WO2006056663A1 - Method of screening compounds for the treatment of diabetes - Google Patents

Abstract

The present invention describes a method of screening a modulator agent of a polyamine pathway related to type 2 diabetes comprising the steps of introducing a candidate modulator agent into the cell culture system or a mouse model; and monitoring the level of glucose metabolism in a cell, wherein said agent modulates or ameliorates insulin sensitivity and glucose metabolism progression of diabetes and/or obesity.

Description

Method of screening compounds for the treatment of diabetes

FIELD OF THE INVENTION

The invention provides methods for identifying agents which are useful in the treatment of type 2 diabetes.

BACKGROUND OF THE INVENTION

Type 2 diabetes is a growing epidemic worldwide. Defects in insulin secretion and action are fundamental disorders in this disease (1). Several mechanisms regulating insulin secretion and insulin action potentially leading to type 2 diabetes have been identified, but none of them is likely to explain completely the risk of type 2 diabetes. Two recent studies have yielded significant new information by revealing novel mechanisms for type 2 diabetes, distinct of insulin signaling pathways. Mootha et al (2) identified a set of genes involved in oxidative phosphorylation (OXPHOS), the expression of which was coordinately decreased in human diabetic muscle. Similarly, Patti et al (3) found downregulation of OXPHOS, not only in type 2 diabetic individuals but also in their first-degree relatives. In both of these studies decreased PPARγ co-activator 1α (PGC-1α) expression was responsible for the downregulation of OXPHOS genes. In addition, the expression of PGC-1α has been shown to be down-regulated in WAT of insulin-resistant (4) and morbidly obese (5) subjects. PGC-1α was first identified as a co-activator of PPARy (6) and it was shown to play a critical role in the regulation of adaptive thermogenesis. Subsequent studies have demonstrated that PGC-1α regulates mitochondrial biogenesis (7), uncoupling (6, 8), fatty acid oxidation (9, 10), OXPHOS (2), glucose transport in muscle (11) and hepatic gluconeogesis (12) and skeletal muscle fiber-type switching (13). PGC-1α is highly expressed in brown adipose tissue (BAT), heart and skeletal muscle, and moderately in liver but low levels in white adipose tissue (WAT).

The naturally occurring polyamines, putrescine, spermidine and spermine, are implicated in the control of cellular growth and differentiation (14). Spermidine and spermine have been shown to mimic insulin action in glucose metabolism in isolated rat adipocytes (15). In contrast, the role of putrescine in glucose metabolism and insulin action has remained controversial (15, 16). However, putrescine/spermine pathway has been shown to regulate mitochondrial respiratory chain activity in tumor- bearing mice (17). In this study we investigated mice overexpressing spermidine/spermine N¹-acetyltransferase (18) (SSAT), a key regulatory enzyme in polyamine catabolism targeting spermidine and spermine to oxidative catabolism ultimately yielding putrescine. SSAT mice exhibited reduced amount of white adipose tissue (WAT). We show that these mice have high basal metabolic rate, improved glucose tolerance, high insulin sensitivity, a low tissue accumulation of triglycerides, and overexpression of OXPHOS pathway coordinated by high expression of PGC-1α and high putrescine level in WAT. Our results give evidence for the significance of OXPHOS pathway as a possible defect in type 2 diabetes, and identify mechanisms how this defect could be overcome.

SUMMARY OF THE INVENTION

In one aspect, the present invention relates to a method of screening a modulating agent of a SSAT enzyme comprising the steps of introducing a candidate modulating agent into a cell culture system; and monitoring the level of SSAT activity in a cultured cell to detect whether said candidate modulating agent modulates or ameliorates cell's polyamine pathway metabolism related to diabetes and/or obesity.

In another aspect, the present invention relates to a method of screening a modulating agent of a SSAT enzyme in a mouse model comprising the steps of exposing a mouse to a candidate modulating agent; and monitoring the level of SSAT activity in a tissue or cell sample from the mouse to detect whether said candidate modulating agent modulates or ameliorates cell's polyamine pathway metabolism related to diabetes and/or obesity.

A BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 Reduced white adipose tissue (WAT) mass in SSAT mice. (A) Female and male SSAT (solid circles) and wild-type (open circles) mice were weighed, and the data were collected using 1- or 2-week intervals. Data are means ± SEM, n= 13-26. (B) Body composition, including fat and lean body mass was determined by MRI from SSAT (solid bars) and wild-type (open bars) mice. Skin weight was obtained after dissection of skin. All values are means ± SEM of three mice per group. *, p<0.05 and **, p<0.01. (C) Triglyceride content in different tissues of female SSAT (solid bars) and wild-type (open bars) mice. Results are expressed as means ± SEM of n=10 mice per genotype. *, p<0.05 and **, p<0.01. (D) Histology of BAT and WAT in female SSAT and wild-type mice. Adipocytes were photographed at 2Ox magnification. Bar 50 μm. (E) Cell diameter and (F) density (cell number per one millilitre) of isolated adipocytes from perigonadal fat pads of male SSAT (solid line or bar) and wild-type (dashed line or open bar) mice. Results are presented as means from two pools of SSAT mice (n=6 per pool) and three individual wild-type mice.

Figure 2 Glucose and insulin tolerance of SSAT and wild-type mice. Intraperitoneal glucose tolerance test with 2 mg/mg glucose was performed on fasted non- anaesthetized 3- to 4-month-old female SSAT (solid line and circles) and wild-type (dashed line and open circles) mice. (A) Glucose and (B) insulin concentrations during test. Intraperitoneal insulin tolerance tests with (C) 0.25 mU/g insulin and (D) 0.15 mU/g insulin and 0.4 mg/g glucose was performed on fasted non-anaesthetized 3- to 4-month-old female SSAT (solid line and circles) and wild-type (dashed line and open circles) mice. Blood samples were collected from tail vein at indicated time points. Results are presented as means ± SEM of six mice per group. *, p<0.05, **, p<0.01 and ***, p<0.001.

Figure 3 Energy expenditure of SSAT and wild-type mice. (A) Oxygen consumption was measured in 6-month-old female and male SSAT (solid bars) and wild-type (open bars) mice after fasting using indirect calorimetrγ. Results are expressed as proportion to body weight or lean body mass. Data are means ± SEM of n=15-16 mice per genotype. ***, p<0.001. (B) Oxygen consumption measured before (2.5 weeks) and after (13 weeks) hair loss in female and male SSAT (solid bars) and wild- type (open bars) mice in fasting state. Data are means ± SEM, n=7-8. **, p<0.01 and ***, p<0.001. (C) Food and water intake was measured in 4- to 6-month-old female SSAT (solid bars) mice and wild-type (open bars) mice. Mice were housed five to eight per cage and food and water consumption was measured after one week. Results are expressed as means ± SEM of 19 mice per group. **, p<0.01 and ***, p<0.001. (D) Body temperature and locomotor activity of female and male SSAT (solid circles) and wild-type (open circles) mice was monitored telemetrically at 25 °C and 12 ⁰C during a 12-h light and 12-h dark cycle. Gray color indicates night-time. Results are expressed as means ± SEM of six mice per group. (E) Palmitate- oxidation was determined as CO₂ production by pooled isolated adipocytes from female and male (5-13 mice per group) SSAT (solid bars) and wild-type (open bars) mice in the fed state. Figure 4 Transmission electron microscopy of mitochondria in WAT and mtDNA amount in different tissues of female SSAT and wild-type mice. (A) Electron microscopic examination of mitochondria in WAT. Mitochondria were photographed at 25 00Ox magnification. Bar 200 nm. (B) Mitochondrial DNA amount in female SSAT (solid bars) and wild-type (open bars) mice analyzed by quantitative RT-PCR. Results are presented as means ± SEM of 6-7 per group. *, p<0.05.

Figure 5 PGC-1α and UCP1 protein levels in WAT and BAT. (A) PGC-1α levels in WAT detected with a polyclonal antibody against the carboxyl terminus of PGC-1α (Chemicon International, Inc., Temecula, CA, USA). The second panel displays actin levels used for normalization. Values below both panels indicate relative PGC-1α levels after normalization. (B) PGC-1α levels in BAT detected with the same antibody as for WAT. The lower panel displays actin levels of the samples. (C) UCP1 levels in BAT detected with a polyclonal antibody against the carboxyl terminus of UCP1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). The lower panel displays actin levels of the samples.

Figure 6. Proposed molecular mechanism leading to the phenotype of SSAT mice.

A) Each polyamine cycle consumes four ATP equivalents. DFMO is an inhibitor of ODC and reduces putrescine synthesis and the rate of polyamine cycle.

B) Based on the data presented it is hypothesized that enhanced polyamine catabolism in WAT leads to high ATP consumption and high AMP levels which stimulate AMPK. This in turn induces the expression of PGC-1α resulting in increased mitochondrial biogenesis, uncoupling, fatty acid oxidation and insulin sensitivity. Enhanced polyamine catabolism also depletes SSAT cofactor, acetyl-CoA pool, and causes the reduction in fatty acid synthesis.

DETAILED DESCRIPTION OF THE INVENTION

The term "modulating agent" as used herein refers to a compound that alters at least one step in the polyamine pathway such that the alteration in the polyamine pathway produces a modification in the a diabetes or obesity or alike disorder. In particular, the alteration in the polyamine pathway produces an amelioration of diabetes and the symptoms of diabetes, such as increasing the life expectancy of the subject. The term "modulating agent" includes polyamine analogs and activators that target at least one enzyme in the polyamine pathway. In one embodiment, the modulating agent targets a specific enzyme involved in the pathway, for example, a modulating agent that activates one of the enzymes involved in that pathway such as SSAT, PAO, or PGC-1α. The modulation to the pathway can be in the form of increasing, decreasing, elevation, or depressing processes or signal transduction cascades, involving a target gene or a target protein, e.g., SSAT. This modulation may result by direct, (e.g., direct binding) or indirect (e.g., use of analogs that mimic the action of the native substrate or bind to the enzyme substrate complex) interaction with the target protein. The modifications can result in a direct affect on the target protein, e.g., activation of SSAT. Alternatively, the modifications can be indirect modification of a process or cascade involving the target protein, e.g., activation of SSAT which increases the concentration of putrescine.

Examples of modulating agents that target specific enzymes include, but are not limited to, SSAT activators and polyamine analogs. Examples of SSAT activators include, but are not limited to, N',N'2-bis(ethyl)spermine (BESM), N' ,N' '- bis(ethyl)norspermine (BENSM), N1 ,N11-diethylnorspermine (DENSPM), methyl glyoxal bis(guanylhydrazone), N-butyl- 1,3-diaminopropane, N,N'-bis[3- (ethylamino)propyl]-l,7-heptanediamine, many other N-alkylated polyamines, methyl glyoxal bis(guanylhydrazone), adriamycin, 5-fluorouracil, methotrexate, ionophores, carbamoyl choline, apomorphine, piribedil, 3-isobuthylmethylxanthine, isoprenaline, lithium salts, platinum drugs (Hector S, Porter CW, Kramer DL, Clark K, Prey J, Kisiel N, Diegelman P, Chen Y, Pendyala L. Polyamine catabolism in platinum drug action: Interactions between oxaliplatin and the polyamine analogue N1.N11- diethylnorspermine at the level of spermidine/spermine N1-acetyltransferase. MoI Cancer Ther. 2004 Jul;3(7):813-22), gossypol (Rasanen TL, Alhonen L, Sinervirta R, Uimari A, Kaasinen K, Keinanen T, Herzig KH, Janne J. Gossypol activates pancreatic polyamine catabolism in normal rats and induces acute pancreatitis in transgenic rats over-expressing spermidine/spermine N1-acetyltransferase. Scand J Gastroenterol. 2003 Jul;38(7):787-93), agmatine (Vargiu C, Cabella C, Belliardo S, Cravanzola C, Grillo MA, Colombatto S. Agmatine modulates polyamine content in hepatocytes by inducing spermidine/spermine acetyltransferase. Eur J Biochem. 1999 Feb;259(3):933-8), corticosteroids, estradiol, vitamin D derivatives, secretin, glucagon, growth hormone, parathyroid hormone, corticotropin, catecholamines, serum growth factors, lectins, phorbol esters and aspirin (Table 1 in Casero, R.A. & Pegg, A.E. (1993) Spermidine/spermine N 1 -acetyltransferase - the turning point in polyamine metabolism. FASEB J. 7, 653-661). Examples of modulating agents that target specific enzymes include, but are not limited to, PAO activators and polyamine analogs. Examples of PAO activators include, but are not limited to, MDL72527(N(1),N(2)-bis(2,3-butadienyl)-1,4- butanediamine, oxa-spermine derivatives (Pavlov V, Rodilla V, Kong Thoo Lin P. Growth, morphological and biochemical changes in oxa-spermine derivative-treated MCF-7 human breast cancer cells. Life Sci. 2002 JuI 26;71(10):1161-73), sulphonamido oxa-polyamine derivatives (Pavlov V, Lin PK, Rodilla V. Biochemical effects and growth inhibition in MCF-7 cells caused by novel sulphonamido oxa- polyamine derivatives. Cell MoI Life Sci. 2002 Apr;59(4):715-23), polyamine analogues described in Wang et al (Cloning and characterization of a human polyamine oxidase that is inducible by polyamine analogue exposure. Cancer Res. 2001 JuI 15;61(14):5370-3) and Devereux et al (Induction of the PAOM/SMO polyamine oxidase by polyamine analogues in human lung carcinoma cells. Cancer Chemother Pharmacol. 2003 Nov;52(5):383-90. Epub 2003 Jun 25).

In another embodiment, the modulating agent targets more that one step in the polyamine synthesis, such as an agent that effects both SSAT and PAO or PGC-1α, or PAO and PGC-1α. In another yet another embodiment, more than one modulating agent can be used to alter the polyamine pathway. For example, a combination of modulating agents comprising at least one modulating agent that alters SSAT activity and at least one modulating agent that alters PAO activity or PGC-1α activity. Further example comprises a combination of modulating agents comprising at least one modulating agent that alters PAO activity and at least one modulating agent that alters PGC-1α activity. In yet another embodiment, the combination of modulating agents can comprise at least one modulating agent that is a polyamine analog, and at least one modulating agent that is an activator of an enzymes involved in the polyamine pathway.

