody. Rs is the rate of color development in the sample. Antibody activity is calculated as (Rs - Ro)/(Rp - Ro)
* 100. Values should range between 0% and 100%. Antibody activity was plotted vs. amount antibody (on a log scale). Curves generated by test antibody and standard (usually murine 77 A3) were compared.
The data for murine 77 A3, c77A3, and h77A3-l are shown in Figure 20. The curves for murine and chimeric 77A3 were superimposable. The curve for h77A3-2 indicates a potential small loss in activity (20-30%).
The clot lysis assays were performed as follows. Test clots were formed in 96- well Corning #25805 microtiter plates by mixing 25 uL 16 mM CaCl2, 50 uL of pooled human plasma, and 25 uL of 4 NLH unit/ml of human alpha-thrombin (Sigma) in 30mM Hepes buffer, pH 7.40. Plates were incubated overnight at room temperature to allow clots to achieve maximum clot turbidities. Clot lysis was initiated by adding 10 uL of antibody to give 5 or 10 ug/well and 100 uL of urokinase to give 1, 3 or 5 units of urokinase/well (Abbott Labs) at pH 7.40. Plates were mixed on a table top microplate vortexer for 30 sec before the initial reading at 405 nm to get values corresponding to 0% lysis. Plates were sealed with Corning sealing tape #430454 and incubated at 37°C. During the course of 24 hrs, the decrease of turbidity was measured at 405 nm to quantify the progress of clot lysis.
The results of a clot lysis experiment of humanized 77A3-1 indicate that h77A3-l enhances clot lysis dramatically in comparison to buffer controls in each of the conditions tested. There was significant separation between the humanized and murine 77 A3 in clots containing 5 ug antibody in the presence of 1 or 3 units of urokinase indicating that humanized 77 A3 was somewhat less active than murine 77 A3, even though the lysis profiles were similar at the remaining four conditions tested. It should be noted that murine RWR, a monoclonal antibody with a 10-fold lower affinity than murine 77A3, causes no lysis at 10 ug per clot in the presence of 1 unit of urokinase and would give a lysis profile like buffer control.
Example 5 Preparation and Characterization of Single Chain Fv Fragments
A. Design and expression ofsFvform of 77 A3
The sFv fragment of an antibody is most commonly obtained by the tandem expression of the variable region of the antibody heavy chain along with the variable region of the antibody light chain spaced by a linker of 15-20 amino acids. sFv fragments are expected to have superior clot penetration to parent antibodies. Two constructs, p53-6 and p52-12, were prepared using murine variable regions with a VH-(linker)-VL polarity using YPRSIYLRRRHPSPSLTT (SEQ LD NO:73) as linker 1 for sFv77A3-l and GGSGSGGSGSGGSGS (SEQ LD NO.74) as linker 2 for sFv77A3-2. Both constructs were cloned into the pET-22b vector from Novagen and transformed into the BL21 (DE3) strain of E. coli grown in minimal M9 media. Though the majority of the His-tagged product was found in inclusion bodies, supernatants of cell lysate contained sufficient quantities of soluble sFv fragments for nickel-column purification. sFv77A3-2 present in fractions 7-11 collected from a nickel-column gave a single Coomasie staining band with a MW about 30,000 agreeing well with the calculated MW of 29,986. A similar but more weakly staining gel was obtained for sFv77A3-l.
B. Activity of sFv77A3-l and sFv77A3-2
Preparations of both sFv77A3-l and sFv77A3-2 were tested for alpha2- antiplasmin binding activity in a competition binding assay. Microplate wells coated with 77 A3 were treated with mixtures of biotinylated-human alpha2- antiplasmin and either sFv77A3-l or sFv77A3-2 along with positive control 77 A3 and negative control, mAb-59D8. Increasing quantities of 77 A3 prevented binding of biotinylated-human alpha2-antiplasmin whereas negative control 59D8 had little effect as an competitive inhibitor. With concentrations of test samples estimated by intensity of Coomasie stained bands, both sFv77A3-l and sFv77A3-2 completely inhibited the binding of biotinylated-human α2-antiplasmin with a profile of inhibition nearly superimposible to the parental 77 A3 reference.
Idiotypic markers present on 77 A3 were probed with a sandwich ELISA using a biotinylated polyclonal reagent rendered specific by multiple immunoadsorbtion steps through columns bearing immunoglobulins from man, mouse, baboon and cynomologous monkey (P Stenzel-Johnson & D Yelton, Seattle). Microplate wells were coated with 77 A3 and 59D8 as controls along with sFv77A3-l and sFv77A3-2. It is evident that 77A3 control and both sFv fragments bear idiotypic markers at each dose tested indicating that the sFv fragments "look" like the parental 77A3.
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.
The disclosure of all references, patent application, and patents referred to herein are hereby incorporated by reference.
74. 1
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule Ubis)
A. The indications made below relate to the microorganism referred to in the description on page 2 , line 12
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an addilionai sheet |y~]
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
20 September 1996 HB-12192
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet | |
Hybridoma cell line, 77a3
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed beiow will be submitted to the International Bureau later {specify the general nature of the indications e.g„ 'Accession Number of Deposit")
Figure imgf000077_0001
74.2
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule I3bis)
A. The indications made below relate to the microorganism referred to in the description on page 18 , . li:.n.e. 21
B. IDENTD7ICATION OF DEPOSIT Further deposits arc identified on an additional sheet [ ]
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 TEA
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet | |
77A3-HC
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (iflhe ind cations are not (or all designated Slates)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the Internationa I Bureau later (specify tne general nature ofthemώcation eg , 'Accession Number of Deposit')
Accession number will be furnished at a later date .
I or International Bureau use onh
ITns slu -maimnal Bureau on
