WO2001040292A1

WO2001040292A1 - Antigen-binding fragments specific for tumor associated antigens

Info

Publication number: WO2001040292A1
Application number: PCT/CA1999/001141
Authority: WO
Inventors: Michael Dan; Joycelyn Entwistle; Darren Fast; Howard Kaplan; Keith Lewis; Glen Macdonald; Pradip Maiti
Original assignee: Novopharm Biotech Inc.
Priority date: 1998-11-27
Filing date: 1999-11-29
Publication date: 2001-06-07

Abstract

The present invention relates to antigen-binding fragments that are specific for stressprotein-peptide complexes specifically associated with tumors, particularly human tumors, and compositions thereof. The compositions are suitable for diagnostic and pharmaceutical use. The invention further provides methods of making and screening for the antigen-binding fragments. The invention further encompasses compositions containing cancer-associated stress protein-peptide complexes (including derivatives thereof) and methods of use thereof. The cancer-specific stress protein-peptide complexes ('SPPC's) are particularly useful in eliciting cancer-specific immunogenic responses against a plurality of cancers. The invention also provides novel phage display libraries for use in producing further SPPCs and anti-SPPCs of the invention.

Description

ANTIGEN-BINDING FRAGMENTS SPECIFIC FOR TUMOR ASSOCIATED ANTIGENS

Reference To Related Applications

This application is a continuation in part and claims priority from U.S. Serial No. 60/1 10,126 filed November 27, 1998, U.S. Serial No. 60/1 13,729 filed December 23, 1998 and U.S. Serial Number 60/149,645 filed August 18, 1999 entitled Antigen-Binding Fragments Specific for Cancer Associated Stress Protein Peptide Complexes and Methods of Use Thereof. All references disclosed in this application are hereby incorporated by reference.

Technical Field

The present invention relates to antigen-binding fragments that are specific for cancer.

Background

Heat shock proteins ("HSP"s) form a family of highly conserved proteins that are widely distributed throughout the plant and animal kingdoms. On the basis of their molecular weights, HSPs are grouped into six different families: small (hsp20-30kDa); hsp40; hspόO; hsp70; hsp90; and hsp 100. Although HSPs were originally identified in cells subjected to heat stress, they have been found to be associated with many other forms of stress such as infections, and are thus more commonly known as "stress proteins" ("SP"s).

Members of the mammalian hsp90 family include cytosolic hsp90 (hsp83) and the endoplasmic reticulum counteφarts hsp90 (hsp83), hsp87, Gφ94 (ERp99) and gp96. See for instance, Gething et al. ( 1992) Nature 355:33-45. Members of the hsp70 family include cytosolic hsp70 (p73) and hsp 70 (p72), the endoplasmic reticulum counteφart BiP (Gφ78), and the mitochondrial counteφart hsp 70 (Gφ75). Members of the mammalian hspόO family have only been identified in the mitochondria.

A variety of recent reports corroborate an association between the presence of SPs on the cell surface and cancer. The relationship between SPs and cancer was discovered in the course of efforts to identify cancer-associated antigens by their ability to elicit protective immunity to cancer challenges. The approach typically involved fractionating tumor homogenates into various protein components by conventional chromatographic methods and using these fractions to immunize animals just prior to challenge with live cancer cells. The fractions that elicited protection against the cancer were then repeatedly refractionated until apparently homogeneous preparations were obtained. Molecules identified by such methodology turned out to be SPs of the hsp90 or hsp70 family, even from cancers of diverse historic origins. See, Srivastava et al., Heat Shock Proteins Come of Age (Immunity 1998 Jun;8(6):657-65). Naturally, this finding fostered a focused interest in using such fractions to immunize cancer patients against tumor tissue.

SPs are ubiquitous within cells. The roles of SPs include chaperoning peptides from one cellular compartment to another and presenting the peptides to the major histocompatability complex (MHC) molecules for cell surface presentation to the immune system. In the case of diseased cells, SPs also chaperone viral or cancer-associated peptides to the cell surface. Li and Srivastava (1994) Behring Inst Mitt 94:37-47; and Suzue et al. (1997) Proc. Natl. Acad.

Sci. USA 94: 13146-13151. The chaperone function is accomplished through the formation of complexes between the SPs and proteins and between SPs and viral or cancer-associated peptides. These complexes are termed "SPPC's herein. The bound peptides appear to be a random mix of peptides. The mixtures and exact natures of these peptides have not been determined. The association of SPs with various peptides has been observed in normal tissues as well and is not a cancer-specific phenomenon. See Srivastava (1994) Experientia 50: 1054-60.

For instance, expression of hsp26, hspόO, hsp70 and hsp90 on the surface of human chronic myeloid leukemia (CML) cells from patients has been observed. Chant et al. (1995) Br. J.

Haematol. 90:163-8. Cell surface expression of hsp70 has been detected on normal, premalignant and malignant human oral mucosa. Kaur et al. (1998) Oral Oncol. 34:93-8. A correlation of hsp70 expression with clinicopathological features showed a positive association with the severity of dysplasia in oral mucosal epithelium.

Ito et al. ((1998) J. Oral. Pathol. Med. 27: 18-22), reported that they examined 24 specimens of squamous cell carcinoma of the tongue and found that, although SP immunohistochemistry revealed changes in expression during tumorigenesis of squamous epithelium of the tongue, there was no observed correlation with other clinical features studied (survival period, stage, lymph node metastasis, histological grade or p53 immunostaining).

It is currently believed that the antigenicity of SPPCs results not from the SP per se, but from the complex formed when the peptide associated with the SP. This conclusion is based on a number of characteristics of the SPPCs. There are no differences in the structure of SPs derived from normal and rumor cells. Certain SPPCs lose their immunogenicity upon treatment with ATP. Udono et al. (1993) J Exp. Med. 178:1391-1396. Such loss of immunogenicity is due to dissociation of the SPPC into its SP and peptide components.

Vaccination with a mixture of SPPCs can induce a potent humoral immune response, as evidenced by the anti-peptide IgG response in BCG-primed mice injected with covalent hsp65 complex or hsp65-oligosaccharide complexes (Del Guidice Experentia (1994) 50: 1061). In contrast, vaccination with mixtures of SPPCs from tumor cells appears to generate a strong cell mediated response with little more than a weak humoral response even after prolonged immunization (Srivastava et al. Int. J. Cancer (1984) 33:417-422). The explanation for the absence of a strong humoral response is that vaccination of rumor cell- derived SPPCs favors a Thi immune response and would therefore, by definition, down- regulate any potential antibody response (Th2) directed against the rumor (Srivastava (1994) Experentia 50: 1054-1060).

It has been proposed to use SP-antigen complexes as vaccines. In particular, U.S. Patent No.

5,750,119 to Srivastava discloses a multi-step, cancer patient-specific method for inhibiting the proliferation of a tumor in a mammal, by (a) removing tumor cells from the mammal; (b) isolating all SPPCs from the tumor cells; and (c) administering the isolated mixture of SPPCs back to the mammal in order to stimulate in the mammal a cancer-specific immune response. Hsp70-peptide, hsp90-peptide and gp96-peptide complexes are itemized as complexes having particular vaccine utility. Nevertheless, in the practice of the method disclosed by

Srivastava, it is not considered necessary or even practical to isolate a specific peptide involved or even the particular SPPC involved in eliciting the immune response.

Moreover, Srivastava postulated that, "the prospect of identification of the immunogenic antigens of individual tumors from cancer patients, is daunting to the extent of being impractical." On this basis, Srivastava proposes immunizing a mammal harboring a tumor with a mixture of SPPCs derived from the animal's own tumor, without isolating complexes specific to the tumor and without attempting to characterize complexes which are found on more than one tumor in one or more mammals.

U.S. Patent No. 5,837,251 discloses a method of eliciting an immune response in a mammal comprising administering a specified low dose of a SP peptide and an antigenic peptide. The antigenic peptide can be provided exogenously, that is, non-covalently reacted with the SP to form a complex, or it can be endogenous i.e. naturally occurring in a native complex. Again, the native material is a mixture of SPPCs and is not free of complex associated with normal cells. WO 99/22761 relates to conjugate peptides engineered to non-covalently bind to heat shock proteins. These peptides may be used to link antigenic peptides to heat shock proteins.

Summary Of The Invention

Antigen Binding-Fragments

The present invention encompasses a composition of matter comprising an isolated antigen- binding fragment specific for a tumor cell surface associated SPPC. These antigen-binding fragments are termed "anti-SPPCs." As used herein, anti-SPPCs encompass any anti-SPPC antigen-binding fragment and any HI 1 variant that binds to an SPPC, but not to an SP without an associated peptide. These include antibodies into which CDRs of such anti- SPPCs of the invention have been engineered.

The invention further encompasses a composition of matter comprising an isolated antigen- binding fragment of an antibody specific for a cancer-associated SPPC and acceptable excipients. These excipients can vary depending on whether the anti-SPPC is to be used in imaging, inhibition of metastases, treatment of cancer or other therapy or diagnostic methods.

The invention further encompasses immunoaffinity matrices to which anti-SPPC is bound. Such matrices are suitable for use in purifying SPPCs and isolating cells to which the SPPCs are bound.

The invention also encompasses a method of obtaining antigen-binding fragments specific for a cancer-associated SPPC for instance by generating a population of antigen-binding fragments; generating cancer-associated SPPC; screening the antigen-binding fragments with the complex to obtain antigen-binding fragments that bind specifically to cancer-associated SPPC; and screening the antigen-binding fragments obtained for cell surface cancer- associated reactivity. The antigen binding fragments that bind specifically on SPPC are screened against the SPPC following release of the peptide to determine whether they are specific for the complex in the presence of the peptide. This is preferably done prior to screening for cell-surface tumor associated reactivity. An optional screening step can be included to isolate antibodies that are not cross-reactive with HI 1, thus providing antibodies specific for additional epitopes. As discussed in greater detail below, particularly with reference to specific Examples herein, the final screening step is preferably accomplished by screening the antigen-binding fragments obtained with at least one and preferably several cell lines or tissues derived from one or more cancer types and at least one and preferably several normal non-cancerous cell or tissue types. Suitable screening methods and parameters are known in the art and are also described in the Examples with respect to antibody HI 1.

SPPCs

The invention encompasses compositions containing one or more isolated cancer-associated

SPPCs ("SPPCs") designated C-antigens. The compositions can also include physiologically acceptable excipients and/or adjuvants. The invention further encompasses compositions containing substantially purified SPPC peptides and immunogenic fragments thereof. The invention further encompasses SPPCs obtained by any of the methods described herein.

Any of the SPPC or SPPC peptide compositions can be formulated in therapeutically or immunogenically effective amounts. These compositions can also be provided in dried or concentrated form for rehydration or dilution prior to use.

The invention is further directed to a method of isolating an intact SPPC by: fractionating a tumor cell extract; identifying an antigenically active fraction, thereof using an antigen binding fragment which binds specifically to the SPPC; applying the antigenically active fraction to an ADP chromatographic media; applying the active fraction eluted from the ADP chromatographic media to a strong anionic medium; collecting active fractions eluted from the strong anionic medium where activity is determined by specific reactivity with the antigen-binding fragment; and, preferably, purifying the active fractions under non- denaturing conditions, preferably electrophoretic protein separation and extraction.

The invention is also directed to a method of isolating an antigenic SPPC by: fractionating a tumor cell extract on an affinity medium, such as an immunoaffinity column, to bind the complex; eluting the complex to obtain an eluate; applying the eluate to a molecular sieve capable of separating the SP from the peptide; isolating, (and if necessary, sequencing,) the peptide; and re-associating the SP with the isolated peptide. The invention is also directed to C-antigen peptide isolated by said method and as described in more general terms below.

Polynucleotides

The invention encompasses compositions containing polynucleotides encoding the antigen- binding fragments. Recombinant vectors containing the polynucleotides and host cells transfected with the vectors are also encompassed by the invention.

The invention encompasses compositions containing polynucleotides encoding the peptide portion of an SPPC. In the case of C-antigen, the invention encompasses polynucleotides encoding the peptide portion of the complex.

Kits

The invention encompasses kits comprising the antigen-binding fragments of the invention and buffers, labeling agents, toxins and radioisotopes necessary for the diagnostic or therapeutic use of the antigen-binding fragments.

The invention further encompasses kits comprising the SPPC or peptide portion thereof of the invention and buffers, adjuvants etc. for the therapeutic and/or immunogenic use of the compositions.

Pharmaceutical Compositions

The invention encompasses therapeutic or pharmaceutically or physiologically acceptable compositions of matter. These compositions include an active component comprised of the SPPCs, peptides, antigen binding fragments and polynucleotides described herein and a physiologically acceptable buffer, vehicle or excipient thereof. Preferably, the active component is present in an "effective amount," that is, an amount to effect the desired result such as amelioration or palliation of symptoms or imaging.

Methods of Treatment

The invention encompasses methods of treating cancer patients or patients at risk for cancer.

The methods comprise administering to the patient a therapeutically effective amount of an antigen-binding fragment of the invention. The methods further comprise administering to the patient an immunogenic amount of an SPPC or SPPC peptide of the invention.

The invention also encompasses a method of treating a cancer subject comprising administering to the subject an amount of a composition of matter comprising an isolated antigen-binding fragment specific for a cancer-associated SPPC and a physiologically acceptable excipient effective to elicit a cancer-specific immune response.

The invention further encompasses a method of treating a cancer subject comprising administering to the subject an amount of a composition of matter comprising an isolated antigen-binding fragment specific for a cancer-associated SPPC and a physiologically acceptable excipient effective to ameliorate the cancer.

Additional Methods of Use

The invention encompasses methods of inducing a tumor-specific immune response in a subject. The methods can be used for cancer treatment as above, or as a preventative measure, particularly in a subject at risk for cancer. The methods include administering to the subject an amount of an active, effective to induce a cancer-specific immune response in the subject. The active can be cancer- associated SPPC or an antigenic fragment or recombinant variant thereof or an anti-idiotype anti-SPPC antibody.

The invention also encompasses methods of detecting or imaging cancer cells. In the case of in vitro detection, labeled anti-SPPCs are incubated with biological samples under suitable conditions and for a time sufficient to allow specific binding of the anti-SPPCs to cancer cells. Unbound anti-SPPCs are then removed and bound label measured or detected. In the case of imaging, labeled anti-SPPCs are administered to a patient (either having or suspected of having cancer), or animal model system in an amount and under conditions sufficient for the anti-SPPCs specifically binding to cancer cells. Excess or non-specifically bound anti- SPPCs are removed, if necessary, and bound anti-SPPCs are detected.

The invention, further encompasses methods of monitoring progress and efficiency of anti- cancer therapy. In this case, cancer patients undergoing chemotherapy or other forms of anti- cancer therapy are treated as described for diagnostic imaging but repeatedly and at defined intervals. A decrease in tumor burden is indicative of successful chemotherapy.

According to another aspect of the invention, the invention is directed to antigen-binding fragments, which bind to at least one tumor associated SPPC, and to a plurality of such SPPCs. Such antigen-binding fragments are screened against a panel of different tumor types to identify positive clones which are specific for one or more cancer-associated stress protein peptide complexes and a correspondingly wide variety of single tumor and multi-tumor specificities. In a preferred embodiment of the invention such variants of the HI 1 antigen- binding fragments are multi-carcinomic anti-SPPCs.

In yet another aspect of the invention, the invention is directed to a method of treating a cancer subject comprising administering to the subject amount of a composition of matter comprising an isolated SPPC according to the invention, or such isolated SPPC.

Thus, the present invention teaches a composition comprising an isolated stress protein- peptide complex (SPPC) capable of binding specifically to an anti-SPPC. In preferred embodiments, the anti-SPPC binds specifically to the surface of a stressed cell; the stressed cell is a cancer cell; the isolated SPPC is immunogenically cross-reactive with a cancer cell surface associated SPPC; the stress protein of the isolated SPPC belongs to one of the HSP70 or HSP90 families; the stress protein of the isolated SPPC belongs to the HSP70 family; the stress protein of the isolated SPPC belongs to the HSP90 family; the stress protein is HSP72 or HSP85; and/ or the stress protein is HSP96. The invention also teaches a composition comprising at least one isolated stress protein- peptide complex (SPPC) which is immunogenically cross-reactive with a cancer cell surface associated stress protein-peptide complex, said isolated SPPC capable of specifically binding to an anti-SPPC, which binds specifically to said cancer cell surface associated SPPC. In preferred embodiments, anti-SPPC is multi-carcinomic; the anti-SPPC binds specifically to a plurality of SPPCs, including SPPCs belonging to more than one family; the isolated SPPC is immunogenically cross-reactive with more than one cancer cell surface associated SPPC; and/ or the composition also has at least one other different isolated SPPC which is immunogenically cross-reactive with a cancer associated SPPC, said different isolated SPPC also capable of binding to said anti-SPPC. Preferably, the stress proteins of the different isolated SPPCs belong to at least both of the HSP70 and HSP90 families. More preferably, the isolated SPPC is immunogenically cross-reactive with more than one type of cancer cell population selected from the group of cancer cell types which are capable of exhibiting cell surface associated SPPCs. More preferably, the group of cancer cell-types is constituted from the group consisting of: astrocytoma, fibrosarcoma, myxosarcoma, liposarcoma, oligodendroglioma, ependymoma, medulloblastoma, primitive neural ectodermal tumor (PNET), chondrosarcoma, osteogenic sarcoma, pancreatic ductal adenocarcinoma, small and large cell lung adenocarcinomas, chordoma, angiosarcoma, endotheliosarcoma, squamous cell carcinoma, bronchoalveolarcarcinoma, epithelial adenocarcinoma, and liver metastases thereof, lymphangiosarcoma, lymphangioendotheliosarcoma, hepatoma, cholangiocarcinoma, synovioma, mesothelioma, Ewing's tumor, rhabdomyosarcoma, colon carcinoma, basal cell carcinoma, sweat gland carcinoma, papillary carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, bileduct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, testicular tumor, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, leukemia, multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease, breast tumors such as ductal and lobular adenocarcinoma, squamous and adenocarcinomas of the uterine cervix, uterine and ovarian epithelial carcinomas, prostatic adenocarcinomas, transitional squamous cell carcinoma of the bladder, B and T cell lymphomas (nodular and diffuse) plasmacytoma, acute and chronic leukemias, malignant melanoma, soft tissue sarcomas and leiomyosarcomas. In a further embodiment the group of cancer cell types is constituted from the group consisting of glioblastoma, malignant melanoma, colon adenocarcinoma, breast adenocarcinoma, kidney adenocarcinoma, osteogenic sarcoma or ovary adenocarcinoma cells. In yet a further embodiment, the group of cancer cell types is constituted from the group consisting of glioblastoma, neuroblastoma, malignant melanoma, breast adenocarcinoma, lung adenocarcinoma, small cell lung carcinoma, colon adenocarcinoma, prostate adenocarcinoma, kidney adenocarcinoma, osteogenic sarcoma, bladder cell carcinoma, ovarian adenocarcinoma and larynx carcinoma. In a further embodiment, the group of cancer cell types is constituted from the group consisting of breast carcinoma, colon carcinoma, glioma, gastric carcinoma, lung adenocarcinoma, lung squamous carcinoma, lung small cell carcinoma, lymphoma, melanoma, ovarian carcinoma and prostate carcinoma.

Preferably, the anti-SPPC is HI 1. In another embodiment, preferably the anti-SPPC is E6.

The invention also teaches a composition comprising an isolated peptide portion of the isolated SPPC contained within the composition. Also, the invention teaches a composition comprising at least one substantially purified SPPC, said SPPC corresponding to one of the substantially purified SPPCs specifically recognized by HI 1 within a population of SPPCs derived from A-375 melanoma. Preferably, the substantially purified SPPC belongs to the HSP70 family. Preferably, the substantially purified SPPC belongs to the HSP90 family.

The invention teaches a pharmaceutical composition. The invention also teaches a composition comprising at least one isolated SPPC derived from a target cancer, wherein said isolated SPPC is immunogenically cross-reactive with a cancer cell surface associated SPPC of a cell of said target cancer. In another embodiment, the invention teaches a composition comprising SPPCs derived from a target cancer, said composition enriched with at least one isolated SPPC which is immunogenically cross-reactive with a cancer cell surface associated SPPC of a cell of said target cancer. In yet another embodiment, the invention teaches a composition comprising SPPCs derived from a target cancer, said composition predominantly comprising at least one isolated SPPC which is immunogenically cross- reactive with a cancer cell surface associated SPPC of a cell of said target cancer. The invention also teaches peptide portions of the isolated SPPC constituting the composition an SPPC which is reconstituted from a stress protein and the peptide portion of an isolated SPPC; and a peptide portion of an isolated SPPC used to create an immunogen.

The invention further teaches a process of creating an immunogen using the peptide portion of an isolated SPPC by linking said peptide portion to a peptide coupling molecule. Preferably, the peptide portion is covalently linked to said peptide coupling molecule. Further preferably, the peptide portion is non-covalently linked to said peptide presenting molecule. Further preferred, the peptide-coupling molecule is a heat shock protein. Examples can be found in U.S. Patent Nos. 5,807,690, 5,780,246, 5,464,750 and 5,232,833.

The invention also teaches antigen-presenting cells sensitized with a sensitizing amount of a composition of the invention.

The invention further teaches a composition comprising an antigen binding fragment of an antibody which binds specifically to at least one cancer-associated SPPC of a target cancer cell. The invention teaches a composition comprising an antigen-binding fragment of an antibody which binds specifically to a plurality of cancer-associated SPPCs. Preferably, the antigen binding fragment binds specifically to a plurality of different types cancer cells; the plurality of cancer associated SPPCs include SPPCs in which the stress proteins belong to different families of stress proteins; the stress protein portion of the SPPC belongs to one of the HSP70 or HSP90 families; the stress protein belong to both the HSP70 and HSP90 families; the stress protein belongs to the group consisting of HSP72 and HSP85; the antigen-binding fragment is of human origin; and/ or the target cancer cell is of human origin.

The invention also teaches a pharmaceutical composition of the invention. Optionally, the antigen-binding fragment is unconjugated to any chemical entity including a bioresponse modifier or toxin for improved efficacy in a mammal. Preferably, the antigen-binding fragment does not have an Fc portion for activating complement. Preferably, the pharmaceutical composition is free of any associated or unassociated synergistic or cancer cell inhibiting or killing compound.

In another embodiment, the invention teaches a cancer imaging composition comprising a composition of the invention bound to a chemical entity, which is suitable for imaging a target cancer.

The invention also teaches the use of the imaging composition of the invention for imaging a cancer cell comprising administering said imaging composition to a group of cells to enable specific binding to such cells. The invention further teaches the use of the imaging composition of the invention for imaging a cancer cell in a mammal comprising administering to a mammal said imaging composition with a physiologically acceptable excipient.

In another embodiment, the composition of the invention is a diagnostic reagent. Preferably, the anti-SPPC is linked to an entity which assists in detecting specific binding of the anti- SPPC to a ligand.

Also taught is the use of a composition of the invention for treating or preventing a cancer in a mammal comprising administering to said mammal said composition with a physiologically acceptable excipient; and/ or the use of a composition of the invention for treating or preventing metastasis of a cancer in a mammal comprising administering to said mammal said composition with a physiologically acceptable excipient.

The invention teaches a pharmaceutical composition for use with a plurality of cancer cell types belonging to the group of types capable of exhibiting SPPCs of the surface of the cell. Preferably, the pharmaceutical composition is for use with plurality of carcinoma types.

The invention teaches a method of treating an individual having a type of cancer or metastasis comprising the steps of: (a) sensitizing antigen presenting cells in vitro with a sensitizing-effective amount of composition of claim 45; and (b) administering to an individual a cancer or metastasis a therapeutically effective amount of the sensitized antigen presenting cells.

The invention also teaches a pharmaceutical composition comprising a therapeutically effective amount of sensitized antigen presenting cells, in a pharmaceutically acceptable carrier, wherein the antigen presenting cells have been sensitized in vitro with a composition of the invention. The invention further teaches a composition of the invention wherein said antigen-binding fragment competitively inhibits the binding of HI 1 to a target tumor or is inhibited by the binding of HI 1 to said tumor.

Also taught is a composition of the invention wherein said antigen-binding fragment competitively inhibits the binding of E6 to a target rumor or is inhibited by the binding of E6 to said tumor.

The invention further teaches a method of selecting human MAbs directed against cancer associated SPPCs comprising: (a)fusing peripheral blood lymphocytes from a patient presenting with a cancer with an antigen-negative human cell line; (b) screening for anti- SPPC reactivity and selecting cells showing anti-SPPC activity; and; (c) screening for cancer cell specific antibody binding activity in the presence of and in the absence of a stress peptide releasing agent, and selecting cells showing such activity in the absence of such peptide releasing agent and no such activity in the presence of such agent.

In another embodiment, the invention teaches a method of generating cancer associated anti- SPPCs by using: (a) one or more phage particles displaying candidate antigen-binding fragments, said phage particles selected from a phage display library displaying a suitably diverse population of such fragments; or one or more such candidate antigen-binding fragments derived from such phage particles; to screen for cancer cell surface associated binding activity, said phage particles or candidate binding fragments selected on the basis of their ability to bind to SPPCs derived from one or more target tumors in the absence of a stress peptide releasing agent but not in the presence of such agent. Also taught is a population of genetic packages having a genetically determined outer surface protein including genetic packages which collectively display a plurality of different potential immunoglobulin binding-fragments in association with said outer surface protein, each package including a nucleic acid construct coding for a fusion protein which is at least a portion of said outer surface protein and a variant of at least one parental anti-SPPC immunoglobulin binding-fragment, wherein at least part of said construct preferably including at least a part of the CDR3 region of the V_H chain, which is randomized to create variation among said potential binding- fragments, is biased in favor of encoding the amino acid constitution of said parental immunoglobulin binding fragment. Preferably the genetic package is a phage and said parental immunoglobulin binding- fragment is selected from the group consisting of an scFv, Fab, V_H, Fd, Fv, F(ab')₂, F(ab)₂. Preferably the immunoglobulin binding fragment is a scFv, Fab, or V single domain V_H binding fragment. Preferably the parental anti-SPPC immunoglobulin binding fragment is a multicarcinomic anti-SPPC and wherein said plurality of different potential immunoglobulin binding fragments contain an enhanced representation of multi-carcinomic anti-SPPCs. Preferably the plurality of libraries are pooled, and at least a first and second of said pooled libraries differ in the degree of biasing to parental amino acids.

The invention teaches a population of genetic packages of the invention wherein said parental anti-SPPC immunoglobulin binding fragment is HI 1 and a population of genetic packages of the invention, wherein said parental anti-SPPC immunoglobulin binding fragment is E6.

The invention teaches a composition of the invention, wherein the antigen-binding fragment is selected from the group consisting of whole antibodies, bispecific antibodies, chimeric antibodies, Fab, F(ab')2, single chain V region fragments (scFv) and fusion polypeptides. The invention teaches a composition of the invention, wherein the antigen-binding fragment is encoded by a phage particle within a phage display library. Preferably, the antigen- binding fragment consists essentially of a scFv. In a composition of the invention, preferably the whole antibody is a human immunoglobulin of any isotype. In another preferred embodiment, the antigen binding fragment comprises a variable region derived from an IgM and a constant region derived from an IgG. In another preferred embodiment, the fusion peptide comprises the antigen-binding fragment fused to a chemically functional moiety. Further preferred, the moiety is selected from the group consisting of signal peptides, agents that enhance immunologic reactivity, agents that facilitate coupling to a solid support, bioresponse modifiers, immunotoxins, toxins, detectable labels, paramagnetic labels and drugs. Further preferred, the agent that facilitates coupling to a solid support is selected from the group consisting of biotin and avidin. In another preferred embodiment, the bioresponse modifier is a cytokine. In another embodiment, the cytokine is selected from the group consisting of tumor necrosis factor, interleukin-2, interleukin-4, interleukin-12, granulocyte macrophage colony stimulating factor and γ-interferons. In another embodiment, the drug is an antineoplastic agent selected from the group consisting of radioisotopes, vinca alkaloids, adriamycin, bleomycin sulfate, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, duanorubicin hydrochloride, doxorubicin hydrochloride, etoposide, fiuorouracil, lomustine, mechlororethamine hydrochloride, melphalan, mercaptopurine, methotrexate, mitomycin, mototane, pentostatin, pipobroman, procarbaze hydrochloride, streptozotocin, taxol, thioguanine and uracil mustard. Further preferred, the vinca alkaloid is selected from the group consisting of vinblastine sulfate, vincristine sulfate and vindesine sulfate. In a further embodiment, the toxin is selected from the group consisting of ricin, radionuclides, pokeweed antiviral protein, Pseudomonas exotoxin A, diphtheria toxin, ricin A chain, fungal ribosome inactivating proteins and phospholipase enzymes. Also preferred the detectable label is selected from the group consisting of radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, bioluminescent compounds, enzymes, substrates, cofactors and inhibitors.

The invention also teaches a composition of the invention, wherein the stress protein is a member of a heat shock protein family selected from the group consisting of hsp20-30, hsp60, hsp70, hsp90 and combinations thereof. Also taught is a composition comprising an isolated antigen-binding fragment of an antibody specific for a cancer-associated stress protein-peptide complex and a physiologically acceptable excipient, wherein the antigen-binding fragment is present in an amount effective to elicit a cancer-associated immune response in a subject upon administration to the subject.

Also taught is a method of treating a cancer subject comprising administering to the subject an amount of a composition comprising an isolated antigen-binding fragment of an antibody specific for a cancer-associated stress protein-peptide complex and a physiologically acceptable excipient effective to elicit a cancer-associated immune response. In one embodiment, the SPPC is multi-carcinomic. In another embodiment, the antigen is multi- carcinomic. In another embodiment, the SPPC is pan-carcinomic.

The invention also teaches a method of identifying antigen-binding fragments of an antibody specific for a tumor-associated stress protein-peptide complex comprising the steps of: (a)generating a suitable phage display library; (b) generating stress protein-peptide complex from a tumor; (c) screening the product of step (a) with the product of step (b) both with and without the peptide portion of the complex to obtain phage which display an antigen binding fragment that binds specifically to stress protein peptide complex only in the presence of the peptide portion of the complex; and (d) screening the phage obtained in step (c) for cell surface tumor-associated reactivity.

The invention teaches a method of isolating an antigenic tumor associated stress protein peptide complex, comprising the steps of : a)fractionating a tumor-cell extract on an antigen binding fragment affinity medium to bind the complex; b) applying the eluate from the affinity medium to molecular sieve which is capable of separating the stress protein from the peptide; c)isolating the peptide; and d)re-associating the stress protein with the isolated peptide.

Also taught is a method of isolating a peptide forming part of an antigenic tumor-associated peptide complex comprising: (a) fractionating a tumor cell extract an antigen binding fragment affinity medium to bind the complex; (b) applying the eluate from the affinity medium to a molecular sieve which is capable of separating the stress protein from the peptide; and (c) isolating the peptide.

In preferred embodiments of the methods of the invention, the stress protein is a member of the HSP70 family. Preferably, the stress protein is HSP72. In a further preferred embodiment, the stress protein peptide complex is C antigen. In another preferred embodiment, the stress protein peptide complex is first fractionated on a hydrophobic column to isolate a hydrophobic fraction.

The invention also teaches a method isolating an antigenically active cancer-associated protein peptide complex, comprising: (a) fractionating a tumor cell extract using a hydrophobic chromatographic media to obtain a hydrophobic fraction; (b) identifying an antigenically active such fraction using an antigen binding fragment of an antibody which binds specifically to a cancer-associated SPPC; (c) applying the antigenically active fraction to an ADP chromatographic media; (d) applying the active fraction eluted from the ADP chromatographic media to a strong anionic media; (e) collecting fractions eluted from the strong media which are determined to be active using said antibody; and preferably (f) a further purification step carried out under non-denaturing conditions, preferably eletrophoretic extraction.

The invention teaches a composition of matter comprising an isolated antigenic SPPC which is immunologically cross-reactive with an SPPC found on the surface of cancer cells, said SPPC substantially free from non-tumor-associated SPPCs and other contaminating proteins. The invention teaches a composition of matter comprising an isolated antigenic SPPC which is immunologically cross-reactive with an SPPC found on the surface of cancer cells, said

SPPC substantially free from non-tumor-associated SPPCs, other tumor-associated SPPCs and other contaminating proteins.

Also taught are cancer associated antigen binding fragments which react specifically with C- antigen. The invention further teaches an immunoaffinity matrix to which an anti-SPPC is bound. Brief Description Of The Drawings

Figure 1 depicts flow cytometric analysis of cells recognized by HI 1.

Figure 2 depicts a flow cytometric analysis of cells recognized by HI 1.

Figure 3 depicts analysis of Mab HI 1 with melanoma (A-375) antigen by ELISA.

Figure 4 depicts analysis of Mab HI 1 with glioma (SK-MG-1) antigen by ELISA.

Figure 5 depicts binding of HI 1 to human tumor cell lines by ELISA.

Figure 6 is a bar graph depicting the number of metastatic foci based on treatment of mice with human breast cancer xenograft, at day 42.

Figure 7 is a bar graph depicting the number of metastatic foci based on treatment of mice with human breast cancer xenograft, at day 100.

Figure 8 is a line graph depicting the effect of HI 1 on human melanoma xenograft.

Figure 9 is a Western Blot of partially purified HI 1 -antigen detected by (A) HI 1-IgG (B) anti-HSP70 antibody and (C) anti-HSP90 antibody

Figure 10 is a diagrammatic representation of vector SJFl, used to create a vector into which the library is cloned.

Figure 11 is a line graph depicting the effect of HI 1 on the growth of human lymphoma.

Figure 12 is a line graph depicting the effect of HI 1 on human breast adenocarcinoma.. Figure 13 is a schematic diagram of an HI 1 single chain Fv showing the number of residues in the various CDRs.

Figure 14 is a line graph showing predicted levels of amino acid substitutions at different spiking levels for the randomization of amino acid residues at a total of 19 positions.

Figure 15 is a diagram showing the strategy for the randomization of VL and VH CDRl and CDR3 residues.

Figure 16 is a diagram showing the strategy for construction of a HI 1 scFv library in which all six CDRs are randomized at a predetermined level.

Description Of Preferred Embodiments

SPPCs

The present invention encompasses compositions comprising cancer-associated SPPCs. The invention also encompasses compositions comprising substantially isolated SPPC peptide.

The invention further encompasses SSPCs obtained according to the methods described herein.