In other embodiment, putrescine or its derivatives or analogues is administered according to the present invention. Examples of putrescine analogues include, but are not limited to, 1-aminooxy-3-aminopropane, 2,5-diamino-3-hexyne, 1,4-diamino- 2-butyne, 2,4-diamino butanone, (2R,5R)-6-heptyne-2,5-diamine, keto-putrescine , (E)-1 ,4-diaminobut-2- ene, N-3-[3-methoxy-4-(.beta.-methoxy)ethoxymethoxy]phenyl- 2-butenoyl-N'-(2-ami no)benzoylputrescine and N-5-[3-methoxy-4-(.beta.-methoxy) ethoxymethoxy]phenyl-2,4-pentadienoyl-N'-(2-amino)benzoyl putrescine (as described in US pat no 4,673,684). The term "putrescine" means putrescine molecule and its analogues and derivatives.

In one embodiment, the invention pertains to methods for treating a subject having a weight disorder, e.g., obesity, or a disorder associated with insufficient insulin activity and glucose tolerance, e.g., diabetes, comprising administering to the subject a SSAT modulating agent and/or PAO modulating agent and/or putrescine-PGC-1α interaction modulating agent, e.g., a SSAT and/or PAO protein or portion thereof or a compound or an agent thereby increasing the expression or activity of SSAT and/or PAO such that treatment of the disease occurs. Weight disorders, e.g., obesity, and disorders associated with insufficient insulin activity can also be treated according to the invention by administering to the subject having the disorder a SSAT modulating agent, PAO modulating agent, putrescine-PGC-1 α interaction modulating agent e.g., polyamine analogue according the present invention or small molecule such that treatment occurs.

The invention also pertains to methods for identifying a modulating agent which interacts with (e.g., binds to) a SSAT or PAO protein. These methods include the steps of contacting the SSAT or PAO protein with the compound or agent under conditions which allow binding of the compound to the SSAT or PAO protein to form a complex and detecting the formation of a complex of the SSAT or PAO protein and the compound in which the ability of the compound to bind to the SSAT or PAO protein is indicated by the presence of the compound in the complex.

The invention further pertains to methods for identifying a compound or agent which modulates, e.g., stimulates or inhibits, the interaction of the SSAT or PAO substrate with a target molecule, e.g. SSAT or PAO. In these methods, the SSAT or PAO substrate is contacted, in the presence of the compound or agent, with the SSAT or PAO under conditions which allow interaction of the SSAT or PAO to the SSAT or PAO substrate. An alteration, e.g., an increase or decrease, in insulin sensitivity and/or glucose tolerance resulting from the interaction between the SSAT or PAO substrate and the SSAT or PAO as compared to the insulin sensitivity and/or glucose tolerance in the absence of the compound or agent is indicative of the ability of the compound or agent to modulate the interaction of the SSAT or PAO substrate with a SSAT or PAO. In a preferred embodiment, alterations can be further detected by the overexpression of the OXPHOS pathway and by the reduction of WAT. The invention further pertains to methods for identifying a compound or agent which modulates, e.g., stimulates or inhibits, the interaction of the putrescine with a target molecule, e.g. PGC-1α. In these methods, the putrescine is contacted, in the presence of the compound or agent, with the PGC-1α under conditions which allow interaction of the PGC-1α to the putrescine. An alteration, e.g., an increase or decrease, in insulin sensitivity and/or glucose tolerance resulting from the interaction between the putrescine and the PGC-1α as compared to the insulin sensitivity and/or glucose tolerance in the absence of the compound or agent is indicative of the ability of the compound or agent to modulate the interaction of the putrescine with a PGC- 1α. The one preferred embodiment, alterations can be further detected by the overexpression of the OXPHOS pathway and by the reduction of WAT.

Pharmaceutical compositions

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.TM. (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound (e.g., SSAT or PAO or putrescine-PGC-1α modulator agent, putrescine or putrescine analogue or derivative) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drγing which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrγstalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

Screening

The present invention also encompasses agent which modulate SSAT and/or PAO and/or PGC-1α and/or OXPHOS expression or activity. A modulator agent may, for example, be a small molecule. For example, such small molecules include, but are not limited to, polyamine analogues, putrescine analogues or derivatives, peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e.. including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1 ,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds. It is understood that appropriate doses of small molecule agents depends upon a number of factors within the ken of the ordinarily skilled physician, veterinarian, or researcher. The dose(s) of the small molecule will vary, for example, depending upon the identity, size, and condition of the subject or sample being treated, further depending upon the route by which the composition is to be administered, if applicable, and the effect which the practitioner desires the small molecule to have upon the polyamine pathway. Exemplary doses include milligram or microgram amounts of the small molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is furthermore understood that appropriate doses of a small molecule depend upon the potency of the small molecule with respect to the expression or activity to be modulated. Such appropriate doses may be determined using the assays described herein. When one or more of these small molecules is to be administered to an animal (e.g., a human) in order to modulate expression or activity of a polypeptide or nucleic acid of the invention, a physician, veterinarian, or researcher may, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained. In addition, it is understood that the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.

In another aspect, the invention provides methods of screening for agents which modulate SSAT and/or PAO and/or PGC-1α and/or OXPHOS ligand/substrate interactions. These methods generally involve forming a mixture of an SSAT and/or PAO and/or PGC-1α-expressing cell, an SSAT and/or PAO and/or PGC-1α ligand polypeptide and a candidate modulator agent, and determining the effect of the agent on the amount of SSAT and/or PAO and/or PGC-1α activity expressed by the cell. The methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. Identified reagents find use in the pharmaceutical industries for animal and human trials; for example, the reagents may be derivatized and rescreened in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.

The invention further provides methods (also referred to herein as "screening assays") for identifying modulators or modulating agents, i.e., candidate or test compounds or agents (e.g., polyamine analogues, peptides, peptidomimetics, peptoids, small molecules or other drugs) which bind to SSAT and/or PAO and/or PGC-1 α and/or OXPHOS proteins, have a stimulatory or inhibitory effect on, for example, SSAT and/or PAO and/or PGC-1α and/or OXPHOS expression or SSAT and/or PAO and/or PGC-1α and/or OXPHOS activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of an SSAT and/or PAO and/or PGC-1α and/or OXPHOS substrate. Compounds thus identified can be used to modulate the activity of SSAT and/or PAO and/or PGC-1α and/or OXPHOS in a therapeutic protocol, to elaborate the biological function of the SSAT and/or PAO and/or PGC-1α and/or OXPHOS, or to identify compounds that disrupt normal SSAT and/or PAO and/or PGC-1α and/or OXPHOS interactions.

In another embodiment, the invention provides screening assays to identify candidate/test compounds which modulate (e.g., stimulate or inhibit) the interaction between a PGC-1 protein and a putrescine with which the PGC-1 protein normally interacts. Typically, the assays are cell-free assays which include the steps of combining a PGC-1 protein or a biologically active portion thereof, putrescine and a candidate/test compound, e.g., under conditions wherein but for the presence of the candidate compound, the PGC-1 protein or biologically active portion thereof interacts with (e.g., binds to) putrescine, and detecting the formation of a complex which includes the PGC-1 protein and putrescine or detecting the interaction/reaction of the PGC-1 protein and putrescine. Detection of complex formation can include direct quantitation of the complex by, for example, measuring inductive effects of the PGC-1 protein. A statistically significant change, such as a decrease, in the interaction of the PGC-1 and putrescine (e.g., in the formation of a complex between the PGC-1 and putrescine) in the presence of a candidate compound (relative to what is detected in the absence of the candidate compound) is indicative of a modulation (e.g., stimulation or inhibition) of the interaction between the PGC-1 protein and putrescine. Modulation of the formation of complexes between the PGC- 1 protein and the putrescine can be quantitated using, for example, an immunoassay.

In one embodiment, an assay is a cell-based assay in which a cell which expresses an SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein or biologically active portion thereof is contacted with a test or modulator compound and the ability of the test compound to modulate SSAT and/or PAO and/or PGC-1α and/or OXPHOS activity is determined. Determining the ability of the test compound to modulate SSAT and/or PAO and/or PGC-1α and/or OXPHOS activity can be accomplished by monitoring, for example, SSAT activity or PAO activity, or upregulation of OXPHOS or PGC-1α. The cell, for example, can be of mammalian origin, e.g., a fat or muscle cell.

In yet another embodiment, the cell-free assay involves contacting an SSAT and/or PAO and/or PGC-1α protein or biologically active portion thereof with a known compound or ligand or substrate which binds the SSAT and/or PAO and/or PGC-1α protein to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with the SSAT and/or PAO and/or PGC-1α protein, wherein determining the ability of the test compound to interact with the SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein comprises determining the ability of the SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein to preferentially bind to or modulate the activity of an SSAT and/or PAO and/or PGC-1α and/or OXPHOS ligand/substrate.

Assays for the Detection of the Ability of a Test Compound to Modulate Expression of SSAT and/or PAO and/or PGC-1α and/or OXPHOS

In another embodiment, modulators of SSAT and/or PAO and/or PGC-1α and/or OXPHOS expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein in the cell is determined. The level of expression of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein in the presence of the candidate compound is compared to the level of expression of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein in the absence of the candidate compound. The candidate compound can then be identified as a modulator of SSAT and/or PAO and/or PGC-1α and/or OXPHOS expression based on this comparison. For example, when expression of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein expression. Alternatively, when expression of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of SSAT and/or PAO and/or PGC-1α and/or OXPHOS mRNA or protein expression. The level of SSAT and/or PAO and/or PGC- 1 α and/or OXPHOS mRNA or protein expression in the cells can be determined by methods described herein for detecting SSAT and/or PAO and/or PGC-1 α and/or OXPHOS mRNA or protein.

Combination Assays

In another aspect, the invention pertains to a combination of two or more of the assays described herein. For example, a modulating agent can be identified using a cell-based or a cell free assay, and the ability of the agent to modulate the activity of an SSAT and/or PAO and/or PGC-1 α and/or OXPHOS protein can be confirmed in vivo, e.g., in an animal such as an animal model for diabetes disorders, or for cellular transformation and/or neuronal regeneration.

This invention farther pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., an SSAT and/or PAO and/or PGC- 1α and/or OXPHOS modulating agent) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.

The choice of assay format will be based primarily on the nature and type of sensitivity/resistance protein being assayed. A skilled artisan can readily adapt protein activity assays for use in the present invention with the genes identified herein.

Modulators of SSAT and/or PAO and/or PGC-lα and/or OXPHOS protein activity and/or SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression identified according to these drug screening assays can be used to treat, for example, weight disorders, e.g. obesity, and disorders associated with insufficient insulin activity, e.g., diabetes. These methods of treatment include the steps of administering the modulators agents of SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity and/or nucleic acid expression, e.g., in a pharmaceutical composition as described to a subject in need of such treatment, e.g., a subject with a disorder described herein.

Polvamine metabolism

L-ornithine and L-methionine are the primary precursors of the polyamines. L- omithine is cleaved from L-arginine, and then then decarboxylated by ornithine decarboxylase to yield putrescine. L-methionine is first converted to S-adenosyl-L- methionine (AdoMet), and then by AdoMet decarboxylase (AdoMetDC) to decarboxylated AdoMet (dcAdoMet). DcAdoMet donates its aminopropyl group either to putrescine in a reaction catalyzed by spermidine synthase to yield spermidine, or to spermine synthase to yield spermine. These reaction are irreversible and an entirely distinct system is needed to convert the higher polyamines back to putrescine. SSAT is the rate-controlling enzyme in this backconversion pathway. SSAT acetylates or diacetylates spermine, and diacetylspermine is backconverted to putrescine by an enzyme, peroxisomal flavoprotein polyamine oxidase (PAO). SSAT is a rate-controlling enzyme in this backconversion pathway. In addition to putrescine, the PAO reaction yields hydrogen peroxide and acetaminopropanal.

The evaluation of different compounds is based on their effect on insulin sensitivity and glucose tolerance. Intraperitoneal glucose tolerance test is performed in wild- type mice or in SSAT knockout (KO) mice to evaluate the changes in fasting and postload glucose levels. The lowering of glucose is the primary end point in both models. The normalization of glucose tolerance in SSAT KO mice is evaluated. If there is a lowering of glucose levels in an intraperitoneal glucose tolerance test, the mechanisms for this are evaluated by an insulin tolerance test which measures insulin sensitivity. The expected change is an increase in insulin sensitivity. Furthermore, in wild type and SSAT KO mice the amount of WAT is monitored. It is expected that the amount of WAT will be lowered because the basal metabolic rate is expected to increase.

Methods of treatment

Another aspect of the invention pertains to methods for treating a subject, e.g., a human, having a disease or disorder characterized by (or associated with) aberrant or abnormal insulin sensitivity and/or glucose tolerance. These methods include the step of administering a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent to the subject such that treatment occurs. The term "SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent" is intended also to encompass putrescine and putrescine analogues. As the polyamine pathway is involved in, for example, insulin sensitivity and/or glucose tolerance, aberrant polyamine pathway may interfere with the normal weight control and metabolic functions. Non-limiting examples of disorders or diseases include weight disorders, e.g., obesity, cachexia, anorexia, and disorders associated with insufficient insulin and/or glucose tolerance activity, e.g., diabetes. Disorders associated with body weight are disorders associated with abnormal body weight or abnormal control of body weight. Abnormal glucose tolerance and/or insulin function includes any abnormality or impairment in insulin production, e.g., expression and/or transport through cellular organelles, such as insulin deficiency resulting from, for example, loss of beta cells as in IDDM (Type I diabetes), secretion, such as impairment of insulin secretory responses as in NIDDM (Type Il diabetes), the form of the insulin molecule itself, e.g., primary, secondary or tertiary structure, effects of insulin on target cells, e.g., insulin-resistance in bodily tissues, e.g., peripheral tissues, and responses of target cells to insulin. See Braunwald, E. et al. eds. Harrison's Principles of Internal Medicine, Eleventh Edition (McGraw-Hill Book Company, New York, 1987) pp. 1778-1797; Robbins, S. L. et al. Pathologic Basis of Disease, 3rd Edition (W.B. Saunders Company, Philadelphia, 1984) p. 972 for further descriptions of abnormal insulin activity in IDDM and NIDDM and other forms of diabetes. The terms "treating" or "treatment", as used herein, refer to reduction or alleviation of at least one adverse effect or symptom of a disorder or disease.