Figure imgf000078_0001
74.3
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule I3bis)
The indications made below relate to the microorganism referred to in the description on page 18 , l ιi.n„e„ 19
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet HT]
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklan Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 TEA
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet | |
77A3-LC
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for ell designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau laier (specify the general nature of ihεinaications eg , 'Accession Number of Deposit")
Accession number will be furnished at a later date .
l-or International Bureau use onlv l"hιs shccl was received bv the International Bureau on
Λuthon/L * ict r
Figure imgf000079_0001
74.4
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13-us)
A. The indications made below relate to the microorganism referred to in the description on page iβ , line 22
D. IDENTIFICATION OF DEPOSIT Further deposits arc identified on an additional sheet \
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklan Drive P ckville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 TEA
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet j 1
49C9-HC
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed beiow will be submitted to Ihe Internaiional Bureau later (specify the general nature of the indications e.g., 'Accession Number of Deposit')
Accession number will be furnished at a later date .
— — — i or International Bureau use oni — — — —— I"hιs shccl was received bv ihr inirrnminnal Bureau on.
Figure imgf000080_0001
74.5
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule Ϊ3bis)
A. The indications made below relate to the microorganism referred to in the description on page 18 . line 19
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet HTJ
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 TEA
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet | j
49C9-LC
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the Internaiion l Bureau later (specify the general nature of the indications e.g., 'Accession Number of Deposit")
Accession number will be furnished at a later date.
Figure imgf000081_0001
74.6
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule I3bis)
A. The indications made below relate to the microorganism referred lo in the description on page 18 , line 23
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet |γ I
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 TEA
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet |"~|
70B11-HC
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank tf not applicable)
The indications listed below will be submitted to the Internaiional Bureau later (spccifyihegenerainaiurcoftheindicationse g , 'Accession Number of Deposit')
Accession number will be furnished at a later date.
Figure imgf000082_0001
74.7
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule I3bis)
Figure imgf000083_0001
74.8
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
Figure imgf000084_0001
For receiving Office use only For Imemalional Bureau use only
I I This sheet was rccciveα with the international application j This sheet was received by the International Bureau on:
22 JANUARY 1998
Authorized officer Authorized officer
l: rtn I'CT/UO -l (Inly |<><>2) ^ 74.9
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13....)
Figure imgf000085_0001
For receiving Office use only
[ I This shcei was received with the iniernaiional application
Λuthori7.cd officer
Form PCTKOΪ.14 (Inly IV>2)
Figure imgf000085_0002
74. 10
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
Figure imgf000086_0001
A. The indications made below relate to the microorganism referred to in the description on page 18 , line 20
D. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheei 1 I
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklawn Drive ockville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 209292
C ADDITIONAL INDICATIONS (leaveblank if not applicable) This infomiation is continued on an additional sheet ~\
70B11 LC
In respect of those designations in which a European Patent is sought a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC) .
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if tiie indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify Ike general nature of the indications eg., 'Accession Number of Deposit')
Figure imgf000086_0002
l-orm PCT/HO/n* (luly IV>2) 74.11
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13/;..)
Figure imgf000087_0001
i-or receiving Office use only
[ I This sheet was received with the internaiional application
Λuthori7cd officer
■(win I'CT/KO/114 ( liilv l<)<)2)
Figure imgf000087_0002
74.12
INDICATIONS RELATING TO Λ DEPOSITED MICROORGANISM
(PCT Rule 13t»ιι)
Figure imgf000088_0001
74.13
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
Figure imgf000089_0001
A. The indications made below relate to the microorganism referred lo in the description on page 18 . I c 23
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet |X
Name of depositary institution
AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including postal code and country)
12301 Parklawn Drive Rockville, Maryland 20852 United States of America
Date of deposit Accession Number
19 September 1997 209288
C. ADDITIONAL INDICATIONS (leave blank if not applicahle) This infomiation is continued on an additional sheet Q
70B11 HC In respect of those designations in which a European Patent is sought a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn , only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC) .
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if tiie indications arc not for all designated States)
E- SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
Tbe indications listed below will be submitted to the international Bureau late (specify ihegenerainatureoftheindicaiionseg., "Accession Number of Deposit")
For receiving Office use only For International Bureau use onlv
I j This shcei was received with the international application {•^ This sheet was received by the International Bureau on:
2 2 JAKUA Ϊ 1998
Authorized officer Authorized officer
l-orm I'd /It 0/| "M ( Inly \ψ)2) -

