Search Images Maps Play YouTube News Gmail Drive More »
Sign in
Screen reader users: click this link for accessible mode. Accessible mode has the same essential features but works better with your reader.

Patents

  1. Advanced Patent Search
Publication numberWO2006094286 A2
Publication typeApplication
Application numberPCT/US2006/008055
Publication dateSep 8, 2006
Filing dateMar 3, 2006
Priority dateMar 4, 2005
Also published asCN101188942A, CN101188942B, EP1860950A2, EP1860950A4, WO2006094286A3
Publication numberPCT/2006/8055, PCT/US/2006/008055, PCT/US/2006/08055, PCT/US/6/008055, PCT/US/6/08055, PCT/US2006/008055, PCT/US2006/08055, PCT/US2006008055, PCT/US200608055, PCT/US6/008055, PCT/US6/08055, PCT/US6008055, PCT/US608055, WO 2006/094286 A2, WO 2006094286 A2, WO 2006094286A2, WO-A2-2006094286, WO2006/094286A2, WO2006094286 A2, WO2006094286A2
InventorsJohn O'neil, Jean Xu, Alireza Rezania
ApplicantJohn O'neil, Jean Xu, Alireza Rezania
Export CitationBiBTeX, EndNote, RefMan
External Links: Patentscope, Espacenet
Adult pancreatic derived stromal cells
WO 2006094286 A2
Abstract
The present invention provides methods for isolating pancreatic stromal cells from pancreatic tissues. The pancreatic stromal cells isolated according to the present invention are capable of being propagated in vitro and differentiated into cells of a pancreatic β-cell lineage. The isolated pancreatic stromal cells can be induced to differentiate in vitro into fully or partially differentiated pancreatic cells for transplantation into a patient in need thereof. Alternatively, the isolated pancreatic stromal cells can be directly transplanted into a patient in need thereof and differentiate in vitro into the desirable cell types.
Claims  (OCR text may contain errors)
WHAT IS CLAIMED IS:
1. A substantially pure population of adult pancreatic-derived stromal cells.
2. The population of adult pancreatic-derived stromal cells according to claim 1, wherein the cells of the population are substantially negative in the expression of at least one protein marker selected from the group consisting of NCAM, ABCG2, cytokeratin 7, cytokeratin 8, cytokeratin 18, or cytokeratin 19.
3. The population of adult pancreatic-derived stromal cells according to claim 1, wherein the cells of the population are substantially positive in the expression of at least one protein marker selected from the group consisting of CD44, CD73, CD90 or CD105.
4. The population of adult pancreatic-derived stromal cells according to claim 1, capable of propagating in vitro.
5. The population of adult pancreatic-derived stromal cells according to claim 4, capable of propagating under hypoxic conditions.
6. The population of adult pancreatic-derived stromal cells according to claim 1, capable of differentiating into cells displaying the characteristics of the β-cell lineage.
7. The population of adult pancreatic-derived stromal cells according to claim 1 that has been genetically engineered to over express a protein.
8. The population of adult pancreatic-derived stromal cells according to claim
1 that has been genetically engineered to decrease the expression of a protein.
9. The population of adult pancreatic-derived stromal cells according to claim
2 that has been genetically engineered to over express a protein.
10. The population of adult pancreatic-derived stromal cells according to claim
2 that has been genetically engineered to decrease the expression of a protein.
11. The population of adult pancreatic-derived stromal cells according to claim
3 that has been genetically engineered to over express a protein. 12. The population of adult pancreatic-derived stromal cells according to claim 3 that has been genetically engineered to decrease the expression of a protein.
13. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 1, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
14. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 2, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
15. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 3, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
16. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 1, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
17. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 2, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells wiSf an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
18. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 3, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
19. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 1, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
20. A method of screening for agents capable of altering the expression of a. protein in the adult pancreatic-derived stromal cells of claim 2, comprising: a. Culturing the adult pancreatic-derived stromal cells,
■ b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
21. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 3, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
22. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 7, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
23. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 8, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
24. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 9, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
25. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 10, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
26. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 11, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
27. A method of screening for agents capable of inducing adult pancreatic- derived stromal cells to differentiate into a cell of a β-cell lineage using the cells of claim 12, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of inducing cells to differentiate into a cell of a β-cell lineage, d. Incubating the cells with the agent, and e. Determining the expression levels of pancreatic makers in the adult pancreatic-derived stromal cells.
28. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 7, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived . . stromal cells.
29. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 8, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
30. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 9, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
31. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 10, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
32. A method of screening for agents capable of altering the expression of a , '. gene in the adult pancreatic-derived stromal cells of claim 11, comprising: a. Culturing the adult pancreatic-derived stromal cells,
: b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
33. A method of screening for agents capable of altering the expression of a gene in the adult pancreatic-derived stromal cells of claim 12, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a gene in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a gene, d. Incubating the cells with the agent, and e. Determining the expression levels of a gene in the pancreatic-derived stromal cells.
34. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 7, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
35. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 8, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
36. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 9, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells. 37. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 10, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
38. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 11, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
39. A method of screening for agents capable of altering the expression of a protein in the adult pancreatic-derived stromal cells of claim 12, comprising: a. Culturing the adult pancreatic-derived stromal cells, b. Determining the expression levels of a protein in the adult pancreatic- derived stromal cells, c. Contacting the adult pancreatic-derived stromal cells with an agent capable of altering the expression of a protein, d. Incubating the cells with the agent, and e. Determining the expression levels of a protein in the pancreatic-derived stromal cells.
40. A method of obtaining a population of cells enriched in stromal cells from a mammalian pancreas, comprising: a. Isolating pancreatic cells from the mammalian pancreas; b. Culturing the cells in a basal nutrient medium supplemented with serum and glucose at a concentration of below about 3OmM; and c. Allowing the cells to grow in the medium for at least about two weeks, thereby obtaining a population of cells enriched in stromal cells.
41. The method of claim 40, wherein the serum concentration is below about 5%.
42. The method of claim 40, wherein the population of cells are substantially negative in the expression of at least one protein marker selected from the group consisting of NCAM, ABCG2, cytokeratin 7, cytokeratin 8, cytokeratin 18, or cytokeratin 19.
43. The method of claim 40, wherein the population of cells are substantially positive in the expression of at least one protein marker selected from the group consisting of CD44, CD73 , CD90 or CD 105.
44. The method of claim 40, wherein the stromal cells in the population of cells are capable of propagating in vitro.
45. The method of claim 40, wherein the stromal cells in the population of cells are capable of differentiating into cells displaying the characteristics of the β-cell lineage.
46. The method of claim 40, further comprising: a. Selecting and isolating the stromal cells based on at least one protein marker selected from the group consisting of CD44, CD73, CD90 or CD105.
47. A method of obtaining a pure population of adult pancreatic-derived stromal cells from a mammalian pancreas, comprising: a. Isolating pancreatic cells from the mammalian pancreas; b. Culturing the cells in a basal nutrient medium supplemented with serum and glucose at a concentration of below about 3OmM; c. Allowing the cells to grow in the medium for at least about two weeks to obtain a population of cells enriched in adult pancreatic-derived stromal cells; d. Isolating cells that specifically bind to an agent specific for a protein marker specifically expressed in the adult pancreatic-derived stromal cells, thereby obtaining a pure population of adult pancreatic-derived stromal cells.
48. The method of claim 47, wherein the serum concentration is below about 5%.
49. The method of claim 47, wherein the protein marker is selected from the group consisting of CD44, CD73, CD90 or CD 105.
50. The method of claim 47, wherein the population of cells are substantially negative in the expression of at least one protein marker selected from the group consisting of NCAM, ABCG2, cytokeratin 7, cytokeratin 8, cytokeratin 18, or cytokeratin 19.
51. The method of claim 47, wherein the population of cells are capable of propagating in vitro.
52. The method of claim 47, wherein the population of cells are capable of propagating under hypoxic conditions.
53. The method of claim 47, wherein the population of cells are capable of differentiating into cells displaying the characteristics of the β-cell lineage.
54. A method of obtaining cells displaying the characteristics of the β-cell lineage, comprising obtaining a substantially pure population of adult pancreatic-derived stromal cells from a mammalian pancreas, treating the adult pancreatic-derived stromal cells with an effective amount of an agent(s) that induces the adult pancreatic-derived stromal cells to differentiate into cells displaying the characteristics of the β-cell lineage.
55. The method of claim 54, wherein the population of adult pancreatic-derived stromal cells are obtained by: a. Isolating pancreatic cells from the mammalian pancreas; b. Culturing the cells in a basal nutrient medium supplemented with serum and glucose at a concentration of below about 3OmM; c. Allowing the cells to grow in the medium for at least about two weeks to obtain a population of cells enriched in adult pancreatic-derived stromal cells; d. Isolating cells that specifically bind to an agent specific for a protein marker specifically expressed in the adult pancreatic-derived stromal cells, thereby obtaining a purified population of adult pancreatic- derived stromal cells.
56. The method of claim 55, wherein the serum concentration is below about 5%.
57. The method of claim 54, wherein the population of adult pancreatic-derived stromal cells are expanded in culture prior to the treatment to induce differentiation.
58. The method of claim 54, wherein the cells displaying the characteristics of the β-cell lineage are insulin-producing cells.
59. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising (a) isolating a population of adult pancreatic-derived stromal cells from donor pancreatic tissue; and (b) transferring the adult pancreatic-derived stromal cells into the patient, wherein the adult pancreatic-derived stromal cells differentiate into pancreatic hormone producing cells.
60. The method of claim 59, wherein the patient is the donor of the pancreatic tissue.
61. The method of claim 59, wherein the pancreatic hormone producing cells are insulin-producing cells.
62. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising (a) isolating a population of adult pancreatic-derived stromal cells from donor pancreatic tissue; (b) expanding the stromal cells ex vivo to produce progenitor cells; and (c) transferring the progenitor cells into the patient, wherein the progenitor cells differentiate into pancreatic hormone producing cells.
63. The method of claim 62, wherein the pancreatic hormone producing cells are insulin-producing cells. 64. The method of claim 62, wherein the patient is the donor of the pancreatic tissue.
65. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising (a) isolating a population of adult pancreatic-derived stromal cells from donor pancreatic tissue; (b) expanding the population of adult pancreatic-derived stromal cells in vitro; and (c) transferring the expanded adult pancreatic-derived stromal cells into the patient, wherein the stromal cells differentiate into a pancreatic hormone producing cell.
66. The method of claim 65, wherein the pancreatic hormone producing cells are insulin-producing cells.
67. The method of claim 65, wherein the patient is the donor of the pancreatic tissue.
68. A method of treating a patient with diabetes mellitus or at risk of . . . ; developing diabetes, comprising (a) isolating a population of adult pancreatic-derived stromal cells from donor pancreatic tissue; (b) expanding the population of adult pancreatic-derived stromal cells in vitro; (c) differentiating the expanded adult pancreatic-derived stromal cells into a pancreatic β cell lineage and (d) transferring the differentiated cells into the patient.
69. The method of claim 68, wherein the pancreatic β cell lineage cells are insulin-producing cells.
70. The method of claim 68, wherein the patient is the donor of the pancreatic tissue.
71. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising (a) isolating a population of adult pancreatic-derived stromal cells from a donor pancreatic tissue; (b) obtaining mature islets from a donor; and (c) transferring both the adult pancreatic-derived stromal cells and the islets into the patient, wherein the islets enhance the survival and function of the adult pancreatic-derived stromal cells in the patient. 72. The method of claim 71, wherein the donor of the mature islets is allogeneic or xenogeneic relative to the patient.
73. A method of treating a patient with diabetes mellitus or at risk of developing diabetes, comprising (a) isolating a population of adult pancreatic-derived stromal cells from a donor pancreatic tissue; (b) obtaining mature islets from a donor; and (c) transferring both the adult pancreatic-derived stromal cells and the islets into the patient, wherein the adult pancreatic-derived stromal cells enhance the survival and function of the islets in the patient.
74. The method of claim 73, wherein the donor of the mature islets is allogeneic or xenogeneic relative to the patient.
75. A method according to any one of claims 59, 62, 65, 68, 71 or 73, further comprising administering a pharmaceutical carrier or bioactive agent to the patient to facilitate the survival and function of the cells transferred to the patient, wherein the carrier or agent is admim'stered to the patient before, after, or simultaneously with, the transfer of the cells to the patient.
76. A method according to any one of claims 59, 62, 65, 68, 71 or 73, wherein the cells to be transferred to the patient are incorporated in a polymeric support material.
77. The method according to claim 76, wherein the polymeric support material is also loaded with a pharmaceutical carrier or bioactive agent that facilitates the survival and function of the cells in the patient.
Description  (OCR text may contain errors)

ADULT PANCREATIC DERIVED STROMAL CELLS

FIELD OF THE INVENTION

This invention relates to an expandable population of adult pancreatic cells that can be differentiated into a β-cell lineage. This invention also provides methods for isolating and expanding such adult pancreatic cells, as well as related methods and compositions for utilizing such cells in the therapeutic treatment of diabetes.

BACKGROUND OF THE INVENTION

Loss of organ function can result from congenital defects, injury or disease. One example of a disease causing loss of organ function is diabetes mellitus, or diabetes. Most cases of diabetes fall into two clinical types: Type 1, also known as juvenile- onset diabetes or insulin dependent diabetes mellitus (IDDM), and Type 2, also known as adult-onset diabetes. Each type has a different prognosis, treatment, and cause. Both classes are characterized by the patient's inability to regulate their blood glucose levels. As a consequence, blood glucose levels rise to high values because glucose cannot enter cells to meet metabolic demands. This inability to properly metabolize blood sugar causes a complex series of early and late-stage symptomologies, beginning with, for example, hyperglycemia, abnormal hunger, thirst, polyuria, and glycouria, and then escalating to, for example, neuropathy, macro-vascular disease, and micro-vascular disease.

A common method of treatment of Type 1 diabetes involves the exogenous administration of insulin, typically by injection with either a syringe or a pump. This method does not completely normalize blood glucose levels and is often associated with an increased risk of hypoglycemia. More effective glycemic control can be achieved if the function of the pancreas can be restored or rejuvenated via transplantation or cell-based therapies.

It has been documented that progenitor cells, derived from fetal or embryonic tissues, have the potential to differentiate into a pancreatic hormone-producing cell. See, for example, U.S. Patent 6,436,704, WO03/062405, WO02/092756 and EP 0 363 125 A2, which report the potential of human fetal and embryonic derived cells to differentiate into a β-cell lineage. It is important to note from these publications, however, that human embryonic cells often require a feeder layer for expansion and maintenance of pluripotency, which does not allow for facile scale up of cells and an eventual cell therapy for treating diabetes.

It has also been documented that progenitor cells derived from adult tissues are capable of differentiation into a pancreatic β-cell phenotype. See, for example, WO2004/087885 A2, Hess et al. {Nature Biotechnology 21, 763 - 770, 2003), and Ianus et al. {J. Clin. Invest. I l l : 843-850, 2003), which report the capacity of adult bone marrow-derived cells (mesenchymal and hematopoetic cells) to differentiate into cells having characteristics of a pancreatic β-cell in vitro, or secrete trophic factors that help regenerate a damaged pancreas in vivo.

Among other sources of progenitor cells that can be differentiated into pancreatic cells include rodent liver oval stem cells (WO03/033697) and post-partum placenta (U.S. Published Application 2004/0161419 Al)-

The endocrine cells of the islets of Langerhans, including β-cells, are constantly turning over by processes of apoptosis and the proliferation of new islet cells (neogenesis). As such, the pancreas is thought to be a source of progenitor cells that are capable of differentiating into pancreatic hormone producing cells. There are three distinct tissue types, isolated from a pancreas, that are a potential source of pancreatic progenitor cells: an islet rich fraction, a ductal cell rich fraction, and an acinar cell rich fraction.

Isolation of progenitor cells or partially differentiated cells from crude pancreatic tissue extracts may be achieved using antibodies raised against cell surface markers. For example, U.S. Published Application 2004/0241761 discloses isolation of murine cells that were positive for ErbB2, ErbB3, ErbB4, Msx-2 and PDX-I (Cell 1, Table I hereinbelow), and positive for insulin expression. Gershengorn et al. {Science 306: 2261-2264, 2004) teach the production of proliferating cells that were able to form islet-like cell aggregates. The cells were derived from a heterogeneous population of adherent cells that emerged from the culture of isolated human pancreatic islets in vitro. The isolated islets of Langerhans were initially seeded onto tissue culture dishes and cultured in medium containing 10% serum. Fibroblast-like cells were observed to migrate out of the cultured islets and form a monolayer. These cells expressed Nestin, smooth muscle actin and vimentin (Cell 2, Table I hereinbelow).

Pancreatic progenitor cells may also arise from the culture of pancreatic islet and ductal tissue that has been dissociated into single cells, as disclosed by Seaberg et al. {Nature Biotechnology 22: 1115 - 1124, 2004). The murine progenitor cells disclosed by Seaberg et al. expressed Nestin during proliferation (Cell 3, Table I hereinbelow).

U.S. Published Application 2003/0082155 discloses methods to isolate and identify a population of cells from the islets of Langerhans of human pancreas, which have the functional and molecular characteristics of stem cells. In particular, these cells were characterized by Nestin-positive staining, Nestin gene expression, GLP-lR-positive staining, GLP- IR gene expression, ABCG2 positive staining, ABCG2 gene expression, Oct3/4 positive staining, Oct3/4 gene expression, latrophilin (type 2) positive staining, latrophilin (type 2) gene' expression, Hes-1 positive staining, Hes-1 gene expression, Integrin subunits α6 and βl positive staining, Integrin subunits α6 and βl gene expression, C-kit positive staining, C-kit gene expression, MDR-I positive staining, MDR-I gene expression, SST-R, 2, 3, 4 positive staining, SST-R, 2, 3, 4 gene expression, SUR-I positive staining, SUR-I gene expression, Kir 6.2 positive staining, Kir 6.2 gene expression, CD34 negative staining, CD45 negative staining, CD 133 negative staining, MHC class I negative staining, MHC class II negative staining, cytokeratin-19 negative staining, long-term proliferation in culture, and the ability to differentiate into pseudo-islets in culture (Cell 4, Table I hereinbelow).

In another approach, as disclosed in U.S. Patent 5,834,308, U.S. Patent 6,001,647 and U.S. Patent 6,703,017, crude preparations of islet cultures from NOD mice may be used to establish epithelial-like cultures, which can be maintained in growing cultures for greater than 1 year and which appear to demonstrate the ability to differentiate into islet-like clusters, capable of secreting insulin. (Cell 5, Table I hereinbelow).

Islet-like structures may be generated from fractions of digested human pancreata enriched for ductal tissue, as disclosed in Bonner-Weir et al. (Proc Nat Acad Sci 97: 7999-8004, 2000) and U.S. Patent 6,815,203 Bl. Islet-like clusters disclosed in these publications stained positive for cytokeratin 19 and showed immunoreactivity for insulin. (Cell 6, Table I hereinbelow).

WO2004/011621 discloses the generation of insulin negative adherent cells from human pancreatic ductal fragments. (Cell 7, Table I hereinbelow).

WO03/102134 discloses the generation of an epithelial cell positive for cytokeratin- 19 from an acinar fraction of a human pancreatic digest. The cells generated are capable of limited expansion and differentiate into an insulin-producing cell in the presence of an induction media. (Cell 8, Table I hereinbelow).

U.S. Published Application 2004/015805 Al reports that a subset of human pancreatic stem cells may be isolated using ligands to the cell surface marker CD56 (also known as NCAM). These cells can differentiate into insulin producing cells and insulin producing aggregates. (Cell 9, Table I hereinbelow).

Thus, there remains a significant need to develop culture conditions for establishing adult pancreatic derived cell lines that can be expanded to address the current clinical needs, while retaining the potential to differentiate into a β-cell lineage at late passages.

SUMMARY OF THE INVENTION

The present invention is directed to methods for isolating an adult pancreatic-derived cell population and expanding the cell population for up to about 20 population doublings, while retaining the potential of the cells to differentiate into cells with characteristics of a β-cell lineage. Alternatively, the cell population can be expanded for up to about 50, or, alternatively, for up to about 70 population doublings, while retaining the potential of the cells to differentiate into cells with characteristics of a β-cell lineage.

In one embodiment, the present invention provides a method for isolating mammalian adult pancreatic-derived stromal cells. According to the present invention, pancreatic cells are obtained from pancreatic tissue digests, which include differentiated pancreatic cells and undifferentiated pancreatic stromal cells. In order to select and enrich stromal cells, the cells obtained from pancreatic tissue digests are cultured in a selection media, which is a nutrient rich media containing less than 5% serum and glucose at a concentration less than 30 mM. The glucose range may also be less, for example, 6 mM or less. The culture is left undisturbed for about two to about four weeks without any media changes until cells become attached to the culture substrates.

Subsequent to the initial phase of selection and cell attachment, the selection media can be switched to a nutrient rich expansion media supplemented with serum at a concentration of greater than 1% but less than 20% and glucose at a concentration of less than 30 mM.

The resulting cell population is enriched in adult pancreatic-derived stromal cells. Such stromal cell population is substantially negative for at least one of the following markers: EPCAM, CD 45, CD117, CD 133, CD138, CD184, NCAM, ABCG2, cytokeratin 7, 8, 18, or 19, and can be expanded for multiple generations without losing the capacity to differentiate into cells of the β-cell lineage.

The cell population enriched in adult pancreatic-derived stromal cells can be contacted, for example, with an agent (such as an antibody) that specifically recognizes a protein marker expressed by stromal cells, to identify and select adult pancreatic-derived stromal cells, thereby obtaining a substantially pure population of adult pancreatic-derived stromal cells, i.e., wherein a recognized protein marker is expressed in at least 50% of the cell population.

In another embodiment, the present invention provides an isolated pure population of adult pancreatic-derived stromal cells that are substantially negative for at least one of the following markers: EPCAM5 CD45, CDl 17, CD133, CD138, CD184, NCAM, ABCG2, cytokeratin 7, 8, 18, or 19.

In one embodiment, the adult pancreatic-derived stromal cells isolated and expanded according to the present invention can be used in an in vitro assay to screen for agents that are capable of differentiating cells into the β-cell lineage.

The adult pancreatic-derived stromal cells isolated and expanded according to the present invention can be induced to differentiate into cells of the β-cell lineage under appropriate in vitro or in vivo conditions. Accordingly, the adult pancreatic-derived stromal cells selected and expanded according to the present invention, as well as the differentiated cells derived from the adult pancreatic-derived stromal cells, are useful for treating Type 1 and 2 diabetes.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 outlines the multi-stage process used to isolate the adult pancreatic-derived stromal cells of the present invention.

Figure 2 depicts the morphology of undifferentiated adhered human adult-pancreatic derived stromal cells (10OX magnification) at passage 12 grown in basal media supplemented with 5% fetal bovine serum (FBS), 1% penicillin/streptomycin (P/S), and 0.0165 mM zinc sulphate.

Figure 3 shows the typical growth curve of adult pancreatic-derived stromal cells of the current invention. The depicted curve is for passage 10 cells.

Figure 4 illustrates typical FACS analysis of passage 9 adult pancreatic-derived stromal cells of the current invention, a) isotype control, b) CDl 17 on X-axis and alkaline phosphatase on Y-axis, c) CD 105 on X-axis and CD44 on Y-axis, d) CD73 on X-axis and CD90 on Y-axis, e) EPCAM, f) ABCG2, g) Pan cytokeratin 14, 15, 16, and 19, h) Pan cytokeratin 5, 6, 8, 10, 13, and 18, i) vimentin. Figure 5 depicts immunostaining of passage 11 cells. Cells stained positive for vimentin, nestin, beta III tubulin, smooth muscle actin, and negative for pan cytokeratin (including CK 7 and CK 19).

Figure 6 shows the expansion potential of an adult pancreatic-derived stromal cell population isolated according to the present invention.

Figure 7 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H4. Cells were cultured in DMEM supplemented with 2% FBS.

Figure 8 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 4 of donor pancreas H4. Cells were cultured in DMEM supplemented with 2% FBS.

Figure 9 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 5 of donor pancreas H4. Cells were cultured in DMEM supplemented with 2% FBS.

Figure 10 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H4. Cells were cultured in DMEM supplemented with 10% FBS.

Figure 11 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 4 of donor pancreas H4. Cells were cultured in DMEM supplemented with 10% FBS.

Figure 12 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 5 of donor pancreas H4. Cells were cultured in DMEM supplemented with 10% FBS.

Figure 13 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H4. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 14 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 4 of donor pancreas H4. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 15 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 5 of donor pancreas H4. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 16 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of PDX-I (Panel A), insulin (Panel B), HNF-3β (Panel C) and CK 19 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H8. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 17 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of glucagon (Panel A), Glut-2 (Panel B), Pax-4 (Panel C) and Pax-6 (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H8. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 18 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of somatostatin (Panel A), neuroDl (Panel B)5 Nkx2.2 (Panel C) andNkxό.l (Panel D), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H8. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 19 shows the expression of selected genes, as determined by real-time PCR with time in culture. Results shown are the expression levels of HNF-I α (Panel A), and Sox-17 (Panel B), expressed as a percentage of the levels observed in human pancreas. Time in culture, as depicted by passage number is indicated on the x-axis. Data was obtained from adult pancreatic stromal cells derived from fraction 3 of donor pancreas H8. Cells were cultured in CMRL supplemented with 10% FBS.

Figure 20 shows the expression of selected genes, as determined by real-time PCR following treatment.

Figure 21 shows the expansion potential of two adult pancreatic-derived stromal cell populations isolated according to the present invention prior to, and after revival from cryopreservation.

Figure 22 shows the effects of nutrient deprivation on the expansion potential of an adult pancreatic-derived stromal cell population isolated according to the present invention.

Figure 23 shows the karyotype of a representative adult pancreatic-derived stromal cell population isolated according to the present invention.

Figure 24 shows the karyotype of a representative adult pancreatic-derived stromal cell population isolated according to the present invention.

Figure 25 shows the karyotype of a representative adult pancreatic-derived stromal cell population isolated according to the present invention.

Figure 26 shows the karyotype of a representative adult pancreatic-derived stromal cell population isolated according to the present invention.

Figure 27 shows the karyotype of a representative adult pancreatic-derived stromal cell population isolated according to the present invention. Figure 28 shows the scatter plots for genes expressed in adult pancreatic-derived stromal cells derived from fractions 3, 4, and 5 of donor pancreas H5. Pearson correlation coefficient for each comparison is also listed.

Figure 29 shows the scatter plot for genes expressed in adult pancreatic stromal cells derived from fraction 3 of donor pancreas H5 and donor pancreas H8. Pearson correlation coefficient is also listed.

DETAILED DESCRIPTION OF THE INVENTION

For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections that describe or illustrate certain features, embodiments or applications of the present invention.

Definitions

"Pancreatic-derived cells" refer to primary pancreatic cells from mammalian species, or primary cells isolated from a mammalian pancreas, that contain acinar, duct, and islet cell types, as well as supportive cells such as stromal, stellate, neurons, vascular cells, stem cells, and progenitor cells.

"Acinar cells" refer to pancreatic cells that account for about 80% of the cells of the pancreas and produce many different enzymes including amylase, lipase, trypsin, chymotrypsin, and elastase.

"Ductal cells" refer to pancreatic cells that account for about 10% of cells of the pancreas and define the larger interlobular and intralobular ducts, as well as the smallest, intercalated ducts, that drain the pancreatic enzymes from the acini. Duct cells also produce bicarbonate and water to dilute the enzymes and alter the intestinal pH upon release into the gut from these ductal structures. Duct cells can be identified by cytokeratin 19 (CK 19).

"Islet cells" refer to endocrine cells that account for about 1 to 2% of cells of the pancreas and exist as distinct cell aggregates called islets, which contain different cell types making different hormones, β-cells account for about 60 to 80% of the islet aggregate and secrete insulin that permits glucose entry into most cells of the body. Alpha cells account for about 10 to 30% of the islet, and secrete glucagon that is released during fasting to permit glucose delivery from the liver to maintain normal blood sugar. Delta cells account for about 5 to 10% of the islet cells and secrete somatostatin that further regulates glucose levels. Pancreatic polypeptide producing cells (about 5 to 10% of the islet cells) release their hormone that alters exocrine and gastrointestinal function. There are also other islet cell types, such as endothelial cells, neuronal cells, and progenitor cells.

"Pancreatic-derived stromal cells" refer to fibroblast-like cells derived from the pancreas that have the ability to expand in vitro and are devoid of any of the markers that are characteristic of a pancreatic hormone-producing cell, an islet cell, a cell of β-cell lineage, or a β-cell.

"β-cell lineage" refer to cells with positive gene expression for the transcription factor PDX-I and at least one of the following transcription factors: NGN-3, Nkx2.2, Nkxβ.l, NeuroD, IsI-I, HNF-3 beta, MAFA, Pax4, and Pax6.

"Pancreatic islet-like structure" refers to a three-dimensional clusters of cells derived by practicing the methods of the invention, which has the appearance of a pancreatic islet. The cells in a pancreatic islet-like structure express at least the PDX-I gene and one hormone selected from the list glucagon, somatostatin, or insulin.