As used herein, a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent is a molecule which can modulate SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression and/or SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity. For example, a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent can modulate, e.g., upregulate (activate) or downregulate (suppress), SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression. In another example, a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent can modulate (e.g., stimulate or inhibit) SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity. If it is desirable to treat a disorder or disease characterized by (or associated with) aberrant or abnormal insulin sensitivity and/or glucose tolerance SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression and/or SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity by activating SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression, a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent can be a polyamine analogue as described herein.

A SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent which activates SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression can also be a small molecule or other drug, e.g., a small molecule, polyamine analogue or drug identified using the screening assays described herein, which activates SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression. If it is desirable to treat a disease or disorder characterized by (or associated with) aberrant or abnormal insulin sensitivity and/or glucose tolerance SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent can be, for example, a nucleic acid molecule encoding SSAT and/or PAO and/or PGC-1α and/or OXPHOS or a small molecule or other drug, e.g., a small molecule (peptide) or drug identified using the screening assays described herein, which stimulates SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression.

In addition, a subject having a weight disorder, e.g., obesity, can be treated according to the present invention by administering to the subject a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent such that treatment occurs. Similarly, a subject having a disorder associated with insufficient insulin activity and/or glucose tolerance can be treated according to the present invention by administering to the subject a SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent such that treatment occurs.

Other aspects of the invention pertain to methods for modulating a cell associated activity. These methods include contacting the cell with an agent (or a composition which includes an effective amount of an agent) which modulates SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity or SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression such that a cell associated activity is altered relative to a cell associated activity of the cell in the absence of the agent. As used herein, "a cell associated activity" refers to a normal or abnormal activity or function of a cell. Examples of cell associated activities include proliferation, migration, differentiation, production or secretion of molecules, such as proteins, cell survival, polyamine pathway related activities and their manifestations in a cell and thermogenesis. In a preferred embodiment, the cell associated activity is improvement of insulin sensitivity and glucose tolerance and the cell is a white or brown adipocyte. The term "altered" as used herein refers to a change, e.g., an increase or decrease, of a cell associated activity. In one embodiment, the agent stimulates SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity or SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression. Examples of such stimulatory agents include an active SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein, a nucleic acid molecule encoding SSAT and/or PAO and/or PGC-1α and/or OXPHOS that has been introduced into the cell, and a modulating agent which stimulates SSAT and/or PAO and/or PGC-1α and/or OXPHOS protein activity or SSAT and/or PAO and/or PGC-1α and/or OXPHOS nucleic acid expression and which is identified using the drug screening assays described herein. These modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). In a preferred embodiment, the modulatory methods are performed in vivo, i.e., the cell is present within a subject, e.g., a mammal, e.g., a human, and the subject has a disorder or disease characterized by or associated with abnormal or aberrant insulin sensitivity and/or glucose tolerance.

A SSAT and/or PAO and/or PGC-1α and/or OXPHOS modulating agent etc. used in the methods of treatment can be incorporated into an appropriate pharmaceutical composition described herein and administered to the subject through a route which allows the molecule, protein, modulator, or compound etc. to perform its intended function.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patent applications, patents, and published patent applications cited throughout this application are hereby incorporated by reference.

ADVANTAGES OF THE PRESENT INVENTION

Diabetes 2 patients have overweight, high fat and high glucose levels in serum. The modulator agent of the present invention negates these manifestations.

Commercially available drugs stimulates secretion of insulin, which in turn increases appetite and thus, promotes overweight. Sulfonylureas and insulin increase body weight, unlike metformin but it has not significant effect on fat tissue and glucose serum levels.

EXPERIMENTAL SECTION

EXAMPLE 1

Results

Growth and body composition of SSAT mice

Female wild-type mice were heavier from 2 to 8 weeks and male wild-type mice from 4- to 8-weeks as compared with corresponding SSAT mice. However, female SSAT mice were heavier than wild-type mice from 13 to 16 weeks but after that body weight was similar in SSAT and wild-type mice (Figure 1A). Four-month-old mice female SSAT mice had significantly enlarged liver, spleen, pancreas, heart and kidney (Table 1). In addition, the spleens of male transgenic mice were significantly enlarged whereas the size of the liver, kidney and heart was only slightly increased (Table 1). Histological analysis of the organs from female SSAT mice did not reveal any abnormalities (data not shown). Whole body fat mass was significantly lower both in female and male SSAT mice as compared with wild-type mice (Figure 1B). In SSAT mice, females had increased lean body mass in comparison with wild-type mice. Furthermore, the weight of skin was higher in SSAT mice than in wild-type mice (Figure 1 B).

Because the lack of adipose tissue causes ectopic lipid accumulation in insulin sensitive tissues, we determined triglyceride concentrations in skeletal muscle, liver and heart in female SSAT and wild-type mice in fed state. As compared with wild-type mice, SSAT mice showed about 20 to 25 % lower triglyceride content in skeletal muscle, liver and heart (Figure 1C).

Autopsies of adult SSAT mice revealed markedly reduced subcutaneous (18) and visceral fat pads (19). Perigonadal WAT was significantly reduced in SSAT mice as compared with wild-type mice (Table 1) but there was no difference in the weight of brown adipose tissue (BAT). However, histological analyses of perigonadal fat pads and isolated adipocytes showed that the cell diameter was about 2-fold smaller in SSAT mice in comparison with wild-type mice (Figure 1 D and E), and the cell density was increased by 9-fold (Figure 1 F). In contrast, the total cell number was equal in perigonadal fat pads (SSAT: 3.2 ± 0.2 x 10⁶ vs. wt: 3.3 ± 0.1 x 10⁶) due to reduced fat mass. Histological examination of BAT did not reveal any difference between SSAT and wild-type mice (Figure 1D).

Polyamine pools in WA T of SSA T mice

Female SSAT mice displayed significantly higher SSAT activity and putrescine concentrations than wild-type mice in WAT (Table 2). In contrast, spermidine and spermine levels were similar (Table 2).

Biochemical parameters of SSAT mice

Plasma leptin levels were reduced about 80 % in SSAT mice than in wild-type mice (Table 3). In addition, SSAT mice showed no change in circulating serum FFA levels in comparison with wild-type mice either in fed or fasting state. In contrast, triglyceride (TG) levels of SSAT mice were increased in fed state whereas fasting TGs were significantly reduced in SSAT mice as compared with wild-type mice (Table 3). In addition, SSAT mice had significantly reduced fed and fasting glucose levels. However, insulin levels were increased in the fed state, yet, the fasting insulin levels were significantly reduced in SSAT mice (Table 3). In fed state, serum 3- hydroxybutyrate levels, which are produced as an energy source in the liver from FFA at times of low glucose, low insulin, and high glucagon levels, were almost undetectable in both groups whereas fasting 3-hydroxybutyrate levels of SSAT mice did not rise nearly as much as in wild-type mice (Table 3). Plasma glycerol, which is mainly released from WAT by lipolysis and can be convert to glucose, did not differ between SSAT and wild-type mice in fed state, but fasting glycerol was lower in SSAT mice than in wild-type mice (Table 3).

Improved glucose tolerance and insulin sensitivity in SSAT mice In the glucose tolerance test at 15, 30, 60, and 120 min after glucose administration, plasma glucose was significantly lower in SSAT mice than in wild-type mice (Figure 2A). In addition, insulin levels were lower at 0 and 120 min in SSAT mice (Figure 2B). Insulin sensitivity, evaluated by two different intraperitoneal insulin tolerance tests (Figure 2C and D), showed that SSAT mice were more insulin-sensitive than wild-type mice as their plasma glucose levels were lower at 20, 40 and 80 min.

SSAT mice showed increased energy expenditure

In SSAT mice (combined results from females and males), oxygen consumption, as related to body weight, was significantly higher than in wild-type mice (Figure 3A). The results remained essentially similar when expressed as VO2/lean body mass (Figure 3A). We also measured basal energy expenditure in the same mice before (at the age of 2.5 weeks) and after the hair loss (at the age of 13-weeks). Oxygen consumption was significantly higher in SSAT mice than in wild-type mice before and after hair loss (Figure 3B).

In contrast, RQ, the ratio of carbon dioxide produced to oxygen consumed, was similar in both groups after fasting in resting state irrespective of the age (SSAT 6- month-old: 0.84 ± 0.01 vs. wt 6-month-old: 0.86 ± 0.01. SSAT 3-month-old: 0.74 ± 0.01 vs. wt 3-month-old: 0.77 ± 0.02). However, after fasting in the active state, 6- month-old SSAT mice showed significantly lower RQ (0.82 ± 0.01 vs. 0.86 ± 0.01, p<0.05). In addition, SSAT mice had lower RQ in the fed and resting state (0.75 ±0.03 vs. 0.82 ± 0.01) but the difference was not significant.

Consistent with increased energy expenditure, 4-month-old female SSAT mice had significantly higher food and water intake (Figure 3C) as compared with wild-type mice. Due to increased energy expenditure, we also studied telemetrically body temperature and physical activity of SSAT and wild-type mice. At 25 °C, SSAT mice had similar or somewhat higher body temperature during daytime (36.5 ± 0.1 vs. 36.3 ± 0.1 "C) (Figure 3D) and lower body temperature than wild-type mice during night-time (36.8 ± 0.1 vs. 37.2 ± 0.1 ⁰C, p<0.05) (Figure 3D) but the mean temperature during 24 h did not differ between SSAT mice and wild-type mice (36.6 ± 0.1 vs. 36.8 ± 0.1 ⁰C). Locomotor activity of wild-type mice was substantially increased during night-time whereas SSAT mice did not show any significant circadian change in their activity pattern (Figure 3D). At 12 ⁰C, adaptive thermogenesis was not induced in SSAT mice as compared with wild-type mice (Figure 3D) because SSAT mice had significantly reduced mean body temperature during daytime (35.5 ± 0.5 vs. 36.2 ± 0.1 °C, p<0.05), night-time (35.0 ± 0.3 vs. 36.8 ± 0.1 ⁰C, p<0.001) and 24 h (35.2 ± 0.4 vs. 36.5 ± 0.1 °C, p<0.001) than in wild-type mice. Locomotor activity patterns were quite similar at 12 ⁰C in comparison with the results obtained at 25 °C (Figure 3D).

As oxygen consumption is largely determined by the rate of fatty acid oxidation and mitochondrial activity, it was meaningful to study β-oxidation rate in liver. The oxidation of palmitoylcarnitine, monitored as the rate of ferricyanide reduction, was slightly but not significantly reduced in isolated mitochondria from the liver of SSAT mice (34.0 ± 7.21 vs. 39.2 ± 4.7 nmol/mg prot). Preliminary data from skeletal muscle likewise showed that palmitate oxidation did not differ between the groups in tissue homogenates or isolated mitochondria (data not shown). Therefore, we decided to measure β-oxidation rate in pooled isolated adipocytes. The rate of total fatty acid oxidation was estimated by measuring the amount of ¹⁴CO₂ produced from exogenously administered [¹⁴C]-palmitate. Interestingly, palmitate oxidation in adipocytes from both male and female SSAT mice was markedly increased as compared with wild-type mice (Figure 3E).

Overexpression of genes involves in the OXPHOS pathway In order to elucidate the molecular mechanisms leading to the phenotype of SSAT mice, we analyzed gene expression profiles from WAT, liver and skeletal muscle of fed SSAT and wild-type mice using Affymetrix analysis. Affymetrix data have been published in ArrayExpress repository (http://www.ebi.ac.uk/arrayexpress/ with accession number E-MEXP-165). Of 12 000 sequences represented in the array, 643 in WAT, 610 in skeletal muscle and 789 in liver were differentially expressed in SSAT mice as compared with wild-type mice. According to the MappFinder program, the number of changes was highest in WAT and the top-ranked cellular components of WAT were mitochondrion, cytoplasm and mitochondrial matrix (Z scores 11.2, 4.6 and 3.6, respectively). In addition, top-ranked metabolic pathways or process terms relevant to the phenotype of SSAT in WAT were for example oxidoreductase, pyruvate metabolism, energy derivation by oxidation of organic compounds, lipid metabolism, glucose metabolism, polyamine biosynthesis, electron transport and tricarboxylic acid cycle (Z scores 9.3, 7.3, 6.4, 5.8, 5.3, 5.0, 5.0, 5.0).

Mitochondrial analyses

Based on MappFinder results, we focused our further studies on WAT and mitochondria. Electron microscopic examination revealed that SSAT mice had an increase in the number and size of mitochondria in WAT as compared with wild-type mice (Figure 4A). To verify our electron microscopy results, we also determined the amount of mitochondrial DNA (mtDNA) by measuring the ratio of a mitochondrial gene (16S RNA) to a nuclear gene (HKII, intron 9) using quantitative RT-PCR. SSAT mice showed about a 2-fold increase in the amount of mtDNA in their WAT (Figure 4B). In quadriceps muscle, mtDNA amount was significantly reduced in SSAT mice as compared with wild-type mice whereas the liver mtDNA amount did not differ between the groups (Figure 4B).

Quantitative RT-PCR analyses

To further investigate the underlying molecular mechanisms contributing to our findings, RT-PCR was used to quantify the expression of genes regulating mitochondrial biogenesis, mtDNA replication and transcription and mitochondrial metabolic pathways. Table 4 shows gene expression pattern of 4-month-old female fed SSAT and wild-type mice analyzed by quantitative RT-PCR.

Our results showed that the expression of SSAT was markedly upregulated in all tissues studied, the highest mRNA levels being found in WAT. Expression of PGC-1α, that activates mitochondrial biogenesis (7), oxidative phosphorylation (2), uncoupling (6, 8) and fatty acid oxidation (9, 10) was elevated in WAT of SSAT mice. However, expression of PPARγ co-activator 1 β, a regulator of oxidative metabolism in mitochondria (20), and, mitochondrial transcription factor A (7), a regulator of mtDNA replication and transcription, was only slightly elevated in WAT of SSAT mice, and there was no change in expression level of nuclear respiratory factor 1 (7) between the groups in WAT. Thus, based on these data it would appear that PGC-1α is the key factor involved in increased mitochondrial biogenesis in WAT of SSAT mice. In addition, expression of estrogen related receptor α, which is an effector of PGC-1α and an activator of oxidative phosphorylation and mitochondrial biogenesis (21), appeared to follow the expression pattern of PGC-1α in WAT. Therefore, we next investigated expression of genes encoding proteins related to five electron transport complexes and the results showed that the expression of all genes (NADH- ubiquinone oxidoreductase MWFE subunit, succinate dehydrogenase Ip subunit, cytochrome c, cytochrome c oxidase polypeptide IV, ubiquinol-cytochrome c reductase complex and ATP synthase α) was upregulated indicating increased oxidative phosphorylation in SSAT-mice most probably as a result of overexpression of PGC-1α and estrogen related receptor α.

