WO2000052044A1 - Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof - Google Patents

Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof Download PDF

Info

Publication number
WO2000052044A1
WO2000052044A1 PCT/US2000/005612 US0005612W WO0052044A1 WO 2000052044 A1 WO2000052044 A1 WO 2000052044A1 US 0005612 W US0005612 W US 0005612W WO 0052044 A1 WO0052044 A1 WO 0052044A1
Authority
WO
WIPO (PCT)
Prior art keywords
tadg
protein
seq
fragment
dna
Prior art date
Application number
PCT/US2000/005612
Other languages
French (fr)
Inventor
Timothy J. O'brien
Lowell J. Underwood
Original Assignee
The Board Of Trustees Of The University Of Arkansas
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Board Of Trustees Of The University Of Arkansas filed Critical The Board Of Trustees Of The University Of Arkansas
Priority to CA2362830A priority Critical patent/CA2362830C/en
Priority to AU37209/00A priority patent/AU765471B2/en
Priority to JP2000602268A priority patent/JP4558948B2/en
Priority to EP00916045A priority patent/EP1157035A4/en
Publication of WO2000052044A1 publication Critical patent/WO2000052044A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6472Cysteine endopeptidases (3.4.22)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

The present invention provides a TADG-12 protein and a DNA fragment encoding such protein. Also provided is a vector/host cell capable of expressing the DNA. The present invention further provided various methods of early detection of associated ovarian and other malignancies, and of interactive therapies for cancer treatment by utilizing the DNA and/or protein disclosed herein.