Claims

-75-What Is Claimed Is:
1. An immunologic molecule, wherein said immunologic molecule does not compete with RWR and is capable of binding to and inhibiting both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins, selected from the group consisting of:
(a) a chimeric antibody comprising a human IgG2 constant region; and
(b) a single chain antibody.
2. The immunologic molecule of claim 1, wherein said immunologic molecule is a chimeric antibody comprising a human IgG2 constant region.
3. The chimeric antibody of claim 2, wherein said chimeric antibody is
C77A3.
4. The immunologic molecule of claim 1, wherein said immunologic molecule is a single chain antibody.
5. The single chain antibody of claim 4, wherein said single chain antibody comprises a linker having the amino acid sequence of SEQ ID NO: 73.
6. The single chain antibody of claim 4, wherein said single chain antibody comprises a linker having the amino acid sequence of SEQ ID NO: 74.
7. The single chain antibody of claim 4, wherein said single chain antibody is an sFv antibody.
8. An immunologic molecule, wherein said immunologic molecule does not compete with RWR and is capable of binding to and inhibiting both (1) human -76-
and nonhuman circulating c.2-antiplasmins and (2) human and nonhuman fibrin crosslinked o.2-antiplasmins, selected from the group consisting of:
(a) an immunologic molecule, wherein the CDR1 region of the light chain of said immunologic molecule comprises amino acids 26 to 32 of SEQ ID NO:77;
(b) an immunologic molecule, wherein the CDR2 region of the light chain of said immunologic molecule comprises amino acids 50 to 52 of SEQ ID NO:77;
(c) an immunologic molecule, wherein the CDR3 region of the light chain of said immunologic molecule comprises amino acids 91 to 96 of SEQ
ID NO:77;
(d) an immunologic molecule, wherein the CDR1 region of the heavy chain of said immunologic molecule comprises amino acids 26 to 32 of SEQ ID NO:81; (e) an immunologic molecule, wherein the CDR2 region of the heavy chain of said immunologic molecule comprises amino acids 53 to 56 of SEQ ID NO:81; and
(f) an immunologic molecule, wherein the CDR3 region of the heavy chain of said immunologic molecule comprises amino acids 100 to 107 of SEQ ID NO:81.
9. The immunologic molecule of claim 8, wherein said immunologic molecule comprises amino acids 1 to 107 of SEQ D NO:77 and amino acids 1 to 119 ofSEQ ED NO:81.
10. An immunologic molecule, wherein said immunologic molecule does not compete with RWR and is capable of binding to and inhibiting both (1) human and nonhuman circulating 0.2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins, selected from the group consisting of: -77-
(a) an immunological molecule wherein the light chain of said immunological molecule is derived from a humanized antibody and the heavy chain of said immunological molecule is derived from a non-humanized antibody; and
(b) an immunological molecule wherein the light chain of said immunological molecule is derived from a non-humanized antibody and the heavy chain of said immunological molecule is derived from a humanized antibody.
11. A humanized antibody capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins, selected from the group consisting of: (a) an immunologic molecule, wherein the CDR1 region of the light chain of said immunologic molecule comprises amino acids 26 to 32 of SEQ ID NO: 17;