PGC-1α stimulates β-oxidation by co-activating PPARα (9) and PPARδ (10). In SSAT mice, expression level of PPARα was only slightly increased in WAT while that of PPARδ was significantly increased. In addition, expression levels of short-chain, medium-chain and long-chain acyl-CoA dehydrogenases, which catalyze the key reaction in the β-oxidation of fatty acids, were upregulated in WAT. Expression of genes involved in fatty acid uptake and trapping, such as CD36 antigen/fatty acid translocase, fatty acid transport protein 1 and adipocyte-specific fatty acid-binding protein were elevated in SSAT mice. We also investigated expression of genes involved in regulation of lipolysis. The expression levels for β_1-3-adenergic receptors did not differ between SSAT and wild-type mice in WAT indicating no change in sensitivity to adrenergic stimuli. In contrast, hormone-sensitive lipase, the rate- controlling gene in lipolysis, was upregulated in WAT of SSAT mice, suggesting that lipolysis may be enhanced in WAT.

PGC-1α is a co-activator of PPARY which is highly expressed in WAT and involved in adipocyte differentiation and regulation of insulin sensitivity (22). PPARY expression was slightly, but not significantly, elevated in WAT of SSAT mice. In addition, other transcription factors known to promote adipocyte differentiation (cAMP responsive element binding protein, CCAAT/enhancer binding protein α and SREBPIc) were upregulated in WAT of SSAT mice.

The activation of PGC-1α also increases the expression of uncoupling proteins (UCPs) leading to the dissipation of energy in mitochondria (6, 8). UCP1 produces heat to maintain body temperature whereas UCP2 and UCP3 are linked to the regulation of fatty acid oxidation, glucose transport and negative regulation of reactive oxygen species (23). UCP3 expression in WAT was increased in SSAT mice indicating that an induction of uncoupling also plays an important role leading to the lean phenotype of SSAT mice.

PGC-1α also stimulates expression of glucose transporter 4 (GLUT4) (11). Based on the quantitative RT-PCR results, GLUT4 was up-regulated in WAT of SSAT mice. In addition, expression of hexokinase II, which catalyzes the phosphorylation of glucose to glucose-6-phosphate in WAT and skeletal muscle, was increased in WAT of SSAT mice.

Because PGC-1α expression was increased in SSAT mice, we investigated next the expression of factors known to stimulate PGC-1α expression (24). The expression of 5'-AMP-activated protein kinase (AMPK) regulatory subunits B1 and G1, evaluated by quantitative RT-PCR, was increased. Of the cytokines, only IL-1 β expression was elevated in WAT of SSAT mice. Therefore, AMPK and IL-1 β may activate PGC-1α expression in WAT of SSAT mice.

Table 4 also shows gene expression profiles in skeletal muscle and liver. Changes in gene expression levels were mostly observed in WAT, as was expected based on the MappFinder results. PGC-1α expression was insignificantly reduced in skeletal muscle whereas in liver the expression did not differ between the groups. The expression of estrogen related receptor α and genes involved in oxidative phosphorylation also followed the expression pattern of PGC-1α in skeletal muscle and liver. The expression of nuclear receptors and genes participating in fatty acid oxidation did not differ between the groups in skeletal muscle and liver paralleling our results from β-oxidation. In addition, the expression of hormone-sensitive lipase and β₂-adenergic receptors was also elevated in liver. Expression of uncoupling proteins was elevated in both tissues. However, UCP3 expression in skeletal muscle was significantly reduced, and therefore followed the expression of PGC-1α. In skeletal muscle, GLUT4 and hexokinase Il were upregulated. In addition, the expression of PPARY was increased in skeletal muscle likely contributing to the overexpression of UCPs and GLUT4. Expression of AMPK regulatory subunits B1 and G1 was similar in both groups in skeletal muscle and liver. IL-1 β and TN Fa were up-regulated in skeletal muscle, whereas IL-6 was downregulated. No significant changes in the expression of cytokines were found in liver. Due to the apparent inability of SSAT mice to form ketone bodies, we analyzed expression of genes regulating ketogenesis in liver in fasting state. Expression of rate- limiting mitochondrial gene, HMG-CoA synthase, was significantly reduced in liver (0.62 ± 0.06, fold wild-type, p<0.01). In addition, an activator of HMG-CoA synthase and fatty acid oxidation, PPARα was down-regulated in SSAT mice (0.72 ± 0.05, fold wild-type, p<0.05).

PGC-Ia and UCP1 protein expression in WAT and BAT

Western blotting of PGC-1α in fed state showed that the level of 91-kDa full length

PGC-1α protein was elevated by 5.0-fold in WAT of SSAT mice (Figure 5A) whereas in BAT, PGC-1α levels were unaltered in SSAT mice (Figure 5B). The brown adipose tissue marker, UCP1, was undetectable in WAT of both mouse lines in fed state and in addition, SSAT mice showed no change in protein levels of UCP1 in BAT (Figure

5C).

Inhibition ofputrescine biosynthesis

To investigate whether enhanced putrescine accumulation was responsible for the activation of PGC-1α, directly or indirectly through some signaling molecule, we used a specific inhibitor of L-ornithine decarboxylase, 2-difluoromethylomithine (DFMO), to block increased synthesis of putrescine in SSAT mice. We gave 0.5% DFMO for 2 or 5 weeks in the drinking water of SSAT and wild-type mice after weaning when SSAT mice loose their hair. DFMO treatment did not have any effect on body weight in wild- type mice, but in SSAT mice it caused about 2-fold increase in the amount of WAT after 2 weeks and about 2.3-fold increase after 5 weeks as compared with untreated SSAT mice (Table 5). The treatment reduced putrescine levels in WAT by about 55% after 2 weeks and about 70% after 5 weeks in SSAT mice (Table 5).

We subsequently monitored the gene expression profile at 2 weeks after DFMO treatment. The most important finding was that DFMO treatment reduced the expression of PCG-1α to near wild-type level (Table 6). Similarly, the expression of all genes induced by PGC-1α was reduced in response to the treatment (Table 6). In addition, the expression of AMPK regulatory subunit G1 was reduced whereas the expression of IL-1β was unaltered after DFMO treatment (Table 6)

SSA T knockout mouse

Our preliminary results in SSAT knockout mice generated by our group (Niiranen K et al. J Buil Chem 277:25323-8, 2002) show that these mice accumulate WAT and have impaired glucose tolerance in intraperitoneal glucose tolerance test. Furthermore, PGC-1α expression is downregulated. These findings give further evidence that SSAT regulates glucose metabolism.

Discussion

In this study we investigated transgenic mice overexpressing SSAT (18) which have the massive accumulation of putrescine especially in WAT. The metabolic phenotype is opposite to that observed in patients with type 2 diabetes as they have severely reduced deposits of WAT, increased basal metabolic rate, glucose tolerance, insulin sensitivity and mitochondrial biogenesis, and low accumulation of fat in internal organs and overexpression of OXPHOS pathway in WAT. The observed changes are not related to the hairless phenotype of the SSAT mice, as similarly hairless mice (resulted from the spontaneous mutation of the hairless gene) showed normal white adipose tissue mass, unaltered blood glucose and insulin levels (data not shown). We demonstrated that the phenotype is apparently due to increased levels of PGC-1α and putrescine in WAT.

Ectopic expression of PGC-1α in human adipocytes increased expression of genes regulating uncoupling (UCP1), fatty acid oxidation (carnitine palmitoyltransferase I and medium-chain acyl-CoA dehydrogenase) and OXPHOS (cytochrome c) (25). These changes are consistent with a gene expression profile of brown adipocytes and therefore, PGC-1α induces a conversion from white to brown adipocytes or in other words, a conversion from fat storing cells to fat oxidizing cells. Mouse models overexpressing PGC-1α in WAT (26, 27) have brown-fat like adipocytes, reduced fat pads, increased metabolic rate, uncoupling and insulin sensitivity, and they are protected from diet-induced obesity. In addition, it has been shown in rodents that hyperleptinemia resulting from adenovirus-induced ectopic overexpression of leptin gene causes a dramatic decrease of WAT due to increased fatty oxidation and upregulation of PPARα and PGC-1α (28, 29). Our results showed that SSAT mice had severely reduced white fat pads resulting from overexpression of PGC-1α in WAT leading to metabolic changes which resemble the characteristics of BAT, as in other mouse models overexpressing PGC-1α in WAT (26, 27). Firstly, SSAT mice had increased number of mitochondria in WAT, a typical feature of BAT (30). Secondly, the expression of UCP3 was increased in WAT indicating increased uncoupling. Thirdly, palmitate oxidation rate and the expression of genes involved in fatty acid oxidation was found to be increased in WAT of SSAT suggesting elevated fatty acid oxidation. Fourthly, OXPHOS seems to be enhanced in WAT of SSAT because the expression of genes involved in OXPHOS (estrogen related receptor α, NADH- ubiquinone oxidoreductase MWFE subunit, succinate dehydrogenase Ip subunit, cytochrome c, cytochrome c oxidase polypeptide IV, ubiquinol-cytochrome c reductase complex and ATP synthase α) was increased in WAT. Therefore, the upregulation of endogenous PGC-1α expression in WAT seems to be an attractive target for obesity drug therapy.

Previous BAT-like characteristics of WAT provide an explanation for the increased metabolic rate observed in SSAT mice. Metabolic rate was determined as oxygen consumption at thermoneutrality (32 ⁰C) of both mouse lines in order to exclude an effect of hairlessness on SSAT mice. Oxygen consumption, determined before and after hair loss, was increased in SSAT mice in both states indicating that the hair loss does not contribute to the increased metabolic rate in SSAT mice. Similarly, the increased metabolic rate of SSAT mice was not due to increased physical activity because our and previous results (31) showed that SSAT mice were less active than wild-type mice. However, corresponding to the increased metabolic rate, SSAT mice had hyperphagia. This may be results from reduced leptin levels known to lead to increased food intake (32). On the other hand, hyperphagia may also be a compensatory effect for the lack of stored energy. Interestingly, despite of the increased metabolic rate, body temperature of SSAT mice was not elevated and SSAT mice were unable to induce adaptive thermogenesis. Thermogenesis takes place in BAT and the stimulation of sympathetic nervous systems due to cold- exposure leads to an activation of UCP1 which uncouples proton energy from ATP synthesis and therefore, dissipates energy as heat (33). PGC-1α is an activator of UCP1 and it is induced by cold-exposure via β-adenergic signalling pathway in BAT. Thermogenesis is also shown to be impaired in leptin-deficient and leptin unresponsive rodents (34) and UCP1 levels are reduced in their BAT. Namely, leptin is needed for the stimulation of sympathetic nerve activity of BAT in response to cold- exposure (35, 36). Similarly, thyroid hormones play also a fundamental role in adaptive thermogenesis because the stimulation of thermogenesis depends on synergism between sympathetic nervous system and thyroid hormones (33). Hypothyroid rats have normal diet-induced thermogenesis (37) but almost no cold- induced thermogenesis because they do not survive cold exposure (38). Our results showed that PGC-1α and UCP1 protein levels in BAT were similar in fed state in SSAT and wild-type mice. In addition, it has been shown that SSAT mice have markedly reduced thyroid hormones levels (31). Therefore, it seems that the impaired adaptive thermogenesis in SSAT mice results from decreased sympathetic outflow to BAT due to hypoleptinemia and hypothyroidism.

The histological examination of WAT revealed that adipocytes from SSAT mice were smaller than wild-type cells but there was not brown-fat like multilocular cells as could have been expected. The number of adipocytes was equal in perigonadal fat pads as compared with wild-type mice indicating that SSAT do not have impaired adipocyte differentiation. Previously, it has been reported that polyamines, especially spermidine and putrescine, are needed for the differentiation of 3T3-L1 fibroblasts to adipocytes (39). However, in WAT, there was not a reduction in spermidine levels as in other tissues in SSAT mice (18) and putrescine levels were strikingly increased. Therefore, to exclude a defect in adipocyte differentation we studied an ability of embryonic fibroblast from SSAT mice to differentiate into adipocytes, and it was found to be similar than in wild-type cells (unpublished data). This result is supported by the fact that the expression of transcription factors promoting differentiation (PPARY, CAMP responsive element binding protein, CCAAT/enhancer binding protein α and SREBPIc) was upregulated in SSAT mice.

Lipoatrophic mouse models (40, 41) have lipoatrophic diabetes characterized by increased tissue triglyceride content, hyperinsulinemia, hyperglycemia, hyperlipidemia and insulin resistance (42). Unlike these models, SSAT mice do not exhibit lipodystrophy associated metabolic symptoms shown above. Namely, SSAT mice had low accumulation of triglycerides in skeletal muscle and liver, and unaltered blood FFA and TG levels except TG levels were increased in fed state but this is probably due to the lack of WAT which leads usually to an inability to store FFA and triglycerides derived mainly from diet and hepatic production. Normal FFA and low TG levels in fasting state are consistent with the enhanced palmitate oxidation rate in WAT of SSAT mice and the lower RQ values in the active state. SSAT mice had also reduced plasma fasting glucose and insulin levels, improved glucose tolerance and increased insulin sensitivity. In addition, the expression of Glut4 and HKII was increased in WAT and skeletal muscle suggesting that glucose uptake may be increased in both tissues which may be stimulated by PGC-1α (11). The lack of WAT causes leptin deficiency (43) which is observed to contribute for a development of insulin resistance. Namely, leptin increases muscle glucose utilization (44), enhances insulin's inhibition of hepatic glucose production (45) and exogenous leptin has been shown to rescue diabetes in lipodystrophic mouse models (46) and in humans (47). However, as an indicator of reduced fat mass, SSAT mice had reduced levels of leptin but it did not result in insulin resistance and therefore, further studies are required to determine the mechanism for insulin sensitivity in SSAT mice.