The term "hypoxic" refers to oxygen levels less than 20%, alternatively less than 10%, alternatively less than 5% but more than 1%. '

The term "normoxia" refers to atmospheric oxygen levels of about 20%.

The term "substantially positive," when used in connection with a population of cells with respect to the expression of certain marker (such as a membrane receptor, cytoplasmic or nuclear protein, or a transcription factor), means that the marker is present or expressed in at least about 50%, preferably at least about 60%, and more preferably at least about 70%, of the total cell population. The term "substantially negative," when used in connection with a population of cells with respect to the expression of certain marker (such as a membrane receptor, cytoplasmic or nuclear protein, or a transcription factor), means that the marker is not present or expressed in at about 70%, alternatively about 80%, alternatively about 90%, of the total cell population.

The term "substantially pure," when used in connection with a population of cells means that the cell of interest accounts for at least about 50%, preferably at least about 60%, and more preferably at least about 70%, and most preferably > 80% of the total cell population.

A "stem cell" as used herein refers to an undifferentiated cell that is capable of extensive propagation either in vivo or ex vivo and capable of differentiation to other cell types.

A "progenitor cell" refers to a cell that is derived from a stem cell by differentiation and is capable of further differentiation to more mature cell types. Progenitor cells typically have more restricted proliferation capacity as compared to stem cells. Alternatively a "progenitor cell" may arise from the dedifferentiation of a fully or partially differentiated cell.

"Expandable population" refers to the ability of an isolated cell population to be propagated through at least about 20, alternatively, through at least about 50, alternatively, at least about 70 population doublings in a cell culture system.

By "undifferentiated cells," when used in connection with cells isolated from a pancreas, are meant a population of pancreatic-derived cells that are substantially negative for the expression of PDX-I or insulin.

By "differentiated cells," when used in connection with cells isolated from a pancreas, are meant a population of pancreatic-derived cells that are substantially positive for the expression of PDX-I or insulin.

"Markers" as used herein, are nucleic acid or polypeptide molecules that are differentially expressed in a cell of interest. In this context, differential expression means an increased level of the marker for a positive marker, and a decreased level for a negative marker. The detectable level of the marker nucleic acid or polypeptide is sufficiently higher or lower in the cells of interest, compared to other cells, such that the cell of interest can be identified and distinguished from other cells, using any of a variety of methods known in the art.

"Nestin" refers to an intermediate filament protein having a sequence disclosed in Genbank Accession No. X65964, or a naturally occurring variant sequence thereof (e.g., allelic variant).

"Beta III tubulin" is part of the cytoskeletal component involved in diverse cytosolic functions, such as the generation and maintenance of cell morphology and the transport of membranous organelles. Beta III tubulin has been shown to be present in neuronal cells.

"Vimentin" is a cytoskeletal intermediate filament protein that is a general marker of cells originating in the mesenchyme.

"ABCG2" refers to ATP-binding cassette multi-drag resistance transporter G2 having a sequence disclosed in Genbank Accession No. XM 032424, or a naturally occurring variant sequence thereof (e.g., allelic variant). One of skill in the art will recognize that equivalents exist wherein the DNA sequence encoding ABCG2 may vary, but wherein the encoded amino acid sequence remains the same.

"Cluster of Differentiation" (CD) molecules are markers on the cell surface, as recognized by specific sets of antibodies, used to identify the cell type, stage of differentiation and activity state of a cell. Function and designation of CD markers are well established in the art. See, for example, The Leukocyte Antigen Fact Book, 2nd edition, Barclay, A. N. et al. Academic Press, London 1997.

"CD49b" is also refferd to as "VLA-2" and is a surface recpetor for extracellular protiens such as laminin, collagen, fibronectin, and e-cadherin. It plasy a role in both coagulation and angiogenesis and is found primarily on platelets and activated B and T cells. "CD49e" is also referred to as "VLA-5" and serves as a receptor for fibronectin and fibrinogen. CD49e is expressed primarily on platelets, monocytes, and neutrophils.

"CD49f" is also referred to as "α6 integrin" and "VLA-6," and associates with integrin subunit beta 1 to bind laminin. CD49f is expressed primarily on epithelial cells, trophoblasts, platelets, and monocytes.

"CD90" is also referred to as "Thy-1" and is primarily expressed on hematopoietic stem cells, connective tissue cells, and various fibroblastic and stromal cells.

"CD91" is also referred to as alpha-2-marcoglobulin receptor binds to lipoproteins and also serves as a surface receptor for heat shock proteins. CD91 is primarily expressed on fibroblasts, dendritic cells, and macrophages.

"CD95" is also referred to as "FAS" or "APO-I" and is the receptor for FAS ligand. It is primarily expressed on activated B and T cells and in certain types of epithelial cells.

"CDl 05" is also referred to as "Endoglin" and is primarily expressed on endothelial cells, monocytes, macrophages, stromal cells, and bone marrow mesenchymal cells.

"NCAM" refers to Neural Cell Adhesion Molecule, also known as "CD56," is a Ca2+ independent cell adhesion molecule expressed in many tissues, including the nervous system and pancreatic tissue.

"PECAM" refers to Platelet/Endothelial Cell Adhesion Molecule and belongs to the family of cell adhesion molecules that are cell-surface glycoproteins, involved in cell- cell interactions.

"EPCAM" refers to Epithelial Cell Adhesion Molecule that is a cell surface glycoprotein involved in cell-cell interactions, primarily in epithelial cells.

"c-MET" refers to the receptor forhepatocyte growth factor. "CD44" is also referred to as "Hermes antigen" and is the main cell surface receptor for hyaluronan. This CD is primarily expressed in most cell types, except for tissues/cells such as hepatocytes, some epithelial cells, and cardiac muscle.

"CD73" is also referred to as "ecto-5'-nucleotidase" and is primarily expressed on a subset of-B and T cells, bone marrow stromal cells, various epithelial cells, fibroblasts, and endothelial cells.

"CD81" is also referred to as Target of an Anti-Proliferative Antibody (TAPAl) and is primarily expressed on lymphocytes, endothelial and epithelial cells.

"CD 124" is also referred to as Interleukin 4 receptor and is expressed on mature B cells, T cells, hemopoietic precursors, fibroblasts, and endothelial cells.

"CD138" is also referred to as heparin sulfate proteogycan or syndecan-1 which mediates cell adhesion and is associated with later stages of B cell differentiation. It is common found on B cell precursors, plasma cells, and some epithelial cell types.

"CDl 51" has been implied to modify integrin function and signaling and is typically found on endothelium, platelets, megakaryocytes, and epithelium.

"CD 166" is also referred to as Activated Leukocyte Cell Adhesion Molecule (ALCAM) and is involved in neuronal neurite extension, embryonic hemopoiesis, and embryonic angiogenesis. CD 166 is primarily expressed on neurons, activated T cells and monocytes, epithelial cells, and fibroblasts.

"CDl 84" is also referred to as CXCR4 or Stromal cell Derived Factor 1 (SDFl). It is the receptor for the CXC chemokine SDF-I and is found in all mature blood cells, blood progenitors, endothelial and epithelial cells, astrocytes, and neurons.

"c-Kit" and "CDl 17" both refer to a cell surface receptor tyrosine kinase having a sequence disclosed in Genbank Accession No. X06182, or a naturally occurring variant sequence thereof (e.g., allelic variant). "CD45" refers to the leukocyte common antigen having a sequence disclosed in Genbank Accession No. Y00638, or a naturally occurring variant sequence thereof (e.g., allelic variant).

"CD133" refers to a five-transmembrane hematopoietic stem cell antigen having a sequence disclosed in Genbank Accession No. NM 006017.

"Alkaline Phosphatase" is an enzyme made in the liver, bone, and the placenta and normally present in high concentrations in growing bone and in bile. A distinguishing characteristic of undifferentiated pluripotent stem cells is their expression of high levels of Alkaline Phosphatase (AP) on their cell surface.

By "basic defined cell culture medium" is meant a serum free or serum containing, chemically defined cell growth medium. Such medium includes, but is not limited to, Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha MMEM), Basal Medium Essential (BME), CMRL- 1066, RPMI 1640, M199 medium, Ham's FlO nutrient medium and DMEM/F12. These and other useful media are available from GIBCO, Grand Island, New York, U.S.A., for example. A number of these media are reviewed in Methods in Enzymology, Volume LVIII, "Cell Culture," pp. 62-72, edited by William B. Jakoby and Ira H. Pastan, published by Academic Press Inc.

"Pharmaceutical carrier" refers to a biodegradable or non-degradable porous or non- porous matrix that can act as a carrier for transplantation of mammalian cells.

"Transplantation" as used herein, can include the steps of introducing a cell or a population of cells or tissue into a mammal such as a human patient. "Transplantation" may also include incorporating cells or tissue into a pharmaceutical carrier, and implanting the carrier in a mammal such as a human patient.

Isolation of Adult Pancreatic-Derived Stromal Cells

In one aspect of the present invention, pancreatic-derived stromal cells are isolated by a multi-stage method, which is depicted in Figure 1. This method essentially involves: - Perfusion of a cadaver pancreas, living donor or autologous pancreas, with an enzymatic solution,

Mechanical dissociation of the perfused pancreas,

- Layering the digested tissue over a density gradient such as polysucrose or Ficoll, followed by centrifugation to yield three distinct interfaces,

- Removing the tissues and cells at each interface,

Culturing the tissues and cells in standard tissue culture plates in a nutrient rich selection media containing less than 5% serum,

- Leaving the culture undisturbed for about up to about two to up to about four weeks without any media changes.

Perfusion of a cadaver pancreas can be achieved with any of the enzymatic solutions well known to those skilled in the art. An example of an enzymatic solution suitable for use in the present invention contains LIBERASE HI ™ (Roche - 0.5 mg/ml) and DNase I (0.2 mg/ml).

Mechanical dissociation of the pancreatic tissue can be carried out rapidly by the use of a tissue processor. Alternatively, mechanical dissociation of the pancreatic tissue can be carried out using a Ricordi Chamber or other equivalent apparatus that enables a less destructive dissociation of the tissue, compared to other procedures.

The digested pancreatic tissues are then subjected to a polysucrose or Ficoll gradient centrifugation to yield three distinct interfaces, which are enriched in cells from islets, the ductal tissue and the acinar tissue, respectively. In one embodiment, the tissues and cells are removed from each interface and cultured separately. In an alternative embodiment, the tissues and cells from all the interfaces are combined and cultured. It has been determined in accordance with the present invention that adult pancreatic- derived stromal cells can be derived from any of the three interfaces. Alternatively, the digested pancreatic tissue may be applied to a continuous density gradient whereby the islet enriched tissue, ductal tissue and acinar tissue may also be collected.

According to the present invention, the tissues and cells collected from one or more of the interfaces are cultured in a selection media to selectively enrich adult pancreatic-derived stromal cells in the cell population. The selection media is rich in nutrient and contains low levels of glucose and serum. Generally speaking, the selection media contains less than 5% serum, alternatively, about 1 to about 3% serum, alternatively, about 2% serum; and less than 30 mM glucose. " In one embodiment, the selection media is supplemented with 2% serum that is derived from the same mammalian species that the donor pancreas was harvested from. Alternatively, fetal or calf serum, serum from other species, or other serum supplements or replacements can be used to supplement the selection media. An example of a suitable selection media is composed of DMEM (5 mM glucose), 2% fetal bovine serum (FBS), 100 U/μg penicillin/streptomycin, insulin-transferrin- selenium (ITS), 2 mM L-Glutamine, 0.0165 mM ZnSO4, and 0.38 μM 2- mercaptoethanol.

During the culture in a selection media ("the selection phase"), the cells can be cultured under hypoxic or normoxic conditions. Under hypoxic conditions, oxygen levels are lower than 20%, alternatively lower than 10%, alternatively lower than 5%, but more than 1%.

In one embodiment, the culture is maintained in the selection media undisturbed for about two to about four weeks without any media changes, at which point the cells have typically become adherent to the culture substrate used. The selection phase is considered to be complete when there is no further increase in the number of adherent cells.

It has been discovered that the methods of tissue harvest and culturing in accordance with the present invention result in a cell population enriched in adult pancreatic- derived stromal cells. By "enriched" is meant that adult pancreatic-derived stromal cells account for at least about 30%, alternatively about 40%, alternatively about 50% of all the cells in the population.

Subsequent to the initial phase of selection and cell attachment, the cells (enriched with adult pancreatic-derived stromal cells) are expanded under conditions as further described hereinbelow.

If desirable, the cell population enriched in adult pancreatic-derived stromal cells can be exposed, for example, to an agent (such as, for example, an antibody) that specifically recognizes a protein marker expressed by stromal cells, to identify and select adult pancreatic-derived stromal cells, thereby obtaining a substantially pure population of adult pancreatic-derived stromal cells. Characterization of The Isolated Adult Pancreatic-Derived Stromal Cells

Methods for assessing expression of protein and nucleic acid markers in cultured or isolated cells are standard in the art. These include quantitative reverse transcriptase polymerase chain reaction (RT-PCR), Northern blots, in situ hybridization (see, for example, Current Protocols in Molecular Biology (Ausubel et ah, eds. 2001 supplement)), and immunoassays, such as, for example, immunohistochemical analysis of sectioned material, western blotting, and for markers that are accessible in intact cells, flow cytometry analysis (FACS) (see, for example, Harlow and Lane, Using Antibodies: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press (1998)).

Examples of antibodies useful for detecting certain protein markers are listed in Table II and Table V. It should be noted that other antibodies directed to the same markers that are recognized by the antibodies listed in Table II and Table V, are available or can be readily developed. Such other antibodies can also be employed for assessing expression of markers in the cells isolated in accordance with the present invention.

Characteristics of cells of the β-cell lineage are well known to those skilled in the art, and additional characteristics of the β-cell lineage continue to be identified. These characteristics can be used to confirm that the adult pancreatic-derived stromal cells isolated in accordance with the present invention have differentiated to acquire the properties characteristic of the β-cell lineage, β-cell lineage specific characteristics include the expression of one or more transcription factors such as, for example, insulin, PDX-I (pancreatic and duodenal homeobox gene-1), NGN-3 (neurogenin-3), Hlxb9, Nkx6, IsIl, Pax6, NeuroD, Hnfla, Hnf6, Hnf3 Beta, and MafA, among others. These transcription factors are well established in the art for identification of endocrine cells. See, for example, Edlund (Nature Reviews Genetics 3: 524-632 (2002)).

The present inventors have identified and isolated a population of adult stromal cells from the mammalian pancreas that have the capacity to proliferate for up to about 20 population doublings while maintaining the potential to differentiate into cells with characteristics of a β-cell lineage. In an alternate embodiment, the present inventors have identified and isolated a population of adult stromal cells from the mammalian pancreas that have the capacity to proliferate for up to about 50 population doublings while maintaining the potential to differentiate into cells with characteristics of a β-cell lineage. In an alternate embodiment, the present inventors have identified and isolated a population of adult stromal cells from the mammalian pancreas that have the capacity to proliferate for up to about 70 population doublings while maintaining the potential to differentiate into cells with characteristics of a β-cell lineage.

In particular, the adult pancreatic-derived stromal cells isolated in accordance with the present invention are characterized as, inter alia, substantially lacking at least one of the following protein markers: CDl 17, NCAM, ABCG2, cytokeratin 7, 8, 18, or 19. In certain specific embodiments, the adult pancreatic-derived stromal cells isolated in accordance with the present invention are characterized as substantially positive for at least one of the following protein markers: CD44, CD49b, CD49e, CD73, CD81, CD90, CD95, CD105, CD151 or CD166.

Expansion of Adult Pancreatic-Derived Stromal Cells

In a further aspect, the present invention provides a method for expanding the adult pancreatic-derived stromal cells obtained in accordance with the present invention. As described hereinabove, pancreatic digests, which may contain a heterogeneous mixture of islets, ductal fragments and exocrine tissue, are cultured in a low serum selection media for about two to about four weeks, preferably without any media changes, to selectively enrich the desired adult pancreatic-derived stromal cells. The resulting cell population, now enriched with adult pancreatic-derived stromal cells, is then switched to a growth media to expand the adult pancreatic-derived stromal cells in the cell population.

The growth media suitable for use in the present invention can be composed of media such as, for example, DMEM containing penicillin/streptomycin (P/S) and serum at a concentration of 2% to 20%, preferably about 5%. In a specific embodiment, the growth media is composed of DMEM (2750 mg/1 D-glucose; 862 mg/1 glutamine), 5% fetal bovine serum, and 0.0165 niM zinc sulphate. In a specific embodiment, the growth media is supplemented with serum that is derived from the same mammalian species that the donor pancreas was harvested from. Alternatively, fetal or calf serum, or other serum supplements or replacements, such as, for example, serum albumin, may be used to supplement the growth media.

Furthermore, the adult pancreatic-derived stromal cells can be expanded by culturing in a defined growth media containing agent(s) that stimulate the proliferation of the cells of the present invention. These factors may include, for example, nicotinamide, members of TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -4, 6, -7, -11, -12, and -13), serum albumin, fibroblast growth factor family, platelet-derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, 11), glucagon like peptide-I and II (GLP-I and II), GLP-I and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-α, forskolin, Na-Butyrate, activin, betacellulin, insulin/transferring/selenium (ITS), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), bovine pituitary extract, islet neogenesis- associated protein (INGAP), proteasome inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, or combinations thereof. Alternatively, the adult pancreatic- derived stromal cells may be expanded by culturing in conditioned media. By "conditioned media" is meant that a population of cells is grown in a basic defined cell culture medium and contributes soluble factors to the medium. In one such use, the cells are removed from the medium, while the soluble factors the cells produce remain. This medium is then used to nourish a different population of cells.

In certain embodiments, the adult pancreatic-derived stromal cells are cultured on standard tissue culture plates. Alternatively, the culture plates may be coated with extracellular matrix proteins, such as, for example, MATRIGEL ®, growth factor reduced MATRIGEL ®, laminin, collagen, gelatin, tenascin, fibronectin, vitronectin, thrombospondin, placenta extracts or combinations thereof. Furthermore, the adult pancreatic-derived stromal cells can be expanded in vitro under hypoxic or normoxic conditions.

Under the above growth conditions for expansion, the adult pancreatic-derived stromal cells isolated in accordance with the present invention can be expanded for more than about 20 population doublings, alternatively, more than about 50 population doublings, alternatively, more than about 70 population doublings while maintaining the potential to differentiate into cells with characteristics of a β-cell lineage.

Differentiation Of Adult Pancreatic-Derived Stromal Cells

In one aspect, the present invention provides compositions capable of differentiating the expanded adult pancreatic-derived stromal cells of this invention into cells bearing markers characteristic of the β-cell lineage.

A basic defined culture medium, when supplied with one or more components, that support the growth of adult pancreatic-derived stromal cells and with differentiation- inducing amounts of one or more growth factors, is referred to as an "induction medium." In accordance with the present invention, the induction medium contains less than or equal to 2% serum. In one embodiment, fetal calf serum may be used. Alternatively, fetal bovine serum may be replaced by serum from any mammal, or by human albumin, bovine albumin or other compounds that permit or enhance differentiation of adult pancreatic-derived stromal cells to the β cell lineage. Alternatively, the induction medium may be conditioned medium.

Factors appropriate for use in the induction medium may include, for example, nicotinamide, members of TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -4, 6, -7, -11, -12, and -13), serum albumin, fibroblast growth factor family, platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, - 10, 11), glucagon like peptide-I and II (GLP-I and II), GLP-I and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-α, forskolin, Na- Butyrate, activin, betacellulin, ITS, hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), bovine pituitary extract, islet neogenesis-associated protein (INGAP), proteasome inhibitors, histone deacetylase inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, or combinations thereof.

In one aspect of the present invention, a combination of growth factors and chemical agents, including bFGF, Activin-A, FGF5, N2 and B27 supplements (Gibco, CA), steroid alkaloid such as, for example, cyclopamine (EMD, CA) that inhibits sonic hedgehog signaling, and a proteasome inhibitor such as, for example MGl 32 (EMD, CA), is supplied to a basic defined medium to support differentiation of adult pancreatic-derived stromal cells into a β-cell lineage. In one aspect, the cells are cultured in an induction media composed of DMEM (low glucose, 5.5 mM) containing 10 micromolar MG-132 for about one to about two days, followed by additional incubation for about three to about seven days in an induction media supplemented with IX B27 (Gibco, CA) and IX N2 (Gibco, CA) and further supplemented with Cyclopamine (10 μM; EMD, CA), bFGF (20 ng/ml; R&D Systems, MN), Activin A (20 nM; R&D Systems, MN) or FGF5 (20 ng/ml; R&D Systems, MN) for an additional five days.

In another aspect of the present invention, a combination of growth factors and chemical agents, including a proteasome inhibitor such as, for example MGl 32 (EMD, CA), is supplied to a basic defined medium to support differentiation of adult pancreatic-derived stromal cells into a β-cell lineage. In one aspect, the cells are cultured in induction media composed of DMEM (low glucose, 5.5 mM) containing a range of MG-132 concentrations from one to ten micromolar for about one to about two days, followed by additional incubation for about one to about two days with a histone deacetylase inhibitor such as, for example, Trichostatin A (Sigma, MO). Following the removal of these inhibitors, the cells are cultured in an induction media supplemented with factors appropriate for use in the induction medium which may include, for example, nicotinamide, members of TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -4, 6, -7, -11, -12, and— 13), serum albumin, fibroblast growth factor family, platelet-derived growth factor-AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, 11), glucagon like peptide-I and II (GLP-I and II), GLP-I and GLP-2 mimetobody, Exendin-4, retinoic acid, parathyroid hormone, insulin, progesterone, aprotinin, hydrocortisone, ethanolamine, beta mercaptoethanol, epidermal growth factor (EGF), gastrin I and II, copper chelators such as triethylene pentamine, TGF-α, forskolin, Na-Butyrate, activin, betacellulin, ITS, hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), bovine pituitary extract, islet neogenesis-associated protein (INGAP), proteasome inhibitors, histone deacetylase inhibitors, notch pathway inhibitors, sonic hedgehog inhibitors, or combinations thereof for an additional period of time to achieve the desired degree of differentiation to a β-cell lineage.

The combination and concentrations of growth factors, the length of culture, and other culture conditions can be optimized by those skilled in the art to achieve effective differentiation by, e.g., monitoring the percentage of cells that have differentiated into cells characteristic of the β-cell lineage. The one or more growth factors may be added in an amount sufficient to induce the differentiation of the pancreatic stromal cells of the present invention into cells bearing markers of a β-cell lineage over a time period of about one to four weeks.

Alternatively, the adult pancreatic-derived stromal cells of the present invention may be utilized in an in vitro assay to test for agents mat are capable of inducing cells to differentiate into a β-cell lineage. Cells may be contacted with one or more than one agent and changes in gene expression monitored over time. An example of the method that may be employed is disclosed in Example 9 below.

Therapeutic Use of The Cells of The Present Invention.

It was found that the adult pancreatic-derived stromal cells isolated and expanded according to the methods of this invention maintain the ability to differentiate into cells of a pancreatic β-cell lineage. The cells of the present invention can be utilized for the treatment of Type 1 and 2 diabetes.

In one aspect, the present invention provides a method for treating a mammal suffering from, or at risk of developing Typel diabetes. This method involves isolating and culturing adult pancreatic-derived stromal cells, expanding the isolated population of cells, differentiating the cultured cells in vitro into a β-cell lineage, and implanting the differentiated cells either directly or in a pharmaceutical carrier into the mammal. If appropriate, the mammal can be further treated with pharmaceutical agents or bioactives that facilitate the survival and function of the transplanted cells. These agents may include, for example, insulin, members of the TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -3, -4, -5, -6, -7, -11, -12, and - 13), fibroblast growth factors-1 and -2, platelet-derived growth factor-AA, and— BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, -15), vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other pharmaceutical compounds can include, for example, nicotinamide, glucagon like peptide-I (GLP-I) and II, GLP-I and 2 mimetibody, Exendin-4, retinoic acid, parathyroid hormone, MAPK inhibitors, such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729.

In yet another aspect, this invention provides a method for treating a mammal suffering from, or at risk of developing Type 2 diabetes. The method involves isolating and culturing adult pancreatic-derived stromal cells according to the present invention, expanding the isolated population of cells, differentiating the cultured cells in vitro into a β-cell lineage, and implanting the differentiated cells either directly or in a pharmaceutical carrier into* the mammal.

In yet another embodiment, the adult pancreatic-derived stromal cells of the present invention can be transplanted with mature islets of the same or different animal species to enhance the survival of the stromal cells or to induce further differentiation of the stromal cells into a β-cell lineage.

The source of pancreatic tissue from which the stromal cells of the present invention are isolated can be autologous in relation to the mammal undergoing the therapeutic treatment. Alternatively, the source may be allogeneic, or xenogeneic. Cells to be administered to a mammal can also be genetically modified to enhance proliferation and/or differentiation or prevent or lessen the risk of immune rejection. Alternatively, the adult pancreatic-derived stromal cells obtained in accordance with the present invention can be used to modulate the recipient's immune response, prior to transplantation of differentiated cells prepared in accordance with the present invention. See, for example, U.S. Patent 6,328,960, U.S. Patent 6,281,012.

The adult pancreatic-derived stromal cells of the present invention can be fully differentiated into an insulin-producing cell, prior to transplantation into a recipient. In a specific embodiment, the adult pancreatic-derived stromal cells of the present invention are fully differentiated into β-cells, prior to transplantation into a recipient. Alternatively, the adult pancreatic-derived stromal cells of the present invention can be transplanted into a recipient in an undifferentiated or partially differentiated state. Further differentiation may take place in the recipient.

The cells, undifferentiated or otherwise, can be used as dispersed cells or formed into clusters that can be infused into the hepatic portal vein. Alternatively, the cells can be provided in biocompatible degradable polymeric supports, porous non-degradable devices or encapsulated to protect from host immune response. The cells can be implanted into an appropriate site in a recipient. The implantation sites include, for example, the liver, natural pancreas, renal subcapsular space, omentum, peritoneum, subserosal space or a subcutaneous pocket.

To enhance further differentiation, survival or activity of implanted cells, additional factors, such as growth factors, antioxidants or anti-inflammatory agents, can be administered before, simultaneously with, or after the administration of the cells. In certain embodiments, growth factors are utilized to differentiate the administered cells in vivo. These factors can be secreted by endogenous cells and exposed to the administered stromal cells in situ. Implanted stromal cells can be induced to differentiate by any combination of endogenous and exogenously administered growth factors known in the art.

The amount of cells used in implantation depends on a number of factors including the patient's condition and response to the therapy, and can be determined by one skilled in the art. In one aspect, this invention provides a method for treating a mammal suffering from, or at risk of developing diabetes. The method includes isolating and culturing adult pancreatic derived stromal cells according to the present invention, expanding the isolated population of cells, differentiating in vitro the cultured stromal cells into a β- cell lineage, and incorporating the cells into a three-dimensional support. The cells can be maintained in vitro on this support prior to implantation into the mammal. Alternatively, the support containing the cells can be directly implanted in the mammal without additional in vitro culturing. The support can optionally be incorporated with at least one pharmaceutical agent that facilitates the survival, differentiation and function of the transplanted cells.

Support materials suitable for use for purposes of the present invention include tissue templates, conduits, barriers, and reservoirs useful for tissue repair. In particular, synthetic and natural materials in the form of foams, sponges, gels, hydrogels, textiles, and nonwoven structures, which have been used in vitro and in vivo to reconstruct or regenerate biological tissue, as well as to deliver chemotactic agents for inducing tissue growth, are suitable for use in practicing the methods of the present invention. See, e.g., the materials disclosed in U.S. Patent 5,770,417, U.S. Patent 6,022,743, U.S. Patent 5,567,612, U.S. Patent 5,759,830, U.S. Patent 6,626,950, U.S. Patent 6,534,084, U.S. Patent 6,306,424, U.S. Patent 6,365,149, U.S. Patent 6,599,323, U.S. Patent 6,656,488, and U.S. Patent 6,333,029. Exemplary polymers suitable for use in the present invention are disclosed in U.S. Published Application 2004/0062753 Al and U.S. Patent 4,557,264.

To form a support incorporated with a pharmaceutical agent, the pharmaceutical agent can be mixed with the polymer solution prior to forming the support. Alternatively, a pharmaceutical agent could be coated onto a fabricated support, preferably in the presence of a pharmaceutical carrier. The pharmaceutical agent may be present as a liquid, a finely divided solid, or any other appropriate physical form. Alternatively, excipients may be added to the support to alter the release rate of the pharmaceutical agent. In an alternate embodiment, the support is incorporated with at least one pharmaceutical compound that is an anti-inflammatory compound, such as, for example compounds disclosed in U.S. Patent 6,509,369. In one embodiment, the support is incorporated with at least one pharmaceutical compound that is an anti-apoptotic compound, such as, for example, compounds disclosed in U.S. Patent 6,793,945.

In another embodiment, the support is incorporated with at least one pharmaceutical compound that is an inhibitor of fibrosis, such as, for example, compounds disclosed in U.S. Patent 6,331,298.

In a further embodiment, the support is incorporated with at least one pharmaceutical compound that is capable of enhancing angiogenesis, such as, for example, compounds disclosed in U.S. Published Application 2004/0220393 and U.S. Published Application 2004/0209901.