It has now been found that antigens, herein designated "C-antigen" are found on the surface of a variety of cancer cells but only at low levels or not at all on normal, non-cancerous cells, consists of SPPC. One such C-antigen was previously described by its immunologic reactivity with an antibody designated HI 1, but was not previously isolated or characterized. HI 1 is described in detail in WO97/44461. The antigen comprises the complex of SP and a peptide; HI 1 binding is lost when the complex is dissociated. HI 1 specifically recognizes a broad range of many, but not all, neoplastic cells. The specificity of HI 1 includes, but is not limited to, glioblastoma, neuroblastoma, malignant melanoma, breast adenocarcinoma, lung adenocarcinoma, small cell lung carcinoma, colon adenocarcinoma and prostate adenocarcinoma. Another such anti-SPPC, E6, has recently been isolated by the methods of the present invention, and is described in copending U.S. application No. [not yet known], filed November 29, 1999, entitled "Antigen Binding Fragments Specific for Cancer Antigens".

The term "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer can be linear or branched, it can comprise modified amino acids or amino acid analogs, and it can be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; including, but not limited to, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component. Unless stated or implied otherwise, the term antigen-binding fragment includes any polypeptide monomer or polymer with immunologic specificity, including the intact antibody, and smaller and larger functionally equivalent polypeptides, as described herein. With respect to "stress protein-peptide complex," "peptide" refers to the peptide moiety non-covalently complexed specifically to SP. Maintenance of HSP70 peptide complexes are typically ATP dependent and can be dissociated by the addition of ATP. Dissociation also occurs under denaturing conditions.

The terms "immunologically" and "immunogenically" and derivatives thereof are used interchangeably herein to mean recognition by an antibody or immune cell. Hence, the term "immunologically cross-reactive" and derivatives thereof, as used herein, encompasses "immunogenically cross-reactive" and refers to sharing antigenic determinants; the term

"immunologically cross-reactive" and is not intended to exclude compositions that have identical antigenic determinants.

The term "non-covalent" and derivatives thereof encompasses any molecular association, bond or link that is not a covalent bond. The complexed peptide can be either endogenous or synthetically synthesized. Endogenous peptides are native peptides complexed with SPs in vivo. Native peptides can be those associated with SPs in vivo or modifications thereof including those made by associating a peptide with a SP in vitro to form a complex which is antigenically similar to that found in vivo, particularly so as to be specifically reactive with the same antigen-binding fragment. Native peptides and modified peptides can be made by recombinant DNA techniques, peptide synthesis and other methods known in the art. In vitro complex association can be obtained with peptides either isolated from a mammalian source or obtained by recombinant means or synthetically prepared.

The invention also encompasses compositions comprising at least one SPPC, which is immunogenically cross-reactive with one or more cell surface-associated SPPCs specific to a target cancer. In particular the SPPC contains a non-covalently bound peptide, which confers the specific immunogenicity.

The invention also encompasses compositions comprising a plurality of SPPCs which are immunogenically cross-reactive with one or more cell surface-associated SPPCs specific to a target cancer. In particular the SPPCs contain different non-covalently bound peptides, which confer the specific immunogenicity.

Preferably, for the puφoses of tumor-specific treatment, SPPCs are "cancer-associated." The use of disease-associated SPPCs for treatment is also encompassed by the invention. The SPPCs of interest might not be found exclusively on cancer cells but might also be found on other cells. To the extent SPPCs are on normal cells not found associated with tumors, it is at a level of detection below that of the present invention. Therefore, as used herein, "not on normal cells" indicates that the SPPCs have not yet been detected on normal cells. However, normal cells could express SPPCs if diseased. In this sense, the term "tumor associated" complexes encompasses both rumor-specific and disease-associated. Accordingly, it is contemplated that a SPPC and/or an antigen binding fragment specifically reactive therewith, obtained according to the methods defined herein, can be useful therapeutically against other diseases, particularly, virally or otherwise infected cells or tissues. "Stress protein"("SP", "hsp") refers to any member of the various families of heat shock proteins. These families include, but are not limited to, hsp26, hsp40, hspόO, hsp70, hsp90, and hsp 100. Preferably, the hsps are hsp72, hsp85 and hsp96. Most preferably the hsp is from the HSP family.

Isolation of SPPCs, SPPC peptide and C-antigen

Exemplary methods for isolating SPPCs in general and C-antigen in particular follow. It is understood that the isolation methods can be modified by the addition or deletion of steps and changes in the steps within functional parameters. The isolation method is encompassed by the invention. C-antigen is best characterized by obtaining the antigen following such a procedure and, particularly, the procedures more specifically provided in the Examples.

The invention further encompasses compositions comprising the isolated, disassociated SPPC peptides of the invention and functionally equivalent fragments and derivatives thereof. In the case of C-antigen, the invention encompasses peptides containing at least 5-10 amino acid residues of the peptide sequence.

SPPC - specific antigen-binding fragments

This invention encompasses antigen-binding fragments that specifically recognize SPPCs in a tumor-or disease-associated manner. That is, in the case of tumors, the SPPC is predominantly found on tumor cells such that antigen binding fragments that recognize the complexes preferentially recognize or bind to cancer cells. The term "disease- associated" means associated with cancer as well as one or more other pathologic conditions that induce cell surface expression of SPPC.

The invention further encompasses an isolated antigen-binding fragment of an antibody which binds specifically to at least one SPPC which is immunogenically cross-reactive with one or more cell surface-associated SPPCs specific to a target cancer. In particular, at least one SPPC contains a non-covalently bound peptide.

The invention further encompasses a composition comprising an antigen binding fragment of an antibody which binds specifically to a plurality of SPPCs which is immunogenically cross-reactive with one or more cell surface-associated SPPCs specific to a target cancer. In particular, the SPPCs contain different non-covalently bound peptides, which confer the specific immunogenicity.

The term "antigen-binding fragment" includes any peptide that binds to the cancer- surface associated specific SPPCs in a specific manner. Typically, these fragments include such immunoglobulin fragments as Fab, F(ab')₂, Fab', scFv (both monomer and polymeric forms), single domain antibodies, whole or partially truncated antibodies, minimum recognition units and isolated V_H and V_L chains. An antigen-binding fragment retains specificity of the intact immunoglobulin, although avidity and/or affinity can be altered. First generation therapies are those based on such compounds and compositions. Especially preferred are the anti-C and anti-SPPC scFvs.

"HI 1" the exemplary anti-SPPC antibody is an antibody obtained from the fusion of peripheral blood lymphocytes of a 64 year old male with a low grade glioma and fused to a human myeloma cell line to produce a hybridoma designated NBGM1/H11. The generation and characterization of HI 1 is described in the Examples.

"E6" this anti-SPPC antibody is an antibody obtained from the PBL's of a cancer patient. The generation and characterization of E6 is described in copending U.S. application No. [not yet known], filed November 29, 1999, entitled "Antigen Binding Fragments Specific for Cancer Antigens".

"Anti-C" represents any antibody, or antigen-binding fragment thereof, either monoclonal, polyclonal or derivative thereof that recognizes specifically the C-antigen and distinguishes between cancer and stressed cell surfaces. Anti-C, as defined herein, does not include HI 1 and its non-SPPC specific derivatives.

Certain compounds, compositions and methods described in this application relate generally to anti-C and derivatives thereof which can be generated routinely by standard immunochemical techniques. This includes, but is not limited to, anti-C coupled to another compound by chemical conjugation, or associated with by mixing with an excipient or an adjuvant. Specific conjugation partners and methods of making them are described herein and well known in the art. More preferred are anti-C and anti-SPPC scFvs that are not coupled to a chemical agent.

Antigen-binding fragments (also encompassing "derivatives" thereof) are typically generated by genetic engineering, although they can be obtained alternatively by other methods and combinations of methods. This classification includes, but is not limited to, engineered peptide fragments and fusion peptides. Preferred compounds include polypeptide fragments containing the anti-stress protein-peptide CDRs, antibody fusion proteins containing cytokine effector components, antibody fusion proteins containing adjuvants or drugs, and, single-chain V region proteins. Antigen-binding fragments are considered to be of human origin if they are isolated from a human source, and used directly or cloned (either intact genes or portions thereof) and expressed in other cell types and derivatives thereof.

A "fusion polypeptide" is a polypeptide comprising contiguous peptide regions in a different position than would be found in nature. The regions can normally exist in separate proteins and are brought together in the fusion polypeptide; they can normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide; or they can be synthetically arranged. For instance, as described below, the invention encompasses recombinant proteins (and the polynucleotides encoding the proteins or complementary thereto) that are comprised of a functional portion of an antigen-binding fragment and a toxin. Methods of making these fusion proteins are known in the art and are described for instance in WO93/07286. A "functionally equivalent fragment" of a polypeptide varies from the native sequence by any combination of additions, deletions, or substitutions while preserving at least one functional property of the fragment relevant to the context in which it is being used.

The antigen-binding fragments provided herein are useful in palliating the clinical conditions related to a wide variety of cancers. The invention encompasses antigen- binding fragments (excluding HI 1) recognizing C-antigen. These are designated anti-C. The invention further comprises polypeptide derivatives of the antigen-binding fragments and methods for using these compositions in diagnosis, treatment, and manufacture of novel reagents.

The invention also encompasses antigen-binding fragments conjugated to a chemically functional moiety. As used herein, "chemically functional moiety" and derivatives thereof refer to a functional group capable of forming a covalent or non-covalent bond upon activation between two ligands held in a reactive position. Activation may include chemical or physical changes to the environment. Typically, the moiety is a label capable of producing a detectable signal. These conjugated antigen-binding fragments are useful, for example, in detection systems such as quantitation of tumor burden, and imaging of metastatic foci and tumor imaging. Such labels are known in the art and include, but are not limited to, radioisotopes, enzymes, fluorescent compounds, chemiluminescent compounds, bioluminescent compounds, substrate cofactors and inhibitors. For examples of patents teaching the use of such labels, see, for instance U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. The moieties can be covalently linked, recombinantly linked, or conjugated (covalently or non-covalently) through a secondary reagent, such as a second antibody, protein A, or a biotin-avidin complex.

Other functional moieties include signal peptides, agents that enhance immunologic reactivity, agents that facilitate coupling to a solid support, vaccine carriers, bioresponse modifiers, paramagnetic labels and drugs. Signal peptides are described above and include prokaryotic and eukaryotic forms. Agents that enhance immunologic reactivity include, but are not limited to, bacterial superantigens and adjuvants. Agents that facilitate coupling to a solid support include, but are not limited to, biotin, avidin or derivatives thereof. Immunogen carriers include, but are not limited to, any physiologically acceptable buffer. Bioresponse modifiers include, but are not limited to, cytokines, particularly tumor necrosis factor (TNF), IL-2, interleukin-4 (IL-4), GM-CSF; and certain interferons. See also, US Patent 5,750,1 19; and WO patent publications: 96/1041 1; 98/34641 ; 98/23735; 98/34642; 97/10000; 97/10001; and 97/06821.

A "signal peptide" or "leader sequence" is a short amino acid sequence that directs a newly synthesized protein through a cellular membrane, usually the endoplasmic reticulum in eukaryotic cells, and either the inner membrane or both inner and outer membranes of bacteria. Signal peptides are typically at the N-terminus of a polypeptide and are removed enzymatically between biosynthesis and secretion of the polypeptide from the cell. Thus, the signal peptide is not present in the secreted protein but is present only during protein production.

Suitable drug moieties include antineoplastic agents. These include, but are not limited to, radioisotopes, immunotoxins, vinca alkaloids such as the vinblastine, vincristine and vindesine sulfates, adriamycin, bleomycin sulfate, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, duanorubicin hydrochloride, doxorubicin hydrochloride, etoposide, fluorouracil, lomustine, mechloroethamine hydrochloride, melphalan, mercaptopurine, methotrexate, mitomycin, mitotane, pentostatin, pipobroman, procarbaze hydrochloride, streptozotocin, taxol and analogs thereof, thioguanine, and uracil mustard.

Immunotoxins, including single chain conjugates, can be produced by recombinant means. Production of various immunotoxins is well known in the art, and methods can be found, for example, in "Monoclonal Antibody-toxin Conjugates: Aiming the Magic Bullet," Thoφe et al. (1982) Monoclonal Antibodies in Clinical Medicine, Academic Press, pp. 168-190; Vitatta (1987) Science 238: 1098-1104; and Winter and Milstein (1991) Nature 349:293-299. Suitable toxins include, but are not limited to, ricin, radionuclides, pokeweed antiviral protein, Pseudomonas exotoxin A, diphtheria toxin, ricin A chain, fungal toxins such as fungal ribosome inactivating proteins such as gelonin, restrictocin and phospholipase enzymes. See, generally, "Chimeric Toxins," Olsnes and Pihl, Pharmac. Ther. 15:355-381 (1981); and "Monoclonal Antibodies for Cancer Detection and Therapy," eds. Baldwin and Byers, pp. 159-179, 224-266, Academic Press (1985).

The chemically functional moieties can be made recombinantly for instance by creating a fusion gene encoding the antigen-binding fragment and functional regions from other genes (e.g. enzymes). In the case of gene fusions, the two components are present within the same gene. Alternatively, antigen-binding fragments can be chemically bonded to the moiety by any of a variety of well known chemical procedures. For example, when the moiety is a protein, the linkage can be by way of hetero-bifunctional cross linkers, e.g., SPDP, carbodiimide glutaraldehyde, or the like. The moieties can be covalently linked, or conjugated, through a secondary reagent, including, but not limited to a second antibody, protein A, or a biotin-avidin complex. Paramagnetic moieties and the conjugation thereof to antibodies are well-known in the art. See, e.g., Miltenyi et al. (1990) Cytometry 1 1 :231-238.

Methods of antibody production and isolation are well known in the art. See, for example, Harlow and Lane (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. Generally antibody purification methods include, but are not limited to, salt precipitation (for example, with ammonium sulfate); ion exchange chromatography (for example, on a cationic or anionic exchange column run at neutral pH and eluted with step gradients of increasing ionic strength); gel filtration chromatography (including gel filtration HPLC); and chromatography on affinity resins such as protein A, protein G, hydroxyapatite, and anti-immunoglobulin. Antigen-binding fragments can also be purified on affinity columns comprising the C-antigen or an antigenic portion thereof. Preferably fragments are purified using Protein-A-CL- Sepharose™ 4B chromatography followed by chromatography on a DEAE-Sepharose™ 4B ion exchange column. The invention also encompasses hybrid antibodies, for instance in which one pair of H and L chains is obtained from a first antibody, while the other pair of H and L chains is obtained from a different second antibody. For puφoses of this invention, one pair of L and H chains is from anti-stress protein-peptide. In one example, each L-H chain pair binds different epitopes of the C-antigen. Such hybrids can also be formed using humanized H or L chains. The invention also encompasses other bispecific antibodies such as those containing two separate antibodies covalently linked through their constant regions.

Other antigen-binding fragments encompassed by this invention are antibodies in which the H or L chain has been modified to provide additional properties. For instance, a change in amino acid sequence can result in reduced immunogenicity of the resultant polypeptide. The changes range from changing one or more amino acids to the complete redesign of a region such as a C region domain. Typical changes include, but are not limited to, those related to complement fixation, interaction with membrane receptors, and other effector functions. A recombinant antibody can also be designed to aid the specific delivery of a substance (such as a cytokine) to a tumor cell. Also encompassed by the invention are peptides in which various immunoglobulin domains have been placed in an order other than that which occurs in nature.

The size of the antigen-binding fragments can be only the minimum size required to provide a desired function. It can optionally comprise additional amino acid sequence, either native to the antigen-binding fragment, or from a heterologous source, as desired. Anti-SPPCs can contain only 5 consecutive amino acids from an anti-stress protein- peptide V region sequence. Polypeptides comprising 7 amino acids, more preferably about 10 amino acids, more preferably about 15 amino acids, more preferably about 25 amino acids, more preferably about 50 amino acids, more preferably about 75 amino acids from the anti-stress protein-peptide L or H chain V region are also included. Even more preferred are polypeptides, comprising the entire anti-stress protein-peptide L or H chain V region. Substitutions can range from changing or modifying one or more amino acid residue to complete redesign of a region, such as the V region. Amino acid substitutions, if present, are preferably conservative substitutions that do not deleteriously affect folding or functional properties of the peptide. Groups of functionally related amino acids within which conservative substitutions can be made are glycine/alanine; valine/isoleucine/leucine; asparagine/glutamine; aspartic acid/glutamic acid; serine/threonine/methionine; lysine/arginine; and phenylalanine/tryosine/tryptophan. Antigen-binding fragments of this invention can be in glycosylated or unglycosylated form, can be modified post-translationally (e.g., acetylation, and phosphorylation) or can be modified synthetically (e.g., the attachment of a labeling group).

Polypeptide derivatives comprising both an L chain and an H chain can be formed as separate L and H chains and then assembled, or assembled in situ by an expression system for both chains. Such expression systems can be created by transfecting with a plasmid comprising separate transcribable regions for the L and H chain, or by co- transfecting the same cell with plasmids for each chain. In a third method, a suitable plasmid with an H chain encoding region is transfected into an H chain loss mutant.

H chain loss mutants can be obtained by treating anti-stress protein-peptide producing cells with fluorescein-labeled rabbit anti-mouse IgG (H chain specific, DAKO Coφoration, Caφinteria, CA) according to the supplier's instruction. The stained and unstained cell populations are analyzed by flow cytometry. Unstained cells are collected in a sterilized tube and placed in 96-well plates at 1 cell/well by limiting dilution. Culture supernatants are then assayed by ELISA using goat anti-mouse IgG (H chain specific) and goat anti-mouse kappa. Clones having a kappa-positive, IgG-negative phenotype are subcloned at least 3 times to obtain stable anti-stress protein-peptide^("H) mutants. mRNA from putative H chain loss mutants can be isolated and the sequence of the L chain V region cDNA determined. Reverse PCR of the mRNA for the V_H is performed with 2 sets of 5'- and 3'- primers, and used for cloning of anti-stress protein- peptide^{( H)} cDNA. An H chain loss mutant yields no detectable DNA band. Transfection of the cells proceeds with a suitable H chain plasmid.

Another antigen-binding fragment derivative encompassed by this invention is an antibody in which the constant region of the H or L chain has been modified to provide additional properties. For instance, a change in amino acid sequence can result in altered immunogenicity of the resultant polypeptide. The changes range from one or more amino acids to the complete redesign of constant region domain. Changes contemplated affect complement fixation, interaction with membrane receptors, and other effector functions. A recombinant antibody can also be designed to aid the specific delivery of a substance (such as a lymphokine) to an effector cell. Also encompassed by the invention are proteins in which various immunoglobulin domains have been placed in an order other than that which occurs in nature.

The invention further encompasses single domain antibodies of the invention.

The invention also encompasses single chain V region fragments ("scFv") of anti-stress protein-peptides. Single chain V region fragments are made by linking L and/or H chain V regions by using a short linking peptide. Bird et al. (1988) Science 242:423-426. Any peptide having sufficient flexibility and length can be used as a linker in a scFv. Usually the linker is selected to have little to no immunogenicity. An example of a linking peptide is (GGGGS)₃, which bridges approximately 3.5 nm between the carboxy terminus of one V region and the amino terminus of another V region. Other linker sequences can also be used, and can provide additional functions, such as a means for attaching to a drug or solid support. Preferably, for therapeutic use, the scFvs are not coupled to a chemically functional moiety.

All or any portion of the H or L chain can be used in any combination. Typically, the entire V regions are included in the scFv. For instance, the L chain V region can be linked to the H chain V region. Alternatively, a portion of the L chain V region can be linked to the H chain V region, or portion thereof. Also contemplated are scFvs in which the H chain V region is from HI 1, and the L chain V region is from another immunoglobulin. It is also possible to construct a biphasic, scFv in which one component is an antigen-binding fragment and another component is a different polypeptide, such as a T cell epitope.

The scFvs can be assembled in any order, for example, V_H — (linker) — V_L or V — (linker) — V_H. There can be a difference in the level of expression of these two configurations in particular expression systems, in which case one of these forms can be preferred. Tandem scFvs can also be made, such as (X) — (linker) — (X) — (linker) — (X), in which X are scFvs , or combinations thereof with other polypeptides. In another embodiment, single chain antibody polypeptides have no linker polypeptide, or just a short, inflexible linker. Possible configurations are V_L — V_H and V_H — N . The linkage is too short to permit interaction between N_L and V_H within the chain, and the chains form homodimers with a V_L/V_H antigen-binding site at each end. Such molecules are referred to in the art as "diabodies".

ScFvs can be produced either recombinantly or synthetically. For synthetic production of scFv, an automated synthesizer can be used. For recombinant production of scFv, a suitable plasmid-containing polynucleotide that encodes the scFv can be introduced into a suitable host cell, either eukaryotic, such as yeast, plant, insect or mammalian cells, or prokaryotic, such as Escherichia coli, and the expressed protein can be isolated using standard protein purification techniques. ScFv can also be obtained from a phage display library as described in more detail herein and in the Examples (see also Peptides: Frontiers of Peptide Science, Tarn, JP et al, 1998, Kluwer Ac Publns; Capillary Electrophoresis of Protein & Peptides, Pritchett, TJ et al, Methods in Molecular Biology Ser., Humana Publns, 1999; Peptides: Biology & Chemistry, Xu, X-J et al, Chinese Peptide Symposia Ser., Kluwer Ac Publns, 1998; Bioorganic Chemistry: Peptides & Proteins, Topics in Bioorganic & Biological Chemistry Ser., OUP Pulbns, 1998; Proteins: Analysis & Design, Angeletti, RH, Acad Press, 1998; Protein Protocols, Walker, JM, Humana Publns, 1998; Guidebook to Molecular Chaperones & Protein- Folding Catalysts, The Guidebook Ser., OUP, 1998; Protein Purification: Principles, High Resolution Methods, & Application, Janson, J-C et al, 2nd ed., Wiley Publns, 1998; Proteins: Physical & Chemical Properties of, Jai Press, 1998).

A particularly useful system for the production of scFvs is plasmid pET-22b(+) (Novagen, Madison, WI) in E. coli pET-22b(+) contains a nickel ion binding domain consisting of 6 sequential histidine residues, which allows the expressed protein to be purified on a suitable affinity resin. Another example of a suitable vector is pcDNA3 (Invitrogen, San Diego, CA), described above.

Conditions of gene expression should ensure that the scFv assumes optimal tertiary structure. Depending on the plasmid used (especially the activity of the promoter), and the host cell, it can be necessary to modulate the rate of production. For instance, use of a weaker promoter, or expression at lower temperatures, can be necessary to optimize production of properly folded scFv in prokaryotic systems; or, it can be preferably to express scFv in eukaryotic cells.

The invention further includes anti-idiotypic-antigen-binding fragments to anti- C-antigen-specific antibodies. Such anti-idiotypes can be made by any method known in the art. Specifically, the invention encompasses anti-Hl 1 anti-idiotype antigen binding fragments. Anti-idiotypes are particularly suitable for use as vaccines.

Lindemann ((1973) Ann. Immunol. 124:171-184) and Jerne ((1974) Ann. Immunol. 125:373-389) describe how to transform epitope structures into idiotypic determinants expressed on the surface of antibodies. Immunization with a given cancer-associated antigen will generate production of antibodies against this cancer-associated antigen, termed Abl ; this Abl is then used to generate a series of anti-idiotype antibodies against the Abl, termed Ab2. Some of these Ab2 molecules can effectively mimic the three- dimensional structure of the cancer-associated antigen identified by the Abl . These particular anti-idiotypes called Ab2θ fit into the paratopes of Abl, and express the internal image of the cancer-associated antigen. The Ab2θ can induce specific immune responses similar to those induced by the original cancer-associated antigen and can, therefore, be used as surrogate cancer-associated antigens. Immunization with Ab2θ can lead to the generation of anti-anti-idiotype antibodies (Ab3) that recognize the corresponding original cancer-associated antigen identified by Abl. Because of this Abl -like reactivity, the Ab3 is also called Abl' to indicate that it might differ in its other idiotopes from Ab 1.

A potentially promising approach to cancer treatment is immunotherapy employing anti- idiotype antibodies. In this form of therapy, an antibody mimicking an epitope of a cancer-associated protein is administered in an effort to stimulate the patient's immune system against the tumor, via the cancer-associated protein. WO 91/11465 describes methods of stimulating an immune response in a human against malignant cells or an infectious agent using primate anti-idiotype antibodies.

Anti-Id monoclonal antibodies structurally resembling cancer-associated antigens have been used as antigen substitutes in cancer patients (Herlyn et al. (1987) Proc. Natl. Acad. Sci. USA 84:8055-8059; Mittleman et al. (1992) Proc. Natl. Acad. Sci. USA 89:466-470; Chatterjee et al. (1993) Ann. N.Y. Acad. Sci. 690:376-278). It has been proposed that the anti-Id provides a partial analog of the cancer-associated antigen in an immunogenic context.

Cancer patients are often immunosuppressed and tolerant to some tumor associated antigens (TAA). Triggering an active immune response to such TAA represents an important challenge in cancer therapy. Immunization with a given antigen generates the production of antibodies against the antigen. The present invention encompasses anti- rumor monoclonal antibodies; anti-idiotypic monoclonal antibodies; and anti-anti- idiotypic monoclonal antibodies or fragments thereof. See also PCT/US95/17103.

While vaccines are generally designed for asymptomatic individuals, vaccines can also be used to treat those with advanced cases of disease. For example, a vaccine therapy of 16 patients with advanced epithelial ovarian cancer or recurrences involved ACA125. ACA125 is an immunoglobulin Gl (IgGl) murine monoclonal anti-idiotype antibody that mimics a specific epitope on CA125, an antigen that is expressed by most malignant ovarian tumors. Nine of 16 patients developed a CA125-specific cellular immune response by their peripheral blood lymphocytes (PBL). Wagner et al. (1997) Hybridoma 16:33-40. For work related to the use of anti-idiotype antibodies in cancer vaccines, see Durrant et al. (1997) Hybridoma 16: 23-6.

Any carrier can be used which is not harmful to the host. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins; polysaccharides (such as latex functionalized Sepharose, agarose, cellulose, cellulose beads and the like); polymeric amino acids (such as polyglutamic acid, polylysine, and the like); amino acid copolymers; and inactive virus particles or attenuated bacteria, such as Salmonella. Especially useful carrier proteins are serum albumins, keyhole limpet hemacyanin (KLH), certain Ig molecules, thyroglobulin, ovalbumin, and tetanus toxoid.

Methods of Obtaining anti-SPPCs

The invention encompasses methods of obtaining anti-SPPCs. Anti-SPPCs can be obtained and isolated in a number of ways.

Methods of generating new antigen-binding fragments to C-antigen or other such cancer- associated SPPCs, as detailed below, include: 1) employing phage display techniques (see, generally, Hoogenboom et al. (1998) Immunotechnology 4:1-20) by which cDNA encoding antibody repertoires are preferably amplified from lymphocyte or spleen RNA using PCR and oligonucleotide primers specific for species-specific V regions; 2) immunizing mammals with the antigen and generating polyclonal or monoclonal antibodies (Mabs); 3) generating hybridomas from cancer patients including humamhuman hybridomas; and 4) employing phage display to make antibodies without prior immunization by displaying on phage, very large and diverse V gene repertoires.

With respect to the first of these techniques, the method of Medez et al. (1997) Nature Genetics 18:410 can be used. Briefly, purified SPPC (such as C-antigen), is used to immunize transgenic mice lacking the native murine antibody repertoire and instead having most of the human antibody V-genes in the germ line configuration. Human antibodies are subsequently produced by the murine B cells. The antibody genes are recovered from the B cells by PCR library selection or classic hybridoma technology.

Alternatively, by using the second of these techniques, antibodies can be obtained from mice (such as BALB/c) after injection with purified stress protein-peptide. Mabs are generated using standard hybridoma technology. See for instance, Maiti et al. (1997) Biotechnology International 1:85-93 (human hybridomas); and Kohler and Milstein (1975) Nature 256:495 - 497 (mouse hybridomas). Murine antibodies can be subsequently humanized for instance by the method of Rosok et al. (1996) J. Biol. Chem. 271:2261 1-22618; Baca et al. (1997) J. Biol. Chem. 272:10678-10684; Rader et al. Proc. Natl. Acad. Sci. USA 95:8910-8915; and Winter and Milstein (1991) Nature 349:293- 299.

According to the third technique, a phage display approach can be used to rapidly generate human antibody against C-antigen or other SPPCs. This approach can employ the method outlined by Henderikx et al. (1998) Cancer Res. 58:4324-32. Antibody fragments displayed on phage are selected from a large naive phage antibody/fragment library containing different single chain antibodies by separating those which bind to immobilized antigen. As regards the antigen, preferably the entire SPPC is used. Human antibody fragments are selected from naive repertoires constructed either from germline V-domains or synthesized with many mutations (mutations are targeted either by homologous gene re-assortments or error prone PCR) in both the framework and CDR regions.

Antigen-binding fragments specifically reactive with SPPCs can be screened against tumor and normal tissues as described herein in order to identify tumor-specific antigen-binding fragments. One can screen for cancer cell surface associated binding activity, selecting candidate binding fragments on the basis of their ability to bind to SPPCs derived from one or more target tumors in the absence of a stress peptide releasing agent but not in the presence of such agent. Examples of suitable stress peptide releasing agents include, depending on the type of HSP: ATP, mild acid and denaturing agents.

The invention also encompasses methods of identifying antigen-binding fragments specific for a cancer-associated SPPCs by generating a suitable phage display library; isolating SPPCs from a tumor or recombinant host; screening the phage display library with the complexes according to standard immunochemical techniques to obtain phage that display an antigen-binding fragment that binds specifically to SPPC; and screening the phage obtained for specific cell surface cancer-associated reactivity, by screening against tumor and normal cells and selecting the phage that bind preferentially to tumor but not normal cells. Methods of generating antigen-binding fragments by phage display are well known in the art. See, Hoogenboom et al. (1998) Immunotechnology 4: 1-20.

The complexes used for panning may be derived from a single tumor or may be a pooled mixture of SPPCs from a plurality of tumors.

Lymphocyte (PBL) or spleen RNA is typically used to make antibody fragment repertoires. Mutagenesis using homologous reassortment or error prone PCR increases the diversity.

Phage display libraries created from human lymphocytes of cancer patients are expected to be enriched in antibodies specific for cancer-associated SPPCs. Also, antibody phage display libraries have been prepared from B-cells of patients undergoing active specific immunotherapy (ASI) with autologous tumor cells. Hall et al. (1998) Immunotechnology 4: 127-140.

Repertoires of antibody genes can be amplified from immunized mice or humans using PCR and scFv, sdAbs, minimum recognition units or Fab antibody fragments obtained thereby can be cloned and expressed on the surface of bacteriophage. The antibody gene repertoires are amplified from lymphocyte or spleen RNA using PCR and oligonucleotide primers specific for host animal-specific V regions. Phage display can also be used to make antibodies without prior immunization by displaying very large and diverse V gene repertoires on phage. The natural V gene repertoires present in PBL (peripheral blood lymphocytes) are isolated by PCR amplification and the VH and VL regions are spliced together at random using PCR. Mutations can be targeted to the V-domain genes by homologous gene reassortments (Zhao et al. Nat. Biotechnol. (1998) 15:258) or error- prone PCR. Hoogenboom et al. Immunotechnology (1998) 4: 1-20. Totally synthetic human libraries can also be created and used to screen for SPPC-specific antibody fragments. Regardless of the method used to operate the phage display library, each resulting phage has a functional antibody fragment displayed on its surface and contains the gene encoding the antibody fragment in the phage genome. See, e.g. WO97/02342.

Affinity chromatography in which binding antibodies can be subtracted from non-binding antibodies has been established for some time. Nissim et al. (1994) EMBO J. 13:692- 698; and Vaughan et al. (1996) Nat. Biotechnol. 14:309-314. Critical parameters affecting success are the number and affinity of antibody fragments generated against a particular antigen. Until recently, the production of large, diverse libraries remained somewhat difficult. Historically, scFv repertoires have been assembled directly from VH and VL RT-PCR products. RΝA availability and the efficiency of RT-PCR were limiting factors of the number of V genes available. Also, assembly was based on ligating three fragments, namely VH and VL and the linker regions. Marks et al. (1991) J. Mol. Biol. 222:581-597.

An improved library construction method (Sheets et al. (1998) Proc. Natl. Acad. Sci. USA 95:6175-6162) uses cloned NH and VL gene repertoires in separate plasmid vectors to provide a stable and limitless supply of material for scFv assembly. Also, the efficiency is increased by having DΝA encoding the linker region at the 5' end of the VL library. Therefore there are only two fragments to be ligated instead of three.

The improved strategies (Sheets et al.) for generating phage antibody libraries have been demonstrated to efficiently and rapidly produce high affinity antibodies to a wide variety of protein antigens. Thus, a large library (> 6.0 x 10⁹) of phage displayed antibody fragments (e.g. scFv), panned against SPPCs can result in the selection of a panel of high affinity antibodies. See the Examples for a method overview.

Anti-SPPCs can also be derived or manipulated using genetic recombination. For example, the immunogenic activity of the V regions of the L and H chains can be screened by preparing a series of short polypeptides that together span the entire V region amino acid sequence. Using a series of polypeptides of 20 or 50 amino acids in length, each V region can be surveyed for useful functional properties. It is also possible to carry out a computer analysis of a protein sequence to identify potentially interesting polypeptides. Such peptides can then be synthesized and tested for immunogenic activity.

The invention further encompasses various adaptations of antigen-binding fragments described in this section combined in various fashions to yield other anti-stress protein- peptides with desirable properties. For example, an anti-SPPC scFv is fused to a cytokine, such as IL-2. All such combinations are contemplated in this invention.

The antigen-binding fragments of this invention can be made by any suitable procedure, including proteolysis of the antibody, by recombinant methods or by chemical syntheses. These methods are known in the art and need not be described in detail herein. Examples of proteolytic enzymes include, but are not limited to, trypsin, chymotrypsin, pepsin, papain, V8 protease, subtilisin, plasmin, and thrombin. Intact anti-SPPCs can be incubated with one or more proteinases simultaneously or sequentially. Alternatively, or in addition, intact antibody can be treated with disulfide reducing agents. Peptides can then be separated from each other by techniques known in the art, including but not limited, to gel filtration chromatography, gel electrophoresis, and reverse-phase HPLC.