Description

TRANSMEMBRANE SERINE PROTEASE OVEREXPRESSED IN OVARIAN CARCINOMA AND USES THEREOF
BACKGROUND OF THE INVENTION
Cross-Reference to Related Application
This application is a continuation-in-part patent application and claims the benefit of priority under 35 USC § 120 of USSN 09/261,416, filed March 3, 1999.
Field of the Invention
The present invention relates generally to the fields of cellular biology and diagnosis of neoplastic disease. More specifically, the present invention relates to a transmembrane serine protease termed Tumor Associated Differentially-Expressed Gene- 12 (TADG-12), which is overexpressed in ovarian carcinoma.
Description of the Related Art
Tumor cells rely on the expression of a concert of proteases to be released from their primary sites and move to distant sites to inflict lethality. This metastatic nature is the result of an aberrant expression pattern of proteases by tumor cells and also by stromal cells surrounding the tumors [1-3]. For mo st tumors to become metastatic, they must degrade their surrounding extracellular matrix components, degrade basement membranes to gain access to the bloodstream or lymph system, and repeat this process in reverse fashion to settle in a secondary host site [3-6]. All of these processes rely upon what now appears to be a synchronized protease cascade. In addition, tumor cells use the power of proteases to activate growth and angiogenic factors that allow the tumor to grow progressively [1]. Therefore, much research has been aimed at the identification of tumor- associated proteases and the inhibition of these enzymes for therapeutic means. More importantly, the secreted nature and/or high level expression of many of these proteases allows for their detection at aberrant levels in patient serum, e.g. the prostate- specific antigen (PSA), which allows for early diagnosis of prostate cancer [7].
Proteases have been associated directly with tumor growth, shedding of tumor cells and invasion of target organs. Individual classes of proteases are involved in, but not limited to (1) the digestion of stroma surrounding the initial tumor area, (2) the digestion of the cellular adhesion molecules to allow dissociation of tumor cells; and (3) the invasion of the basement membrane for metastatic growth and the activation of both tumor growth factors and angiogenic factors.
For many forms of cancer, diagnosis and treatment has improved dramatically in the last 10 years. However, the five year survival rate for ovarian cancer remains below 50% due in large part to the vague symptoms which allow for progression of the disease to an advanced stage prior to diagnosis [8]. Although the exploitation of the CA125 antigen has been useful as a m arker for monitoring recurrence of ovarian cancer, it has not proven to be an ideal marker for early diagnosis. Therefore, new markers that may be secreted or released from cells and which are highly expressed by ovarian tumors could provide a useful tool for th e early diagnosis and for therapeutic intervention in patients with ovarian carcinoma. The prior art is deficient in the lack of the complete identification of the proteases overexpressed in carcinoma, therefore, deficient in the lack of a tumor marker useful as a n indicator of early disease, particularly for ovarian cancers. Specifically, TADG-12, a transmembrane serine protease, has not been previously identified in either nucleic acid or protein form. The present invention fulfills this long-standing need and desire in the art.
SUMMARY OF THE INVENTION
The present invention discloses TADG-12, a n e w member of the Tumor Associated Differentially-Expressed Gene (TADG) family, and a variant splicing form of TADG-12 (TADG- 12N) that could lead to a truncated protein product. TADG-12 is a transmembrane serine protease overexpressed in ovarian carcinoma. The entire cDΝA of TADG-12 has been identified (SEQ ID No. 1). This sequence encodes a putative protein of 454 amino acids (SEQ ID No. 2) which includes a potential transmembrane domain, an LDL receptor like domain, a scavenger receptor cysteine rich domain, and a serine protease domain. These features imply that TADG-12 is expressed at the cell surface, an d it may be used as a molecular target for therapy or a diagnostic marker. In one embodiment of the present invention, there is provided a DNA fragment encoding a TADG-12 protein selected from the group consisting of: (a) an isolated DNA fragment which encodes a TADG-12 protein; (b) an isolated DNA fragment which hybridizes to isolated DNA fragment of (a) above and which encodes a TADG-12 protein; and (c) an isolated DNA fragment differing from the isolated DNA fragments of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a TADG-12 protein. Specifically, the DNA fragment has a sequence shown in SEQ ID No. 1 or SEQ ID No. 3.
In another embodiment of the present invention, th ere is provided a vector/host cell capable of expressing the DNA of th e present invention.
In yet another embodiment of the present invention, there is provided an isolated and purified TADG-12 protein encoded by DNA selected from the group consisting of: (a) isolated DNA which encodes a TADG-12 protein; (b) isolated DNA which hybridizes to isolated DNA of (a) above and which encodes a TADG-12 protein; and (c) isolated DNA differing from the isolated DNAs of (a) and (b) above in codon sequence due to th e degeneracy of the genetic code, and which encodes a TADG-12 protein. Specifically, the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
In still yet another embodiment of the present invention, there is provided a method for detecting expression of a TADG-12 protein, comprising the steps of: (a) contacting mRNA obtained from the cell with the labeled hybridization probe; an d (b) detecting hybridization of the probe with the mRNA. The present invention further provides methods for diagnosing a cancer or other malignant hyperplasia by detecting the TADG-12 protein or mRNA disclosed herein.
In still another embodiment of the present invention, there is provided a method of inhibiting expression of endogenous TADG-12 mRNA in a cell by introducing a vector into the cell, wherein the vector comprises a DNA fragment of TADG-12 in opposite orientation operably linked to elements necessary for expression. In still yet another embodiment of the pre sent invention, there is provided a method of inhibiting expression of a TADG-12 protein in a cell by introducing an antibody directed against a TADG- 12 protein or fragment thereof.
In still yet another embodiment of the present invention, there is provided a method of targeted therapy b y administering a compound having a targeting moiety specific for a TADG-12 protein and a therapeutic moiety. Specifically, the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4. The present invention still further provides a method of vaccinating an individual against TADG-12 by inoculating th e individual with a TADG-12 protein or fragment thereof. Specifically, the TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4. The TADG-12 fragment includes the truncated form of TADG-12N pep tide having a sequence shown in SEQ ID No. 8, and a 9-residue up to 12-residue fragment of TADG-12 protein.
In yet another embodiment of the present invention, there is provided an immunogenic composition, comprising a n immunogenic fragment of a TADG-12 protein and an appropriate adjuvant. The TADG-12 fragment includes the truncated form of TADG-12N peptide having a sequence shown in SEQ ID No. 8, and a 9-residue up to 12-residue fragment of TADG-12 protein. Other and further aspects, features, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of th e invention given for the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
So that the matter in which the above-recited features, advantages and objects of the invention, as well as others which will become clear, are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments thereof which are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, th at the appended drawings illustrate preferred embodiments of th e invention and therefore are not to be considered limiting in their scope.
Figure I A shows that the expected PCR product of approximately 180 bp and the unexpected PCR product of approximately 300 bp using the redundant serine protease primers were not amplified from normal ovary cDNA (Lane 1) b u t were found in abundance from ovarian tumor cDNA (Lane 2). The primer sequences for the PCR reactions are indicated by horizontal arrows. Figure IB shows that TADG-12 was subcloned from th e 180 bp band while the larger 300 bp band was designated TADG- 12N. The sequences were found to overlap for 180 bp (SEQ ID No. 5 for nucleotide sequence, SEQ ID No. 6 for deduced amino acid sequence) with the 300 bp TADG- 12V (SEQ ID No. 7 for nucleotide sequence, SEQ ID No. 8 for deduced amino acid sequence) having an additional insert of 133 bases. This insertion (vertical arrow) leads to a frame shift, which causes the TADG- 12V transcript to potentially produce a truncated form of TADG-12 with a variant amino acid sequence.
Figure 2 shows that Northern blot analysis for TADG- 12 revealed three transcripts of 2.4, 1.6 and 0.7 kilobases. These transcripts were found at significant levels in ovarian tumors and cancer cell lines, but the transcripts were found only at low levels in normal ovary.
Figure 3 shows an RNA dot blot (CLONTECH) probed for TADG-12. The transcript was detectable (at background levels) in all 50 of the human tissues represented with the greatest abundance of transcript in the heart. Putamen, amygdala, kidney, liver, small intestine, skeletal muscle, and adrenal gland were also found to have intermediate levels of TADG-12 transcript.
Figure 4 shows the entire cDNA sequence for TADG- 12 (SEQ ID No. 1) with its predicted open reading frame of 454 amino acids (SEQ ID No. 2). Within the nucleotide sequence, th e Kozak's consensus sequence for the initiation of translation and the poly-adenylation signal are underlined. In the protein sequence, a potential transmembrane domain is boxed. The LDLR- A domain is underlined with a solid line. The SRCR domain is underlined with a broken line. The residues of the catalytic triad of the serine protease domain are circled, and the beginning of the catalytic domain is marked with an arrow designated as a potential proteolytic cleavage site. The * represents the stop codon that terminates translation.
Figure 5 A shows the 35 amino acid LDLR-A domain of TADG-12 (SEQ ID No. 13) aligned with other LDLR-A motifs from the serine protease TMPRSS2 (U75329, SEQ ID No. 14), th e complement subunit C8 (P07358, SEQ ID No. 9), two LDLR-A domains of the glycoprotein GP300 (P98164, SEQ ID Nos. 1 1 - 12), and the serine protease matriptase (AF118224, SEQ ID No. 10). TADG-12 has its highest similarity with the other serine proteases for which it is 54% similar to TMPRSS2 and 53% similar to matriptase. The highly conserved cysteine residues are shown in bold type. Figure 5B shows the SRCR domain of TADG-12 (SEQ ID No. 17) aligned with other domain family members including th e human macrophage scavenger receptor (P21757, SEQ ID No. 16), human enterokinase (P98073, SEQ ID No. 19), bovine enterokinase (P21758, SEQ ID No. 15), and the serine protease TMPRSS2 (SEQ ID No. 18). Again, TADG-12 shows its highest similarity within this region to the protease TMPRSS2 at 43%. Figure 5C shows th e protease domain of TADG-12 (SEQ ID No. 23) in alignment with other human serine proteases including protease M (U62801 , SEQ ID No. 20), trypsinogen I (P07477, SEQ ID No. 21), plasma kallikrein (P03952, SEQ ID No. 22), hepsin (P05981, SEQ ID No. 25), and TMPRSS2 (SEQ ID No. 24). Cons represents the consensus sequence for each alignment.
Figure 6 shows semi-quantitative PCR analysis th at was performed for TADG-12 (upper panel) and TADG-12V (lower panel). The amplification of TADG-12 or TADG-12N w as performed in parallel with PCR amplification of β-tubulin product as an internal control. The TADG-12 transcript was found to b e overexpressed in 41 of 55 carcinomas. The TADG-12V transcript was found to be overexpressed in 8 of 22 carcinomas examined. Note that the samples in the upper panel are not necessarily the same as the samples in the lower panel.
Figure 7 shows immunohistochemical staining of normal ovary and ovarian tumors which were performed using a polyclonal rabbit antibody developed to a TADG-12 specific peptide. No significant staining was detected in normal ovary (Figure 7 A). Strong positive staining was observed in 22 of 2 9 carcinomas examined. Figures 7B and 7C represent a serous and mucinous carcinoma, respectively. Both show diffuse staining throughout the cytoplasm of tumor cells while stromal cells remain relatively unstained. Figure 8 is a model to demonstrate the progression of
TADG-12 within a cellular context. In normal circumstances, th e TADG-12 transcript is appropriately spliced and the resulting protein is capable of being expressed at the cell surface where the protease may be cleaved to an active form. The role of th e remaining ligand binding domains has not yet been determined, but one can envision their potential to bind other molecules for activation, internalization or both. The TADG-12N transcript, which occurs in some tumors, may be the result of mutation and/or poor mRΝA processing may be capable of producing a truncated form of TADG-12 that does not have a functional protease domain. In addition, this truncated product may pre sent a novel epitope at the surface of tumor cells. DETAILED DESCRIPTION OF THE INVENTION
To examine the serine proteases expressed by ovarian cancers, a PCR based differential display technique was employed utilizing redundant PCR primers designed to the most highly conserved amino acids in these proteins [9]. As a result, a novel cell-surface, multi-domain serine protease, named Tumor Associated Differentially-expressed Gene-12 (TADG-12) w as identified. TADG-12 appears to be overexpressed in many ovarian tumors. The extracellular nature of TADG-12 may render tumors susceptible to detection via a TADG-12 specific assay. In addition, a splicing variant of TADG-12, named TADG- 12V, was detected a t elevated levels in 35% of the tumors that were examined. TADG- 12V encodes a truncated form of TADG-12 with an altered amino acid sequence that may be a unique tumor specific target for future therapeutic approaches.
The TADG-12 cDNA is 2413 base pairs long (SEQ ID No. 1 ) encoding a 454 amino acid protein (SEQ ID No. 2). A variant form, TADG-12N (SEQ ID No. 3), encodes a 294 amino acid protein (SEQ ID No. 4). The availability of the TADG-12 and/or TADG-12V gene opens the way for a number studies that can lead to various applications. For example, the TADG-12 and/or TADG-12N gene can be used as a diagnostic or therapeutic target in ovarian carcinoma and other carcinomas including breast, prostate, lung and colon.
In accordance with the present invention there may b e employed conventional molecular biology, microbiology, and recombinant DΝA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch & Sambrook, "Molecular Cloning: A Laboratory Manual (1982); "DNA Cloning: A Practical Approach," Volumes I and I I (D.N. Glover ed. 1985); "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)] ; "Transcription and Translation" [B.D. Hames & S.J. Higgins eds. (1984)]; "Animal Cell Culture" [R.I. Freshney, ed. ( 1986)] ; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).