In still another embodiment, the support is incorporated with at least one pharmaceutical compound that is an immunosuppressive compound, such as, for example, compounds disclosed in U.S. Published Application 2004/0171623.

In a further embodiment, the support is incorporated with at least one pharmaceutical compound that is a growth factor, such as, for example, members of the TGF-β family, including TGF-βl, 2, and 3, bone morphogenic proteins (BMP-2, -3, -4, -5, -6, -7, - 11, -12, and -13), fibroblast growth factors-1 and -2, platelet-derived growth factor- AA, and -BB, platelet rich plasma, insulin growth factor (IGF-I, II) growth differentiation factor (GDF-5, -6, -8, -10, -15), vascular endothelial cell-derived growth factor (VEGF), pleiotrophin, endothelin, among others. Other pharmaceutical compounds can include, for example, nicotinamide, hypoxia inducible factor 1 -alpha, glucagon like peptide-I and II (GLP-I, -2), GLP-I and GLP-2 mimetibody, , Exendin- 4, retinoic acid, parathyroid hormone, tenascin-C, tropoelastin, thrombin-derived peptides, cathelicidins, defensins, laminin, biological peptides containing cell- and heparin-binding domains of adhesive extracellular matrix proteins such as fibronectin and vitronectin, MAPK inhibitors, such as, for example, compounds disclosed in U.S. Published Application 2004/0209901 and U.S. Published Application 2004/0132729.

The incorporation of the cells of the present invention into a scaffold can be achieved by the simple depositing of cells onto the scaffold. Cells can enter into the scaffold by simple diffusion (J. Pediatr. Surg. 23 (1 Pt 2): 3-9 (1988)). Several other approaches have been developed to enhance the efficiency of cell seeding. For example, spinner flasks have been used in seeding of chondrocytes onto polyglycolic acid scaffolds (Biotechnol. Prog. 14(2): 193-202 (1998)). Another approach for seeding cells is the use of centrifugation, which yields minimum stress to the seeded cells and enhances seeding efficiency. For example, Yang et al. developed a cell seeding method (J. Biomed. Mater. Res. 55(3): 379-86 (2001)), referred to as Centrifugational Cell Immobilization (CCI).

The present invention is further illustrated, but not limited by, the following examples.

Example 1

The Establishment of Human Adult Pancreatic-Derived Stromal Cell Lines

Pancreas Preparation - Human pancreata not suitable for clinical transplantation were obtained from The National Disease Research Interchange (Philadelphia, PA), following appropriate consent for research use. The pancreas was transferred with organ preservation solution to a stainless steel pan on ice and trimmed of all extraneous tissue. The pancreatic duct was cannulated with an 18-gauge catheter and the pancreas was injected with an enzyme solution, which contained the LIBERASE HI ™ enzyme (Roche - 0.5 mg/ml) and DNase I (0.2 mg/ml), dissolved in Dulbecco's Phosphate Buffered Saline (DPBS).

Rapid Mechanical Dissociation Followed by Enzymatic Digestion - The enzyme infused pancreata were homogenized in a tissue processor, pulsed 3 to 5 times for 3 to 5 seconds/pulse, and the dissociated tissue were transferred to two 500 ml trypsinizing flasks (Bellco) containing magnetic stir bars. Thereafter, 50 to 100 ml of the enzyme solution was added to each flask. The flasks were placed in a 37°C water bath on submersible stir plates and allowed to incubate with an intermediate stir rate for 10 minutes. The stirring was stopped and the fine digested tissue was removed from the flask and transferred into 250 ml tube containing DPBS, 5% Fetal Bovine Serum (FBS) and 0.1 mg/ml DNase I (DPBS+) at 4°C to quench the digestion process. The flasks were replenished with 50 to 100 ml of the enzyme solution and returned to the water bath and the stirring was re-initiated for an additional ten minutes. Again, the flasks were removed and the fine digest was collected and transferred to the 250 ml tubes on ice. This process was repeated for additional 3-5 times until the pancreas was completely digested.

Gradual Mechanical Dissociation with Simultaneous Enzyme Digestion - The enzyme infused pancreata were processed according to methods as described in Diabetes 37:413-420 (1988). Briefly, the pancreata were cleaned of extraneous tissue and injected with the enzyme solution as described above. The pancreata were then placed into a Ricordi Chamber with beads and covered with a screen with a mesh size of 400 to 600 μm to retain larger clusters of tissue. The chamber was covered and the enzyme solution was circulated through the chamber at approximately 37°C and the chamber was shaken to allow beads to disrupt pancreatic tissue while the enzyme digested the pancreas. Once adequate dissociation and digestion was achieved, the digestion was terminated and the tissue was collected.

Tissue Separation - The collected tissue was centrifuged at 150 x g for 5 minutes at 4°C. The supernatant was aspirated and the tissue was washed two additional times in DPB S+. Following the final wash, the tissue was applied to a discontinuous gradient for purification. The digested tissue was suspended in polysucrose (Mediatech, VA) with a density of 1.108 g/ml at a ratio of 1 to 2 ml tissue pellet per 10 ml of polysucrose solution. The tissue suspension was then transferred to round-bottom polycarbonate centrifuge tubes and polysucrose solutions with densities of 1.096 and 1.037 were carefully applied to the tubes. A final layer of DMEM completed the discontinuous purification gradient. The gradient tubes were centrifuged at 2000 rpm for 20 minutes at 4°C with no brake applied. Following centrifugation, the tissue was collected from each interface (three interfaces) and washed several times in DPB S+ as described above and collected in a 50 ml test tube.

Further Cell Cluster Dissociation - Optionally, one can further dissociate large cell clusters obtained using the above protocol into smaller clusters or single cell suspensions. After the final wash, the tissue from each fraction was suspended in 10 ml IX trypsin/EDTA solution containing 200U/ml DNase I. The tubes were placed in the water bath and repeatedly aspirated and discharged from a 10 ml serological pipette for 5 to 6 minutes until a near single cell suspension is achieved. The digestion was quenched with the addition of 4°C DPBS+ and the tubes centrifuged at 800 rpm for 5 minutes. The cell suspensions were washed with DPB S+ and cultured as described below.

Pancreatic Cell Culture - Following the final wash, the cells from each interface were resuspended in DMEM, 2% FBS, 100 U/μg penicillin/streptomycin, ITS, 2 mM L- Glutamine, 0.0165 mM ZnSO4 (Sigma), and 0.38 μM 2-mercaptoethanol (Invitrogen, CA) (hereinafter "the selection media"). Six ml of the cell suspension was seeded in T-25 tissue culture flasks and 12 ml of the cell suspension was seeded into T-75 flasks. The flasks were placed in 370C incubators with 5% CO2. Following two to about four weeks culture, a complete media change was performed and adherent cells were returned to culture in DMEM (2750 mg/1 D-glucose, 862 mg/1 glutamine) (Gibco, CA) with 5% FBS (HyClone, UT), 1% P/S, 0.0165 mM ZnSO4 (hereinafter "the growth media") and allowed to reach near confluence (this stage is referred to as "passage 0" or "PO"), at which point they were passaged. Subsequent culturing of the cells was at 5000 cell/cm2 in the growth media. Cultures were passaged every seven to ten days at approximately 70 to 90% confluency. Figure 2 depicts the typical morphology of the adult pancreatic-derived stromal cells of the present invention.

Example 2

Population Doubling Time

Passage 10 and 12 adult pancreatic-derived stromal cells isolated and expanded according to Example 1 above were seeded at 10000 cells/well of a 24-well tissue culture plate (Corning, MA) in the growth media. At various time points, cells were removed from three wells of the plate using TRYPLE™ Express (Invitrogen, CA) and counted using a Guava PCA-96 cell analysis system and the VIACOUNT® reagent (Guava, CA). Figure 3 depicts the growth curve of passage 10 cells cultured under normoxic conditions. The linear phase of the log plot was used to estimate the population doubling time of the cells. Population doubling time of passage 10 and 12 cells was 36 hrs and 38 hrs, respectively.

Example 3

Expansion Potential of Adult Pancreatic-Derived Stromal Cells

Adult pancreatic-derived stromal cells isolated according to Example 1 were cultured in a 75cm2 tissue culture treated flask (Corning, MA) under normoxic conditions (5% CO2, 20% O2, and 75% N2) for 3 wks in the selection media. The cultures were then switched to growth media and fed two to three times per week. The cells were allowed to reach near confluence, at which point they were passaged. Cultures were passaged every 7-14 days at approximately 70 to 95% confluency for the first 9 passages during which time the cell population doubling time was greater than 100 hrs. Following the tenth passage the cell growth rate increased and the population doubling time was reduced to approximately 40 hrs with the cells passaged every 4 to 6 days. Cells were harvested from flasks at each passage using TRYPLE™ Express (Invitrogen, CA) and counted using a Guava PCA-96 cell analysis system and the VIACOUNT® reagent (Guava, CA). The cells continue to proliferate in expansion media culture for 132 days, currently reaching 40 population doublings and a projected 1012 fold increase in cell numbers. (See Figure 6)

Example 4

Expansion Potential of a Number of Adult Pancreatic-Derived Stromal Cell Lines

Adult pancreatic-derived stromal cells isolated according to Example 1 were either cultured under hypoxic conditions (5% CO2, 3% O2, and 92% N2) or normoxic conditions (5% CO2, 20% O2, and 75% N2) for two to four weeks in the selection media. The cultures were then switched to the growth media and fed two to three times per week. After the initial culture period, adherent cells were observed in plates cultured under hypoxic and normoxic conditions. Furthermore, following the initial two to four weeks of culturing, there were very few remaining islet-like or ductal structures in the plates. The in vitro expansion potential of the adult pancreatic-derived stromal cell lines, isolated from a number of donor pancreata was tested, using a variety of media. Cells from fractions 3, 4 and 5 were cultured under normoxic conditions on tissue culture treated flasks, in media comprising DMEM, 5% FBS, 25mM HEPES5 0.0165 mM ZnSO4,. Parallel populations of cells were cultured in CMRL1066, 10% FBS, 25mM HEPES, or DMEM, 10% FBS, 25 mM HEPES, all cultures were supplemented with antibiotics. Cultures were allowed to reach confluence before passage. Table VI describes the population doubling time (PDT), the total number of population doublings (PD) and the projected cell number, of the cell lines cultures iinder the conditions tested.

Example 5

Selection of CDl 05 Positive Cells

At about 70% confhiency, PO adult pancreatic-derived cells isolated according to Example 1 were released using the TRYPLE™ Express (Invitrogen, CA) solution, followed by rinsing with the growth media (DMEM5 5% FBS, 0.0165 mM ZnSO4 and 1% P/S). The cell suspension was centrifuged for 5 mins at 1400 RPM, and the supernatant was discarded. The resulting cell pellet was resuspended in phosphate buffered saline (PBS), supplemented with 0.5% bovine serum albumin (BSA) and 2 mM EDTA. The cells were selected for a CD 105 positive population following manufacturer's instructions (Miltenyi Biotech, CA). The isolation of CD105 positive fraction was confirmed by using flow cytometry and using mouse anti-human CD105PE-labeled antibody (Santa Cruz, CA). The positive fraction was cultured in growth media. The CD105 positive fraction consisted mainly of proliferating adult pancreatic-derived stromal cells.

Example 6

Fluorescence-Activated Cell Sorting (FACS) Analysis

Adhered cells were removed from passage 9-12 plates by five-minute incubation with the TRYPLE™ express solution (Gibco, CA). Released cells were resuspended in DMEM supplemented with 10% FBS and recovered by centrifiαgation, followed by washing and resuspending the cells in a staining buffer consisting of 2% BSA, 0.05% sodium azide (Sigma, MO) in PBS. If appropriate, the cells were Fc-receptor blocked using a 0.1% γ-globulin (Sigma) solution for 15 mins. Aliquots (approximately 105 cells) were incubated with either phycoerythirin (PE) or allophycocyanin (APC) conjugated monoclonal antibodies (5 μl antibody per 106 cells), as indicated in Table H-A, or with an unconjugated primary antibody. Controls included appropriate isotype matched antibodies, non-stained cells, and cells only stained with secondary , conjugated antibody. AU incubations with antibodies were performed for 30 mins at 4°C, after which the cells were washed with the staining buffer. Samples that were stained with unconjugated primary antibodies were incubated for additional 30 mins at 4°C with secondary conjugated PE or -APC labeled antibodies. See Table H-B for a list of secondary antibodies used. Washed cells were pelleted and resuspended in the staining buffer and the cell surface molecules were identified by using a FACS Array (BD Biosciences) by collecting at least 10,000 events.

For intracellular staining, cells were first fixed for 10 mins with 4% paraformaldheyde, followed by two rinses in the staining buffer, centrifugation of cells and resuspension of the cells in a permeabilization buffer containing 0.5% Triton-X (Sigma) in PBS for 5 mins at room temperature (RT). Tlτe permeabilized cells were rinsed twice with a rinsing buffer, centrifuged, and resuspended in the staining buffer and incubated with an appropriate conjugated antibody (5 μl antibody per 106 cells), as indicated in Table JT-C for 30 mins at 4°C. Samples that were stained with unconjugated primary antibodies were incubated for additional 30 mins at 4°C with secondary conjugated PE or -APC labeled antibodies (Table II B). Washed cells were pelleted and resuspended in the staining buffer and the internal proteins were identified by using a FACSArray (BD Biosciences) by collecting at least 10,000 events. The expression level of examined surface and internal markers is listed in Table III and Table IV. Figure 4 depicts a sample FACS profile of passage 9 cells.

Example 7

Immunostaining of Adult Pancreatic-Derived Stromal Cells 10,000 cells/cm2 passage 10 adult pancreatic-derived stromal cells, cultured according to Example 1, were seeded into glass bottom 35 mm microwell dishes (Matek Corp, MA) in growth media. Following three days in culture, the cells were fixed for 10 mins with 4% paraformaldheyde, followed by two rinses in the PBS, and addition of a permeabilization buffer containing 0.5% Triton-X (Sigma) for 5 mins at room temperature (RT) followed by additional three rinses with PBS. The fixed and permeabilized cells were blocked with either 1 % bovine serum albumin (BSA) or 4% sera from the species where the secondary antibody was raised in (Goat, donkey, or rabbit). Primary and secondary antibodies used are listed in Table V A-B. Control samples included reactions with the primary antibody omitted or where the primary antibody was replaced with corresponding immunoglobulins at the same concentration as the primary antibodies. Stained samples were rinsed with a PROLONG® antifade reagent (Invitrogen, CA) containing diamidino-2-phenylindole, dihydrochloride (DAPI) to counter stain the nucleus. Images were acquired using a Nikon Confocal Eclipse C-I inverted microscope (Nikon, Japan) and a 6OX objective. During the expansion phase, a majority of the cells stained positive for smooth-muscle actin, Nestin, vimentin, beta III tubulin, and GAT A4 (Figure 5), a minority of cells (less than 5%) stained positive for GFAP, and none of the cells stained positive for CK 7 or CK 19.

Example 8

PCR Analysis Of Adult Pancreatic-Derived Stromal Cells

RNA was extracted from passage 9 cells cultured in the growth media. RNA collected from human pancreas was used as positive control; and bone marrow derived mesenchymal cells (Cambrex, MD) was used as negative controls for the expression of key genes involved in pancreatic development.

RNA extraction, purification, and cDNA synthesis. RNA samples were purified through its binding to a silica-gel membrane (Rneasy Mini Kit, Qiagen, CA) in the presence of an ethanol-containing, high-salt buffer; while contaminants were washed away. The RNA was further purified while bound to the column by treatment with DNase I (Qiagen, CA) for 15 min. High-quality RNA was then eluted in water. Yield and purity were assessed by A260 and A280 readings on the spectrophotometer. cDNA copies were made from purified RNA using an ABI (ABI, CA) high capacity cDNA archive kit.

Real-time PCR amplification and quantitative analysis. Unless otherwise stated, all reagents were purchased from Applied Biosystems. Real-time PCR reactions were performed using the ABI PRISM® 7000 Sequence Detection System. TAQMAN® UNIVERSAL PCR MASTER MIX® (ABI, CA) was used with 20 ng of reverse transcribed RNA in a total reaction volume of 20 μl. Each cDNA sample was run in duplicate to correct for pipetting errors. Primers and FAM-labeled TAQMAN®probes were used at concentrations of 200 nM. The level of expression of each target gene was normalized using the pre-developed Applied Biosystem's 18S ribosomal RNA or human glyceraldehydes-3-phosphate dehydrogenase (GAPDH) endogenous control kit. Primers and probes were either designed using ABI PRISM PRIMER EXPRESS™ software or used pre-developed ABI gene analysis kit. For each gene, either one of the primers or the probe were designed to be exon-boundary spanning. This eliminated the possibility of the primers/probe binding to any genomic DNA present. The primer and probe sets are listed as following Nkx2.2 (Hs00159616), Pdx-1 (Hs00426216), Nkxβ.l (Hs00232355), Ngn3 (Hs00360700), Pax4 (Hs00173014), Pax6 (Hs00240871), Insulin (Hs00355773), Glu2 (Hs00165775), glucagon (Hs00174967), IsI-I (Hs00158126), somatostatin (Hs00174949), FoxA2 (Hs00232764), HlxB9 (Hs00232128), GATA-4 (Hs00171403), GFAP (Hs00157674), MAP2 (Hs00159041), Olig2 (Hs00377820) and Oct-4 (CGACCATCTGCCGCTTTGAG (SEQ ID NO: 1) and CCCCCTGTCCCCCA TTCCTA (SEQ ID NO: 2)) Rex-1 (CAGATCCTAAACAGCTCGCAGAAT (SEQ ID NO: 3) and GCGTACGCAAATTAAACTCCAGA(SEQ ID NO: 4)). After an initial 500C for 2 min, and 95°C for 10 min, samples were cycled 40 times in two stages - a denaturation step at 95°C for 15 sec followed by an annealing/extension step at 600C for 1 min. Data analysis was carried out using GENEAMP®7000 Sequence Detection System software. For each primer/probe set, a Q value was determined as the cycle number at which the fluorescence intensity reached a specific value in the middle of the exponential region of amplification. Relative gene expression levels were calculated using the comparative Q method. Briefly, for each cDNA sample, the endogenous control Q value was subtracted from the gene of interest Q to give the delta Q value (ΔCt). The normalized amount of target was calculated as 2"ΛCt, assuming amplification to be 100% efficiency. Final data were expressed relative to a calibrator sample. The comparative Q method is only valid if target and endogenous control amplification efficiencies are approximately equal. Preliminary validation experiments were therefore performed for each primer/probe set by amplifying serially diluted cDNA samples and determining the ΔCt values. These ΔQ values remain constant across the range of dilutions if amplification efficiencies are equal.

PCR data obtained from adult pancreatic-derived stromal cells cultured in either DMEM + 2% FBS, or DMEM + 10% FBS, or CMRL + 10% FBS showed that the cells expressed PDX-I, insulin and HNF-3β initially, following isolation. However, the expression of these genes rapidly decreased, such that by passage 9, expression of these genes was undetectable by real-time PCR (Figures 7-19). Expression of these genes remained undetectable for up to passage 30. These data suggest that the adult pancreatic-derived stromal cells isolated as described above remained fully undifferentiated cells while being cultured under growth conditions.

Example 9

Differentiation Protocols

IxIO4 cells/cm2 of passage 13 adult pancreatic-derived stromal cells were seeded in a 24 well plate (Corning, CA) and cultured under standard conditions at 37°C in a 5% CO2 incubator in the growth media until 100% confluent, after which they were cultured for 24 hours in DMEM (lOOOmg/L D-glucose) with 10 μM of MG132 (EMD, CA) for 24 hours. Cells were washed once with PBS and cultured in DMEM (1000 mg/1 D-glucose) supplemented with IX B27 (Gibco, CA) and IX N2 (Gibco, CA) and further supplemented with Cyclopamine (10 μM; EMD, CA), bFGF (20 ng/ml; R&D Systems, MN), Activin A (20 nM; R&D Systems, MN) or FGF5 (20 ng/ml; R&D Systems, MN) for additional 5 days. RNA was collected from cells and analyzed for the expression of PDX-I and insulin by methods outlined in Example 7. These culture conditions induced the expression of PDX-I, but not insulin.

In a separate experiment, adult pancreatic-derived stromal cells from passage 12 and passage 19 from fraction 3 were seeded at 105 cells/well into 6-well tissue culture plates (BD Falcon, NJ) and allowed to reach confluence whereupon 1 or 10 μM of the gamma secretase inhibitor InSolution™ MG-132 (Calbiochem, CA) was added for 1 day. RNA was collected from cells and analyzed for the expression of HNF3β, PDX-I, Nkx6.1 and insulin. The treatment with InSolution™ MG-132 alone did not lead to the expression of key β-cell lineage genes such as HNF3β, PDX-I, Nkxβ.l or insulin. Following InSolution™ MG-132 treatment for 1 day, the cells were treated with 1.25 or 2.5 μM of the histone deacetylase inhibitor Trichostatin A (Sigma, MO) for one day. RNA was collected from cells and analyzed for the expression of HNF3β, PDX- 1, Nkxό.l and insulin. The combination of the two agents resulted in the expression of HNF3β, PDX-I, Nkxβ.l, and insulin (Table VII and Figure 20).

In a separate experiment, adult pancreatic-derived stromal cells from passage 18 from fraction 3 were seeded at 105 cells/well into 6-well tissue culture plates (BD Falcon, NJ) and allowed to reach confluence whereupon 10 μM of the gamma secretase inhibitor [(2R, 4R, 5S)-2-Benzyl-5 (Boc-amino)-4-hydroxy-6-phenyl-hexanoyl]-Leu- Phe-NH2 (Sigma, MO, hereafter referred to as B5306) was added for 1, 3, 7, 10, and 14 days. RNA was collected from cells and analyzed for the expression of HNF3β, PDX-I, Nkxό.l and insulin. The treatment with B5306 alone did not lead to the expression of β-cell lineage genes such as HNF3β, PDX-I, Nkxό.l or insulin. Following B5306 treatment for 1,7, or 14 days the cells were treated with 1.25 or 2.5 μM of the histone deacetylase inhibitor Trichostatin A (Sigma, MO) for one day. RNA was collected from cells and analyzed for the expression of HNF3β, PDX-I, Nkxβ.l and insulin. The combination of the two agents resulted in the expression of HNF3β, PDX-I, Nkxβ.l, but not insulin (Table VIH).

In a separate experiment, adult pancreatic-derived stromal cells from passage 5 were seeded into 6-well tissue culture plates at 105 cells/well and incubated with the induction media listed in Table IX for two weeks with a complete media change twice a week. Following two weeks incubation, RNA was collected from representative wells and analyzed for the expression of pancreatic genes. The cells were found to be positive for glucagon, Nkxβ.l, Pax6, and somatostatin but not insulin, PDX-I, or HNF3β (see Table X - differentiation column). In a parallel experiment, the effects of cell aggregation on pancreatic gene expression were examined. Following the two weeks incubation with the various induction media, the induction media was removed and the adult pancreatic-derived stromal cells were treated with 0.05% trypsin/EDTA (Invitrogen, CA) for two minutes whereupon it was removed. Serum free media consisting of CMRL 1066 (Invitrogen, CA), 1% BSA (Sigma, MO), and ITS (Invitrogen, CA) was then added to each of the remaining wells. The following day the cells had formed islet-like aggregates and RNA was collected and analyzed for the expression of pancreatic genes. The cells were found to be positive for insulin and HNF3β by methods outlined in Example 7 (see Table X - aggregation column).

In a separate experiment, adult pancreatic-derived stromal cells from passage 13 were seeded into 6-well tissue culture plates at 105 cells/well and incubated with the induction media listed in Table IX for two weeks with a complete media change twice a week. Following two weeks incubation, RNA was collected from representative wells and analyzed for the expression of pancreatic genes. The cells were found to be positive for glucagon, Nkx6.1, Pax6, and somatostatin but not insulin, PDX-I, or HNF3 β (see Table X - differentiation column). In a parallel experiment, the effects of cell aggregation on pancreatic gene expression were examined. Following the two weeks incubation with the various induction media, the induction media was removed and the cells were treated with 0.05% trypsin/EDTA (Invitrogen, CA) for two minutes whereupon it was removed. Serum free media consisting of CMRL 1066 (Invitrogen, CA), 1% BSA (Sigma, MO), and ITS (Invitrogen, CA) was then added to each of the remaining wells. The following day the cells had formed islet-like aggregates and RNA was collected and analyzed for the expression of pancreatic genes. The cells were found to be positive for insulin and HNF3β by methods outlined in Example 7 (see Table X- aggregation column). Taken together, these data suggest that the adult pancreatic-derived stomal cells of the present invention are capable of differentiating towards cells of the β-cell lineage..

Example 10

Cryopreservation of Adult Pancreatic-Derived Stromal Cells

Adult-pancreatic-derived stromal cells isolated according to the methods described in Example 1 were collected at the desired passage number and are resuspended in 1 to 2 ml of 90% FBS (HyClone, UT) and 10% DMSO (Sigma, MO) at a concentration of 1 to 5 x 106 cells/ml. The cell suspension was aliquoted into cryogenic vials (Corning, NY) and transferred to a Nalgene Cryo 1°C Freezing Container and placed into a - 8O0C freezer for a minimum of 4 hrs. The vials were removed from -800C and transferred to the vapor phase of a liquid nitrogen storage tank until needed. The cells were thawed by removing the cryogenic vials from the vapor phase of a liquid nitrogen storage tank and transferring them immediately to a 37° water bath and for 1 to 2 minutes or until only a small ice crystal remained. The cells were washed with culture media and placed into 37°C culture as described in the above examples. The cells were then passaged as necessary. The data shown in Figure 21 demonstrated that the cryopreservation had little effect on the expansion potential and growth rate.

Example 11

Effects of Nutrient Deprivation on Adult Pancreatic-Derived Stromal Cell

Growth

Adult pancreatic-derived stromal cells isolated according to the methods described in Example 1 were subjected to different culture conditions and evaluated for the effects of these conditions on subsequent cell growth dynamics. Cells isolated from islet depleted/acinar rich fraction, H8F5 were culture in DMEM, 5.5 mM glucose (Invitrogen, CA), 10% FBS (HyClone, UT), 2mM Glutamax, 25 mM HEPES and IX AB/ AM (Invitrogen, CA). In one culture, the cells were fed with fresh media every 2 to 3 days and by day 8 cells had reached confluence. The cells were passaged once a week thereafter upon reaching confluence in the culture flask. In the second culture, cells were allowed to grow for 7 days prior to media replacement that resulted in lower degree of attachment and expansion as compared to the cells re-fed more frequently. This culture did not reach confluence until 12 days after seeding the flask at which point the cells were passaged. Thereafter, both cells were fed every 2 to 3 days and passaged upon reaching confluence. The cells were counted at each passage and the projected number of cells was calculated from the number of cells originally seeded in the flask and those recovered.

Initially the cells proliferated at the same pace as is seen in Figure 22. However following the first few passages, cells that had been deprived of media replacement in their early culture demonstrated an increase in growth rate as compared to those cells that underwent a complete media change every 2 to 3 days after establishing the culture. As shown in Figure 22, the population doubling time was calculated as 84.2 hrs for this first culture and 58.5 hrs for the cells starved from media for the first 7 days following their establishment in culture. These results suggest that nutrient deprivation is a means to selectively establish adult pancreatic-derived stromal cells with an increased ability to expand as compare to conventional cell culture techniques.

Example 12

Cytogeneic Analysis of a Representative Population of Adult Pancreatic-Derived Stromal Cells of the Present Invention.

Adult pancreatic-derived stromal cells from passage 13 underwent cytogenetic analysis conducted in compliance with Food and Drug Administration Good Laboratory Practice Regulations set forth in Part 58 of Title 21, CFR. The cells were grown in monolayers in T-75 tissue culture flasks with DMEM, 5.5 mM glucose (Invitrogen, CA), 10% FBS (HyClone, UT), 2mM Glutamax, 25 mM HEPES and IX AB/AM (Invitrogen, CA). When cultures were judged to have a suitable amount of mitotic cells, chromosome harvests were performed. The cells were treated with Colcemid (0.02 to 0.03 μg/ml) for 2 to 18 hours at 37°C. Thereafter, the cells were trypsinized, centrifuged for 6 to 7 minutes at 200 x g, and the supernatant removed. The cells were resuspended in warm hypotonic solution at 370C for 10 to 16 minutes and then centrifuged as described above. The cells were then fixed with Carnoy's fixative (3:1 methanol: glacial acetic acid) at room temperature for 36 to 50 minutes and washed with Carnoy's fixative twice, and then resuspended in freshly prepared fixative to produce an opalescent cell suspension. Drops of the final cell suspension were placed on clean slides and air-dried.

Chromosome Count per 100 Metaphases. The distribution of Chromosome numbers found in the 100 metaphases analyzed is shown in Table XII. The chromosome count ranged from 45 to 46 chromosomes per metaphase with a modal chromosome number of 46. Six polyploidy metaphases (0.6%) were recorded per 1000 cells analyzed.

Chromosome Aberration. The chromosome aberration data for the 100 metaphases analyzed are summarized in Table XIII. The cytogeneic data include the total number of cells analyzed for aberrations, the total number of aberrant cells, and the total number of aberrations. No chromosome aberrations were found in the 100 cells analyzed.