(b) an immunologic molecule, wherein the CDR2 region of the light chain of said immunologic molecule comprises amino acids 50 to 52 of SEQ ID NO: 17;
(c) an immunologic molecule, wherein the CDR3 region of the light chain of said immunologic molecule comprises amino acids 91 to 96 of SEQ LD NO:17;
(d) an immunologic molecule, wherein the CDR1 region of the heavy chain of said immunologic molecule comprises amino acids 26 to 32 of SEQ
ID NO:78;
(e) an immunologic molecule, wherein the CDR2 region of the heavy chain of said immunologic molecule comprises amino acids 53 to 56 of SEQ ID NO:78; and (f) an immunologic molecule, wherein the CDR3 region of the heavy chain of said immunologic molecule comprises amino acids 100 to 107 of SEQ ID NO:78. -78-
12. A humanized antibody capable of binding to both (1) human and nonhuman circulating α2-antiplasmins and (2) human and nonhuman fibrin crosslinked α2-antiplasmins, selected from the group consisting of:
(a) a humanized antibody comprising the amino acid sequence of amino acid residues 1 to 107 of SEQ ID NO: 17 and amino acid residues 1 to 119 of SEQ ID NO: 19;
(b) a humanized antibody comprising the amino acid sequence of amino acid residues 1 to 107 of SEQ ID NO:17 and amino acid residues 1 to 119 of SEQ ID NO:21; and (c) a humanized antibody comprising the amino acid sequence of amino acid residues 1 to 107 of SEQ ID NO:17 and amino acid residues 1 to 119 of SEQ ID NO:78.
13. A nucleic acid molecule, comprising a nucleotide sequence encoding for the immunological molecule of claim 11.
14. A nucleic acid molecule, selected from the group consisting of:
(a) a nucleic acid molecule comprising a nucleotide sequence encoding for amino acids 1 to 107 of SEQ ED NO: 17;
(b) a nucleic acid molecule comprising a nucleotide sequence encoding for amino acids 1 to 1 19 of SEQ ED NO: 19; (c) a nucleic acid molecule comprising a nucleotide sequence encoding for amino acids 1 to 119 of SEQ ED NO:21; and
(d) a nucleic acid molecule comprising a nucleotide sequence encoding for amino acids 1 to 119 of SEQ ED NO:78 .
15. A method of making a recombinant host cell, comprising: (a) inserting into a vector a nucleic acid molecule comprising a nucleotide sequence encoding for amino acids 1 to 107 of SEQ ED NO: 17; -79-
(b) inserting into the same or a separate vector a nucleic acid molecule comprising a nucleotide sequence encoding for either amino acids 1 to 119 of SEQ ED NO:19 or amino acids 1 to 119 of SEQ ID NO:21 or amino acids 1 to 119 of SEQ ID NO:78; and
(b) introducing said vectors (a) and (b) into a host cell.
16. The method of claim 15, wherein said host cell is a CHO cell.
PCT/US1997/016123 1996-09-20 1997-09-19 Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin WO1998012334A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU44135/97A AU741338B2 (en) 1996-09-20 1997-09-19 Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin
CA002266339A CA2266339A1 (en) 1996-09-20 1997-09-19 Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin
EP97942436A EP0941345A2 (en) 1996-09-20 1997-09-19 Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin
JP10514756A JP2001502895A (en) 1996-09-20 1997-09-19 Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US2635696P 1996-09-20 1996-09-20
US60/026,356 1996-09-20