Anti-SPPCs can also be made by expression from a polynucleotide encoding the protein, in a suitable expression system by any method known in the art. Typically, polynucleotides encoding a suitable polypeptide are ligated into an expression vector under control of a suitable promoter and used to genetically alter the intended host cell. Both eukaryotic and prokaryotic host systems can be used. The polypeptide is then isolated from lysed cells or from the culture medium and purified to the extent needed for its intended use. Examples of prokaryotic host cells appropriate for use with this invention include E. coli. Examples of eukaryotic host cells include avian, insect, plant, and animal cells such as COS7, HeLa, and CHO cells.

Optionally, matrix-coated channels or beads and cell co-cultures can be included to enhance growth of antibody-producing cells. For the production of large amounts of antibody, it is generally more convenient to obtain ascitic fluid. The method of raising ascites generally comprises injecting hybridoma cells into an immunologically naϊve, histocompatible or immunotolerant mammal, especially a mouse. The mammal can be primed for ascites production by prior administration of a suitable composition; e.g., Pristane. The ascitic fluid is then removed from the animal and processed to isolate the antibodies.

Alternatively, antigen-binding fragments can be chemically synthesized using amino acid sequence data and other information provided in this disclosure, in conjunction with standard methods of protein synthesis. A suitable method is the solid-phase Merrifield technique. Automated peptide synthesizers are commercially available, such as those manufactured by Applied Biosystems, Inc. (Foster City, CA).

Individual SPPCs that are derived from a particular cancer and that are recognized by HI 1 may be injected into a mouse to raise polyclonal or monoclonal antibodies and thereby obtain more specific SPPC for that individual antigen. HI 1 can be adapted to bind more specifically to an HI 1 antigen from a given tumor by using the techniques described herein for improving the affignity of the antibodies. The affinity of HI 1 as a multi-carcinomic or multi-SPPC antibody can also be improved by using a high affignity anti-idiotype to HI 1 prepared according to techniques known in the art.

Another method of obtaining anti-SPPCs is to immunize suitable host animals with tumor- or disease-associated SPPCs and to follow standard procedures for polyclonal or Mab production and isolation. Mabs thus produced can be "humanized" by methods known in the art. The invention thus encompasses humanized Mabs.

"Humanized" antibodies are antibodies in which at least part of the sequence has been altered from its initial form to render it more like human immunoglobulins. In one version, the H chain and L chain C regions are replaced with human sequence. This is a fusion polypeptide comprising an anti-SPPC V region and a heterologous immunoglobulin (C) region. In another version, the CDR regions comprise anti-SPPC amino acid sequences, while the V framework regions have also been converted human sequences. See, for example, EP 0329400. In a third version, V regions are humanized by designing consensus sequences of human and mouse V regions, and converting residues outside the CDRs that are different between the consensus sequences.

In making humanized antibodies, the choice of framework residues can be critical in retaining high binding affinity. In principle, a framework sequence from any human antibody can serve as the template for CDR grafting; however, it has been demonstrated that straight CDR replacement into such a framework can lead to significant loss of binding affinity to the antigen. Glaser et al. (1992) J. Immunol. 149:2606; Tempest et al. (1992) Biotechnology 9:266; and Shalaby et al. (1992) J Exp. Med. 17:217. The more homologous a human antibody is to the original murine antibody, the less likely that the human framework will introduce distortions into the murine CDRs that could reduce affinity. Based on a sequence homology search against an antibody sequence database, the human antibody IC4 provides good framework homology to muM4TS.22, although other highly homologous human antibodies would be suitable as well, especially kappa L chains from human subgroup I or H chains from human subgroup III. Kabat et al.

(1987). Various computer programs such as ENCAD (Levitt et al. (1983) J. Mol. Biol. 168:595) are available to predict the ideal sequence for the V region. The invention thus encompasses human antibodies with different V regions. It is within the skill of one in the art to determine suitable V region sequences and to optimize these sequences. Methods for obtaining antibodies with reduced immunogenicity are also described in U.S. Patent No. 5,270,202 and EP 699,755. In certain applications, such as when an antigen binding-fragment is expressed in a suitable storage medium such as a plant seed, the antigen binding-fragment can be stored without purification. Fiedler et al. (1995) Biotechnology 13:1090-1093. For most applications, it is generally preferable that the polypeptide is at least partially purified from other cellular constituents. Preferably, the antigen-binding fragment is at least about 50% pure as a weight percent of total protein. More preferably, the antigen- binding fragment is at least about 50-75% pure. For clinical use, the antigen-binding fragment is preferably at least about 80% pure.

If the compositions of the present invention are to be administered to an individual, the antigen-binding fragment is preferably at least 80% pure, more preferably it is at least 90%) pure, even more preferably it is at least 95% pure and free of pyrogens and other contaminants. In this context, the percent purity is calculated as a weight percent of the total protein content of the preparation, and does not include constituents which are deliberately added to the composition after the antigen-binding fragment is purified.

The invention also encompasses methods of detecting cancer or disease-associated SPPCs in a biological sample. The methods include obtaining a biological sample, contacting the sample with an anti-SPPC under conditions that allow antibody-antigen- binding and detecting binding, if any, of the antibody to the sample as compared to a control, non-cancerous or non-diseased biological sample.

The invention also encompasses methods of detecting anti-SPPCs in a biological sample. These methods are applicable in a clinical setting, for example, for monitoring antibody levels in an individual, as well as an industrial setting, as in commercial production of anti-SPPCs.

After a biological sample is suitably prepared, for instance by enriching for anti-SPPC, it is mixed with excess SPPC under conditions that permit formation of a complex between SPPC and any target antibody that can be present. The amount of complex is then determined, and compared with complexes formed with standard samples containing known amounts of target antibody in the range expected. Complex formation can be observed by immunoprecipitation or nephelometry, but it is generally more sensitive to employ a reagent labeled with such labels as radioisotopes like ¹²⁵I, enzymes like - peroxidase and β-galactosidase, or fluorochromes like fluorescein.

Anti-SPPC can be characterized by any method known in the art. For instance, by the ability to bind specifically to tumors, cancer cell lines, C-antigen or a tumor- or disease- associated SPPC. An antigen-binding fragment can also be tested for the ability to specifically inhibit the binding between antigen and intact antibody either competitively or non-competitively. Anti-SPPCs can also be tested for their ability to palliate or ameliorate neoplastic disease, such as carcinomas. It is understood that only one of these properties need be present in order for a polypeptide to come within the scope of this invention, although preferably more than one of these properties is present.

The ability of an anti-SPPC to bind antigen can be tested by any immunoassay known in the art. Any form of direct binding assay is suitable. In one such assay, one of the binding partners, the antigen or the putative anti-SPPC, is labeled. Suitable labels include, but are not limited to, radioisotopes such as I, enzymes such as peroxidase, fluorescent labels such as fluorescein, and chemiluminescent labels. Typically, the other binding partner is insolubilized (for example, by coating onto a solid phase such as a microtiter plate) to facilitate removal of unbound soluble binding partner. After combining the labeled binding partner with the unlabeled binding partner, the solid phase is washed and the amount of bound label is determined. Another such assay is a sandwich assay, in which the putative anti-SPPC is captured by a first anti- immunoglobulin on a solid phase, the SPPC is added and any resultant captured complex is labeled and with an antibody that binds to SPPC. The anti-immunoglobulin can be specific, for instance, an antibody constant region such as by mouse anti-human IgG.

When used for immunotherapy, anti-SPPCs can be unlabeled or labeled with a therapeutic agent as described herein and as known in the art. These agents can be coupled either directly or indirectly to the antigen-binding fragments of the invention. One example of indirect coupling is by use of a spacer moiety. These spacer moieties, in turn, can be either insoluble or soluble (Diener et al. ( 1986) Science 231 :148) and can be selected to enable drug release at the target site. Examples of therapeutic agents that can be coupled to antigen-binding fragments for immunotherapy include, but are not limited to bioresponse modifiers, drugs, radioisotopes, lectins, and toxins. Bioresponse modifiers include lymphokines which include, but are not limited to, TNF-a, IL-1, -2, and 3, lymphotoxin, macrophage activating factor, migration inhibition factor, colony stimulating factor, and IFNs. Interferons with which antigen-binding fragments can be labeled include IFN-a, IFN-b, and IFN-g and their subtypes.

In using radioisotopically conjugated antigen-binding fragments for immunotherapy, certain isotypes can be more preferable than others depending on such factors as isotope stability and emission. If desired, the malignant cell distribution can be evaluated by the in vivo diagnostic techniques described below. Depending on the malignancy, some emitters are preferable. In general, alpha and beta particle-emitting radioisotopes are preferred in immunotherapy. For example, if a subject has a solid tumor, as in a carcinoma, a high energy beta emitter capable of penetrating several millimeters of tissue, such as ⁹⁰Y, can be preferable. On the other hand, if the malignancy consists of simple target cells, as in the case of leukemia, a short range, high energy alpha emitter, such as ²¹²Bi, can be preferable. Examples of radioisotopes which can be bound to the antigen- binding fragments of the invention for therapeutic puφoses include, but are not limited to, ¹²⁵I, ^{13 ,}I, ⁹⁰Y, ⁶⁷Cu, ^2,2Bi, ^{2 , ,}At, ²¹²Pb, ⁴⁷Sc, ¹⁰⁹Pd, and ¹⁸⁸Re.

Lectins are proteins, usually isolated from plant material, which bind to specific sugar moieties. Many lectins are also able to agglutinate cells and stimulate lymphocytes. However, ricin is a toxic lectin which has been used immunotherapeutically. This is preferably accomplished by binding the alpha-peptide chain of ricin, which is responsible for toxicity, to the antibody molecule to enable site specific delivery of the toxic effect.

Toxins are poisonous substances produced by plants, animals, or microorganisms that, in sufficient dose, are often lethal. Diphtheria toxin is a substance produced by Corynebacterium diphtheria which can be used therapeutically. This toxin consists of an alpha and beta subunit which under proper conditions can be separated. The toxic A chain component can be bound to an-anti-SPPC and used for site specific delivery to a neoplastic cell.

Thus, for example, anti-stress protein-peptide can be used in combination with IFN-a. This treatment modality enhances Mab targeting of melanomas by increasing the expression of Mab reactive antigen by the melanoma cells. Greiner et al. (1987) Science 235:895. Alternatively, anti-SPPC can be used, for example, in combination with IFN-g to thereby activate and increase the expression of Fc receptors by effector cells which, in turn, results in an enhanced binding of the antigen-binding fragments to the effector cell and killing of target malignant cells. Those of skill in the art will be able to select from the various biological response modifiers to create a desired effector function that enhances the efficacy of anti-SPPC

Hll Variants Which Bind to SPPCs

The invention is also directed to HI 1 variants which bind to SPPCs. These may be generated using techniques known in the art or using techniques described herein.

Included are variants prepared employing specific strategies and techniques disclosed in the literature for affinity maturation, systematic variation of hypervariable regions, etc., including variants those prepared using any of the following strategies or methods and combinations thereof:

1. Techniques of codon based mutagenesis as disclosed in Glaser et. al. (December 15, 1992), Journal of Immunology, Vol. 149, No. 12, pp 3903-3913 and subsequent publications referencing Glaser et. al (1992).

2. Stepwise in vitro affinity maturation See Wu H. et al. (May 1998) Proc. Natl. Acad. Sci. USA, Vol. 95 pp. 6037-6042

3. Techniques based on substitutions of amino acids that are preferred for intermolecular interaction (see for example Kirkham, P.M. et al., J. Mol. Biol. (1999) Vol. 285 pp. 909-

915 and literature referenced therein) 4. Antibody engineering including affinity maturation by parsimonious mutagenesis Balint

R.F. et al. Gene 137 (1993) p. 109-118 5. CDR walking mutagenesis Yang, W. et al. J. Mol. Biol. (1995) 392-403

6. CDR implantation Soderlind E. et al. Immunotechnology 4 (1999) 279-285

Reference is also made to the techniques disclosed and referenced in Hoogenboom H. et al.

Antibody phage display technology and its applications. Immunotechnology. 1998 Jun;4(l):l-20.; Hoogenboom H. Designing and optimizing library selection strategies for generating high-affinity antibodies. Trends Biotechnol. 1997 Feb;15(2):62-70. Barbas et al.

TIBTECH July 1996, Vol 14, No. 7 pp. 230-234; Winter G. et al. (1994) Annu. Rev.

Immunol. 12 433-455; Burton D.R. et al. 1994 Adv. Immunol. 57 191-280 and

WO9920749.

Several of these techniques may be employed, some simultaneously, others individually, both for the creation of individual variants with enhanced properties and for the creation of libraries of variants to be used in various competition assays with HI 1. Individual variants

(eg. higher affinity variants) may be used as parental binding molecules for the creation of libraries and several libraries of variants can be pooled to optimize the size and relevance of the population of variants (eg. for competitive binding with HI 1).

The invention is also directed to variants having higher affinity for C-antigen and more particularly to such variants when prepared by any of the preceding methods. It is also contemplated that methods and strategies known in the art including some of the foregoing methods may be used to generate variants with fewer cross-reactivities insofar as such cross-reactivities, if any, might be recognized to be counter-productive.

Phage Display Libraries

The invention contemplates populations of genetic packages having a genetically determined outer surface protein including genetic packages collectively display a plurality of potential binding fragments in association with the outer surface protein, such as phage display libraries. Each package in the library includes a nucleic acid construct coding for a fusion protein which includes at least a portion of the outer surface protein and a variant of at least one parental binding-fragment. Preferably the vaoable region is only partly randomized in that it is biased in favor of encoding the amino acid constitution of the parental binding-fragment such that the plurality of different potential binding domains are adapted to express characteristics of the parent.

Furthermore, a method for biasing a library in favor of obtaining selected percentages of wild type amino acid residues is achieved by creating residue substitutions by using different spiking levels of the various dNTPs as described below. When creating a phage library, the randomization of amino acids is often achieved by DNA synthesis. A primer is annealed next to DNA encoding for the variable region, and nucleotides are randomly added to synthesize randomized variable regions. Normally, at the step of synthesizing the DNA used to produce the variable region of the phage library, one uses a nucleotide ratio of 1: 1 :1: 1, which generates a totally random variable region. By the present method, during synthesis of the variable region, the likelihood of preserving a particular tumor specificity or other desirable traits found in the wild type may be enhanced as follows. At each step of adding a nucleotide to the DNA variable region, one selects a dNTP ratio which is biased in favor of producing amino acids which reflect the DNA of the parental (wild type) species.

"Biasing", "biased in favor of and related forms of these terms are generally intended to refer to weighting in the course of introducing variation in the parental binding- fragment.

"Homologous" or "homology" as used herein refers to "identity" or "similarity" as used in the art, meaning relationships between two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Both identity and similarity can be readily calculated (Lesk, A. M., ed., Computational Molecular Biology, Oxford University Press, New York, 1988; Smith, D. W., ed., Biocomputing: Informatics and Genome Projects, Academic Press, New York, 1993; Griffin, A. M., and Griffin, H. G., eds., Computer Analysis of Sequence Data, Part I, Humana Press, New Jersey, 1994; von Heinje, G., Sequence Analysis in Molecular Biology, Academic Press, 1987; and Gribskov, M. and Devereux, J., eds., Sequence Analysis Primer, M Stockton Press, New York, 1991). While there exist a number of methods to measure identity and similarity between two polynucleotide sequences, both terms are well known to skilled artisans (von Heinje, G., 1987;Gribskov, M. and Devereux, J., 1991; and Carillo, H., and Lipman, D., 1988). Methods commonly employed to determine identity or similarity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D. (1988, SIAMJ.

Applied Math., 48: 1073). Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCG program package (Devereux, J., et al.(1984), Nucleic Acids Research 12(1): 387), BLASTP, BLASTN, and FASTA (Atschul, S. F. et al.(1990), J. Molec. Biol. 215: 403). "Percent homology" or "% homologous" or related terms include both of the following inteφretations / methods of calculation: 1) an approximate percentage of the sequence referenced in terms of the number of common residues (e.g. 80% of 11 is understood to be an approximation insofar as application of the percentage does not yield a unit number of residues, in which case both the immediately higher number and immediately lower unit numbers, 9 and 8 respectively, are deemed to be covered); 2) the percentage of binding fragments theoretically achievable that have the full wild-type sequence, which is calculated as a product of the probabilities that the wild-type amino acid will occur at a given amino acid position.

"Conserved" regions refer to those which are commonly found in at least other antibodies of the same type or in at least the same species of mammal.

"Wild-type" refers to the parental binding-fragment.

"Step-wise" refers to the addition of, for example, nucleic acids, in a manner such that the quantity of nucleic acids added at each step is rigorously control, usually one nucleic acid at a time.

"Percent biasing" or "% of binding fragments" (or "biasing 10-100%", etc.) refers to biasing on an individual amino acid basis (though other techniques to accomplish the same effect might apparent to those skilled in the art). Similarly, the specification that wild-type amino acids occur at a specified position or series of positions in, for example, at least approximately 50% of potential binding fragments is intended to mean both that 50% biasing is sought at a given such position or that a total of 50% of the correct nucleotide triplets are represented.

"Approximately" in reference to percentages is intended to accommodate attrition of various desired potential binding fragments, the assumption that the probabilistic outcomes will be achieved in practice and that certain variation in methods to accomplish the specified results is deemed to be suitable. The term 50% or approximately 50% in reference to an uneven number of amino acids residues means that either one more or one less than half of the amino acids is referred to.

Suitable parental binding-fragments include any known in the art and include the group consisting of an scFv, Fab, V_H, Fd, Fabc, F(ab')₂, F(ab)₂.

Nucleotide sequences can be isolated, amplified, and processed by standard recombinant techniques. Standard technique in the art include digestion with restriction nucleases, and amplification by polymerase chain reaction (PCR), or a suitable combination thereof. PCR technology is described in U.S. Patent Nos. 4,683,195; 4,800,159; 4,754,065; and 4,683,202, as well as PCR: The Polymerase Chain Reaction, Mullis et al., eds., Birkauswer

Press, Boston (1994).

In addition to the specific PCR methods of biasing to wild-type amino acid residues detailed below, it is possible to produce multiple different oligonucleotide primers consisting of specified amino acid residues (one or more) of the wild-type molecule, mixing these in appropriate concentrations with a completely randomized oligonucleotide primer and subjecting the mixture of oligonucleotide primers to PCR. This will result in a biased phage library population of one's choosing (i.e. the amounts of the selectively randomized and totally randomized primers in the mixture will determine the per cent of each binding region representation in the library).

Polynucleotides comprising a desired sequence can be inserted into a suitable vector, and the vector in turn can be introduced into a suitable host cell for replication and amplification. Polynucleotides can be introduced into host cells by any means known in the art. Cells are transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis, transfection, f-mating or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or integrated into the host cell by standard methods. See, e.g., Sambrook et al. (1989). RNA can also be obtained from transformed host cell, or it can be obtained directly from the DNA by using a DNA-dependent RNA polymerase.

Suitable cloning and expression vectors include any known in the art, e.g., those for use in bacterial, mammalian, yeast and insect expression systems. Specific vectors and suitable host cells are known in the art and are not described in detail herein. See e.g. Gacesa and Ramji, Vectors, John Wiley & Sons (1994).

Phage display techniques are generally described or referenced in some of the preceding general references, as well as in U.S. Patent Nos. 4,593,002; 5,403,484; 5,837,500; 5,571,698; 5,750,373; 5,821,047; 5,223,409 and 5,702,892. "Phage Display of Peptides and Proteins", (Kay, Brian K. et al., 1996); "Methods in Enzymology", Vol. 267 (Abelson, John N., 1996); "Immunology Methods Manual", (Lefkovits, Ivan, 1997); "Antibody phage display technology and its applications", (Hoogenboom, Hennie R. et al., 1998). Immunotechnology 4 p.1-20; Cesareni G et al. Phage displayed peptide libraries. Comb Chem High Throughput Screen. 1999 Feb;2(l):l-17; Yip, YL et al. Epitope discovery using monoclonal antibodies and phage peptide libraries. Comb Chem High Throughput Screen. 1999 Jun;2(3):125-38; Rodi DJ et al. Phage-display technology— finding a needle in a vast molecular haystack. Curr Opin Biotechnol. 1999 Feb;10(l):87-93. Generally, DNA encoding millions of variants of a parental binding-fragment can be batch- cloned into the phage genome as a fusion to the gene encoding one of the phage coat proteins (pill, pVI or pVIII). Upon expression, the coat protein fusion will be incoφorated into new phage particles that are assembled in the bacterium. Expression of the fusion product and its subsequent incoφoration into the mature phage coat results in the ligand being presented on the phage surface, while its genetic material resides within the phage particle. This connection between ligand genotype and phenotype allows the enrichment of specific phage, e.g. using selection on immobilized target. Phage that display a relevant ligand will be retained, while non-adherent phage will be washed away. Bound phage can be recovered from the surface, reinfected into bacteria and re-grown for further enrichment, and eventually for analysis of binding. The success of ligand phage display hinges on the combination of this display and enrichment method, with the synthesis of large combinatorial repertoires on phage.

Obtaining individual SPPCs from different tumors using anti-SPPCs allows one to use such SPPCs to obtain more specific antibodies for those specific SPPCs, which antibodies can then be tested for tumor surface reactivity.

Anti-SPPC Libraries

As described above, the invention also relates to a population of genetic packages having a genetically determined outer surface protein including genetic packages which collectively display a plurality of different potential immunoglobulin binding-fragments in association with said outer surface protein, each package including a nucleic acid construct coding for a fusion protein which is at least a portion of said outer surface protein and a variant of at least one parental anti-SPPC immunoglobulin binding- fragment, wherein at least part of said construct preferably including at least a part of the CDR3 region of the heavy chain, which is randomized to create variation among said potential binding-fragments, is biased in favor of encoding the amino acid constitution of said parental anti-SPPC immunoglobulin binding fragment. The relationship 20^x < library size; where X represents the number of amino acids randomized, describes the number of amino acids that can be randomized without exceeding the practically obtainable library size. Many useful libraries are not quite as large as 10⁹ or 10¹⁰ phage (the average practically obtainable limits). Therefore, the maximum number of amino acids that could be fully randomized without exceeding these attainable sizes are 7 and 8 amino acids, respectively (20⁷ = 1.3X10⁹ & 20⁸ = 2.6X10¹⁰ ).

Accordingly, in order to obtain a strong probability of obtaining amino acid sequences very closely related to the parental amino acid constitution so that the library contains an enhanced representation of anti-SPPCs (one indicator of which is that the exact amino acid constitution of the parent will theoretically be represented at least 1 to 10 times) the number of fully randomized amino acids varied cannot exceed approximately 6 to 8. Where the number of amino acids sought to be randomized exceeds this number it is desirable to bias the library in favor of the parental amino acid constitution.

At the other extreme, where the number of amino acids sought to be varied far exceeds this number, for example, 25 amino acids, as may be the case where the CDRl and CDR3 of the light and heavy chains are sought to be varied, the theoretical library size far exceeds the actual size. Though relationship to the parental amino acid constitution may be partially preserved through biasing, some of the desired diversity of the library is lost. Certainly, any naive aspects of the library would not be available if the library was intended to serve multiple objectives, at least one objective requiring naϊve characteristics eg. generating higher affinity multi-SPPC specific antibodies (where the greatest parental biasing may be required), as well as generating other lesser related such multi-SPPC antibodies (where a greater naivity is required), as well as generating cancer type specific anti-SPPCs, also where more naϊve aspects of the library may be required. We disclose a scheme of pooling several libraries having differing degrees of biasing to the parent so as to accomplish such multiple objectives as well as compensate for the loss in diversity attributable to varying multiples of 6 to 8 amino acids. Therefore, in one aspect, the part of said construct which is randomized to create variation among said potential binding fragments is biased to produce a probability of occurrence of the parental amino acid of less than 100%, at a given amino acid position, having regard to the number of amino acids randomized, such that said plurality of different potential immunoglobulin binding fragments contains an enhanced representation of anti-SPPCs and such that the probability of occurrence of said the parental amino acid at all randomized positions, preferably does not exceed 20%. It will be readily appreciated that 20% representation of the exact parental amino acid constitution in a single library, even where several libraries are pooled, does not make optimum use of the diversity of the library.

Accordingly, the part of the construct which is randomized (i.e. varied) to create variation among said potential binding fragments is biased to optimize the representation of anti- SPPCs as a first consideration, and to minimize the probability of occurrence of said the parental amino acid at all randomized positions, as a balancing but second consideration.

Where the number of amino acids sought to be varied is small eg. 4 or 5 amino acids, for example where the important regions of the CDR3 for binding are known, not only is biasing in favour of the parent not desired by biasing away from the parent so that chance occurrence of the parent is less than the random 5% (0-5%) may be implemented or partially implemented.

Not exclusively, but particularly where several libraries are pooled and, for example, where higher affinity antibodies are sought to be generated through systematic close parental relationship, especially where the location of the desired changes is not pinpointed and multiples of 6 or 7 amino acids are varied, the primary consideration is not compromised by balancing considerations other than unnecessary waste of diversity, and the part of said construct which is randomized to create variation among said potential binding fragments is biased to optimize the representation of anti-SPPCs as a first consideration, and to minimize the probability of occurrence of the parental amino acid at all varied positions, as a purely second consideration. As discussed above, one aspect of the invention contemplates a population of genetic packages (eg. phage) comprising a plurality of libraries, which are pooled, wherein at least a first and second of said pooled libraries differ in the degree of biasing to parental amino acids.

In order to ensure naive aspects of the library, where desired, in at least one of said pooled libraries, the degree of biasing to parental amino acids is selected to minimize the probability of exact occurrence of the parental amino sequence, as a primary consideration or as an exclusive consideration. Thus for example, in at least one of said pooled libraries, at least part of the CDR3, of the heavy chain or light chain or both, is completely randomized.

A suggested above, it is contemplated that in addition to the library which is most heavily biased in favour of the parental amino acid constitution and the one which is least heavily biased, there are one or more libraries wherein the degree of biasing towards parental amino acids is systematically reduced relative to the library with the greatest degree of biasing towards parental amino acids (which is taken herein to be equivalent to saying systematically upgraded relative the least amount of biasing).

It is to be understood that the term pooled libraries refers to a series of libraries which may or may not be used simultaneously in a single panning.

It also contemplated that a number of libraries with the same degree of biasing may be used to compensate for some of the lost diversity, for example, where a large number of amino acids are varied.

It also contemplated that different CDRs may be varied to create the diversity within library, for example, the CDR3 of one or both of the heavy and light chains, or additionally, for example the CDRls of one or both of the heavy and light chains, or for example all the CDRs.

As suggested above, it is contemplated herein that the parental anti-SPPC immunoglobulin binding fragment binds specifically to a plurality of different SPPCs and that the library will contain an enhanced representation of anti-SPPCs which bind to different SPPCs and/or that the parental anti-SPPC immunoglobulin binding fragment is a multicarcinomic anti-SPPC and that the library will contain an enhanced representation of multi-carcinomic anti-SPPCs.

As examples, it is contemplated that 1) the population of genetic packages or phage comprise a plurality of libraries, which are pooled, wherein at least a first and second of said pooled libraoes differ in the degree of biasing to parental amino acids, and wherein said first library is biased to produce a 35% to 85% (the upper end of this range being preferred where multiples of 6-8 residues are varied) probability of the parental amino acid type at a given position and wherein the second library is biased to produce a 25% to 75% of the parental amino acid type at a given position, said population of genetic packages preferably including a library wherein the probability of occurrence of the parental amino acid at each randomized position does not exceed 0.001%; or that 2) a first, second and third of said pooled libraries differ in the degree of biasing to parental amino acids, and wherein said first library is biased to produce 55% to 75% probability of the parental amino acid type at a given position and wherein the second library is biased to produce a 45% to 65% probability of occurrence of the parental amino acid type at a given position and wherein said third library is biased to produce a 35% to 55 probability of occurrence of the parental amino acid type at a given position.

It is contemplated, for example, assuming an achievable theoretical library size of 10⁹ , that the exact parental amino acid sequence preferably does exceed, 1-20%, preferably 0.001%, more preferably 0.0001%, more preferably .000001%), affecting factors being the number of libraries pooled, the number of positions varied and the degree of importance given to achieving a close relationship to the parent as an exclusive consideration and care taken to avoid unnecessary loss of diversity.

It will be appreciated that the foregoing scheme of "pooling" multiple libraries allows a greater number of residues to be varied than might otherwise be attempted with a single library. It is contemplated that the parental anti-SPPC immunoglobulin binding fragment is preferably HI 1, E6 or an antibody that binds to the same target as HI 1 or E6 (including derivatives of the foregoing).

Methods of creating and using phage display libraries are also disclosed in copending applications U.S. Serial Number 60/163,546 filed November 4, 1999 entitled Enhanced Phage Display Libraries and Methods for Producing Same, Canadian patent application serial No. 2,282,179 filed September 7, 1999, entitled Enhanced Phage Display Libraries, and Canadian patent application serial No. [not yet know] filed November 4, 1999, entitled

Enhanced Phage Display Libraries and Methods for Producing Same. All references disclosed in this application are hereby incoφorated by reference.

SPPC Related Polynucleotide

A "polynucleotide" is a polymeric form of nucleotides of any length that contains deoxyribonucleotides, ribonucleotides, and analogs thereof in any combination. Polynucleotides can have any three-dimensional structure, and can perform any polynucleotide-specific function, known or unknown. The term "polynucleotide" includes double-, single-stranded, and triple-helical molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the double stranded form of either the DNA, RNA or hybrid molecules.

A functionally equivalent fragment of a polynucleotide either encodes a polypeptide that is functionally equivalent to the original polypeptide when produced by an expression system, or has similar hybridization specificity as the original polynucleotide when used in a hybridization assay. A functionally equivalent fragment of a native antigen-binding fragment described herein typically has one or more of the following properties: ability to bind tumor- or disease-associated SPPCs; ability to bind at least one type of cancer cell in a specific manner; and an ability to elicit a cancer-specific immune response.

The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, viruses, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide can compose modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thioate, and nucleotide branches. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified , such as by conjugation with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to other compounds or supports, including, without limitation, proteins, metal ions, labeling components, other polynucleotides, or a solid support.

The term "recombinant" polynucleotide means a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin that either does not occur in nature or is covalently linked to another polynucleotide in an arrangement not found in nature. Recombinant methods are well known in the art.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory

Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (Gait, ed., 1984); "Animal Cell Culture" (Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (Wei & Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (Miller & Calos, eds., 1987); "Current Protocols in Molecular Biology" (Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction",

(Mullis et al., eds., 1994); "Current Protocols in Immunology" (Coligan et al., eds., 1991). These techniques are applicable to the production of the polynucleotides and polypeptides, and, as such, can be considered in making and practicing the invention. Particularly useful techniques for particular embodiments are discussed in the sections that follow.

A "vector" refers to a recombinant plasmid or virus that comprises a heterologous polynucleotide to be delivered, either in vitro or in vivo, into a target cell. The heterologous polynucleotide can comprise a sequence of interest for puφoses of therapy, and can be optionally in the form of an expression cassette. As used herein, a vector need not be capable of replication in the ultimate target cell or subject. The term includes cloning vectors for the replication of a polynucleotide, and expression vectors for translation of a polynucleotide encoding sequence. Also included are viral vectors, which comprise a polynucleotide encapsulated or enveloped in a viral particle.

A "cell line" or "cell culture" denotes bacterial, plant, insect or higher eukaryotic cells grown or maintained in vitro. The progeny of a cell may not be completely identical (either moφhologically, genotypically, or phenotypically) to the parent cell. A hybridoma refers to a cell line that produces a Mab. Methods of making hybridomas, both murine and human, are known in the art. Particular methods of producing human hybridomas are described and referenced throughout the specification.

A "host cell" denotes a prokaryotic or eukaryotic cell that has been genetically altered, or is capable of being genetically altered by administration of an exogenous polynucleotide, such as a recombinant plasmid or vector. When referring to genetically altered cells, the term refers both to the originally altered cell, and to the progeny thereof. "Heterologous" refers to an entity genotypically distinct from the entity to which it is being compared. For example, a polynucleotide can be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter.

"Isolated", when used herein in conjunction with, for example, an antigen, antibody, polynucleotide, polypeptide or stress protein-peptide complex refers to a composition that is substantially free of the materials with which it is associated in its native environment such that the essential components of interest can be physically characterized by a person skilled in the art for the puφoses of the invention described herein. By substantially free is meant that at least 50%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 95% free of these materials, and even more preferably to clinically acceptable standards of purity. The "native environment" is the cell in which it is synthesized whether in vitro or in vivo. A "stable duplex" of polynucleotides refers to a duplex that is sufficiently long-lasting to persist between the formation of the duplex or complex and subsequent detection, including any optional washing steps or other manipulation that can take place in the interim. The invention also encompasses polynucleotides encoding for functionally equivalent variants and derivatives of the native peptide and functionally equivalent fragments thereof which can enhance, decrease or not significantly affect properties of the polypeptides encoded thereby. These functionally equivalent variants, derivatives, and fragments display the ability to specifically recognize disease and tumor associated SPPCs. For instance, changes in a DNA sequence that do not change the encoded amino acid sequence, as well as those that result in conservative substitutions of amino acid residues, one or a few amino acid deletions or additions, and substitution of amino acid residues by amino acid analogs are those which will not significantly affect properties of the encoded polypeptide. The polynucleotides of the invention can comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, and polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, and transformation of a host cell, and any such construct as can be desirable to provide embodiments of this invention.

The invention encompasses a polynucleotide of at least about 9-15 consecutive nucleotides, preferably at least about 20 nucleotides, more preferably at least about 25 consecutive nucleotides, more preferably at least about 35 consecutive nucleotides, more preferably at least about 50 consecutive nucleotides, even more preferably at least about 75 nucleotides, still more preferably at least about 100 nucleotides, still more preferably at least about 200 nucleotides, and even more preferably at least about 300 nucleotides that forms a stable hybrid with a polynucleotide encoding the L chain or H chain V region of anti-stress protein-peptide, but not with other immunoglobulin encoding regions known at the time of filing of this application. Any set of conditions can be used for this test, as long as at least one set of conditions exist wherein the test polynucleotide demonstrates the required specificity.

Hybridization reactions can be performed under conditions of different "stringency." Conditions that increase stringency of a hybridization reaction are published. See, for example, Sambrook and Maniatis. Examples of relevant conditions include (in order of increasing stringency): incubation temperatures of 25°C, 37°C, 50°C and 68°C; buffer concentrations of 10 x SSC, 6 x SSC, 1 x SSC, 0.1 x SSC (where SSC is 0.15 M NaCl and 15 mM citrate buffer) and their equivalent using other buffer systems; formamide concentrations of 0%, 25%, 50%, and 75%; incubation times from 5 minutes to 24 hours; 1, 2, or more washing steps; wash incubation times of 1, 2, or 15 minutes; and wash solutions of 6 x SSC, 1 x SSC, 0.1 x SSC, or deionized water.