Therefore, if appearing herein, the following term s shall have the definitions set out below.
As used herein, the term "cDNA" shall refer to the DNA copy of the mRNA transcript of a gene.
As used herein, the term "derived amino acid sequence" shall mean the amino acid sequence determined b y reading the triplet sequence of nucleotide bases in the cDNA.
As used herein the term "screening a library" shall refer to the process of using a labeled probe to check whether, under the appropriate conditions, there is a sequence complementary to the probe present in a particular DNA library. In addition, "screening a library" could be performed by PCR.
As used herein, the term "PCR" refers to th e polymerase chain reaction that is the subject of U.S. Patent Nos. 4,683,195 and 4,683,202 to Mullis, as well as other improvements now known in the art. The amino acid described herein are preferred to be in the "L" isomeric form. However, residues in the "D" isomeric form can be substituted for any L-amino acid residue, as long as th e desired functional property of immunoglobulin-binding is retained by the polypeptide. NH2 refers to the free amino group present a t the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J Biol. Chem., 243 :3552-59 (1969), abbreviations for amino acid residues are known in the art.
It should be noted that all amino-acid residue sequences are represented herein by formulae whose left and right orientation is in the conventional direction of amino- terminus to carboxy-terminus. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino-acid residues.
A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment. A "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) i n its either single stranded form, or a double-stranded helix. This term refers only to the primary and secondary structure of th e molecule, and does not limit it to any particular tertiary forms . Thus, this term includes double-stranded DNA found, inter alia, i n linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA).
An "origin of replication" refers to those DNA sequences that participate in DNA synthesis. A DNA "coding sequence" is a double-stranded DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
Transcriptional and translational control sequences are DNA regulatory sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for the expression of a coding sequence in a host cell. A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription a t levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well a s protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic promoters often, b u t not always, contain "TATA" boxes and "CAT" boxes. Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the - 1 0 and -35 consensus sequences. An "expression control sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. A coding sequence is "under the control" of transcriptional and translational control sequences in a cell when RNA polymerase transcribes the coding sequence into mRNA, which is then translated into the protein encoded by the coding sequence.
A "signal sequence" can be included near the coding sequence. This sequence encodes a signal peptide, N-terminal to the polypeptide, that communicates to the host cell to direct th e polypeptide to the cell surface or secrete the polypeptide into th e media, and this signal peptide is clipped off by the host cell before the protein leaves the cell. Signal sequences can be found associated with a variety of proteins native to prokaryotes an d eukaryotes . The term "oligonucleotide", as used herein in referring to the probe of the present invention, is defined as a molecule comprised of two or more ribonucleotides, preferably more th an three. Its exact size will depend upon many factors which, in turn, depend upon the ultimate function and use of the oligonucleotide. The term "primer" as used herein refers to a n oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed u nder conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in th e presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must b e sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon many factors, including temperature, source of primer and use the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the oligonucleotide primer typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.
The primers herein are selected to be " substantially" complementary to different strands of a particular target DNA sequence. This means that the primers must be sufficiently complementary to hybridize with their respective strands . Therefore, the primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being complementary to the strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the primer, provided that th e primer sequence has sufficient complementary with the sequence or hybridize therewith and thereby form the template for the synthesis of the extension product. As used herein, the terms "restriction endonucleases" and "restriction enzymes" refer to enzymes, each of which cut double-stranded DNA at or near a specific nucleotide sequence.
A cell has been "transformed" by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by th e ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing th e transforming DNA. A "clone" is a population of cells derived from a single cell or ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for m any generations . Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80%, and mo st preferably at least about 90% or 95%) of the nucleotides match over the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing th e sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.
A "heterologous" region of the DNA construct is a n identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, th e gene will usually be flanked by DNA that does not flank th e mammalian genomic DNA in the genome of the source organism. In another example, coding sequence is a construct where the coding sequence itself is not found in nature (e.g., a cDNA where the genomic coding sequence contains introns, or synthetic sequences having codons different than the native gene). Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.
The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals which fluoresce when exposed to ultraviolet light, and others. A number of fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate.
Proteins can also be labeled with a radioactive element or with an enzyme. The radioactive label can be detected by any of the currently available counting procedures. The preferred isotope may be selected from 3H, "C, 32p, 35 S, 36 C1, 5 i r, 57 o, 58Q), 59Fe, 9θγ; 1251, 1311, and 186Re .
Enzyme labels are likewise useful, and can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques . The enzyme is conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Many enzymes which can be used in these procedures are known and can be utilized. The preferred are peroxidase, β-glucuronidase, β-D-glucosidase, β-D- galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. U.S. Patent Nos. 3,654,090, 3,850,752, and 4,016,043 are referred to by way of example for their disclosure of alternate labeling material and methods. A particular assay system developed and utilized in the art is known as a receptor assay. In a receptor assay, th e material to be assayed is appropriately labeled and then certain cellular test colonies are inoculated with a quantitiy of both the label after which binding studies are conducted to determine th e extent to which the labeled material binds to the cell receptors. I n this way, differences in affinity between materials can b e ascertained.
An assay useful in the art is known as a "cis/trans" assay. Briefly, this assay employs two genetic constructs, one of which is typically a plasmid that continually expresses a particular receptor of interest when transfected into an appropriate cell line, and the second of which is a plasmid that expresses a reporter such as luciferase, under the control of a receptor/ligand complex. Thus, for example, if it is desired to evaluate a compound as a ligand for a particular receptor, one of the plasmids would be a construct that results in expression of the receptor in the chosen cell line, while the second plasmid would possess a promoter linked to the luciferase gene in which the response element to th e particular receptor is inserted. If the compound under test is a n agonist for the receptor, the ligand will complex with the receptor, and the resulting complex will bind the response element and initiate transcription of the luciferase gene. The resulting chemiluminescence is then measured photometrically, and dose response curves are obtained and compared to those of known ligands. The foregoing protocol is described in detail in U.S. Patent No. 4,981 ,784.
As used herein, the term "host" is meant to include not only prokaryotes but also eukaryotes such as yeast, plant and animal cells. A recombinant DNA molecule or gene which encodes a human TADG-12 protein of the present invention can be used to transform a host using any of the techniques commonly known to those of ordinary skill in the art. Especially preferred is the use of a vector containing coding sequences for the gene which encodes a huma TADG-12 protein of the present invention for purposes of prokaryote transformation. Prokaryotic hosts may include E. coli, S. tymph imurium , Serratia marcescens and Bacillus subtilis. Eukaryotic hosts include yeasts such as Pichia pastoris, mammalian cells and insect cells. In general, expression vectors containing promoter sequences which facilitate the efficient transcription of th e inserted DNA fragment are used in connection with the host. The expression vector typically contains an origin of replication, promoter(s), terminator(s), as well as specific genes which are capable of providing phenotypic selection in transformed cells. The transformed hosts can be fermented and cultured according to means known in the art to achieve optimal cell growth.
The invention includes a substantially pure DNA encoding a TADG-12 protein, a strand of which DNA will hybridize at high stringency to a probe containing a sequence of at least 1 5 consecutive nucleotides of the sequence shown in SEQ ID No. 1 or SEQ ID No. 3. The protein encoded by the DNA of this invention may share at least 80% sequence identity (preferably 85%, more preferably 90%, and most preferably 95%) with the amino acids listed in SEQ ID No. 2 or SEQ ID No. 4. More preferably, the DNA includes the coding sequence of the nucleotides of Figure 4 (SEQ ID No. 1), or a degenerate variant of such a sequence.
The probe to which the DNA of the invention hybridizes preferably consists of a sequence of at least 2 0 consecutive nucleotides, more preferably 40 nucleotides, even more preferably 50 nucleotides, and most preferably 1 00 nucleotides or more (up to 100%) of the coding sequence of th e nucleotides listed in Figure 4 (SEQ ID No. 1) or the complement thereof. Such a probe is useful for detecting expression of TADG- 12 in a human cell by a method including the steps of (a) contacting mRNA obtained from the cell with the labeled hybridization probe; and (b) detecting hybridization of the probe with the mRNA. This invention also includes a substantially pure DNA containing a sequence of at least 15 consecutive nucleotides (preferably 20, more preferably 30, even more preferably 50, and most preferably all) of the region from nucleotides 1 to 2413 of the nucleotides listed in SEQ ID No. 1, or of the region from nucleotides 1 to 2544 of the nucleotides listed in SEQ ID No. 3. The present invention also comprises antisense oligonucleotides directed against this novel DNA. Given the teachings of th e present invention, a person having ordinary skill in this art would readily be able to develop antisense oligonucleotides directed against this DNA.
By "high stringency" is meant DNA hybridization and wash conditions characterized by high temperature and low salt concentration, e.g., wash conditions of 65°C at a salt concentration of approximately 0.1 x SSC, or the functional equivalent thereof. For example, high stringency conditions may include hybridization at about 42°C in the presence of about 50% formamide; a first wash at about 65°C with about 2 x SSC containing 1% SDS; followed by a second wash at about 65°C with about 0.1 x SSC. By "substantially pure DNA" is meant DNA that is not part of a milieu in which the DNA naturally occurs, by virtue of separation (partial or total purification) of some or all of th e molecules of that milieu, or by virtue of alteration of sequences that flank the claimed DNA. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into th e genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by polymerase chain reaction (PCR) or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence, e.g., a fusion protein. Also included is a recombinant DNA which includes a portion of the nucleotides shown in SEQ ID No. 3 which encodes a n alternative splice variant of TADG-12 (TADG- 12V).
The DNA may have at least about 70% sequence identity to the coding sequence of the nucleotides listed in SEQ ID No. 1 or SEQ ID No. 3, preferably at least 75% (e.g. at least 80%); and most preferably at least 90%. The identity between two sequences is a direct function of the number of matching or identical positions. When a subunit position in both of the two sequences is occupied by the same monomeric subunit, e.g., if a given position is occupied by an adenine in each of two DNA molecules, then they are identical at that position. For example, if 7 positions in a sequence 10 nucleotides in length are identical to the corresponding positions in a second 10-nucleotide sequence, then the two sequences have 70% sequence identity. The length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 7 5 nucleotides, and most preferably 100 nucleotides. Sequence identity is typically measured using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).
The present invention comprises a vector comprising a DNA sequence which encodes a human TADG-12 protein and th e vector is capable of replication in a host which comprises, in operable linkage: a) an origin of replication; b) a promoter; and c) a DNA sequence coding for said protein. Preferably, the vector of the present invention contains a portion of the DNA sequence shown in SEQ ID No. 1 or SEQ ID No. 3. A "vector" may be defined as a replicable nucleic acid construct, e.g., a plasmid or viral nucleic acid. Vectors may be used to amplify and/or express nucleic acid encoding a TADG-12 protein. An expression vector is a replicable construct in which a nucleic acid sequence encoding a polypeptide is operably linked to suitable control sequences capable of effecting expression of the polypeptide in a cell. The need for such control sequences will vary depending upon the cell selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter and/or enhancer, suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation. Methods which are well known to those skilled in the art can be used to construct expression vectors containing appropriate transcriptional and translational control signals. See for example, the techniques described in Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual (2nd Ed.), Cold Spring Harbor Press, N.Y. A gene and its transcription control sequences are defined a s being "operably linked" if the transcription control sequences effectively control the transcription of the gene. Vectors of th e invention include, but are not limited to, plasmid vectors and viral vectors. Preferred viral vectors of the invention are those derived from retroviruses, adenovirus, adeno-associated virus, SV40 virus, or herpes viruses.
