WO1999049884A1 - A method for the prevention of a patient's fibroproliferative vasculopathy - Google Patents
A method for the prevention of a patient's fibroproliferative vasculopathy Download PDFInfo
- Publication number
- WO1999049884A1 WO1999049884A1 PCT/FI1999/000222 FI9900222W WO9949884A1 WO 1999049884 A1 WO1999049884 A1 WO 1999049884A1 FI 9900222 W FI9900222 W FI 9900222W WO 9949884 A1 WO9949884 A1 WO 9949884A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sst
- injury
- patient
- somatostatin
- sstr
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/22—Hormones
- A61K38/31—Somatostatins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
Definitions
- This mvention relates to the use of an agonist specific for at least one somatostatin (SST) receptor showing an increased expression in the patient's vascular wall subsequent to vascular trauma, for the treatment or prevention of the patient's f ⁇ broproliferative vasculopathy such as chronic allograft rejection or vascular restenosis following vascular trauma.
- SST somatostatin
- Fibroproliferative vasculopathy includes restenosis following coronary bypass surgery and PTCA (percutaneous transluminal coronary angioplasty). allograft arteriosclerosis in chronic allograft rejection, diabetic angiopathy and all forms of common arteriosclerosis.
- PTCA percutaneous transluminal coronary angioplasty
- Vascular intimal dysplasia and remodelling are characteristic features of rein jury following balloon angioplasty, coronaiy bypass surgery (Holmes et alJ984; Holmes et al. 1988) and in chronic allograft rejection (Lemstrom and Koskinen. 1997; Hayry et al. 1993).
- the initial response to vascular injury is inflammatory and involves attraction of lymphocytes, macrophages and thromocytes to the site of injury and secretion of cytokines, eicosanoids and growth factors (Ross 1993). Under the influence of growth factors and cytokines, smooth muscle cells (SMC) proliferate and migrate from the media to the inti a and contribute to intimal 2
- TNF PDGF IGF 1 bFGF EGF TGF ⁇ and VEGF Asahara et al 1 95 Bornfeldt et al 1994. Feins et al 1991 , Libby and Gahs 1995. Gahs et al 1995. Gi onwald et al 1989, Hancock et al 1994, Hayry et al 1995. Lindnei and Reidin 1991, Myllarmerm et al 1997, Nabel et al 1993 , Shi et al 1996.
- the ne ohormone SST is produced widely in the body and acts both systemicalK via the circulation and locally to inhibit cell prohfeiation as well as the secretion of various hormones, growth factors and neurotransmitter substances SST and its metabolically moie stable synthetic analogs, such as SMS201 -995 (octreotide) and BIM23014 (lanreotide, angiopeptm), exert a numbei of vascular effects such as vasoconstrict on m the gut and inhibition of angiogenesis
- Some of the leceptor isotypes also modulate other effectors such as phosphotyiosine phosphatase, K and voltage-dependent Ca ⁇ ion channels, a
- the SST receptor family can be subdivided into two categones the SSTR2.3.5 category with high affinity to these analogs and the SSTR 1.4 category with low affinity to these compounds (see Table)
- tire administration of octreotide or lanreotide prevents the formation of dysplastic lesions (Foegh et al. 1994, Foegh and Ramwell 1995.