The polynucleotides of this invention can be obtained using chemical synthesis, recombinant cloning methods, PCR, or any combination thereof. Methods of chemical polynucleotide synthesis are well known in the art and need not be described in detail herein. One of skill in the art can use the sequence data provided herein to obtain a desired polynucleotide by employing a DNA synthesizer or ordering from a commercial service.

Alternatively, nucleotides can be obtained from cell lines producing the peptide, cloning vectors, or expression vectors. RNA or DNA encoding the desired sequence can be isolated, amplified, and processed by standard recombinant techniques. Such techniques include digestion with restriction endonucleases, and amplification by polymerase chain reaction (PCR), or a suitable combination thereof. PCR technology is described in U.S. Patent Nos. 4,683,195, 4,800,159, 4,754,065 and 4,683,202, as well as PCR: The Polymerase Chain Reaction, Mullis et al. eds., Birkauswer Press, Boston (1994). (a) SPPC peptide encoding polynucleotides.

The invention encompasses compositions comprising polynucleotides that encode SPPC peptides. In the case of C-antigen, the polynucleotides encode at least five consecutive amino acid residues of an SPPC.

(b) Polynucleotides encoding antigen-binding fragments.

The invention encompasses polynucleotides encoding anti-C, derivatives thereof and complementary polynucleotides therefor. Methods of use of the polynucleotides are also encompassed by the invention. Methods of obtaining polynucleotides encoding anti-SPPC and methods of use thereof are the same as for anti-C. As used herein anti-SPPC encompasses anti-C.

The invention further comprises polynucleotides encoding the SPPC-specific antibody V regions and derivatives thereof. These include isolated polynucleotide fragments, recombinant polynucleotides, and therapeutic plasmids and vectors, such as vaccinia vectors, comprising the polynucleotides.

Included in all these embodiments are polynucleotides with encoding regions for anti-stress protein-peptides, fusion proteins, humanized immunoglobulins, single-chain V regions, and other particular polypeptides of interest. These polypeptides are described above.

The invention also provides polynucleotides covalently linked with a detectable label. Such polynucleotides are useful, for example, as probes for detection of related nucleotide sequences.

Anti-SPPC Recombinant Expression Vectors

Polynucleotides comprising a desired sequence can be inserted into a suitable vector, and the vector in turn can be introduced into a suitable host cell for replication and amplification. Polynucleotides can be inserted into host cells by any means known in the art. Cells are transformed by introducing an exogenous polynucleotide by any method known in the art, including, but not limited to, direct uptake, endocytosis, transfection, f- mating or electroporation. Once introduced, the exogenous polynucleotide can be maintained within the cell as a non-integrated vector (such as a plasmid) or integrated into the host cell genome. Amplified DNA can be isolated from the host cell by standard methods: see, e.g., Sambrook et al. (1989). RNA can also be obtained from transformed host cell, or it can be obtained by using a DNA-dependent RNA polymerase.

The present invention further includes a variety of vectors comprising a polynucleotide encoding anti-SPPC. These vectors can be used for expression of recombinant polypeptides as well as a source of anti-SPPC polynucleotides. Cloning vectors can be used to obtain replicate copies of the polynucleotides they contain, or as a means of storing the polynucleotides in a depository for future recovery. Expression vectors (and host cells containing these expression vectors) can be used to obtain polypeptides produced from the polynucleotides they contain. They can also be used where it is desirable to express anti- SPPC in an individual and thus have intact cells capable of synthesizing the polypeptide, such as in gene therapy. Suitable cloning and expression vectors include any known in the art, e.g., those for use in bacterial, mammalian, yeast and insect expression systems. Specific vectors and suitable host cells are known in the art and are not described in detail herein. See e.g. Gacesa and Ramji, (1994) Vectors, John Wiley & Sons.

Cloning and expression vectors typically contain a selectable marker (for example, a gene encoding a protein necessary for the survival or growth of a host cell transformed with the vector), although such a marker gene can be carried on another polynucleotide sequence co- introduced into the host cell. Only those host cells into which a selectable gene has been introduced will grow under selective conditions. Typical selection genes either: (a) confer resistance to antibiotics or other toxic substances, e.g., ampicillin, neomycin, methotrexate; (b) complement auxotrophic deficiencies; or (c) supply critical nutrients not available from a defined medium. The choice of the proper marker gene will depend on the host cell, and appropriate genes for different hosts are known in the art. Vectors also typically contain a replication system recognized by the host. Suitable cloning vectors can be constructed according to standard techniques, or can be selected from a large number of cloning vectors available in the art. While the cloning vector selected can vary according to the host cell intended to be used, useful cloning vectors will generally have the ability to self-replicate, can possess a single target for a particular restriction endonuclease, or can carry genes for a marker that can be used in selecting clones containing the vector. Suitable examples include plasmids and bacterial viruses, e.g., pUC18, mpl8, mpl9, pBR322, pMB9, ColEl, pCRl, RP4, phage DNAs, and shuttle vectors such as pSA3 and pAT28. These and many other cloning vectors are available from commercial vendors such as BioRad, Stratagene, and Invitrogen. Expression vectors generally are replicable polynucleotide constructs that contain a polynucleotide encoding an anti-stress protein-peptide of interest. The polynucleotide encoding the anti-SPPC is operatively linked to suitable transcriptional controlling elements, such as promoters, enhancers and terminators. For expression (i.e., translation), one or more translational controlling elements are also usually required, such as ribosome binding sites, translation initiation sites, and stop codons. These controlling elements (transcriptional and translational) can be derived from a gene encoding an anti-SPPC, or they can be heterologous (i.e., derived from other genes or other organisms). A polynucleotide sequence encoding a signal peptide can also be included to allow an anti-SPPC to cross or lodge in cell membranes or be secreted from the cell. A number of expression vectors suitable for expression in eukaryotic cells including yeast, avian, and mammalian cells are known in the art. One example of an expression vector is pcDNA3 (Invitrogen, San Diego, CA, in which transcription is driven by the cytomegalovirus (CMV) early promoter/enhancer. This vector also contains recognition sites for multiple restriction enzymes for insertion of the polynucleotide of interest. Another example of an expression vector (system) is the baculovirus/insect system.

Also encompassed herein are expression systems suitable for use in antibody-targeted gene therapy comprising a polynucleotide encoding an anti-SPPC. Suitable systems are described for instance by Brown et al. (1994) Virol. 198:477-488; and Miyamura et al. ( 1994) Proc. Natl. Acad. Sci. USA 91 :8507-851 1. The vectors containing the polynucleotides of interest can be introduced into the host cell by any of a number of appropriate means, including electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; lipofection; and infection. The choice of means of introducing vectors or polynucleotides encoding anti-SPPCs will often depend on features of the host cell.

Once introduced into a suitable host cell, expression of an anti-SPPC can be determined using any assay known in the art. For example, the presence thereof can be detected by RIA or ELISA of the culture supernatant (if the polypeptide is secreted) or cell lysates.

A vector of this invention can contain one or more polynucleotides encoding an anti-SPPC. It can also contain polynucleotide sequences encoding other polypeptides that enhance, facilitate, or modulate the desired result, such as lymphokines, including, but not limited to, IL-2, IL-4, GM-CSF, TNF-α and IFN-γ. A preferred lymphokine is GM-CSF. Preferred GM-CSF constructs are those which have been deleted for the AU-rich elements from the 3 ' untranslated regions and sequences in the 5' untranslated region that are capable of forming a haiφin loop. Also embodied in this invention are vaccinia vectors encoding for recombinant anti-SPPCs, such as scFvs and other antigen-binding fragments, chimeras, and polymers. The invention further encompasses the generation of antigen-binding fragments from phage display libraries that have been selected by at least one round of screening with

C-antigen or other disease- or cancer-associated stress protein-peptide. This includes use of phage display to humanize murine antibodies/antibody fragments to SPPCs. See, for example, (1996) J Biol. Chem. 13:271; (1997) J. Biol. Chem. 18:272, and 10678-10684; and (1998) Proc. Natl. Acad. Sci. USA 95:8910-8915. Isolated phage and the anti-SPPCs encoded therein obtained by such a screening process are also included in the invention.

Host Cells

Other embodiments of this invention encompass host cells transformed with polynucleotides encoding anti-SPPCs and vectors comprising anti-SPPCs polynucleotide sequences, as described above. Both prokaryotic and eukaryotic host cells can be used. Prokaryotic hosts include bacterial cells, for example E. coli and mycobacteria. Among eukaryotic hosts are yeast, insect, avian, plant and mammalian cells. Host systems are known in the art and need not be described in detail herein. Examples of a mammalian host cells include CHO and NSO, obtainable from the European Collection of Cell Cultures (England). Transfection of NSO cells with a plasmid, for example, which is driven by a CMV promoter, followed by amplification of this plasmid in using glutamine synthetase provides a useful system for protein production. Cockett et al. (1990) Bio/Technology 8:662-667.

The host cells of this invention can be used, inter alia, as repositories of polynucleotides encoding anti-SPPCs, or as vehicles for production thereof. They can be used also as vehicles for in vivo expression of anti-SPPCs. The polynucleotides of this invention can be used in expression systems to produce polypeptides, intact antigen-binding fragments, or recombinant forms thereof.

Methods of use of the polynucleotides

The polynucleotides of this invention have several uses. They are useful, for example, in expression systems for the production of anti-SPPC. They are also useful as hybridization probes to assay for the presence of polynucleotides encoding anti-SPPC or related sequences in a sample using methods well known to those in the art. Further, the polynucleotides are also useful as primers to effect amplification of desired polynucleotides. The polynucleotides of this invention are also useful in pharmaceutical compositions including vaccines and for gene therapy.

The polynucleotides can also be used as hybridization probes for detection of anti-SPPC encoding sequences. Suitable hybridization samples include cells transformed ex vivo for use in gene therapy. In one illustration, DNA or RNA is extracted from a sample, and optionally run on a gel and/or digested with restriction endonucleases. The processed sample polynucleotide is typically transferred to a medium suitable for washing. The sample polynucleotide is then contacted with the anti-SPPC polynucleotide probe under conditions that permit a stable duplex to form if the sample contains a matching polynucleotide sequence. Any stable duplexes formed are detected by any suitable means. For example, the polynucleotide probe can be supplied in labeled form, and label remaining with the sample after washing will directly reflect the amount of stable duplex formed. In a second illustration, hybridization is performed in situ. A suitably prepared tissue sample is overlaid with a labeled probe to indicate the location anti-SPPC encoding sequences.

A short polynucleotide can also be used as a primer for a PCR reaction, particularly to amplify a longer sequence comprising a region hybridizing with the primer. This can be conducted preparatively, in order to produce polynucleotide for further genetic manipulation. It can also be conducted analytically, to determine whether an anti-SPPC encoding polynucleotide is present, for example, in a sample of diagnostic interest.

Another use of the polynucleotides is in vaccines and gene therapy. The general principle is to administer the polynucleotide so that it either promotes or attenuates the expression of the polypeptide encoded therein. Thus, the present invention includes methods of inducing an immune response and methods of treatment comprising administration of an effective amount polynucleotides encoding anti-SPPC or an SPPC to an individual. In these methods, a polynucleotide encoding an anti-SPPC or SPPC is administered to an individual, either directly or via cells transfected with the polynucleotide. Preferably, the polynucleotide is in the form of a circular plasmid, preferably in a supercoiled configuration. Preferably, the polynucleotide is replicated inside a cell. Thus, the polynucleotide is operatively linked to a suitable promoter, such as a heterologous promoter that is intrinsically active in cells of the target tissue type. Preferably, once in cell nuclei, plasmids persist as circular non- replicating episomal molecules. In vitro mutation can be carried out with plasmid constructs to encode, for example, molecules with greater affinity and/or avidity.

To determine whether plasmids containing polynucleotides encoding anti-SPPC are capable of expression in eukaryotic cells, cells such as COS-7, CHO, or HeLa can be transfected with the plasmids. Expression is then determined by immunoassay; for example, by Western blot. Smaller SPPCs can be detected, for example, by constructing the plasmid so that the resultant polypeptide is fused with a tag, such as a target epitope or enzyme label. Further characterization of the expressed polypeptide can be achieved by purifying the peptide and then conducting one of the functional assays described herein

Kits

The present invention encompasses kits containing anti-SPPC. Diagnostic procedures using the kits can be performed by diagnostic laboratories, experimental laboratories, practitioners, or private individuals. The clinical sample is optionally pre-treated for enrichment of the target being tested for. The user then applies a reagent contained in the kit in order to detect the changed level or alteration in the diagnostic component.

Each kit comprises antigen-binding fragments used for detecting cancer associated SPPC in the sample. Optionally, the reagent can be conjugated with a label to permit detection of any complex formed with the target in the sample. In another option, a second reagent is provided that is capable of combining with the first reagent after it has found its target and thereby supplying the detectable label. For example, labeled anti-human IgG can be provided as a secondary reagent for use with intact anti-stress protein-peptide. Labeled avidin is a secondary reagent when the primary reagent has been conjugated to biotin.

The kits can be employed on a variety of biological samples including, both liquid samples cell suspensions and tissue samples. Suitable assays using anti-C that can be supplied in kit form include those described herein.

Each reagent is supplied in a solid form or dissolved/suspended in a liquid buffer suitable for inventory storage and later for exchange or addition into the reaction medium when the test is performed. Suitable packaging is provided. The kit can optionally provide additional components that are useful in the procedure. These optional components include, but are not limited to, buffers, capture reagents, developing reagents, labels, reacting surfaces, means for detection, control samples, instructions, and inteφretive information.

Pharmaceutical Compositions The preparation of pharmaceutical compositions described herein is conducted in accordance with generally accepted procedures for the preparation of pharmaceutical preparations. See, for example, Remington's Pharmaceutical Sciences 18th Edition (1990), E.W. Martin ed., Mack Publishing Co., PA. Depending on the intended use and mode of administration, it can be desirable to process the active ingredient further in the preparation of pharmaceutical compositions. Appropriate processing can include sterilizing, mixing with appropriate non-toxic and non-interfering components, dividing into dose units, and enclosing in a delivery device.

(a) General modes of administration

Pharmaceutical compositions of the present invention are administered by a mode appropriate for the form of composition. Typical routes include intravenous, subcutaneous, intramuscular, intraperitoneal, intradermal, oral, intranasal, intradermal, and intrapulmonary (i.e., by aerosol). Pharmaceutical compositions of this invention for human use are typically administered by a parenteral route, most typically intravenous, subcutaneous, intramuscular. Although not required, pharmaceutical compositions are preferably supplied in unit dosage form suitable for administration of a precise amount. Also contemplated by this invention are slow release or sustained release forms, whereby a relatively consistent level of the active compound are provided over an extended period.

(b) Liquid formulations

Liquid pharmaceutically acceptable compositions can, for example, be prepared by dissolving or dispersing a polypeptide or polynucleotide embodied herein in a liquid excipient, such as water, saline, aqueous dextrose, glycerol, or ethanol. The composition can optionally also contain other medicinal agents, pharmaceutical agents, carriers, and auxiliary substances such as wetting or emulsifying agents, and pH buffering agents. Compositions for injection can be supplied as liquid solutions or suspensions, as emulsions, or as solid forms suitable for dissolution or suspension in liquid prior to injection.

Pharmaceutical compositions for oral, intranasal, or topical administration can be supplied in solid, semi-solid or liquid forms, including tablets, capsules, powders, liquids, and suspensions. For administration via the respiratory tract, a preferred composition is one that provides a solid, powder, or liquid aerosol when used with an appropriate aerosolizer device.

The present invention also encompasses compositions comprising liposomes with membrane bound peptide to specifically deliver the liposome to the area of the tumor or neoplastic cells or to the immune system. These liposomes can be produced such that they contain, in addition to peptide, immunotherapeutic agents such as those described above which would then be released at the site of malignancy. Wolff et al. (1984) Biochem.

Biophys. Acta 802:259. Another such delivery system described by Brown et al. ((1994) Virology 198:477-488; and Miyamura et al. (1994) Proc. Natl. Acad. Sci. USA 91:8507- 8511) utilizes chimeric parvovirus B19 capsids for presentation of the antigen-binding fragments. Such chimeric systems are encompassed for use in the claimed methods.

Compositions embodied in this invention can be assessed for their efficacy in a number of ways. Accordingly, test compounds are prepared as a suitable pharmaceutical composition and administered to test subjects. Initial studies are preferably done in small animals such as mice or rabbits, optionally next in non-human primates and then ultimately in humans. Immunogenicity is preferably tested in individuals without a previous antibody response. A test composition in an appropriate test dose is administered on an appropriate treatment schedule. It can be appropriate to compare different doses and schedules within the predicted range. The dosage ranges for the administration of anti-SPPC are those large enough to produce the desired effect in which the symptoms of the malignant disease are ameliorated without causing undue side effects such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any complication. Dosage can vary from about 0.1 mg/kg to about 2000 mg/kg, preferably about 0.1 mg/kg to about 500 mg/kg, in one or more dose administrations daily, for one or several days.

Generally, when the compositions are administered conjugated with therapeutic agents, lower dosages, comparable to those used for in vivo immunodiagnostic imaging, can be used.

Antigen-binding Fragments

The present invention encompasses pharmaceutical compositions containing anti-SPPC. Such pharmaceutical compositions are useful for inducing or aiding an immune response and treating neoplastic diseases, either alone or in conjunction with other forms of therapy, such as chemotherapy, radiotherapy or immune therapies described in WO98/23735; WO98/34642; WO97/10000; WO97/10001; and WO97/06821.

Compositions containing antigen-binding fragments specific for disease-associated SPPCs and methods of use thereof, as described for cancer treatment, are also encompassed by the invention.

Immunogenic Compositions

The invention also contemplates a process of creating an immunogen using the peptide portion of an isolated SPPC by linking said peptide portion to a peptide coupling molecule or using the peptide portion in conjunction with an adjuvant. In one embodiment, the peptide portion is covalently associated with said peptide coupling molecule. In another embodiment, the peptide portion is not covalently associated with said peptide presenting molecule. In either case, the peptide-coupling molecule may be a heat shock protein. It is understood in this example that said peptide coupling molecule is any molecule that, when associated with the peptide, presents the peptide in a manner that allows the peptide to be immunogenic. Methods of using peptides as immunogens are described in the art (see for example, Immunological Recognition of Peptides in Medicine and Biology 1995, Zegers et al, editors).

The SPPC compositions and SPPC peptide compositions of the present invention can be used as cancer immunogens including vaccines. These compositions can comprise a cancer- specific antigen or epitope (e.g. one found on cancer cells but not on non-cancerous cells), which can be in the form of native peptides, artificial proteins, for example multiantigen peptides, branched polypeptides, fusion and recombinant peptides, as well as single T cell epitopes and tumor antigen peptides. Ben-Yedidia et al. (1997) Curr. Opin. Biotechnol. 8:442-8; and Hellstrom et al. (1997) Mol. Med. Today 3:286-90. A cancer vaccine can alternatively comprise a polynucleotide encoding an antigen, which is directly injected into muscle or skin to cause an immune response against the encoded antigen. Moelling (1997) Cytokines Cell. Mol. Ther. 3:127-35; and Moling (1997) J. Mol. Med. 75:242-6. Cancer vaccines can also comprise tumor cells. Mackensen et al. (1997) J. Mol. Med. 75:290-6. Anti-idiotype antigen-binding fragments are also suitable for use as vaccines.

A new method for generating useful tumor cell populations for such vaccines from tumor biopsies has been described. Lahn et al. (1997) Eur. Surg. Res. 29:292-302. Whole tumor cells used for this puφose can be lethally irradiated and transformed to produce a cytokine such as granulocyte-macrophage colony stimulating factor (GM-CSF). Mahvi et al. (1997)

Hum. Gene Ther. 8:875-891 ; Stingl et al. (1997) J. Mol. Med. 75:297-9; and Jaffee et al. (1997) Methods 12:143-53. While both whole cells and cell lysates can be used as vaccines, whole cell vaccines may induce a better immune response against cell-surface antigens. Ravindranath et al. (1997) Anticancer Drugs 8:217-24.

In a murine breast cancer model, Flt3-Ligand (Flt3-L), a stimulatory cytokine for a variety of hematopoietic lineages, including dendritic cells and B cells, has been used in conjunction with murine breast cancer cells as a vaccine. Chen et al. (1997) Cancer Res. 57:351 1-6. Dendritic cells (DCs) can also be loaded with or transduced to express rumor antigens; these cells are then used as adjuvants to tumor vaccination. DCs present cancer- associated antigens endogenously to the afferent lymphatic system in the appropriate histocompatibility complex (MHC)-restricted context. Wan et al. (1997) Hum. Gene Ther. 8: 1355-63; Peiper et al. (1997) Surgery 122:235-41; and Smith et al. (1997) Int. Immunol. 9: 1085-93. Current melanoma vaccines manipulate antigen presentation networks and combine the best cellular and antibody antitumor immune response effective in mediating tumor protective immunity. These therapies have caused regression, delayed disease progression or an improvement in survival in some cases, with a paucity of side effects. Kuhn et al. (1997) Dermatol. Surg. 23:649-54. Melanoma vaccines are also reviewed in Conforti et al. (1997) J. Surg. Oncol. 66:55-64.

Vaccines can be packaged in pharmaceutically acceptable carriers or admixed with adjuvants or other components (such as cytokines) as is known in the art.

More specifically, an SPPC of the invention may be adapted for use in a vaccine and can compose at least one polypeptide, which is an antigenic fragment, anti-idiotype of anti- SPPC, derivative, or variant of C-antigen or C-antigen peptide. Optionally the adapted

SPPC comprises an epitope of C-antigen which is not found on an SP alone. It is contemplated that the SPPC or epitope thereof can be found in the membrane fraction of disrupted and separated cells but the SPPC or portion thereof can be obtained in any manner including recombinant genetics. Thus, the SPPC or epitope thereof can be derived directly or indirectly from such a fraction

An epitope typically includes 5-10 amino acid residues. The C-antigen polypeptide comprises derivatives of C-antigen which preferably retain at least one epitope present on native, whole C-antigen. This polypeptide can be administered as a vaccine in the form of free C-antigen polypeptide, C-antigen present on a cell expressing C-antigen; C-antigen in the context of multi-antigen peptides, branched polypeptides, fusion peptides, recombinant peptides; or C-antigens loaded onto dendritic cells (DCs). The cell expressing C-antigen can be a tumor cell naturally expressing C-antigen or a cell, which does not normally express C-antigen, which has been transformed with the C-antigen polynucleotide in order to express C-antigen. The cell can be irradiated or otherwise rendered non-viable. The C- antigen-expressing cell can also be altered (e.g. by transduction) to express a cytokine.

Methods of making vaccines using polynucleotides encoding various peptides according to the invention have been described for various applications. Reference is made to US Patent Nos. 5,580,859 and 5,589,466, which describe the generation of nucleic acids that may by used in "DNA vaccine" applications as well as US Patent Nos. 5,843,913, 5,814,617, 5,81 1,406, 5,736,524, 5,676,954, 5,620,896, 5,593,972, 5,589,466 and 5,580,859, as well as Pardoll D.M. (1998) Cancer vaccines. Nat. Med., 4:525-531 ; Young J.W. and Inaba K. (1996) Dendritic cells as adjuvants for class I major histocompatibility complex-restricted anti-tumor immunity. J Exp. Med., 183:7-11; Hart I. and Colaco C. (1997) Fusion induces tumor rejection. Nature, 388:627-628; Banchereau J. and Steinman R.M. (1998) Dendritic cells and the control of immunity. Nature, 392:245-252; Bakkar A.B.H. et al. (1995) Generation of anti-melanoma cytotoxic T lymphocytes from healthy donors after presentation of melanoma-associated antigen-derived epitopes by dendritic cells in vitro. Cancer Res., 55:5330-5334; Pogador A. and Gilboa E. (1995) Bone marrow-generated dendritic cells pulsed with class-I restricted peptides are potent inducers of cytotoxic T- lymphocytes. J. Exp. Med., 182:255-260; Hsu F.J. et al. (1996) Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat. Med., 2:52-58; Boczkowski D. et al. (1996) Dendritic cells pulsed with RNA are potent antigen-presenting cells in vitro and in vivo. J. Exp. Med., 184:465-472; Gong J. et al. (1997) Induction of antitumor activity by immunization with fusions of dendritic and carcinoma cells. Nat.

Med., 3:558-561; Muφhy G. et al. (1996) Phase I clinical trial: T-cell therapy for prostate cancer using autologous dendritic cells pulsed with HLA-A0201 -specific peptides from prostate-specific membrane antigen. Prostate, 29:371-380; and, Nestle F.O. et al. (1998) Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4:328-332.

Vaccines for veterinarian use are substantially similar to that in humans with the exception that adjuvants containing bacteria and bacterial components such as Freund's complete or incomplete adjuvants, are allowed in the formulations. Gene Therapy

The present invention further encompasses methods of gene therapy and compositions for use therein. In one mode of gene therapy, the polynucleotides are used for genetically altering cells ex vivo. In this strategy, cells removed from a donor or obtained from a cell line are transfected or transduced with vectors encoding an anti-SPPC, and then administered to a recipient. Suitable cells for transfection include peripheral blood mononuclear cells.

In another mode of gene therapy, the polynucleotides of this invention are used for genetically altering cells in vivo. The puφose can include, but is not limited to, treating various types of cancer.

Use of SPPCs in Treatment

Also included in this invention are methods for treating cancer. A number of studies have been employed to demonstrate the biological safety and in vivo rumor specificity of the recombinant HI 1 scFv.

For biological safety:

(a) Acute toxicity studies for the HI 1 scFv recombinant antibody have indicated no mortality or gross pathological findings in rats injected intravenously with 1000 times the human dose.

The clinical grade DTPA (diethylenetriaminepentaacetic acid)-Hl 1 scFv kit for radiochelating with indium- 11 1 has been tested in guinea pigs and mice for general safety and in rabbits for pyrogens.

For tumor specificity: 1. The tumor imaging potential of ' ' 'in-DTPA-Hl 1 scFv has been examined in a biodistribution and pharmacokinetics study. Nude mice bearing human melanoma tumor xenografts were injected intravenously with ' "in-DTPA-Hl 1 scFv. Specific tumor imaging was observed and a 12: 1 tumor blood ratio was obtained at 48 hours post-injection.

2. In a study examining the treatment of nude mice bearing human lymphoma xenografts with unconjugated HI 1 scFv or HI 1 scFv-toxin conjugate, both forms of the HI 1 scFv recombinant antibody fragment significantly inhibit early tumor growth. Thus the HI 1 scFv recombinant antibody has potential as a therapeutic as well as a diagnostic tumor agent.

3. In a study examining the treatment of humans with ' ' ' In-DTPA-Hl 1 scFv, the pharmaceutical was well tolerated in all patients. The study drug showed binding specificity by localizing to known tumor sites in 80% of patients

Other studies demonstrating biological safety and tumor specificity can be found in the Examples section, below.

The methods of treating cancer comprise administering an amount of a pharmaceutical composition containing a composition of the invention in an amount effective to achieve the desired effect, be it palliation of an existing tumor mass or prevention of recurrence. For treatment of cancer, the amount of a pharmaceutical composition administered is an amount effective in producing the desired effect. An effective amount can be provided in one or a series of administrations. An effective amount can be provided in a bolus or by continuous perfusion. Suitable active agents include the anti-neoplastic drugs and bioresponse modifiers described above and effector cells such as those described by Douillard et al. (1986) Hybridomas (Supp. 1 :5139).

Pharmaceutical compositions and treatment modalities of this invention are suitable for treating a patient by either directly or indirectly eliciting an immune response against neoplasia. An "individual", "patient" or "subject" is a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to: humans, wild animals, feral animals, farm animals, sport animals, and pets. A "cancer subject" is a mammal, preferably a human, diagnosed as having a malignancy or neoplasia or at risk thereof.

As used herein, "treatment" refers to clinical intervention in an attempt to alter the disease course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Therapeutic effects of treatment include without limitation, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastases, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.

The "pathology" associated with a disease condition is any condition that compromises the well-being, normal physiology, or quality of life of the affected individual. This can involve, but is not limited to, destructive invasion of affected tissues into previously unaffected areas, growth at the expense of normal tissue function, irregular or suppressed biological activity, aggravation or suppression of an inflammatory or immunologic response, increased susceptibility to other pathogenic organisms or agents, and undesirable clinical symptoms such as pain, fever, nausea, fatigue, mood alterations, and such other disease-related features as can be determined by an attending physician.

An "effective amount" is an amount sufficient to effect a beneficial or desired clinical result upon treatment. An effective amount can be administered to a patient in one or more doses. In terms of treatment, an effective amount is an amount that is sufficient to palliate, ameliorate, stabilize, reverse or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease. The effective amount is generally determined by the physician on a case-by-case basis and is within the skill of one in the art. Several factors are typically taken into account when determining an appropriate dosage to achieve an effective amount. These factors include age, sex and weight of the patient, the condition being treated, the severity of the condition and the form and effective concentration of the antigen-binding fragment administered.

Suitable subjects include those who are suspected of being at risk of a pathological effect of any neoplasia, particularly carcinoma, are suitable for treatment with the pharmaceutical compositions of this invention. Those with a history of cancer are especially suitable. Suitable human subjects for therapy further comprise two treatment groups, which can be distinguished by clinical criteria. Patients with "advanced disease" or "high rumor burden" are those who bear a clinically measurable tumor. A clinically measurable tumor is one that can be detected on the basis of tumor mass (e.g., by palpation, CAT scan, sonogram, mammogram or X-ray; positive biochemical or histopathologic markers on their own are insufficient to identify this population). A pharmaceutical composition embodied in this invention is administered to these patients to elicit an anti-rumor response, with the objective of palliating their condition. Ideally, reduction in tumor mass occurs as a result, but any clinical improvement constitutes a benefit. Clinical improvement includes decreased risk or rate of progression or reduction in pathological consequences of the tumor.

A second group of suitable subjects is known in the art as the "adjuvant group." These are individuals who have had a history of cancer, but have been responsive to another mode of therapy. The prior therapy can have included (but is not restricted to, surgical resection, radiotherapy, and traditional chemotherapy. As a result, these individuals have no clinically measurable tumor. However, they are suspected of being at risk for progression of the disease, either near the original tumor site, or by metastases.

"Adjuvant" as used herein has several meanings, all of which will be clear depending on the context in which the term is used. In the context of a pharmaceutical preparation, an adjuvant is a chemical or biological agent given in combination (whether simultaneously or otherwise) with, or recombinantly fused to, an antigen to enhance immunogenicity of the antigen. In the context of cancer diagnosis or treatment, adjuvant refers to a class of cancer patients with no clinically detectable tumor mass, but who are suspected of being at risk of recurrence.

This group can be further subdivided into high-risk and low-risk individuals. The subdivision is made on the basis of features observed before or after the initial treatment. These features are known in the clinical arts, and are suitably defined for each different cancer. Features typical of high-risk subgroups are those in which the tumor has invaded neighboring tissues, or who show involvement of lymph nodes. Another suitable group of subjects is those with a genetic predisposition to cancer but who have not yet evidenced clinical signs of cancer. For instance, women testing positive for a genetic mutation associated with breast cancer, but still of childbearing age, can wish to receive anti-SPPC treatment prophylactically to prevent the occurrence of cancer until it is suitable to perform preventive surgery.

A pharmaceutical composition embodied in this invention is administered to patients in the adjuvant group, or in either of these subgroups, in order to elicit an anti-cancer response. Ideally, the composition delays recurrence of the cancer, or even better, reduces the risk of recurrence (i.e., improves the cure rate). Such parameters can be determined in comparison with other patient populations and other modes of therapy.

Of course, crossovers between these two patient groups occur, and the pharmaceutical compositions of this invention can be administered at any time that is appropriate. For example, anti-SPPC therapy can be conducted before or during traditional therapy of a patient with high tumor burden, and continued after the tumor becomes clinically undetectable. Anti-SPPC therapy can be continued in a patient who initially fell in the adjuvant group, but is showing signs of recurrence. The physician has the discretion to determine how or when the compositions are to be used.

Various compounds and compositions of this invention have other clinical indications, of which the following section provides only a survey.

One indication is the treatment of cells ex vivo. This can be desirable for experimental puφoses, or for treatment of an individual with a neoplastic disease. In one example, anti- SPPC is administered to a culture of cells, such as peripheral blood cells obtained from a donor, or a suitable cell line. About 0.5 to 2 mg/mL of anti-C can be an effective dose for this puφose. In a second example, donor cells are genetically altered with an expression vector of this invention, to provide for ongoing secretion of anti-SPPC after administration of the cells to the recipient. Human cancer patients, including, but not limited to, glioblastoma, melanoma, neuroblastoma, adenocarcinoma, glioma, soft tissue sarcoma, and various carcinomas (including small cell lung cancer) are especially appropriate subjects. Suitable carcinomas further include any known in the field of oncology, including, but not limited to, astrocytoma, fibrosarcoma, myxosarcoma, liposarcoma, oligodendroglioma, ependymoma, medulloblastoma, primitive neural ectodermal tumor (PNET), chondrosarcoma, osteogenic sarcoma, pancreatic ductal adenocarcinoma, small and large cell lung adenocarcinomas, chordoma, angiosarcoma, endotheliosarcoma, squamous cell carcinoma, bronchoalveolarcarcinoma, epithelial adenocarcinoma, and liver metastases thereof, lymphangiosarcoma, lymphangioendotheliosarcoma, hepatoma, cholangiocarcinoma, synovioma, mesothelioma, Ewing's tumor, rhabdomyosarcoma, colon carcinoma, basal cell carcinoma, sweat gland carcinoma, papillary carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, bileduct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, testicular tumor, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, leukemia, multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease, breast tumors such as ductal and lobular adenocarcinoma, squamous and adenocarcinomas of the uterine cervix, uterine and ovarian epithelial carcinomas, prostatic adenocarcinomas, transitional squamous cell carcinoma of the bladder, B and T cell lymphomas (nodular and diffuse) plasmacytoma, acute and chronic leukemias, malignant melanoma, soft tissue sarcomas and leiomyosarcomas.