The metabolic characteristics common to lipoatrophic models and SSAT mice is organomegaly and an inability to form ketone bodies in addition to hypoleptinemia, hyperphagia and the increased metabolic rate. Organomegaly in lipoatrophic models is apparently due to increased levels of insulin which activates IGF-1 receptors. Therefore, increased insulin levels of SSAT mice in fed state may be sufficient to activate IGF receptor(s). In addition, the lack of ketosis is a typical characteristic of lipoatrophic models, and one explanation is also the high levels of insulin which communicate fed status to liver. Interestingly, SSAT mice were unable to raise their ketone bodies during fasting but they had reduced insulin levels in fasting state excluding the previous hypothesis. In contrast, our results suggest that fatty acid oxidation, which induces ketogenesis, is decreased in the liver of SSAT mice because oxidation of palmitoylcarnitine was slightly reduced in fasting state in liver of SSAT mice. In addition, the expression of mitochondrial HMG-CoA synthase, rate-limiting gene of ketogenesis, and the expression of PPARα, the activator of HMG-CoA synthase and fatty acid oxidation, was significantly reduced in fasting state. Therefore, the livers of SSAT mice may be geared towards lipogenesis or gluconeogenesis than fatty acid oxidation and lipolysis in fasting state, which might prevent ketogenesis even in the face of a sharp drop in blood glucose levels. The reduced glycerol levels of SSAT mice in fasting state indicates that lipolysis may be reduced or gluconeogenesis is increased, therefore, supporting the previous hypothesis.

Factors known to activate PGC-1α expression are cytokines, AMPK, Ca²⁺ (24) and leptin (28, 29). In SSAT mice, the expression of AMPK and IL-1β was increased suggesting one of them or both may activate PGC-1α expression in WAT of SSAT mice. Interestingly, SSAT overexpression and putrescine accumulation is highest in WAT as compared with other tissues investigated and WAT is only tissue where PGC- 1 a expression is elevated. Therefore, our hypothesis was that the high levels of putrescine may activate PGC-1α in SSAT because putrescine is a cationic molecule resembling Ca²⁺ (48). SSAT mice have also increased biosynthesis of putrescine because increased polyamine catabolism may cause a reduction in spermidine and spermine levels which in turn activates L-ornithine decarboxylase to synthesize more putrescine into polyamine cycle. Therefore, we used a specific inhibitor of L-ornithine decarboxylase, DFMO, to block the increased synthesis of putrescine in SSAT mice. In WAT of SSAT mice, DFMO treatment caused more than 50 % decrease in putrescine levels, the expression of PCG-1α and PCG-1α responsive genes was reduced to near wild-type levels and the animals started to gain WAT. These results are understood in terms that an enhanced accumulation of putrescine seems to activate PGC-1α expression in WAT of SSAT mice. In addition, the expression of AMPK expression, but not IL-1 β, followed the expression pattern of PGC-1α. As AMPK can stimulate PGC-1α expression (24), it is possible that elevated levels of putrescine in WAT induces AMPK expression in SSAT mice which in turn activates PGC-1α. On the other hand, it is shown that cold-induced PGC-1α expression can modulate AMPK expression (49) and therefore, it is unclear which is the primary phenomenon. In contrast, unaltered IL-1 β expression after DFMO treatment suggests that IL-1β is not a signaling molecule between putrescine and PGC-1α. Whether putrescine is a direct or indirect activator of PGC-1α needs to be addressed in future studies.

However, several lines of evidence support an interaction of PGC-1α and putrescine. First, overexpression of SSAT led to high putrescine levels, and simultaneously to increased size and number of mitochondria in WAT. Second, DFMO treatment reduced putrescine levels to > 50% as compared with values without treatment, and led to an increase in WAT mass. Third, DFMO treatment normalized overexpression of PGC-1α and several genes regulated by PGC-1α. Fourth, it has been reported that putrescine injections into rat result in increased glucose transport and therefore reduced glucose and insulin levels (16) as was observed in SSAT mice. Previously, it has been shown that spermidine and spermine have insulin like-effects in rat adipocytes (15) but a role of putrescine in glucose and energy metabolism has been unclear (15). However, the present findings show that polyamines, specifically putrescine, modulate significantly both energy and glucose metabolism.

We demonstrated that, in SSAT mice, putrescine seems to be a direct or indirect activator of PGC-1α leading to overexpression of OXPHOS pathway in WAT. Because type 2 diabetic patients are often obese and insulin resistant and their OXPHOS pathway is downregulated (2, 3), our results confirm the essential role of this pathway in metabolic disturbances in type 2 diabetes. In addition, our results show that putrescine plays an important role in the regulation of energy and glucose metabolism. The identification of mechanism(s) by which polyamines regulate energy and glucose metabolism offers a novel target for drug development of obesity and type 2 diabetes.

Methods

Animals. The generation of SSAT mice has been described previously by Pietila et al (18). DBA/2 x Balb/c mice were housed on 12-h light/dark cycle and were fed a regular laboratory chow. The study protocols were approved by the Animal Care and Use Committee of the University of Kuopio, Finland.

Histology and cell sizing of adipocytes. Tissues were removed from 2.5- to 4-month- old female and male mice and fixed in 10 % formaldehyde. Fixed samples were dehydrated and embedded in paraffin. Tissues were cut into 10-μm sections, mounted on slides and stained with hematoxylin and eosin (HE). Adipocytes were isolated by collagenase digestion and the mean cell size was determined on sectioned slices as previously described (50). Cell density and total cell number of perigonadal fat pads was calculated according to the methods described by (51).

Analysis of body composition. Organ weights were determined by weighing organs dissected from 4-month-old female mice. Lean body mass and fat mass of 6-month- old mice (transgenic n=6 and control n=6, three males and three females in both groups) were determined using high resolution magnetic resonance imaging (MRI). For MRI, the animals were sacrificed using 5% halothane in N₂O/O₂ and externally fixed to a custom-built animal holder. A chemical-shift-selective 3-dimensional gradient echo pulse sequence (time-to-repetition 100 ms, time-to-echo 12 ms, field of view 4x2.56x10 cm3, data matrix 400x128x128) was used to acquire whole body fat images at 4.7 T using a quadrature-type volume coil (length 10 cm, diameter 6 cm). Total fat was estimated from images as previously described (52).

Tissue triglyceride concentrations. Triglyceride concentrations in skeletal muscle, liver and heart were determined in 4-month-old fed female SSAT-TG and wild-type mice after KOH hydrolysis and saponification using a microfluorometric glycerol assay method (53, 54).

Polyamine metabolites. Polyamines were determined from 6-month-old female SSAT and wild-type mice using HPLC (55). SSAT activity was assayed as described previously (56). Metabolic assays. Metabolic parameters of female 4-month-old SSAT and wild-type mice were determined before and after 12-18 h fasting. Plasma or serum samples were taken from the saphenous vein. Plasma leptin was analyzed using a mouse leptin ELISA kit (Crystal Chem Inc, Chicago, IL, USA). Blood levels of serum free fatty acids were measured using a triglyceride detection kit (WAKO, Osaka, Japan) and plasma triglyceride levels were measured colorimetrically using Microlab 200 analyzer (Merck, Darmstadt, Germany). Plasma glucose was determined microfluorometrically (57) and plasma insulin was measured using a rat insulin ELISA kit (Crystal Chem Inc, Chicago, IL, USA) with mouse insulin as a standard. Serum β-hydroxybutyrate was determined enzymatically using Hitachi 717 analyzer. Glycerol levels were determined using microfluorometric glycerol assay (54).

Glucose and insulin tolerance tests. Glucose tolerance test was performed on non- anaesthetized 3- to 4-month-old female SSAT and wild-type mice after 12-13 h fasting. After intraperitoneal injections of 2 mg/g D-glucose, blood samples were taken from the tail vein at time points 0, 15, 30, 60 and 120 min. In the insulin tolerance test, 12-13 h fasted non-anaesthetized 3- to 4-month-old female SSAT and wild-type mice were subjected intraperitoneal injection of 0.25 mU/g insulin (Actrapid, Novo Nordisk, Denmark) or 0.15 mU/g insulin and 0.4 mg/g D-glucose. Blood samples were drawn from the tail vein at time points 0, 20, 40 and 80 min.

Indirect calorimetry. Basal metabolic rate was measured by indirect calorimetry using a 4-chamber open-flow respirometer. We individually housed animals in specially built chambers, which were constructed of acrylic (Plexiglas) tube (inside diameter 70 mm, length 205 mm) and resided in darkened climatic cabinet, with an air flow of 300 ml/min (STPD, regulated by mass-flow controllers). A sample (75 ml/min) of dried outlet air was pumped into O₂- and CO₂-analyzers (Servomex 1440, Servomex, U.K.) and each animal was measured at 20 min intervals for five minutes during each measurement cycle.

For measurements in adulthood, 4-month-old female and male SSAT and wild-type mice were fasted for 12 h, whereas for the determination of basal metabolic rate before and after hair loss, we used 2.5-week-old and 13-week-old mice without or with 4 h fasting. All the measurements were done at thermoneutrality (at 32.5°C). Pilot experiments showed that in neither group did metabolic rate show any further decrease when ambient temperature was increased from 32.5°C to 34°C (data not shown). FO₂ and FCO₂ (ml/min) were calculated using equations appropriate for a measurement where only water is removed before analysis (58). RQ was calculated

as RQ = VCO₂ IVO₂ in the resting and active state.

Body temperature and activity. Core body temperature and activity of SSAT and wild- type mice was monitored telemetrically by intraperitoneal^ implanted body temperature transmitter devices (59).

Fatty acid oxidation in liver and adipocytes. After 12 h fasting, the mitochondria were isolated from the liver tissues of 6-month-old male transgenic and wild-type mice as described (60). The incubations were carried out with 0.5-1.2 mg/ml of mitochondrial protein at 30 °C. β-oxidation of palmitoylcamitine was monitored as the rate of ferricyanide (0.5 mM initial concentration) reduction (nmol / min per mg protein) in the presence of 1.0 mM KCN, 1 mM ADP, 0.1 mg/ml cytochrome c and 6 μg rotenone and 10 mM oxaloacetate as described (61).

Adipocytes were isolated from perigonadal fat pads by a modification of Rodbell^'s method (62). One milliliter of the diluted adipocyte suspension was incubated with 0.5 μCi [¹⁴C]-palmitate (57 μCi/μmol, Amersham Biosciences, UK) for 30 min in test tubes at 37 ⁰C with a gentle shaking. Liberated ¹⁴CO₂ was trapped into folded filter paper containing 0.5 M Solvable™ (Packard Instrument Company, Inc., USA). At the end of the incubation period, the ¹⁴CO₂ produced by the adipocytes was released by injection of 0.5 ml of 10% trichloroacetic acid into the test tubes. After 15 min incubations at 37 °C, each folded filter papers containing the absorbed ¹⁴CO₂ were quickly transferred into a scintillation vial with 3 ml of scintillation fluid for β-counting. Values were normalized for protein concentration assayed by Bradford protein assay (Bio-Rad Laboratories, CA, USA).

Affymetrix analysis. Total RNA from skeletal muscle and liver of fed 4-month-old female mice was isolated using the acidic guanidinium thiocyanate method (63) and RNeasy Mini kit (Qiagen, Germany) was used for RNA from WAT. Equal quantities of total RNA were pooled together from 4 individual mice for skeletal muscle and liver and from 3 mice for WAT within genotype. A hybridization mixture containing 15 μg of biotinylated cRNA was prepared according to the protocols provided by Affymetrix. Ten μg of biotinylated cRNA was hybridized to mouse Affymetrix MG-U74A-v2 chips (Affymetrix, Santa Clara, CA, USA) containing -6,000 sequences in the Mouse UniGene database (Build 74) that have been functionally characterized and -6,000 EST clusters. The chips were washed and scanned according to Affymetrix standard protocols.

Signal intensities were quantitated using Affymetrix Microarray Suite 5.0 (MAS). Global scaling was used to standardize signal intensities across the individual arrays. Gene expression changes in different tissues were evaluated comparing individual arrays (two wild-type and two transgenic) to each other by using MAS (total of four comparisons per tissue). Change p-value for each probe set reported by MAS was scored as follows: 0.0000 <= p <= 0.0025 = +10 scores and 0.0025 < p <= 0.030 = +5 scores for up-regulated genes and -10, -5 for downregulated genes, respectively. Signal fold changes as Iog2 ratios were averaged and scores were summed.

GenMAPP (64) and MAPPFinder (65) were used to identify gene expression changes in the context of the biological pathways and gene ontology. Analysis was performed using two criteria: average fold change Iog2 ratio >= 0.4 and score >= 20 for up- regulated genes and -0.4 and -20 for down-regulated genes, respectively.

Electron microscopy. Tissue pieces from 7-month-old female SSAT and wild-type mice were fixed with 2.5% glutaraldehyde and 0.1 M sodium cacodylate pH 7.4 overnight. Post-fixation was obtained with 1% OsO₄ in 0.1 M sodium cacodylate pH 7.4 for 2 h. After ethanol dehydration, the samples were embedded in LX-112 resin (Ladd Research Industries, Burlington, VT, USA). Ultrathin sections (μm) were obtained with a Reichert Jung Ultracut E ultramicrotome and were contrasted with uranyl acetate and lead citrate before examination in a JEOL JEM 1200EX transmission electron microscope (JEOL Ltd., Tokyo, Japan).

mtDNA analysis. Mitochondrial DNA was quantitated by measuring the ratio of a mitochondrial gene (16S RNA) to a nuclear gene (HKII, intron 9) by quantitative RT- PCR. DNA was isolated from WAT, skeletal muscle and liver of 6-month-old female SSAT and wild-type mice using proteinase K and phenol/chloroform/isoamyl alcohol extraction. Quantitative RT-PCRs were performed using 0.5 ng of DNA as template, gene-specific primers and probe, and Taqman reagents from Applied Biosystems in ABI BRISM 7700 (Applied Biosystems, Foster City, CA, USA). Running conditions were 2 min at 50⁰C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60⁰C. Primers and probes were designed using Assay-by-Design system (Applied Biosystems, Foster City, CA, USA). Primer sets are given in Supplementary Table 1.