By a "substantially pure protein" is meant a protein which has been separated from at least some of those components which naturally accompany it. Typically, the protein is substantially pure when it is at least 60%, by weight, free from th e proteins and other naturally-occurring organic molecules with which it is naturally associated in vivo. Preferably, the purity of the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight. A substantially p ure TADG-12 protein may be obtained, for example, by extraction from a natural source; by expression of a recombinant nucleic acid encoding an TADG-12 polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, e.g., column chromatography such as immunoaffinity chromatography using an antibody specific for TADG-12, polyacrylamide gel electrophoresis, or HPLC analysis. A protein is substantially free of naturally associated components when it is separated from at least some of those contaminants which accompany it in its natural state. Thus, a protein which is chemically synthesized or produced in a cellular system different from the cell from which it naturally originates will be, b y definition, substantially free from its naturally associated components. Accordingly, substantially pure proteins include eukaryotic proteins synthesized in E. coli, other prokaryotes, o r any other organism in which they do not naturally occur.
In addition to substantially full-length proteins, th e invention also includes fragments (e.g., antigenic fragments) of the TADG-12 protein. As used herein, "fragment," as applied to a polypeptide, will ordinarily be at least 10 residues, more typically at least 20 residues, and preferably at least 30 (e.g., 50) residues in length, but less than the entire, intact sequence. Fragments of the TADG- 12 protein can be generated by methods known to those skilled in the art, e.g., by enzymatic digestion of naturally occurring or recombinant TADG-12 protein, by recombinant DNA techniques using an expression vector that encodes a defined fragment of TADG-12, or by chemical synthesis. The ability of a candidate fragment to exhibit a characteristic of TADG-12 (e.g., binding to an antibody specific for TADG-12) can be assessed b y methods described herein. Purified TADG-12 or antigenic fragments of TADG-12 can be used to generate new antibodies or to test existing antibodies (e.g., as positive controls in a diagnostic assay) by employing standard protocols known to those skilled in the art. Included in this invention are polyclonal antisera generated by using TADG-12 or a fragment of TADG-12 as th e immunogen in, e.g., rabbits. Standard protocols for monoclonal and polyclonal antibody production known to those skilled in this art are employed. The monoclonal antibodies generated by this procedure can be screened for the ability to identify recombinant TADG-12 cDNA clones, and to distinguish them from known cDNA clones.
Further included in this invention are TADG-12 proteins which are encoded at least in part by portions of SEQ ID No. 1 or SEQ ID No. 3, e.g., products of alternative mRNA splicing or alternative protein processing events, or in which a section of TADG-12 sequence has been deleted. The fragment, or the intact TADG-12 polypeptide, may be covalently linked to another polypeptide, e.g. which acts as a label, a ligand or a means to increase antigenicity.
The invention also includes a polyclonal or monoclonal antibody which specifically binds to TADG-12. The invention encompasses not only an intact monoclonal antibody, but also a n immunologically-active antibody fragment, e.g., a Fab or (Fab)2 fragment; an engineered single chain Fv molecule; or a chimeric molecule, e.g., an antibody which contains the binding specificity of one antibody, e.g., of murine origin, and the remaining portions of another antibody, e.g., of human origin.
In one embodiment, the antibody, or a fragment thereof, may be linked to a toxin or to a detectable label, e.g. a radioactive label, non-radioactive isotopic label, fluorescent label, chemiluminescent label, paramagnetic label, enzyme label, o r colorimetric label. Examples of suitable toxins include diphtheria toxin, Pseudomonas exotoxin A, ricin, and cholera toxin. Examples of suitable enzyme labels include malate hydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, alcohol dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, acetylcholinesterase, etc. Examples of suitable radioisotopic labels include 3H, 125L 1 31I, 32P, 35S, 14C, etc.
Paramagnetic isotopes for purposes of in vivo diagnosis can also be used according to the methods of this invention. There are numerous examples of elements that are useful in magnetic resonance imaging. For discussions on in v ivo nuclear magnetic resonance imaging, see, for example, Schaefer e t al., ( 1989) JACC 14, 472-480; Shreve et al., (1986) Magn. Reson. Med. 3, 336-340; Wolf, G. L., (1984) Physiol. Chem. Phys. Med. NMR 16, 93-95; Wesbey et al., (1984) Physiol. Chem. Phys. Med. NMR 16, 145-155; Runge et al., (1984) Invest. Radiol. 19„ 408 -415. Examples of suitable fluorescent labels include a fluorescein label, an isothiocyalate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an ophthaldehyde label, a fluorescamine label, etc. Examples of chemiluminescent labels include a luminal label, an isoluminal label, an aromatic acridiniu ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label, a n aequorin label, etc.
Those of ordinary skill in the art will know of other suitable labels which may be employed in accordance with the present invention. The binding of these labels to antibodies or fragments thereof can be accomplished using standard techniques commonly known to those of ordinary skill in the art. Typical techniques are described by Kennedy et al., (1976) Clin. Chim. Acta 70, 1-31 ; and Schurs et al., (1977) Clin. Chim. Acta 81, 1 -40. Coupling techniques mentioned in the latter are th e glutaraldehyde method, the periodate method, the dimaleimide method, the m-maleimidobenzyl-N-hydroxy-succinimide ester method. All of these methods are incorporated by reference herein.
Also within the invention is a method of detecting TADG-12 protein in a biological sample, which includes the steps of contacting the sample with the labeled antibody, e.g., radioactively tagged antibody specific for TADG-12, and determining whether the antibody binds to a component of th e sample. As described herein, the invention provides a number of diagnostic advantages and uses. For example, the TADG-12 protein disclosed in the present invention is useful in diagnosing cancer in different tissues since this protein is highly overexpressed in tumor cells. Antibodies (or antigen-binding fragments thereof) which bind to an epitope specific for TADG-12, are useful in a method of detecting TADG-12 protein in a biological sample for diagnosis of cancerous or neoplastic transformation. This method includes the steps of obtaining a biological sample (e.g., cells, blood, plasma, tissue, etc.) from a patient suspected of having cancer, contacting the sample with a labeled antibody (e.g., radioactively tagged antibody) specific for TADG-12, and detecting the TADG-12 protein using standard immunoassay techniques such as an ELISA. Antibody binding to the biological sample indicates that the sample contains a component which specifically binds to an epitope within TADG-12.
Likewise, a standard Northern blot assay can be u sed to ascertain the relative amounts of TADG-12 mRNA in a cell or tissue obtained from a patient suspected of having cancer, in accordance with conventional Northern hybridization techniques known to those of ordinary skill in the art. This Northern assay uses a hybridization probe, e.g. radiolabelled TADG-12 cDNA, either containing the full-length, single stranded DNA having a sequence complementary to SEQ ID No. 1 or SEQ ID No. 3, or a fragment of that DNA sequence at least 20 (preferably at least 30, more preferably at least 50, and most preferably at least 1 00 consecutive nucleotides in length). The DNA hybridization probe can be labeled by any of the many different methods known to those skilled in this art. Antibodies to the TADG-12 protein can be used in a n immunoassay to detect increased levels of TADG-12 protein expression in tissues suspected of neoplastic transformation. These same uses can be achieved with Northern blot assays an d analyses . The present invention is directed to DNA fragment encoding a TADG-12 protein selected from the group consisting of:
(a) an isolated DNA fragment which encodes a TADG-12 protein;
(b) an isolated DNA fragment which hybridizes to isolated DNA fragment of (a) above and which encodes a TADG-12 protein; an d (c) an isolated DNA fragment differing from the isolated DNA fragments of (a) and (b) above in codon sequence due to th e degeneracy of the genetic code, and which encodes a TADG-12 protein. Preferably, the DNA has the sequence shown in SEQ ID No. 1 or SEQ ID No. 3. More preferably, the DNA encodes a TADG- 12 protein having the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
The present invention is also directed to a vector and/or a host cell capable of expressing the DNA of the present invention. Preferably, the vector contains DNA encoding a TADG- 12 protein having the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4. Representative host cells include bacterial cells, yeast cells, mammalian cells and insect cells.
The present invention is also directed to an isolated and purified TADG-12 protein coded for by DNA selected from th e group consisting of: (a) isolated DNA which encodes a TADG-12 protein; (b) isolated DNA which hybridizes to isolated DNA of (a) above and which encodes a TADG-12 protein; and (c) isolated DNA differing from the isolated DNAs of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a TADG-12 protein. Preferably, the isolated and purified TADG-12 protein has the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4.
The present invention is also directed to a method of detecting expression of the TADG-12 protein described herein, comprising the steps of: (a) contacting mRNA obtained from the cell with the labeled hybridization probe; and (b) detecting hybridization of the probe with the mRNA.
A number of potential applications are possible for th e TADG-12 gene and gene product including the truncated product TADG- 12V.
In one embodiment of the present invention, there is provided a method for diagnosing a cancer by detecting a TADG- 12 protein in a biological sample, wherein the presence or absence of a TADG-12 protein indicates the presence or absence of a cancer. Preferably, the biological sample is selected from th e group consisting of blood, urine, saliva, tears, interstitial fluid, ascites fluid, tumor tissue biopsy and circulating tumor cells. Still preferably, the detection of TADG-12 protein is by means selected from the group consisting of Northern blot, Western blot, PCR, dot blot, ELIZA sandwich assay, radioimmunoassay, DNA array chips and flow cytometry. Such method is used for detecting an ovarian cancer, breast cancer, lung cancer, colon cancer, prostate cancer and other cancers in which TADG-12 is overexpressed.
In another embodiment of the present invention, there is provided a method for detecting malignant hyperplasia b y detecting a TADG-12 protein or TADG-12 mRNA in a biological sample. Further by comprising the TADG-12 protein or TADG-12 mRNA to reference information, a diagnosis or a treatment can b e provided. Preferably, PCR amplification is used for detecting TADG-12 mRNA, wherein the primers utilized are selected from the group consisting of SEQ ID Nos. 28-31. Still preferably, detection of a TADG-12 protein is by immunoaffinity to a n antibody directed against a TADG-12 protein.
In still another embodiment of the present invention, there is provided a method of inhibiting expression of endogenous TADG-12 mRNA in a cell by introducing a vector comprising a DNA fragment of TADG-12 in opposite orientation operably linked to elements necessary for expression. As a result, the vector produces TADG-12 antisense mRNA in the cell, which hybridizes to endogenous TADG-12 mRNA, thereby inhibiting expression of endogenous TADG-12 mRNA.
In still yet another embodiment of the pre sent invention, there is provided a method of inhibiting expression of a TADG-12 protein by introducing an antibody directed against a TADG-12 protein or fragment thereof. As a result, the binding of the antibody to the TADG-12 protein or fragment thereof inhibits the expression of the TADG-12 protein. TADG-12 gene products including the truncated form can be used for targeted therapy. Specifically, a compound having a targeting moiety specific for a TADG-12 protein and a therapeutic moiety is administered to an individual in need of such treatment. Preferably, the targeting moiety is selected from the group consisting of an antibody directed against a TADG-12 protein and a ligand or ligand binding domain that binds a TADG- 12 protein. The TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4. Still preferably, th e therapeutic moiety is selected from the group consisting of a radioisotope, a toxin, a chemotherapeutic agent, an immune stimulant and a cytotoxic agent. Such method can be used for treating an individual having a disease selected from the group consisting of ovarian cancer, lung cancer, prostate cancer, colon cancer and other cancers in which TADG-12 is overexpressed.
In yet another embodiment of the present invention, there is provided a method of vaccinating, or producing a n immune response in, an individual against TADG-12 by inoculating the individual with a TADG-12 protein or fragment thereof. Specifically, the TADG-12 protein or fragment thereof lacks TADG- 12 activity, and the inoculation elicits an immune response in the individual, thereby vaccinating the individual against TADG-12. Preferably, the individual has a cancer, is suspected of having a cancer or is at risk of getting a cancer. Still preferably, TADG-12 protein has an amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4, while TADG-12 fragment has a sequence shown in SEQ ID No. 8, or is a 9-residue fragment up to a 20-residue fragment. Examples of 9-residue fragment are shown in SEQ ID Nos. 35, 36, 55, 56, 83, 84, 97, 98, 119, 120, 122, 123 and 136. In still yet another embodiment of the pre sent invention, there is provided an immunogenic composition, comprising an immunogenic fragment of a TADG-12 protein and an appropriate adjuvant. Preferably, the immunogenic fragment of the TADG-12 protein has a sequence shown in SEQ ID No. 8, or is a 9-residue fragment up to a 20-residue fragment. Examples of 9 - residue fragment are shown in SEQ ID Nos. 35, 36, 55, 56, 83, 84, 97, 98, 119, 120, 122, 123 and 136.
The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion.
EXAMPLE 1