The patients can have an advanced form of disease, in which case the treatment objective can include mitigation or reversal of disease progression, and/or amelioration of side effects. The patients can have a history of the condition, for which they have already been treated, in which case the therapeutic objective will typically include a decrease or delay in the risk of recurrence. "Immunologic activity" of an antigen-binding fragment refers to the ability to specifically bind the antigen, which the intact antibody recognizes. Such binding may or may not elicit an immune response. A specific immune response can elicit antibody, B cell responses, T cell responses, any combination thereof, and effector functions resulting therefrom. Included, without limitation, are the antibody-mediated functions ADCC and complement- mediated cytolysis (CDC). The T cell response includes, without limitation, T helper cell function, cytotoxic T cell function, inflammation/inducer T cell function, and T cell mediated immune suppression. A compound (either alone or in combination with a carrier or adjuvant) able to elicit either directly or indirectly, a specific immune response according to any of these criteria is referred to as "immunogenic." Antigen-binding fragment

"activity" or "function" refers to any of the immunologic activities of an antibody, including the detection, amelioration or palliation of cancer.

An "immune response" refers to induction or enhancement of an immunologic response to malignant or diseased tissue, disease-causing agents and other foreign agents to which the body is exposed. Immune responses can be humoral, as evidenced by antibody production; and/or cell-mediated, as evidenced by cytolytic responses demonstrated by such cells as natural killer cells or cytotoxic T lymphocytes (CTLs) and the cytokines produced thereby. Immune responses can be monitored by a mononuclear cell infiltrate at the site of infection or malignancy. Typically, such monitoring is by histopathology. A "cancer-specific immune response" is one that occurs against the malignancy but not against non-cancerous cells. The treatments described herein typically induce or augment an antibody-mediated response but can also induce or augment a cell-mediated immune response.

When anti-SPPC is used in combination with various therapeutic agents, such as those described herein, the administration of both usually occurs substantially contemporaneously. The term "substantially contemporaneously" means that they are administered reasonably close together with respect to time. Usually, it is preferred to administer the therapeutic agent before anti-SPPC. For example, the therapeutic agent can be administered 1 to 6 days before anti-SPPC. The administration of the therapeutic agent can be daily, or at any other suitable interval, depending upon such factors, for example, as the nature of the malignancy, the condition of the patient and half-life of the agent.

Anti-SPPC enables therapies combining all of the characteristics described herein. For example, in a given situation it can be desirable to administer a therapeutic agent, or agents, prior to the administration of anti-SPPC in combination with effector cells and the same, or different, therapeutic agent or agents. For example, patients can be treated by first administering IFN-γ and IL-2 daily for 3 to 5 days, and on day 5 administering anti-SPPC in combination with effector cells, IFN-g, and IL-2.

Therapeutic compositions can be administered by injection or by gradual perfusion over time. The anti-SPPCs can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, intrathecally or transdermally, alone or in combination with effector cells.

Another method of administration is intralesionally, for instance by injection directly into the tumor. Intralesional administration of various forms of immunotherapy to cancer patients does not cause the toxicity seen with systemic administration of immunologic agents. Fletcher et al. (1987) Lymphokine Res. 6:45; Rabinowich et al. (1987) Cancer Res. 47:173; Rosenberg et al. (1989) Science 233:1318; and Pizz et al. (1984) J. Int. Cancer 34:359.

Anti-SPPC is suitable for use in treating and imaging brain cancer. When the site of delivery is the brain, the therapeutic agent must be capable of being delivered to the brain. The blood-brain barrier limits the uptake of many therapeutic agents into the brain and spinal cord from the general circulation. Molecules that cross the blood-brain barrier use two main mechanisms: free diffusion; and facilitated transport. Because of the presence of the blood-brain barrier, attaining beneficial concentrations of a given therapeutic agent in the CNS can require the use of drug delivery strategies. Delivery of therapeutic agents to the CNS can be achieved by several methods.

One method relies on neurosurgical techniques. In the case of gravely ill patients, surgical intervention is warranted despite its attendant risks. For instance, therapeutic agents can be delivered by direct physical introduction into the CNS, such as intraventricular, intralesional, or intrathecal injection. Intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Methods of introduction can also be provided by rechargeable or biodegradable devices.

Another approach is the disruption of the blood-brain barrier by substances which increase the permeability of the blood-brain barrier. Examples include intra-arterial infusion of poorly diffusible agents such as mannitol, pharmaceuticals which increase cerebrovascular permeability such as etoposide, or vasoactive agents such as leukotrienes. Neuwelt and Rappoport (1984) Fed. Proc. 43:214-219; Baba et al. ( 1991 ) J. Cereb. Blood Flow Metab.

11 :638-643; and Gennuso et al. (1993) Cancer Invest. 11 :638-643.

Further, it can be desirable to administer the compositions locally to the area in need of treatment; this can be achieved by, for example, local infusion during surgery, by injection, by means of a catheter, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as silastic membranes, or fibers. A suitable such membrane is Gliadel® provided by Guilford sciences.

Another method involves pharmacological techniques such as modification or selection of the anti-SPPC to provide an analog which will cross the blood-brain barrier. Examples include increasing the hydrophobicity of the molecule, decreasing net charge or molecular weight of the molecule, or modifying the molecule, such as to resemble one normally transported across the blood-brain barrier. Levin (1980) J. Med. Chem. 23:682-684; Pardridge (1991) in: Peptide Drug Delivery to the Brain; and Kostis et al. (1994) J. Clin. Pharmacol. 34:989-996.

Encapsulation of anti-SPPC in a hydrophobic environment such as liposomes is also effective in delivering drugs to the CNS. For example, WO 91/04014 describes a liposomal delivery system in which the drug is encapsulated within liposomes to which molecules have been added that are normally transported across the blood-brain barrier. Yet another method takes advantage of physiological techniques such as conjugation of anti- stress protein-peptide to a transportable agent to yield a new chimeric, transportable, molecule. For example, vasoactive intestinal peptide analog (VlPa) exerts its vasoactive effects only after conjugation to a Mab to the specific carrier molecule transferrin receptor, which facilitates the uptake of the VIPa-Mab conjugate through the blood-brain barrier.

Pardridge (1991); and Bickel et al. (1993) Proc. Natl. Acad. Sci. USA 90:2618-2622. Several other specific transport systems have been identified, these include, but are not limited to, those for transferring insulin, or insulin-like growth factors I and II. Other suitable, non-specific carriers include, but are not limited to, pyridinium, fatty acids, inositol, cholesterol, and glucose derivatives.

Diagnostic Antibody Clearance

The invention also encompasses compositions and methods of use thereof in diagnostic antibody clearance. SPPC or anti-anti-SPPC can be administered to an individual who has received a labeled anti-SPPC the course of radioscintigraphy or radiotherapy to remove the unbound label. Effective imaging using radiolabeled antibodies is hampered due to excess circulating radiolabeled antibody, which often takes several days to clear. Accordingly, the SPPC recognized by the anti-SPPC is administered to the individual at a specified time after administration of the labeled anti-SPPC. Antigen that is complexed with the antigen- binding fragments at sites other than the tumor, such as in the circulation and interstitial spaces, promotes clearance of non-bound antibody and decreases background radiation. As a result, the level of label in unaffected tissues is reduced, and the image of the tumor (in comparison to neighboring tissues) is enhanced.

Similarly, when radioisotopes are given to subjects for irradiation of a tumor site, it is desirable to reduce collateral exposure of unaffected tissue. This invention thus includes methods of treatment in which a radiolabeled anti-SPPC is administered in a therapeutic dose, and followed by administration of a molar excess of SPPC to remove unbound radiolabelled anti-SPPC from circulation. Imaging/Diagnostic, in vivo

The present invention further encompasses methods for in vivo detection of antigen. A diagnostically effective amount of detectably labeled anti-SPPC is given to the subject in need of tumor imaging. The term "diagnostically effective" means that the amount of detectably labeled anti-SPPC is administered in sufficient quantity to enable detection of the neoplasia.

The concentration of detectably labeled anti-SPPC which is administered should be sufficient such that the binding to those cells having cancer-associated SPPC is detectable compared to the background. Further, it is desirable that the non-bound labeled antigen- binding fragment be rapidly cleared from the circulatory system in order to give the best target-to-background signal ratio.

As a rule, the dosage of detectably labeled antigen-binding fragment for in vivo diagnosis is somewhat patient-specific and depends on such factors as age, sex, and extent of disease. The dosage can vary from about 0.01 mg/m² to about 500 mg/m², preferably 0.1 mg/m² to about 200 mg m², most preferably about 0.1 mg/m² to about 10 mg/m². Such dosages can vary, for example, depending on number of injections given, tumor burden, and other factors known to those of skill in the art.

For in vivo diagnostic imaging, the type of detection instrument available is a major factor in selecting a given radioisotope. The radioisotope chosen must have a type of decay, which is detectable for a given type of instrument. Still another important factor in selecting a radioisotope for in vivo diagnosis is that the half-life of the radioisotope be long enough so that it is still detectable at the time of maximum uptake by the target, but short enough so that deleterious radiation with respect to the individual is minimized. Ideally, a radioisotope used for in vivo imaging lacks a particle emission, but produces a large number of photons in the 140-250 keV range, to be readily detected by conventional gamma cameras.

For in vivo diagnosis, radioisotopes can be bound to anti-stress protein-peptide either directly or indirectly by using an intermediate functional group. Intermediate functional groups which often are used to bind radioisotopes which exist as metallic ions to immunoglobulins are the bifunctional chelating agents such as diethylene triaminepentacetic acid (DTP A) and ethylenediaminetetracetic acid (EDTA) and similar molecules. Typical examples of metallic ions which can be bound are ' ' 'in, ⁹⁷Ru, ⁶⁷Ga, ⁶⁸Ga, ⁷²As, ⁸⁹Zr, ⁹⁰Y,

^99mTc and ²⁰¹T1.

Antigen-binding fragments can also be labeled with a paramagnetic isotope for puφoses of in vivo diagnosis, as in magnetic resonance imaging (MRI) or electron spin resonance (ESR). In general, any conventional method for visualizing diagnostic imaging can be utilized. Usually, gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic isotopes for MRI. Elements which are particularly useful in such techniques include ¹⁵⁷Gd, ⁵⁵Mn, ¹⁶²DY, ⁵²Cr, and ⁵⁶Fe.

Imaging/diagnostic, in vitro

Antigen-binding fragments can also be used to detect neoplasias using in vitro assays. Biological samples are taken from the patient and subject to any suitable immunoassay with anti-SPPC to detect the presence of tumor associated SPPCs. This is particularly useful in detecting cancers where the tumor cells are circulating in the patient's bloodstream.

A "biological sample" encompasses a variety of sample types, including blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimens or tissue cultures, or cells derived therefrom and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as proteins or polynucleotides. The term encompasses various kinds of clinical samples obtained from any species, and also includes cells in culture, cell supernatants, cell lysates and fractions thereof. Particularly, for the puφoses described herein, biological samples comprise tumor tissue or tissue thought to be tumorous and are obtained for instance by surgical resection, biopsy, aspiration or any method known in the art. Therapeutic Monitoring

Antigen-binding fragments can also be used to monitor the course of amelioration of malignancy in an individual. Thus, by measuring the increase or decrease in the number of cells expressing tumor associated SPPC or changes in the concentration of the complex present in various biological samples, it is possible to determine whether a particular therapeutic regimen aimed at ameliorating the malignancy is effective.

Therapeutic Use of Antigen Presenting Cells

The present invention also provides compositions comprising macrophages and/or other antigen presenting cells ( APC) sensitized with complexes of heat shock proteins (hsps) non- covalently bound to antigenic molecules, and methods comprising administering such compositions in pharmaceutically acceptable carriers to human subjects with cancer or infectious diseases. The preferred hsps comprised in the complexes suitable for sensitizing the macrophages include, but are not limited to hsp70, hsp90 and hsp96 or a combination thereof. In a preferred embodiment, a complex used to sensitize the macrophages is H 11. In a further preferred embodiment, a complex used to sensitize the macrophages is E6. Such cells sensitized by complexes comprising hsps and antigenic molecules are herein referred to as "hsp-sensitized" cells. Examples of methods of producing such cells are found, for example, in U.S. patent number 5,985,270 to Srivastava. Methods of producing APCs and related vaccines are disclosed in, for example, Nawrocki S. et al, Cancer Treat Rev 1999 Feb 25:1 29-46; Bartholevns J et al, Res Immunol 1998 Sep-Oct 149:7-8 647-9; Caveux S et al, Eur J Immunol 1999 Jan 29: 1 225-34: Bomford R. Dev Biol Stand 1998 92 13-7;

Buschle M. et al, Proc Natl Acad Sci USA 1997 Apr 1 94:7 3256-61; Bronte V et al, Proc Natl Acad Sci USA 1997 Apr 1 94:7 3183-8; Nair SK. et al, EurJ Immunol 1997 Mar 27:3 589-97; Cao X et al, Immunology 1999 Aug 97:4 616-25; Henry F. et al, Cancer Res 1999 Jui 15 59:14 3329-32; DeMatos P. et al, Cell Immunol 1998 Apr 10 185:1 65-74; Pardoll DM, Nat Med 1998 May 4:5 Suppl 525-3; Raychaudrhuri, S., et al, Nat. Biotech. 1998

Nov/ Vol 16: 1025-1031, all of which are incoφorated herein by reference. f

87

Adoptive immunotherapy of cancer and infectious diseases enhances the host's immunocompetence and activity of immune effector cells. Adoptive immunotherapy with hsp-sensitized macrophages and other antigen-presenting cells (APC), for example, dendritic cells and B cells (B lymphocytes), induces specific immunity to tumor cells and/or antigenic components, promoting regression of the tumor mass or treatment of immunological disorders or infectious diseases, as the case may be.

The effectiveness of cross-priming of T-cell responses by host APCs with transferred tumor antigen suggests another strategy for tumor immunotherapy. It has been demonstrated that isolated murine dendritic cells, after short-term culture in GM-CSF and incubation with rumor fragments, can immunize mice against subsequent challenge with rumor (Grabbe S, et al, J Immunol 1991, 146: 3656-3661; Flamand V, et al, Eur J Immunol 1994, 24: 605-610; Grabbe S, et al, Immunol Today 1995, 16: 117-121) Methods employing GM-CSF, tumor necrosis factor-oc, and IL-4 have recently been developed that allow the generation of large numbers of dendritic cells from murine or human progenitor cells, including progenitors found in the blood of adult humans (Sallusto F, Lanzavecchia A, J Exp Med 1994, 179: 1109-1 1 18 Xu S, et al, J Immunol 1995, 154: 2697-2705; O'Doherty U, et al, J Exp Med 1993, 178: 1067-1076; Romani N, et al, J Exp Med 1994, 180: 83-93; Bernhard H et al, Cancer Res 1995, 55: 1099-1104.. The immunotherapy strategy that is emerging would be to generate dendritic cells from a patient's own blood, pulse, them with tumor fragments (or antigenic peptides, if identified), and then reintroduce them into the patient. This approach would avoid the necessity for the modification of the tumor cells and their reintroduction into patients Allison, JP et al, Current Opinion in Immunology 1995, 7:682-686).

Methods of Production of HSP-Peptide Complexes

Reference is made to the ensuing examples herein. In an embodiment of the invention heat shock proteins bound to peptides may be generated intracellularly by synthetically generating a polynucleotide encoding a plurality of such Peptides as segments within larger peptide. Optionally, enzymatic peptide cleavage sites may be introduced between the various Peptide segments to ensure intracellular cleavage of intact segments. These polynucleotides are optionally amplified prior to introduction into a host cell for expression. The polynucleotides are then inserted into an expression vector or intrachromosomally integrated, operatively linked to regulatory element(s) such as a promoter, for puφoses of expressing the encoded proteins in suitable host cells in vitro. Reference is made to US

Patent No. 5,948,646, which describes analogous methods using cancer cell DNA, the disclosure of which is hereby incoφorated by reference.

The polynucleotides are introduced into host cells where they are expressed by the host cells, thereby producing intracellularly noncovalent complexes of hsps and peptides

(including those peptides encoded by the polynucleotides). The recombinant host cells can be cultured on a large scale for production of large amounts of the immunogenic complexes. The polynucleotide library can be stored for future use (e.g. by lyophilization or freezing), or expanded by replication in a cloning vector in suitable host cells to meet increased demand for the subject immunogenic complexes.

Optionally, the host cell is a cancer cell, optionally which expresses SPPCs on its surface, optionally the same type of cancer as the tumor target, optionally cancer cells of individual sought to be treated by the HSP-Peptide complexes.

Methods of Purifying SPPCs

A variety of methods have been proposed in the literature for purifying SPPCs. Reference is made to WO95/24923 and to more recent US Patent No. 5,948,646 (Srivastava et al.) and WO99/29182, the disclosures of which are hereby incoφorated by reference. Reference is also made to the examples herein.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Animal Cell Culture (R.I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (D.M. Wei & CC. Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (J.M. Miller & M.P. Calos, eds., 1987); "Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987);

"PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994); "Cuoent Protocols in Immunology" (J.E. Coligan et al., eds., 1991). These references are incoφorated herein by reference. These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

Recombinant genetic techniques have allowed cloning and expression of antibodies, functional fragments thereof and the antigens recognized. These engineered antibodies provide novel methods of production and treatment modalities. For instance, functional immunoglobulin fragments have been expressed in bacteria and transgenic tobacco seeds and plants. Skerra (1993) Curr. Opin. Immunol. 5:256:262; Fiedler and Conrad (1995) Bio/Technology 13: 1090-1093; Zhang et al. (1993) Cancer Res. 55:3384-3591 ; Ma et al. (1995) Science 268:916; and, for a review of synthetic antibodies, see Barbas (1995) Nature Med. 1 :836-839. These and more current references describing these techniques, which these references, particularly those well known to persons practicing in the relevant arts, are hereby incoφorated herein by reference.

General Methodology

With respect to the immunology methods and materials of the invention, the following guides are incoφorated by reference: Antibody Fusion Proteins (1998, Wiley Publications); Advances in Immunology (1998, Acad Press ; Recombinant Antibodies (1998, Dubel, S, Wiley Publications); Manual of Immunological Methods (1998, Canadian Networking Toxicology Center Staff, Pharmacology & Toxicology Ser; CRC Press);

Cellular Methods in Immunology (1998, Fernandez-Botran, R, CRC Press); Linscott's Directory of Immunological & Biological Reagents (1998, Linscott, WD, lOthRevised ed., Linscotts Direct Publications); Intracellular Antibodies: Developments & Applications (1997, Spr-Verlag Publications); Cells: A Laboratory Manual (1997, Spector, DL, et al., Cold Spring Harbor); Manipulation & Expression of Recombinant DNA: A Laboratory Manual (1997, Robertson, D, Acad Press); The Generation of Diversity: Clonal Selection

Theory & the Rise of Molecular Immunology (1997, Podolsky, SH, HUP Publications); Animal Cell Technology: Applied Aspects (1997, Kluwer Ac); Antibody Production: Essential Techniques (1996, Essential Techniques Ser., Wiley Publications); Methods in Gene Biotechnology (1996, Wu, W, CRC Press); and Super antigens: Molecular Biology, Immunology & Relevance to Human Disease ( 1996, Dekker Publications).

With respect to the molecular biology methods and materials of the invention, the following guides are incoφorated by reference: Biochemical Pathways: An Atlas of Biochemistry & Molecular Biology (1998, Michal et al, Wiley Publications); Enzymes of Molecular Biology (1999, Burrell, M, Methods in Molecular Biology Ser., 2nd ed.,

Humana Publications); Progress in Nucleic Acid Research & Molecular Biology ( 1998, Acad Press); Advanced Molecular Biology: A Concise Reference (1998, Twyman, R., Spr- Verlag Publications); Molecular Biology Labfax (1998, Brown, T, Labfax Ser., 2nd ed., Acad Pr); The Molecular Biology ofB-Cell & T-Cell Development (1998, Moore, JG et al, Contemporary Immunology Ser., Humana Publications); Progress in Nucleic Acid

Research & Molecular Biology (1997, Acad Press); Bioinformation on the World Wide Web 1997: An Annotated Directory of Molecular Biology Tools (1996, Smagula, Cynthia S, 2^nd Revised ed., Biota Pubns); Oxford Dictionary of Biochemistry & Molecular Biology (1997, OUP); Encyclopedia of Molecular Biology & Molecular Medicine (1997, Wiley Pulbns).

With respect to the phage display methods and materials of the invention, the following guides are incoφorated by reference: Phage Display of Peptides & Proteins: A Laboratory Manual (1996, Acad Press); Methods in Protein Structure Analysis: Proceedings of the W^h International Conference Held in Snowbird, Utah, September 8-13,

1994 (1995, Plenum Press); Antibody Engineering Protocols (1995, Methods in Molecular Biology Ser., Humana Pblns ; A Short Course in Bacterial Genetics: A Laboratory Manual & Handbook for Escherichia Coli & Related Bacteria (1990, Miller, JH); Phage & the Origins of Molecular Biology (1992, Cold Spring Harbor); Phage Mu (1988, Cold Spring Harbor); Annual Reports in Combinatorial Chemistry & Molecular Diversity (1998, Kluwer Ac); Combinatorial Chemistry (1997, Terrett, NK, Oxford Chemistry

Masters Ser.); Combinatorial Chemistry & Molecular Diversity in Drug Discovery (1998, Wiley Publns,); A Practical Guide to Combinatorial Chemistry (1997, ACS Professional Reference Bks., Am Chemical Publns); Structure-Based Drug Design (1997, Dekker Publns); Molecular Diversity & Combinatorial Chemistry: Libraries & Drug Discovery (1996, ACS Conference Proceedings Ser., Am Chemical Publns); Combinatorial

Chemistry: Synthesis & Application (1996, Wilson, SR et al, Wiley Publns); Combinatorial Chemistry in Drug Design (1996, Nielsen, Routledge Chapman & Hall); Molecular Biotechnology: Therapeutic Applications & Strategies (1996, Maulik, S et al, Wiley Publns); Combinatorial Chemistry (1995, Methods in Enzymology Ser., Acad Pr).

EXAMPLES

EXAMPLE 1 - Isolation of SPPCs, SPPC Peptide and C-Antigen

Tumor cells grown in tissue culture had their membranes disrupted, and an extract made by freeze-thaw. In particular detail, after cell harvest, cells are centrifuged at 1500 φm for 10 min. The cells are washed twice in a PBS/lmM phenylmethyl-sulfonyl fluoride (PMSF)/10mg/ml aprotinin solution. After washing, the pellet is resuspended in the wash solution and the cell concentration is adjusted to 10-20 x 10⁶ cells/mL. This suspension is then subjected to five freeze-thaw sequences consisting of freezing in a dry-ice-acetone solution, followed immediately by thawing in a 37°C water bath. After the freeze-thaw treatments, the extract mixture is centrifuged at lOOOφm to obtain a pellet of cellular debris and a supernatant.

The supernatant is combined with 3M ammonium sulfate buffer in a 2: 1 ratio. This sample is then loaded onto a general-puφose hydrophobic chromatographic medium (preferably Phenyl Sepharose) at a rate of 0.5ml/min using a pump. The column is connected to an FPLC system. Once loaded, the column is washed with 15 column volumes (CV) of Buffer A (50mM sodium phosphate and 1M ammonium sulfate pH 7.0). The bound proteins are eluted with a linear gradient to 100% Buffer B (50mM sodium phosphate pH 7.0). Active fractions are determined by immunological methods. SPPC is eluted in the latter fraction. The positive fraction is concentrated on a membrane concentrator with a MW cut-off of lOkDa, preferably a Centriprep 10. The concentrated sample is passed through a buffer exchange column (eg. Sephadex) to the ADP-agarose chromatographic Buffer A (20 mM Tris-acetate, 20 mM NaCl, 3 mM MgCl₂,pH 7.5).

Six mL of the buffer exchanged material is incubated overnight with an additional 4 mL Buffer A and 5 mL ADP-agarose at 4°C on a platform shaker. Following incubation, the mixture is poured into a XK16 column. The column is washed with the ADP-agarose chromatographic Buffer A until the OD at 280 nm reaches baseline. The column is further washed with 0.5M NaCl in chromatographic-Buffer A and re-equilibrated with Buffer A.

The bound protein is then eluted with 3 mM ADP in the ADP Buffer A and fractions collected. The active fraction is concentrated on a membrane concentrator with a MW cutoff of lOkDa (preferably Amicon).

The concentrated, eluted sample is diluted with anionic chromatographic Buffer A (20 mM

Tris pH 7.8) at 1 :10. One mL of diluted sample is loaded onto a strong anionic column (preferably a Mono Q or HiTrap Q) attached to an FPLC. The flow rate is set at 1 ml/min. The column is washed with a Q buffer A 20 mM Tris pH 7.8 until the O.D. 280 nm reaches baseline. The proteins were then eluted with a linear gradient of 600 mM NaCl in Q buffer A. Fractions are collected and the antigenic fraction identified. This three-step procedure gives a suitable, substantially homogeneous, active, SPPC.

ADP chromatographic media are media to which ADP is bound, and includes, but is not limited to, ADP bound to Sepharose and agarose. Preferably the medium is ADP agarose. Although the preceding method applies most aptly to hsp70 (particularly as detailed below) and (with limited routine modification, if any such modification is required) to hspόO, it can be used for cancer-associated SPPCs that are determined to be of the hsp20-30 and hsp40 families (with necessary modifications according to routine skill in the art). Additionally, in the case of the hsp90 family, a lectin column, preferably a Concanavalin A column, can substitute for the ADP chromatographic media described above.

Optionally, in a preferred method, C-antigen and other such SPPCs can be further purified under non-denaturing conditions, preferably in an electrophoretic extraction step. For example, after final concentration from the anionic column (particularly, in the case of C-antigen, the SPPC is already substantially purified), 15mL of the complex is mixed 50/50 with 2X Laemmli's buffer. The sample is separated on a suitable polyacrylamide gel electrophoresis apparatus under native, non-denaturing conditions (no SDS, mercaptoethanol or boiling). After completion of electrophoresis, the gel is blotted onto a membrane (PVDF or nitrocellulose) again under non-denaturing conditions. Identification of the SPPC location on the blotted membrane is confirmed by treatment with an anti-SPPC antigen-binding fragment followed by binding an appropriately labeled secondary antibody.

The SPPC can be excised from the membrane and the bound SPPC can be treated to cause the release of the peptide from the complex and subjected to further analysis. For example; the membrane can be treated to cause the release of the complex and the subsequently released peptide can be analyzed, for instance, by capillary electrophoresis, or applied to a MALDI mass spectrograph.

An alternate method for the purification of SPs is developed from the creation of affinity chromatographic media of SPPC specific IgG antibodies or fragments thereof, for example the recombinant HI 1 IgG described in WO 97/44461. A 5 mL sample from a hydrophobic column (preferably Phenyl Sepharose) is incubated with 2 mL of SPPC-specific IgG

Sepharose. The IgG-Sepharose/sample is incubated over-night at 4°C on a rotary shaker. After incubation, the mixture is poured into a small chromatographic column (preferably BioRad 10 mL Econo-Column). The column is washed with ten column volumes (CV) of PBS (pH 7.4) followed by three CV of 0.5 M NaCl in PBS. The affinity column is then re- equilibrated with PBS. Following equilibration, SPPC is eluted using a glycine buffer pH

2.8. The eluate is concentrated on a micro-pore concentrator (preferably Centriprep 3). The acid elution results in the dissociation of the SP from its peptides. The small molecular weight fraction (peptide) is concentrated with a peptide concentrator (preferably Microcon SCX). The purified SP is retained on the micro-pore concentrator.

After concentration, the eluted mixture of peptide and SP dissociated complex is passed through a peptide concentrator (preferably Microcon-SCX). The resultant material is freeze dried, and re-dissolved in 0.1% TFA. After re-constitution the material is fractionated on a reverse-phase HPLC column. Fractions are analyzed directly on a MALDI mass spectrometer.

Reconstitution of the peptide with the SP can be effected by any method known in the art such as mixing the affinity column purified SP with the peptide (purified native, recombinant or synthesized peptide) in PBS in the presence of 1 mM ADP and 1 mM MgCl₂ and incubating at 37°C for 30 min. Optionally and required cofactors supplied, for example, from a cell extract, could be added to improve yeild. Alternatively, other methods such as those provided by Wallen and Moseley (US Patent 5981706) could be utilized.

SPPCs may alternatively be isolated using an IgG affinity column and an alkaline elution buffer. 100 mL of A-375 cell extract is centrifuged at 1400g for 30 min and the supernatant collected. The supernatant is then diluted five times with Q buffer A (Tris 20mM, pH 8.2).

Diisopropyl fluorophosphate (DFP), a protease inhibitor, is added to a final concentration of ImM. The sample is loaded on a 10 mL anionic Q Sepharose HPcolumn at a rate of 3 mL/min. The column is then washed with 15 CV of 50 mM NaCl in HiTrap Q buffer A. Bound protein is eluted with 20 CV of a 50mM to 600 mM NaCl gradient, and 10 mL fractions collected. Fractions are concentrated using Centriprep 10. The SPPC-containing fractions are identified by Western blot analysis using HI 1 IgG as the primary antibody and an appropriately labeled secondary antibody.

SPPC, partially purified through the Q Sepharose HP anionic column, is applied to the HI 1 IgG affinity column and incubated for 2 hours at room temperature with gentle rotation.

Following incubation, the column is washed with 20 mL TBS (Tris 20 mM, NaCl 150 mM, pH 7.4). The bound SPPC is eluted with 50 mM diethylamine pH 1 1. The eluted material is concentrated and the purity is determined using Western blot analysis. The results show that, under these conditions, the SPPC is eluted intact.

EXAMPLE 2 - Purification of SPPCs

(a) Purification of Mixtures of SPPCs

Purification of SPPC mixtures using ADP-affinity chromatography is described in Peng et al. (1997) J. Immunol. Met. 204 13-21; and WO98/12208. In particular, a semi-purified cell extract is added to a column containing an ADP matrix and a buffer containing ADP is then added to the column to elute the SPPCs. Generally, a tumor cell extract can be prepared by standard techniques in the art, with specific attention paid to inhibiting protease activity, preferably by freeze thaw extract methodology as generally described in Chen et al (1994) J. Immunol. 152:3-11. Preferably the protease activity is inhibited using PMSF, aprotinin and

EDTA.

(b) Purification of hsp 70.

C-antigen was isolated in the following manner. A-375 cells (human melanoma cell line) were grown in tissue culture to a cell density of 50-80% confluent, disrupted, and an extract made by freeze-thaw. In detail, after cell harvest, cells were centrifuged at 1500 φra for 10 min. The cells were washed twice in a PBS/lmM PMSF/lOmg/mL aprotinin solution. After washing, the pellet was resuspended in the solution and the cell concentration was adjusted to 10-20 x 10⁶ cells/mL. This suspension was then subjected to five freeze-thaw cycles consisting of freezing in a dry-ice-acetone solution, followed immediately by thawing in a 37°C water bath. After the freeze-thaw treatments the extract mixture was centrifuged at 2500φm for 30 minutes at4°C.

The resulting supernatant was combined with 3M ammonium sulfate buffer in a 2: 1 ratio.

This sample was then loaded onto a general puφose hydrophobic chromatographic media (preferably Phenyl Sepharose) at a rate of 0.5 mL/min using a pump. The column was connected to an FPLC system. Once loaded, the column was washed with 15 column volumes (CV) of buffer A (50 mM sodium phosphate/1 M ammonium sulfate pH 7.0). The bound proteins were eluted with a linear gradient to 100% buffer B (50 mM sodium phosphate pH 7.0). Active fractions were determined by immunological methods. The positive fractions were concentrated by a membrane concentrator with a MW cut-off of lOkD (preferably a Centriprep 10). The concentrated sample was passed through a buffer exchange media (preferably Sephadex G-25) to the ADP-agarose chromatographic buffer A (20 mM Tris-acetate, 20 mM NaCl, 3 mM MgCl₂,ρH 7.5).

Six mL of the buffer exchanged material was incubated overnight with an additional 4 mL buffer A and 5 mL ADP-agarose at 4°C on a platform shaker. Following incubation, the mixture was poured into a XK16 column. The column was washed with the ADP-agarose chromatographic Buffer A until the OD at 280 nm reached base-line. The column was further washed with 0.5M NaCl in chromatographic-buffer A and re-equilibrated with

Buffer A. The bound protein was then eluted with 3 mM ADP in the ADP Buffer A and fractions collected. The active fraction was concentrated on a membrane concentrator with a MW cut-off of lOkD (preferably Microcon 10).

The concentrated, eluted, sample was diluted with anionic chromatographic buffer A (20 mM Tris pH 7.8) at a 1:10 dilution. One mL of diluted sample was loaded onto a strong anionic column (preferably a Q Sepharose HP) attached to an FPLC. The column is washed with the Q buffer A (20 mM Tris pH 7.8) until the OD 280 nm reaches baseline. The proteins were then eluted with a linear gradient of NaCl to 600 mM (in Buffer A). Fractions were collected and the antigenic fraction identified as outlined above. This three-step procedure gives a reasonable homogeneous active C-antigen (>95%).

Subsequently, after final concentration from the anionic column, 15ml of 95% purified SPPC was mixed 50/50 with 2X Laemmli's buffer. The sample was run under native, non- denaturing, conditions (no SDS, mercaptoethanol or boiling). After completion of electrophoresis, the separated protein were blotted onto a membrane (PVDF or nitrocellulose) again under non-denaturing conditions. Identification of the antigen location on the blotted membrane was confirmed by incubation with HI 1-IgG followed by an appropriately labeled secondary antibody. The C-antigen can then be excised and eluted from the membrane and subjected to further analyses.

An alternate method for the purification of SPPCs was developed by generating affinity chromatographic media of C-antigen-specific IgG antibodies or fragments thereof, using, eg. H 1 1 IgG described in WO97/44461. A 5 mL sample from a hydrophobic column (preferably Phenyl Sepharose) was incubated with 2 mL of HI 1 IgG-Sepharose. The IgG- Sepharose/sample was incubated over-night at 4°C on a rotary shaker. After incubation the mixture was poured into a small chromatographic column (preferably BioRad 10 ml Econo- Column). The column was washed with ten CV of PBS (pH 7.4) followed by three CV of 0.5 M NaCl in PBS. The affinity column was then re-equilibrated with PBS. Following equilibration, C-antigen was eluted using a glycine buffer pH 2.8. The eluted material is concentrated on a micro-pore concentrator (preferably Centriprep 3). The acid elution results in the dissociation of SP from its peptide. The small molecular weight fraction (peptide) was concentrated with a peptide concentrator (preferably Microcon SCX). The purified SP was retained on the micro-pore concentrator.