Quantitative PCR. To verify our Affymetrix results, total RNA from skeletal muscle, liver and perigonadal WAT of fed 4-month-old female mice was isolated using the same methods as for Affymetrix analysis, except that for perigonadal WAT we used RNeasy Lipid Tissue Mini Kit (Qiagen, Germany). Total RNA was treated with DNase I (Promega, Madison, Wl), and purified using RNeasy Mini kit (Qiagen, Germany). The absence of genomic DNA in the RNA samples was verified by the lack of PCR amplification with primers recognizing numerous Gapdh pseudogenes. Total RNA was transcribed to cDNA using High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA, USA). Quantitative RT-PCRs were performed using 12 ng (RNA equivalents) of cDNA as template, gene-specific primers and probe, and Taqman reagents from Applied Biosystems in ABI BRISM 7700 and 7000 (Applied Biosystems, Foster City, CA, USA). Running conditions were 2 min at 50⁰C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. Primers and probes were designed using Assay-by-Design system (Applied Biosystems, Foster City, CA, USA). Data were normalized to β-actin mRNA expression. Primer sets are given in Supplementary Table 1.

Western blot. WAT or BAT was homogenized in buffer containing 50 rtiM Tris-HCI pH 7.6, 0.15 M NaCI, 1 % Triton-X, 1 rtiM PMSF in DMSO, 10 rtiM Na₃VO₄, 100 rtiM NaF, 10 rtiM Na₄P₂O₇, and protease inhibitor cocktail (Roche Applied Science, Switzerland). Forty μg of protein from WAT and five μg proteins from BAT were boiled for 5 min, subjected to SDS-PAGE, and electrophoretically transferred onto nitrocellulose membranes. Membranes were blocked overnight with 5% nonfat dry milk in phosphate-buffered saline containing 0.1% Tween. Blots were probed with 1/1000 dilution of a polyclonal antibody directed against the carboxyl terminus of PGC- 1α (Chemicon International, Inc., Temecula, CA, USA), UCP1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) or actin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). This was followed by incubation with appropriate horseradish peroxidase-conjugated secondary antibody. Antibody-bound protein was detected using Western lighting chemiluminescence reagent plus detection kit (Perkin Elmer Life Sciences, Inc., Boston, MA, USA).

DFMO treatment. SSAT and wild-type mice were pair-matched in DFMO treatment and control groups after weaning (4- to 5-week-old) when SSAT mice start to loose their hair. DFMO (gift from Ilex Oncology, Inc., TX, USA), 0.5%, was given in the drinking water ad libitum for 2 or 5 weeks. Upon termination of the experiment, the animals were sacrificed after 12 h fasting and tissues were taken for polyamine and quantitative RT-PCR analyses. Both analyses were performed as previously shown except that RNA isolation from WAT was performed using RNeasy Lipid Tissue Mini Kit (Qiagen, Germany) and total RNA was treated with DNA-free™ Kit (Ambion, Inc, Austin, TX, USA). In addition, polyamine concentrations were normalized for DNA amount assayed by modified Burton's method (66).

Statistical analysis. Statistical analyses were performed using Student's t-test (two- tailed). A p value less than 0.05 was considered significant. Data are expressed as means ± SEM. Insulin levels were logarithmically transformed for statistical analyses.

Drug screening. The aim is to find compounds that activate SSAT to produce more putrescine, or to synthesize putrescine analogues which will have the effects of naturally occurring putrescine to activate the OXPHOS pathway. The third possibility is to find compounds that stimulate PAO.

Drug development can be tested using three different approaches: 1) Compounds that overstimulate SSAT, and lead to increased levels of putrescine which in turn activate PGC-1α and lead to overexpression of the OXPHOS pathway, reduction of WAT and improved insulin sensitivity, and thus to improved glucose tolerance (reduction of glucose levels), 2) Compounds that include putrescine or its analoque which can probably directly activate the same pathway, 3) Compounds that stimulate PAO to back-convert acetyl-spermine of diacetylspermine to putrescine.

These possibilities can be tested at lest in two animal models. D WiId type mice. Compounds that activate SSAT should lead in wild type mice to elevated levels of putrescine, overexpression of the OXPHOS pathway, reduction of WAT and finally to lowering of glucose levels. Putrescine analogues and compounds stimulating PAO should have similar effects. 2) SSAT KO mice. Giving compounds described in 1) should normalize glucose tolerance in SSAT KO mice, and reduce WAT. This is a direct test that these compounds are potential drugs in the treatment of diabetes and obesity. EXAMPLE 2

Screening of SSAT Il modulators

Wild-type or transgenic cells (preferably fat cells, such as cells of WAT or BAT) underexpressing or overexpressing spermidine/spermine N¹-acetyltransferase (SSAT), such as 3T3L1 cells (Green H and Meuth M. Ce// 3: 127-133, 1974), are incubated several days with the medium containing a candidate modulator of SSAT activity or polyamine metabolism. Alternatively, a wild-type mouse and a transgenic mouse underexpressing or overexpressing SSAT (e.g. under endogenous SSAT promoter or metallothionein I promoter) are exposed to a modulator of SSAT activity or polyamine metabolism for several days. Preferably, said modulator of SSAT activity is administered orally or intravenously to said mouse. After the treatment, cell or tissue samples, such as blood samples, are collected. Measurement of polyamine content, SSAT activity and ATP concentrations, and gene expression analyses are performed. Polyamine content is determined using high performance liquid chromatography (Hyvόnen T. et. al 1992 J. Chromatogr. 574:17-21) and polyamine concentrations are normalized for DNA amount assayed by modified Burton's method (GiIe, K.W., and Myers A. 1964 Biochim. Biophys. Acta 87:460-477). SSAT activity is assayed as described (Bemacki R.J et. al 1995 CHn. Cancer Res. 1 :847-85725) and the values are normalized for protein concentration assayed by Bradford protein assay (Bio-Rad Laboratories, CA, USA). RNA isolation is performed using Trizol® reagent (Invitrogen, CA, USA) or RNeasy Mini Kit (Qiagen, Germany) according the manufacturer's manuals. Total RNA is treated with DNA-free™ Kit (Ambion, Inc, Austin, USA) and transcribed to cDNA using High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA, USA) according the manufacturer's manuals. Quantitative RT-PCRs is performed using 12 ng (RNA equivalents) of cDNA as template, gene-specific primers and probe, and Taqman reagents from Applied Biosystems in ABI BRISM 7700 and 7000 (Applied Biosystems, Foster City, CA, USA). ATP concentrations are analyzed using ATP lite 1 step kit (Perkin Elmer, MA, USA) according the manufacturer's manual and the results are normalized for the dsDNA amount analyzed using Quant-iT™ PicoGreen® kit (Invitrogen, CA, USA) according the manufacturer's manual. For the ATP measurement from the animals, adipocytes are isolated from perigonadal fat pads by a slight modification of Rodbell^'s method (Rodbell M. et al. 1964 J. Biol. Chem. 239:375-380). Candidate modulators of SSAT activity or polyamine metabolism which may be used in the screening are, for example: bis-alpha-methylspermine, diethylnorspermine, alpha-methyl-spermine, alpha-methyl-spermidine, N-alkylated polyamines, putrescine analogs, 2-difluoromethylomithine, methylglyoxalbisguanylhydrazone, N,N'-bis(2,3- butadienyl)-1,4-butanediamine (MDL-72,527), non-steroidal anti-inflammatory drugs, H₂O₂, substances causing oxidative stress, high-fat diet, high-fat diet with the combination of high-carbohydrate diet, thiazolidinediones, ATP depletors like oligomycin, fructose, and ethionine.

Table 1. Organ weights as % of body weight in female and male SSAT and wild-type mice. Results are expressed as means ± SEM (n=5-9 mice per gender per genotype). WAT represents white adipose tissue and BAT brown adipose tissue.

5 Epi WAT BAT Liver Pancreas Spleen Heart Kidney

Wild-type, females 3.7 ± 0.5 0.78 ± 0.07 3.8 ± 0.2 0.65 ± 0. ,03 0.30 ± 0.02 0.44 ± 0.01 0.46 ± 0.02

SSAT, female 1.1 ± 0.1 0.69 ± 0.13 4.8 ± 0.2 0.75 ± 0. ,02 0.58 ± 0.02 0.53 ± 0.02 0.55 ± 0.01

P <0.01 NS <0.05 <0.05 <0.05 <0.05 <0.05

Wild-type, males 2.58 ± 0.31 0.69 ± 0.04 4.3 ± 0.3 ND 0.26 ± 0.01 0.53 ± 0.01 0.70 ± 0.02

SSAT, males 0.73 ± 0.12 0.59 ± 0.02 4.6 ± 0.1 ND 0.50 ± 0.05 0.56 ± 0.02 0.73 ± 0.03

P <0.001 NS NS <0.01 NS NS

Table 2. SSAT activity and polyamine concentrations in WAT of SSAT and wild-type mice. Results are expressed as means ± SEM (n=5-6 mice per genotype).

Polyamines (pmol/μg prot)

SSAT N¹-

Putrescine Spermidine Spermine (pmol/mg/1 Omin) Acetylspermidine

Wild-type 0.5 ± 0.2 1.5 ± 0.8 0 10.7 ± 1.5 3.9± 0.8

SSAT 1.8 ± 0.4 22.0 ± 4.2 2.9 ± 2.8 ll.O ± l.O 2.5 ± 0.6

P <0.05 <0.05 NS NS NS

Table 3. Blood metabolites of female SSAT and wild-type mice in fed and fasting state. Results are expressed as means ± SEM (n=7-15 mice per genotype). FFA represents free fatty acids and TG triglycerides.

Leptin FFA TG Glucose Insulin β-hydroxy- Glycerol 5 butura t e

(ng/ml) (mM) (mM) (mM) (ng/ml) (mM) (mM)

Fed

Wild-type 7.2 ±1.5 0.43 ±0.04 2.6 ±0.2 9.8 ±0.2 1.0 ±0.1 0.09 ±0.04 0.80 ±0.04

SSAT 1.4 ±0.3 0.37 ±0.05 3.6 ±0.2 8.7 ±0.2 1.5 ±0.2 0.08 ± 0.03 0.81 ±0.03

P <0.05 NS <0.001 <0.001 <0.05 NS NS

Fasting

Wild-type 2.9 ±0.8 0.67 ± 0.05 1.4 ±0.1 10.3 ±0.4 0.6 ±0.2 2.45 ±0.42 1.16 ±0.12

SSAT 0.3 ±0.1 0.72 ±0.06 1.0 ±0.1 8.5 ±0.2 0.2 ±0.1 0.58 ± 0.43 0.88 ±0.05

P <0.05 NS <0.05 <0.001 <0.05 <0.001 <0.05

Table 4. Selected gene expression profiles in female SSAT mice as compared with wild-type mice. Data are means ± SEM (8 mice per group). WAT, quadriceps muscle and liver of adult female SSAT and wild-type mice was excised in the fed state and the expression of selected genes was analyzed by quantitative RT-PCR as described in methods. *, p<0.05, **, p<0.01 and ***, p<0.001. ND, not determined.

SSAT, fold wild-type (n=8)

Tissue

Gene Gene product WAT Skeletal muscle Liver

SSAT Spermidine/spermine N(I)- 52.50 ± 3.75*** 36.21 ± 2.16*** 38.71 ± 2.83*** acetyltransferase

Regulators of mitochondrial biogenesis, mtDNA replication and transcription

PGC-lα PPARgamma coactivator 1 2.06 ± 0.21** 0.85 ± 0.02 1.08 ± 0.05 alpha

PGC-I β PPARgamma coactivator 1 1.27 ± 0.12 1.15 ± 0.06 0.91 ± 0.08 beta

NRF-I Nuclear respiratory factor 1 1.02 ± 0.05 1.09 ± 0.06 0.92 ± 0.04 mtTFA Transcription factor A, 1.19 ± 0.06 0.97 ± 0.06 0.88 ± 0.03* mitochondrial

Orphan and nuclear receptors

ERRα Estrogen related receptor alpha 1.73 ± 0.12** 0.88 ± 0.05 1.14 ± 0.06

PPARγ Peroxisome proliferator 1.23 ± 0.06 1.47 ± 0.19* 1.05 ± 0.12 activated receptor gamma

PPARα Peroxisome proliferator 1.19 ± 0.16 0.92 ± 0.09 1.00 ± 0.05 activated receptor alpha

PPARδ Peroxisome proliferator 1.21 ± 0.06* 1.05 ± 0.05 1.04 ± 0.07 activated receptor delta

Oxidative phosphorylation

Ndufal NADH-ubiquinone 1.57 ± 0.15* 0.86 ± 0.04 1.14 ± 0.04* oxidoreductase MWFE subunit

Sdhb Succinate dehydrogenase Ip 1.45 ± 0.12* 0.78 ± 0.05* 1.03 ± 0.05 subunit

Ucrh Ubiquinol-cytochrome c 1.39 ± 0.12* 0.74 ± 0.05** 0.91 ± 0.04 reductase complex

Cyt c Cytochrome c 1.32 ± 0.11 1.14 ± 0.05 1.01 ± 0.05

Cox4A Cytochrome c oxidase 1.48 ± 0.13* 0.93 ± 0.06 1.01 ± 0.05 polypeptide IV ATP5A1 ATP synthase alpha 1.46 ± 0.09* 1.08 ± 0.05 ND

Fatty acid oxidation

Acads Acyl-CoA dehydrogenase, 1.39 ± 0.07 0.93 ± 0.06 0.96 ± 0.05 short chain Mead Acyl-CoA dehydrogenase, 1.33 ± 0.10 0.90 ± 0.07 0.80 ± 0.05* medium chain

Acadl Acyl-CoA dehydrogenase, 1.50 ± 0.09* 1.08 ± 0.09 ND long chain

Fatty acid transporters CD36 CD36 antigen/fatty acid 1.21 ± 0.05 1.15 ± 0.09 ND translocase

Fatpl Fatty acid transport protein 1 2.25 ± 0.26** 1.32 ± 0.10* ND

Fabp4 Fatty acid-binding protein 1.34 ± 0.06* ND ND (adipocyte)

Lipolysis

Adrbl Beta-adrenergic receptor 1 0.96 ± 0.11 ND ND

Adrb2 Beta-adrenergic receptor 2 0.98 ± 0.06 1.17 ± 0.07 1.42 ± 0.06*** Adrb3 Beta-adrenergic receptor 3 0.79 ± 0.04 ND ND

HSL Hormone sensitive lipase 1.34 ± 0.07** ND 1.35 ± 0.08**

Adipocyte differentiation markers Crebp cAMP responsive element 1.14 ± 0.07 0.97 ± 0.03 0.91 ± 0.04 binding protein

Srebp 1 c Sterol regulatory element 1.66 ± 0.12** 1.71 ± 0.28* 1.13 ± 0.06 binding protein Ic

CEBPα CCAAT/enhancer binding 1.60 ± 0.07*** ND ND protein alpha

Uncoupling UCPl Uncoupling protein 1 0.73 ± 0.09 2.03 ± 0.64* 1.50 ± 0.12* UCP2 Uncoupling protein 2 1.09 ± 0.09 1.35 ± 0.13 1.38 ± 0.08** UCP3 Uncoupling protein 3 1.55 ± 0.11** 0.64 ± 0.06* 1.16 ± 0.20

Glucose metabolism

Glut4 Glucose transporter 4 1.66±0.14** 1.14±0.06 ND

HKII Hexokinase II 1.46±0.09* 1.24±0.05** ND

AMPK(Gl) 5'-AMP-activated protein 1.39±0.06*** 1.07±0.05 0.99±0.05 kinase, gamma- 1 subunit

AMPK(Bl) 5'-AMP-activated protein 1.22±0.07 1.12±0.06 1.08±0.05 kinase, beta-1 subunit (Table 4 continued)

Cytokines

IL-lβ Interleukin 1 beta 2.53 ±0.25*** 2.93 ±0.31** 1.12 ±0.08

IL-6 Interleukin 6 0.94 ±0.20 0.64 ±0.06** 0.85 ±0.10

TNFα Tumor necrosis factor alpha 1.06 ±0.09 1.57 ±0.16** 1.20 ±0.19

Table 5. Effect of DFMO treatment on weight, amount of white adipose tissue (WAT) and polyamine concentrations of WAT in female and male SSAT and wild-type (wt) mice. Results are expressed as means ± SEM (4-19 mice per genotype). *, p<0.05 and ***, p<0.001. ND, not determined. DFMO represents 2-difluoromethylomithine.