Tissue collection and storage Upon patient hysterectomy, bilateral salpingo- oophorectomy, or surgical removal of neoplastic tissue, th e specimen is retrieved and placed on ice. The specimen was th en taken to the resident pathologist for isolation and identification of specific tissue samples. Finally, the sample was frozen in liquid nitrogen, logged into the laboratory record and stored at -80°C. Additional specimens were frequently obtained from th e Cooperative Human Tissue Network (CHTN). These samples w ere prepared by the CHTN and shipped on dry ice. Upon arrival, these specimens were logged into the laboratory record and stored at - 80°C.
EXAMPLE 2 mRNA Extraction and cDNA Synthesis
Sixty-nine ovarian tumors (4 benign tumors, 10 low malignant potential tumors and 55 carcinomas) and 10 normal ovaries were obtained from surgical specimens and frozen in liquid nitrogen. The human ovarian carcinoma cell lines SW 626 and Caov 3, the human breast carcinoma cell lines MDA-MB-231 and MDA-MB-435S were purchased from the American Type Culture Collection (Rockville, MD). Cells were cultured to sub- confluency in Dulbecco's modified Eagle's medium, supplemented with 10% (v/v) fetal bovine serum and antibiotics.
Extraction of mRNA and cDNA synthesis were carried out by the methods described previously [14-16]. mRNA was isolated by using a RiboSep mRNA isolation kit (Becton Dickinson Labware). In this procedure, poly A+ mRNA was isolated directly from the tissue lysate using the affinity chromatography media oligo(dT) cellulose. cDNA was synthesized with 5.0 μg of mRNA b y random hexamer priming using 1st strand cDNA synthesis kit (CLONTECH).
EXAMPLE 3
PCR with Redundant Primers and Cloning of TADG-12 cDNA
Redundant primers, forward 5 ' - TGGGTIGTIACIGCIGCICA(CT)TG -3' (SEQ ID No. 26) and reverse 5 ' - A(AG)IA(AG)IGCIATITCITTICC-3' (SEQ ID No. 27), for the consensus sequences of amino acids surrounding the catalytic triad for serine proteases were used to compare the PCR products from normal and carcinoma cDNAs. The appropriate bands were ligated into Promega T-vector plasmid and the ligation product was used to transform JM109 cells (Promega) grown on selection media. After selection of individual colonies, they were cultured and plasmid DNA was isolated by means of the Wizard miniprep DNA purification system (Promega). Nucleotide sequencing w as performed using PRISM Ready Reaction Dye Deoxy terminator cycle sequencing kit (Applied Biosystems). Applied Biosystems Model 373A DNA sequencing system was used for direct cDNA sequence determination. The original TADG-12 subclone was randomly labeled and used as a probe to screen an ovarian tumor cDNA library b y standard hybridization techniques [11 ,15]. The library w as constructed in λZAP using mRNA isolated from the tumor cells of a stage Ill/grade III ovarian adenocarcinoma patient. Three overlapping clones were obtained which spanned 23 1 5 nucleotides. The final 99 nucleotides encoding the most 3' sequence including the poly A tail was identified by, homology with clones available in the GenBank EST database.
EXAMPLE 4
Quantitative PCR
The mRNA overexpression of TADG-12 w as determined using a quantitative PCR. Quantitative PCR w as performed according to the procedure as previously reported [16] . Oligonucleotide primers were used for: TADG-12, forward 5 ' - GAAACATGTCCTTGCTCTCG-3' (SEQ ID No. 28) and reverse 5 ' - ACTAACTTCCACAGCCTCCT-3' (SEQ ID No. 29); the variant TADG-12, forward 5'-TCCAGGTGGGTCTAGTTTCC-3' (SEQ ID No. 30), reverse 5, .CTCTTTGGCTTGTACTTGCT _γ (SEQ ID No. 31); β-tubulin, forward 5'- CGCATCAACGTGTACTACAA -3' (SEQ ID No. 32) and reverse 5 ' - TACGAGCTGGTGGACTGAGA -3' (SEQ ID No. 33). β-tubulin w a s utilized as an internal control. The PCR reaction mixture consists of cDNA derived from 50 ng of mRNA, 5 pmol of sense an d antisense primers for both the TADG-12 gene and the β-tubulin gene, 200 μmol of dNTPs, 5 μCi of α-32PdCTP and 0.25 unit of Taq DNA polymerase with reaction buffer (Promega) in a final volume of 25 μl. The target sequences were amplified in parallel with the β-tubulin gene. Thirty cycles of PCR were carried out in a Thermal Cycler (Perkin-Elmer Cetus). Each cycle of PCR included 3 0 seconds of denaturation at 94%C, 30 seconds of annealing at 60%C and 30 seconds of extension at 72%C. The PCR products w ere separated on 2% agarose gels and the radioactivity of each PCR product was determined by using a Phospho Imager (Molecular Dynamics). The present study used the expression ratio (TADG- 12/β -tubulin) as measured by phosphoimager to evaluate gene expression and defined the value at mean + 2SD of normal ovary as the cut-off value to determine overexpression. The student' s t test was used for comparison of the mean values of normal ovary and tumors.
EXAMPLE 5
Sequencing of TADG- 12/TADG-12V
Utilizing a plasmid specific primer near the cloning site, sequencing reactions were carried out using PRISM™ Ready Reaction Dye Deoxy™ terminators (Applied Biosystems cat# 401384) according to the manufacturer's instructions. Residual dye terminators were removed from the completed sequencing reaction using a Centri-sep™ spin column (Princeton Separation cat.# CS-901). An Applied Biosystems Model 373A DNA Sequencing System was available and was used for sequence analysis. EXAMPLE 6
Antibody Production
Polyclonal rabbit antibodies were generated b y immunization of white New Zealand rabbits with a poly-lysine linked multiple antigen peptide derived from the TADG-12 carboxy-terminal protein sequence NH -WIHEQMERDLKT-COOH
(WIHEQMERDLKT, SEQ ID NO. 34). This peptide is present in full length TADG-12, but not TADG-12V. Rabbits were immunized with approximately 100 μg of peptide emulsified in Ribi adjuvant. Subsequent boost immunizations were carried out at 3 and 6 weeks, and rabbit serum was isolated 10 days after the boost inoculations. Sera were tested by dot blot analysis to - determine affinity for the TADG-12 specific peptide. Rabbit pre-immune serum was used as a negative control.
EXAMPLE 7 Northern Blot Analysis
10 μg of mRNA were loaded onto a 1% formaldehyde- agarose gel, electrophoresed and blotted on a Hybond-N+ nylon
32 membrane (Amersham). P-labeled cDNA probes were made b y Prime-a-Gene Labeling System (Promega). The PCR products amplified by the same primers as above were used for probes . The blots were prehybridized for 30 min and hybridized for 6 0 min at 68%C with P-labeled cDNA probe in ExpressHyb Hybridization Solution (CLONTECH). Control hybridization to determine relative gel loading was performed with the β-tubulin probe . Normal human tissues; spleen, thymus, prostate, testis, ovary, small intestine, colon and peripheral blood leukocyte, and normal human fetal tissues; brain, lung, liver and kidney (Human
Multiple Tissue Northern Blot; CLONTECH) were also examined b y same hybridization procedure.
EXAMPLE 8
Immunohistochemistry
Immunohistochemical staining was performed using a Vectastain Elite ABC Kit (Vector). Formalin fixed and paraffin embedded specimens were routinely deparaffinized and processed using microwave heat treatment in 0.01 M sodium citrate buffer (pH 6.0). The specimens were incubated with normal goat s erum in a moist chamber for 30 minutes. TADG-12 peptide antibody was allowed to incubate with the specimens in a moisture chamber for 1 hour. Excess antibody was washed away with phosphate buffered saline. After incubation with biotinylated anti-rabbit IgG for 30 minutes, the sections were then incubated with ABC reagent (Vector) for 30 minutes. The final products were visualized using the AEC substrate system (DAKO) a nd sections were counterstained with hematoxylin before mounting. Negative controls were performed by using normal serum instead of the primary antibody.
EXAMPLE 9
Isolation of Catalytic Domain Subclones of TADG-12 and TADG-12 Variant
To identify serine proteases that are expressed i n ovarian tumors, redundant PCR primers designed to the conserved regions of the catalytic triad of these enzymes were employed. A sense primer designed to the region surrounding the conserved histidine and an anti-sense primer designed to the region surrounding the conserved aspartate were used in PCR reactions with either normal ovary or ovarian tumor cDNA as template. I n the reaction with ovarian tumor cDNA, a strong product band of the expected size of approximately 180 bp was observed as well as an unexpected PCR product of approximately 300 bp which showed strong expression in some ovarian tumor cDNA's (Figure IA). Both of these PCR products were subcloned and sequenced. The sequence of the subclones from the 180bp band (SEQ ID No. 5 ) was found to be homologous to the sequence identified in th e larger, unexpected band (SEQ ID No. 7) except that the larger b and had an additional insert of 133 nucleotides (Figure IB). The smaller product of the appropriate size encoded for a protein sequence (SEQ ID No. 6) homologous to other known proteases while the sequence with the insertion (SEQ ID No. 8) encoded for a frame shift from the serine protease catalytic domain and a subsequent premature translational stop codon. TADG-12 variants from four individual tumors were also subcloned and sequenced. It was found that the sequence and insert to be identical. The genomic sequences for these cDNA derived clones were amplified by PCR, examined and found to contain potential AG/GT splice sites that would allow for the variant transcript production.
EXAMPLE 10
Northern Blot Analysis of TADG-12 Expression
To examine transcript size and tissue distribution, the catalytic domain subclone was randomly labeled and used to probe Northern blots representing normal ovarian tissue, ovarian tumors and the cancer cell lines SW626, CAOV3, HeLa, MD-MBA- 435S and MD-MBA-231 (Figure 2). Three transcripts of 2.4, 1 .6 and 0.7 kilobases were observed. In blots of normal and ovary tumor the smallest transcript size 0.7 kb was lowly expressed in normal ovary while all transcripts (2.4, 1.6 and 0.7 kb) w ere abundantly present in serous carcinoma. In addition, Northern blots representing the normal human tissues spleen, thymus, prostate, testis, ovary, small intestine, colon and peripheral blood leukocyte, and normal human fetal tissues of brain, lung, liver and kidney were examined. The same three transcripts were found to be expressed weakly in all of these tissues (data not shown). A human β-tubulin specific probe was utilized as a control for relative sample loading. In addition, an RNA dot blot was probed representing 50 human tissues and determined that this clone is weakly expressed in all tissues represented (Figure 3). It w as found most prominently in heart, with intermediate levels in putamen, amygdala, kidney, liver, small intestine, skeletal muscle, and adrenal gland.
EXAMPLE 11 Sequencing and Characterization of TADG-12
An ovarian tumor cDNA library constructed in λZAP was screened by standard hybridization techniques using th e catalytic domain subclone as a probe. Two clones that overlapped with the probe were identified and sequenced and found to represent 2316 nucleotides. The 97 nucleotides at the 3' end of the transcript including the poly-adenylation signal and the poly (A) tail were identified by homology with clones available in GenBank's EST database. This brought the total size of th e transcript to 2413 bases (SEQ ID No. 1, Figure 4). Subsequent screening of GenBank's Genomic Database revealed that TADG-12 is homologous to a cosmid from chromosome 17. This cosmid has the accession number AC015555.
The identified cDNA includes an open reading frame that would produce a predicted protein of 454 amino acids (SEQ ID No. 2), named Tumor Associated Differentially-Expressed Gene 1 2 (TADG-12). The sequence has been submitted to the GenBank database and granted the accession # AF201380. Using homology alignment programs, this protein contains several domains including an amino-terminal cytoplasmic domain, a potential Type II transmembrane domain followed by a low-density lipoprotein receptor-like class A domain (LDLR-A), a scavenger receptor cysteine rich domain (SRCR), and an extracellular serine protease domain.
As predicted by the ™Pred program, TADG-12 contains a highly hydrophobic stretch of amino acids that could serve as a potential transmembrane domain, which would retain the amino terminus of the protein within the cytoplasm and expose th e ligand binding domains and protease domain to the extracellular space. This general structure is consistent with other known transmembrane proteases including hepsin [17], and TMPRSS2 [18], and TADG-12 is particularly similar in structure to th e TMPRSS2 protease.
The LDLR-A domain of TADG-12 is represented by th e sequence from amino acid 74 to 108 (SEQ ID No. 13). The LDLR-A domain was originally identified within the LDL Receptor [19] as a series of repeated sequences of approximately 40 amino acids, which contained 6 invariant cysteine residues and highly conserved aspartate and glutamate residues. Since that initial identification, a host of other genes have been identified which contain motifs homologous to this domain [20]. Several proteases have been identified which contain LDLR-A motifs including matriptase, TMPRSS2 and several complement components. A comparison of TADG-12 with other known LDLR-A domains is shown in Figure 5A. The similarity of these sequences range from 44 to 54% of similar or identical amino acids. In addition to the LDLR-A domain, TADG-12 contains another extracellular ligand binding domain with homology to th e group A SRCR family. This family of protein domains typically is defined by the conservation of 6 cysteine resides within a sequence of approximately 100 amino acids [23]. The SRCR domain of TADG-12 is encoded by amino acids 109 to 206 (SEQ ID No. 17), and this domain was aligned with other SRCR domains and found to have between 36 and 43% similarity (Figure 5B). However, TADG-12 only has 4 of the 6 conserved cysteine residues. This is similar to the SRCR domain found in the protease TMPRSS2.
The TADG-12 protein also includes a serine protease domain of the trypsin family of proteases. An alignment of the catalytic domain of TADG-12 with other known proteases is shown in Figure 5C. The similarity among these sequence ranges from 4 8 to 55%, and TADG-12 is most similar to the serine protease TMPRSS2 which also contains a transmembrane domain, LDLR-A domain and an SRCR domain. There is a conserved amino acid motif (RIVGG) downstream from the SRCR domain that is a potential cleavage/activation site common to many serine proteases of this family [25]. This suggests that TADG-12 is trafficked to the cell surface where the ligand binding domains are capable of interacting with extracellular molecules and th e protease domain is potentially activated. TADG-12 also contains conserved cysteine residues (amino acids 208 and 243) which in other proteases form a disulfide bond capable of linking th e activated protease to the other extracellular domains.
EXAMPLE 12 Quantitative PCR Characterization of the Alternative Transcript