G-Banded Chromosome Analysis/Karyotype. Five karyotypes were prepared (Human Karyotype #1 through #5). Cytogeneic analysis shows that the cell line is of human origin (See Figures 23 to 27). Normal autosomes were present in all karyotypes as were the X and Y chromosomes. All unidentifiable chromosomes and rearrangements were classified as unidentifiable chromosomes (UC). Two of the five karyotypes analyzed contained one UC per karyotype.

Example 13

Micro Array Analysis of Adult Pancreatic-Derived Stromal Cells Derived from Fractions 3, 4, and 5 from a Human Pancreas.

Human pancreas H5 line was processed according to methods outlined in Example 1. Cells at passage 6-8 isolated from islet rich fraction (fraction 3), ductal rich fraction (fraction 4), and exocrine rich fraction (fraction 5) were used for gene expression profiling. Total RNA was isolated from human H5 line (fractions 3, 4, and 5) and human pancreas RNA (Ambion) using an RNeasy mini kit (Qiagen). The sample preparation, hybridization, and image analysis was performed according to the CodeLink™ System (GE Healthcare, Amersham Biosciences, NJ). Codelink™ Human Whole Genome arrays were used. It is comprised of approximately 55 000 30- mer probes designed to conserved exons across the transcripts of targeted genes. The chip contains ~45000 unique Unigene IDs. Following normalization and a log transformation, data analysis was performed using OmniViz® software (MA) and GENESIFTER (VizXLabs, WA). The variance stabilizing transformation along with cross sample normalization was applied to the log transformed array dataset. The variability within each cell line and among the different cell lines was compared using the Pearson correlation coefficient. For each cell line, three biological and two technical replicates were used. For all the samples analyzed, the correlation coefficient within a cell line was higher as compared to those between the lines. Variance in gene expression profiles between the different cell types are depicted in Figure 28. Significant differences in gene expression between the cell types was evaluated using analysis of variance and an F-test with adjusted P-value of 4 0.05.

Tables XIV-XVI lists the genes that are differentially expressed at least 5 -fold between the various cell lines.

Example 14

Micro Array Analysis of Adult Pancreatic-Derived Stromal Cells from Two Representative Donor Pancreata.

Two donor human pancreata were processed according to methods outlined in Example 1. Adult pancreatic-derived stromal cells at passage 9-11 isolated from islet rich fraction (fraction 3) were used for gene expression profiling. Total RNA was isolated from cells using an RNeasy mini kit (Qiagen). RNA was purified , cRNA was labeled and fragmented as per the manufacturers protocols (Affymetrix, CA). Labeled cRNA was hybridized to the Ul 33 2.0 plus Affymetrix human gene chips, which was scanned using an Affymetrix GeneChip Analyzer. For each cell line, three biological and two technical replicates were used. Data was analyzed using OmniViz® software (MA) and GENESIFTER (VizXLabs, WA). The average correlation coefficient between the H8 replicates was 0.893 (0.892-0.895, n=3) and was 0.906 (0.903-0.909, n=3) for H9 replicates. Scatter plot comparing gene expression profile of H8F3 vs. H9 F3 cells is depicted in Figure 29. Tables XVII and XVIII list the genes that were assigned the present call by the Affymetrix software.

TABLE L COMPARISON OF THE CELL OF THE PRESENT INVENTION WITH PANCREATIC STEM CELLS OF THE ART.

TABLE II A. ANTIBODIES TO SURFACE RECEPTORS

TABLE II B. LIST OF SECONDARY CONJUGATED ANTIBODIES USED FOR FACS ANALYSIS

TABLE II C. LIST OF ANTIBODIES USED FOR IDENTIFICATION OF INTRACELLULAR MARKERS

TABLE III. EXPRESSION LEVEL OF SURFACE RECEPTORS OF ADULT PANCREATIC-DERΓVED STROMAL CELLS AT PASSAGE IO.

Level of expression was assigned based on the magnitude of the geometric mean of the population as compared to isotype controls. "+" refers to a population which has a geometric mean level of at least 1OX higher than an isotype matched control and "-" refers to a population which has a geometric mean of level within 3X of the isotype matched control.

TABLE IV. EXPRESSION LEVEL OF INTERNAL MARKERS OF ADULT PANCREATIC-DERIVED STROMAL CELLS AT PASSAGE 10.

Level of expression was assigned based on the magnitude of the geometric mean of the population as compared to isotype controls. "+" refers to a population which has a geometric mean level of at least 1OX higher than an isotype matched control and "-" refers to a population which has a geometric mean of level within 3X of the isotype matched control.

TABLE V A. LIST OF ANTIBODIES USED FOR IMUNOFLUORESCENCE STAINING.

TABLE V B. SECONDARY CONJUGATED ANTIBODIES USED FOR IMMUNOSTAINING.

TABLE VL CELL GROWTH CHARACTERISTICS OF ADULT PANCREATIC-DERΓVΈD STROMAL CELL LINES

TABLE VII. GENE EXPRESSION FOLLOWING SEQUENTIAL DIFFERENTIATION OF ADULT PANCREATIC-DERTVED STROMAL CELLS

TSA = trichostatin A, Id = 1 day

H = donor pancreas number, F = Fraction number, P = passage number

TABLE Vm. GENE EXPRESSION FOLLOWING SEQUENTIAL DIFFERENTIATION OF ADULT PANCREATIC-DERIVED STROMAL CELLS

TSA = trichostatin A, Id = 1 day

H = donor pancreas number, F = Fraction number, P = passage number TABLE IX. MEDIA FORMULATIONS FOR ADULT PANCREATIC- DERIVED STROMAL CELL DIFFERENTIATION

DM #1 DMEM HG DM #6 DMEM HG 1 % FBS 1 % FBS

Activin A - 20 ng/mL EGF - 0.3 ug/mL Betacellulin - 10 ng/mL Gastrin - 1.0 ug/mL bFGF - 20 ng/mL GLP-1 R agonist - 50 nM DM #7 DMEM HG Nicotinamide - 10 mM 1% FBS EGF 0.3 ug/mL

DM #2 DMEM - LG Gastrin 1.0 ug/mL 1% FBS GLP-1 R agonist - 50 nM

Activin A - 20 ng/mL Nicotinamide - 10 mM Betacellulin - 10 ng/mL bFGF - 20 ng/mL DM #8 DMEM/F12 GLP-1 R agonist- 50 nM B27 Nicotinamide - 10 mM N2

EGF - 0.3 ug/mL

DM #3 DMEM/F12 Gastrin 1.0 ug/mL N2 Exendin 4 - 20 nM B27 Nicotinamide - 10 mM

Laminin 1 ug/mL bFGF - 20 ng/mL DM #9 DMEM/F12 Nicotinamide 10 mM B27

Exendin 4 - 20 nM

DM #4 DMEM/F12 Nicotinamide - 10 mM B27 bFGF - 20 ng/mL DM #10 CMRL - 1066 EGF - 20 ng/mL 1% BSA ITS-x

DM #5 DMEM/F12 Na Pyruvate B27

GLP-1 R agonist - 50 nM Nicotinamide - 10 mM

TABLE X. PCR RESULTS FROM DIFFERENTIATION OF FRACTION3 PASSAGE 5 ADULT PANCREATIC-DERIVED STROMAL CELLS WITH DIFFERENTIATION MEDIA DM#1 - DM#10.

ND = Not Done

TABLE XL PCR RESULTS FROM DIFFERENTIATION OF FRACTION 3 PASSAGE 13 ADULT PANCREATIC-DERIVED STROMAL CELLS WITH DIFFERENTIATION MEDIA DM#1 - DM#10.

ND = Not Done

TABLE XII: DISTRIBUTION OF CHROMASOME NUMBERS IN THE 100 METAPHASES ANALYZED IN A REPRESENTATIVE ADULT PANCREATIC-DERIVED STROMAL CELL LINE.

TABLE XIII. CHROMASOME ABBERATION DATA FOR A REPRESENTATIVE ADULT PANCREATIC-DERIVED STROMAL CELL LINE.

TABLE XIV: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5-FOLD BETWEEN ADULT PANCREATIC-DERIVED STROMAL CELLS DERIVED FROM THE F3 AND F5 FRACTIONS OF A DONOR HUMAN PANCREAS.

Gene Identifier Gene Name Ratio (F3/F5) Direction adj. p-value NM_033439 Homo sapiens chromosome 9 open reading frame 26 169.79 Up 2.17E-04

(NF-HEV) (C9orf26), mRNA

NM_015973 Homo sapiens galanin (GAL), mRNA 67.54 Up 2.09E-05

NM_005525 Homo sapiens hydroxysteroid (11-beta) 37.62 Up 1.30E-05 dehydrogenase 1 (HSD11B1), transcript variant 1, mRNA

NM_007193 Homo sapiens annexin A10 (ANXA10), mRNA 27.82 Up 1.02E-04

NM_005525 Homo sapiens hydroxysteroid (11-beta) 24.43 Up 1.25E-04 dehydrogenase 1 (HSD11B1), transcript variant 1, mRNA NM_014178 Homo sapiens syntaxin binding protein 6 (amϊsyn) 20 Up 1.81 E-05

(STXBP6), mRNA NM_002422 Homo sapiens matrix metalloproteinase 3 (stromelysin 16.5 Up 4.37E-05

1, progelatinase) (MMP3), mRNA NM_000640 Homo sapiens interleukin 13 receptor, alpha 2 15.93 Up 2.28E-04

(IL13RA2), mRNA NM_018894 Homo sapiens EGF-containing fibulin-like extracellular 14.85 Up 1.25E-04 matrix protein 1 (EFEMP1), transcript variant 2, mRNA NM_000735 Homo sapiens glycoprotein hormones, alpha 14.7 Up 1.81 E-05 polypeptide (CGA), mRNA

NM_000584 Homo sapiens interleukin 8 (IL8), mRNA 13.7 Up 1.97E-03

NM_005807 Homo sapiens proteoglycan 4 (PRG4), mRNA 12.53 Up 6.38E-04

BE904671 601498784F1 NlH_MGC_70 Homo sapiens cDNA 12.38 Up 3.79E-04 clone IMAGE:3900717 5, mRNA sequence NM_001086 Homo sapiens arylacetamide deacetylase (esterase) 11.98 Up 1.01 E-03

(AADAC), mRNA NM_018371 Homo sapiens chondroitin betai ,4 N- 11.9 Up 6.00E-04 acetylgalactosaminyltransferase (ChGn), mRNA NM_053044 Homo sapiens serine protease HTRA3 (HTRA3), 11.09 Up 3.46E-04 mRNA D29453 HUMNK566 Human epidermal keratinocyte Homo 10.25 Up 1.24E-04 sapiens cDNA clone 566, mRNA sequence R41565 yf88eO1.s1 Soares infant brain 1NIB Homo sapiens 10.23 Up 8.47E-05 cDNA clone IMAGE:29531 3, mRNA sequence NM_005127 Homo sapiens C-type (calcium dependent, 10.11 Up 8.47E-05 carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced) (CLECSF2), mRNA NM_002089 Homo sapiens chemokine (C-X-C motif) ligand 2 9.87 Up 6.92E-04

(CXCL2), mRNA NM_012310 Homo sapiens kinesin family member 4A (KIF4A), 9.85 Up 1.10E-03 mRNA AI215024 qg66e11.x1 Soares_testis_NHT Homo sapiens cDNA 9.43 Up 1.48E-04 clone IMAGE:1840172 3, mRNA sequence NM_153256 Homo sapiens chromosome 10 open reading frame 47 9.34 Up 2.44E-04

(C10orf47), mRNA

NM_005951 Homo sapiens metallothionein 1H (MT1H), mRNA 9.09 Up 1.79E-04

NM_006211 Homo sapiens proenkephalin (PENK), mRNA 8.78 Up 1.30E-03

NM_198538 Homo sapiens HLAR698 (UNQ698), mRNA 8.72 Up 3.45E-04

NM_006183 Homo sapiens neurotensin (NTS), mRNA 8.19 Up 3.72E-04

BU536871 AGENCOURTJ 0224340 NIH_MGC_141 Homo 8.16 Up 1.23E-03 sapiens cDNA clone IMAGE:6565454 5, mRNA sequence NM_000693 Homo sapiens aldehyde dehydrogenase 1 family, 7.99 Up 1.56E-03 member A3 (ALDH1A3), mRNA

NM_005950 Homo sapiens metallothionein 1G (MT1G), mRNA 7.89 Up 2.51E-03

NM_145244 Homo sapiens DNA-damage-inducible transcript 4-like 7.8 Up 2.17E-04

(DDIT4L), mRNA BF514016 UI-H-BW1-amv-f-04-0-Ul.s1 NCI_CGAP_Sub7 Homo 7.73 Up 5.09E-05 sapiens cDNA clone IMAGE:3071359 3, mRNA sequence NM_004675 Homo sapiens ras homolog gene family, member I 7.71 Up 2.32E-03

(ARHI), mRNA NM_017805 Homo sapiens Ras interacting protein 1 (RASIP1), 7.66 Up 4.22E-04 mRNA AA662240 nu89cO1.s1 NCI_CGAP_Alv1 Homo sapiens cDNA 7.44Up 2.30E-04 clone IMAGE:1217856, mRNA sequence NM_002426 Homo sapiens matrix metalloproteinase 12 7.41 Up 2.28E-03

(macrophage elastase) (MMP12), mRNA NM_000170 Homo sapiens glycine dehydrogenase 7.35 Up 1.53E-04

(decarboxylating; glycine decarboxylase, glycine cleavage system protein P) (GLDC), mRNA CB160856 K-EST0220612 L18POOL1n1 Homo sapiens cDNA 7.33 Up 2.17E-04 clone L18POOL1n1-33-F125, mRNA sequence NM_032849 Homo sapiens hypothetical protein FLJ 14834 7.07 Up 1.75E-04

(FLJ14834), mRNA BM988338 UI-H-DH0-asd-f-10-0-Ul.s1 NCI_CGAP_DH0 Homo 7.01 Up 4.12E-04 sapiens cDNA clone 1MAGE:5857545 3, mRNA sequence NM_145033 Homo sapiens chromosome 21 open reading frame 6.91 Up 8.47E-05

100 (C21orf100), mRNA NM_033120 Homo sapiens naked cuticle homolog 2 (Drosophila) 6.83 Up 2.17E-04

(NKD2), mRNA NM_080388 Homo sapiens S100 calcium binding protein A16 6.67 Up 2.13E-03

(S100A16), mRNA AA813769 ai69h12.s1 Soares_testis_NHT Homo sapiens cDNA 6.62 Up 1.48E-04 clone 13761353, rriRNA sequence NM_198389 Homo sapiens lung type-l cell membrane-associated 6.55 Up 2.78E-04 glycoprotein (T1A-2), transcript variant 2, mRNA

AK024865 Homo sapiens cDNA: FLJ21212 fis, clone COL00502 6.54 Up 2.34E-04

AW294090 UI-H-BI2-ahg-b-12-0-Ul.s1 NCI_CGAP_Sub4 Homo 6.53 Up 2.19E-04 sapiens cDNA clone IMAGE:27267343, mRNA sequence AA553336 nk61e11.s1 NCI_CGAP_Sch1 Homo sapiens cDNA 6.46 Up 9.15E-04 clone IMAGE:1018028 3, mRNA sequence NM_006273 Homo sapiens chemokine (C-C motif) ligand 7 (CCL7), 6.45 Up 3.45E-04 mRNA BG206063 RST25498 Athersys RAGE Library Homo sapiens 6.41 Up 2.09E-05 cDNA, mRNA sequence NM_022154 Homo sapiens solute carrier family 39 (zinc 6.28 Up 1.02E-03 transporter), member 8 (SLC39A8), mRNA NM_002245 Homo sapiens potassium channel, subfamily K, 6.24 Up 3.68E-04 member 1 (KCNK1), mRNA NM_022833 Homo sapiens chromosome 9 open reading frame 88 6.24 Up 3.27E-04

(C9orf88), mRNA NM_017779 Homo sapiens DEP domain containing 1 (DEPDC1), 6.04 Up 2.26E-03 mRNA NM_012320 Homo sapiens lysophospholipase 3 (lysosomal 5.98 Up 3.46E-04 phospholipase A2) (LYPLA3), mRNA BM977193 UI-CF-DU1-ads-h-16-0-Ul.s1 UI-CF-DU1 Homo 5.97 Up 3.45E-04 sapiens cDNA clone UI-CF-DU1-ads-h-16-0-UI 3, mRNA sequence NM_001928 Homo sapiens D component of complement (adipsin) 5.89 Up 9.04E-04

(DF), mRNA

NM_014736 Homo sapiens KIAA0101 (KIAA0101), mRNA 5.84 Up 1.25E-04

NM_002497 Homo sapiens NIMA (never in mitosis gene a)-related 5.81 Up 2.17E-04 kinase 2 (NEK2), mRNA NM_022809 Homo sapiens cell division cycle 25C (CDC25C), 5.81 Up 4.37E-05 transcript variant 2, mRNA NM_138484 Homo sapiens shugoshin-like 1 (S. pombe) (SGOL1 ), 5.8 Up 1.24E-04 mRNA NM_003975 Homo sapiens SH2 domain protein 2A (SH2D2A), 5.68 Up 2.46E-04 mRNA NM_020675 Homo sapiens kinetochore protein Spc25 (Spc25), 5.68 Up 1.26E-04 mRNA NM_001657 Homo sapiens amphiregulin (schwannoma-derived 5.62 Up 2.30E-04 growth factor) (AREG), mRNA NM_145697 Homo sapiens cell division cycle associated 1 5.59 Up 3.75E-04

(CDCA1), transcript variant 1, mRNA

NM_005213 Homo sapiens cystatin A (stefin A) (CSTA), mRNA 5.51 Up 1.02E-04

AW968578 EST380654 MAGE resequences, MAGJ Homo sapiens 5.43 Up 1.68E-04 cDNA, mRNA sequence NM_002922 Homo sapiens regulator of G-protein signalling 1 5.38 Up 7.97E-04

(RGS 1), mRNA BC044933 Homo sapiens, clone IMAGE:4540326, mRNA, partial 5.37 Up 4.22E-04 cds AA043255 zk49fO7.s1 Soares_pregnant_uterus_NbHPU Homo 5.31 Up 8.47E-05 sapiens cDNA clone 1MAGE:486181 3, mRNA sequence NM_199414 Homo sapiens protein regulator of cytokinesis 1 5.29 Up 2.09E-05

(PRC1), transcript variant 3, mRNA AK093618 Homo sapiens cDNA FLJ36299 fis, clone 5.26 Up 5.30E-04

THYMU2004356 NM_152759 Homo sapiens hypothetical protein MGC35140 5.23 Up 1.75E-04

(MGC35140), mRNA NM_006438 Homo sapiens collectin sub-family member 10 (C-type 5.22 Up 3.45E-04 lectin) (COLEC10), mRNA CA310410 Ul-H-FE1-bei-b-08-0-Ul.s2 NCI_CGAP_FE1 Homo 5.2 Up 8.47E-05 sapiens cDNA clone UI-H-FE1-bei-b-08-0-UI 3, mRNA sequence

NM_020242 Homo sapiens kinesin-like 7 (KNSL7), mRNA 5.18 Up 1.68E-04

AB058769 Homo sapiens mRNA for KIAA1866 protein, partial cds 5.18 Up 4.64E-04

AI807813 wf50h08.x1 Soares_NFL_T_GBC_S1 Homo sapiens 5.17 Up 2.72E-04 cDNA clone IMAGE:2359071 3, mRNA sequence NMJD18944 Homo sapiens chromosome 21 open reading frame 45 5.17 Up 3.46E-04

(C21orf45), mRNA NM_018136 Homo sapiens asp (abnormal spindle)-like, 5.16 Up 3.48E-04 microcephaly associated (Drosophila) (ASPM), mRNA NM_001353 Homo sapiens aldo-keto reductase family 1 , member 5.1 Up 8.62E-05

C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)- hydroxysteroid dehydrogenase) (AKR1C1), mRNA NM_001809 Homo sapiens centromere protein A, 17kDa (CENPA), 5.02 Up 4.44E-04 mRNA NM_002009 Homo sapiens fibroblast growth factor 7 (keratinocyte 5Up 2.32E-03 growth factor) (FGF7), mRNA NM_002474 Homo sapiens myosin, heavy polypeptide 11 , smooth 18.05 Down 1.02E-04 muscle (MYH11 ), transcript variant SM1 , mRNA BG571477 602592765F1 NIH_MGC_79 Homo sapiens cDNA 13.35 Down 4.10E-03 clone IMAGE:47200255, mRNA sequence NM_206927 Homo sapiens synaptotagmin-like 2 (SYTL2), transcript 9.94 Down 3.13E-03 variant c, mRNA NM_014476 Homo sapiens PDZ and LIM domain 3 (PDLIM3), 9.51 Down 2.32E-03 mRNA AK124751 Homo sapiens cDNA FLJ42761 fis, clone 9.09 Down 5.54E-04

BRAWH3002574, highly similar to Calpain 2, large

[catalytic] subunit precursor (EC 3.4.22.17)

AF269162 Homo sapiens c21 orf7 form B mRNA, complete cds 7.75 Down 1.03E-02

NM_003617 Homo sapiens regulator of G-protein signalling 5 7.59 Down 6.56E-03

(RGS5), mRNA NM_139211 Homo sapiens homeodomain-only protein (HOP), 7.55 Down 2.34E-04 transcript variant 2, mRNA NM_015234 Homo sapiens G protein-coupled receptor 116 7.47 Down 1.97E-03 (GPR116), mRNA NM_012278 Homo sapiens integrin beta 1 binding protein (melusin) 7.05 Down 1.09E-03

2 (ITGB1 BP2), mRNA AL713608 DKFZp686O179_r1 686 (synonym: hlcc3) Homo 7.03 Down 6.29E-03 sapiens cDNA clone DKFZp686O179 5, mRNA sequence BQ439091 AGENCOURT_7761579 NIH_MGC_70 Homo sapiens 6.92 Down 3.27E-04 cDNA clone IMAGE:6020085 5, mRNA sequence BX640908 Homo sapiens mRNA; cDNA DKFZp686J18113 (from 6.87 Down 1.03E-03 clone DKFZp686Ji8113) NM_024586 Homo sapiens oxysterol binding protein-like 9 6.69 Down 1.30E-02

(0SBPL9), transcript variant 6, mRNA NM_012137 Homo sapiens dimethylarginine 6.22 Down 1.36E-02 dimethylaminohydrolase 1 (DDAH1), mRNA BX119527 BX119527 Soares_fetal_liver_spleen_1NFLS_S1 5.99 Down 1.94E-03

Homo sapiens cDNA clone IMAGp998O214529 ;

IMAGE:1851116, mRNA sequence NM_021154 Homo sapiens phosphoserine aminotransferase 1 5.83 Down 2.32E-02

(PSAT1), transcript variant 2, mRNA NM_003617 Homo sapiens regulator of G-protein signalling 5 5.68 Down 4.22E-04

(RGS5), mRNA H08012 yl91bO8.r1 Soares infant brain 1NlB Homo sapiens 5.54 Down 1.03E-03 cDNA clone IMAGE:45474 5, mRNA sequence AA608841 af83gO4.s1 Soares_testis_NHT Homo sapiens cDNA 5.39 Down 8.01E-03 clone I MAG E: 1048662 3, mRNA sequence NM_016203 Homo sapiens protein kinase, AMP-activated, gamma 5.38 Down 5.05E-03

2 non-catalytic subunit (PRKAG2), mRNA BE697175 RC1-CT0414-260700-011-aO3 CT0414 Homo sapiens 5.37 Down 1.89E-03 cDNA, mRNA sequence NM_014799 Homo sapiens hephaestin (HEPH), transcript variant 2, 5.36 Down 1.11E-02 mRNA

NM_021229 Homo sapiens netrin 4 (NTN4), mRNA 5.35 Down 4.06E-02

AA844712 ai70e12.s1 Soares_testis_NHT Homo sapiens cDNA 5.35 Down 3.21E-03 clone 1MAGE:13762O6 3, mRNA sequence

NM_006587 Homo sapiens conn, serine protease (CORIN), mRNA 5.11 Down 7.77E-03

NM_021098 Homo sapiens calcium channel, voltage-dependent, 5.06 Down 2.80E-02 alpha 1H subunit (CACNA1H), transcript variant 1, mRNA

TABLE XV : GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5-FOLD BETWEEN ADULT PANCREATIC-DERIVED STROMAL CELLS DERIVED FROM THE F4 AND F5 FRACTIONS A SINGLE DONOR HUMAN PANCREAS.

Gene Identifier Gene Name Ratio (F5/F4) Direction adj. p-value

NM_033439 Homo sapiens chromosome 9 open 50.81 Up 2.11E-06 reading frame 26 (NF-HEV) (C9orf26), mRNA

NM_015973 Homo sapiens galanin (GAL), mRNA 19.55 Up 4.25E-05

NM_007193 Homo sapiens annexin A10 (ANXA10), 19.55 Up 2.77E-05 mRNA

NM_005525 Homo sapiens hydroxysteroid (11-beta) 15.43 Up 1.78E-05 dehydrogenase 1 (HSD11B1), transcript variant 1, mRNA

NM_005525 Homo sapiens hydroxysteroid (11-beta) 12.49 Up 4.38E-05 dehydrogenase 1 (HSD11B1), transcript variant 1, mRNA

NM_000170 Homo sapiens glycine dehydrogenase 10.23 Up 2.77E-05

(decarboxylating; glycine decarboxylase, glycine cleavage system protein P)

(GLDC), mRNA

NM_018371 Homo sapiens chondroitin beta1,4 N- 9.72 Up 1.57E-04 acetylgalactosaminyltransfera se (ChGn), mRNA

NMJ02422 Homo sapiens matrix metalloproteinase 3 9.43 Up 1.78E-05

(stromelysin 1, progelatinase) (MMP3), mRNA

NM_145033 Homo sapiens chromosome 21 open 8.73 Up 4.25E-05 reading frame 100 (C21orf100), mRNA

BF514016 UI-H-BW1-amv-f-04-0-Ul.s1 8.16 Up 5.53E-05

NCI_CGAP_Sub7 Homo sapiens cDNA clone IMAGE:30713593, mRNA sequence

NM_005382 Homo sapiens neurofilament 3 (15OkDa 8.15 Up 1.83E-04 medium) (NEF3), mRNA

NMJ300735 Homo sapiens glycoprotein hormones, 7.8 Up 5.48E-04 alpha polypeptide (CGA), mRNA

NM_021992 Homo sapiens thymosin, beta, identified 7.79 Up 6.74E-04 in neuroblastoma cells (TMSNB), mRNA

NM_001523 Homo sapiens hyaluronan synthase 1 7.34 Up 2.68E-06

(HAS1), mRNA

NM_145697 Homo sapiens cell division cycle 7.22 Up 2.74E-04 associated 1 (CDCA1), transcript variant 1, mRNA BQ267806 ij94eO4.x1 Human insulinoma Homo 7.2 Up 2.57E-04 sapiens cDNA clone IMAGE:57792783, mRNA sequence NM_001255 Homo sapiens CDC20 cell division cycle 7.2 Up 4.28E-04

20 homolog (S. cerevisiae) (CDC20), mRNA NM_017413 Homo sapiens apelin, AGTRL1 ligand 7.06 Up 5.94E-05

(APLN), mRNA NM_005252 Homo sapiens v-fos FBJ murine 6.96 Up 1.12E-02 osteosarcoma viral oncogene homolog

(FOS), mRNA CB160856 K-EST0220612 L18POOL1n1 Homo 6.83 Up 6.45E-05 sapiens cDNA clone L18POOL1n1-33-

F12 5, mRNA sequence NM_002497 Homo sapiens NIMA (never in mitosis 6.75 Up 4.25E-05 gene a)-related kinase 2 (NEK2), mRNA NM_012310 Homo sapiens kinesin family member 4A 6.75 Up 3.90E-03

(KIF4A), mRNA NM_020675 Homo sapiens kinetochore protein Spc25 6.72 Up 4.25E-05

(Spc25), mRNA NM_005192 Homo sapiens cyclin-dependent kinase 6.56 Up 1.11E-04 inhibitor 3 (CDK2-associated dual specificity phosphatase) (CDKN3), mRNA NM_006211 Homo sapiens proenkephalin (PENK), 6.56 Up 3.63E-04 mRNA NM_022809 Homo sapiens cell division cycle 25C 6.43 Up 1.78E-05

(CDC25C), transcript variant 2, mRNA NM_152694 Homo sapiens zinc finger, CCHC domain 6.43 Up 2.78E-04 containing 5 (ZCCHC5), mRNA NM_001657 Homo sapiens amphiregulin 6.41 Up 9.94E-05

(schwannoma-derived growth factor)

(AREG), mRNA NlVM 38484 Homo sapiens shugoshin-like 1 (S. 6.41 Up 1.72E-04 pombe) (SG0L1), mRNA NM_001809 Homo sapiens centromere protein A, 6.36 Up 6.90E-05

17kDa (CENPA), mRNA NMJD02421 Homo sapiens matrix metalloproteinase 1 6.36 Up 3.50E-03