A third step purification utilizes a HiTrap Q anionic exchange (Amersham Pharmacia) column by gradient elution. The purified preparation is concentrated using a Centricon 10 concentrator (Millipore). The purity of the HSP70 preparation is determined by loading a sample of the preparation onto a 4-15% gradient polyacrylamide gel and visualizing by silver staining. Western blotting with an anti HSP70 (Stressgen) antibody is used to confirm the identity of the isolated protein.

Stripping of endogenous peptide from HSP70: Using the above method for isolation and purification of HSP70 results in a preparation essentially free of peptides. However, should removal of endogenous peptides be required, this can be achieved by one of the following methods prior to reconstitution with synthetic peptides, as described by Srivastava [U.S.

Patent 5,837,251]: 1. Treating with lOmM ATP for 30 min at room temperature

2. Treating with 0.05-10% trifluoroacetic acid (v/v).

After treatment , the solution will be concentrated on a Centricon 10. The HSPs will be collected on the membrane-retained portion of the Centricon 10.

EXAMPLE 3 - Purification of HSP96

In lieu of the ADP agarose purification step, hsp96 (Gp96) complexes can be purified as described by Blahere et al. J. Exp. Med. (1997) 186:1315-1322. Cancer cell extract is applied to a lectin column, specifically concanavalin A and incubated over-night at 4°C. The SP is eluted from the column with 10% methylmannoside. The hsp90 active fractions are concentrated on a micro-pore filter (preferably Centriprep 10).

SPPCs can be isolated from other diseased cells in a manner analogous to the methods described herein for isolation of such complexes from tumor cell extracts, for example cells which are viral ly or otherwise infected, with the result that the screening protocols described herein for differentiating between tumor and non-tumor cells could be analogously applied, by persons skilled in the art, according to methods within the skill of those in the art, to identify: 1) complexes that are found on the surface of infected but not rumor cells; and 2) antibodies which react specifically with such complexes.

EXAMPLE 4 -Determining the Binding Efficiency of Synthetic peptides to HSP70

Briefly, antigenic peptides are labelled with NaB[³H]₄ (15 Ci/mmol) by reductive methylation. Competition assays were carried out using highly purified (>95%) HSP70 (1 uM) in a reaction mixture containing binding buffer (50mM Tris-HCl, pH 7.5, 200 mM NaCl, ImM EDTA), 0.9 uM of [³H]antigenic peptide (specific radioactivity: 50-500 uCi/mmol), 5 ug of BSA, and various concentrations of non-labelled synthetic peptides

(generally 0-1 mM) in a total volume of 50 ul and incubated at 30°C for 30 min. The complexes were then passed through Sephadex G-50 spin columns and quantitative binding of the radiolabelled peptide to the HSP70 present in the eluate was determined by scintillation counting. See also Flynn et al., (1989) Science 245, 385-390 and Takenaka I. M. et al, (1995) J. Biol. Chem. 270, 19839-19844.

Gel Shift analysis to demonstrate native binding of peptides to HSP70: The migration pattern of HSP-peptide complexes on non-denaturing polyacrylamide gels is peptide dependent and native binding of antigenic peptides can be assessed using methods known in the art (see, for example, Takenaka et al, (1995) J.Biol. Chem. 270, 19839-19844). For example, 2 ug (0.3 uM) HSP70 is incubated with 250 uM of antigenic peptide at 37°C for 30 min in binding buffer (20 mM HEPES-KOH, pH 7.0, 25mM KC1, lOmM (NH₄)₂SO₄, 2mM magnesium acetate, 0.1 mM EDTA, 1 mM dithiothreitol) containing 0.15 uM of ADP. The proteins are separated on a 6% non-reducing, non-denaturing polyacrylamide gel, and visualized by silver staining.

EXAMPLE 5 - Obtaining Mab HI 1

Fusion of HI 1 was accomplished by fusing 8 x 10⁶ peripheral blood lymphocytes obtained from a 64 year old male with a low grade glioma with the TM-H2-SP2 human myeloma cell line. TM-H2-SP2 cell line is the immunoglobulin non-secreting subline of the parental cell line TM-H2, a hypoxanthine guanine phosphoribosyltransferase (EC 2.4.2.8)-deficient derivative of human myeloma-like line selected in 0.8% methylcellulose for its resistance to 6-thioguanine (6 mg/mL) and failure to grow in hypoxanthine-aminopterin-thymidine medium. The karyotype of TM-H2-SP2 is 46±2. See also Maiti, P.K. et al, 1997 for general procedures.

The resultant viable hybridoma cells were plated (0.2 mL/well) into 40 microwells at a density of 2 x 10⁵ cells/mL. The frequency of outgrowth from fusion HI 1 was 12 of 40 (30%) potential hybridoma-containing wells. Outgrowth resulting from sustained growth is defined as prolonged growth with culture expansion for periods longer than 3 months; instances of hybridoma growth failure occurring later than 3 months post- fusion were not observed.

Screening of hybridoma clones was performed by antigen-capture enzyme-linked immunosorbent assay (ELISA) in microtiter plates using polyclonal anti-human IgM or IgG as coating antigen. A hybridoma culture supernatant was positive if the measured optical density (O.D.) value exceeded the mean background level of a control culture supernatant by greater than two standard deviations (S.D.).

Selection of a hybridoma clone was performed by cell-fixed ELISA. Culture supernatants from 6 microtiter wells, which tested high for IgM or IgG secretion, were screened against the following previously attached and fixed human rumor cell lines: glioblastoma (SKMG-1 and D-54MG); melanoma (A-375); and colon adenocarcinoma (SK-CO-1). A hybridoma supernatant was considered to be positive if the measured O.D. value exceeded the mean background level of control culture supernatants by greater than two S.D. Mabs produced by hybridoma NBGM1/H11, obtained in this manner, continues to be reactive against these tumor cell lines. The "Hl l" antibodies are IgM( ).

HI 1 -antigen partially purified from human melanoma cell line A375 extract was further prepared by sonication and chromatographed sequentially by Q Sepharose HP, Phenyl Sepharose HP, HI 1-IgG immunoaffinity, and HiTrap Q. For electrophoresis, native PAGE

4-15% gradient gel was used (non-denaturing and non-reducing conditions; SPPC complex is not dissociated). Immunodetection, as seen in Figure 9, was accomplished by immunoblotting of electrophoresed HI 1 -antigen preparation after transfer to nitrocellulose membrane; detection by different primary antibodies [blot A: HI 1-IgG; blot B: anti-HSP70 antibody (StressGen); blot C: anti-HSP90 antibody (StressGen)], and secondary antibody, goat anti-human IgG-HRP; the blot is developed using DAB (Pierce Chemical Co.) as substrate. The data demonstrated that the antigen complex recognized by HI 1-IgG contains both HSP70 and HSP90. (Note: Treatment of the HI 1-antigen preparation with 0.1% TFA for 60 min at room temperature prior to loading onto the gel results in a loss of HI 1-IgG immunoreactivity.) Additional evidence of the binding of HI 1 to both HSP70 and HSP90 families of SPPCs was demonstrated by differential binding upon ATP treatment of the complex. Since HSP70 SPPCs and not HSP90 SPPCs bind and cleave ATP, thus releasing peptide from the SPPC, we treated isolated complex bound to a membrane with 10 mM ATP or (0-10%) TFA or TBS as control as described by Srivastava (US Patent 5,837,251). The complex was then tested for reactivity with HI 1 by western blot as described in example 9. It was observed that treatment of the complex with TFA caused a complete loss of reactivity with HI 1 and that treatment with ATP only caused a partial loss of reactivity with HI 1, which is consistent with our finding that both HSP70 and HSP90 SPPCs are present together in the isolated complexes bound by H 11.

The methods used for the characterization of Mab NBGM1/H11 include: antigen-capture ELISA, antigen ELISA, cell-fixed ELISA, flow cytometry, immunoperoxidase staining of human rumor cell lines and immunohistochemistry of human tumor and normal tissues (see following examples).

Binding characteristics of this human Mab to human tumor cell lines as determined by flow cytometry, immunoperoxidase staining, cell-fixed ELISA and antigen ELISA (i.e., rumor cell freeze-thaw extracts) are presented below.

EXAMPLE 6 - Purification and Chemical and Physical Characterization of H-ll Antigen

A large volume of A-375 tumor cell extract was prepared by lysing cells at a cell density of 20X10⁶/ml. Purification of antigenic material from the human melanoma A375 cell extract was subjected to a four steps of purification.

In general terms the steps were: Anionic exchange chromatography; Hydrophobic resin chromatography; IgG (H-l l)-affinity chromatography; and a high resolution Anionic chromatography. In detail; crude extract was loaded to a Q Sepharose HP column, the bound proteins were eluted with a gradient buffer, 20mM Tris, 1M NaCl at pH 8.2 (buffer B) at a gradient of 5%- 60%. Fifteen millilitre aliquots were collected and the location of the antigen identified using IgG H-l 1 /Western blot analysis. The active fractions were combined, concentrated on an Amicon concentrator and applied to a Phenyl Sepharose HP column, pre-equilibriated with 50 Na₃PO₄, 1 M (NH₄)₂SO₄ pH 8.0. The antigen was eluted with a linear gradient to Buffer B (50 mM Na₃PO₄ pH 8.0). After identification with IgG H-l l, active fractions were concentrated and loaded to the IgG H-l 1 affinity column and after a two hour incubation period the bound protein was eluted with 50mM diethylamine pH 1 1.0. The eluted material from the affinity column was collected, concentrated as above and applied to a HiTrap Q column. The bound proteins were eluted with a linear gradient of 5% to 50% buffer B, 20mM sodium phosphate, 1M NaCl at pH 7.8. One millilitre fractions were collected and the fractions containing H- 11 antigen were combined and concentrated.

Purified antigen was analyzed with Native PAGE and Western immunoblot analysis.

Immunoblot analysis used H- 11 IgG form to identify the location of the antigen. Antigen samples, cut from acrylamide gels and stained with amido black (for band identification) were forwarded to the Mass Spectroscopy (M/S) facility at the NRC labs (Ottawa, ON). At the NRC the protein complex was treated by in-gel tryptic digestion (without reduction alkylation) and the peptide pieces extracted from the gel with adsorbtive cartridges. The peptides were then subjected to ESI-MS analysis.

The M/S analysis completed on the semi-pure preparation of the H-l l antigen revealed four proteins. Two were identified as cytosolic proteins, 6-phosphogluconate dehydrogenase (53kDa) and rab GDP dissociation inhibitor (51kDa). Using Western blot analysis these proteins have been eliminated as constituting a whole or part of the H-l 1 antigen. The second set were shown to be heat shock proteins (HSP) from the HSP70 family and a second from the HSP90 family. The HSP70 was principally in the inducible form (HSP72) with a trace of the constituent HSP73. The second heat shock protein identified was HSP90, specifically human HSP85. Extensive studies have improved the purification methodology have resulted in a four-step purification protocol (see above). The final purification procedure gives a preparation whereby the principal protein present is H-l 1 antigen with two-three minor contaminating proteins as shown with the sensitive silver stain method.

When the antigen is run on an SDS-PAGE gel it loses antigenicity. However, when run under native conditions (non-denaturing) the purified antigen maintains its ability to bind H- 11. This result indicates that the antigen consists of a protein complex and is dissociated in the presence of detergent (SDS). Further, the complex is disrupted in the presence of weak acid (TFA) and to a lessor extent with ATP. These latter two biochemical findings are consistent with a heat shock protein peptide complex.

Because the H-l l antigen cannot be visualized under SDS-PAGE it is difficult to assess its molecular weight. However, from size exclusion chromatography (SEC) we estimate the molecular weight of the complex to be approximately 120kDa. Although SEC is not an accurate way of determining molecular weight, it is believed that 120kDa value represents the total weight of the complex including the antigenic peptide/protein.

Following the result of the M/S analysis which indicated the presence of two HSPs in the semi-purified antigen preparation, the preparation was confirmed by testing reactivity with anti-HSP70 and anti-HSP90 (both from Stressgen, Victoria, B.C.). The Western blot clearly demonstrated the presence of both proteins in the purified antigen preparation. The same protein preparation was found to be reactive with H-l l IgG.

An analysis of the semi-purified H-l l preparation of Mass Spec revealed the presence of an

HSP70 and an HSP90. On further purification and using anti-HSP antibodies we have identified these two heat shock proteins independently of the M/S analysis as being a part of the antigen.

Dissociation of the complex by TFA and ATP and further evidence indicate a Heat Shock

Protein Peptide Complex (SPPC) as the antigen. Currently therefore it is believed that the antigen is a peptide associated with HSP70 and HSP90. The peptide is only antigenic when associated with (bound to) either HSP70 or HSP90. In our preparation of antigen we believe we co-purify the antigen in its SPPC70 form and SPPC90 form.

Studies on the characterization of MAb HI 1, using genetically engineered fragments of the parent HI 1 IgM and chromatographically-purified extracts prepared from human tumor cell lines, indicate that the antigen is a surface-expressed heat shock protein-peptide complex (SPPC). More specifically, analysis of the antigen by immunochemical and mass spectroscopic techniques indicates that SPPC antigen consists of both HSP70 and HSP90 peptide-complexes. Acid and ATP dissociation of the peptide(s) from the SPPC results in the loss of MAb HI 1 recognition. These results suggest that the HSP-bound peptides(s) forms all or part of the epitope recognized by MAb HI 1.

EXAMPLE 7 - Analysis of HSP Bound Peptides

Antigen containing fractions from the anionic exchange column (see the four step purification protocol set out in the above Examples) are pooled and the antigen preparation acidified to pH 3.0 with a mild acid, preferably with TFA at a final concentration of 0.1%. Acidification is conducted at room temperature (RT) for 60 min. The resulting preparation is passed through a molecular sieve, (MWCO lOkDa) preferably a Microcon 10 (Amicon).

The flow-through is collected and acetic acid is added to 1% to the peptide preparation. This ensures peptide binding to the concentrator membrane. A concentrator, preferably a Microcon-SCX peptide concentrator (Amicon) is loaded with the peptide preparation and centrifuged for 1 min. at 1200g. From the concentrator the flow through is discarded and the retentive washed from the membrane with desoφtion reagent consisting 50% MEOH + 10%

NH₄OH + 40% H₂0. The eluted, concentrated peptide(s), are dried in a "speed vac", preferable a Savant model SCI 10A, resuspended in dH₂O, re-dried and the process repeated.

The peptide preparation is injected into an electrospray mass spectrometer (for example a

Quattro-LC equipped with a Z-Spray ion source and a triple quadrupole analyzer. Micromass, Manchester, U.K; see also Billael TM et al, 1993, Anal. Chem. 65: 1709-1716; Hunt DF et al., 1992, Science 356: 1261-3; Kiselar JG et al, 1999, Anal Chem. 71(9): 1792- 1801). Twenty microlitres of peptide preparation are injected, the running buffer is a mixture of acetonitrile- water, 50-50. The electrospray needle potential is adjusted to 3.6kV and the declustering voltage to 60V. The mass ranged scanned is 2000 amu. The peptide analysis includes a MS/MS approach to obtain a sequence analysis of the peptide(s).

EXAMPLE 8 - Flow Cytometric Analysis of Mab Hll Binding to Human Glioblastoma and Melanoma

In order to determine HI 1 binding to intact tumor cells, anchorage-dependent tumor cells growing in T-flasks were detached by incubation with PBS-EDTA and examined by flow cytometry. Cells were collected by low speed centrifugation, washed with ice-cold PBS-1% FBS, centrifuged and the supernatant aspirated. The cell pellet was resuspended in a control human melanoma IgM and incubated on ice for 30 minutes. After incubation, the cells were collected by centrifugation, washed by resuspension in PBS-FBS and centrifuged. The cell pellet was then incubated for 30 min with FITC-conjugated goat anti-human IgM. After incubation, the cells were washed with PBS-FBS. Finally, the cells were resuspended in PBS-FBS followed by addition of propidium iodide (PI) and washed. Pi-positive and FITC- positive cells were analyzed by flow cytometry.

Figures 1 and 2 show reactivity of cell surface antigen(s) of rumor cell by flow cytometry. Melanoma A-375 (Figure 1) and glioma SKMG-1 (Figure 2) tumor cell lines were incubated with human myeloma IgM (10 μg/mL) or MAb Hl l (10 μg/mL) and binding detected with phycoerythin (PE) conjugated goat anti-human IgM. Relative cell numbers are plotted versus the relative fluorescent intensity. Reactivity with MAb Hl l is indicated by the thick line.

These results indicate that crude and purified forms of Mab HI 1 bind to a cell surface- associated antigen(s) expressed on glioblastoma (SKMG-1) and melanoma (A-375) live human tumor cell lines. EXAMPLE 9 - Analysis of Mab Hll Binding to human Tumor Cell Lines by ELISA

In order to determine the ability of HI 1 to bind specifically to human tumor cell antigen, ELISA plates were coated with human tumor cell extracts prepared by repeated freezing and thawing of glioblastoma (SKMG-1), breast adenocarcinoma (BT-20, MB-468 and MB-453), colon adenocarcinoma (SK-CO-1 and HT-29) cells.

The antigen coated ELISA plates were incubated for 16-18 hours at 2-8°C. The plates were blocked with PBS-3% BSA for 1 hr at room temperature. Then the plates were incubated with either biotinylated Mab HI 1 in PBS or biotinylated control IgM in PBS for 2 hrs at room temperature. The plates were washed and incubated with streptavidin-conjugated alkaline phosphatase for 2 hrs. After washing, p-nitrophenyl phosphate substrate was added to each plate and, after incubation, the plates were read at 405 nm in an ELISA plate reader.

Figures 3 and 4 show antigen dose dependent binding of NovoMAb-G2 and NovoMAb-G2 scFv to melanoma (A-375) antigen (Figure 3) and glioma (SK-MG-1) antigen (Figure 4). These results indicate that Mab HI 1 binds to tumor cell extracts prepared from glioblastoma, breast adenocarcinoma and colon adenocarcinoma cells in a dose-dependent manner.

EXAMPLE 10 - Binding of Mab Hll to Human Tumor Cells Determined by Immunoperoxidase Staining

In order to determine immunoreactivity of HI 1, the following experiment was performed. Tumor cells grown in 24-well plates on coverslips for 48-96 hrs were washed. The cells were washed with PBS, fixed with formaldehyde and incubated with 5% normal goat serum on PBS for 30 min. After washing, the cells were incubated for 2 hrs with Mab HI 1 IgM in PBS with control human myeloma IgM. The cells were then washed and incubated with anti-human IgM conjugated to HRP. Finally, the cells were washed, incubated with DAB substrate to visualize Mab Hl l binding, counter- stained with hematoxylin and mounted in

GVA. The results of the immunoreactivity of Mab H l l are shown in Table 1 , where reactivity is indicated as negative (-), weak positive (+), positive (++), strong positive (+++). These results indicate that, as determined by immunoperoxidase staining, the epitope recognized by Mab H I 1 is expressed by a number of different types of human tumor cell lines.

Table 1 - Reactivity of Hll IgM with Tumor Cell Lines

CELL LINES/TYPE OF TUMOR REACTIVITY Control IgM Mab Hl l

HUMAN GLIOBLASTOMA

SKMG 1

U-118 MG

U-87 MG

HUMAN MALIGNANT MELANOMA

A-375

SK-MEL-5

HUMAN COLON ADENOCARCINOMA

SK-CO-1

HUMAN BREAST ADENOCARCINOMA

MG-468

MB-453 +

BT-20

BT-474

HUMAN KIDNEY ADENOCARCINOMA

SW-839

HUMAN OSTEOGENIC SARCOMA SAOS-2

HUMAN OVARY ADENOCARCINOMA SK-OV-3

EXAMPLE 11 - Binding of Mab Hl l to Human Tumor Cell Lines Determined by Cell- Fixed ELISA

The binding of H I 1 to human tumor cells and cell lines was also determined by cell-fixed ELISA. Growing tumor cells were detached from the T-flask by incubating with EDTA- PBS. Cells were collected by centrifugation, washed with PBS, resuspended in culture medium, counted, and fixed with formalin fixed (10,000) cells placed in each well of 96- well ELISA plates. The plates were then centrifuged at 1500 RPM for 10 minutes and supernatants were removed carefully. Plates containing tumor cells were then air dried and incubated at 37°C. The plates were blocked with PBS-BSA. The cells were then incubated with different concentrations (1-20 mg/mL) of either Mab HI 1 or control human myeloma IgM for 2 hrs. After incubation, the plates were washed, incubated with biotin-conjugated goat anti-human IgM, washed again and incubated with streptavidin-conjugated alkaline phosphatase. Finally, the plates were washed, incubated with p-nitrophenyl phosphate substrate and read at 405 nm with an ELISA plate reader.

Results of the reactivity of Mab HI 1 to human tumor cell lines by cell-fixed ELISA are shown in Table 2 and Figure 5. In Table 2, Control IgM 10 μg/mL were used for testing the reactivity, and values are given as ± S.D. These results indicate that: 1) Mab HI 1 reacts strongly with glioblastoma cells (SKMG-1), even at a low concentration of 1 μg/mL, whereas control IgM at 20 μg/mL does not react with SKMG- 1 cells; and 2) Mab H 1 1 recognizes the tumor antigen(s) present on numerous tumor cell lines (breast adenocarcinoma, colon adenocarcinoma, malignant melanoma, neuroblastoma, glioblastoma, lung adenocarcinoma, small cell lung carcinoma and prostate adenocarcinoma). The degree for Mab reactivity varies both with the type of cancer and the tumor cell lines. TABLE 2 - Binding of Mab to Tumor Cell Lines by ELISA

Cell lines/Tumor Type Reactivity (O.D. at 405 nm) Control IgM Mab Hl l

Human Glioblastoma

SKMG- 1 0.21 ± 0.01 0.95 ± 0.06

D-54-MG 0.13 ± 0.02 0.43 ± 0.07

U-87MG 0.13 ± 0.02 0.60 ± 0.01

Neuroblastoma

SK-N-SH 0.14 ± 0.02 0.96 ± 0.06

SK-N-MC 0.17 ± 0.03 1.00 ± 0.05

Malignant Melanoma

A-375 0.25 ± 0.04 1.25 ± 0.04

SK-MEL-5 0.18 ± 0.03 1.42 ± 0.04

SK-MEL-28 0.19 ± 0.03 1.79 ± 0.05

Breast adenocarcinoma

MB-453 0.68 ± 0.18 2.85 ± 0.14 MB-468 0.60 ± 0.03 2.39 ± 0.10 SK-BR-3 0.60 ± 0.03 2.14 ± 0.13

T47D 0.58 ± 0.01 2.13 ± 0.04

BT-20 0.57 ± 0.02 2.07 ± 0.13

BT-474 0.61 ± 0.03 2.20 ± 0.17

Lung adenocarcinoma

S W-900 0.20 ± 0.02 0.68 ± 0.10

SK-LU- 1 0.19 ± 0.02 0.57 ± 0.07

A-427 0.22 ± 0.01 0.88 ± 0.07

Small cell lung carcinoma

NCI-H69 0.25 ± 0.04 1.42 ± 0.20

NCI-H82 0.20 ± 0.09 1.16 ± 0.13

Colon adenocarcinoma

SK-Co-1 0.27 ± 0.03 0.98 ± 0.1 1

HT-29 0.37 ± 0.02 l .78 ± 0.20

Kidney Adenocarcinoma

S W-839 °-⁰² ± °-° ^! 1 -43 ± 0.01

Prostate adenocarcinoma

PC-3 0.17 ± 0.01 0.60 ± 0.01

DU-145 0.15 ± 0.01 0.52 ± 0.01

Osteogenic Sarcoma

SAOS-2 0.24 ± 0.02 1.22 ±0.07 0.13 ±0.04 1.93 ± 0.05

U-2 0S

Bladder Cell Carcinoma _τ_24 0.13 ± 0.01 1.25 ± 0.03

Ovarian Adenocarcinoma

SK-OV-3 .012 ± 0.01 1.14 ±0.02

Larynx Carcinoma

HEP-2 0.25 ±0.01 1.25 ± 0.01

Normal Human Fibroblast

GM-8333 0.13 ± 0.01 0.39 ± 0.01

EXAMPLE 12 - Immunoanatomic Distribution and Immunopathologic Analysis of Hll

Irnmunohistochemistry was used to determine expression of HI 1 for evaluation of micro- anatomical detail and heterogeneity in tissues and tumors. Limitations of this technique include possible false negative results due to low levels of expression of the molecule under study, as well as false positive results (cross-reactivity) due to antibody-binding to similar epitopes or epitopes shared by other antigens. To address these limitations, this study was carried out at the highest concentration of antibody that did not show non-specific binding by a control antibody. This allowed for detection of all levels of cross-reactivity in different tissues. In addition, fixation analysis to establish the best combination of antigenic staining intensity and moφhological preservation, was performed. The present example presents results obtained from IMPATH Inc., New York, which was retained to study the cellular specificity and antigen expression of HI 1, on a selected panel of cryostat-cut frozen sections of normal and tumor tissues. The study used an indirect immunoperoxidase technique.

Histologically normal human tissues were obtained from surgical and autopsy specimens. These fresh tissues were embedded in OCT compound (Miles Laboratories, Inc., Naperville, IL) in cryomolds and snap-frozen in isopentane, cooled by liquid nitrogen. These tissues from IMPATH's frozen tissue bank were then cut at 5 microns, placed on poly-L-lysine coated slides, air-dried, and stored in a -70°C tissue bank until needed.

Hl l, received on cold pack and stored at 2-8°C, was supplied as non-biotinylated antibody at a concentration of 200 mg/mL, total volume of 3.0 mL. A human myeloma IgM (Pierce Cat. #31146), also supplied by Novopharm Biotech, Inc., was used as the negative control antibody. Both the negative control antibody and HI 1 were diluted in phosphate buffered saline (PBS) to the same working concentrations dictated by titration analysis of HI 1. The peroxidase-labeled secondary antibody was a goat anti-human IgM (American Qualex, San Clemente, CA, lot #A112PN) diluted in PBS to 1 :500.

The puφose of the fixation analysis was to establish the conditions which provide the optimal combination of antigenic staining intensity and moφhologic preservation. The positive control tissue was tested with five fixation protocols, including no fixation. The fixation protocols tested were 10% neutral buffered formalin (23-25°C), acetone (2-8°C), methyl/acetone (1 : 1 V/V, 2-8°C) and 95% ethanol (23-25°C). For this study, 10% neutral buffered formalin (NBF) gave optimal results for H 1 1.

Using 10% NBF as the fixative, serial antibody dilutions (20.0 μg/mL to 0.1 μg/ml) were tested on the positive control, human breast carcinoma. A concentration of 10.0 μg/mL of antibody HI 1 gave optimal results — maximum staining intensity without significant background staining of the negative control. Immunoperoxidase Techniques: Immunohistochemical studies were performed using an indirect immunoperoxidase method. The cryostat cut sections were removed from the - 70°C freezer, air-dried and fixed (fixation details provided below). Tissue sections were blocked for 10 minutes with 5% normal goat serum diluted in PBS, then incubated with the primary antibody overnight at 4°C. Slides were washed in PBS, followed by a wash with 0.5%) Tween/PBS solution, then another wash in PBS. Endogenous peroxidase activity was blocked with a 30 minute 3% hydrogen peroxide/methanol incubation, followed by 3 washes of PBS. The sections were then incubated with goat anti-human IgM (peroxidase- labeled) secondary antibody for 15 minutes, at room temperature, and washed in PBS as described above.

The peroxidase reaction was visualized by incubating tissue sections for 2-5 minutes with 3, 3-diaminobenzidine-tetrahydrochloride (DAB) (Sigma Chemical Co., St. Louis, MO). Tissue sections were thoroughly washed, counterstained with a modified Harris hematoxylin

(Fisher Scientific, Fairlawn, NJ) dehydrated through graded alcohols, cleared in xylene, and coverslipped. Tissues that demonstrated high levels of background staining with the negative control antibody were stained again utilizing more extensive washing.

Human breast carcinoma (F95-036), supplied by IMPATH, was used as the positive control for HI 1. Negative controls substituted the primary test antibody with purified human myeloma IgM.

The results obtained are depicted in Tables 3, 4 and 5. Table 3 depicts cell surface reactivity of Mab HI 1 with tumor cell lines determined by flow cytometry. Table 4 depicts HI 1 reactivity on normal tissues and Table 5 shows Hl l reactivity on human tumors. TABLE 3 Cell Surface Reactivity of Mab HI 1 with Tumor Cell Lines, Determined by Flow Cytometry

% Reactivity (Positive Cells)

Tumor Cell Lines Control IgM MAb Hll

A-375 (melanoma) 9 99

SKMG-1 (Glioma) 10 95

LS-174T (Colon Adenocarcinoma) 10 53

HT-29 (Colon Adenocarcinoma) 20 38

MB-468 (Breast Adenocarcinoma) 22 65

T-47D (Breast Ductal Carcinoma) 25 51

TABLE 4

Tested Range of

Tissue Positive/Total Reactivity (0-3+)

Adrenal 0/3 0

Bladder 0/3 0

Bone Marrow 1/3 1+

Brain 0/3 0

Breast 0/3 0

Cervix 0/3 0

Esophagus 0/3 0

Eye 0/3 0

Heart 0/3 0

Kidney 0/3 0

Large Intestine 0/3 0

Liver 0/3 0

Lung 0/3 0

Lymph Node 0/3 0

Muscle 0/3 0

Ovary 0/2 0

Pancreas 0/3 0

Parotid 0/3 0

Pituitary 0/1 0 Prostate 0/3 0

Skin 0/3 0

Small intestine 0/3 0

Spinal cord 0/3 0

Spleen 0/3 0

Stomach 0/3 0

Testis 0/3 0

Thymus 0/3 0

Thyroid 0/3 0

Tonsil 1/3 1 +

Uterus 0/3 0

White Blood Cell 0/3 0

TABLE 5

Tested % of Tumor Range of

Tumor Positive/Tota l Cells Reactivity

1 Staining (0-3+)

Breast carcinoma 2/3 30-90 1-3+

Colon carcinoma 3/3 40-70 1-2+

Glioma 4/6 30-90 1-2+

Gastric carcinoma 3/3 30-50 1-2+

Lung adenocarcinoma 3/4 10-70 1-2+

Lung squamous 3/3 10-95 1-3+ carcinoma

Lung small cell Vl 30 1+ carcinoma

Lymphoma 8/8 10-95 1-3+

Melanoma 3/3 20-95 1-2+

Ovarian carcinoma 3/3 20-30 1-3+

Prostate carcinoma 3/3 20-95 1-2+

Sarcoma 0/3 0 0

The results indicate that weak (1+) to strong (3+) reactivity was observed in over 70% of the positive control sample. The antigen recognized by HI 1 has a restricted pattern of distribution. HI 1 was largely unreactive with normal human tissues tested in the IMPATH system. All simple epithelial cells, as well as the stratified epithelia and squamous epithelia of different organs, were found to be unreactive. No reactivity was observed in neuroectodermal cells, including those in the brain, spinal cord and peripheral nerves. Mesenchymal elements such as skeletal and smooth muscle cells, fibroblasts, and endothelial cells were negative. Tissues of lymphoid origin including bone marrow, lymph node, spleen, and thymus were largely unreactive with antibody Hl l . Weak (1+) reactivity was observed in rare cells in one specimen of bone marrow and in the germinal centers of one of three specimens of tonsil tested.

Positive immunoreactivity was observed in almost all specimens of tumor tested including breast, colon, glioma, gastric, lung (adeno, squamous, and small cell), lymphoma, melanoma, ovarian, and prostate. Reactivity was seen in 10% to greater than 95% of the tumor cells present in these specimens; staining intensity ranged from weak (1+) to strong (3+).

Antibody Hl l was, however, unreactive with all three specimens of sarcoma tested. Some, but not all, normal counteφarts of the tumor cells, when present in the specimens, were reactive with Hl l . A few normal cells present in breast, gastric and prostate carcinoma were reactive with antibody Hl l. The large granular cells that were reactive with antibody Hl l are believed to be inflammatory cells of the eosinophil-mast cell lineage.

In summary, antibody HI 1 is largely unreactive with normal human tissues with the exception of some normal cells such as infiltrating leukocytes, tissue present in rumors. The HI 1 antibody detects an antigen that is expressed in almost all of the tumors tested in the present study.

EXAMPLE 13 - Therapeutic Effect of Hll scFv on Human Tumor Xenografts

The potential of HI 1 scFv as a cancer therapeutic agent was explored using a human tumor xenograft mouse model (Balb/c athymic nude mice). In these studies, outlined below, an anti-tumor effect was found to be associated with HI 1 scFv treatment in mice implanted with one of the following human tumors: non-Hodgkin's B-cell lymphoma, prostate adenocarcinoma, breast adenocarcinoma, and melanoma. The anti-tumor effects observed, at the doses given, include reduced tumor size, tumor regression, reduced metastatic index and increased survival.

A. Non-Hodgkin 's Lymphoma Mice that were implanted with human non-Hodgkin's lymphoma (Daudi) tissue exhibited a smaller mean tumor volume than their control counteφarts (n=3) after being treated with HI 1 scFv (n=9) and HI 1 scFv-restrictocin (n=9). The total dose of HI 1 scFv given was 0.5 mg/kg in a regimen that consisted of 0.1 mg/injection given intravenously (i.v.), 5 times, once, every 4 days. In the HI 1 scFv-restrictocin-treated group, 2 of 8 animals remaining on Day 38 of the study exhibited partial tumor regression. Despite the reduction in mean tumor volume, the differences found on the last day of the study (Day 38) were not significantly different from that determined for control animals. (p=0.405, Student's t-test, HI 1 scFv; p=0.423, Hl l scFv-restrictocin).

In a follow-up to the first lymphoma study, mice implanted with Daudi were treated with a total dose of 1 mg/kg of HI 1 scFv (n=13). These HI 1 scFv-treated mice demonstrated a statistically significant suppression of tumor growth compared to controls at Day 42 (n=8), (P-0.004, Student's t-test). Moreover, 31% (4/18) of the Hl l scFv-treated animals exhibited tumor regression, with 3 being partial and 1 being complete. No spontaneous regression was observed in the control animals. The dose used was administered at

O.lmg/kg i.v., given once a day for 5 days, rested for 9 days, and then retreated for 5 days as before.

A third study implanted Balb/C athymic mice with varying sizes (4-10, 30-60 and 100-200 mm³) of human non-Hodgkin's B-cell lymphoma tumor tissue and given a total dose of 20 mg/kg HI 1 scFv. The dose regimen included 4 cycles of HI 1 scFv treatment (1 cycle of treatment constituted 5 daily i.v. injections of 1 mg/kg with each cycle being separated by 2 days of rest). There were 22 animals in each treatment group. At the end of treatment all mice treated with HI 1 scFv showed a reduction in tumor volume compared to controls. The difference was statically significant at Day 51, compared to controls, for the 4-10 and 30-60 mm³ size tumors (p=0.02 and p=0.006, respectively).