Publications (3)

Publication Number Publication Date
WO1998012334A2 true WO1998012334A2 (en) 1998-03-26
WO1998012334A3 WO1998012334A3 (en) 1998-07-23
WO1998012334A9 WO1998012334A9 (en) 1998-08-27

Family

ID=21831346

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US1997/016122 WO1998012329A2 (en) 1996-09-20 1997-09-19 Composition and method for enhancing fibrinolysis using antibodies to alpha-2-antiplasmin
PCT/US1997/016123 WO1998012334A2 (en) 1996-09-20 1997-09-19 Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US1997/016122 WO1998012329A2 (en) 1996-09-20 1997-09-19 Composition and method for enhancing fibrinolysis using antibodies to alpha-2-antiplasmin

Country Status (6)

Country Link
US (3) US20030017147A1 (en)
EP (2) EP0941345A2 (en)
JP (2) JP2001502895A (en)
AU (2) AU741338B2 (en)
CA (2) CA2266341A1 (en)
WO (2) WO1998012329A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004507745A (en) * 2000-08-28 2004-03-11 ソシエテ・ディアグノスティカ−スタゴー Assay for soluble fibrin
WO2022058261A2 (en) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Novel anti-a2ap antibodies and uses thereof

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1062953A1 (en) * 1999-06-22 2000-12-27 Leuven Research & Development vzw Use of compounds that reduce alpha2-antiplasmin in vivo for the preparation of a composition for the treatment of ischemic stroke
ES2276536T3 (en) * 1998-09-29 2007-06-16 LEUVEN RESEARCH &amp; DEVELOPMENT VZW USE OF COMPOUNDS THAT REDUCE ALFAS2-ANTIPLASMINAS IN VIVO FOR THE PREPARATION OF A COMPOSITION FOR THE TREATMENT OF ISCHEMICAL ICTUS.
AR040778A1 (en) * 2002-08-06 2005-04-20 Glaxo Group Ltd ALTERED ANTIBODIES OR FUNCTIONAL FRAGMENTS THAT BIND MAG (GLICOPROTEIN ASSOCIATED WITH HONEY).
GB0304576D0 (en) * 2003-02-28 2003-04-02 Lonza Biologics Plc Protein a chromatography
GB0306309D0 (en) 2003-03-19 2003-04-23 Glaxo Group Ltd Method of treatment
DE10346751A1 (en) * 2003-10-06 2005-04-21 Transmit Technologietransfer Clot lysis assay
US9150903B2 (en) * 2007-04-25 2015-10-06 Translational Sciences Inc. Method of increasing plasmin activity through antiplasmin conversion
US20100272740A1 (en) * 2007-10-17 2010-10-28 Alexey Vertegel Micro- and nanoscale devices for delivery of active fibronolytic agents
AU2012304635B2 (en) * 2011-09-06 2017-08-31 Translational Sciences Inc. SerpinF2-binding molecules and methods of use
WO2013082463A2 (en) * 2011-11-30 2013-06-06 Wellstat Diagnostics, Llc. Assays, antibodies, immunogens and compositions related to 5-fu
WO2016022547A1 (en) * 2014-08-06 2016-02-11 Indiana University Research And Technology Corporation Tuneable delivery of nanoparticle bound active plasmin for the treatment of thrombosis
US11078297B2 (en) 2014-12-22 2021-08-03 Translational Sciences, Inc. Prophylaxis of thrombosis