(interstitial collagenase) (MMP1), mRNA NM_024053 Homo sapiens chromosome 22 open 6.3 Up 9.40E-04 reading frame 18 (C22orf18), transcript variant 1, mRNA NM_181803 Homo sapiens ubiquitin-conjugating 6.11 Up 4.76E-04 enzyme E2C (UBE2C), transcript variant

6, mRNA NMJD18304 Homo sapiens hypothetical protein 6.09 Up 9.77E-04

FU11029 (FLJ11029), mRNA NM_006681 Homo sapiens neuromedin U (NMU), 6.07 Up 1.57E-04 mRNA NM_012484 Homo sapiens hyaluronan-mediated 6.03 Up 2.77E-05 motility receptor (RHAMM) (HMMR), transcript variant 1, mRNA BQ053282 AGENCOURT_6821603 NIH_MGC_106 6 Up 6.90E-05

Homo sapiens cDNA clone

IMAGE:59349395, mRNA sequence NM_014736 Homo sapiens KIAA0101 (KIAA0101), 5.98 Up 2.72E-04 mRNA

NM_006607 Homo sapiens pituitary tumor- 5.95 Up 3.46E-05 transforming 2 (PTTG2), mRNA AI215024 qg66e11.x1 Soares_testis_NHT Homo 5.95 Up 1.51E-04 sapiens cDNA clone IMAGE:18401723, mRNA sequence

NM_032117 Homo sapiens GAJ protein (GAJ), mRNA 5.89 Up 4.58E-05

NM_002658 Homo sapiens plasminogen activator, 5.86 Up 4.25E-05 urokinase (PLAU), mRNA BC069212 Homo sapiens cDNA clone 5.83 Up 2.77E-05

IMAGE:4871934, partial cds NM_017779 Homo sapiens DEP domain containing 1 5.79 Up 4.26E-03

(DEPDC1), mRNA NM_007280 Homo sapiens Opa-interacting protein 5 5.78 Up 2.77E-05

(OIP5), mRNA NM_001786 Homo sapiens cell division cycle 2, G1 to 5.74 Up 5.06E-05

S and G2 to M (CDC2), transcript variant

1, mRNA NM_018492 Homo sapiens T-LAK cell-originated 5.7Up 6.90E-05 protein kinase (TOPK), mRNA NM_018454 Homo sapiens nucleolar and spindle 5.7 Up 1.24E-03 associated protein 1 (NUSAP1), mRNA NM_004701 Homo sapiens cyclin B2 (CCNB2), mRNA 5.68 Up 2.41E-04

NM_003155 Homo sapiens stanniocalcin 1 (STC1), 5.66 Up 6.59E-04 mRNA NM_014750 Homo sapiens discs, large homolog 7 5.62 Up 4.17E-04

(Drosophila) (DLG7), mRNA NM_006461 Homo sapiens sperm associated antigen 5.58 Up 5.17E-05

5 (SPAG5), mRNA NM_018136 Homo sapiens asp (abnormal spindle)- 5.54 Up 3.76E-04 like, microcephaly associated

(Drosophila) (ASPM), mRNA NM_004217 Homo sapiens aurora kinase B (AURKB), 5.48 Up 2.37E-04 mRNA NM_016195 Homo sapiens M-phase phosphoprotein 5.46 Up 1.54E-03

1 (MPHOSPH1), mRNA BC044933 Homo sapiens, clone IMAGE:4540326, 5.46 Up 2.16E-04 mRNA, partial cds NM_001353 Homo sapiens aldo-keto reductase family 5.46 Up 4.58E-05

1 , member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)- hydroxysteroid dehydrogenase)

(AKR1C1), rtiRNA NM_145061 Homo sapiens chromosome 13 open 5.41 Up 1.05E-04 reading frame 3 (C13orf3), mRNA AF131784 Homo sapiens clone 25194 mRNA 5.41 Up 2.51E-04 sequence NM_152515 Homo sapiens hypothetical protein 5.36 Up 4.28E-04

FLJ40629 (FLJ40629), mRNA NM_021000 Homo sapiens pituitary tumor- 5.34 Up 3.12E-04 transforming 3 (PTTG3), mRNA NM_003318 Homo sapiens TTK protein kinase (TTK), 5.34 Up 2.64E-04 mRNA NM_003259 Homo sapiens intercellular adhesion 5.33 Up 8.55E-04 molecule 5, telencephalin (ICAM5), mRNA NM_199414 Homo sapiens protein regulator of 5.32 Up 2.24E-05 cytokinesis 1 (PRC1 ), transcript variant 3, mRNA NM_006845 Homo sapiens kinesin family member 2C 5.28 Up 2.09E-04

(KIF2C), mRNA NM_032849 Homo sapiens hypothetical protein 5.28 Up 3.44E-04

FLJ14834 (FLJ14834), mRNA NM_006101 Homo sapiens kinetochore associated 2 5.25 Up 1.22E-04

(KNTC2), mRNA AA662240 nu89cO1.s1 NCI_CGAP_Alv1 Homo 5.24 Up 7.33E-04 sapiens cDNA clone 1MAGE:1217856, mRNA sequence NMJD01826 Homo sapiens CDC28 protein kinase 5.21 Up 2.51E-04 regulatory subunit 1B (CKS 1B), mRNA NM_024745 Homo sapiens SHC SH2-domain binding 5.16 Up 4.90E-04 protein 1 (SHCBP1), mRNA NM_016426 Homo sapiens G-2 and S-phase 5.16 Up 4.20E-03 expressed 1 (GTSE1), mRNA NM_001813 Homo sapiens centromere protein E, 5.15 Up 3.41E-06

312kDa (CENPE), mRNA

NM_031966 Homo sapiens cyclin B1 (CCNB1), mRNA 5.13 Up 4.25E-05

BE735115 601566084F1 NIH_MGC_21 Homo 5.05 Up 2.74E-04 sapiens cDNA clone lMAGE:38408375, mRNA sequence BG939678 cr60d11.x1 Human bone marrow stromal 5 Up 1.62E-03 cells Homo sapiens cDNA clone

HBMSC_cr60d11 3, mRNA sequence NM_002474 Homo sapiens myosin, heavy polypeptide 95.15 Down 2.77E-05

11, smooth muscle (MYH11), transcript variant SM1, mRNA BG571477 602592765F1 NIH_MGC_79 Homo 13.02 Down 6.90E-04 sapiens cDNA clone IMAGE:47200255, mRNA sequence

NM_002986 Homo sapiens chemokine (C-C motif) 12.42 Down 3.33E-04

Iigand 11 (CCL11), mRNA

AL713608 DKFZp686O179_r1 686 (synonym: hlcc3) 11.81 Down 4.28E-04

Homo sapiens cDNA clone

DKFZp686O179 5, mRNA sequence

NM_153267 Homo sapiens MAM domain containing 2 10.38 Down 3.46E-05

(MAMDC2), mRNA

W92068 zh48gO3.r1 9.47 Down 2.37E-04

Soares_fetal_liver_spleen_1NFLS_S1

Homo sapiens cDNA clone

IMAGE:415348 5, mRNA sequence

NM_017680 Homo sapiens asporin (LRR class 1) 8.99 Down 4.58E-05

(ASPN), mRNA

AA608841 af83gO4.s1 Soares_testis_NHT Homo 8.59 Down 4.37E-04 sapiens cDNA clone IMAGE:1048662 3, mRNA sequence

AL134451 DKFZp547J015_r1 547 (synonym: hfbri) 8.53 Down 2.51 E-04

Homo sapiens cDNA clone

DKFZp547J0155, mRNA sequence

NM_006774 Homo sapiens indolethylamine N- 8.49 Down 1.07E-04 methyltransferase (INMT), mRNA

NM_006774 Homo sapiens indolethylamine N- 8.35 Down 2.51 E-04 methyltransferase (INMT), mRNA

AK124751 Homo sapiens cDNA FLJ42761 fis, clone 8.22 Down 9.94E-05

BRAWH3002574, highly similar to

Calpain 2, large [catalytic] subunit precursor (EC 3.4.22.17)

NM_001001430 Homo sapiens troponin T2, cardiac 8.1 Down 4.25E-05

(TNNT2), transcript variant 2, mRNA

BX119527 BX119527 7.44 Down 2.88E-04

Soares_fetal_liver_spleeη_1NFLS_S1

Homo sapiens cDNA clone

IMAGp998O214529 ; IMAGE:1851116, mRNA sequence

BF940114 nac68cO6.x1 NCI_CGAP_Brn23 Homo 7.4 Down 6.95E-04 sapiens cDNA clone IMAGE:3439475 3, mRNA sequence

AI221408 qg92cO1.x1 Soares_NFL_T_GBC_S1 7.03 Down 6.90E-04

Homo sapiens cDNA clone

IMAGE:18426243, mRNA sequence

NM_012278 Homo sapiens integrin beta 1 binding 6.89 Down 3.76E-04 protein (melusin) 2 (ITGB1BP2), mRNA

NM_025202 Homo sapiens EF hand domain 6.87 Down 4.71 E-05 containing 1 (EFHD1), mRNA

NM_000961 Homo sapiens prostaglandin I2 6.87 Down 3.96E-04

(prostacyclin) synthase (PTGIS), mRNA

D29134 HUMNK158 Human epidermal 6.86 Down 4.28E-04 keratinocyte Homo sapiens cDNA clone

158, mRNA sequence

BX107738 BX107738 Soares_testis_NHT Homo 6.71 Down 1.65E-04 sapiens cDNA clone IMAGp998F181825

; IMAGE:743057, mRNA sequence

NM_006587 Homo sapiens corin, serine protease 6.64 Down 9.90E-04

(CORIN), mRNA

AF070632 Homo sapiens clone 24405 mRNA 6.47 Down 9.94E-05 sequence

NM_032762 Homo sapiens hypothetical protein 6.44 Down 6.95E-04

MGC16121 (MGC16121), mRNA

NM_002587 Homo sapiens protocadherin 1 (cadherin- 6.39 Down 2.77E-05 like 1) (PCDH1), transcript variant 1, mRNA

AV700621 AV700621 GKC Homo sapiens cDNA 6.33 Down 2.84E-03 clone GKCDKF093, mRNA sequence

R67051 yi30b07.s1 Soares placenta Nb2HP 6.29 Down 6.14E-04

Homo sapiens cDNA clone

IMAGE:140725 3, mRNA sequence

NM_052890 Homo sapiens peptidoglycan recognition 6.21 Down 6.86E-05 protein 2 (PGLYRP2), mRNA

AF220263 Homo sapiens MOST2 mRNA, complete 6.18 Down 1.68E-04 cds

NM_014476 Homo sapiens PDZ and LIM domain 3 6.04 Down 4.17E-04

(PDLIM3), mRNA

NM_000095 Homo sapiens cartilage oligomeric matrix 5.96 Down 4.11E-03 protein (COMP), mRNA

AI954275 wx95cO9.x1 NCI_CGAP_Mel15 Homo 5.95 Down 1.15E-03 sapiens cDNA clone IMAGE:2551408 3, mRNA sequence

NM_005202 Homo sapiens collagen, type VIlI, alpha 2 5.76 Down 2.77E-05

(COL8A2), mRNA

BX649033 Homo sapiens mRNA; cDNA 5.73 Down 3.96E-04

DKFZp686K1098 (from clone

DKFZp686K1098)

AI392805 tgO4hO3.x1 NCI_CGAP_CLL1 Homo 5.63 Down 3.84E-04 sapiens cDNA clone IMAGE:21078293, mRNA sequence

NM_002217 Homo sapiens inter-alpha (globulin) 5.54 Down 4.28E-04 inhibitor H3 (ITIH3), mRNA

CA773752 im56fO3.y1 HR85 islet Homo sapiens 5.48 Down 1.62E-03 cDNA clone IMAGE:6039292 5, mRNA sequence

NM_003725 Homo sapiens 3-hydroxysteroid 5.45 Down 3.96E-04 epimerase (RODH), mRNA

T71557 yd36bO8.s1 Soares fetal liver spleen 5.39 Down 4.17E-04

1 NFLS Homo sapiens cDNA clone

IMAGE:110295 3, mRNA sequence AW297946 UI-H-BW0-ajn-d-08-0-Ul.s1 5.39 Down 2.50E-03

NCI_CGAP_Sub6 Homo sapiens cDNA clone IMAGE:2732223 3, mRNA sequence AK025101 Homo sapiens cDNA: FLJ21448 fis, clone 5.38 Down 2.87E-03

COL04473 NM_005725 Homo sapiens tetraspan 2 (TSPAN-2), 5.37 Down 1.24E-03 mRNA AW136248 UI-H-BI1-act-e-05-0-Ul.s1 5.37 Down 1.11E-03

NCI_CGAP_Sub3 Homo sapiens cDNA clone IMAGE:2715369 3, mRNA sequence NM_001854 Homo sapiens collagen, type Xl, alpha 1 5.35 Down 4.42E-04

(COL11 A1 ), transcript variant A, mRNA AW075298 xa92cO6.x1 NCI_CGAP_Co17 Homo 5.33 Down 6.95E-04 sapiens cDNA clone IMAGE:2574250 3, mRNA sequence AA9Q3192 ok48d01.s1 NCI_CGAP_Lei2 Homo 5.29 Down 2.97E-03 sapiens cDNA clone IMAGE:15171853, mRNA sequence AV700217 AV700217 GKC Homo sapiens cDNA 5.26 Down 2.31E-03 clone GKCDNE03 3, mRNA sequence AA633962 ac73hO1 ,s1 Stratagene lung (#937210) 5.26 Down 9.43E-04

Homo sapiens cDNA clone

1MAGE:868273 3 similar to gb:M57627

INTERLEUKIN-10 PRECURSOR

(HUMAN);contains element MER16 repetitive element ;, mRNA sequence BQ439091 AGENCOURT_7761579 NIH_MGC_70 5.26 Down 3.33E-04

Homo sapiens cDNA clone

IMAGE:6020085 5, mRNA sequence H41942 yo60a08.r1 Soares breast 3NbHBst 5.25 Down 9.94E-05

Homo sapiens cDNA clone

1MAGE:1822945 similar to contains AIu repetitive element;contains LTR9 repetitive element ;, mRNA sequence AK021531 Homo sapiens cDNA FLJ11469 fis, clone 5.2 Down 1.04E-03

HEMBA1001658 AA558704 nl42cO3.s1 NCI_CGAP_Pr4 Homo 5.19 Down 2.31 E-03 sapiens cDNA clone IMAGE:1043332, mRNA sequence AA846538 aj56f12.s1 Soares_testis_NHT Homo 5.19 Down 4.16E-04 sapiens cDNA clone IMAGE:1394351 3, mRNA sequence AI766299 wh71c10.x1 NCI_CGAP_Kid11 Homo 5.14 Down 4.48E-04 sapiens cDNA clone IMAGE:2386194 3, mRNA sequence BE173027 MR0-HT0559-200400-015-e07_1 5.11 Down 1.04E-03 HT0559 Homo sapiens cDNA, mRNA sequence BE697175 RC1-CT0414-260700-011-a03 CT0414 5.1 Down 4.42E-04

Homo sapiens cDNA, mRNA sequence AI805522 tx86bO2.x1 NCI_CGAP_Ut4 Homo 5.08 Down 1.50E-03 sapiens cDNA clone IMAGE:2276427 3, mRNA sequence NM_003287 Homo sapiens tumor protein D52-like 1 5.06 Down 5.00E-04

(TPD52L1), transcript variant 1, mRNA CA948483 iq27cO9.x1 HR85 islet Homo sapiens 5.05 Down 1.38E-03 cDNA clone IMAGE: 3, mRNA sequence

TABLE XVT: GENES THAT WERE DIFFERENTIALLY EXPRESSED AT LEAST 5-FOLD BETWEEN ADULT PANCREATIC-DERTVED STROMAL CELLS DERIVED FROM THE F4 AND F3 FRACTIONS OF A SINGLE DONOR HUMAN PANCREAS.

Gene Identifier Gene Name Ratio (F4/F3) Direction adj. p-value

NM_000961 Homo sapiens prostaglandin I2 19.44 Up 7.06E-05

(prostacyclin) synthase (PTGIS), mRNA

NM_198389 Homo sapiens lung type-l cell membrane- 12.97 Up 1.01E-04 associated glycoprotein (T1A-2), transcript variant 2, mRNA

NM_018894 Homo sapiens EGF-containing fibulin-like 10.65 Up 7.32E-04 extracellular matrix protein 1 (EFEMP1), transcript variant 2, mRNA

NM_014178 Homo sapiens syntaxin binding protein 6 10.23 Up 5.37E-05

(amisyn) (STXBP6), mRNA

BE904671 601498784F1 NIH_MGC_70 Homo 8.72 Up 6.44E-04 sapiens cDNA clone IMAGE:39007175, mRNA sequence

NM_003014 Homo sapiens secreted frizzled-related 8.64 Up 3.28E-04 protein 4 (SFRP4), mRNA

NM_001998 Homo sapiens fibulin 2 (FBLN2), transcript 8.1 Up 7.69E-03 variant 2, mRNA

R41565 yf88eO1.s1 Soares infant brain 1 NIB 7.68 Up 8.31 E-05

Homo sapiens cDNA clone IMAGE:29531

3, mRNA sequence

NM_153256 Homo sapiens chromosome 10 open 7.16 Up 5.46E-04 reading frame 47 (C10orf47), mRNA

AF010236 Homo sapiens mRNA from chromosome 7.12 Up 3.72E-04

5q31-33 region

AB058769 Homo sapiens mRNA for KIAA1866 7.04 Up 2.63E-04 protein, partial cds

NM_021012 Homo sapiens potassium inwardly- 7.02 Up 1.09E-03 rectifying channel, subfamily J, member

12 (KCNJ12), mRNA

D29453 HUMNK566 Human epidermal 7.02 Up 1.53E-04 keratinocyte Homo sapiens cDNA clone

566, mRNA sequence

BX648964 Homo sapiens mRNA; cDNA 6.86 Up 8.31 E-05

DKFZp686J0156 (from clone

DKFZp686J0156)

NM_017805 Homo sapiens Ras interacting protein 1 6.56 Up 6.43E-04

(RAS1P1), mRNA

CA428652 UI-H-FH1-bfe-k-11-0-Ul.s1 6.41 Up 1.01E-04 NCI_CGAP_FH1 Homo sapiens cDNA clone UI-H-FH1-bfe-k-11-0-UI 3, mRNA sequence

NM_005213 Homo sapiens cystatin A (stefin A) 6.24 Up 3.33E-05

(CSTA), mRNA

NM_005127 Homo sapiens C-type (calcium 6.17 Up 1.10E-04 dependent, carbohydrate-recognition domain) lectin, superfamily member 2

(activation-induced) (CLECSF2), mRNA

NM_006183 Homo sapiens neurotensin (NTS), mRNA 5.98 Up 7.13E-04

AB011538 Homo sapiens mRNA for MEGF5, partial 5.93 Up 9.44E-05 cds

AA813769 ai69h12.s1 Soares_testis_NHT Homo 5.78 Up 1.10E-04 sapiens cDNA clone 13761353, mRNA sequence

NM_001276 Homo sapiens chitinase 3-like 1 (cartilage 5.52 Up 3.33E-05 glycoprotein-39) (CHI3L1), mRNA

AF070632 Homo sapiens clone 24405 mRNA 5.47 Up 7.80E-05 sequence

NM_005807 Homo sapiens proteoglycan 4 (PRG4), 5.34 Up 3.05E-03 mRNA

NM_002474 Homo sapiens myosin, heavy polypeptide 5.27 Up 1.01E-04

11, smooth muscle (MYH11), transcript variant SM1, mRNA

BQ435580 AGENCOURT_7836890 NIH_MGC_82 5.24 Up 8.31 E-05

Homo sapiens cDNA clone

IMAGE:6102371 5, mRNA sequence

NM_000104 Homo sapiens cytochrome P450, family 1 , 5.23 Up 1.56E-04 subfamily B, polypeptide 1 (CYP1B1), mRNA

AW294090 Ul-H-BI2-ahg-b-12-0-Ul.s1 5.2 Up 6.44E-04

NCI_CGAP_Sub4 Homo sapiens cDNA clone IMAGE:2726734 3, mRNA sequence

NM_001928 Homo sapiens D component of 5.08 Up 9.52E-04 complement (adipsin) (DF), mRNA

NM_002245 Homo sapiens potassium channel, 5.05 Up 5.46E-04 subfamily K, member 1 (KCNK1), mRNA

TABLE XVII: GENES THAT WERE EXPRESSED IN ADULT PANCREATIC-DERΓVED STROMAL CELLS DERIVED FROM DONOR PANCREAS H8

GeneViewSeqlD GeneViewSeqDesc

U48705 discoidin domain receptor family, member 1

M87338 replication factor C (activator 1 ) 2, 4OkDa

AK126431 Paired box gene 8

NMJ303335 Ubiquitin-activating enzyme E1-like

NM_003250 Thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)

J02843 cytochrome P450, family 2, subfamily E, polypeptide 1

BC063795 Estrogen-related receptor alpha

X13897 Cytochrome P450, family 2, subfamily A, polypeptide 6

AK023485 Scavenger receptor class B, member 1

D63487 KIAA0153 protein

NM_002745 Mitogen-activated protein kinase 1

NM_002745 Mitogen-activated protein kinase 1

BX537600 PX domain containing serine/threonine kinase

BX537600 PX domain containing serine/threonine kinase

AK092292 Similar to RIKEN cDNA 5730528L13 gene

AL832613 Similar to RIKEN cDNA 1110002G08 gene

AK091293 AFG3 ATPase family gene 3-like 1 (yeast)

BC022542 Hypothetical protein FLJ20522

BX647491 Solute carrier family 39 (zinc transporter), member 13

BC028205 Coronin 6

NM_032834 Asparagine-linked glycosylation 10 homolog (yeast, alpha-1 ,2-glucosyltransferase)

AF114264 Nexilin (F actin binding protein)

CR614786 Hypothetical protein MGC29937

NM_005927 Microfibrillar-associated protein 3

AK090611 Hypothetical protein BC017868

NM_006910 Retinoblastoma binding protein 6

NIVM45039 Hypothetical protein MGC16385

BC060852 CCR4-NOT transcription complex, subunit 7

AK057604 Crystallin, zeta (quinone reductase)-like 1

BF570950 Hypothetical protein LOC132321

BC067131 Retinol dehydrogenase 10 (all-trans)

AY154460 NACHT, leucine rich repeat and PYD containing 5

BC026168 Neural precursor cell expressed, developmentally down-regulated 1

BX641093 BBP-like protein 2

BC019095 Chromosome 9 open reading frame 65

BC030262 ADAMTS-like 1 BM541904 Guaπidinoacetate N-methyltransferase

BC067288 Lactamase, beta

BC067288 Lactamase, beta

NM_052931 SLAM family member 6

BQ420572 Potassium voltage-gated channel, Isk-related family, member 4

BQ420572 Potassium voltage-gated channel, Isk-related family, member 4

AK126483 Vesicle transport through interaction with t-SNAREs homolog 1A (yeast)

NM_173850 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12

NM_138726 ATP-binding cassette, sub-family C (CFTR/MRP), member 13

NM_153203 chromosome 21 open reading frame 74

BX648044 Janus kinase 1 (a protein tyrosine kinase)

BX648044 Janus kinase 1 (a protein tyrosine kinase)

BC058909 CDC42 small effector 2

BC058909 CDC42 small effector 2

AK022076 Constitutive photomorphogenic protein

BC039118 Syntaxin θ

NM_018685 Anillin, actin binding protein (scraps homolog, Drosophila)

BQ613856 gb:BQ613856 /DB_XREF=gi:21603525 /DB_XREF=il16dO4.x1 /CLONE=lMAGE:6030007 /TID=Hs2.375569.1 /CNT=38 /FEA=FLmRNA /TIER=ConsEnd /STK=I /LL=246721 /UG_GENE=POLR2J2 /UG=Hs.375569 /UG_TITLE=DNA directed RNA polymerase Il polypeptide J-related gene /FL=gb:NM_145325.1 gb:AF468111.1

NM_182916 TRNA nucleotidyl transferase, CCA-adding, 1

NM_001173 Rho GTPase activating protein 5

BC035153 Hypothetical protein FLJ22313

CR749233 Zinc finger protein 626

BX647312 Polyhomeotic like 3 (Drosophila)

AL137257 Kinase interacting with leukemia-associated gene (stathmin)

AJ488201 Neuron navigator 3

BC032845 Hypothetical protein FLJ11193

NM_144997 Hypothetical protein MGC13008

AK024067 Protein phosphatase 1 , regulatory (inhibitor) subunit 3B

AF298591 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 7

NM_020886 Ubiquitin specific protease 28

AK097557 SUMO/sentrin specific protease family member 8

BX537997 Non imprinted in Prader-Willi/Angelman syndrome 1

AK125640 CARD only protein

AK125640 CARD only protein

BC060779 Hypothetical protein FLJ32499

AF288395 Nicotinamide nucleotide adenylyltransferase 2

NM_000800 Fibroblast growth factor 1 (acidic)

AF111806 Kelch domain containing 1

NM_152756 hypothetical protein MGC39830

NM_007014 WW domain containing E3 ubiquitin protein ligase 2

BX537988 Suppression of tumorigenicity 7 like

NM_080387 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8

NM_153039 Homo sapiens hypothetical protein FLJ32803 (FLJ32803), mRNA

NM_153039 Homo sapiens hypothetical protein FLJ32803 (FLJ32803), mRNA NM_173631 Spondyloepiphyseal dysplasia, late, pseudogene

BX640784 SUMO1/sentrin specific protease 1

AK026009 Hypothetical protein MGC45806

BC021552 Calcium channel, voltage-dependent, gamma subunit 6

NM_138568 Protein 7 transactivated by hepatitis B virus X antigen (HBxAg)

NM_033259 CaM-KII inhibitory protein

BI459694 Chromosome 21 open reading frame 99

AF448838 Neuropilin (NRP) and tolloid (TLL)-like 1

AK027537 Fidgetin-like 1

AK093058 Membrane metallo-endopeptidase-like 2

NM_173668 hypothetical protein FLJ34836

AK098601 Hypothetical protein FLJ25735

AL833263 Zinc finger protein 258

AK124196 Trinucleotide repeat containing 5

NM_004866 Secretory carrier membrane protein 1

BC020496 RecQ protein-like 4

L31573 Sulfite oxidase

AK023517 Serologically defined colon cancer antigen 8

NM_003559 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta

BX647942 Hypothetical protein MGC19764

BC033694 BCL2-like 11 (apoptosis facilitator)

BC035143 Tigger transposable element derived 1

AK023835 Hypothetical protein FLJ20308

NM_002504 Nuclear transcription factor, X-box binding 1

NM_001943 Desmoglein 2

BC053677 Hypothetical protein FLJ37562

BC053677 Hypothetical protein FLJ37562

BC047364 Cyclin-dependent kinase 8

BC047364 Cyclin-dependent kinase 8

NM_007271 Serine/threonine kinase 38

AK096211 C-terminal modulator protein

NM_021163 RB-associated KRAB repressor

BX538036 Hypothetical protein FLJ38725

BX538036 Hypothetical protein FLJ38725

BC050289 Sorting nexin 13

NM_153042 gb:NM_153042.1 /DB_XREF=gi:23308564 /TlD=Hs2.237691.1 /CNT=22 /FEA=FLmRNA /TIER=FL /STK=I /LL=221656 /UG_GENE=FLJ34109 /UG=Hs.237691 /UG_TITLE=hypothetical protein FLJ34109/DEF=Homo sapiens hypothetical protein FLJ34109 (FLJ34109), mRNA. /FL=gb:NM_153042.1

BC065207 ATPase, H+ transporting, lysosomal 38kDa, VO subunit d isoform 2

BC007827 Hypothetical protein MGC14126

AK055219 Hypothetical protein BC017947

BC023539 gb:BC023539.1 /DB_XREF=gi:23273769 /Tl D=Hs2.161436.2 /CNT=IO /FEA=FLmRNA /TIER=FL /STK=I /LL=51091 /UG_GENE=SLALP /UG=Hs.161436 /DEF=Homo sapiens, soluble liver antigenliver pancreas antigen, clone MGC: 14307 1MAGE:4138072, mRNA, complete cds. /PROD=soluble liver antigenliver pancreas antigen /FL=gb:NM_016955.1 gb:AF146396.2 gb:BC023539.1

AB033111 KIAA1285 protein AK124747 Phosphodiesterase 5A, cGMP-specific

AK056882 RAS and EF hand domain containing

AK056882 RAS and EF hand domain containing

NM_183380 Dystonin

BX649086 Zinc finger protein 441

BC015023 Zinc finger protein 41

NM_032434 Zinc finger protein 512

BX537704 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13

NM_033656 Chromosome 21 open reading frame 107

CR627109 Inter-alpha (globulin) inhibitor H5

AY497052 Bromo domain-containing protein disrupted in leukemia

CA411757 hypothetical protein FLJ90036

AL832462 Chromosome 6 open reading frame 151

NM_173594 gb:NM_173594.1 /DB_XREF=gi:27734784 /TlD=Hs2.270868.1 /CNT=6 /FEA=FLmRNA

/TIER=FL /STK=I /LL=283372 /UG_GENE=FLJ25613 /UG=Hs.27O868

/UG_TITLE=hypothetical protein FLJ25613 /DEF=Homo sapiens hypothetical protein

FLJ25613 (FLJ25613), mRNA. /FL=gb:NM_173594.1 AL832208 Hypothetical protein FLJ32312

AL832140 Zinc finger protein 555

AL833289 TEA domain family member 1 (SV40 transcriptional enhancer factor)

AY035864 Trinucleotide repeat containing 6

NM_002504 Nuclear transcription factor, X-box binding 1

NM_152641 gb:NM_152641.1 /DB_XREF=gi:22749308 /TID=Hs2.379904.1 /CNT=3 /FEA=FLmRNA

/TIER=FL /STK=I /LL=196528 /UG_GENE=FLJ30619 /UG=Hs.3799O4

/UG_TITLE=hypothetical protein FLJ30619 /DEF=Homo sapiens hypothetical protein

FLJ30619 (FLJ30619), mRNA. /FL=gb:NM_152641.1 BC069230 Hypothetical protein FLJ25168

NM_173580 Hypothetical protein FLJ39058

CN831816 G protein-coupled receptor MRGX4

BF510484 RCD1 required for cell differentiation 1 homolog (S. pombe)

AK075110 Vanin 3

NM_176820 NACHT, leucine rich repeat and PYD containing 9

NM_006951 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 10OkDa

NM_002211 Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2,

MSK12)

BC041396 Ran GTPase activating protein 1

NWM73704 gb:NM_173704.1 /DB_XREF=gi:27754203 /GEN=MTCOI /TID=Hs2Affx.1.24 /CNT=I

/FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens cytochrome c oxidase I (MTCO1), mRNA. /PROD=cytochrome c oxidase I

/FL=gb:NM_173704.1 NM_173709 gb:NM_173709.1 /DB_XREF=gi:27754201 /GEN=MTND2 /TlD=Hs2Affx.1.29 /CNT=I

/FEA=FLmRNA /TlER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens

NADH dehydrogenase 2 (MTND2), nuclear gene encoding mitochondrial protein, mRNA.