The original TADG-12 subclone was identified a s highly expressed in the initial redundant-primer PCR experiment. The TADG-12 variant form (TADG-12V) with the insertion of 1 3 3 bp was also easily detected in the initial experiment. To identify the frequency of this expression and whether or not th e expression level between normal ovary and ovarian tumors w as different, a previously authenticated semi-quantitative PCR technique was employed [16]. The PCR analysis co-amplified a product for β-tubulin with either a product specific to TADG-12 or TADG-12V in the presence of a radiolabelled nucleotide. The products were separated by agarose gel electrophoresis and a phosphoimager was used to quantitate the relative abundance of each PCR product. Examples of these PCR amplification products are shown for both TADG-12 and TADG- 12V in Figure 6. Normal expression was defined as the mean ratio of TADG-12 (or TADG- 12V) to β-tubulin +/- 2SD as examined in normal ovarian samples . For tumor samples, overexpression was defined as >2SD from th e normal TADG- 12/β-tubulin or TADG- 12V/β-tubulin ratio. The results are summarized in Table 1 and Table 2. TADG-12 w as found to be overexpressed in 41 of 55 carcinomas examined while the variant form was present at aberrantly high levels in 8 of 22 carcinomas. As determined by the student's t test, these differences were statistically significant (p < 0.05).
TABLE 1
Frequency of Overexpression of TADG-12 in Ovarian Carcinoma
Figure imgf000045_0001
Overexpression =more than two standard deviations above the mean for normal ovary
LMP = low malignant potential tumor
TABLE 2
Frequency of Overexpression of TADG- 12V in Ovarian Carcinoma
Figure imgf000046_0001
Overexpression =more than two standard deviations above the mean for normal ovary; LMP = low malignant potential tumor
EXAMPLE 13
Immunohistochemical Analysis of TADG-12 in Ovarian Tumor Cells In order to examine the TADG-12 protein, polyclonal rabbit anti-sera to a peptide located in the carboxy-terminal amino acid sequence was developed. These antibodies were u s ed to examine the expression level of the TADG-12 protein and its localization within normal ovary and ovarian tumor cells b y immuno-localization. No staining was observed in normal ovarian tissues (Figure 7A) while significant staining was observed in 2 2 of 29 tumors studied. Representative tumor samples are shown in
Figures 7B and 7C. It should be noted that TADG-12 is found in a diffuse pattern throughout the cytoplasm indicative of a protein i n a trafficking pathway. TADG-12 is also found at the cell surface in these tumor samples as expected. It should be noted that th e antibody developed and used for immunohistochemical analysis would not detect the TADG- 12V truncated protein.
The results of the immunohistochemical staining are summarized in Table 3. 22 of 29 ovarian tumors showed positive staining of TADG-12, whereas normal ovarian surface epithelium showed no expression of the TADG-12 antigen. 8 of 10 serous adenocarcinomas, 8 of 8 mucinous adenocarcinomas, 1 of 2 clear cell carcinomas, and 4 of 6 endometroid carcinomas showed positive staining.
TAB &LE 3
Case Stage Histology Grade LN* TADG 12 Prognosis
1 Normal ovary 0-
2 Normal ovary 0-
3 Normal ovary 0-
4 Mucinous B ND 0- Alive
5 Mucinous B ND 1+ Alive
6 la Serous LMP Gl ND 1+ Alive
7 la Mucinous LMP Gl ND 1+ Alive
8 la Mucinous CA Gl ND 1+ Alive
9 la Mucinous CA G2 ND 1+ Alive
10 la Endometrioid CA Gl ND 0- Alive
11 lc Serous CA Gl N 1+ Alive
12 lc Mucinous CA Gl N 1+ Alive
13 lc Mucinous CA Gl N 2+ Alive
14 lc Clear cell CA G2 N 0- Alive
15 lc Clear cell CA G2 N 0- Alive
16 2c Serous CA G3 N 2+ Alive
17 3a Mucinous CA G2 N 2+ Alive 18 3b Serous CA Gl ND 1+ Alive
19 3c Serous CA Gl N 0- Dead
20 3c Serous CA G3 P 1+ Alive
21 3c Serous CA G2 P 2+ Alive
22 3c Serous CA Gl P 2+ Unknown
23 3c Serous CA G3 ND 2+ Alive
24 3c Serous CA G2 N 0- Dead
25 3c Mucinous CA Gl P 2+ Dead
26 3c Mucinous CA G2 ND 1+ Unknown
27 3c Mucinous CA G2 N 1+ Alive
28 3c Endometrioid CA Gl P 1+ Dead
29 3c Endometrioid CA G2 N 0- Alive
30 3c Endometrioid CA G2 P 1+ Dead
31 3c Endometrioid CA G3 P 1+ Alive
32 3c Clear Cell CA G3 P 2+ Dead
LN*= : Lymph Node: B = Benign; N = Neg ative; P = Positive;
ND = Not Done
EXAMPLE 14
Peptide Ranking
For vaccine or immune stimulation, individual 9-mers to 11-mers of the TADG-12 protein were examined to rank the binding of individual peptides to the top 8 haplotypes in the general population [Parker et al., (1994)]. The computer program used for this analysis can be found at <http://www- bimas.dcrt.nih.gov/molbio/hla_bind/>. Table 4 shows the peptide ranking based upon the predicted half-life of each peptide' s binding to a particular HLA allele. A larger half-life indicates a stronger association with that peptide and the particular HLA molecule. The TADG-12 peptides that strongly bind to an HLA allele are putative immunogens, and are used to innoculate an individual against TADG-12.
TABLE 4
TADG-12 peptide ranking
HLA Type Predicted SEQ
& Ranking Start Peptide Dissociation^ ID No.
HLA A0201
1 40 ILSL PFEV 685.783 35
2 144 AQLGFPSYV 545.316 36
3 225 LSQWPWQA 63.342 . 37
4 252 WIITAAHCV 43.992 38
5 356 VL HAAVPL 36.316 39
6 176 LLPDDKVTA 34.627 40
7 13 FSFRS FG 31.661 41
8 151 YVSSDNLRV 27.995 42
9 436 RVTSFLDWI 21.502 43
10 234 SLQFQGYHL 21.362 44
11 181 KVTA HHSV 21.300 45
12 183 TALHHSVYV 19.658 46
13 411 RLWKLVGAT 18.494 47
14 60 LILALAIGL 18.476 48
15 227 SQWPWQASL 17.977 49
16 301 RLGNDIALM 11.426 50
17 307 ALMKLAGPL 10.275 51
18 262 DLY PKSWT 9.837 52
19 416 LVGATSFGI 9.001 53
20 54 SLGIIALIL 8.759 54 HLA A0205
1 218 IVGGNMSLL 47.600 55
2 60 LILALAIGL 35.700 48
3 35 AVAAQILSL 28.000 56
4 307 ALM LAGPL 21.000 51
5 271 IQVG VS L 19.040 57
6 397 CQGDSGGP 16.800 58
7 227 SQWP QASL 16.800 49
8 270 TIQVG VSL 14.000 59
9 56 GIIA ILAL 14.000 60
10 110 RVGGQNAVL 14.000 61
11 181 KVTALHHSV 12.000 45
12 151 YVSSDNLRV 12.000 42
13 356 VL HAAVPL 11.900 39
14 144 AQLGFPSYV 9.600 36
15 13 FSFRSLFGL 7.560 41
16 54 S GIIALIL 7.000 54
17 234 S QFQGYHL 7.000 44
18 217 RIVGGNMSL 7.000 62 i 19 411 RL KLVGAT 6.000 47
20 252 WIITAAHCV 6.000 38
HLA Al
1 130 CSDDWKGHY 37.500 63
2 8 AVEAPFSFR 9.000 64
: 3 328 NSEENFPDG 2.700 65
4 3 ENDPPAVEA 2.500 66
5 98 DCKDGEDEY 2.500 67
6 346 ATEDGGDAS 2.250 68
7 360 AAVPLIS K 2.000 69 8 153 SSDNLRVSS 1.500 70
9 182 VTALHHSVY 1.250 71
10 143 CAQLGFPSY 1.000 72
11 259 CVYDLYLPK 1.000 73
12 369 ICNHRDVYG 1.000 74
13 278 LDNPAPSH 1.000 75
14 426 CAEVNKPGV 1.000 76
15 32 DADAVAAQI 1.000 77
16 406 VCQERRLWK 1.000 78
17 329 SEE FPDGK 0.900 79
18 303 G DIALMKL 0.625 80
19 127 KTMCSDDWK 0.500 81
20 440 FLDWIHEQM 0.500 82
HLA A24
1 433 VYTRVTSFL 280.000 83
2 263 LYLPKSWTI 90.000 84
3 169 EFVSIDHLL 42.000 85
4 217 RIVGGNMSL 12.000 62
5 296 KYKPKRLGN 12.000 86
I 6 16 RSLFGLDDL 12.000 87
7 267 KSWTIQVGL 11.200 88
8 81 RSSFKCIEL 8.800 89
9 375 VYGGIISPS 8.000 90
10 110 RVGGQNAVL 8.000 91 ϊ 11 189 VYVREGCAS 7.500 92
12 60 LILALAIGL 7.200 48
13 165 QFREEFVSI 7.200 93
14 271 IQVGLVSLL 7.200 57
15 56 GIIALILAL 7.200 60 16 10 EAPFSFRSL 7.200 94
17 307 ALMKLAGPL 7.200 51
18 407 CQERRLWKL 6.600 95
19 356 VLNHAAVPL 6.000 39
20 381 SPSMLCAGY 6.000 96
HLAB7
1 375 VYGGIISPS 200.000 97
2 381 SPSMLCAGY 80.000 98
3 362 VPLISNKIC 80.000 99 4 4 3 355 A AVVAAAAQQIILLSSLL 60.000 56
5 373 RDVYGGIIS 40.000 100
6 307 ALMKLAGPL 36.000 51
7 283 APSHLVEKI 24.000 101
8 177 LPDDKVTAL 24.000 102 9 9 4 477 E EVVFFSSQQSSSSSSLL 20.000 103
10 110 RVGGQNAVL 20.000 91
11 218 IVGGNMSLL 20.000 55
12 36 VAAQILSLL 12.000 104
13 255 TAAHCVYDL 12.000 105
) 1144 1 100 E EAAPPFFSSFFRRSSLL 12.000 94
15 138 YANVACAQL 12.000 106
16 195 CASGHWTL 12.000 107
17 215 SSRIVGGNM 10.00 108
18 298 KPKRLGNDI 8.000 109
5 1199 3 31133 G GPPLLTTFFNNEEMMII 8.000 110
20 108 CVRVGGQNA 5.000 111
HLA B8
1 294 HSKYKPKRL 80.000 112
2 373 RDVYGGIIS 16.000 100 3 177 LPDDKVTAL 4.800 102
4 265 LPKSWTIQV 2.400 113
5 88 ELITRCDGV 2.400 114
6 298 KPKRLGNDI 2.000 109
7 81 RSSFKCIEL 2.000 89
8 375 VYGGIISPS 2.000 97
9 79 RCRSSFKCI 2.000 115
10 10 EAPFSFRSL 1.600 94
11 215 SSRIVGGNM 1.000 108
12 36 VAAQILSLL 0.800 104
13 255 TAAHCVYDL 0.800 116
14 381 SPSMLCAGY 0.800 98
15 195 CASGHWTL 0.800 107
16 362 VPLISNKIC 0.800 99
17 138 YANVACAQL 0.800 106
18 207 ACGHRRGYS 0.400 117
19 154 SDNLRVSSL 0.400 118
20 47 EVFSQSSSL 0.400 103
HLA B2702 ι 1 300 KRLGNDIAL 180.000 119
2 435 TRVTSFLDW 100.000 120
3 376 YGGIISPSM 100.000 121
4 410 RRLWKLVGA 60.000 122
5 210 HRRGYSSRI 60.000 123 i 6 227 SQWPWQASL 30.000 49
7 109 VRVGGQNAV 20.000 124
8 191 VREGCASGH 20.000 125
9 78 YRCRSSFKC 20.000 126
10 113 GQNAVLQVF 20.000 127 11 91 TRCDGVSDC 20.000 128
12 38 AQILSLLPF 20.000 129
13 211 RRGYSSRIV 18.000 130
14 216 SRIVGGNMS 10.000 131
15 118 LQVFTAASW 10.000 132
16 370 CNHRDVYGG 10.000 133
17 393 GVDSCQGDS 10.000 134
18 235 LQFQGYHLC 10.000 135
19 271 IQVGLVSLL 6.000 57 ι 20 408 CQERRLWKL 6.000 95
HLA B4403
1 427 AEVNKPGVY 90.000 136
2 162 LEGQFREEF 40.000 137
3 9 VEAPFSFRS 24.000 138
; 4 318 NEMIQPVCL 12.000 139
5 256 AAHCVYDLY 9.000 140
6 98 DCKDGEDEY 9.000 67
7 46 FEVFSQSSS 8.000 141
8 38 AQILSLLPF 7.500 129
) 9 64 LAIGLGIHF 7.500 142
10 192 REGCASGHV 6.000 143
11 330 EENFPDGKV 6.000 144
12 182 VTALHHSVY 6.000 145
13 408 QERRLWKLV 6.000 146
5 14 206 TACGHRRGY 4.500 147
15 5 DPPAVEAPF 4.500 148
16 261 YDLYLPKSW 4.500 149
17 33 ADAVAAQIL 4.500 150
18 168 EEFVSIDHL 4.000 151 1 9 304 NDIALMKLA 3.750 1 52
2 0 1 04 DEYRCVRVG 3.600 1 5 3
Conclusion
In this study, a serine protease was identified b y means of a PCR based strategy. By Northern blot, the largest transcript for this gene is approximately 2.4 kb, and it is found to be expressed at high levels in ovarian tumors while found a t minimal levels in all other tissues examined. The full-length cDNA encoding a novel multi-domain, cell-surface serine protease w as cloned, named TADG-12. The 454 amino acid protein contains a cytoplasmic domain, a type II transmembrane domain, an LDLR-A domain, an SRCR domain and a serine protease domain. Using a semi-quantitative PCR analysis, it was shown that TADG-12 is overexpressed in a majority of tumors studied.
Immunohistochemical staining corroborates that in some cases this protein is localized to the cell-surface of tumor cells and this suggests that TADG-12 has some extracellular proteolytic functions. Interestingly, TADG-12 also has a variant splicing form that is present in 35% of the tumors studied. This variant mRNA would lead to a truncated protein that may provide a unique peptide sequence on the surface of tumor cells.
This protein contains two extracellular domains which might confer unusual properties to this multidomain molecule. Although the precise role of LDLR-A function with regard to proteases remains unclear, this domain certainly has the capacity to bind calcium and other positively charged ligands [21 ,22] . This may play an important role in the regulation of the protease o r subsequent internalization of the molecule. The SRCR domain w as originally identified within the macrophage scavenger receptor and functionally described to bind lipoproteins. Not only are SRCR domains capable of binding lipoproteins, but they may also bind to molecules as diverse as polynucleotides [23]. More recent studies have identified members of this domain family in proteins with functions that vary from proteases to cell adhesion molecules involved in maturation of the immune system [24]. In addition, TADG-12, like TMPRSS2 has only four of six cysteine residues conserved within its SRCR domain. This difference may allow for different structural features of these domains that confer unu sual ligand binding properties. At this time, only the function of th e CD6 encoded SRCR is well documented. In the case of CD6, th e SRCR domain binds to the cell adhesion molecule ALCAM [23] . This mediation of cell adhesion is a useful starting point for future research on newly identified SRCR domains, however, th e possibility of multiple functions for this domain can not b e overlooked. SRCR domains are certainly capable of cell adhesion type interactions, but their capacity to bind other types of ligands should be considered.
At this time, the precise role of TADG-12 remains unclear. Substrates have not been identified for the protease domain, nor have ligands been identified for the extracellular LDLR-A and SRCR domains. Figure 8 presents a working model of TADG-12 with the information disclosed in the present invention. Two transcripts are produced which lead to the production of either TADG-12 or the truncated TADG- 12V proteins. Either of these proteins is potentially targeted to the cell surface. TADG-12 is capable of becoming an activated serine protease while TADG- 12V is a truncated protein product that if at the cell surface m ay represent a tumor specific epitope.
The problem with treatment of ovarian cancer today remains the inability to diagnose the disease at an early stage. Identifying genes that are expressed early in the disease process such as proteases that are essential for tumor cell growth [26] is an important step toward improving treatment. With this knowledge, it may be possible to design assays to detect the highly expressed genes such as the TADG-12 protease described here or previously described proteases to diagnose these cancers at an earlier stage. Panels of markers may also provide prognostic information and could lead to therapeutic strategies for individual patients. Alternatively, inhibition of enzymes such as proteases may be an effective means for slowing progression of ovarian cancer and improving the quality of patient life. Other features of TADG-12 and TADG-12V must be considered important to future research too. The extracellular ligand binding domains are natural targets for drug delivery systems. The aberrant peptide associated with the TADG- 12V protein may provide an excellent target drug delivery or for immune stimulation.
The following references were cited herein. 1. Duffy, M.J., Clin. Exp. Metastasis, 10: 145-155, 1992.
2. Monsky, W.L., et al., Cancer Res., 53: 3159-3164, 1993.
3. Powell, W.C., et al., Cancer Res., 53: 417-422, 1993. 4. Neurath, H. The Diversity of Proteolytic Enzymes. In: R.J. Beynon and J.S. Bond (eds.), pp. 1- 13, Proteolytic enzymes, Oxford: IRL Press, 1989. 5. Liotta, L.A., et al., Cell, 64: 327-336, 1991. 6. Tryggvason, K, et al., Biochem. Biophys. Acta., 907: 191 -217 , 1987.
7. McCormack, R.T., et al., Urology, 45:729-744, 1995.
8. Landis, S.H., et al., CA Cancer J. Clin., 48: 6-29, 1998. 9. Tanimoto, H., et al., Cancer Res., 57: 2884-2887, 1997.
10. Tanimoto, H., et al., Cancer, 86: 2074-2082, 1999.
11. Underwood, L.J., et al., Cancer Res., 59:4435-4439, 1999.
12. Tanimoto, et al., Increased Expression of Protease M in Ovarian Tumors. Tumor Biology, In Press, 2000. 13. Tanimoto, H., et al., Proc. Of the Amer. Assoc. for Cane. Research 39:648, 1998.
14. Tanimoto, H., et al., Tumor Biology, 20: 88-98, 1999.
15. Maniatis, T., Fritsch, E.F. & Sambrook, J. Molecular Cloning, p. 309-361 Cold Spring Harbor Laboratory, New York, 1982. 16. Shigemasa, K., et al., J. Soc. Gynecol. Invest., 4:95-102, 1997.
17. Leytus, S.P., et al., Biochemistry, 27: 1067-1074, 1988.
18. Paoloni-Giacobino, A., et al., Genomics, 44: 309-320, 1997.
19. Sudhof, T.C., et al., Science, 228: 815-822, 1985.
20. Daly, N., et al., Proc. Natl. Acad. Sci. USA 92: 6334-6338, 1995. 21. Mahley, R.W., Science 240: 622-630, 1988.
22. Van Driel, I.R., et al., J. Biol. Chem. 262: 17443-17449, 1987.
23. Freeman, M., et al., Proc. Natl. Acad. Sci. USA 87: 88 10- 88 14, 1 990.
24. Aruffo, A., et al., Immunology Today 18(10): 498-504, 1997. 25. Rawlings, N.D., and Barrett, A.J., Methods Enzymology 244: 1 9 -
61 , 1994. 26. Torres-Rosado, A., et al., Proc. Natl. Acad. Sci. USA, 90: 7 1 8 1 - 7185, 1993. Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.