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0159025A2 (en) * 1984-04-17 1985-10-23 Teijin Limited Monoclonal antibody specific to human alpha2-plasmin
WO1988001649A1 (en) * 1986-09-02 1988-03-10 Genex Corporation Single polypeptide chain binding molecules

Family Cites Families (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE2532151C3 (en) * 1975-07-18 1979-06-13 Biotest-Serum-Institut Gmbh, 6000 Frankfurt Antisenim for the quantitative determination of the breakdown products of fibrin and fibrinogen «and process for its production
NL7602846A (en) * 1976-03-18 1977-09-20 Leuven Res & Dev Vzw ANTIPLASMIN AND AN ANTI-SERUM AGAINST.
US4273873A (en) * 1977-10-25 1981-06-16 Unitika Ltd. Preparation of antithrombogenic polymeric materials
US4245040A (en) * 1978-11-20 1981-01-13 Laurence Pilgeram Detection and measurement of circulating fibrin
US4421735A (en) * 1980-04-17 1983-12-20 The Massachusetts General Hospital Radiolabeled diagnostic compositions and method for making the same
JPS57106626A (en) * 1980-12-22 1982-07-02 Teijin Ltd Cytotoxic protein complex and its preparation
US4455290A (en) * 1981-04-02 1984-06-19 Research Corporation Inhibition of fibrin polymerization by a peptide isolated from fibrin Fragment D1
US4427646A (en) * 1981-04-02 1984-01-24 Research Corporation Use of radiolabeled peptide derived from crosslinked fibrin to locate thrombi in vivo
FR2504010B1 (en) * 1981-04-15 1985-10-25 Sanofi Sa ANTI-CANCER MEDICINAL PRODUCTS CONTAINING THE RICIN-ASSOCIATED CHAIN ASSOCIATED WITH ANTIMELANOMA ANTIBODY AND PROCESS FOR THEIR PREPARATION
US4474893A (en) * 1981-07-01 1984-10-02 The University of Texas System Cancer Center Recombinant monoclonal antibodies
US4671958A (en) * 1982-03-09 1987-06-09 Cytogen Corporation Antibody conjugates for the delivery of compounds to target sites
EP0088994B1 (en) * 1982-03-15 1991-06-19 Schering Corporation Hybrid dna, binding composition prepared thereby and processes therefor
CA1209907A (en) * 1982-04-12 1986-08-19 Richard M. Bartholomew Method of affinity purification employing monoclonal antibodies
CA1213229A (en) * 1982-04-12 1986-10-28 Gary S. David Antibodies having dual specificities, their preparation and uses therefor
US4470925A (en) * 1982-05-05 1984-09-11 E. I. Du Pont De Nemours And Company Immunoglobulin half-molecules and process for producing hybrid antibodies
AU573529B2 (en) * 1982-05-12 1988-06-16 President And Fellows Of Harvard College Hybrid proteins
AU572125B2 (en) * 1983-03-17 1988-05-05 Mabco Limited Monoclonal antibodies with specificity for crosslinked fibrin and their diagnotic uses
GB8308235D0 (en) * 1983-03-25 1983-05-05 Celltech Ltd Polypeptides
EP0142905A2 (en) * 1983-03-30 1985-05-29 Bio-Response Inc. Therapeutic substance for treating diseases such as cancer