/PROD=NADH dehydrogenase 2 /FL=gb:NM_173709.1

NM_176890 Homo sapiens taste receptor, type 2, member 50 (TAS2R50), mRNA

NM_012137 Dimethylarginine dimethylaminohydrolase 1

NM_173702 gb:NM_173702.1 /DB_XREF=gi:27754207 /GEN=MTATP6 /TID=Hs2Affx.1.41 /CNT=I

/FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens ATP synthase 6 (MTATP6), nuclear gene encoding mitochondrial protein, mRNA.

/PROD=ATP synthase 6 /FL=gb:NM_173702.1 NM_173705 gb:NM_173705.1 /DB_XREF=gi:27754205 /GEN=MTCO2 /TID=Hs2Affx.1.43 /CNT=I

/FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens cytochrome c oxidase Il (MTCO2), mRNA. /PROD=cytochrome c oxidase Il

/FL=gb:NM_173705.1 NM_173705 gb:NM_173705.1 /DB_XREF=gi:27754205 /GEN=MTCO2 /TID=Hs2Affx.1.43 /CNT=I

/FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens cytochrome c oxidase Il (MTCO2), mRNA. /PROD=cytochrome c oxidase Il

/FL=gb:NM_173705.1 NMJ73714 gb:NM_173714.1 /DB_XREF=gi:27754187 /GEN=MTND6 /TID=Hs2Affx.1.46 /CNT=I

/FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens

NADH dehydrogenase 6 (MTND6), mRNA. /PROD=NADH dehydrogenase 6

/FL=gb:NM_173714.1

AL832348 Hypothetical protein FLJ36754

BG682813 Polymerase (DNA-directed), epsilon 4 (p12 subunit)

NM_173710 gb:NM_173710.1 /DB_XREF=gi:27754195 /GEN=MTND3 /TID=Hs2Affx.1.52 /CNT=I

/FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens

NADH dehydrogenase 3 (MTND3), mRNA. /PROD=NADH dehydrogenase 3

/FL=gb:NM_173710.1

BM553309 Insulin-like 3 (Leydig cell)

AK026946 ADP-ribosylation factor-like 6 interacting protein 2.

AL050370 Hypothetical protein FLJ33790

BC036466 Zinc finger protein 354B

NM_001453 Forkhead box C1

BX648302 Chromosome 14 open reading frame 49

BX649166 Chromosome X open reading frame 43

BX648646 Putative MAPK activating protein

NM_002211 Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2,

MSK12)

CR627471 Vitamin K epoxide reductase complex, subunit 1-like 1

BM713088 Peptidylprolyl isomerase (cyclophilin)-like 6

NM_138473 Sp1 transcription factor

AK027185 Hypothetical protein MGC24132

BX648516 Shugoshin-like 1 (S. pombe)

BX648778 Phosphoinositide-3-kinase, class 2, alpha polypeptide

AL833408 Zinc finger protein 569

AK074877 Hypothetical protein FLJ90396

AK074877 Hypothetical protein FLJ90396

CR590249 Hypothetical protein FLJ90724

NM_032864 Hypothetical protein FLJ 14936

AK054811 Hypothetical protein MGC15416

BC030788 Zinc finger protein 548

BC030788 Zinc finger protein 548

NM_201269 Zinc finger motif enhancer binding protein 2

AK131446 Chromosome 6 open reading frame 170

AK001375 Hypothetical protein FLJ 14640

BC033720 Similar to hepatocellular carcinoma-associated antigen HCA557b BC028727 Hypothetical protein MGC33371

NM_032876 Jub, ajuba homolog (Xenopus laevis)

CR749448 Discoidin, CUB and LCCL domain containing 1

NM_152532 golgi autoantigen, golgin subfamily a, 4

NM_152646 Homo sapiens hypothetical protein MGC23270 (MGC23270), mRNA

AK055367 Chromosome 14 open reading frame 126

BC025788 NK2 transcription factor related, locus 3 (Drosophila)

NM_153237 hypothetical protein MGC34760

AL833685 Sterile alpha motif domain containing 3

BX648349 ELMO domain containing 2

AL833556 Leucine rich repeat containing 28

AK024276 Exosome component 6

BF510496 Hypothetical protein MGC19780

AK122900 Smooth muscle myosin heavy chain 11 isoform SM1-!ike

BX538000 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4

NM_080605 UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6

NM_033421 Chromosome 20 open reading frame 161

NM_033421 Chromosome 20 open reading frame 161

NM_004040 Ras homolog gene family, member B

AK091166 Secretory carrier membrane protein 4

L00972 Cystathionine-beta-synthase

AK095271 Hypothetical protein LOC128977

BM465996 Deleted in a mouse model of primary ciliary dyskinesia

AK128256 MADS box transcription enhancer factor 2, polypeptide B (myocyte enhancer factor 2B)

BC020854 Homo sapiens, clone MGC:24034 1MAGE:42817O1 , mRNA, complete cds

AK126180 • Deoxythymidylate kinase (thymidylate kinase)

NM_016534 Apoptosis-related protein PNAS-1

NM_019086 Hypothetical protein FLJ20674

AK055844 ARC/mediator transcriptional coactivator subunit

BC065937 5'-nucleotidase, ecto (CD73)

BC065937 δ'-nucleotidase, ecto (CD73)

AK123825 Hypothetical protein LOC253982

NM_015294 Tripartite motif-containing 37

AB082529 Rho-guanine nucleotide exchange factor

NM_003999 Oncostatin M receptor

NM_001543 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

NM_001271 Chromodomain helicase DNA binding protein 2

NMJD01271 Chromodomain helicase DNA binding protein 2

AK126223 Hypothetical protein FLJ13154

BC032783 Glycoprotein (transmembrane) nmb

BX640749 Zinc finger protein 12 (KOX 3)

NM_003759 Solute carrier family 4, sodium bicarbonate cotransporter, member 4

BC030966 KIAA0372 gene product

NM_006415 Serine palmitoyltransferase, long chain base subunit 1

BU151326 CDNA clone IMAGE:5014808, partial cds

BC036246 hypothetical protein FLJ32549

AK128040 Hypothetical protein MGC17839

NM_005147 DnaJ (Hsp40) homolog, subfamily A, member 3 BF510484 RCD1 required for cell differentiationi homolog (S. pombe)

NM_024654 Hypothetical protein FLJ23323

CR599716 Shwachman-Bodian-Diamond syndrome pseudogene

AK024763 Small nuclear RNA activating complex, polypeptide 5, 19kDa

AL137724 Hypothetical protein MGC20460

AK124391 CDNA clone MGC:30053 IMAGE:5139119, complete cds

AK128688 Family with sequence similarity 11 , member A

AK130065 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16

AB014523 Unc-51 -like kinase 2 (C. elegans)

NM_033389 Slingshot homolog 2 (Drosophila)

BX648776 Hypothetical protein LOC253827

BX648776 Hypothetical protein LOC253827

AF241785 KIAA1128

AK127011 Hypothetical protein FLJ23129

AK122900 Smooth muscle myosin heavy chain 11 isoform SM1-like

D88152 Solute carrier family 33 (acetyl-CoA transporter), member 1

BX647535 Chromosome 3 open reading frame 4

NM_002541 Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)

BX648236 BRAF35/HDAC2 complex (80 kDa)

BC056195 Microcephaly, primary autosomal recessive 1

BC033168 Twist homolog 2 (Drosophila)

NM_001002296 Golgi autoantigen, golgin subfamily a, 7

AF230904 SH3-domain kinase binding protein 1

X95808 Zinc finger protein 261

NM_173657 Hypothetical protein FLJ31139

BC011549 ATP synthase, H+ transporting, mitochondrial FO complex, subunit s (factor B)

AL832346 Hypothetical protein MGC39518

NWM45200 Calcium binding protein 4

NM_138468 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14

AY139008 Adult retina protein

NM_175907 Zinc binding alcohol dehydrogenase, domain containing 2

AK123362 Coagulation factor C homolog, cochlin (Limulus polyphemus)

CR749322 Zinc finger protein 638

AK126632 Tripartite motif-containing 5OB

BC022342 HP1-BP74

AK074078 Hypothetical protein FLJ 11383

XM_496546 Kelch repeat and BTB (POZ) domain containing 9

AK055606 Hypothetical gene supported by BC007071

AF191545 Leukocyte-derived arginine aminopeptidase

NM_012118 CCR4 carbon catabolite repression 4-like (S. cerevisiae)

XM_045423 KIAA0701 protein

D79984 Suppressor of Ty 6 homolog (S. cerevisiae)

AK095625 Hypothetical protein DKFZp564A022

BC040558 Dynein 2 light intermediate chain

NM_138793 Calcium activated nucleotidase 1

NM_133636 DNA helicase HEL308

NM_133636 DNA helicase HEL308

NM_198998 Aquaporin 12 CR627424 Hypothetical protein FLJ20125

BX648646 Putative MAPK activating protein

AL833317 C-myc promoter binding protein

NM_002719 Protein phosphatase 2, regulatory subunit B (B56), gamma isoform

NM_001001412 Family with sequence similarity 26, member C

AY455942 Protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a

NM_012288 Translocation associated membrane protein 2

NM_001005386 ARP2 actin-related protein 2 homolog (yeast)

AL832640 Ornithine decarboxylase-like

CR616778 Ubiquitin-conjugating enzyme E2-like

BC063455 T-complex-associated-testis-expressed 3

BF683703 Thymidine kinase 1, soluble

AL831977 Williams-Beuren syndrome chromosome region 16

BX648430 Gatenin (cadherin-associated protein), beta 1, 88kDa

AF061326 Chromosome 8 open reading frame 1

BC068606 Likely ortholog of C. elegans anterior pharynx defective 1A

BX648151 F-box protein 7

BC024016 FIP1 like 1 (S. cerevisiae)

XM_496318 Dystrophia myotonica-containing WD repeat motif

BC065568 Zinc finger protein 146

AB065003 KIAA0261

AK056172 CDNA clone MGC:32876 IMAGE:4734912, complete cds

AK056172 CDNA clone MGC:32876 I MAGE:4734912, complete cds

BX537798 Hypothetical protein FLJ35954

AY188447 DnaJ (Hsp40) homolog, subfamily C, member 14

BC008573 Hypoxia-inducible protein 2

AK092204 DnaJ (Hsp40) homolog, subfamily B, member 9

NM_006371 Cartilage associated protein

AK097159 Hypothetical protein FLJ20344

BC049375 HSPC063 protein

BC049375 HSPC063 protein

AL136717 Hypothetical protein DKFZp566D1346

CR624520 Monooxygenase, DBH-like 1

AF462442 Hypothetical protein FLJ20718

AB023172 Caspase recruitment domain family, member 8

AL832759 SVH protein

AK056821 SARIa gene homolog 2 (S. cerevisiae)

AF264036 Chromosome 6 open reading frame 114

NM_004381 CAMP responsive element binding protein-like 1

NM_024491 P10-binding protein

NM_030935 TSC-22-like

BC067799 Chromosome 10 open reading frame 97

NM_014394 Growth hormone inducible transmembrane protein

AK001375 Hypothetical protein FLJ 14640

BX648355 Hypothetical protein FLJ 13273

CR627018 Myelin basic protein

BC036453 Family with sequence similarity 13, member C1

AY358965 Similar to putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1 p (Yip1 p-interacting factor)

AK024801 Hypothetical protein FLJ21148

XM_087254 ATPase, Class Vl, type 11 B

XM_031102 WD repeat domain 22

NM_024670 Suppressor of variegation 3-9 homolog 2 (Drosophila)

NM_007326 Diaphorase (NADH) (cytochrome b-5 reductase)

NM_002814 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 10

AL832339 Hypothetical protein MGC50559

BC033795 Hypothetical protein FLJ30990

BC040604 Solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6

BC016767 gb:BC016767.1 /DB_XREF=gi: 16876988 /TID=Hs2.30724.2 /CNT=7 /FEA=FLmRNA

/TIER=FL /STK=I /LL=2967 /UG_GENE=GTF2H3 /UG=Hs.3O724 /DEF=Homo sapiens, general transcription factor HH, polypeptide 3 (34kD subunit), clone MGC:22720 IMAGE:4077665, mRNA, complete cds. /PROD=general transcription factor HH, polypeptide 3(34kD subunit) /FL=gb:BC016767.1

BC016767 gb:BC016767.1 /DB_XREF=gi:16876988 /TID=Hs2.30724.2 /CNT=7 /FEA=FLmRNA

/TIER=FL /STK=I /LL=2967 /UGJ3ENE=GTF2H3 /UG=Hs.30724/DEF=Homo sapiens, general transcription factor HH, polypeptide 3 (34kD subunit), clone MGC:22720 IMAGE:4077665, mRNA, complete cds. /PROD=general transcription factor HH, polypeptide 3(34kD subunit) /FL=gb:BC016767.1

NM_170707 Lamin A/C

BC040527 Hypothetical protein FLJ36090

NM_198519 Similar to Cytochrome c, somatic

NM_003647 Diacylglycerol kinase, epsilon 64kDa

NM_006065 Signal-regulatory protein beta 1

AK096409 Activating signal cointegrator 1 complex subunit 1

BX537601 Hypothetical protein LOC126295

NM_000051 Ataxia telangiectasia mutated (includes complementation groups A, C and D)

AL834246 Hypothetical protein FLJ32001

AK024046 Hypothetical protein FLJ 13984

NM_005463 Heterogeneous nuclear ribonucleoprotein D-like

BC038117 Lysosomal associated protein transmembrane 4 beta

AB032970 Potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2

AB103330 KIAA1199

AF049910 Transforming, acidic coiled-coil containing protein 1

NM_007229 Protein kinase C and casein kinase substrate in neurons 2

BQ056428 Thymidylate synthetase

AL512709 TBC1 domain family, member 16

AF426250 BXMAS2-10

NM_006203 Phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)

NMJD03184 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 15OkDa

AK128057 Vav-1 interacting Kruppel-like protein

NM_005897 lntracisternal A particle-promoted polypeptide

NWM74950 Hypothetical protein FLJ30435

CR749432 PMS1 postmeiotic segregation increased 1 (S. cerevisiae)

D63878 Neural precursor cell expressed, developmentally down-regulated 5

NM_005539 Inositol polyphosphate-5-phosphatase, 4OkDa

AK125479 Hypothetical protein FLJ20397 BX647378 BH3-only member B protein

AK057604 Crystallin, zeta (quinone reductase)-like 1

BQ215664 MAD2 mitotic arrest deficient-like 1 (yeast)

NMJ 52458 Hypothetical protein FLJ32130

NMJ 52458 Hypothetical protein FLJ32130

AL831969 Putative homeodomain transcription factor 2

AK127280 Ubiquitin protein ligase E3C

AL133035 Filamin-binding LIM protein-1

NMJ312180 F-box protein 8

AB032961 Spire homolog 1 (Drosophila)

NM_001004439 Integrin, alpha 11

AB018328 Zinc finger, BED domain containing 1

AL833624 Dudulin 2

S42457 Cyclic nucleotide gated channel alpha 1

CR601525 Docking protein 5

AF242769 Mesenchymal stem cell protein DSC54

BX647886 PEST-containing nuclear protein

BX648715 ATP-binding cassette, sub-family D (ALD), member 3

AK056931 Cockayne syndrome 1 (classical)

NM_000947 Primase, polypeptide 2A, 58kDa

NM_032151 Dimerization cofactor of hepatocyte nuclear factor 1 ( HNF1 ) from muscle

BX647169 ^-phosphodiesterase

NM_005845 ATP-binding cassette, sub-family C (CFTR/MRP), member 4

AJ536056 Fucosyltransferase 8 (alpha (1,6) fucosyltransferase)

BX649155 PC4 and SFRS 1 interacting protein 1

NM_007127 ViIHn 1

NMJ 82909 Downregulated in ovarian cancer 1

NM_015151 Chromosome 21 open reading frame 106

AK123699 Activating transcription factor 3

XM_374949 Sorting nexin 19

NM_000963 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)

BC028421 Hypothetical protein MGC33630

AB062488 OK/SW-cl.92

NMJD20781 Zinc finger protein 398

NMJ 45351 Scavenger receptor class F, member 1

AF020038 lsocitrate dehydrogenase 1 (NADP+), soluble

NM_005845 ATP-binding cassette, sub-family C (CFTR/MRP), member 4

NM_000262 N-acetylgalactosaminidase, alpha-

XM_375837 Family with sequence similarity 34, member A

BC035694 prostaglandin F receptor (FP)

NMJ 73545 Chromosome 2 open reading frame 13

NM_002009 Fibroblast growth factor 7 (keratinocyte growth factor)

AF515448 Mesoderm induction early response 1

CR627421 Hypothetical protein HSPC129

XM_291111 G protein-coupled receptor 125

AF034374 Molybdenum cofactor synthesis 1

AF447585 CG10806-like

AF142421 quaking homolog, KH domain RNA binding (mouse) BC033057 CDNA clone 1MAGE:5262992, partial cds

NM_005746 Pre-B-cell colony enhancing factor 1

AB049758 IVIAWD binding protein

AK027128 Zinc finger protein (C2H2 type) 277

AK000634 Chromosome 6 open reading frame 96

NM_018170 Hypothetical protein FLJ10656

BC008091 Homo sapiens mRNA similar to hypothetical protein FLJ20234 (cDNA clone MGC:17335

1MAGE:421281O), complete cds

BC009278 gb:BC009278.1 /DB_XREF=gi:14424513 /TID=Hs2.325520.2 /CNT=2 /FEA=FLmRNA

/TIER=FL /STK=I /LL=81893 /UG_GENE=LAT1 -3TM /UG=Hs.32552O /DEF=Homo sapiens, Similar to solute carrier family 7 (cationic amino acid transporter, y+ system), member 5, clone MGC:10645 IMAGE:4025075, mRNA, complete cds. /PROD=Similar to solute carrier family 7 (cationicamino acid transporter, y+ system), member 5 /FL=gb:BC009278.1

AK022028 Chromosome 1 open reading frame 43

AK022028 Chromosome 1 open reading frame 43

BC007010 complement component 1 , s subcomponent

BC025770 gb:BC025770.1 /DB_XREF=gi:19344025 /TID=Hs2.243010.2 /CNT=2 /FEA=FLmRNA

/TIER=FL /STK=I /LL=57381 /UG_GENE=ARHJ /UG=Hs.243O1O /DEF=Homo sapiens, Similar to TC10-like Rho GTPase, clone MGC:34777 IMAGE:5210490, mRNA, complete cds. /PROD=Similar to TC10-like Rho GTPase /FL=gb:BC025770.1

NMJ318841 Guanine nucleotide binding protein (G protein), gamma 12

BC039099 Hypothetical gene supported by BC055092

BC039099 Hypothetical gene supported by BC055092

AF117947 KIAA1961 protein

BC069213 Wolfram syndrome 1 (wolframin)

BC044242 Hypothetical protein LOC285927

D43948 KIAA0097 gene product

AK074045 Fas (TNFRSF6) binding factor 1

AK090411 Regucalcin gene promotor region related protein

XM_045907 Family with sequence similarity 40, member B

NM_014693 Endothelin converting enzyme 2

AF125104 gb:AF125104.1 /DB_XREF=gi:18568104 /TID=Hs2Affx.1.177 /CNT=I /FEA=FLmRNA

/TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens RAB22 mRNA, complete cds. /PROD=RAB22 /FL=gb:AF125104.1

NM_003816 A disintegrin and metalloproteinase domain 9 (meltrin gamma)

AF439324 solute carrier family 30 (zinc transporter), member 5

NM_005238 V-ets erythroblastosis virus E26 oncogene homolog 1 (avian)

AB002390 Ectonucleoside triphosphate diphosphohydrolase 4

XM_291202 Zinc finger protein 479

NM_031953 Sorting nexin 25

AB095941 Chromosome 14 open reading frame 21

BX641146 Cyclin LI

NM_004315 N-acylsphingosine amidohydrolase (acid ceramidase) 1

BX537890 Kruppel-like factor 7 (ubiquitous)

BC032643 Synaptotagmin binding, cytoplasmic RNA interacting protein

AK172810 Solute carrierfamily 39 (zinc transporter), member 14

AF213987 ALL1 fused gene from 5q31

NMJD03274 Transmembrane protein 1 CR627327 Hypothetical protein FLJ22054

BX648170 RaI GEF with PH domain and SH3 binding motif 1

NM_012319 Solute carrier family 39 (zinc transporter), member 6

XM_371352 Formin 2

NM_004136 Iron-responsive element binding protein 2

AU 33035 Filamin-binding LIM protein-1

AK096142 Hypothetical protein FLJ11286

BX647971 Serologically defined colon cancer antigen 10

BC013687 gb:BC013687.1 /DB_XREF=gi:16507920 /TID=Hs2Affx.1.336 /CNT=I /FEA=FLmRNA

/TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens, uncharacterized hematopoietic stemprogenitor cells protein MDS027, clone MGC:17655 IMAGE:3858231, mRNA, complete cds. /PROD=uncharacterized hematopoietic stemprogenitorcells protein MDS027 /FL=gb:BC013687.1

NM_016625 BM-011 protein

CR749597 Protein inhibitor of activated STAT, 2

BC018016 forkhead box P2

BC036262 gb:BG036262.1 /DB_XREF=gi:23270696 /TID=Hs2.20814.2 /CNT=I /FEA=FLmRNA

/TIER=FL /STK=I /LL=51072 /UG_GENE=CGI-27 /UG=Hs.2O814 /DEF=Homo sapiens, C21orf19-like protein, clone MGC:8733 IMAGE:3895306, mRNA, complete cds. /PROD=C21orf19-like protein /FL=gb:BC036262.1

NM_145799 Septin 6

AY071904 Ribonuclease/angiogenin inhibitor (RNH)

AB018304 Mid-1-related chloride channel 1

NM_001001890 Runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene)

NM_020121 UDP-glucose ceramide glucosyltransferase-like 2

BC036940 Zinc finger, CCHC domain containing 7

AK122686 I factor (complement)

CR597016 Chromosome 10 open reading frame 93

BG 116085 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1

BC029442 protein tyrosine phosphatase, receptor type, M

NM_021038 Muscleblind-like (Drosophila)

BC007344 gb:BC007344.1 /DB_XREF=gi:13938409 /TID=Hs2Affx.1.382 /CNT=I /FEA=FLmRNA

/TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens, Similar to RIKEN cDNA 4833415E20 gene, clone MGC: 15394 IMAGE:3636977, mRNA, complete cds. /PROD=Similarto RlKEN cDNA 4833415E20 gene/FL=gb:BC007344.1

AY014914 Apolipoprotein L, 4

AK122768 P53 target zinc finger protein

BC012487 methyl-CpG binding domain protein 1

BX538265 SUMO-1 activating enzyme subunit 1

NM_031934 RAB34, member RAS oncogene family

BC000488 RNA binding motif protein 14

BC012090 gb:BC012090.1 /DB_XREF=gi: 15082357 /TID=Hs2Affx.1.415 /CNT=I /FEA=FLmRNA

/TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens, Similar to heterogeneous nuclear ribonucleoprotein A3, clone MGC:20045 1MAGE:4661O41, mRNA, complete cds. /PROD=Similar to heterogeneous nuclearribonucleoprotein A3 /FL=gb:BC012090.1

NM_138468 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14

BC012486 gb:BC012486.1 /DB_XREF=gi: 15214703 /TlD=Hs2Affx.1.428 /CNT=I /FEA=FLmRNA /TIER=FL /STK=I /NOTE=sequence(s) not in UniGene /DEF=Homo sapiens, clone MGC:21715 IMAGE:4472166, mRNA, complete cds. /PROD=Unknown (protein for MGC:21715) /FL=gb:BC012486.1

AK095207 Reticulon 4 interacting protein 1

NM_174963 Sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)

AK056324 Chemokine-like factor super family 3

AL832809 Transgelin

BM462286 Cofilin 1 (non-muscle)

NM_178814 Adaptor-related protein complex 1, sigma 3 subunit

NM_178814 Adaptor-related protein complex 1, sigma 3 subunit

NM_178814 Adaptor-related protein complex 1, sigma 3 subunit

NM_004656 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)

BQ422937 Angiotensin Il receptor-associated protein

AK024018 Gem (nuclear organelle) associated protein 7

BQ056337 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase)

BC042587 RNA binding motif protein 15

BC042587 RNA binding motif protein 15

BC042587 RNA binding motif protein 15

BQ011318 Translocase of inner mitochondrial membrane 10 homolog (yeast)

NM_175619 Zygote arrest 1

D13666 Periostin, osteoblast specific factor

AK125446 Ras homolog enriched in brain

AK000327 PQ loop repeat containing 2

BC008034 gb:BC008034.1 /DB_XREF=gi:14165473 /TID=Hs2.46679.2 /CNT=I 5 /FEA=FLmRNA /TIER=FL /STK=O /LL=55673 /UG_GENE=C14orf34 /UG=Hs.46679 /UG_TITLE=chromosome 14 open reading frame 34 /DEF=Homo sapiens, hypothetical protein FLJ20739, clone MGC:1011 IMAGE:2967039, mRNA, complete cds. /FL=gb:BC008034.1

AY247738 Tribbles homolog 3 (Drosophila)

BM994428 Hypothetical protein MGC2941

BX538029 Hypothetical protein FLJ38482

AB075828 Zinc finger protein 545

BC034231 Actin related protein 2/3 complex, subunit 5, 16kDa

BX538107 Hypothetical protein FLJ 10726

AK056025 Chromosome 14 open reading frame 114

AK125625 Rho GDP dissociation inhibitor (GDI) beta

BM994352 Ras homolog gene family, member A

NM_001003689 L(3)mbt-like 2 (Drosophila)

CR606585 Hypothetical protein FLJ20345

BC022241 AKT1 substrate 1 (proline-rich)

AK098354 BS 3076

BC001224 peptidylprolyl isomerase A (cyclophilin A)

BC004948 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6

AL117595 Homo sapiens, clone IMAGE:4096273, mRNA

AK128554 Similar to FKSG27

BE614461 polymerase (RNA) Il (DNA directed) polypeptide B, 14OkDa

AK092292 Similar to RlKEN cDNA 5730528L13 gene

BM978026 pleckstrin homology, Sec7 and coiled-coil domains 2 (cytohesin-2) NM_005968 Heterogeneous nuclear ribonucleoprotein M

NM_005968 Heterogeneous nuclear ribonucleoprotein M

AI688573 Homo sapiens cDNA FLJ39218 fis, clone OCBBF2006660.

AL832183 Hypothetical protein LOC284454

AK057676 RN A binding motif protein 18

BF341549 Selenoprotein W, 1

CA430188 Homo sapiens cDNA clone 1MAGE:5294561, partial cds

CA430188 Homo sapiens cDNA clone IMAGE:5294561 , partial cds

BG036317 Pyruvate dehydrogenase (lipoamide) alpha 1

NM_173620 Hypothetical protein FLJ23825

AK128450 Hypothetical protein FLJ32096

AK123684 Homo sapiens, clone lMAGE:3604678, mRNA

BX647260 Ribosomal protein S24

BC058938 Leucine zipper, putative tumor suppressor 2

AL832091 Spindlin family, member 3

AL832091 Spindlin family, member 3

NM_020381 Chromosome 6 open reading frame 210

NM_015902 E3 identified by differential display

BQ876971 cartilage associated protein

AB 115770 Hypothetical protein BC002770

BC031322 Homo sapiens cDNA FLJ30738 fis, clone FEBRA2000297.