Tumor regression was seen in 22% (4/18), 10.5% (2/19) and 12% (3/25) of the mice having tumor sizes of 4-10, 30-60 and 100-200mm³, respectively, at the onset of treatment. Most notably, for 75% (3/4) of the mice with a tumor size of 4- 10mm³ at the beginning of the HI 1 scFv treatment, tumor regression was complete. Control animals did not show rumor regression.

β. Melanoma

Mice were implanted with a human melanoma tumor (GI-105) and treated with a total of 1 mg/kg of HI 1 scFv (0.1 mg/kg) once a day for 5 days, rested for 9 days, and then retreated for 5 days. Although the mean tumor volumes of the HI 1 scFv-treated and control groups at the conclusion of the study (Day 42) were not statistically different, the survival rate was higher in the HI 1 scFv-treated group. The animals treated with drug had a mortality rate of 21% (3/14). In contrast, 50% (4 of 8) of the control mice died.

C. Breast Adenocarcinoma

A trial involving mice implanted with a highly metastatic human breast adenocarcinoma (Gl- 101) was also conducted. These animals were given 5 daily i.v. treatments (O.lmg/kg) of HI 1 scFv, rested for 9 days, retreated for 5 days and then given twice weekly injections at the same dosage for approximately 7 weeks. The total dose given was 2.4 mg/kg. All animals were sacrificed on day 77 and the lungs removed for histologic examination and quantification of metastatic foci. The number of metastatic foci was expressed as a metastatic index using the following procedure. Briefly, on each slide, two different lung sections were measured with calipers and the number of metastatic foci in each section was counted. Each focus was counted as containing 1-10 cells, 11-50 cells or greater than 50 cells. When the metastatic index was calculated, foci with 1-10 cells were assigned a value of 1, foci containing 11-50 cells were assigned a value of 5 and foci containing greater than 50 cells were assigned a value of 10. The number of foci of each type was multiplied by it's assigned value and these numbers were added together to obtain the total metastatic index (MI). The MI was then divided by the number of mm² of lung screened. A final score of

Ml/mm² was then reported.

Although the mean tumor volume of the HI 1 scFv-treated group was approximately half that calculated for the control group at the end of the study, 237 mm³ versus 429 mm³, respectively, the difference was not, statistically different (p=0.358 at Day 42). However, the HI 1 scFv-treated mice exhibited a significantly reduced number of metastatic foci in the lungs than control mice, 14 versus 21, respectively (Chi-square analysis, p<0.05).

D. Prostate Cancer

Mice were implanted with a human prostate cancer tumor and then given 4 cycles of HI 1 scFv treatment (1 cycle of treatment constituted 5 daily i.v. injections of lmgkg with each cycle being separated by 2 days of rest). Upon completion of the i.v. protocol, the same treatment schedule and dose regimen were repeated except that HI 1 scFv was administered intraperitoneally. The total dose was 20mg/kg. The treated animals showed marked suppression of tumor size compared to controls. Treatment also had an effect on survival. Thirty-eight percent (6/16) of the mice with 4-20mm³ size tumors at the start of treatment with HI 1 scFv demonstrated long term survival (>100 days). This was significantly different from controls where all animals (10/10) were dead before day 100. Together, these results demonstrate that H 11 scFv, when administered to athymic mice bearing human tumor tissue implants, possesses potent in vivo anti-cancer activity against human tumors of various origins.

EXAMPLE 14 - Human Mabs Directed Against Cancer-associated SPPC

Human-human hybridomas secreting monoclonal antibodies (Mabs) specific for cancer- associated SPPCs are generated by fusing peripheral blood lymphocytes (PBL) from a patient presenting with a malignancy. The fusion protocol has been previously described by Maiti et al (1997).

Briefly, PBL isolated by Ficoll gradient density centrifugation are mixed at a PBL: fusion partner ratio of 3:1 in serum- free medium. The fusion partner is an Epstein-Barr nuclear antigen-negative, human myeloma-like cell line, TM-H2-SP2 (Sullivan et al. Hybridoma Technology, pp. 63-68, L. Russ, D. Carlton, eds. Ortho Pharmaceuticals Canada Ltd., Toronto, 1982). The cell mixture is centrifuged (400 xg, 5 min), the supernatant removed and membrane fusion facilitated by the addition of 1 mL of pre- warmed (37°C) 40% polyethylene glycol (PEG) in serum-free medium directly into the pellet over a period of 1 min. One mL of serum-free medium is added again directly into the pellet over 1 min and this step repeated twice more.

An additional 7 mL serum free medium is added slowly (over the course of 2 min) to the pellet with stirring and a final 12 to 13 mL added dropwise to the mixture. After which, the cell mixture is centrifuged (400 xg, 5 min), the supernatant discarded and the cell pellet resuspended to a final cell concentration of 1.0 x 10 cells/mL in complete medium containing hypoxanthine (H, 100 TM) and thymidine (T, 16 TM). A 200 mL volume of the cell mixture is aliquoted into each well of a sterile 96 well flat-bottom tissue culture plate. The following day 100 mL is removed from each well and replaced with 100 mL of complete medium containing aminopterin (A, 2X, 0.8 TM). Several wells containing the fusion partner alone are added to one of the plates to ensure the selectivity of the medium. Every 3 to 4 days, half of the medium is removed and replaced with medium containing HAT and monitored for the growth of hybridomas. Wells containing hybrids are screened for anti-SPPC reactivity using the dot-blot procedure detailed in the above Examples. Wells exhibiting reactivity towards the SPPC fraction are expanded into 24 well plates.

Supernatants from these cultures are tested against the cell membrane fraction containing the SPPC in the presence and absence of ATP. Clones demonstrating antibody reactivity in the absence of ATP, but negative in the presence of ATP, are cloned by limiting dilution into 96 well plates at 1 cell per well. All subclones are re-tested and the cloning procedure repeated twice more with the best positive subclones.

EXAMPLE 15 - The Effect of Hll scFv and Hll scFv-TNF on the Growth of human B Cell Lymphoma, Daudi, Human Melanoma and Human Breast Adenocarcinoma

The anti-tumor potential of HI 1 scFv was investigated in mice bearing one of several human cancers. HI 1 scFv itself was shown to suppress different aspects of the tumors under study. HI 1 scFv significantly suppressed the growth rate of the lymphoma (Daudi) an in some cases caused tumor regression. Also, HI 1 scFv treatment reduced the number and size of the metastatic foci in mice with a spontaneously metastasizing breast adenocarcinoma (Gl- 101) and increased the survival of mice with melanoma (Gl- 105). Tumor Cell Lines. Daudi, a human non-Hodgkin's lymphoma tumor cell line, was obtained by Goodwin from ATCC (clone designation CCL-213) and maintained in culture in RPMI 1640, 10% FCS, at 37°C and 5% CO2. GI-101, a human breast adenocarcinoma that spontaneously metatstasizes to the lungs, and GI-105, a human melanoma tumor cell line, were provided by Goodwin. Both the Goodwin tumor cell lines were maintained by continuous passage in athymic mice.

Animal Models. Three separate trials were conducted to assess the anti-tumor effect of HI 1 scFv on the growth of three different human cancers (non-Hodgkin's B cell lymphoma, breast adenocarcinoma, and melanoma) in a human tumor, xenograft, athymic mouse model. For each cancer, 6-8 week old athymic Balb/c female mice were implanted subcutaneously on the right shoulder with 4mm³ fragments of rumor. On day 5 post- implant, tumor volumes were measured and the animals randomly assigned to one of three groups; those animals treated with 1) HI 1 scFv-TNF, 2) HI 1 scFv alone, and 3) PBS. Treatment was initiated 7 days post-implant. Animals received daily i.v. injections of either

HI 1 scFv or HI 1 scFv-TNF at a dose of O.lmg/kg in 100 μl PBS. Control animals were injected with 100 μl PBS. After 5 days of treatment, the mice were rested for 9 days and the treatment resumed for an additional 5 days. Daudi and GI-105 mice received no further treatment. The GI-105 mice started twice weekly treatments 3 days after the second 5 day course of treatment until day 77. Tumor growth was monitored twice each week by measuring the length, width and height of the tumor with calipers, multiplying these measurements and dividing by two to obtain tumor volume. For mice receiving the GI-101 tumor line, all mice where sacrificed on day 77 and the lungs removed for histological examination and quantification of metastatic foci. Two different lung sections were processed for each slide. Calipers were used to measure the size of each section and the number of metastatic foci counted. Each focus was counted as containing 1-10, 11-50, or >50 cells. Foci with 1-10 cells were assigned a value of 1, foci containing 11-50 cells a value of 5, and foci >50 a value of 10. The metastatic index (MI) for each lung section was obtained by multiplying the number of foci in each group b the assigned value and adding the resulting numbers. The MI was then weighted according to the size of the section scanned by dividing the MI by the area of the section. Statistical Analysis. For puφose of statistical analysis, the tumor measurements, for a given day, in each of the groups, were converted to log values. The arithmetic means were derived from the log values and comparisons made between groups using parametric (Student's t-test) or non-parametric (Mann- Whitney rank sum test) tests depending on whether the data was normally distributed. The geometric mean was determined by calculating the anti^:log of the arithmetic mean of the log values for each time point and this value was plotted against time. Chi square analysis was done to detect any significant differences in the number of metastatic foci in mice implanted with GI-101 tumor tissue.

The effect of Hll scFv-TNF fusion protein and Hll scFv alone on Daudi tumor growth: The change in mean tumor size of the Daudi lymphoma with time in the group of mice treated with HI 1 scFv-TNF was much different from that observed in the group of animals treated with PBS (Figure 1 1). The mean tumor growth in the PBS-treated group increased rapidly from day 17 onward. In contrast, HI 1 scFv-TNF-treated animals experienced a slower change in mean tumor size over time such that there was a distinct difference between the two groups by the end of the study (day 42). However, this difference was not enough to be statistically significant (Students' t-test, P=0.346). Suφrisingly, the mice that received HI 1 scFv alone exhibited the slowest tumor growth rate. So much so, the mean tumor size on day 42 of the HI 1 scFv-treatment group was significantly smaller than that of the PBS-treated and HI 1 scFv-TNF-treated mice (Student's t-test, P=0.004 and P=0.007, respectively). Moreover, 31% (4 of 13) of the animals demonstrated tumor regression with 3 of 4 being partial and 1 being complete. No tumor regression was observed in the groups of animals treated with HI 1 scFv-TNF or with PBS. Thus, HI 1 scFv and Hl l scFv-TNF treatment suppressed the growth of the lymphoma; however, HI 1 scFv alone was significantly more effective.

The effect of Hll scFv on GI-101 tumor growth: The mean tumor size in the group of animals treated with HI 1 scFv alone increased at a slower rate when compared to PBS- treated animals. In the HI 1 scFv-treatment group the mean tumor size by the end of the study (day 42) was approximately half that calculated for the PBS-treated mice (237 vs. 429 mm³) but the difference was not statistically significant (Student's t-test, P=0.358; see Figure 12).

The same rank order of treatment effectiveness shown above for the change in mean tumor volume over time was also observed regarding the metastatic index (MI) (Table 6). That is, the number of metastatic foci in the lungs of mice treated with HI 1 scFv was significantly reduced when compared with PBS control mice.

Table 6. Effect of HI 1 scFv on the Development and Growth of Metastatic Foci in Mice Implanted with the Breast Adenocarcinoma GI-101

Frequency Ml/mm²

Treatment <10 cells >10<50 cells >50 cells

PBS 8 8 5 0.9

Hl l scFv* 5 6 3 0.41

*Statistically significant versus PBS treatment group by Chi-square analysis, p<0.05. Ml/mm²: geometric mean MI expressed as a function of the mean area of tissue.

The effect of Hll scFv and Hll scFv-TNF on GI-105 tumor growth The effect on HI 1 scFv-TNF on the growth of the human melanoma GI-105 is shown in Figure 8. The tumors in all treatment groups grew at a similar rate until 31 days post- implant at which time the mean tumor size in the PBS-treated group increased dramatically with respect to the HI 1 scFv and HI 1 scFv-TNF treated animals. On subsequent days, the mean tumor size for the PBS-treated animals fluctuated as animals were removed from the group through death. In contrast, HI 1 scFv and HI 1 scFv-TNF treated animals exhibited a slower but steady increase in mean rumor size. The differences in the mean tumor volume on day 31 between the PBS-treated group and the animal groups treated with HI 1 scFv and HI 1 scFv-TNF were not statistically significant. Despite minor differences in mean tumor size, the animal groups treated with either form of scFv exhibited better survival when compared to the PBS-treated animals. Mortality observed in the HI 1 scFv and HI 1-scFv- TNF groups by the end of the study were 21% (3 of 14, not significant) and 8.3% (1 of 12,

d.f.) respectively. In contrast, 50% (4 of 8) of the PBS-treated control mice had died. The failure of H 1 1 scFv and H 1 1 scFv-TNF treatment to significantly slow the growth rate of the primary tumor while reducing mortality in the animals, suggests that, the dosage used may be insufficient to cause regression of this tumor. However, it may be enough to prevent metastasis, and therefore, the development of secondary tumors.

In summary, treatment with HI 1 scFv alone had a positive effect against the cancers tested.

HI 1 scFv treatment caused a significant reduction in mean tumor volume in lymphoma- bearing mice. The treatment reduced the size of the lung metastatic foci in the mice with the breast carcinoma and increased the survival rate for mice with the melanoma.

Thus, the study shows that HI 1-scFv treatment mediates an anti-tumor response against human lymphoma, melanoma and breast carcinoma in a human tumor xenograft, athymic, mouse model.

EXAMPLE 16 - Use of Hll scFv to Treat Breast Carcinoma Second GI-101 Experiment

This study explored the effects of recombinant unconjugated HI 1 single chain Fv (scFv) and PBS on the growth rate and metastic index of spontaneously metastasizing human breast tumor (GI-101; U.S. patent No. 5,693,533) xenografts implanted in athymic nude mice. Groups of 10-16 mice were implanted with 4mm³ rumor fragments, and beginning on day 7 post implantation, given HI 1 scFv (o.l or 10 mg/kg) or PBS, by tail vein injection once per day x5d, followed by 2 days of rest, for four cycles. Starting on day 42 post implantation, the animals were given twice weekly i.p. injections of the same dose of HI 1 scFv (or PBS) until the end of the trial.

Analysis of Tissue Cross Sectional Areas'. The three groups of animals: PBS, Hl l scFv 0.1 mg/kg, and HI 1 scFv 10 mg/kg were killed and the lungs removed. From each lung, anywhere from one to five slide sections were taken, and the tissue cross sectional areas measured. If there were significant differences between the mean tissue cross sectional areas of each of the three groups, then this might introduce bias into the counting of metastatic colonies in each group of animals.

Harvested on day 42 were 33 tissue sections from the PBS group, and 29 from each of the 0.1 mg/kg and 10 mg/kg groups. Single factor analysis of variance was used to determine if there were any significant differences, in the mean cross sectional areas of each group. The results are given in Table 7 and Figure 6. There were no significant differences between the mean cross sectional areas of the three groups. It may be concluded that tissue cross sectional area did not introduce any bias into the counting of metastatic foci.

Table 7: Analysis of Variance of Mean Tissue Cross-sectional Areas, day 42, α=0.05

Groups Count Sum Average Variance

PBS 33 1276 38.66666667 115.6041667

Hl l scFv 0.1 mg/kg 29 1188 40.96551724 236.4630542 Hl l scFv 10 mg/kg 29 1132 39.03448276 1300.463054

ANOVA

Source of Variation SS df MS £ P-value F crit

Between Groups 91.46090691 2 45.73045345 0.0861 1168 0.917568974 3.100069534 Within Groups 46733.26437 88 531.0598224

Total 46824.72527 90

Harvested on day 100 were 63 tissue sections from the PBS group. 56 from the 0.1 mg/kg group, and 77 from the 10 mg/kg group. Single factor analysis of variance was used to determine if there were any significant differences in the mean cross sectional areas of each group. The results are given in Table 8 and Figure 7. There was no significant difference in the mean tissue cross sectional areas of the three groups, however, there was considerably more variation than with the day 42 tissue sections. It may be concluded that tissue cross sectional area did not introduce any bias into the counting of metastatic foci. Table 8: Analysis of Variance of mean tissue cross sectional areas, day 100, =0.05 SUMMARY

Groups Count Sum Average Variance

PBS 63 1777 28.20634921 152.1664107

Hl l scFv 0.1 mg/kg 56 1733 30.94642857 208.1607143 Hl l scFv 10 mg/kg 77 2576 33.45454545 217.5933014

ANOVA

Source of Variation SS df MS P-value F-crit

Between Groups 955.2421408 2 477.6210704 2.463395417 0.087818911 3.042714525 Within Groups 37420.24766 193 193.8872935

Total 38375.4898 195

Analysis of metastatic foci of the three groups of animals: PBS, HI 1 scFv 0.1 mg/kg, and Hl l scFv 10 mg/kg was carried out as follows. From one to five tissue sections were taken, and for each section, the cross sectional area was measured and the number of metastatic foci counted. Each focus was then classified according to size, and grouped into one of three groups based on the number of cells per focus: 1-5, 6-50, and >50. Using this approach, it was possible to calculate a mean number of metastatic foci of a particular size (1-5, 6-50, or >50), per area of tissue, per animal. In some cases, only one tissue section was available per animal, and in others, up to five. Averaging all the animals in a group, a mean of the mean number of metastatic foci of a particular size (1-5, 6-50, or >50), per area of tissue, was estimated for each of the three treatment groups.

Day 42 results are given below in Table 9, which represents means and standard errors for each metastatic focus size and treatment group. Statistical analysis involved comparing the two treatment groups (0.1 and 10 mg/kg) to the PBS control, for each of the three sizes of metastatic focus. As a preliminary step, an F-tesX was performed with =0.05 to determine if there were significant differences in the variances of each group. In cases where the variances were significantly different, a one-tailed, unpaired Student's t-test, assuming unequal variances was used. In cases where the variances were found not to be significantly different, a one-tailed, unpaired Student's t-test, assuming equal variances, was used. The statistical results are given below in Table 9

Table 9: Probability table

CELLS/ FOCUS

Note:

One-tailed, unpaired t-tests vs. PBS

* = statistically significant versus PBS treatment group by Chi-square analysis, p<0.05

Thus, HI 1 scFv, at a dose of 10 mg/kg, appears to be effective in reducing the number of metastatic foci of GI-101 breast carcinoma. At a dose of 10 mg/kg, HI 1 scFv caused a significant (p<0.005) reduction in the proportion of animals with lung metastases (10%> vs. 80% in PBS group) as well as a significant (p<0.01 decrease in the mean number of metastatic units among affected animals (0.09 vs. 0.83 in PBS group). A 50%, albeit nonsignificant reduction in the mean metastatic units was also observed at the dose of 0.1 mg/kg. In all sizes of metastatic foci, there is a clear-cut dose/effect response.

EXAMPLE 17 - Effect of Hll scFv on the Formation of Human Lung Metastatic Tumor Foci in Vivo

Green fluorescent protein (GFP) is encoded by a gene that has been cloned from the bioluminescent jelly fish Aequorea victoria. Because of its bright fluorescence, the cellular expression of GFP in tumor cell lines has been used recently to visualize micrometastases in vivo (1). Balb/c^πw "" mice were injected intradermally with SK-MEL-5-GFP stable transfectants (10° cells in 100:1 of PBS). SK-MEL-5 (ATCC #HTB-70) is a human malignant melanoma cell line that is HI 1 -positive. After implantation, the mice were randomly separated into groups with the test group receiving HI 1 scFv and the control groups receiving a control scFv molecule having an irrelevant specificity and PBS. Animals were sacrificed at defined intervals over a 6 to 8 week period and lung sections analyzed by light and fluorescent microscopy. Metastatic disease in each animal was analyzed by counting the number of foci and by weighting each focus according to one of 3 sizes. A final score for each section was determined by adding together the corrected scores for each of the 3 foci sizes. Three to five sections were scanned for each mouse and the combined scores were used to calculate a final mean score for each mouse.

EXAMPLE 18 - Clinical Study of Imaging with Recombinant Mab Fragment in Patients with Progressive non-Hodgkin's Lymphoma

A phase I safety and imaging study was conducted regarding a single intravenous dose of '"in-DTPA-Hl 1 scFv, a recombinant human monoclonal antibody fragment, in patients with progressive B-cell non-Hodgkin's lymphoma (British Columbia Cancer Agency, Vancouver, British Columbia, Canada). Five patients were enrolled and completed the study. A single intravenous dose of 2 mg of DTPA-H11 scFv labeled with 5 mCi of ' "in was administered. Patients underwent whole body planar imaging starting at 15-30 minutes, 1-2, 4-6, 10-14 (optional), 22-26 and 46-50 hours post-dose, each lasting approximately 30- 60 minutes. Blood samples for pharmacokinetic evaluations were to be drawn at pre-dose and at 5, 10, 15, 30, 45, and 60 minutes, and 2, 4, 12, 24, and 48 hours post-dose. Urine samples were to be collected for 48 hours post-dose. Patients returned for follow-up assessments at day 14 and day 28 after drug administration.

Imaging demonstrated that NovoMAb-G2-scFv localized to known tumor sites in 4 patients. The study drug, ^{ι π}In-DTPA-Hl 1 scFv, was well tolerated in all 5 patients. The study drug showed binding specificity by localizing to known tumor sites in 4/5 patients. The mean terminal half-life in blood and serum was 33.4 and 32.2 hours respectively. Only one adverse event, left arm tenderness which lasted for 7-8 minutes, was rated as possibly related to the study drug. All other events were unlikely or not related to the study drug.

EXAMPLE 19 - Purification of HSP70 and SPPC70 for Phage Display Antibody Library Screening

Human melanoma cells (A375) were suspended in phosphate buffered saline (PBS) containing 1 mM PMSF (phenyl methyl sulfonyl fluoride), and sonicated on ice, until over 95% of the cells were lysed. The lysate is centrifuged at 2500 RPM for 30 min to remove unbroken cells and cell debris. The supernant (1500 ml) was collected and recentrifuged at

1000 xg for 30 min before loading onto a Sephadex G-25 (AmershamPharmacia) column equilibrated with 20 mM Tris, 20 mM NaCl, 0.1 mM EDTA, 3 mM MgC12, pH 7.5 (buffer A). After eluting with buffer A, the fractions containing the bulk of the proteins, as determined by monitoring the column effluent at A280 were pooled and loaded onto a ADP agarose column (Sigma) pre-equilibrated with Buffer A. The column was then washed with

Buffer B ( 20 mM Tris, 0.1 mM EDTA, 3 mM MgC12, 500 mM NaCl, pH 7.5) until the A280 baseline was stable. Subsequently, bound proteins were eluted with 5 column volumes of Buffer C (20 mM Tris, 0.1 mM EDTA, 3 mM MgC12, 500 mM NaCl, 3 mM ADP, pH 7.5). The fractions were pooled and the buffer exchanged with buffer A using a Sephadex G-25 column. This material was loaded onto a HiTrap Q 1 ml column

(Pharmacia) pre-equilibrated with Buffer A. Finally, bound proteins were eluted with a linear gradient up to 100%) Buffer B in 15 column volumes. The fractions were analyzed by SDS-PAGE and immunoblotting. Fractions showing a single silver-stained band following SDS-PAGE and positive imunoblotting with the anti-hsp70 antibody (Stressgen) were pooled and concentrated. About 675 μg purified HSP70/SPPC70 was obtained, which showed a single band on SDS-PAGE, and showed positive binding to an anti-hsp 70 antibody (StressGen) on Western Blot.

EXAMPLE 20 - Construction and Expression of Hll scFv

The μ heavy chain and K light chain of NovoMAb-G2 were cloned from NBGM1/H1 1 hybridoma cells (Maiti et al. 1997). Briefly, mRNA was purified by guanidinium thiocyanate extraction and oligo (dt) cellulose chromatography using the QuickPrep Micro mRNA purification kit (Pharmacia Biotech, Uppsala, Sweden). First strand cDNA synthesis was done by RT-PCR using the Advantage RT for PCR kit (Clontech Laboratories, Inc., Palo Alto, CA) with primers 5'μ (5'-

TCTAAAGAAGCCCCTGGGAGCACAGCTCCTCACCATG), 3'μ (5'- CTCTCTCTGGTCTCCGATGTTCTTCTGTTGGGATCA), 5'κ (5'-TCAGT- CTCAGTCAGGACACAGCATGGACATG) and 3'κ (5^*-GGAACTGAGGAGCAG- GTGGGGGCACTTCTCCCTCTA) which correspond to the constant region consensus sequences. The H-chain was then subcloned into the pGEM-T vector (Promega, Madison,

WI) and the L-chain into pT7 vector (Novogen, Madison, WI). These plasmids were subsequently used as templates for amplifying the scFv gene. The HI 1 V_L and V_H gene fragments were PCR-amplified with oligonucleotides HI 1KT (5'- TATGAAGACACCAGGCCGATATTGTGTTGAC-GCAG)/PCR-NPII (5'- ACCTCCGGAACCGCCACCGCCAGAGACAGATGGTG-CAGCCACAGTTC) and HI1MTLL (5'-TATATATCCGGAGGTGGTGGATCAG-

GTGGAGGTGGCTCCCAGGTGCAGCTGGTGGAGTCT)/H11MB (5'-TATGGA- TCCTGAGGAGACGGTGACCGT), respectively, to introduce a sequence encoding a (Gly₄Ser) linker and restriction sites for cloning into vector pSJFl containing the ompA leader peptide sequence as well as the c-myc detection and His-5 purification tags.

Production and purification of Hll scFv: E. coli TGI cells containing the NovoMAb-G2 scFv plasmid were grown in shake flasks at 26 C in M-9 minimal medium supplemented with 0.4% casamino acids and 30 μg/ml kanamycin. At 30 h, cultures were induced with additional nutrients (12 g tryptone, 24 g yeast extract and 4 ml glycerol per liter) and 1 mM isopropylthiogalactopyranoside (IPTG). Cultures were harvested 36-48 h later and the periplasmic proteins extracted with a hypertonic sucrose buffer (25% sucrose, 1 mM EDTA, 10 mM Tris-HCl pH 8.0) followed by ice-cold hypotonic shock buffer (0.5 mM MgCl₂, 10 mM Tris-HCl pH 8.0). The NovoMAb-G2 scFv was purified from the resulting supernatant by immobilized metal-chelate affinity chromatography (IMAC) followed by ion-exchange chromatography and gel-filtration. Purified NovoMAb-G2-scFv was eluted in buffer containing lOmM sodium phosphate and 300 mM sodium chloride (pH 7.2).

EXAMPLE 21 - Sub-cloning and Expression of scFvs

To amplify scFv DNA inserts in fd-tet, single colonies were suspended in PCR mixtures containing 200 μM each of the four dNTPs, 5 μl 10X buffer (PE), 10 pmol/μl each of fd-tet, -96 gill: 5'(CCCTCATAGTTAGCGTAACG)3,' Fdt-GIIID-5': 5'(GTGAAAAAATTATT- ATTCGCAATTCCT)3' and 0.01 units/μl of Taq DNA polymerase (PE). The PCR protocol consisted of an initial step at 95°C for 5 min followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 1 min, and a final extension step at 72°C for 10 min. The amplified products were purified using the QIAquick PCR Purification™ kit (QIAGEN, Mississauga, ON, Canada) and the primers described above were used to sequence the scFv genes. Following sequencing, two new primers, annealing to the 5' and 3' scFv gene flanking sequences, were designed and used to amplify the scFv gene by PCR as described above. These primers also introduce Bbsl and BgM at the ends of the amplified fragments. Single chain Fv genes were purified as described above, cut sequentially with Bbsl and BgM restriction endonucleases, purified again with the QIAquick Gel Extraction™ kit (QIAGEN) and ligated to the 5b.sJ/δg/II-treated pSJF-8 vector (see Figure 10). Electrocompetent TGI cells were prepared (Tung and Chow) and an aliquot of the ligated product was used to transform the cells using the BIO-RAD Gene Pulser™, according to the manufacturer's instructions. Transformants were selected on ampicillin plates and the clones harboring the scFv genes were identified by PCR and sequencing using RP,

5'(GCGGATAACAATTTCACACAGGAA)3, and FP, '(CCAGGGTTTTCCCAGTCAC- GAC)3,' primers. For expression single positive clones were used to inoculate thirty ml amounts of LB containing 100 μg/ml ampicillin. Cultures were shaken at 240 φm at 37°C overnight and in the morning the entire overnight cultures were used to inoculate 1 liter amounts of M9 medium supplemented with 5 μg/ml vitamin Bl, 0.4% casamino acid and 100 μg/ml ampicillin. The cultures were shaken at room temperature for 30 hr at 180 φm and subsequently supplemented with 100 ml of 10X induction medium and 100 μl of 1 M isopropylthio-β-D-galactoside. The cultures were shaken for another 60 hr, the periplasmic fractions extracted by an osmotic shock method (Anand et al., 1991). The presence of scFv in extracts was detected by Western blotting (MacKenzie et al.,1994). The periplasmic fractions were dialyzed extensively against 10 mM HEPES (N-[2-hydroxyethyl]piperazine- N'-[2-ethanesulfonic acid]) buffer pH 7.0, 500 mM NaCl. The presence of the scFv C- terminal His tag allowed for one step protein purification by immobilized metal affinity chromatography using HiTrap Chelating™ column (Phamacia). The 5-ml column was charged with Ni²⁺ by applying 30 ml of a 5 mg/ml NiCl₂.6H₂O solution and subsequently washed with 15 ml deionized water. Purifications were carried out as described (MacKenzie, 1994) except that the starting buffer was 10 mM HEPES buffer, 10 mM imidazole, 500 mM NaCl, pH 7.0 and the bound protein was eluted with a 10-500 mM imidazole gradient. The purity of the protein was determined by SDS-PAGE (Laemmli,

1970). dAb preparation was further subjected to gel filtration chromatography using Superdex 75 column (Pharmacia) as described (Deng et al., 1995) and the purified monomer species were used in binding studies by surface plasmon resonance.

EXAMPLE 22 - Construction of HI 1 CDR Libraries for the Isolation of SPPC Binders

Libraries in which one or more of the HI 1 CDRs have been randomized, at predetermined levels, are a source of SPPC-binders with improved binding or altered specificity. Such libraries also serve as sources of binders that have the same specificity and affinity profiles as HI 1 but have, for example, improved folding characteristics. There are a total of 70 CDR residues in HI 1 (see Figure 13). The degree to which these residues are changed to non-Hl 1 in libraries can be controlled by synthesizing oligonucleotide building blocks or PCR primers using nucleotide mixtures for extension of the oligonucleotide chain at selected positions. For example, the use of a nucleotide mixture containing 90 % of the wild-type nucleotide and 10 % of a mixture of all four nucleotides will generate a library in which, on average, 15 % of the targeted amino acid residues will be non-Hl 1 (according to equation in Deng et al., 1995; Figure 14). Similarly, an 8: 1 ratio of wild-type nucleotide to nucleotide mixture would give, on average 25 % non-Hl 1 residues and a 6:4 ratio would give, on average, 50 % non- Hl 1 residues (Figure 14). Libraries with varying degrees of homology to HI 1 can be thus constructed for different puφoses with the option of pooling them prior to the phage panning steps. For example, libraries with limited randomization would be expected to be useful for improving the antigen binding affinity of H 1 1 whereas libraries with more extensive randomization would be expected to be useful for generating binders with altered specificities.

At least two methods of library construction strategies could be used for these puφoses (see also Deng, S et al, Proc.Natl. Acad. Sci. USA 92,4992; for Fab libraries, see Griffiths, A. D, 1994. Isolation of high affinity human antibodies)

Generally the CDR3s of the heavy and light chains account for more of the antigen contact residues than other CDRs. In this regard the CDRls are next in importance. Consequently, a library in which these four CDRs are partially randomized will have great structural diversity while minimizing the number of randomized residues and the sampling problems associated with libraries containing large numbers of theoretical sequences. In this example the CDRls and CDR3s are randomized using a PCR strategy. Figure 15 is a diagram showing the strategy for the randomization of VL and VH CDRl and CDR3 residues. Following the generation of the VL and VH PCR products, the full length scFv library is constructed using the four unique restriction sites (RS) introduced by the PCR primers.

The wild-type Hl l scFv sequence is used as a template for all cloning and PCR manipulations. The light and heavy chains are subcloned into cloning vectors with unique restriction sites introduced 5' of CDR LI and HI and 3' of CDR L3 and H3. These vectors are used as templates for randomization. To introduce randomized residues into the CDR's, primers are designed to bind to the templates downstream of the CDR, contain randomized residues within the CDR and bind to the template upstream of the CDR spanning the unique restriction site. One PCR for the light chain and one PCR for the heavy chain generate fragments that are subsequently assembled into full length scFv by PCR.

Obviously, substitution of one, two or three of the mutagenic primers with wild-type primers would reduce the randomized CDRs to three, two and one respectively.

As an alternative, randomization of all six CDRs, or any combination thereof, in a single chain Fv can be achieved by assembly of randomized and non-randomized oligonucleotides in the correct order by PCR. The number of randomized CDRs is reduced by simply replacing the any number of the randomized (boxed) oligonucleotides in Figure 16 with wild- type oligonucleotides.

EXAMPLE 23 - Mouse Library Panning

A small mouse scFv library constructed from mouse spleen cells was panned against SPPC HI 1 of the A-375 cell line for the isolation of binders to this antigen. For the first panning, microtiter plate wells were coated overnight at 4°C with 400 μl of 50 μg/ml SPPC diluted in

PBS. The following morning, plates were washed 3 times with PBS, blotted and blocked with 400 μl of 5% BSA at RT for 1 hr. The wells were emptied and 200 μl of the phage library (1.6 xlθ"), containing 5% BSA, were added to the well and incubated for 3 h. at RT. The well was washed 5 times with PBS, 5 times with PBS Tween and once with PBS. Bound phage were eluted and neutralized and used to inoculate 5 ml of log-phase TGI for 30 min at

37°C and 30 min at RT. Cells were plated on 2xYT+ tetracycline plates and incubated at 32°C overnight. The output phage from the first panning was 2x10⁴. Ten clones were randomly picked for PCR analysis and 9 were observed to have inserts of the correct size. The cells were scraped from the plates, suspended in 2xYT + tetracycline and shaken at 37°C for 1 hr. The cells were removed by centrifugation, 20% PEG/2.5 MNaCl was added and the mixture was incubated at 4°C for at least 1 hr. Phage were sedimented by centrifugation and suspended in sterile PBS.