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
GB2148299B (en) * 1983-09-01 1988-01-06 Hybritech Inc Antibody compositions of therapeutic agents having an extended serum half-life
US4722903A (en) * 1983-11-14 1988-02-02 New York Blood Center, Inc. Monoclonal antibodies specific to in vivo fragments derived from human fibrinogen, human fiberin I or human fibrin II
EP0146050B1 (en) * 1983-12-16 1990-07-04 Denis M. Callewaert Site selective plasminogen activator and method of making and using same
JPS60136520A (en) * 1983-12-23 1985-07-20 Otsuka Pharmaceut Co Ltd Fibrin-adsorbing urokinase complex
GB8400653D0 (en) * 1984-01-11 1984-02-15 Beecham Group Plc Conjugates
US4927916A (en) * 1984-04-23 1990-05-22 The General Hospital Corporation Method of producing fibrin-specific monoclonal antibodies lacking fibrinogen-cross-reactivity using fibrin-specific peptides
GB8422238D0 (en) * 1984-09-03 1984-10-10 Neuberger M S Chimeric proteins
US5116613A (en) * 1985-01-08 1992-05-26 The General Hospital Corporation Antibody-thrombolytic agent product and method of use
AU595173B2 (en) * 1985-01-08 1990-03-29 General Hospital Corporation, The Method and use for site-specific activation of substances
JPH0735340B2 (en) * 1985-05-23 1995-04-19 帝人株式会社 Thrombolysis promoter
EP0263172B1 (en) * 1986-03-28 1993-06-23 Creative Biomolecules, Inc. Protein analogues of tissue plasminogen activator
US4916070A (en) * 1986-04-14 1990-04-10 The General Hospital Corporation Fibrin-specific antibodies and method of screening for the antibodies
JPH0610139B2 (en) * 1986-05-15 1994-02-09 エモリ ユニバーシティ Mixtures of fibrinolytic compounds and agents for dissolving blood clots in blood vessels
US4833085A (en) * 1986-08-13 1989-05-23 Monsanto Company Monoclonal antibody specific for human colon fibroblast-derived t-PA
CA1339445C (en) * 1986-11-12 1997-09-09 The General Hospital Corporation Recombinant hybrid immunoglobulin molecules and method of use
KR100194113B1 (en) * 1988-04-04 1999-06-15 어니스트 엠. 해데드 Blood clot promoting composition
US5372812A (en) * 1988-04-04 1994-12-13 The General Hospital Corporation Composition and method for acceleration of clot lysis
US5582862A (en) * 1988-04-04 1996-12-10 General Hospital Corporation Antibodies that bind to α2-antiplasmin crosslinked to fibrin which do not inhibit plasma α2-antiplasmin
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
GB8928874D0 (en) * 1989-12-21 1990-02-28 Celltech Ltd Humanised antibodies

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0159025A2 (en) * 1984-04-17 1985-10-23 Teijin Limited Monoclonal antibody specific to human alpha2-plasmin
WO1988001649A1 (en) * 1986-09-02 1988-03-10 Genex Corporation Single polypeptide chain binding molecules