Polyamine pools (pmol/mg DNA)

Samples Weight (g) WAT (mg) WAT (% of body Putrescine N¹ -acetyl- Spermidine Spermine weight) spermidine

2 weeks

Wt 16.8 ±0.5 162 ±16 0.94 ± 0.07 56 ±21 ND 1334 ±526 622 ± 292 Wt +DFMO 16.8 ±0.7 195 ± 29 1.07 ±0.12 39 ±13 ND 1514 ±383 774 ± 229 SSAT 15.4 ±0.5 50 ±5 0.34 ± 0.03 4689 ± 1232 136 ±49 1853 ±477 663 ±212 SSAT +DFMO 15.5 ±0.5 110±12*** 0.69 ± 0.06*** 2125 ±413* 126 ±52 1298 ±218 535 ± 90

5 weeks

Wt 21.7 ±0.9 460 ± 91 2 .07 ± 0.35 92 ±16 ND 1120 ±147 498± 64

Wt +DFMO 21.8 ±1.6 468 ±112 1 .98 ± 0.36 128 ±27 ND 1141 ±126 505 ± 79

SSAT 20.6 ± 0.9 155 ±39 0 .72 ±0.17 3979 ±819 98 ±19 1109 ±240 387± 80

SSAT +DFMO 21.9 ±0.9 364 ± 68* 1 .62 ± 0.25* 1161 ±318* 51 ±20 937 ± 257 275 ± 57

Table 6. Effect of 2 weeks DFMO treatment on gene expression profile in WAT of female SSAT mice as compared with wild-type mice. Results are expressed as means ± SEM of 3-4 animals per group. *, p<0.05 and NS, not significant. DFMO represents 2-difluoromethylomithine.

SSAT, fold wild-type

Gene Gene product -DFMO +DFM0 P (effect of treatment)

PGC-lα PPARgamma coacuvator 1 alpha 1.98 ± 0.52 1.15 ± 0.20 NS

ERRα Estrogen related receptor alpha 1.46 ± 0.21 1.17 ± 0.18 NS

Ndufal NADH-ubiquinone oxidoreductase 1.39 ± 0.09 1.01 ± 0.13 NS MWFE subunit Sdhb Succinate dehydrogenase Ip subunit 1.91 ± 0.13 1.67 ± 0.18* NS

Cox4A Cytochrome c oxidase polypeptide IV 1.80 ± 0.10 1.58 ± 0.38* NS ATP5A1 ATP synthase alpha 1.88 ± 0.03* 1.61 ± 0.09* NS

PPARγ Peroxisome proliferator activated 1.76 ± 0.15 1.03 ± 0.07 <0.05 receptor gamma UCPl Uncoupling protein 1 1.76 ± 0.56 0.69 ± 0.05 NS

UCP3 Uncoupling protein 3 1.81 ± 0.11 0.83 ± 0.11 <0.01

Glut4 Glucose transporter 4 1.83 ± 0.26 1.47 ± 0.17 NS

AMPK(Gl) 5'-AMP-activated protein kinase, 1.55 ± 0.15 0.86 ± 0.13 <0.05 gamma- 1 subunit IL-I β Interleukin 1 beta 1.52 ± 0.29 1.49 ± 0.12* NS

Supplementary Table I Primer sets used.

Gene Gene product Forward Primer Sequence Reverse Primer Sequence Reporter

Reporter Sequence Dve

16S RNA lό S ribosomal RNA GTACCGCAAGGGAAAGATGAAAGA GTTAGTTCATTATGCAAAAGGTACAAGGTT FAM CTTTGCTTGTTCTTACTTTTAATTAG

HKII 19 Hexokinase II, intron TCTGGCTCTGAGATCCATCTTCA CCGGCCTCTTAACCACATTCC FAM CCAGGGCTGTAGGAACA

9

SSAT Spermidine/spermine TGGTTGCAGAAGTGCCTAAAGAG AGTACATGGCGAACCCAACAAT FAM CCCTGAAGGACATAGC

N^Lacetvltransferase

PGC-Ia PPARgamma CGAACCTTAAGTGTGGAACTCTCT TTGGCTTTATGAGGAGGAGTTGTG FAM AACTGCAGGCCTAACTC coactivator 1 alpha

PGC-lβ PPARgamma CCAGGTGCTGACGAGAAGTA GCTCTGAACACCGGAAGGT FAM AAAGAGGCCAGAAGCAC coactivator 1 beta

NRF-I Nuclear respiratory GTGAATTACTCTGCTGTGGCTGAT ATTTCACCGCCCTGTAACGT FAM CAGTTTTGTTCCACCTCTCC factor 1 mtTFA Transcription factor GCTTCCAGGAGGCAAAGGA TCCAAGCCTCATTTACAAGCTTCA FAM TTTTCCCTGAGCCGAATCA

A, mitochondrial

ERRa Estrogen related CCATCAGCTGGGCCAAGAG CACACTCTGCAGTACTGACATCTG FAM CATCCCAGGCTTCTCC receptor alpha

PPARy Peroxisome CAAATATGACCTGAAGCTCCAAGAA AATAATAAGGTGGAGATGCAGGTTCT FAM ACCAAAGTGCGATCAA proliferator activated receptor gamma

PPARa Peroxisome GGTCATACTCGCGGGAAAGAC CATACACAAGGTCTCCATGTCATGT FAM CAACCCGCCTTTTG proliferator activated receptor alpha

PPARS Peroxisome GCCCCGGAGCTCAATGG TGGTCCAGCAGGGAGGAA FAM CTGTGCAGACCTCTCC proliferator activated receptor delta

Ndufal NADH-ubiquinone GCGTACATCCACAAATTCACCAA CATCAGATACCACTGGTACTGAACA FAM ACTCGTTTTTCCTTGCCCCC oxidoreductase

MWFE subunit

Sdhb Succinate GTGGAACGGAGACAAGTACCT GTCGTCTCTGGAGTCGATCATC FAM CATGCAGGCCTATCGCT dehydrogenase Ip

Gene Gene product Forward Primer Sequence Reverse Primer Sequence P Reporter Sequence

Ucrh Ubiquinol- AGGAGCTCTTTGACTTCTTGCAT AGGACGAATCTGCACATTTACTTCA FAM ACCACTGTGTGGCCCAC cytochrome c reductase complex

Cyt c Cytochrome c GCTGCTGGATTCTCTTACACAGATG TCCAAATACTCCATCAGGGTATCCT FAM CAGGTGATGCCTTTGTTC

Cox4A Cytochrome c CAGCCTTTCCAGGGATGAGA GGCGAAGCTCTCGTTAAACTG FAM ATGCGGTACAACTGAACTT oxidase polypeptide

IV

ATP5A1 ATP synthase alpha GCCAACTCCAGCTTCATGGTA FAM CCTGCCACCTGCTTCA

Acads Acyl-CoA CAATGGTGACAAAATCGGCTGTTT GCGGCTCCAGCATCACT FAM CCATTGCCTGGCTCACT dehydrogenase, short chain

Mead Acyl-CoA GGAGCCCGGATTAGGGTTT GCGGGCAGTTGCTTGAAAC FAM TTCCGTCAACTCAAAACT dehydrogenase, medium chain

Acadl Acyl-CoA GACTCCGGTTCTGCTTCCAT TGCACACATTCATAAGCTACACTGT FAM CAGATGCCCAGTATTTC dehydrogenase, long chain

CD36 CD36 antigen fatty TGGTGTGCTAGACATTGGCAAAT CATGTAGGAAATGTGGAAGCGAAAT FAM ACAGGCTTTCCTTCTTTG acid translocase

Fatpl Fatty acid transport TCTTCTGCCCCAGGTGGAT AGCCGGGTCTTCTGGATCT FAM ACCACAGGCACCTTCA protein 1

Fabp4 Fatty acid-binding AGTCGACCACAATAAAGAGAAAACGA TGTGGAAGTCACGCCTTTCAT FAM CTGGTGGTGGAATGTG protein (adipocyte)

Adrbl Beta-adrenergic TGGCCAGCGCTGATCTG TGGTGGCCCCGAAAGG FAM CACCACCAGCAATCC receptor 1

Adrb2 Beta-adrenergic CGGCAGAACGGACTACACA TGACAGTTCACAAAGCCTTCCAT FAM CACACAGCAGTTCCTG receptor 2

Adrb3 Beta-adrenergic recep. CTGTTGAAGCCAGGCAGAGT GCCTGGGTΓCCCGAAGA FAM CCGCTCAACAGTTCCCT

protein kinase, beta- 1 subunit

IL-I β Interleukin 1 beta ACATGAGCACCTTCTTTTCCTTCA ACACCAGCAGGTTATCATCATCATC FAM CAGAGGATGGGCTCTTCT

IL-6 Interleukin 6 TCTCTGGGAAATCGTGGAAATGAG GCAAGTGCATCATCGTTGTTCATA CCATTGCACAACTCTΠT FAM

TNFa Tumor necrosis CAAAATTCGAGTGACAAGCCTGTAG GCTGCTCCTCCACTTGGT CACGTCGTAGCAAACC FAM factor alpha HMGCS2 HMG-CoA synthase CAGCAGTGACAAACAGAACAACTTA TGGTGTAGGTTTCTTCCAGCnTAG FAM ACCCCTGAAGGCCTC

References

1. Laakso, M. 2001. Insulin resistance and its impact on the approach to therapy of type 2 diabetes. Int. J. Clin. Pract. Suppl. 8-12.

2. Mootha, V.K., Lindgren, CM., Eriksson, K.F., Subramanian, A., Sihag, S., Lehar, J., Puigserver, P., Carlsson, E., Ridderstrale, M., Laurila, E., et al. 2003. PGC- 1 alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat. Genet. 34:267-273.

3. Patti, M. E., Butte, A.J., Crunkhom, S., Cusi, K., Berria, R., Kashyap, S., Miyazaki, Y., Kohane, I., Costello, M., Saccone, R., et al. 2003. Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: Potential role of PGC1 and NRF1. Proc. Natl. Acad. ScI. U.S.A 100:8466-8471.

4. Hammarstedt, A., Jansson, P.A., Wesslau, C, Yang, X., and Smith, U. 2003. Reduced expression of PGC- 1 and insulin-signaling molecules in adipose tissue is associated with insulin resistance. Biochem. Biophys. Res. Commun. 301:578-582.

5. Semple, R.K., Crowley, V.C., Sewter, C. P., Laudes, M., Christodoulides, C, Considine, R.V., Vidal-Puig, A., and O'Rahilly, S. 2004. Expression of the thermogenic nuclear hormone receptor coactivator PGC-1 alpha is reduced in the adipose tissue of morbidly obese subjects. Int. J. Obes. Relat. Metab. Disord. 28:176-179.

6. Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B. M. 1998. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92:829-839.

7. Scarpulla, R.C. 2002. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim. Biophys. Acta 1576:1-14.

8. St-Pierre, J., Lin, J., Krauss, S., Tarr, P.T., Yang, R., Newgard, CB. , and Spiegelman, B. M. 2003. Bioenergetic analysis of peroxisome proliferator-activated receptor gamma coactivators 1 alpha and 1 beta (PGC-1 alpha and PGC-1 beta) in muscle cells. J. Biol. Chem. 278:26597-26603.

9. Vega, R.B., Huss, J. M., and Kelly, D. P. 2000. The coactivator PGC-1 cooperates with peroxisome proliferator-activated receptor alpha in transcriptional control of nuclear genes encoding mitochondrial fatty acid oxidation enzymes. MoI. Cell. Biol. 20:1868-1876.

10. Wang, Y.X., Lee, CH., Tiep, S., Yu, R.T., Ham, J., Kang, H., and Evans, R.M. 2003. Peroxisome-proliferator-activated receptor delta activates fat metabolism to prevent obesity. Ce// 113:159-170.

11. Michael, L. F., Wu, Z., Cheatham, R.B., Puigserver, P., Adelmant, G., Lehman, J. J., Kelly, D. P., and Spiegelman, B. M. 2001. Restoration of insulin-sensitive glucose transporter (GLUT4) gene expression in muscle cells by the transcriptional coactivator PGC-1. Proc. Natl. Acad. ScL U.S.A 98:3820-3825.

12. Yoon, J. C, Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C.R., Granner, D. K., et al. 2001. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413:131-138.

13. Puigserver, P., and Spiegelman, B.M. 2003. Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator. Endocr. Rev. 24:78-90.