- the ideal approach would be to characterize the pattern of expression of SSTRs in the vascular wall after trauma, and to target the subtypes involved with appropiate agonists Towards this objective, we have determined the time course of expression of mRNA for SSTR1 -5 in rat aorta after endothelial denudation (balloon injury) by reverse transcription polymerase chain reaction (RT-PCR) and localized the reseptors directly by lrrrmunocytochemistry with rabbit polyclonal antibodies to receptor subtype specific peptides
- the object of this invention is thus to characterize level of expression of somatostatin receptors (SSTRs) versus time in the intimal layer of the vascular wall after trauma (v ascular injury or vasculai suiger ) . and to target the receptoi subtypes showing increased expiession aftei trauma with appropiate agonists so as to avoid fibroprohfeiative vasculopathy of the patient's blood vessels which have been subjected to trauma
- SSTRs somatostatin receptors
- the mvention thus concerns the use of an agonist specific for at least one somatostatin (SST) receptoi showing an inci eased expi ession in a patient s v asculai wall subsequent to mjurv 01 operation, for the manufactuie of a pharmaceutical preparation for use in the treatment or the pi evention of said patient s fibroprohferative v asculopathy following vascular injury or a vascular suigical operation Said pharmaceutical composition is intended for administering to said patient foi one to two weeks after the injury oi suigical operation
- Figure 1 shows Southern blots of mRNA RT-PCR products for the five SSTR subtypes at different times in control and in denuded aortic samples.
- Figure 2 shows the mean expression level versus time for mRNA of five SSTR subtypes following vascular injury
- Figure 3 shows the immunoreactivity of the five SSTR subtypes at diffeient times in control and in denuded aortic samples
- an SST receptor subtype which is present in the intimal layer of the vasculai wall and shows an increased expression din ing the first week following the injury 01 the surgical operation should be activated bv the agonist
- the process of wound healing is essentially completed after two weeks A prolonged activation of an highly expressed SST receptor after this point would not have any restenosis preventing action
- the SSTR 1 or SSTR4 receptoi should be activated
- the SS T receptor active agonist is a compound such as somatostatin SR1F- 14.
- somatostatin SR1F-28. or D AD1-SST 14 (des.AA ' "[D-Trp ⁇ -p- ⁇ sopropyl-4-am ⁇ nomethyl-L-phenylalan ⁇ ne]-S T- 14)
- D AD1-SST 14 des.AA ' "[D-Trp ⁇ -p- ⁇ sopropyl-4-am ⁇ nomethyl-L-phenylalan ⁇ ne]-S T- 14
- the table below shows a companson of binding affinities K, (nM) somatostatin and its key cyclic analogs lanreotide and octeo ⁇ de for five human somatostatin receptors m transfected CHO cell lines
- the data are provided by YC Patel
- the selected SST-ieceptor is the SS Y- l eceptoi subtype 1 oi subtype 4 and the agonist is somatostatin SRI V- 14
- the method according to this mvention is useful in the prevention of the patient ' s fibroproliferative vasculopathy following vascular trauma
- the method accoiding to this invention is useful to prevent vascular restenosis following balloon angioplasty or a coronary bypass operation
- the invention is not restricted heieto
- the pattern of expression for the v arious SST receptoi subtypes found in the aorta is believed to exist thioughout the patient ' s vascular system
- the inv ention is ther efore applicable to the pi e ention of restenosis following anv v ascular tr auma in the patient ' s bod ⁇
- the method according to this invention is useful for the pievention of a patient's chronic allograft rejection
- SST receptor active agonist shall be understood to include the compound as such as well as any pharmaceutically acceptable de ⁇ vative thei eot such as salt, ester etc
- the SST receptor active agonist can be administered by va ⁇ ous routes but pieferable by systemic routes
- the suitable administration forms include, for example, oial formulations, parenteral injections including inti avenous. intiamusculai . lntradermal and subcutanous injections, oi transdermal administration forms
- the therapeutically effective dose for a particulai compound can. for example, be in the range 1 - 10 ⁇ g pei kg of body weight and day
- the suitable period of treatment is one to two weeks after the trauma, perfeiably two weeks If the trauma is caused by surgical operation, the administration of the agent is pieferable started one da before the surgical operation
- aortic tissue specimens were flash frozen in liquid nitr ogen and stored at -80 °C for R A isolation
- aortic cioss sections from the mid segment of the denuded aiea wei e fixed in 3°o paraformalhyde (pH 7 4), embedded in paraffin foi sectioning and stained with Mayei s haematoxylin and eosin (HE) Foi lmmunocytochemistry.
- aortic specimens were embedded m Tissue-Tek (Miles lnc .