CR749476 Armadillo repeat containing, X-linked 5

AI147556 hypothetical protein DKFZp313N0621

D79989 Centaurin, gamma 1

BC075701 Chromosome 9 open reading frame 10

AK056761 Pentatricopeptide repeat domain 2

BX648802 Hypothetical protein FLJ20203

BM670238 hypothetical protein MGC29784

BX647444 Chromobox homolog 3 (HP1 gamma homolog, Drosophila)

BC040880 Chromosome 10 open reading frame 114

AK093924 Vimentin

AK091785 chromosome 9 open reading frame 10

BC075701 Chromosome 9 open reading frame 10

BC075701 Chromosome 9 open reading frame 10

CA448665 decay accelerating factor for complement (CD55, Cramer blood group system)

AK054976 Histidine triad nucleotide binding protein 1

AK054976 Histidine triad nucleotide binding protein 1

R13687 Transcribed locus

R13687 Transcribed locus

AB007952 F-box protein 28

AK055685 Hypothetical protein DKFZp762C2414

NMJ314992 Dishevelled associated activator of morphogenesis 1

BC039344 Eukaryotic translation initiation factor 4A, isoform 2

NM_000599 Insulin-like growth factor binding protein 5

BX538231 BTB (POZ) domain containing 7

BX647478 Casein kinase 1 , alpha 1

AK093866 Peroxisome biogenesis factor 13

XMJ385261 Mesoderm posterior 2 BF105980 hypothetical protein LOC144874

AK128627 Smoothelin

AL834501 Zinc finger protein 207

AB046807 Melanoma antigen, family E, 1

BC033363 Homo sapiens, clone IMAGE:4753714, mRNA

NM_015001 SMART/HDAC1 associated repressor protein

BX648336 KIAA1702 protein

AK095810 Ribonuclease P/MRP 3OkDa subunit

NM_176792 Mitochondrial ribosomal protein L43

AF196185 Par-3 partitioning defective 3 homolog (C. elegans)

AL162068 Nucleosome assembly protein 1-like 1

CA431092 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_060190.1

(H.sapiens) hypothetical protein FLJ20234 [Homo sapiens]

CA431092 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_060190.1

(H.sapiens) hypothetical protein FLJ20234 [Homo sapiens]

NM_000093 Collagen, type V, alpha 1

NM_030790 T-cell immunomodulatory protein

BU618741 gb:BU618741 /DB_XREF=gi:23284956 /DB_XREF=UI-H-FH1-bfk-f-10-0-Ul.s1 /CLONE=UI-

H-FH1-bfk-f-10-0-UI /TΪD=Hs2.254211.3 /CNT=58 /FEA=mRNA /TIER=ConsEnd /STK=4

/LL=135763 /UG_GENE=LOC135763 /UG=Hs.254211 /UG_TITLE=taube nuss

BU618741 gb:BU618741 /DB_XREF=gi:23284956 /DB_XREF=UI-H-FH1-bfk-f-10-0-Ul.s1 /CLONE=Ul-

H-FH1 -bfk-f-10-0-UI /TID=Hs2.254211.3 /CNT=58 /FEA=mRNA /TIER=ConsEnd /STK=4

/LL=135763 /UG_GENE=LOC135763 /UG=Hs.254211 /UG_TITLE=taube nuss

AK095170 Hypothetical protein LOC255458

AF086373 Full length insert cDNA clone ZD67E01

AK128052 CDNA FLJ33585 fis, clone BRAMY2012163

NM_001004298 Chromosome 10 open reading frame 90

BG548775 CDNA clone IMAGE:5261375, partial cds

BQ575589 Hypothetical protein LOC347813

BG924540 Full length insert cDNA clone ZC24E10

BC035153 Hypothetical protein FLJ22313

AK127941 Gasdermin domain containing 1

AK094554 LOC440856

BX641042 Immunoglobulin superfamily, member 4

AK094888 FGFR1 oncogene partner 2

AL833123 Inorganic pyrophosphatase 2

AL833123 Inorganic pyrophosphatase 2

AF090693 CUG triplet repeat, RNA binding protein 2

AK097245 Cardiotrophin-like cytokine

BU 192089 Full length insert cDNA clone ZD81 A03

NM_203422 Similar to hypothetical protein

AF086098 Hypothetical protein LOC257407

BC031882 Homo sapiens, Similar to hypothetical gene LOC118703, clone 1MAGE:4825811 , mRNA, partial cds

BE221212 collagen, type I, alpha 1

BC029602 Homo sapiens, clone IMAGE:5296510, mRNA, partial cds

AK056941 CDNA FLJ32379 fis, clone SKMUS1000030

NM_012319 Solute carrierfamily 39 (zinc transporter), memberθ BC042032 Hypothetical gene supported by BC042032

AK098812 Hypothetical gene supported by AK098812

NM_175898 Hypothetical protein LOC283687

BF183894 Full length insert cDNA clone YT69G03

AK057057 Hypothetical protein BC011840

AA714835 Homo sapiens cDNA FLJ30738 fis, clone FEBRA2000297.

XM_499008 Hypothetical gene supported by AK124699

XM_499008 Hypothetical gene supported by AK124699

NM_182584 Hypothetical protein FLJ33706

AK124747 Phosphodiesterase 5A, cGMP-specific

AF264787 Deleted in lymphocytic leukemia, 2

NM_001376 Dynein, cytoplasmic, heavy polypeptide 1

BC035120 leptin receptor

BC036696 Homo sapiens, clone IMAGE:4827621, mRNA

BC036212 Chromodomain helicase DNA binding protein 1-like

BC036581 CDNA clone IMAGE:4795984, partial cds

AB033023 YEATS domain containing 2

XM_378860 Hypothetical protein LOC149478

AK022839 Homo sapiens, clone IMAGE:5019307, mRNA

AK022839 Homo sapiens, clone IMAGE:5019307, mRNA

AK001327 Taxi (human T-cell leukemia virus type I) binding protein 3

AK096570 Hypothetical protein LOC284591

BC040316 Homo sapiens, clone 1MAGE:4838183, mRNA

XM_372038 Hypothetical protein FLJ32731

BC065198 LUC7-like (S. cerevisiae)

AK124562 CDNA FLJ32587 fis, clone SPLEN2000402

BX647942 Hypothetical protein MGC19764

AI753143 integrin, beta-like 1 (with EGF-like repeat domains)

AI753143 integrin, beta-like 1 (with EGF-like repeat domains)

AL832314 RNA binding motif protein 25

AY254380 HECT domain containing 1

CA425979 Full length Insert cDNA clone YR50A02

AI421660 hypothetical protein LOC284385

AK097266 CDNA FLJ39947 fis, clone SPLEN2024232

BX640831 Amplified in breast cancer 1

AK091902 Transmembrane protein 17

AY210418 CUB and Sushi multiple domains 2

AY024361 B melanoma antigen family, member 4

AK024111 CDNA FLJ30357 fis, clone BRACE2007727

AK024111 CDNA FLJ30357 fis, clone BRACE2007727

AW243038 Homo sapiens LOC346541 (LOC346541 ), mRNA

AK124859 RNA binding protein with multiple splicing

NM_003292 Translocated promoter region (to activated MET oncogene)

BF512806 Homo sapiens partial mRNA; ID EE2-16B

AF082283 B-cell CLUIymphoma 10

BC036085 Four and a half LIWI domains 2

AK001007 CDNA FLJ10145 fis, clone HEMBA1003322

CN359839 Transcribed locus AK090574 CDNA FLJ33255 fls, clone ASTRO2005553

AF049910 Transforming, acidic coiled-coil containing protein 1

NM_175895 Hypothetical protein FLJ25590

CA442932 polymerase (RNA) I polypeptide B, 128kDa

AF075587 MYC binding protein 2

AK123751 Hypothetical gene supported by AF086285; AK123751

BC040588 Hypothetical protein LOC339505

NM_005691 ATP-binding cassette, sub-family C (CFTR/MRP), member 9

NM_014556 Ellis van Creveld syndrome

NM_173630 Rotatin

BC019584 Similar to solute carrier family 25 , member 16

BC005700 Motile sperm domain containing 1

AK096227 SHB (Src homology 2 domain containing) adaptor protein B

AK096888 Hypothetical protein LOC284121

AB046765 Kl AA1545 protein

AK056395 CDNA FLJ31833 fls, clone NT2RP6000130

AK128076 CDNA FLJ33163 fls, clone UTERU2000541

NM_015941 ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H

AY555274 Projection protein PF6

XM_051081 TBC1 domain family, member 12

BC047659 Hypothetical protein FLJ40089

AK097124 CDNA FLJ39805 fls, clone SPLEN2007951

BX099435 Transcribed locus

AK093907 CDNA FLJ36588 fls, clone TRACH2013991

BC025260 Zinc finger protein 286

AK124136 Homo sapiens, clone IMAGE:5303580, mRNA

BX537946 EPH receptor A5

AK097099 FP2025

BU733109 Chromosome 11 open reading frame 31

BU733109 Chromosome 11 open reading frame 31

AK124354 Chaperonin containing TCP1 , subunit 5 (epsilon)

AF150386 HSPC103

BC065016 AFG3 ATPase family gene 3-like 2 (yeast)

BC043233 Chromosome 10 open reading frame 103

BC013351 Hypothetical protein FLJ21657

NM_000610 CD44 antigen (homing function and Indian blood group system)

AY359878 Heat shock 9OkDa protein 1 , beta

BQ224776 Glutathione S-transferase omega 1

NMJ303051 Solute carrier family 16 (monocarboxylic acid transporters), member 1

AL545542 polymerase I and transcript release factor

AF062341 Catenin (cadherin-associated protein), delta 1

BC063455 T-complex-associated-testis-expressed 3

NM_198850 Pleckstrin homology-like domain, family B, member 3

NM_004713 Serologically defined colon cancer antigen 1

BG761185 zinc finger protein 36 (KOX 18)

AK127332 Retinoblastoma binding protein 7

BG492376 gb:BG492376 /DB_XREF=gi: 13453888 /DB_XREF=602536302F1

/CLONE=IMAGE:4655161 /TID=Hs2.356149.1 /CNT=36 /FEA=mRNA /TIER=ConsEnd /STK=O /UG=Hs.356149 /UG_TITLE=Homo sapiens cDNA FLJ25490 fis, clone CBR00320.

NM_182501 Hypothetical protein MGC61716

NM_182501 Hypothetical protein MGC61716

AK025561 Hypothetical protein FLJ21908

XM_095991 Chromosome 9 open reading frame 81

BX648892 Male sterility domain containing 2

NMJ301005386 ARP2 actin-related protein 2 homolog (yeast)

NM_005399 Protein kinase, AMP-activated, beta 2 non-catalytic subunit

BI857154 Homo sapiens mRNA; cDNA DKFZp566E0124 (from clone DKFZp566E0124)

BF692729 homolog of yeast mRNA transport regulator 3

BC001576 Putative NFkB activating protein HNLF

AK024941 DnaJ (Hsp40) homolog, subfamily C, member 3

BX537365 Matrin 3

BQ071860 H1 histone family, member X

AK055438 Transmembrane 6 superfamily member 1

AK096921 Homo sapiens, Similarto LOC169932, clone IMAGE:4499203, mRNA

BX648668 Reversion-inducing-cysteine-rich protein with kazal motifs

BX648668 Reversion-inducing-cysteine-rich protein with kazal motifs

BX647568 TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa

BX537577 HepG23' region cDNA, clone hmd1cO7.

BC033694 BCL2-like 11 (apoptosis facilitator)

BE092211 Homo sapiens transcribed sequence with strong similarity to protein sp:P10909 (H.sapiens) CLUS_HUIV1AN Clusterin precursor (Complement-associated protein SP-40,40) (Complement cytolysis inhibitor) (CLI) (NA1 and NA2) (Apolipoprotein J) (Apo-J) (TRPM-2)

NM_033631 Leucine zipper protein 1

W73431 fibronectin 1

AK001486 Solute carrier family 4 (anion exchanger), member 1 , adaptor protein

AK056606 hypothetical protein LOC145783

NM_005417 V-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)

CR627004 Hypothetical gene supported by AK092343

U03100 Catenin (cadherin-associated protein), alpha 1, 102kDa

AU145147 gb:AU145147 /DB_XREF=gi:11006668 /DB-XREF=AU 145147 /CLONE=HEMBA1004029 /TID=Hs2.417554.1 /CNT=11 /FEA=mRNA/TlER=ConsEnd /STK=O /UG=Hs.417554 /UG_TITLE=H.sapiens mRNA autoantigen NOR-90 3-untranslated region

AK126488 Splicing factor 3b, subunit 2, 145kDa

CR624071 Activating transcription factor 1

BC014318 Homo sapiens, clone IMAGE:3684608, mRNA

BC014318 Homo sapiens, clone IMAGE:3684608, mRNA

BX537977 Syntaxin 16

BX648207 HepG2 partial cDNA, clone hmd2d12m5.

U88666 SFRS protein kinase 2

AK022299 Hypothetical protein LOC148189

AK126679 Follicular lymphoma variant translocation 1

BG200951 Homo sapiens mRNA; cDNA DKFZp686L2129 (from clone DKFZp686L2129)

NM_178517 Phosphatidylinositol glycan, class W

XM_034086 KIAA1107 protein

AK126971 Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 AK123669 CDNA FLJ37332 fis, clone BRAMY2019710

BC082983 Homo sapiens, clone IMAGE:4403366, mRNA, partial cds

NMJ322835 Likely ortholog of mouse common-site lymphoma/leukemia GEF

XM_380135 Hypothetical LOC402578

BX506157 Transcribed locus

CR749334 Alpha-2-macroglobulin

AB051461 Leucine rich repeat containing 27

BC001576 Putative NFkB activating protein HNLF

XM_371331 Similarto Hypothetical protein CBG13135

AY368150 Kl AA1228 protein

AK125248 Hypothetical LOC401440

AK024367 Solute carrier family 2 (facilitated glucose transporter), member 11

AL536899 H.sapiens mRNA; clone CD 43T7

AK123811 Homo sapiens, clone IMAGE:4819775, mRNA

CR749268 Zinc finger protein 621

NM_007038 A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5

(aggrecanase-2)

BQ067292 Hypothetical protein LOC202051

BX648583 EGF-like repeats and discoidin l-like domains 3

BX647422 SH3 domain protein D19

AL832032 hypothetical protein MGC20481

NM_004713 Serologically defined colon cancer antigen 1

BF510540 Full-length cDNA clone CS0DF028YB15 of Fetal brain of Homo sapiens (human)

NM_005019 Phosphodiesterase 1A, calmodulin-dependent

CR613749 Hypothetical protein BC009467

BG701300 Hypothetical gene supported by BC030123

BF690855 Kidney predominant protein NCU-G1

BF690855 Kidney predominant protein NCU-G 1

BG249246 hypothetical protein FLJ22313

BC042676 Hypothetical protein LOC339324

AL832613 Similar to RIKEN cDNA 1110002C08 gene

CR749611 Atonal homolog 8 (Drosophila)

BX641117 Ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

XM_172341 Hypothetical protein FLJ35036

XM_113962 KIM0650 protein

BG109249 Homo sapiens cDNA FLJ37777 fis, clone BRHIP2026274.

NM_003580 Neutral sphingomyelinase (N-SMase) activation associated factor

AK125434 MRNA full length insert cDNA clone EUROIMAGE 138904

AK091716 Homo sapiens, clone IMAGE:5301900, mRNA

AK055769 Homo sapiens cDNA FLJ31207 fis, clone KIDNE2003357.

AK123554 Full length insert cDNA clone YB64B08

R76828 Homo sapiens cDNA FLJ36355 fis, clone THYMU2007384

BI868572 NAD(P)H dehydrogenase, quinone 2

AA442490 , Homo sapiens cDNA FLJ13849 fis, clone THYRO1000865.

BC021684 Homo sapiens, clone 1MAGE-.4414836, mRNA

NM_016076 CGI-146 protein

NM_002956 Restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)

BC043574 Homo sapiens, clone IMAGE:5222953, mRNA BX647981 Hypothetical protein BC001610

BX647981 Hypothetical protein BC001610

AB028975 Kl AA1052 protein

NM_020800 KIAA1374 protein

AL832104 Choline/ethanolaminephosphotransferase

BX641154 Hypothetical protein LOC132241

BX647069 Chromosome 9 open reading frame 39

BM908230 Homo sapiens, clone IMAGE:5745274, mRNA

NM_002577 P21 (CDKNIA)-activated kinase 2

BC028590 Zinc finger protein 611

AL109717 MRNA full length insert cDNA clone EUROIMAGE 240968

AB020683 Jumonji domain containing 2B

AK095307 F-box only protein 9

BC038383 hypothetical protein LOC283232

BG037297 Hypothetical protein LOC157693

AK122764 Retinol dehydrogenase 13 (all-trans and 9-cis)

BC039687 Homo sapiens, clone IMAGE:5248198, mRNA

XM__376821 Chromosome 9 open reading frame 14

AK054607 Hypothetical protein LOC144481

BX648276 Hypothetical protein MGC2747

CR627287 Hypothetical protein FLJ38508

AK122970 Zinc finger, CCHC domain containing 10

BG620958 pregnancy-associated plasma protein A

AK094053 CDNA FLJ36734 fis, clone UTERU2012890

CR749827 Meisi , myeloid ecotropic viral integration site 1 homolog (mouse)

AK094805 DKFZP566B183 protein

BX537675 Similar to zinc finger protein 91 (HPF7, HTF10)

AB032961 Spire homolog 1 (Drosophila)

AK097492 CDNA FLJ40173 fis, clone TESTI2016922

BC040901 Homo sapiens, clone IMAGE:5743779, mRNA

AK096134 Chromosome 4 unknown transcript 1 variant 2 mRNA, partial sequence, alternatively spliced

BC033251 Homo sapiens, clone IMAGE:5441133, mRNA

BX537949 Hypothetical protein DKFZp686G0786

BC030833 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)

AK095502 hypothetical protein LOC125476

AK074456 Eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa

AK092751 Hypothetical protein LOC286254

H41167 GM2 ganglioside activator protein

NM_152605 Hypothetical protein FLJ37549

AK090649 CDNA FLJ33330 fis, clone BRACE2000441

XM_376247 Hypothetical LOC401074

XM_376247 Hypothetical LOC401074

CR627148 LOC441434

AK056982 CDNA FLJ32420 fis, clone SKMUS2000898

BX640749 Zinc finger protein 12 (KOX 3)

AK095614 Chromosome 21 open reading frame 34

BC031683 Homo sapiens, clone IMAGE:5167209, mRNA

NM_199072 l-mfa domain-containing protein AK057498 RuvB-like 2 (E. coli)

NM_007372 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42

NM_007372 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42

BG396868 Homo sapiens, clone IMAGE:4581955, mRNA, partial cds

BC037827 CDNA clone IMAGE:4811567, partial cds

BC037827 CDNA clone IMAGE:4811567, partial cds

AK127112 DnaJ (Hsp40) homolog, subfamily C, member 13

XM_373413 Hypothetical protein FLJ20847

BC033321 Homo sapiens, clone IMAGE:4828738, mRNA

CA311143 Homo sapiens cDNA FLJ34740 fis, clone MESAN2008729.

BC026168 Neural precursor cell expressed, developmentally down-regulated 1

AK124888 Homo sapiens, clone IMAGE:5261865, mRNA

BC043405 Homo sapiens, clone IMAGE:6050118, mRNA

AK097618 gb:AK097618.1 /DB_XREF=gi:21757447 /TID=Hs2.334419.1 /CNT=4 /FEA=mRNA

/TIER=ConsEnd /STK=O /UG=Hs.334419 /UG_TITLE=Homo sapiens cDNA FLJ40299 fis, clone TEST12028997. /DEF=Homo sapiens cDNA FLJ40299 fis, clone TESTI2028997.

NM_025137 Hypothetical protein FLJ21439

NM_014939 K1AA1012

BC038536 Homo sapiens, clone IMAGE:5171618, mRNA

AK129643 Homo sapiens, clone IMAGE:5480271, mRNA

BC041362 Homo sapiens, clone IMAGE:5273088, mRNA

AK095320 Nucleosome assembly protein 1-like 4

NM_054027 Ankylosis, progressive homolog (mouse)

AK025846 Growth arrest-specific 5

AK057448 CDNA FLJ32886 fis, clone TESTI2004255

BM718477 Similar to Ten-m2

BX648243 Hypothetical protein MGC48625

BU734349 Peroxiredoxin 5

AF445027 Glutamine-fructose-6-phosphate transaminase 1

AK123358 TPA regulated locus

NM_005831 Nuclear domain 10 protein

AK097252 Asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta- glucosyltransferase)

CR605719 Huntingtin interacting protein 2

A1138766 Homo sapiens similar to Protein C21orf15 (LOC283436), mRNA

BG122789 gb:BG122789 /DB_XREF=gi:12616298 /DB_XREF=602351740F1

/CLONE=IMAGE:4450040 /TID=Hs2.399743.1 /CNT=3 /FEA=mRNA /TIER=ConsEnd /STK=O /UG=Hs.399743 /UG_TITLE=Homo sapiens, clone IMAGE:5275148, mRNA

AK055621 CDNA FLJ31059 fis, clone HSYRA2000832

NMJD31912 Synaptotagmin XV

AA399670 MRNA fragment APT-L12

XM_371891 K1AA0877 protein

AK122832 Zinc finger protein 169

XM_497676 Hypothetical protein FLJ40434

AK127072 Similar to RIKEN cDNA 2210021 J22

AF086272 Full length insert cDNA clone ZD44H09

BC043282 CDNA clone IMAGE:5297486, partial cds

BC015159 CDNA clone IMAGE:3885734, partial cds AK022384 FLJ34870 protein

BC043141 Low density lipoprotein receptor-related protein 11

BC042526 Homo sapiens, clone IMAGE:4819376, mRNA

NM_015151 Chromosome 21 open reading frame 106

AK057475 Hypothetical protein LOC150005

BC034912 Homo sapiens, clone IMAGE:5272441, mRNA

BC036597 Hypothetical protein LOC285103

BX647915 KIAA0804 protein

NM_014745 Hypothetical protein LOC348180

BX648299 Solute carrier family 8 (sodium/calcium exchanger), member 1

BI461922 Homo sapiens, clone IMAGE:5270007, mRNA

BC042527 CDNA clone IMAGE:4836898, partial cds

BC040600 gb:BC040600.1 /DB_XREF=gi:26251854 ATID=Hs2.434387.1 /CNT=I /FEA=mRNA /TIER=ConsEnd /STK=I /UG=Hs.434387 /UG_TITLE=Homo sapiens, clone IMAGE:5270641 , mRNA /DEF=Homo sapiens, clone IMAGE:5270641 , mRNA.

BC039335 Homo sapiens, clone IMAGE:5268043, mRNA

BC042368 Homo sapiens, clone IMAGE:4820434, mRNA

BC063301 Heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1

BC042969 CDNA clone IMAGE:5288530, partial cds

AK094733 CDNA FLJ37414 fis, clone BRAWH1000157

XM_085234 Similar to Mund 3-3 protein - rat

BC062763 Homo sapiens, clone IMAGE:4285253, mRNA

AK124747 Phosphodiesterase 5A, cGMP-specific

AL833487 MRNA; cDNA DKFZp686H1629 (from clone DKFZp686H1629)

AL833487 MRNA; cDNA DKFZp686H1629 (from clone DKFZp686H1629)

NM_033004 NACHT, leucine rich repeat and PYD containing 1

AL833246 MRNA; cDNA DKFZp761 C2420 (from clone DKFZp761C2420)

NM_182920 A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9

NM_147223 Nuclear receptor coactivator 1

AF245303 Prominin 2

BC040584 Similar to Hypothetical protein KIAA0563

BC039103 Myosin light chain kinase (MLCK)

AK131447 SPOC domain containing 1

BC043601 Homo sapiens, clone lMAGE:5228040, mRNA

AB040890 Phosphatidylinositol transfer protein, membrane-associated 2

AK097428 hypothetical protein LOC286009

AK055141 Keratin associated protein 5-5

NM_198441 FLJ40296 protein

NM_004397 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6

BC038350 gb:BC038350.1 /DB_XREF=gi:23468216 /TID=Hs2.385724.1 /CNT=2 /FEA=mRNA /TIER=ConsEnd /STK=O /UG=Hs.385724 /UG_TlTLE=Homo sapiens, clone IMAGE:4537875, mRNA /DEF=Homo sapiens, clone IMAGE:4537875, mRNA.

AK094434 CDNA FLJ37115 fis, clone BRACE2022158

AF217970 Similar to hypothetical protein SB153 isoform 1

AF177941 Collagen, type V, alpha 3

BC036613 hypothetical protein FLJ21062

BC041921 Homo sapiens, clone IMAGE:5300163, mRNA

BC022542 Hypothetical protein FLJ20522 NM_198841 Chromosome 9 open reading frame 10 opposite strand

BG567116 Homo sapiens, clone IMAGE:4723407, mRNA, partial cds

AK128263 Hypothetical protein MGC15523

AK095489 Chromosome 14 open reading frame 135

BI560986 CDNA clone IMAGE:5296578, partial cds

BX647093 Hypothetical protein LOC157697

L04731 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)

AL049245 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9

BF673449 Homo sapiens, clone IMAGE:4272847, mRNA

BG771696 Homo sapiens, clone IMAGE:4836780, mRNA

AA807959 Homo sapiens transcribed sequence

AK094988 Cathepsin L-like 3

AL832681 AT rich interactive domain 5B (MRF1-like)

AL832339 Hypothetical protein MGC50559

AK074231 Homo sapiens cDNA FLJ23651 fis, clone COL08363

NM_203487 Protocadherin 9

BX648768 Hypothetical protein MGC26979

AL713632 MRNA; cDNA DKFZp761 B0221 (from clone DKFZp761 B0221 )

NWM 75768 Glutamate receptor, ionotropic, kainate 2

NM_198129 Laminin, alpha 3

AL832489 Kl AA1970 protein

XM_371783 Similar to KIAA0752 protein

AL832005 YTH domain family 3

XM_087254 ATPase, Class Vl , type 11 B

XM_087254 ATPase, Class Vl, type 11 B

AK093987 CDNA FLJ36668 fis, clone UTERU2003926

AK090801 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase

(carboxylating))

AK124753 PRKR interacting protein 1 (IL11 inducible)

AK124897 CDNA FLJ34546 fis, clone HLUNG2008959

XM_379820 Hypothetical protein FLJ35390

AL832380 Membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)

AK055534 CDNA FLJ30972 fis, clone HEART2000492

AK025042 CDNA: FLJ21389 fis, clone COL03455

XM_091914 Hypothetical protein LOC162993

AK056734 CDNA FLJ32172 fis, clone PLACE6000555

NM_198531 ATPase, Class II, type 9B

AF277398 Cat eye syndrome chromosome region, candidate 3

AK096248 Hypothetical protein MGC46336

XM_291019 Hypothetical protein FU13305

AL834311 MRNA; cDNA DKFZp434O1614 (from clone DKFZp434O1614)

AK098256 Hypothetical LOC285711

J02783 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide

(protein disulfide isomerase; thyroid hormone binding protein p55)

NM_006109 SKB1 homolog (S. pombe)

NM_006109 SKB1 homolog (S. pombe)

NM_173611 Hypothetical protein FLJ38426

S78159 gb:S78159.1 /DB_XREF=gi:999360 /TID=Hs2.434273.1 /CNT=I /FEA=mRNA /TIER=ConsEnd /STK=O /UG=Hs.434273 /UG_TITLE=Homo sapiens AML1-ETO fusion protein (AML1-ETO) rnRNA, partial cds. /DEF=Homo sapiens AML1-ETO fusion protein

(AML1-ETO) mRNA, partial cds.