14. Janne, J., Alhonen, L., Pietila, M., and Keinanen, T.A. 2004. Genetic approaches to the cellular functions of polyamines in mammals. Eur. J. Biochem. 271 :877-894.

15. Lockwood, D. H., and East, L. E. 1974. Studies of the insulin-like actions of polyamines on lipid and glucose metabolism in adipose tissue cells. J. Biol. Chem. 249:7717-7722.

16. Shelepov, V.P., Chekulaev, V.A., and Pasha-Zade, G. R. 1990. Effect of putrescine on carbohydrate and lipid metabolism in rats. Biomed. ScL 1:591-596.

17. Ushmorov, A., Hack, V., and Droge, W. 1999. Differential reconstitution of mitochondrial respiratory chain activity and plasma redox state by cysteine and ornithine in a model of cancer cachexia. Cancer Res. 59:3527-3534.

18. Pietila, M., Alhonen, L., Halmekyto, M., Kanter, P., Janne, J., and Porter, CW. 1997. Activation of polyamine catabolism profoundly alters tissue polyamine pools and affects hair growth and female fertility in transgenic mice overexpressing spermidine/spermine N1-acetyltransferase. J. Biol. Chem. 272:18746-18751.

19. Kee, K., Foster, B.A., Merali, S., Kramer, D. L., Hensen, M. L., Diegelman, P., Kisiel, N., Vujcic, S., Mazurchuk, R.V., and Porter, CW. 2004. Activated polyamine catabolism depletes acetyl-CoA pools and suppresses prostate tumor growth in TRAMP mice. J. Biol. Chem. 279:40076-40083.

20. Lin, J., Tarr, P.T., Yang, R., Rhee, J., Puigserver, P., Newgard, CB., and Spiegelman, B.M. 2003. PGC-1 beta in the regulation of hepatic glucose and energy metabolism. J. Biol. Chem. 278:30843-30848.

21. Schreiber, S.N., Emter, R., Hock, M. B., Knutti, D., Cardenas, J., Podvinec, M., Oakeley, E.J., and Kralli, A. 2004. The estrogen-related receptor alpha (ERRalpha) functions in PPARgamma coactivator 1 alpha (PGC-1 alpha)-induced mitochondrial biogenesis. Proc. Natl. Acad. ScL U.S.A 101 :6472-6477.

22. Picard, F., and Auwerx, J. 2002. PPAR(gamma) and glucose homeostasis. Annu. Rev. Nutr. 22:167-197. 23. Argiles, J. M., Busquets, S., and Lopez-Soriano, F.J. 2002. The role of uncoupling proteins in pathophysiological states. Biochem. Biophys. Res. Commun. 293:1145-1152.

24. Attie, A.D., and Kendziorski, CM. 2003. PGC-1alpha at the crossroads of type 2 diabetes. NatGenet. 34:244-245.

25. Tiraby, C, Tavernier, G., Lefort, C, Larrouy, D., Bouillaud, F., Ricquier, D., and Langin, D. 2003. Acquirement of brown fat cell features by human white adipocytes. J. Biol. Chem. 278:33370-33376.

26. Cederberg, A., Gronning, L. M., Ahren, B., Tasken, K., Carlsson, P., and Enerback, S. 2001. FOXC2 is a winged helix gene that counteracts obesity, hypertriglyceridemia, and diet-induced insulin resistance. Ce// 106:563-573.

27. Tsukiyama-Kohara, K., Poulin, F., Kohara, M., DeMaria, C. T., Cheng, A., Wu, Z., Gingras, A.C., Katsume, A., Elchebly, M., Spiegelman, B. M., et al. 2001. Adipose tissue reduction in mice lacking the translational inhibitor 4E-BP1. Nat. Med. 7:1128- 1132.

28. Zhou, Y.T., Wang, Z.W., Higa, M., Newgard, C.B., and Unger, R.H. 1999. Reversing adipocyte differentiation: implications for treatment of obesity. Proc. Natl. Acad. Sci. U.S.A 96:2391-2395.

29. Kakuma, T., Wang, Z.W., Pan, W., Unger, R.H., and Zhou, YT. 2000. Role of leptin in peroxisome proliferator-activated receptor gamma coactivator-1 expression. Endocrinology 141 :4576-4582.

30. Tiraby, C, and Langin, D. 2003. Conversion from white to brown adipocytes: a strategy for the control of fat mass? Trends Endocrinol. Metab. 14:439-441.

31. Kaasinen, S. K., Oksman, M., Alhonen, L., Tanila, H., and Janne, J. 2004. Spermidine/spermine N1-acetyltransferase overexpression in mice induces hypoactivity and spatial learning impairment. Pharmacol. Biochem. Behav. 78:35-45.

32. Robinson, S.W., Dinulescu, D. M., and Cone, R.D. 2000. Genetic models of obesity and energy balance in the mouse. Annu. Rev. Genet. 34:687-745.

33. Lowell, B. B., and Spiegelman, B. M. 2000. Towards a molecular understanding of adaptive thermogenesis. Nature 404:652-660.

34. Trayhum, P., Thurlby, P. L., and James, W. P. 1976. A defective response to cold in the obese (obob) mouse and the obese Zucker (fafa) rat [proceedings]. Proc. Nutr. Soc. 35:133A.

35. Hausberg, M., Morgan, D.A., Mitchell, J. L., Sivitz, W.I., Mark, A.L., and Haynes, W.G. 2002. Leptin potentiates thermogenic sympathetic responses to hypothermia: a receptor-mediated effect. Diabetes 51:2434-2440. 36. Collins, S., Kuhn, CM., Petro, A.E., Swick, A.G., Chrunyk, B.A., and Surwit, R.S. 1996. Role of leptin in fat regulation. Nature 380:677.

37. Curcio, C, Lopes, A.M., Ribeiro, M.O., Francoso, O.A., Jr., Carvalho, S. D., Lima, F. B., Bicudo, J. E., and Bianco, A.C. 1999. Development of compensatory thermogenesis in response to overfeeding in hypothyroid rats. Endocrinology 140:3438-3443.

38. Sellers, E.A., and You, S. S. 1950. Role of the thyroid in metabolic responses to a cold environment. Am. J. Physiol. 163:81-91.

39. Bethell, D. R., and Pegg, A.E. 1981. Polyamines are needed for the differentiation of 3T3-L1 fibroblasts into adipose cells. Biochem. Biophys. Res. Commun. 102:272-278.

40. Moitra, J., Mason, M. M., Olive, M., Krylov, D., Gavrilova, O., Marcus-Samuels, B., Feigenbaum, L., Lee, E., Aoyama, T., Eckhaus, M., et al. 1998. Life without white fat: a transgenic mouse. Genes Dev. 12:3168-3181.

41. Laustsen, P.G., Michael, M. D., Crute, B. E., Cohen, S. E., Ueki, K., Kulkami, R.N., Keller, S. R., Lienhard, G. E., and Kahn, CR. 2002. Lipoatrophic diabetes in lrs1(-/-)/lrs3(-/-) double knockout mice. Genes Dev. 16:3213-3222.

42. Reitman, M. L., Arioglu, E., Gavrilova, O., and Taylor, S.I. 2000. Lipoatrophy revisited. Trends Endocrinol. Metab. 11 :410-416.

43. Friedman, J. M., and Halaas, J. L. 1998. Leptin and the regulation of body weight in mammals. Nature 395:763-770.

44. Kamohara, S., Burcelin, R., Halaas, J. L., Friedman, J. M., and Charron, M.J. 1997. Acute stimulation of glucose metabolism in mice by leptin treatment. Nature 389:374-377.

45. Rossetti, L., Massillon, D., Barzilai, N., Vuguin, P., Chen, W., Hawkins, M., Wu, J., and Wang, J. 1997. Short term effects of leptin on hepatic gluconeogenesis and in vivo insulin action. J. Biol. Chem. 272:27758-27763.

46. Ebihara, K., Ogawa, Y., Masuzaki, H., Shintani, M., Miyanaga, F., Aizawa-Abe, M., Hayashi, T., Hosoda, K., Inoue, G., Yoshimasa, Y., et al. 2001. Transgenic overexpression of leptin rescues insulin resistance and diabetes in a mouse model of lipoatrophic diabetes. Diabetes 50:1440-1448.

47. Oral, E.A., Simha, V., Ruiz, E., Andewelt, A., Premkumar, A., Snell, P., Wagner, A.J., DePaoli, A.M., Reitman, M. L., Taylor, S. I., et al. 2002. Leptin- replacement therapy for lipodystrophy. N. Engl. J. Med. 346:570-578.

48. Cohen, S.S. 1998. A quide to the polyamines. New York: Oxforf University Press. 49. Oliveira, R.L., Ueno, M., de Souza, C. T., Pereira-da-Silva, M., Gasparetti, A.L., Bezzera, R.M., Alberici, L.C., Vercesi, A.E., Saad, M.J., and Velloso, L.A. 2004. Cold- induced PGC-1 alpha expression modulates muscle glucose uptake through an insulin receptor/Akt-independent, AMPK-dependent pathway. Am. J. Physiol. Endocrinol. Metab. 287:E686-695.

50. Smith, U., Sjostrom, L., and Bjomstorp, P. 1972. Comparison of two methods for determining human adipose cell size. J. Lipid. Res. 13:822-824.

51. Krotkiewski, M., Bjomtorp, P., Sjostrom, L., and Smith, U. 1983. Impact of obesity on metabolism in men and women. Importance of regional adipose tissue distribution. J. Clin. Invest. 72:1150-1162.

52. Harrington, T.A., Thomas, E. L., Modi, N., Frost, G., Coutts, G.A., and Bell, J. D. 2002. Fast and reproducible method for the direct quantitation of adipose tissue in newborn infants. Lipids 37:95-100.

53. Kiens, B., and Richter, E.A. 1996. Types of carbohydrate in an ordinary diet affect insulin action and muscle substrates in humans. Am. J. Clin. Nutr. 63:47-53.

54. Wieland, O. 1974. Glyserol assay. New York Academic Press, pp. 1404-1406.

55. Hyvonen, T., Keinanen, T.A., Khomutov, A.R., Khomutov, R.M., and Eloranta, T.O. 1992. Monitoring of the uptake and metabolism of aminooxy analogues of polyamines in cultured cells by high-performance liquid chromatography. J. Chromatogr. 574: 17-21.

56. Bemacki, R.J., Oberman, E.J., Seweryniak, K.E., Atwood, A., Bergeron, R.J., and Porter, CW. 1995. Preclinical antitumor efficacy of the polyamine analogue N1, N11-diethylnorspermine administered by multiple injection or continuous infusion. Clin. Cancer Res. 1 :847-857.

57. Passonneau, J.V., and Lowry, O. H. 1993. Enzymatic analysis: A practical quide. Ottawa, ON, Canada, Humana Press.

58. McLean, J.A., and Tobin, G. 1990. Animal and human calorimetry. Cambridge University Press, Cambridge.

59. Hohtola, E., Hissa, R., Pyomila, A., Rintamaki, H., and Saarela, S. 1991. Nocturnal hypothermia in fasting Japanese quail: the effect of ambient temperature. Physiol. Behav. 49:563-567.

60. Pallotti, F., and Lenaz, G. 2001. Isolation and subfractionation of mitochondria from animal cells and tissue culture lines. Methods Cell. Biol. 65:1-35.

61. Osmundsen, H. 1981. Spectrophotometric procedure for measuring mitochondrial beta-oxidation. Methods Enzymol. 72:306-314.

62. Rodbell, M. 1964. Metabolism of Isolated Fat Cells. I. Effects of Hormones on Glucose Metabolism and Lipolysis. J. Biol. Chem. 239:375-380. 63. Chomczynski, P., and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 167:156- 159.

64. Dahlquist, K.D., Salomonis, N., Vranizan, K., Lawlor, S.C., and Conklin, B.R. 2002. GenMAPP, a new tool for viewing and analyzing microarray data on biological pathways. Nat. Genet. 31 :19-20.

65. Doniger, S.W., Salomonis, N., Dahlquist, K.D., Vranizan, K., Lawlor, S. C, and Conklin, B.R. 2003. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. 4:R7.

66. Giles, K.W., and Myers, A. 1964. The Role of Nucleic Acids in the Growth of the Hypocotyl of Lupinus Albus under Varying Light and Dark Regimes. Biochim. Biophys. Acta 87:460-477.

Claims

1. A method of screening a modulating agent of a SSAT enzyme comprising the steps of introducing a candidate modulating agent into a cell culture system; and monitoring the level of SSAT activity in a cultured cell to detect whether said candidate modulating agent modulates or ameliorates cell's polyamine pathway metabolism related to diabetes and/or obesity.

2. The method according to claim 1 , wherein said modulating agent modulates the synthesis of putrescine from spermidine or spermine.

3. The method according to claim 1 , wherein said modulating agent also modulates at least one of the enzymes selected from the group consisting of: PAO and PGC- 1α.

4. The method according to any one of claims 1-3, wherein said modulating agent affects glucose tolerance and/or insulin sensitivity of the cell.

5. The method according to claim 1 , wherein said cell culture system comprises fat cells.

6. The method according to claim 5, wherein said cell culture system comprises white adipose tissue (WAT) or brown adipose tissue (BAT).

7. A method of screening a modulating agent of a SSAT enzyme in a mouse model comprising the steps of exposing a mouse to a candidate modulating agent; and monitoring the level of SSAT activity in a tissue or cell sample from the mouse to detect whether said candidate modulating agent modulates or ameliorates cell's polyamine pathway metabolism related to diabetes and/or obesity.

8. The method according to claim 7, wherein said mouse is exposed to said agent by administering said agent orally or intravenously to said mouse.

9. The method according to claim 7, wherein said modulating agent modulates the synthesis of putrescine from spermidine or spermine.

10. The method according to claim 7, wherein said modulating agent also modulates at least one of the enzymes selected from the group consisting of: PAO and PGC- 1α.

11. The method according to any one of claims 7-9, wherein said modulating agent affects glucose tolerance and/or insulin sensitivity of the cell.

12. The method according to claim 7, wherein said tissue or cell sample comprises fat cells.

13. The method according to claim 12, wherein said tissue or cell sample comprises white adipose tissue (WAT) or brown adipose tissue (BAT).

14. The method according to claim 7, wherein said tissue or cell sample is a blood sample.