- vascular tissue samples were pulverized in liquid nitrogen using a mortal and pestle and total RNA isolated usmg the standard technique of quanidinium lsothiocyanate-phenol-chloroform exti action For reverse transcription. 20 ⁇ g total RNA was treated with 10 units/mg RQ 1 Rnase-free Dnase l (Promega) in 40 mM Tns buffered HCl. pH 7.9, 10 mM NaC l . 6 mM MgC l 2 .
- Antisense 5 ' CCTGCTGGTCTGCATGAGCC 3 ' (nt 1067-1086) (SEQ ID NO: 10)
- ⁇ -actin Sense: 5 ' ATCATGAAGTGTGACGTGGAC 3 ' (nt 90- 110) (SEQIDNOJ1)
- PCR reaction was initiated by the addition of 25 units of Taq polymerase (Gibco BRL) at 85 °C (hot start). The following conditions were used. SSTR 1.2.4 - denaturation at 94 °C for 1 min annealing at 55 °C for 30 seconds and extension at 10
- each blot was exposed to x-ray film foi several different times Only bands that did not reach saturation density of exposure were subjected to quantitative analysis.
- the units derived from the Java analysis were arbitra ⁇ ly assigned a pixel density corrected for background Values of SSTR 1-5 mRNA expression were normalized to those of actm mRNA on the same gels. All expenments were performed at least 3 times and each mRNA quantitation represents the average of six measurements
- Antipeptide labbit polyclonal antibodies specific to SSTR 1-5 weie pioduced and characterized as previously described Synthetic ohgopeptides corresponding to deduced sequences in the amino terminal segment or extracellular loop 3 of hSST l-5 were conjugated to keyhole limpet hemocyanm and used to immunize New Zealand white rabbits The sequences selected were identical or nearly identical between the human and rat SSTR isoforms Anti-SSTR activity m rabbit sera was screened by the ability to inhibit [ 12:> I-LTT] SST-28 binding to membrane SSTRs.
- FIG. 1 depicts Southern blots of RT-PCR products showing the expression of the quadruple specimens of mRNA for the five SSTR subtypes at different times in control and denuded aortic samples
- the time course of the mean levels of expression of expression of mRNA for the five SSTR subtypes following vasculai injury is summa ⁇ zed in Figure 2
- moderate levels of SSTR 1 and SSTR4 mR ⁇ A. and inclinedv detectable concentrations of SSTR2 and SSTRS mRN A follow ma. lnjurv .
- SSTR 1 mRNA displayed a dramatic 2-fold increase at day 3 (p ⁇ 0 01 ) concomitantly with the SMC proliferation in the media and intima
- a parallel increase in SSTR2 mRNA was also observed at day 3 (p ⁇ 0 01 ) although the magnitude of the change ( ⁇ 20%) was considerably smallei than that of SSTR 1 mRNA Unlike SSTR 1 and SSTR2.
- SSTR3 mRNA showed a more gradual increase with no change at day 3 followed by a significant inci ease bv 30 % at da 7 (p ⁇ 0 01 ) and by 40 % at day 14 (p ⁇ 0 001 )
- SSTR4 mRNA followed a similar pattern but the magnitude of the increase was smallei (20%) and statistically significant (p ⁇ 0 05) at day 7 and (p ⁇ 0 001) at day 14
- SSTR5 mRNA iemamed virtually undetectable and its expi ession patte ⁇ i did not change following injury
- Figure 3 depicts the expression and localization of the five SSTR subtype leceptor proteins in injured vesssel wall after denudation injury, as detected by subtype specific rabbit antisera and lmmunoperoxidase staining In all microphotographs lumen is facing down and adventitia is facing up. As exemplified in the microphotograph in the left uppei comei It should be noted that all 14
- SSTR antigens wei e localized predominantly in SVIC that weie present in the media oi which had migiated into the mtima
- the level of expression of SSTR I -5 by mRNA measurement correlated with receptor protein expression by lmmunohistochemistry
- SSTR mRNA levels are augmented by cAMP, gastrin, EGF. and SST itself.