Claims

WHAT IS CLAIMED IS:
1 . A DNA fragment encoding Tumor Associated Differentially-Expressed Gene-12 (TADG-12) protein selected from the group consisting of:
(a) an isolated DNA fragment which encodes a TADG-12 protein;
(b) an isolated DNA fragment which hybridizes to isolated DNA fragment of (a) above and which encodes a TADG-12 protein; and
(c) an isolated DNA fragment differing from th e isolated DNA fragments of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a TADG-12 protein.
2. The DNA fragment of claim 1, wherein said DNA fragment has the sequence selected from the group consisting of SEQ ID No. 1 and SEQ ID No. 3.
3. The DNA fragment of claim 1 , wherein said
TADG-12 protein has the amino acid sequence selected from th e group consisting of SEQ ID No. 2 and SEQ ID No. 4.
4. A vector comprising the DNA fragment of claim 1 and regulatory elements necessary for expression of the DNA in a cell.
5. The vector of claim 4, wherein said DNA fragment encodes a TADG-12 protein having the amino acid sequence selected from the group consisting of SEQ ID No. 2 and SEQ ID No. 4.
6. A host cell transfected with the vector of claim 4, said vector expressing a TADG-12 protein.
7. The host cell of claim 6, wherein said cell is selected from the group consisting of a bacterial cell, a mammalian cell, a plant cell and an insect cell.
8. The host cell of claim 7, wherein said bacterial cell is E. coli.
9. An antisense oligonucleotide directed against th e DNA fragment of claim 1.
10. An isolated and purified TADG-12 protein coded for by DNA selected from the group consisting of:
(a) isoiated DNA which encodes a TADG-12 protein; (b) isolated DNA which hybridizes to isolated DNA of
(a) above and which encodes a TADG-12 protein; and
(c) isolated DNA differing from the isolated DNAs of (a) and (b) above in codon sequence due to the degeneracy of the genetic code, and which encodes a TADG-12 protein.
1 1 . The isolated and purified TADG-12 protein of claim 10, wherein said TADG-12 protein has an amino acid sequence selected from the group consisting of SEQ ID No. 2 and SEQ ID No. 4.
12. A method for detecting expression of the TADG- 12 protein of claim 10, comprising the steps of:
(a) contacting mRNA obtained from a cell with a labeled hybridization probe; and (b) detecting hybridization of the probe with th e mRNA.
13. An antibody directed against the TADG-12 protein of claim 10.
14. A method for diagnosing a cancer in a n individual, comprising the steps of:
(a) obtaining a biological sample from said individual; and (b) detecting a TADG-12 protein in said sample, wherein the presence of a TADG-12 protein in said sample is indicative of the presence of a cancer in said individual, wherein the absence of a TADG-12 protein in said sample is indicative of the absence of a cancer in said individual.
15. The method of claim 14, wherein said biological sample is selected from the group consisting of blood, urine, saliva, tears, interstitial fluid, ascites fluid, tumor tissue biopsy an d circulating tumor cells.
16. The method of claim 14, wherein said detection of a TADG-12 protein is by means selected from the group consisting of Northern blot, Western blot, PCR, dot blot, ELIZA sandwich assay, radioimmunoassay, DNA array chips and flow cytometry.
17. The method of claim 14, wherein said cancer is selected from the group consisting of ovarian cancer, breast cancer, lung cancer, colon cancer, prostate cancer and other cancers in which TADG-12 is overexpressed.
1 8. A method for detecting malignant hyperplasia i n a biological sample, comprising the steps of:
(a) isolating mRNA from said sample; and
(b) detecting TADG-12 mRNA in said sample, wherein the presence of said TADG-12 mRNA in said sample is indicative of the presence of malignant hyperplasia, wherein th e absence of said TADG-12 mRNA in said sample is indicative of the absence of malignant hyperplasia.
19. The method of claim 18, further comprising th e step of comparing said TADG-12 mRNA to reference information, wherein said comparison provides a diagnosis of said malignant hyperplasia.
20. The method of claim 18, further comprising th e step of comparing said TADG-12 mRNA to reference information, wherein said comparison determines a treatment of said malignant hyperplasia.
21 . The method of claim 18, wherein said detection of TADG-12 mRNA is by PCR amplification.
22. The method of claim 21, wherein said PCR amplification uses primers selected from the group consisting of SEQ ID Nos. 28-31.
23. The method of claim 18, wherein said biological sample is selected from the group consisting of blood, urine, saliva, tears, interstitial fluid, ascites fluid, tumor tissue biopsy an d circulating tumor cells.
24. A method for detecting malignant hyperplasia in a biological sample, comprising the steps of:
(a) isolating protein from said sample; and
(b)detecting a TADG-12 protein in said sample, wherein the presence of a TADG-12 protein in said sample is indicative of the presence of malignant hyperplasia, wherein the absence of a TADG-12 protein in said sample is indicative of the absence of malignant hyperplasia.
25. The method of claim 24, further comprising the step of comparing said TADG-12 protein to reference information, wherein said comparison provides a diagnosis of said malignant hyperplasia.
26. The method of claim 24, further comprising th e step of comparing said TADG-12 protein to reference information, wherein said comparison determines a treatment of said malignant hyperplasia.
27. The method of claim 24, wherein said detection is by immunoaffinity to an antibody, wherein said antibody is directed against a TADG-12 protein.
28. The method of claim 24, wherein said biological sample is selected from the group consisting of blood, urine, saliva, tears, interstitial fluid, ascites fluid, tumor tissue biopsy an d circulating tumor cells.
29. A method of inhibiting expression of endogenous
TADG-12 mRNA in a cell, comprising the step of: introducing a vector into a cell, wherein said vector comprises a DNA fragment of TADG-12 in opposite orientation operably linked to elements necessary for expression, wherein expression of said vector in said cell produces TADG-12 antisense mRNA, wherein said TADG-12 antisense mRNA hybridizes to endogenous TADG-12 mRNA, thereby inhibiting expression of endogenous TADG-12 mRNA in said cell.
30. A method of inhibiting expression of a TADG-12 protein in a cell, comprising the step of: introducing an antibody into a cell, wherein said antibody is directed against a TADG-12 protein or fragment thereof, wherein binding of said antibody to said TADG-12 protein or fragment thereof inhibits expression of said TADG-12 protein.
3 1 . A method of targeted therapy to an individual, comprising the step of: administering a compound to an individual, wherein said compound has a targeting moiety and a therapeutic moiety, wherein said targeting moiety is specific for a TADG-12 protein.
32. The method of claim 31, wherein said targeting moiety is selected from the group consisting of an antibody directed against a TADG-12 protein and a ligand or ligand binding domain that binds a TADG-12 protein.
33. The method of claim 32, wherein said TADG-12 protein has an amino acid sequence selected from the group consisting of SEQ ID No. 2 and SEQ ID No. 4.
34. The method of claim 31 , wherein said therapeutic moiety is selected from the group consisting of a radioisotope, a toxin, a chemotherapeutic agent, an immune stimulant and a cytotoxic agent.
35. The method of claim 31 , wherein said individual suffers from a disease selected from the group consisting of ovarian cancer, lung cancer, prostate cancer, colon cancer an d other cancers in which TADG-12 is overexpressed.
36. A method of vaccinating an individual against TADG-12, comprising the step of inoculating the individual with a
TADG-12 protein or fragment thereof, wherein said TADG-12 protein or fragment thereof lacks TADG-12 activity, wherein said inoculation with said TADG-12 protein or fragment thereof elicits an immune response in said individual, thereby vaccinating said individual against TADG-12.
37. The method of claim 36, wherein said individual has a cancer, is suspected of having a cancer or is at risk of getting a cancer.
38. The method of claim 36, wherein said TADG-12 protein has an amino acid sequence selected from the group consisting of SEQ ID No. 2 and SEQ ID No. 4.
39. The method of claim 36, wherein said TADG-12 fragment has a sequence shown in SEQ ID No. 8.
40. The method of claim 36, wherein said TADG-12 fragment is a 9-residue fragment selected from the group consisting of SEQ ID Nos. 35, 36, 55, 56, 83, 84, 97, 98, 119, 120, 122, 123 and 136.
41 . An immunogenic composition, comprising a n immunogenic fragment of a TADG-12 protein and an appropriate adj uvant.
42. The immunogenic composition of claim 41 , wherein said immunogenic fragment of a TADG-12 protein has a sequence shown in SEQ ID No. 8.
43. The immunogenic composition of claim 41 , wherein said immunogenic fragment of a TADG-12 protein is a 9 - residue fragment selected from the group consisting of SEQ ID Nos. 35, 36, 55, 56, 83, 84, 97, 98, 119, 120, 122, 123 and 136.
PCT/US2000/005612 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof WO2000052044A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA2362830A CA2362830C (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
AU37209/00A AU765471B2 (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
JP2000602268A JP4558948B2 (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian cancer and use thereof
EP00916045A EP1157035A4 (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US09/261,416 US6291663B1 (en) 1999-03-03 1999-03-03 TADG-12: a novel transmembrane serine protease overexpressed in a ovarian carcinoma
US09/261,416 1999-03-03