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
A. BUTTE ET AL.: "Alpha2-antiplasmin causes thrombi to resist fibrinolysis induced by tissue plasminogen activator in experimental pulmonary embolism." CIRCULATION, vol. 95, no. 7, 1 April 1997, NEW YORK, NY, USA, pages 1886-1891, XP002062707 *
G. REED ET AL.: "Synergistic fibrinolysis: Combined effects of plasminogen activators and an antibody that inhibits alpha2-antiplasmin." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA, vol. 87, no. 3, February 1990, WASHINGTON, DC, USA, pages 1114-1118, XP002062667 cited in the application *
G. REED: "77 (anti alpha2 antiplasmin)" HYBRIDOMA, vol. 16, no. 4, August 1997, NEW YORK, NY, USA, page 392 XP002062705 *
G. REED: "Functional characterization of monoclonal antibody inhibitors of alpha2-antiplasmin that accelerate fibrinolysis in different animal plasmas." HYBRIDOMA, vol. 16, no. 3, June 1997, NEW YORK, NY, USA, pages 281-286, XP002062706 *
G. SOE ET AL.: "A rapid latex immunoassay for the detection of plasmin-alpha2-plasmin inhibitor complex. Utilization of two monoclonal antibodies differentially recognizing respective components of the complex." BLOOD COAGULATION AND FIBRINOLYSIS, vol. 6, no. 3, May 1995, OXFORD, GB, pages 249-258, XP002062704 *
P. JONES ET AL.: "Replacing the complementarity-determining regions in a human antibody with those from a mouse." NATURE, vol. 321, 29 May 1986, LONDON, GB, pages 522-525, XP002062670 cited in the application *
V. OI: "Chimeric antibodies." BIOTECHNIQUES, vol. 4, no. 3, May 1986, NATICK, MA, USA, pages 214-221, XP002062669 cited in the application *
Y. SAKATA ET AL.: "Clot lysis induced by a monoclonal antibody against alpha2-plasmin inhibitor." BLOOD, vol. 74, no. 8, December 1989, NEW YORK, NY, USA, pages 2692-2697, XP002062668 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004507745A (en) * 2000-08-28 2004-03-11 ソシエテ・ディアグノスティカ−スタゴー Assay for soluble fibrin
WO2022058261A2 (en) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Novel anti-a2ap antibodies and uses thereof

Also Published As

Publication number Publication date
WO1998012329A2 (en) 1998-03-26
EP0937146A2 (en) 1999-08-25
US6114506A (en) 2000-09-05
JP2001502895A (en) 2001-03-06
AU4413597A (en) 1998-04-14
WO1998012329A3 (en) 1998-07-23
AU734997B2 (en) 2001-06-28
AU741338B2 (en) 2001-11-29
JP2001515345A (en) 2001-09-18
EP0941345A2 (en) 1999-09-15
CA2266341A1 (en) 1998-03-26
US20030017147A1 (en) 2003-01-23
CA2266339A1 (en) 1998-03-26
AU4413497A (en) 1998-04-14
US20030031664A1 (en) 2003-02-13
WO1998012334A3 (en) 1998-07-23

Similar Documents

Publication Publication Date Title
KR100553629B1 (en) Anticoagulant Agents Useful in Treatment of Thrombosis
JP4439914B2 (en) Antibody inhibiting blood coagulation and method of use thereof
US8007795B2 (en) Anti-tissue factor antibodies and methods of use thereof
AU741338B2 (en) Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin
US7138116B2 (en) Antithrombotic agent and humanized anti-von Willebrand factor monoclonal antibody
WO1998012334A9 (en) Chimeric, humanized and single chain antibodies to alpha-2-antiplasmin
EP1282444B1 (en) Antithrombotic agents
US20040146511A1 (en) Antithrombotic agents
US20030235587A1 (en) Anticoagulant agents useful in treatment of thrombosis
AU7737401A (en) Composition and method for enhancing fibrinolysis using antibodies to alpha-2-antiplasmin
AU2002359325A1 (en) Antibodies for inhibiting blood coagulation and method of use thereof
AU2008203271A1 (en) Antibodies for inhibiting blood coagulation and methods of use thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
COP Corrected version of pamphlet

Free format text: PAGES 1/22-22/22, DRAWINGS, REPLACED BY NEW PAGES 1/22-22/22; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

ENP Entry into the national phase

Ref document number: 2266339

Country of ref document: CA

Ref country code: CA

Ref document number: 2266339

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1998 514756

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1997942436

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1997942436

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997942436

Country of ref document: EP