- Glucocorticoids acutely induce SSTR1 and SSTR2 mRNA whereas estrogen induces SSTR2 and SSTR3 mRNA and thyroid hormone upregulates SSTR1 and SSTR5 mRNA.
- the 5 upstream promoter regions of the four receptor genes that have been sequenced display a number of consensus sequences that confer responsiveness to cAMP, AP I , AP2. Pit I . and thyroid hormone.
- SSTRs are capable of inhibiting cell proliferation.
- SSTR1-4 act by stimulating PTP which dephosphorylates receptor tyrosine kinases thereby attenuating the mitogenic signal.
- SSTR5. inhibits guanylate cyclase and cGMP-dependent phosphorylation and activation of MAPK. Since the five SSTRs are expressed in the arterial wall, they could all be potential targets for the direct antiproliferative effects of SST. To date, however, only the effects of myointimale proliferation have been tested.
- Our findings suggest that SSTR 1 or SSTR4 may be the optimal subtypes to target, given their appropriate localisation and time related induction during the proliferative stage in the vascular wall. In this respect.
- SSTR1 which is upregulated to a greater extent than SSTR2, and which is insensitive to the current generation of clinically used SST analogs, should be a prime candidate for further testing with SSTR 1 -selective compounds.
- ADDRESSEE ADDUCI, MASTRIANI & S HAUMBERG, LLP
- COMPUTER IBM PC compat ole
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
- MOLECULE TYPE other nucleic acid
Abstract
Description
Claims
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP99910396A EP1064017A1 (en) | 1998-03-27 | 1999-03-23 | A method for the prevention of a patient's fibroproliferative vasculopathy |
JP2000540847A JP2002509894A (en) | 1998-03-27 | 1999-03-23 | How to prevent fibroproliferative vasculopathy in patients |
CA002323748A CA2323748A1 (en) | 1998-03-27 | 1999-03-23 | A method for the prevention of a patient's fibroproliferative vasculopathy |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US09/049,020 | 1998-03-27 | ||
US09/049,020 US6124256A (en) | 1998-03-27 | 1998-03-27 | Method for the prevention of a patient's fibroproliferative vasculopathy |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1999049884A1 true WO1999049884A1 (en) | 1999-10-07 |
Family
ID=21957659
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FI1999/000222 WO1999049884A1 (en) | 1998-03-27 | 1999-03-23 | A method for the prevention of a patient's fibroproliferative vasculopathy |
Country Status (5)
Country | Link |
---|---|
US (1) | US6124256A (en) |
EP (1) | EP1064017A1 (en) |
JP (1) | JP2002509894A (en) |
CA (1) | CA2323748A1 (en) |
WO (1) | WO1999049884A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000012111A2 (en) * | 1998-09-01 | 2000-03-09 | The University Of British Columbia | Selective treatment of endothelial somatostatin receptors |
WO2002064160A2 (en) * | 2001-01-12 | 2002-08-22 | Societe De Conseils De Recherches Et D'applications Scientifiques, S.A.S. | Pharmaceutical compositions which inhibit vascular proliferation and method of use thereof |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CZ20033123A3 (en) * | 2001-06-25 | 2004-11-10 | Societe De Conseils De Recherches Et D'applications Scientifiques, S.A.S. | Pharmaceutical compositions inhibiting proliferation of pituitary gland adenomas |
EP1499367A1 (en) * | 2002-04-24 | 2005-01-26 | Poly-Med, Inc. | Multifaceted endovascular stent coating for preventing restenosis |
WO2005003300A2 (en) * | 2003-06-04 | 2005-01-13 | University Of South Carolina | Tissue scaffold having aligned fibrils, apparatus and method for producing same, and methods of using same |