Publications (1)

Publication Number Publication Date
WO2000052044A1 true WO2000052044A1 (en) 2000-09-08

Family

ID=22993212

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/005612 WO2000052044A1 (en) 1999-03-03 2000-03-02 Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof

Country Status (6)

Country Link
US (2) US6291663B1 (en)
EP (1) EP1157035A4 (en)
JP (1) JP4558948B2 (en)
AU (1) AU765471B2 (en)
CA (1) CA2362830C (en)
WO (1) WO2000052044A1 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001057069A2 (en) * 2000-02-02 2001-08-09 Transgene S.A. Targeting peptides
WO2001083781A2 (en) * 2000-04-28 2001-11-08 Millennium Pharmaceuticals, Inc. 14094, a novel human trypsin family member and uses thereof
WO2001057194A3 (en) * 2000-02-03 2002-03-28 Corvas Int Inc Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
EP1349485A2 (en) * 2000-11-14 2003-10-08 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
EP1354948A1 (en) * 2000-12-22 2003-10-22 Kazusa DNA Research Institute Foundation Novel cancer-associated genes
US7276364B1 (en) 1999-11-18 2007-10-02 Dendreon Corporation Nucleic acids encoding endotheliases, endotheliases and uses thereof
JP2008289482A (en) * 2000-11-14 2008-12-04 Corixa Corp Composition and method for therapy and diagnosis of ovarian cancer
US7598051B2 (en) 1999-09-10 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
EP2311863A1 (en) * 2001-03-05 2011-04-20 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer
US8039603B2 (en) 2001-03-05 2011-10-18 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030032103A1 (en) * 1997-09-18 2003-02-13 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
US20030039648A1 (en) * 1998-09-16 2003-02-27 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
US20030113842A1 (en) * 1998-03-11 2003-06-19 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
PT1082341E (en) * 1998-06-01 2011-02-15 Agensys Inc Tumor antigen useful in diagnosis and therapy of prostate and colon cancer
US7037667B1 (en) * 1998-06-01 2006-05-02 Agensys, Inc. Tumor antigen useful in diagnosis and therapy of prostate and colon cancer
US6902892B1 (en) 1998-10-19 2005-06-07 Diadexus, Inc. Method of diagnosing, monitoring, staging, imaging and treating prostate cancer
US6942978B1 (en) * 1999-03-03 2005-09-13 The Board Of Trustees Of The University Of Arkansas Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US6797504B1 (en) * 2000-09-08 2004-09-28 Dendreon San Diego Llc Inhibitors of serine protease activity of matriptase or MTSP1
US7700341B2 (en) 2000-02-03 2010-04-20 Dendreon Corporation Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
US7265216B2 (en) * 2000-03-02 2007-09-04 The Board Of Trustees Of The University Of Arkansas System Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US20040086875A1 (en) * 2001-11-05 2004-05-06 Agee Michele L. Novel proteins and nucleic acids encoding same
AU2002305052A1 (en) 2001-03-13 2002-09-24 Corvas International, Inc. Nucleic acid molecules encoding a transmembrane serine protease 7, the encoded polypeptides and methods based thereon
WO2002077263A2 (en) 2001-03-22 2002-10-03 Dendreon San Diego Llc Nucleic acid molecules encoding serine protease cvsp14, the encoded polypeptides and methods based thereon
NZ527971A (en) 2001-03-27 2006-03-31 Dendreon Corp Nucleic acid molecules encoding a transmembrane serine protease 9, the encoded polypeptides and methods based thereon
KR20040080940A (en) 2001-05-14 2004-09-20 덴드레온 코포레이션 Nucleic acid molecules encoding a transmembrane serine protease 10, the encoded polypeptides and methods based thereon
AU2002357004A1 (en) * 2001-11-20 2003-06-10 Dendreon San Diego Llc Nucleic acid molecules encoding serine protease 17, the encoded polypeptides and methods based thereon
MXPA04010091A (en) * 2002-04-17 2004-12-13 Genentech Inc Compositions and methods for the diagnosis and treatment of tumor.
US20040001801A1 (en) * 2002-05-23 2004-01-01 Corvas International, Inc. Conjugates activated by cell surface proteases and therapeutic uses thereof
US7799742B2 (en) * 2008-03-07 2010-09-21 Elementis Specialties Inc. Equivalent circulating density control in deep water drilling
US20090163386A1 (en) * 2002-11-27 2009-06-25 Elementis Specialties, Inc. Compositions for drilling fluids useful to produce flat temperature rheology to such fluids over a wide temperature range and drilling fluids containing such compositions
US7345010B2 (en) 2002-11-27 2008-03-18 Elementis Specialties, Inc. Compositions for drilling fluids useful to provide flat temperature rheology to such fluids over a wide temperature range and drilling fluids containing such compositions
WO2004099779A1 (en) * 2003-05-05 2004-11-18 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with human transmembrane serine protease 3 (tmprss3)
AU2005216095B2 (en) * 2004-02-20 2009-09-17 The Regents Of The University Of California Salivary mRNA profiling, biomarkers, and related methods and kits of parts
CN101568550B (en) 2006-10-17 2012-12-26 肿瘤疗法科学股份有限公司 Peptide vaccines for cancers expressing mphosph1 or depdc1 polypeptides
UA113413C2 (en) 2011-08-12 2017-01-25 Онкотерапі Саєнс, Інк. Mphosph1 peptides and vaccines including the same
CA3000808A1 (en) 2015-10-08 2017-04-13 Sachiko YAMASHITA Mphosph1-derived peptide, and vaccine including same

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998041656A1 (en) * 1997-03-19 1998-09-24 The Board Of Trustees Of The University Of Arkansas Compositions and method for the early diagnosis of ovarian cancer

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7014993B1 (en) * 1997-08-21 2006-03-21 The Board Of Trustees Of The University Of Arkansas Extracellular serine protease
US5972616A (en) * 1998-02-20 1999-10-26 The Board Of Trustees Of The University Of Arkansas TADG-15: an extracellular serine protease overexpressed in breast and ovarian carcinomas
PT1386931E (en) * 1998-03-25 2006-09-29 Genentech Inc HOMOLOGO DE NEUROTRIMINA HUMANA
AU1205901A (en) * 1999-10-14 2001-04-23 Board Of Trustees Of The University Of Arkansas, The Tumor antigen derived gene-16 (tadg-16): a novel extracellular serine protease and uses thereof
ATE496123T1 (en) * 2000-02-03 2011-02-15 Dendreon Corp NUCLEIC ACIDS WHICH CODE FOR TRAM MEMBRANE SERINE PROTEASES, THE ENCODED PROTEINS AND METHODS BASED THEREON
AU6802801A (en) * 2000-03-01 2001-09-24 Genentech Inc Secreted and transmembrane polypeptides and nucleic acids encoding the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998041656A1 (en) * 1997-03-19 1998-09-24 The Board Of Trustees Of The University Of Arkansas Compositions and method for the early diagnosis of ovarian cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GENECORE VERSION 4.5 20 October 1999 (1999-10-20), "National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index" *
See also references of EP1157035A4 *
TANIMOTO ET. AL.: "Cloning and expression of TADG-15, a novel serine: protease expressed in ovarian cancer", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 39, March 1998 (1998-03-01), pages - 648 (ABSTRACT #4414), XP002929501 *
THAN N G, ET AL.: "A NEW PLACENTAL PROTEIN FAMILY WITH ONCODEVELOPMENTAL SIGNIFICANCE:CLONING AND SEQUENCE ANALYSIS OF THE HUMAN PLACENTAL PROTEIN 17 (PP17) FAMILY", TUMOR BIOLOGY, KARGER, BASEL, CH, no. SUPPL. 02, 1 January 1998 (1998-01-01), CH, pages 33, XP002929300, ISSN: 1010-4283 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7985843B2 (en) 1999-09-10 2011-07-26 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
US7598051B2 (en) 1999-09-10 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
US7276364B1 (en) 1999-11-18 2007-10-02 Dendreon Corporation Nucleic acids encoding endotheliases, endotheliases and uses thereof
WO2001057069A3 (en) * 2000-02-02 2002-02-21 Transgene Sa Targeting peptides
WO2001057069A2 (en) * 2000-02-02 2001-08-09 Transgene S.A. Targeting peptides
WO2001057194A3 (en) * 2000-02-03 2002-03-28 Corvas Int Inc Nucleic acid molecules encoding transmembrane serine proteases, the encoded proteins and methods based thereon
US7071004B1 (en) 2000-04-28 2006-07-04 Millennium Pharmaceuticals, Inc. 14094, a novel human trypsin family member and uses thereof
WO2001083781A2 (en) * 2000-04-28 2001-11-08 Millennium Pharmaceuticals, Inc. 14094, a novel human trypsin family member and uses thereof
WO2001083781A3 (en) * 2000-04-28 2002-07-11 Millennium Pharm Inc 14094, a novel human trypsin family member and uses thereof
EP1349485A4 (en) * 2000-11-14 2005-11-09 Corixa Corp Compositions and methods for the therapy and diagnosis of ovarian cancer
JP2008289482A (en) * 2000-11-14 2008-12-04 Corixa Corp Composition and method for therapy and diagnosis of ovarian cancer
EP1349485A2 (en) * 2000-11-14 2003-10-08 Corixa Corporation Compositions and methods for the therapy and diagnosis of ovarian cancer
EP1354948A4 (en) * 2000-12-22 2004-06-30 Kazusa Dna Res Inst Foundation Novel cancer-associated genes
US7375199B2 (en) 2000-12-22 2008-05-20 Kazusa Dna Research Institute Foundation Cancer-associated genes
EP1354948A1 (en) * 2000-12-22 2003-10-22 Kazusa DNA Research Institute Foundation Novel cancer-associated genes
US8008437B2 (en) 2000-12-22 2011-08-30 Kazusa Dna Research Institute Foundation Cancer-associated genes
EP2311863A1 (en) * 2001-03-05 2011-04-20 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer
US8039603B2 (en) 2001-03-05 2011-10-18 Agensys, Inc. Nucleic acid and corresponding protein entitled 121P1F1 useful in treatment and detection of cancer

Also Published As

Publication number Publication date
EP1157035A4 (en) 2005-06-08
CA2362830A1 (en) 2000-09-08
JP4558948B2 (en) 2010-10-06
JP2002537791A (en) 2002-11-12
US6291663B1 (en) 2001-09-18
CA2362830C (en) 2012-08-21
EP1157035A1 (en) 2001-11-28
AU3720900A (en) 2000-09-21
US6294663B1 (en) 2001-09-25
AU765471B2 (en) 2003-09-18

Similar Documents

Publication Publication Date Title
US7638277B2 (en) Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US6294663B1 (en) Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof
US7939321B2 (en) TADG-15: an extracellular serine protease overexpressed in carcinomas
AU750932B2 (en) TADG-15: an extracellular serine protease overexpressed in breast and ovarian carcinomas
EP1887082A2 (en) TADG-15: An extracellular serine protease overexpressed in carcinomas
EP1007627B1 (en) Extracellular serine protease
US7759103B2 (en) Extracellular serine protease
US20060205054A1 (en) Extracellular serine protease
US7157084B2 (en) Extracellular serine protease
US7083790B2 (en) Extracellular serine protease
US7265216B2 (en) Transmembrane serine protease overexpressed in ovarian carcinoma and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000916045

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2362830

Country of ref document: CA

Ref country code: CA

Ref document number: 2362830

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 602268

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 37209/00

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2000916045

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 37209/00

Country of ref document: AU