The protocol for the second panning was the same with the following modifications: (i) phage from the first panning were pre-adsorbed on an HSP coated well surface for 1 h at RT before transfer to the SPPC-coated well and (ii) the well was washed 7 times with PBS and PBS-Tween 20 (0.1 %; v/v) (PBS-Tween) and then once with PBS before the phage were eluted. For the pre-adsoφtion step, peptide was released from the HSP70/peptide complex by treatment with 10 mM ATP at RT for 30 min. Free peptide was removed by centrifugation through a Centricon 10. The peptide release procedure was performed three times. The input phage titer was 1.9 x 10¹⁰and the output phage titer was 5 x 10⁵. The protocol for the third panning was the same as the second except for 10 washes with PBS and PBS-Tween. The input phage titer was 3 x 10¹⁰ and the output phage titer was 1 x 10⁷.

Following the third round, clones were randomly picked for phage production and phage ELISA. A clone showing specific binding to SPPC was sequenced. This clone was designated mouse clone 13. The CDR regions of the heavy chain are as follows:

CDRl TNYGMN CDR2 TNTGEPT CDR3 LRAVDY

EXAMPLE 24 - Detection of the Binding of Recombinant Phage Antibodies in Cell Based Assays

ELISA method for the detection of phage antibody binding to SPPC antigen complex on tumor cells: Phage specific antibody are selected specifically for binding with target antigen expressed on tumor cells, using cell- based ELISA assays (see Hombach et al (1998), J.Immunol.Methods. 218: 53-61; Hall, B. et al, (1998). Immunotech. 4: 127-140. Hybridoma derived and filamentous phage- displayed human monoclonal antibodies are selected by cell- based ELISA assays without isolating purified tumor antigen (Siegel, D.L. et al (1997). J. Immunol. Methods 206: 73-85; Maiti, P.K. et al, (1997). Biotech. Intl. 1 : 85-

93). Furthermore SPPC is expressed on tumor cells and can be recognized by antibody Hl l.

For the detection of phage - antibodies against SPPC, a cell-based assay (cell-fixed ELISA) is used to determine the binding of phage - antibodies to SPPC. Microtiter plates are coated with fixed number of formalin-fixed human tumor cells, as previously described Maiti et al

(1997). Plates are blocked and incubated with various concentrations of human monoclonal antibody H 1 1 or control isotype-matched antibody or test phage antibody containing supernatants or irrelevant phage antibody containing supernatants. After incubation, plates are washed with PBS-0.05% Tween-20 and the bound human antibody or phage antibody is detected by incubating plates with enzyme conjugated secondary antibody. For detection of human antibody, plates are incubated with goat- anti-human IgG-HRP and for detection of phage antibodies, plates are incubated with sheep anti-M13 antibody - HRP conjugate. After washing, all are developed with tetramethylbenzidine (TMB) substrate. The reaction is stopped with 1M phosphoric acid and plates are read in ELISA reader at 450nm to measure the absorbance.

Flow cytometry method for binding of phage antibodies to SPPC antigen complex expressed on tumor cell surface: Binding of the phage antibody to SPPC expressing on tumor cell surface is determined by immunofluorescence assays (see also Watters et al (1997), Immunotech. 3: 21-29; and Hombach et al (1998), supra). SPPC expressing live human tumor cells are incubated for lh at 4°C with supernatants containing the phage antibody or irrelevant phage antibody or hybridoma derived human MAb HI 1 or isotype-matched control antibody. Cell- bound MAbs and phage antibodies, respectively, are detected by indirect immunofluorescence, utilizing a sheep-anti-M13 antibody followed by fluorescence- (FITC) conjugated rabbit anti-sheep antibody or (FITC) conjugated goat anti-human antibody. The cell-surface bound immunofluorescence will be analyzed using FACS caliber cytoflourometer (Becton Dickinson, Mountain View, CA).

EXAMPLE 25 - Competitive Inhibition Assays for Determining the Specificity of Antibodies

Various competitive inhibition methods known in the art can be used to assess competitive binding. In brief, a variant binding fragment is incubated with tumor cells and a fixed amount of the antibody shown to be specific for the tumor cell, which serves as a control. A decrease in the binding of the control antibody as compared to its normal (non-competitive) binding level indicates that both the variant binding fragment and the control antibody compete for the same target for the puφoses herein. Comparable inhibition assays for determining binding to the same target site are also contemplated as determinative of competitive binding.

a) Methods for cell —fixed ELISA inhibition assay for the detection of the specificity of recombinant phage antibody binding to SPPC: Microtitre plates are coated with formalin - fixed human tumor cells as described above. Plates are blocked and incubated with phage antibody containing supernatants. For competition assays, plates are incubated with different amounts (0.001 - lOOμg/mL) of hybridoma derived parent human antibody HI 1 (IgG) or control irrelevant human IgG along with fixed amount of phage antibody. Cell bound phage antibodies are detected by HRP- conjugated anti-M13 antibody.

The same assay is carried out using a fixed amount of parent human antibody HI 1 (IgG) or control irrelevant human IgG along with varying concentration of phage antibody / irrelevant phage antibody. The cell bound parent antibody is detected by HRP conjugated goat- human IgG.

Binding inhibition [%] is determined following the method: 100 x { 1- binding without competition / binding with competition}. If the binding is inhibited more than 80% with test phage antibodies of the parent antibody, then it is considered that the test phage antibody competes for the same target as the parent anti-SPPC antibody, Hl l.

b) Flow cytometry methods for cell - based inhibition assay for the detection of the specificity of recombinant phage antibody binding to SPPC on cell surface of tumor cells: For the determination of reactivity of phage antibodies and parent human MAb HI 1 to SPPC complex on the cell surface of human tumor cells, tumor cells are incubated with any of these antibodies, as described above.

For competition assays, tumor cells are incubated with different amounts (0.001 - lOOμg/mL) of hybridoma derived parent human antibody HI 1 (IgG) or control irrelevant human IgG along with fixed amount of phage antibody. Cell bound phage antibodies are detected by biotin conjugated anti-M13 antibody followed by streptavidin - Cy chrome fluorescence reagent. After washing, the cell - surface bound immunofluorescence will be analyzed in FACS caliber, as described above.

The same assay is also carried out using a fixed amount of parent human antibody HI 1 (IgG) or control irrelevant human IgG along with varying concentration of phage antibody / irrelevant phage antibody. The cell bound parent antibody is detected by biotin conjugated goat- human IgG followed by streptavidin - Cy chrome fluorescent reagent.

The binding inhibition [%] is determined following the method: 100 x { 1- binding without competition / binding with competition}. If the binding is inhibited more than 80%> with phage antibodies or with parent antibodies, then it is considered that phage antibody competes for the same target as the parent anti-SPPC antibody.

c) Cell fixed ELISA Inhibition Method for competitive binding by antibodies for SPPC: To further confirm the specificity of phage antibody for competition with SPPC antibodies, tumor cell coated plates are first incubated with varying concentration of phage antibody, and then washed and incubated with fixed amount of HI 1 IgG antibody. The reactivity of HI 1 IgG with SPPC is detected by goat - anti-human IgG- HRP conjugate. If the reactivity of HI 1 IgG is reduced by more than 80% in dose dependent manner and less than 10% with control human myeloma, then it is be considered that both antibodies recognize same target.

EXAMPLE 26 - Determining the HSP Expressed on Cell Surface of Tumor Cells

Generally, to determine whether a given tumor cell produces a given HSPPC, for example, HSP90 peptide complex, the corresponding antibody, anti-HSP90, may be produced by any method known in the art, for example, using the phage display libraries set out in the above examples.

In brief, viable tumor cell suspension, from human tumor tissues or human tumor cell lines or normal cells (peripheral blood monnuclear cells) is incubated for 1.5h at 4°C with anti-HSP mouse monoclonal antibody (for example, anti-HSP72, RPN1197, Amersham Pharmacia Biotech, NJ) or MA3-006 Affinity Bioreagents Inc, Golden, CO). For controls, isotype- matched control mouse antibody are used instead of anti-HSP antibody. After incubation, tumor cells are washed with PBS containing 2% FCS and are incubated with FITC conjugated rabbit anti-mouse IgGl. Finally, quantitative flow cytometric analysis are performed to determine the percentage of antibody stained cells in FACS Calibre (Becton Dickinson, CA), following the method of Botzler et al (1998) and Multhoff et al (1995).

The present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. Certain adaptations and modifications of the invention will be obvious to those skilled in the art. Therefore, the presently discussed embodiments are considered to be illustrative and not restrictive. It is understood that the claims may refer to aspects or embodiments of the invention that are only inferentially referred to in the disclosure.

Claims

We Claim:

1. A composition comprising an isolated stress protein-peptide complex (SPPC) capable of binding specifically to an anti-SPPC.

2. The composition according to claim 1, wherein said anti-SPPC binds specifically to the surface of a stressed cell.

3. The composition according to claim 1 , wherein said stressed cell is a cancer cell.

4. The composition according to claim 1 , wherein the isolated SPPC is immunologically cross-reactive with a cancer cell surface associated SPPC.

5. The composition according to claim 1, wherein the stress protein of the isolated SPPC belongs to one of the HSP70 or HSP90 families.

6. The composition according to claim 1 , wherein the stress protein of the isolated SPPC belongs to the HSP70 family.

7. The composition according to claim 1, wherein the stress protein of the isolated

SPPC belongs to the HSP90 family.

8. The composition according to claim 5, wherein the stress protein is HSP72 or HSP85.

9. The composition according to claim 5, wherein the stress protein is HSP96.

10. A composition comprising at least one isolated stress protein-peptide complex (SPPC) which is immunologically cross-reactive with a cancer cell surface associated stress protein-peptide complex.

1 1. The composition according to claim 10, wherein said anti-SPPC binds to at least two (multiple) different cancers.

12. The composition according to claim 10, wherein said anti-SPPC binds specifically to a plurality of different SPPCs, including SPPCs belonging to more than one family.

13. The composition according to claim 10, wherein the isolated SPPC is immunologically cross-reactive with cancer cell surface associated SPPCs on at least two different (multiple) cancers.

14. The composition according to claim 1 of the isolated SPPC, wherein the stress protein belongs to one of the HSP70 or HSP90 families.

15. The composition according to claim 14, wherein the stress protein of the isolated SPPC is HSP72 or HSP85.

16. The composition according to claim 10, further comprising at least one other different isolated SPPC which is immunogenically cross-reactive with a cancer associated SPPC, said different isolated SPPC also capable of binding to said anti- SPPC.

17. The composition according to claim 16, wherein the stress proteins of the different isolated SPPCs belong to at least both of the HSP70 and HSP90 families.

18. The composition according to claim 17, where the isolated SPPC is immunologically cross-reactive with more than one type of cancer cell population selected from the group of cancer cell types which are capable of exhibiting cell surface associated SPPCs.

19. The composition according to claim 18, where the group of cancer cell-types is constituted from the group consisting of: astrocytoma, fibrosarcoma, myxosarcoma, liposarcoma, oligodendroglioma, ependymoma, medulloblastoma, primitive neural ectodermal tumor (PNET), chondrosarcoma, osteogenic sarcoma, pancreatic ductal adenocarcinoma, small and large cell lung adenocarcinomas, chordoma, angiosarcoma, endotheliosarcoma, squamous cell carcinoma, bronchoalveolarcarcinoma, epithelial adenocarcinoma, and liver metastases thereof, lymphangiosarcoma, lymphangioendotheliosarcoma, hepatoma, cholangiocarcinoma, synovioma, mesothelioma, Ewing's tumor, rhabdomyosarcoma, colon carcinoma, basal cell carcinoma, sweat gland carcinoma, papillary carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, bileduct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, testicular tumor, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, leukemia, multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease, breast tumors such as ductal and lobular adenocarcinoma, squamous and adenocarcinomas of the uterine cervix, uterine and ovarian epithelial carcinomas, prostatic adenocarcinomas, transitional squamous cell carcinoma of the bladder, B and T cell lymphomas (nodular and diffuse) plasmacytoma, acute and chronic leukemias, malignant melanoma, soft tissue sarcomas and leiomyosarcomas.

20. The composition according to claim 18, wherein the group of cancer cell types is constituted from the group consisting of glioblastoma, malignant melanoma, colon adenocarcinoma, breast adenocarcinoma, kidney adenocarcinoma, osteogenic sarcoma or ovary adenocarcinoma cells;

21. The composition according to claim 18, wherein the group of cancer cell types is constituted from the group consisting of glioblastoma, neuroblastoma, malignant melanoma, breast adenocarcinoma, lung adenocarcinoma, small cell lung carcinoma, colon adenocarcinoma, prostate adenocarcinoma, kidney adenocarcinoma, osteogenic sarcoma, bladder cell carcinoma, ovarian adenocarcinoma and larynx carcinoma;

22. The composition according to claim 18, wherein the group of cancer cell types is constituted from the group consisting of breast carcinoma, colon carcinoma, glioma, gastric carcinoma, lung adenocarcinoma, lung squamous carcinoma, lung small cell carcinoma, lymphoma, melanoma, ovarian carcinoma and prostate carcinoma.

23. The composition according to claim 10, wherein the anti-SPPC is HI 1.

24. The composition according to claim 10, wherein the anti-SPPC is E6.

25. A composition comprising the peptide portion of any isolated SPPC contained within the composition as claimed in claim 10.

26. A composition comprising the peptide portion of any isolated SPPC contained within the composition as claimed in claim 11.

27. A composition comprising the peptide portion of any isolated SPPC contained within the composition as claimed in claim 12.

28. A composition comprising the peptide portion of any isolated SPPC contained within the composition as claimed in claim 13.

29. A polynucleotide encoding the peptide as claimed in any of claims 25 to 28.

30. A composition comprising at least one substantially purified SPPC, said SPPC corresponding to one of the substantially purified SPPCs specifically recognized by

HI 1 within a population of SPPCs derived from A-375 human melanoma cell line.

31. A composition according to claim 30, wherein said substantially purified SPPC belongs to the HSP70 family.

32. A composition according to claim 30, wherein said substantially purified SPPC belongs to the HSP90 family.

33. A pharmaceutical composition comprising the composition of any of the preceeding claims.

34. A composition comprising at least one isolated SPPC derived from a target cancer, wherein said isolated SPPC is immunogenically cross-reactive with a cancer cell surface associated SPPC of a cell of said target cancer.

35. A composition comprising SPPCs derived from a target cancer, said composition enriched with at least one isolated SPPC which is immunologically cross-reactive with a cancer cell surface associated SPPC of a cell of said target cancer.

36. A composition comprising SPPCs derived from a target cancer, said composition predominantly comprising at least one isolated SPPC which is immunogenically cross- reactive with a cancer cell surface associated SPPC of a cell of said target cancer.

37. The peptide portion of an isolated SPPC constituting the composition as defined in claim 34.

38. A composition comprising an SPPC which is constituted from a stress protein and the peptide portion of an isolated SPPC as defined in claim 37.

39. The use of the peptide portion of an isolated SPPC according to claim 37 to create an immunogen.

40. A process of creating an immunogen using the peptide portion of an isolated SPPC according to claim 37 by linking said peptide portion to a peptide coupling molecule.

41. A process according to claim 40, wherein said peptide portion is covalently associated to said peptide coupling molecule.

42. The process according to claim 40 wherein said peptide portion is non-covalently associated to said peptide presenting molecule.

43. The process according to claim 41 or 42, wherein said peptide-coupling molecule is a heat shock protein.

44. An antigen-presenting cell sensitized with a sensitizing amount of a composition as defined in claim 10 or 38.

45. A composition comprising an antigen binding fragment of an antibody which binds specifically to at least one cancer-associated SPPC .

46. A composition comprising an antigen-binding fragment of an antibody which binds specifically to a plurality of different cancer-associated SPPCs.

47. A composition according to claim 45, wherein said antigen binding fragment binds specifically to a plurality of different cancer cell types.

48. A composition according to claim 46, wherein said plurality of cancer associated SPPCs include SPPCs in which the stress proteins belong to different families of stress proteins.

49. The composition according to claim 45, wherein the stress protein portion of the SPPC belongs to one or both of the HSP70 or HSP90 families.

50. The composition according to claim 48, wherein said stress protein belong to both the HSP70 and HSP90 families.

51. The composition according to claim 49 or 50, wherein the stress protein belongs to the group consisting of HSP72 and HSP85.

52. The composition according to claim 45, wherein the antigen-binding fragment is of human origin.

53. The composition according to claim 45, 46 or 47, wherein the target cancer cell is of human origin.

54. A pharmaceutical composition, comprising the composition of claim 53.

55. The pharmaceutical composition of claim 54, wherein said antigen-binding fragment is unconjugated to any chemically functional moiety for effectiveness.

56. The pharmaceutical composition of claim 54, wherein said antigen-binding fragment does not have an Fc portion for activating complement.

57. The pharmaceutical composition of claim 54, said composition free of any associated or unassociated synergistic or cancer cell inhibiting or killing compound.

58. A cancer imaging composition comprising a composition of claim 45 bound to detectable label which is suitable for imaging a target cancer.

59. The use of the imaging composition of claim 58 for imaging a cancer cell comprising administering said imaging composition to a group of cells to enable specific binding to such cells.

60. The use of the imaging composition of claim 58 for imaging a cancer cell in a mammal comprising administering to a mammal said imaging composition with a physiologically acceptable excipient.

61. A diagnostic reagent comprising a composition of claim 45.

62. The reagent according to claim 61 , wherein said anti-SPPC is linked to an entity which assists in detecting specific binding of the anti-SPPC to a ligand.

63. The use of the composition of claim 54, 55, 56, or 57 for treating or preventing a cancer in a mammal comprising administering to said mammal said composition with a physiologically acceptable excipient.

64. The use of the composition of claim 54, 55, 56 or 57 for treating or preventing metastasis of a cancer in a mammal comprising administering to said mammal said composition with a physiologically acceptable excipient.

65. A pharmaceutical composition of claim 54 for use with a plurality of cancer cell types belonging to the group of types capable of exhibiting SPPCs on the surface of the cell.

66. A pharmaceutical composition of claim 65 for use with plurality of carcinoma types.

67. A method of treating an individual having a type of primary cancer or metastasized cancer comprising the steps of:

(a) sensitizing antigen presenting cells in vitro with a sensitizing-effective amount of composition of claim 45 or 46; and (b) administering to an individual having a primary cancer or metastasized cancer a therapeutically effective amount of the sensitized antigen presenting cells.

68. A pharmaceutical composition comprising a therapeutically effective amount of sensitized antigen presenting cells, in a pharmaceutically acceptable carrier, wherein the antigen presenting cells have been sensitized in vitro with a composition of claim

45 or 46.

69. A composition as claimed in claim 45, wherein said antigen-binding fragment competitively binds to the same target as HI 1 as determined by a competitive inhibition assay.

70. A composition as claimed in claim 46, wherein said antigen-binding fragment competitively binds to the same target as HI 1 as determined by a competitive inhibition assay.

71. A composition as claimed in claim 47, wherein said antigen-binding fragment competitively binds to the same target as HI 1 as determined by a competitive inhibition assay.

72. A composition as claimed in claim 45, wherein said antigen-binding fragment competitively binds to the same target as E6 as determined by a competitive inhibition assay.

73. A composition as claimed in claim 46, wherein said antigen-binding fragment competitively binds to the same target as E6 as determined by a competitive inhibition assay.

74. A composition as claimed in claim 47, wherein said antigen-binding fragment competitively binds to the same target as E6 as determined by a competitive inhibition assay.

75. An antibody that binds to the same target as HI 1 or E6 as determined by a competitive inhibition assay.

76. A method of selecting human MAbs directed against cancer associated SPPCs comprising:

(a) fusing peripheral blood lymphocytes from a patient presenting with a cancer with a human myeloma like cell line; (b) screening for anti-SPPC in the presence of and in the absence of a stress peptide releasing agent, and selecting cells showing such activity only in the absence of such peptide releasing agent; and;

(c) screening against normal human cells/tissues and cancer cells /tissue to assess cell surface reactivity and selecting cells that show reactivity primarily to cancer cells/tissues but not with normal cells/tissue.

77. A method of generating cancer associated anti-SPPCs by using:

(a) one or more phage particles displaying candidate antigen-binding fragments, said phage particles selected from a phage display library displaying a suitably diverse population of such fragments or a phage library containing an enhanced representation of anti-SPCCs; or

(b) one or more such candidate antigen-binding fragments derived from such phage particles; to screen for cancer cell surface associated binding activity, said phage particles or candidate binding fragments selected on the basis of their ability to bind to SPPCs derived from one or more target tumors in the absence of a stress peptide releasing agent but not in the presence of such agent.

78. A population of genetic packages having a genetically determined outer surface protein including genetic packages which collectively display a plurality of different potential immunoglobulin binding-fragments in association with said outer surface protein, each package including a nucleic acid construct coding for a fusion protein which is at least a portion of said outer surface protein and a variant of at least one parental anti-SPPC immunoglobulin binding- fragment, wherein at least part of said construct preferably including at least a part of the CDR3 region of the V_H chain, which is randomized to create variation among said potential binding-fragments, is biased in favour of encoding the amino acid constitution of said parental immunoglobulin binding fragment.

79. A population of genetic packages according to claim 78, wherein said part of said construct which is randomized to create variation among said potential binding fragments is biased to produce a probability of occurrence of the parental amino acid of less than 100%, at a given amino acid position, having regard to the number of amino acids randomized, such that said plurality of different potential immunoglobulin binding fragments contains an enhanced representation of anti-SPPCs and such that the probability of occurrence of said the parental amino acid at all randomized positions, preferably does not exceed 20%.

80. A population of genetic packages according to claim 78, wherein said part of said construct which is randomized to create variation among said potential binding fragments is biased to optimize the representation of anti-SPPCs as a first consideration, and to minimize the probability of occurrence of said the parental amino acid at all randomized positions, as a balancing but second consideration.

81. A population of genetic packages according to claim 78, wherein said part of said construct which is randomized to create variation among said potential binding fragments is biased to optimize the representation of anti-SPPCs as a first consideration, and to minimize the probability of occurrence of the parental amino acid at all randomized positions, as a second consideration.

82. A population of genetic packages as claimed in any of claims 78 to 81, comprising a plurality of libraries, which are pooled, wherein at least a first and second of said pooled libraries differ in the degree of biasing to parental amino acids.

83. A population of genetic packages as claimed in claim 82, wherein in at least one of said pooled libraries, the degree of biasing to parental amino acids is selected to minimize the probability of occurrence of the parental amino at all randomized positions, as a primary consideration.

84. A population of genetic packages as claimed in claim 82, wherein in at least one of said pooled libraries, the degree of biasing to parental amino acids is selected to minimize the probability of occurrence of the parental amino at all randomized positions, as an exclusive consideration.

85. A population of genetic packages as claimed in claim 82, wherein in at least one of said pooled libraries, at least part of the CDR3, of the heavy chain or light chain or both, is completely randomized.

86. A population of genetic packages as claimed in claim 82, comprising at least one library as defined in any one of claims 79, 80 or 81 and at least one library as defined in any one of claims 83, 84 or 85 and one or more libraries wherein the degree of biasing towards parental amino acids is systematically reduced relative to the library with the greatest degree of biasing towards parental amino acids.

87. A population of genetic packages according to any claims 78 to 86, wherein said part of said construct which is randomized includes at least part of the CDR3 of the heavy chain.

88. A population of genetic packages according to any claims 78 to 87, wherein said part of said construct which is randomized includes at least part of the CDR3 of the light chain.

89. A population of genetic packages according to any claims 78 to 88, wherein said part of said construct which is randomized includes at least part of the CDRl of the heavy chain.

90. A population of genetic packages according to any claims 78 to 89, wherein said part of said construct which is randomized includes at least part of the CDRl of the light chain.

91. A population of genetic packages according to any claims 78 to 90, wherein said part of said construct which is randomized includes at least part of all the CDRs of the heavy and light chains.

92. A population of genetic packages according to claim 78, wherein said genetic package is a phage and said parental immunoglobulin binding-fragment is selected from the group consisting of an scFv, Fab, V_H, Fd, Fabc, F(ab')₂, F(ab)₂.

93. ^' A population of genetic packages according to claim 78, wherein said immunoglobulin binding fragment is a scFv, Fab, or V single domain V_H binding fragment.

94. A population of genetic packages according to claim 79, wherein parental anti- SPPC immunoglobulin binding fragment is a multicarcinomic anti-SPPC and wherein said plurality of different potential immunoglobulin binding fragments contain an enhanced representation of multi-carcinomic anti-SPPCs.

95. A population of genetic packages according to claim 79, wherein parental anti- SPPC immunoglobulin binding fragment binds specifically to a plurality of different SPPCs and wherein said plurality of different potential immunoglobulin binding fragments contain an enhanced representation of anti-SPPCs which bind to different SPPCs.

96. A population of genetic packages or phage as claimed in any of preceding claims comprising a plurality of libraries, which are pooled, wherein at least a first and second of said pooled libraries differ in the degree of biasing to parental amino acids, and wherein said first library is biased to produce 15% to 95% probability of the parental amino acid type at a given position and wherein the second library is biased to produce a 10% to 90of the parental amino acid type at a given position, said population of genetic packages preferably including a library wherein the probability of occurrence of the parental amino acid at each randomized position does not exceed 0.001%>.

97. A population of genetic packages or phage as claimed in claim 83, comprising a plurality of libraries, which are pooled, wherein at least a first, second and third of said pooled libraries differ in the degree of biasing to parental amino acids, and wherein said first library is biased to produce a 35% to 95%> probability of the parental amino acid type at a given position and wherein the second library is biased to produce a 25% to 15% probability of occurrence of the parental amino acid type at a given position and wherein said third library is biased to produce a 10% to 65% probability of occurrence of the parental amino acid type at a given position.

98. A population of genetic packages as claimed in any of claims 78 to 97, wherein said parental anti-SPPC immunoglobulin binding fragment is HI 1.

99. A population of genetic packages as claimed in any of claims 78 to 97, wherein said parental anti-SPPC immunoglobulin binding fragment is E6 or an antibody that binds to the same target as HI 1 as determined by a competitive inhibition assay.

100. The composition according to claim 45 or 46, wherein the antigen-binding fragment is selected from the group consisting of whole antibodies, bispecific antibodies, chimeric antibodies, Fab, F(ab')2, single chain V region fragments (scFv) and fusion polypeptides.

101. The composition according to claim 45 or 46, wherein the antigen-binding fragment is encoded by a phage particle within phage display library.

102. The composition according to claim 45 or 46, wherein the antigen-binding fragment consists essentially of a scFv.

103. The composition according to claim 100, wherein the whole antibody is a human immunoglobulin of any isotype.

104. The composition according to claim 100, wherein the antigen binding fragment comprises a variable region derived from an IgM and a constant region derived from an IgG.

105. The composition according to claim 100, wherein the fusion peptide comprises the antigen-binding fragment fused to a chemically functional moiety.

106. The composition according to claim 105, wherein the moiety is selected from the group consisting of signal peptides, agents that enhance immunologic reactivity, agents that facilitate coupling to a solid support, bioresponse modifiers, immunotoxins, toxins, detectable labels, paramagnetic labels and drugs.

107. The method according to claim 106, wherein the agent that facilitates coupling to a solid support is selected from the group consisting of biotin and avidin.

108. The composition according to claim 106, wherein the bioresponse modifier is a cytokine.

109. The composition according to claim 106, wherein the cytokine is selected from the group consisting of tumor necrosis factor, interleukin-2, interleukin-4, interleukin-12, granulocyte macrophage colony stimulating factor and γ-interferons.

110. The composition according to claim 106, wherein the drug is an antineoplastic agent selected from the group consisting of radioisotopes, vinca alkaloids, adriamycin, bleomycin sulfate, carboplatin, cisplatin, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, duanorubicin hydrochloride, doxorubicin hydrochloride, etoposide, fluorouracil, lomustine, mechlororethamine hydrochloride, melphalan, mercaptopurine, methotrexate, mitomycin, mototane, pentostatin, pipobroman, procarbaze hydrochloride, streptozotocin, taxol, thioguanine and uracil mustard.

111. The composition according to claim 110, wherein the vinca alkaloid is selected from the group consisting of vinblastine sulfate, vincristine sulfate and vindesine sulfate.

112. The composition according to claim 106, wherein the toxin is selected from the group consisting of ricin, radionuclides, pokeweed antiviral protein, Pseudomonas exotoxin A, diphtheria toxin, ricin A chain, fungal ribosome inactivating proteins and phospholipase enzymes.

113. The composition according to claim 112, wherein the detectable label is selected from the group consisting of radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, bioluminescent compounds, enzymes, substrates, cofactors and inhibitors.

114. The composition according to claim 46, wherein the stress protein is a member of a heat shock protein family selected from the group consisting of hsp20-30, hspόO, hsp70, hsp90 and combinations thereof.

115. A composition comprising an isolated antigen-binding fragment of an antibody specific for a cancer-associated stress protein-peptide complex and a physiologically acceptable excipient, wherein the antigen-binding fragment is present in an amount effective to elicit a cancer-associated immune response in a subject upon administration to the subject.

116. A method of treating a cancer subject comprising administering to the subject an amount of a composition composing an isolated antigen-binding fragment of an antibody specific for a cancer-associated stress protein-peptide complex and a physiologically acceptable excipient effective to elicit a cancer-associated immune response.

117. The method according to claim 116, wherein the SPPC is multi-carcinomic.

118. A method of identifying antigen-binding fragments of an antibody specific for a tumor-associated stress protein-peptide complex comprising the steps of: (a) generating a suitable phage display library;

(b) generating stress protein-peptide complex from a tumor;

(c) screening the product of step (a) with the product of step (b) both with and without the peptide portion of the complex to obtain phage which display an antigen binding fragment that binds specifically to stress protein peptide complex only in the presence of the peptide portion of the complex; and

(d) screening the phage obtained in step (c) for cell surface tumor-associated reactivity.

119. A method of isolating an antigenic tumor associated stress protein peptide complex, comprising the steps of : a) fractionating a tumor-cell extract on an antigen binding fragment affinity medium to bind the complex; b) applying the eluate from the affinity medium to molecular sieve which is capable of separating the stress protein from the peptide; c) isolating the peptide; and d)re-associating the stress protein with the isolated peptide.

120. A method of isolating a peptide forming part of an antigenic tumor-associated peptide complex comprising:

(a) fractionating a tumor cell extract an antigen binding fragment affinity medium to bind the complex (b) applying the eluate from the affinity medium to a molecular sieve which is capable of separating the stress protein from the peptide; and (c) isolating the peptide.

121. A method as claimed in claim 1 18, wherein said stress protein is a member of the HSP70 family.

122. A method as claimed in claim 121, wherein said stress protein is HSP72.

123. A method as claimed in claim 118, wherein said stress protein peptide complex is C antigen.

124. A method as claimed in claim 122 wherein said stress protein peptide complex is first fractionated on a hydrophobic column to isolate a hydrophobic fraction.

125. A method isolating an antigenically active tumor-associated protein peptide complex, comprising:

(a) fractionating a tumor cell extract using a hydrophobic chromatographic media to obtain a hydrophobic fraction;

(b) identifying an antigenically active such fraction using an antigen binding fragment of an antibody which binds specifically to a tumor-associated stress protein PPC;

(c) applying the antigenically active fraction to an ADP chromatographic media;

(d) applying the active fraction eluted from the ADP chromatographic media to a strong anionic media;

(e) collecting fractions eluted from the strong media which are determined to be active using said antibody; and preferably

(f) a further purification step carried out under non-denaturing conditions, preferably eletrophoretic extraction.

126. A composition of matter comprising an antigenic native SPPC which is immunologically cross-reactive with an SPPC found on the surface of cancer cells, said

SPPC substantially free from non-tumor-associated SPPCs and other contaminating proteins.

127. A composition of matter comprising an antigenic native SPPC which is immunologically cross-reactive with an SPPC found on the surface of cancer cells, said SPPC substantially free from non-tumor-associated SPPCs, other tumor-associated SPPCs and other contaminating proteins.

128. Cancer associated antigen binding fragments which react specifically with C- antigen.

129. An immunoaffinity matrix to which an anti-SPPC is bound.

130. A cancer associated anti-SPPC obtained by using the method as claimed in claim 77, wherein said library containing an enhanced representation of anti-SPCCs is a library as claimed in any of claims 78 to 99.

131. A method of making of an anti-SPPC by modifying a multi-carcinomic anti- SPPC.

132. A method of making of an anti-SPPC by modifying an anti-SPPC that binds to a plurality of SPPCs.

133. A method of making of an anti-SPPC by modifying an anti-SPPC that binds to the same target as HI 1 as determined by a competitive inhibition assay.

134. A method as claimed in claim 131, 132 or 133 comprising a process of affinity maturation using an HI 1 or E6 anti-idiotype as an antigen.

135. A method as claimed in claim 131, 132 or 133 comprising a process of affinity maturation using an isolated SPPC of the invention as an antigen.

136. A method as claimed in claim 131, 132 or 133 using a library that contains an enhanced representation of anti-SPPCs.

137. An anti-SPPC obtained by a method as claimed in claims 131-136.

138. An anti-SPPC derived from a multi-carcinomic anti-SPPC.

139. An anti-SPPC derived from an anti-SPPC that binds to a plurality of SPPCs.

140. An anti-SPPC derived from an anti-SPPC that binds to the same target as HI 1 as determined by a competitive inhibition assay.

141. An antibody into which any CDR of an anti-SPPC or part thereof or antibody derived therefrom as claimed in any of claims 45, 69, 72, 130 or 137 to 140, has been grafted.

142. The material bound to an anti-SPPC affinity column.

143. The material as claimed in claim 142 wherein said anti-SPPC is a multi- carcinomic anti-SPPC, an anti-SPPC binds to a plurality of SPPCs or an antibody that binds to the same target as HI 1 as determined by a competitive inhibition assay.

144. A monoclonal, polyclonal or phage library derived anti-SPPC that binds specifically to an isolated SPPC of the invention.

145. A polynucleotide encoding an anti-SPPC of the invention.

146. A variant of HI 1 or E6 which binds specifically to an SPPC.

147. A variant of HI 1 or E6 which binds specifically to an SPPC, when prepared by condon-based mutagenesis, stepwise in vitro affinity maturation, substitution of amino acids preferred for intermolecular interaction, affinity maturation by by parsimonious mutagenesis, CDR walking mutagenesis or CDR implantation.