FI20031454A0 (en) | 2003-10-06 | 2003-10-06 | Juvantia Pharma Ltd Oy | Selective somatostatin receptor 1 and / or 4 agonists and antagonists |
WO2005082845A1 (en) * | 2004-02-27 | 2005-09-09 | Oy Juvantia Pharma Ltd | Novel therapies with somatostatin receptor agonists |
WO2005082844A1 (en) * | 2004-02-27 | 2005-09-09 | Oy Juvantia Pharma Ltd | Treatment of diseases by using a somatostatin receptor agonist |
JP2008540618A (en) * | 2005-05-18 | 2008-11-20 | ブルスター,ジークフリート | Peptidomimetics selective for somatostatin receptor subtype 1 and / or 4 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997014715A1 (en) * | 1995-10-18 | 1997-04-24 | The Salk Institute For Biological Studies | Receptor-selective somatostatin analogs |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0912551A1 (en) * | 1996-05-14 | 1999-05-06 | Novo Nordisk A/S | Somatostatin agonists and antagonists |
-
1998
- 1998-03-27 US US09/049,020 patent/US6124256A/en not_active Expired - Fee Related
-
1999
- 1999-03-23 EP EP99910396A patent/EP1064017A1/en not_active Withdrawn
- 1999-03-23 CA CA002323748A patent/CA2323748A1/en not_active Abandoned
- 1999-03-23 JP JP2000540847A patent/JP2002509894A/en active Pending
- 1999-03-23 WO PCT/FI1999/000222 patent/WO1999049884A1/en not_active Application Discontinuation
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997014715A1 (en) * | 1995-10-18 | 1997-04-24 | The Salk Institute For Biological Studies | Receptor-selective somatostatin analogs |
Non-Patent Citations (5)
Title |
---|
AMERICAN HEART JOURNAL, Volume 130, No. 1, July 1995, ULRIK HEDEGAARD ERIKSEN et al., "Randomized Double-Blind Scandinavian Trial of Angiopeptin Versus Placebo for the Prevention of Clinical Events and Restenosis After Coronary Balloon Angioplasty", pages 1-8. * |
FASEB J., Volume 13, 1999, S. KHARE et al., "Differential Regulation of Somatostatin Receptor Types 1-5 in Rat Aorta After Angioplasty", pages 387-394. * |
J. ENDOCRINOL. INVEST., Volume 20, 1997, Y.C. PATEL, "Molecular Pharmacology of Somatostatin Receptor Subtypes", pages 348-367. * |
JOURNAL OF INVESTIGATIVE SURGERY, Volume 10, 1997, JERRY C. CHEN et al., "Somatostatin Receptor Expression in Rat Iliac Arteries After Balloon Injury", pages 17-23. * |
TRANSPLANTATION PROCEEDINGS, Volume 29, 1997, G. WECKBECKER et al., "The Somatostatin Analog Octreotide as Potential Treatment for Re-Stenosis and Chronic Rejection", pages 2599-2600. * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000012111A2 (en) * | 1998-09-01 | 2000-03-09 | The University Of British Columbia | Selective treatment of endothelial somatostatin receptors |
WO2000012111A3 (en) * | 1998-09-01 | 2000-05-25 | Univ British Columbia | Selective treatment of endothelial somatostatin receptors |
WO2002064160A2 (en) * | 2001-01-12 | 2002-08-22 | Societe De Conseils De Recherches Et D'applications Scientifiques, S.A.S. | Pharmaceutical compositions which inhibit vascular proliferation and method of use thereof |
WO2002064160A3 (en) * | 2001-01-12 | 2004-02-19 | Sod Conseils Rech Applic | Pharmaceutical compositions which inhibit vascular proliferation and method of use thereof |
AU2002243552B2 (en) * | 2001-01-12 | 2005-03-10 | Societe De Conseils De Recherches Et D'applications Scientifiques, S.A.S. | Pharmaceutical compositions which inhibit vascular proliferation and method of use thereof |
US7084117B2 (en) | 2001-01-12 | 2006-08-01 | Societe De Conseils De Recherches Et D'applications Scientifiques, Sas | Pharmaceutical compositions which inhibit vascular proliferation and method of use thereof |
AU2002243552C1 (en) * | 2001-01-12 | 2006-08-31 | Societe De Conseils De Recherches Et D'applications Scientifiques, S.A.S. | Pharmaceutical compositions which inhibit vascular proliferation and method of use thereof |
Also Published As
Publication number | Publication date |
---|---|
US6124256A (en) | 2000-09-26 |
EP1064017A1 (en) | 2001-01-03 |
JP2002509894A (en) | 2002-04-02 |
CA2323748A1 (en) | 1999-10-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Taylor et al. | Detection of somatostatin receptor subtype 2 (SSTR2) in established tumors and tumor cell lines: evidence for SSTR2 heterogeneity | |
Schäfer et al. | Corticotropin-releasing factor in antinociception and inflammation | |
JP5054075B2 (en) | Undernutrition Symptom Treatment Agent | |
Martinez et al. | CRF1 receptors as a therapeutic target for irritable bowel syndrome | |
Balasubramaniam | Clinical potentials of neuropeptide Y family of hormones | |
Dembiński et al. | Role of growth hormone and insulin-like growth factor-1 in the protective effect of ghrelin in ischemia/reperfusion-induced acute pancreatitis | |
Bitar | Insulin and glucocorticoid-dependent suppression of the IGF-I system in diabetic wounds | |
Khare et al. | Differential regulation of somatostatin receptor types 1–5 in rat aorta after angioplasty | |
Propato-Mussafiri et al. | Pituitary adenylate cyclase-activating polypeptide releases 7B2, adrenocorticotrophin, growth hormone and prolactin from the mouse and rat clonal pituitary cell lines AtT-20 and GH3 | |
US20100150909A1 (en) | PTHrP-DERIVED MODULATORS OF SMOOTH MUSCLE PROLIFERATION | |
WO1999049884A1 (en) | A method for the prevention of a patient's fibroproliferative vasculopathy | |
Vona-Davis et al. | NPY family of hormones: clinical relevance and potential use in gastrointestinal disease | |
US9220760B2 (en) | Method of modulating the proliferation of medullary thyroid carcinoma cells | |
Poore et al. | Studies on the role of ACTH in the regulation of adrenal responsiveness and the timing of parturition in the ovine fetus | |
Yan et al. | TNF-α decreases expression of somatostatin, somatostatin receptors, and cortistatin in human coronary endothelial cells | |
Findlay et al. | Hormonal regulation of reproduction—general concepts | |
Xu et al. | Peripheral axotomy increases the expression of galanin message-associated peptide (GMAP) in dorsal root ganglion cells and alters the effects of intrathecal GMAP on the flexor reflex in the rat | |
JP2007537153A (en) | Treatment or prevention of extracellular matrix accumulation | |
Goldman et al. | Growth hormone and prolactin responses to bolus and sustained infusions of GRH-1-40-OH in man | |
Laurian et al. | Antiserotonergic inhibition of calcitonin-induced increase of β-endorphin, ACTH, and cortisol secretion | |
Roelfsema et al. | Treatment strategies for acromegaly | |
JP2001523265A (en) | Treatment of hyperprolactinemia and prolactinoma | |
Gómez de Segura et al. | Somatostatin antagonism prevents elemental diet-induced intestinal atrophy in the rat | |
WO2020074707A1 (en) | Prevention or treatment of adrenal insuffiency in critically ill patients | |
Buchwald et al. | Transfection of the DNA for the receptor KDR/flk-1 attenuates neointimal proliferation and luminal narrowing in a coronary stent angioplasty model |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
ENP | Entry into the national phase |
Ref document number: 2323748 Country of ref document: CA Ref country code: CA Ref document number: 2323748 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 1999910396 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 1999910396 Country of ref document: EP |
|
NENP | Non-entry into the national phase |
Ref country code: CA |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 1999910396 Country of ref document: EP |