NM_198571 FLJ39237 protein

AK127242 Special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating

DNA's)

NM_001423 Epithelial membrane protein 1

AF548114 orofacial cleft 1 candidate 1

XM_370652 Dynein, cytoplasmic, heavy polypeptide 2

AK123482 Microsomal glutathione S-transferase 1

CR624071 Activating transcription factor 1

U94385 RNA binding motif protein, Y-linked, family 3, member A pseudogene

AK091805 CDNA FLJ34486 fis, clone HLUNG2004217

U36500 SP140 nuclear body protein

AK096092 Dynein, cytoplasmic, light polypeptide 2A

NM_024652 Leucine-rich repeat kinase 1

AF062341 Catenin (cadherin-associated protein), delta 1

N42910 KIAA0934 protein

AK056856 CDNA FLJ32177 fis, clone PLACE6001294

BX648365 CDC10 cell division cycle 10 homolog (S. cerevisiae)

XM_166450 Bromodomain and PHD finger containing, 3

BC035098 Homo sapiens, clone IMAGE:5261953, mRNA

AK125267 Solute carrier family 5 (sodium/glucose cotransporter), member 11

AF346629 Transient receptor potential cation channel, subfamily M, member 7

NM_017635 Suppressor of variegation 4-20 homolog 1 (Drosophila)

XM_291142 FCH domain only 2

AK090649 CDNA FLJ33330 fis, clone BRACE2000441

D63881 Joined to JA2F1

AK092660 CDNA clone IMAGE:2988896

AL049452 MRNA; cDNA DKFZp586C1322 (from clone DKFZp586C1322)

H48620 Homo sapiens full length insert cDNA YQ80D07

XM_028522 Myosin heavy chain Myr 8

AF070599 Protein phosphatase 1 , regulatory (inhibitor) subunit 11

AF070599 Protein phosphatase 1 , regulatory (inhibitor) subunit 11

BC041951 CDNA clone IMAGE:5301545, partial cds

NR_000012 RNA, U68 small nucleolar

AK098125 Similar to hypothetical protein FLJ20296

AK096357 Hypothetical protein FLJ31795

AK095315 F-box only protein 9

AK126090 Guanine nucleotide binding protein (G protein), gamma 4

AK126881 CWF19-like 2, cell cycle control (S. pombe)

AK124762 FLJ90757 protein

AL713706 Dihydropyrimidinase-like 5

AK057562 Hypothetical protein LOC149086

AK093656 Homo sapiens cDNA FLJ36337 fis, clone THYMU2006324

BX648179 Schwannomin interacting protein 1

AF135168 N-ethylmaleimide-sensitive factor

NM_002285 Lymphoid nuclear protein related to AF4 AK026247 Hypothetical protein FLJ22594

AY094612 LOC441699

CA432118 Chromosome 21 open reading frame 104

AK000016 CDNA FLJ20009 fis, clone ADKA03183

AK024544 CDNA: FLJ20891 fis, clone ADKA03345

NM_177559 Casein kinase 2, alpha 1 polypeptide

NM_177559 Casein kinase 2, alpha 1 polypeptide

NM_198893 Zinc finger protein 160

NM_198893 Zinc finger protein 160

AK000568 Ceroid-lipofuscinosis, neuronal 6, late infantile, variant

AK056565 Tropomyosin 4

Y09703 Pinin, desmosome associated protein

Y09703 Pinin, desmosome associated protein

Z83804 gb:Z83804.1 /DB_XREF=gi:3928207 /TlD=Hs2.421613.2 /CNT=I /FEA=mRNA

/TlER=ConsEnd /STK=O /LL=1764 /UG_GENE=DNAH1 /UG=Hs.421613

/UG_TITLE=dynein, axonemal, heavy polypeptide 1 /DEF=H. sapiens mRNA for axonemal dynein heavy chain (partial, ID hdhc7).

NM_198829 Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)

NM_198829 Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)

Y11718 gb:Y11718.1 /DB_XREF=gi:1881448 /TID=Hs2.404151.1 /CNT=I /FEA=mRNA

/TIER=ConsEnd /STK=O /LL=54740 /UG_GENE=SPAG10 /UG=Hs.4O4151

/UG_TITLE=sperm associated antigen 10 /DEF=Homo sapiens sperm surface protein hP47, partial.

NM_002839 Protein tyrosine phosphatase, receptor type, D

AK128652 Hypothetical protein MGC27165

XM_378511 Hypothetical gene supported by BC031266

CA309468 Homo sapiens, clone IMAGE:4541768, mRNA

BX640817 Calmodulin-like 4

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

CA418310 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide

Il NM_020474 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1

(GaINAc-TI)

XM_091331 Hypothetical protein LOC162073

BC040191 Solute carrier family 35, member E4

BC033311 Homo sapiens, clone IMAGE:4823268, mRNA

BE788543 CDNA clone lMAGE:3878708, partial cds

CF272590 Hypothetical gene supported by AK075484; BC014578

BC077733 FGFR1 oncogene partner

BU733407 MGC16028 similar to RIKEN cDNA 1700019E19 gene

NM__004746 Discs, large (Drosophila) homolog-associated protein 1

BC027461 CDNA clone IMAGE:2984900, containing frame-shift errors

BC045555 Programmed cell death 6

BX649164 Serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type

1), member 1

AK092076 Uroporphyrinogen III synthase (congenital erythropoietic porphyria)

BC030759 Homo sapiens, clone IMAGE:4798168, mRNA

CR605219 Homo sapiens, clone IMAGE:5261280, mRNA BC024736 Homo sapiens, clone IMAGE:4915292, mRNA

AB082527 Acyl-Coenzyme A binding domain containing 5

BC038666 Fanconi anemia, complementation group D2

BC037540 Homo sapiens, clone IMAGE:4798439, mRNA

BX640681 Zinc finger protein 568

XM_291991 Similar to protein tyrosine phosphatase, receptor type, Q isoform 1 precursor; glomerular mesangial cell receptor protein-tyrosine phosphatase; glomerular mesangial cell receptor protein-tyrosine phosphatase precursor

BG403486 Homo sapiens cDNA FLJ41568 fis, clone CTONG2003094

AB007925 Formin binding protein 2

AB007925 Formin binding protein 2

BC037911 Homo sapiens, clone IMAGE:5277449, mRNA

BC053563 Likely ortholog of rat vacuole membrane protein 1

BM551014 CDNA clone IMAGE:465433O, partial cds

BX641141 Hypothetical protein similar to KIAA0187 gene product

BX647410 Similar to expressed sequence AW060714

BX647410 Similar to expressed sequence AW060714

AF459743 NEDD8 ultimate buster-1

BX648243 Hypothetical protein MGC48625

XM_496436 AAAP6077

BU618803 Homo sapiens, clone IMAGE:3459231, mRNA

BX648905 Zinc finger protein 198

AB051544 Hypothetical protein FLJ 10707

BC041873 FLJ 16030 protein

BC045555 Programmed cell death 6

BC016013 Homo sapiens, clone IMAGE:4695648, mRNA

AB002307 Snf2-related CBP activator protein

BC042071 Similar to RIKEN cDNA 5430419M09

XM_091914 Hypothetical protein LOC162993

AL708039 hypothetical protein LOC285989

NM_000828 Glutamate receptor, ionotrophic, AMPA 3

XM_374922 KIAA1731 protein

AB007940 RAB GTPase activating protein 1-like

BC014382 Homo sapiens, clone IMAGE:5557598, mRNA

BM468397 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_062553.1

(H.sapiens) hypothetical protein FLJ11267 [Homo sapiens]

AL833408 Zinc finger protein 569

AK126692 Zinc finger, FYVE domain containing 28

AK090463 RAB40C, member RAS oncogene family

NM_173582 Phosphoglucomutase 2-like 1

NM_003622 PTPRF interacting protein, binding protein 1 (liprin beta 1)

D84294 Tetratricopeptide repeat domain 3

AK091779 Hypothetical gene supported by BC044945; BC069032

BX648290 PDZ and LlM domain 3

BC012429 Homo sapiens, clone IMAGE:3865586, mRNA

BX648778 Phosphoinositide-3-kinase, class 2, alpha polypeptide

NM_004713 Serologically defined colon cancer antigen 1

AF218085 SAM domain, SH3 domain and nuclear localisation signals, 1 AK130173 Homo sapiens, clone IMAGE:4401848, mRNA

AK022538 Hypothetical protein FLJ 12476

NMJ322787 Nicotinamide nucleotide adenylyltransferase 1

NM_014325 Coronin, actin binding protein, 1C

AJ131245 SEC24 related gene family, member B (S. cerevisiae)

BC026117 Homo sapiens, clone IMAGE:4824322, mRNA

BC026112 Similarto hypothetical protein 4932412H11

BC033333 Homo sapiens, clone IMAGE:4831083, mRNA

AK090568 Hypothetical protein FLJ 10986

BC036550 Homo sapiens, clone lMAGE:5264670, mRNA

NM_016436 Chromosome 20 open reading frame 104

BC033539 Homo sapiens, clone IMAGE:4819052, mRNA

BC030617 Homo sapiens, Similarto syndecan binding protein (syntenin), clone IMAGE:4814292, mRNA

AK128034 Similar to cell division cycle 10 homolog

BC024593 Homo sapiens, clone IMAGE:3914314, mRNA

NM_080625 Chromosome 20 open reading frame 160

BC040199 FP6778

AK124684 Homo sapiens, clone IMAGE:4427279, mRNA

AK127265 Carbohydrate (chondroitin 4) sulfotransferase 11

AY210418 CUB and Sushi multiple domains 2

BC039552 Homo sapiens, clone IMAGE:5766850, mRNA

BC033981 Homo sapiens, clone IMAGE:5295453, mRNA

BC033243 Homo sapiens, clone IMAGE:5433475, mRNA

BM473515 LOC440731

AK098109 LIM and senescent cell antigen-like domains 1

BC024025 Homo sapiens, clone IMAGE:4700331 , mRNA

BG281555 Hypothetical gene supported by BC019009

BC020916 similar to ADAMTS-10 precursor (A disintegrin and metalloproteinase with thrombospondin motifs 10) (ADAM-TS 10) (ADAM-TS 10)

AK095600 Hypothetical protein FLJ38281

BC037257 gb:BC037257.1 /DB_XREF=gi:22658409 f[ΪD=Hs2.382115.1 /CNT=I /FEA=mRNA

/TIER=ConsEnd /STK=O /UG=Hs.382115 /UG_TITLE=Homo sapiens, clone

IMAGE:5106435, mRNA /DEF=Homo sapiens, clone IMAGE:5106435, mRNA.

BC034707 Homo sapiens, Similar to hypothetical protein FLJ20489, clone 1MAGE:4755321 , mRNA

BF693957 Homo sapiens, clone IMAGE:4246712, mRNA

AK126034 Chromosome 14 open reading frame 161

BC012364 Homo sapiens, Similarto likely ortholog of yeast ARV1, clone IMAGE:4576306, mRNA

NM_031482 APG10 autophagy 10-like (S. cerevisiae)

BC018531 CDNA clone IMAGE:4344985, partial cds

AK091080 Chromosome 18 open reading frame 17

BC031996 Homo sapiens, clone IMAGE:4753178, mRNA

BC031996 Homo sapiens, clone IMAGE:4753178, mRNA

NM_005935 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

2

BC038672 gb:BC038672.1 /DB_XREF=gi:24270824 /TID=Hs2.385779.1 /CNT=I /FEA=mRNA

/TIER=ConsEnd /STK=O /UG=Hs.385779 /UG_TITLE=Homo sapiens, Similarto neuronal thread protein, clone IMAGE:5265833, mRNA /DEF=Homo sapiens, Similarto neuronal thread protein, clone IMAGE:5265833, mRNA.

AK126533 Growth arrest-specific 6

NM_004995 Matrix metalloproteinase 14 (membrane-inserted)

NM_153425 TNFRSFIA-associated via death domain

BC068976 Phospholipase D1 , phophatidylcholine-specific

AK023420 BCL2-antagonist of cell death

BX649099 PRP8 pre-mRNA processing factor 8 homolog (yeast)

CR612316 Calpain, small subunit 1

CR622666 Ribosomal protein L35

NM_000991 Ribosomal protein L28

BC065276 Eukaryotic translation initiation factor 4 gamma, 2

BC071903 Eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa

AK091679 Parkinson disease (autosomal recessive, early onset) 7

BM805684 Signal recognition particle 14kDa (homologous AIu RNA binding protein)

AK122841 GDP dissociation inhibitor 2

AK122841 GDP dissociation inhibitor 2

CR597812 Ribosomal protein L11

NM_001659 ADP-ribosylation factor 3

CR602527 Ribosomal protein L21

CR608385 Ribosomal protein L24

AK126950 Heterogeneous nuclear ribonucleoprotein C (C1/C2)

D63878 Neural precursor cell expressed, developmentally down-regulated 5

BF206515 Heterogeneous nuclear ribonucleoprotein A1

BU588489 Ribosomal protein S27a

BE621497 Ribosomal protein S 13

BM994406 Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived);

> ribosomal protein S30

NM_007375 TAR DNA binding protein

BM462286 Cofilin 1 (non-muscle)

AK091257 Ribosomal protein L18

AK095574 Eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa

BG 165682 Ribosomal protein S5

BF219474 Ribosomal protein L27

AK055920 Ribosomal protein L34

BC001687 Asparaginyl-tRNA synthetase

BC014274 START domain containing 7

BF698920 Ribosomal protein L19

BX647062 Solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3

AK130324 Ribosomal protein S11

AL832047 Ribosomal protein L9

BX571764 DEAD (Asp-Glu-Ala-Asp) box polypeptide 5

BQ057679 Ribosomal protein L6

BG913659 Dullard homolog (Xenopus laevis)

BF569048 Ribosomal protein L10a

BX647444 Chromobox homolog 3 (HP1 gamma homolog, Drosophila)

BF970890 Ribosomal protein L17

BM545813 Proteasome (prosome, macropain) subunit, beta type, 2

BC010132 KH domain containing, RNA binding, signal transduction associated 1 AK127767 HLA-B associated transcript 1

BC002970 Hypothetical protein HSPC117

BI856529 Enhancer of rudimentary homolog (Drosophila)

CR591670 Splicing factor, arginine/serine-rich 9

BC034488 ATP-binding cassette, sub-family F (GCN20), member 1

BF697316 Defender against cell death 1

BX647456 YY1 transcription factor

BQ062593 Jumping translocation breakpoint

AK122932 MYST histone acetyltransferase 2

BC065568 Zinc finger protein 146

NM_005146 Squamous cell carcinoma antigen recognised by T cells

BG121872 lnterleukin enhancer binding factor 2, 45kDa

AK123065 Sperm associated antigen 7

BC004256 Zinc finger protein 259

AL833496 TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 3OkDa

BM675402 Nuclear DNA-binding protein

NM_007363 Non-POU domain containing, octamer-binding

NM_014014 Activating signal cointegrator 1 complex subunit 3-like 1

BM994352 Ras homolog gene family, member A

AK092131 RNA binding protein S1, serine-rich domain

BX647260 Ribosomal protein S24

AK128768 Ribosomai protein L30

BF131656 Nucleophosmin (nucleolar phosphoprotein B23, numatrin)

AY359878 Heat shock 9OkDa protein 1, beta

AK023803 ADP-ribosylation factor 1

BF204682 IK cytokine, down-regulator of HLA Il

AL078596 sorting nexin 3

NM_001746 Calnexin

AB020880 Squamous cell carcinoma antigen recognised by T cells 3

NM_015680 Chromosome 2 open reading frame 24

BC039110 Survival motor neuron domain containing 1

NM_005968 Heterogeneous nuclear ribonucleoprotein M

AL832723 Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1 , 37kDa)

BF572302 Ribosomal protein L14

AK124677 Guanylate kinase 1

BX648739 Hypothetical protein MGC2749

BC035151 Ornithine decarboxylase antizyme 1

BC053601 ATPase, H+ transporting, lysosomal 21kDa, VO subunit c"

AF285758 Lysyl-tRNA synthetase

BM907805 H3 histone, family 3B (H3.3B)

BM994553 Ribosomal protein S6

BF570942 Ribosomal protein S7

XM_042698 Ubiquitin specific protease 22

AK094549 Small acidic protein

BU603847 Transcription elongation factor B (SIII), polypeptide 2 (18kDa, elongin B)

AK027136 Cytochrome c oxidase subunit IV isoform 1

NMJ306815 Coated vesicle membrane protein

AK026491 gb:AK026491.1 /DB_XREF=gi: 10439364 /FEA=mRNA /CNT=92 /TID=Hs.182979.1 /TIER=Stack /STK=25 /UG=Hs.182979 /LL=6136 /UG_GENE=RPL12 /UG_TITLE=ribosomal protein L12 /DEF=Homo sapiens cDNA: FLJ22838 fis, clone KAIA4494, highly similar to HUML12A Human ribosomal protein L12 mRNA.

CR615743 Ribosomal protein L4

BC037295 Farnesyltransferase, CAAX box, alpha

BG033630 Ribosomal protein S25

AL137450 Ribosomal protein L37

AK054976 Histidine triad nucleotide binding protein 1

BM670470 Transcribed locus

B1254120 Ribosomal protein S 10

BQ230447 ATPase, H+ transporting, lysosomal 9kDa, VO subunit e

NM_002140 Heterogeneous nuclear ribonucleoprotein K

BC045686 Anaphase promoting complex subunit 5

AL356115 gb:AL356115 /DB_XREF=gi:9795038 /FEA=DNA_1 /CNT=I /TID=Hs.3O7132.0

/TIER=ConsEnd /STK=O /UG=Hs.3O7132 /UG_TITLE=Human DNA sequence from clone RP11-486O22 on chromosome 10 Contains the 3part of a gene for KIAA1128 protein, a novel pseudogene, a gene for protein similar to RPS3A (ribosomal protein S3A), ESTs, STSs, GSSs and CpG islands /DEF=Human DNA sequence from clone RP11-486O22 on chromosome 10 Contains the 3part of a gene for KIAA1128 protein, a novel pseudogene, a gene for protein similar to RPS3A (rib

AF068846 Heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)

AF068846 Heterogeneous nuclear ribonucleoprotein U (scaffold attachment factor A)

D50929 Eukaryotic translation initiation factor 3, subunit 10 theta, 150/17OkDa

D50929 Eukaryotic translation initiation factor 3, subunit 10 theta, 150/17OkDa

D50929 Eukaryotic translation initiation factor 3, subunit 10 theta, 150/17OkDa

AK025459 Tumor rejection antigen (gp96) 1

AK025459 Tumor rejection antigen (gp96) 1

NMJD02444 Moesin

U48734 actinin, alpha 4

BX537935 Amyloid beta (A4) precursor protein (protease nexin-ll, Alzheimer disease)

CR749311 Protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1 )

CR749311 Protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1 )

CR749311 Protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)

NM_004415 Desmoplakin

NM_006265 RAD21 homolog (S. pombe)

NM_006265 RAD21 homolog (S. pombe)

BX648190 WD repeat domain 1

AK128584 Nucleolin

BX648190 WD repeat domain 1

NM_001282 Adaptor-related protein complex 2, beta 1 subunit

BC014030 Adaptor-related protein complex 2, mu 1 subunit

NM_004859 Clathrin, heavy polypeptide (Hc)

NM_001282 Adaptor-related protein complex 2, beta 1 subunit

NM_014730 KIAA0152 gene product

NM_014730 KIAA0152 gene product

NM_006148 LIM and SH3 protein 1

NM_006842 splicing factor 3b, subunit 2, 145kDa

AK074636 Chromosome 1 open reading frame 8 CR627407 Cysteine and glycine-rich protein 1

AK094964 Calmodulin 3 (phosphorylase kinase, delta)

AK094964 Calmodulin 3 (phosphorylase kinase, delta)

BX537365 Matrin 3

NM_006367 CAP, adenylate cyclase-associated protein 1 (yeast)

BX537365 Matrin 3

AK098214 Unactive progesterone receptor, 23 kD

NM_004184 Tryptophanyl-tRNA synthetase

NM_004184 Tryptophanyl-tRNA synthetase

NM_003011 SET translocation (myeloid leukemia-associated)

NM_003011 SET translocation (myeloid leukemia-associated)

AK124709 N-myc downstream regulated gene 1

BF572309 Ubiquitin B

BQ055155 Profilin 1

NM_002840 Protein tyrosine phosphatase, receptor type, F

NM_002840 Protein tyrosine phosphatase, receptor type, F

NM_002840 Protein tyrosine phosphatase, receptor type, F

BC051814 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

BC051814 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

BC051814 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

BC051814 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

BF131654 Superoxide dismutase 1 , soluble (amyotrophic lateral sclerosis 1 (adult))

NM_005336 High density lipoprotein binding protein (vigilin)

BU168218 MARCKS-like protein

BM803698 GABA(A) receptor-associated protein

NM_006184 Nucleobindin 1

BX648075 Eukaryotic translation initiation factor 3, subunit 8, 11OkDa

AL161952 Glutamate-ammonia ligase (glutamine synthase)

NM_006184 Nucleobindin 1

BM994401 Lactate dehydrogenase A

AK124177 Guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1

BX649192 Signal sequence receptor, beta (translocon-associated protein beta)

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

J02783 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide

(protein disulfide isomerase; thyroid hormone binding protein p55)

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

J02783 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide

(protein disulfide isomerase; thyroid hormone binding protein p55)

AK092094 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5

BF676086 Prohibitin

BF676086 Prohibitin

BF131641 S100 calcium binding protein A11 (calgizzarin)

AK172808 Protective protein for beta-galactosidase (galactosialidosis)

NM_014765 Translocase of outer mitochondrial membrane 20 homolog (yeast) BM701371 CD63 antigen (melanoma 1 antigen)

BG537255 DnaJ (Hsp40) homolog, subfamily B, member 1

AK126525 Secreted protein, acidic, cysteine-rich (osteonectin)

BC002352 DnaJ (Hsp40) homolog, subfamily B, member 1

AK127304 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)

AK127304 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)

AK127304 Ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)

AK093842 X-box binding protein 1

NM_003128 Spectrin, beta, non-erythrocytic 1

NM_003128 Spectrin, beta, non-erythrocytic 1

BM994353 Lysosomal-associated protein transmembrane 4 alpha

AK124029 Ribosomal protein L32

CR622188 CD81 antigen (target of antiproliferative antibody 1 )

AK125396 Ubiquitin-conjugating enzyme E2L 3

AK095586 Pituitary tumor-transforming 1 interacting protein

NM_002087 Granulin

AK122825 High-mobility group box 1

AK122825 High-mobility group box 1

BC011365 Glyoxalase l

AK125396 Ubiquitin-conjugating enzyme E2L 3

AK125396 Ubiquitin-conjugating enzyme E2L 3

AK125396 Ubiquitin-conjugating enzyme E2L 3

BX640645 Splicing factor, arginine/serine-rich 11

BX640645 Splicing factor, arginine/serine-rich 11

D13642 Splicing factor 3b, subunit 3, 13OkDa

BM994408 Eukaryotic translation elongation factor 1 gamma

NM_004134 Heat shock 7OkDa protein 9B (mortalin-2)

NM_004134 Heat shock 7OkDa protein 9B (mortalin-2)

NM_004134 Heat shock 7OkDa protein 9B (mortalin-2)

NM_006826 Tyrosine 3-monooxygenaseΛryptophan 5-monooxygenase activation protein, theta polypeptide

BX537533 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24

AK090488 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform

AK125819 Gelsolin (amyloidosis, Finnish type)

AK128226 Hexokinase 1

AK093917 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2

AK093917 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2

AK093917 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2

BQ896617 Niemann-Pick disease, type C2

BG421209 DEAD (Asp-Glu-Ala-Asp) box polypeptide 24

BG 165659 Dynein, cytoplasmic, light polypeptide 1

AB034747 Lipopolysaccharide-induced TNF factor

BF214113 Eukaryotic translation elongation factor 1 beta 2

AB034747 Lipopolysaccharide-induced TNF factor

NM_002743 Protein kinase C substrate 80K-H

BC000525 Glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)

BG107659 FK506 binding protein 1A, 12kDa

AK097243 Acyl-Coenzyme A dehydrogenase, very long chain NM_003197 S-phase kinase-associated protein 1A (p19A)

BC040410 Microtubule-associated protein, RP/EB family, member 1

BC040410 Microtubule-associated protein, RP/EB family, member 1

AL137691 Amplified in osteosarcoma

AK056837 Ribosomal protein L13a

AK056837 Ribosomal protein L13a

BM555701 Ribosomal protein L7

NM_003197 S-phase kinase-associated protein 1A (p19A)

NM_003197 S-phase kinase-associated protein 1A (p19A)

AK096085 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)

AK096085 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)

NM_005898 Membrane component, chromosome 11 , surface marker 1

NM_005898 Membrane component, chromosome 11 , surface marker 1

NM_006013 Ribosomal protein L10

NM_002710 Protein phosphatase 1 , catalytic subunit, gamma isoform

NM_001005386 ARP2 actin-related protein 2 homolog (yeast)

NMJD01005386 ARP2 actin-related protein 2 homolog (yeast)

NM_001005386 ARP2 actin-related protein 2 homolog (yeast)

BF576710 protein tyrosine phosphatase type IVA, member 1

BF576710 protein tyrosine phosphatase type IVA, member 1

BF576710 protein tyrosine phosphatase type IVA, member 1

CR749458 Protein tyrosine phosphatase type IVA, member 1

NM_001659 ADP-ribosylation factor 3

AK096699 Nascent-polypeptide-associated complex alpha polypeptide

BM478682 Glutathione peroxidase 1

NM_000291 Phosphoglycerate kinase 1

NM_000291 Phosphoglycerate kinase 1

NMJ506936 SMT3 suppressor of mif two 3 homolog 3 (yeast)

NM_006936 SMT3 suppressor of mif two 3 homolog 3 (yeast)

BU597628 Ribosomal protein S27 (metallopanstimulin 1)

NM_000391 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)

NM_000391 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)

AK123609 Guanine nucleotide binding protein (G protein), beta polypeptide 1

AK123609 Guanine nucleotide binding protein (G protein), beta polypeptide 1

AK123609 Guanine nucleotide binding protein (G protein), beta polypeptide 1

NM_006185 Nuclear mitotic apparatus protein 1

BM994491 Ferritin, heavy polypeptide 1

BM994514 RAN, member RAS oncogene family

BM994514 RAN, member RAS oncogene family

AK126950 Heterogeneous nuclear ribonucleoprotein C (C1/C2)

BC008751 Calpain 1 , (mu/l) large subunit

NM_003016 Splicing factor, arginine/serine-rich 2

NM_003016 Splicing factor, arginine/serine-rich 2

NM_001219 Calumenin

NM_001219 Calumenin

NM_001219 Calumenin

AK090459 Nuclear factor (erythroid-derived 2)-like 1

AK090459 Nuclear factor (erythroid-derived 2)-like 1 NM_006407 ADP-ribosylation-like factor 6 interacting protein 5

NM_006407 ADP-ribosylation-like factor 6 interacting protein 5

AL833091 Dihydropyrimidinase-like 2

BF983386 Ribosomal protein, large, P1

U03100 Catenin (cadherin-associated protein), alpha 1, 102kDa

U03100 Catenin (cadherin-associated protein), alpha 1, 102kDa

AK022293 Cathepsin D (lysosomal aspartyl protease)

BC075701 Chromosome 9 open reading frame 10

NM_005911 Methionine adenosyltransferase II, alpha

NM_005911 Methionine adenosyltransferase II, alpha

NM_002293 Laminin, gamma 1 (formerly LAMB2)

NM_002293 Laminin, gamma 1 (formerly LAMB2)

BF686442 prothymosin, alpha (gene sequence 28)

BX647606 Prothymosin, alpha (gene sequence 28)

BE963765 chromosome 9 open reading frame 10

NM_002140 Heterogeneous nuclear ribonucleoprotein K

XM_045290 Similar to basic leucine zipper and W2 domains 1

AL833518 Basic leucine zipper and W2 domains 1

D63878 Neural precursor cell expressed, developmentally down-regulated 5

NM_001675 Activating transcription factor 4 (tax-responsive enhancer element B67)

NM_080425 GNAS complex locus

AK127316 Ribosomal protein S15a

BM994439 Annexin A5

BX647885 Stathmin 1 /oncoprotein 18

NM_002332 Low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)

NM_002332 Low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor)

AL832574 Proteasome (prosome, macropain) subunit, beta type, 7

NM_003768 Phosphoprotein enriched in astrocytes 15

NM_003768 Phosphoprotein enriched in astrocytes 15

AK126566 Enoyl Coenzyme A hydratase 1 , peroxisomal

CR614398 Ornithine decarboxylase 1

NM_003870 IQ motif containing GTPase activating protein 1

BC008343 Thyroid autoantigen 7OkDa (Ku antigen)

CR595461 Aconitase 2, mitochondrial

AK125855 DAZ associated protein 2

NM_021960 Myeloid cell leukemia sequence 1 (BCL2-related)

NM_021960 Myeloid cell leukemia sequence 1 (BCL2-related)

NM_021960 Myeloid cell leukemia sequence 1 (BCL2-related)

BC018740 Heat shock 7OkDa protein 1 A

BC018740 Heat shock 7OkDa protein 1 A

AK125561 Actin, beta

AK093718 Seryl-tRNA synthetase

AK130050 Testis enhanced gene transcript (BAX inhibitor 1 )

AK130050 Testis enhanced gene transcript (BAX inhibitor 1 )

AK025041 Lectin, mannose-binding 2

L33477 Cadherin 12, type 2 (N-cadherin 2)

BC047350 Heat shock 6OkDa protein 1 (chaperonin)

BC073825 Zyxin AK057602 Ribosomal protein L12

AK095781 Cold inducible RNA binding protein

AK095781 Cold inducible RNA binding protein

NM_006429 Chaperonin containing TCP1 , subunit 7 (eta)

NM_000430 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa

BQ073751 Proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)

NM_000430 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa

NM_000430 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa

BI254120 Ribosomal protein S10

BF965152 ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit (oligomycin sensitivity conferring protein)

BM923584 Ribosomal protein S15

NM_002812 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 8

BX648255 Lysosomal-associated membrane protein 2

BM913099 Triosephosphate isomerase 1

BM907839 Ribosomal protein L29

BM926728 Glutathione S-transferase pi

NM_006389 Hypoxia up-regulated 1

BQ050126 Small nuclear ribonucleoprotein D2 polypeptide 16.5kDa

NM_000302 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type Vl)

AL834501 Zinc finger protein 207

AL834501 Zinc finger protein 207

NM_002808 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 2

NM_005063 Stearoyl-CoA desaturase (delta-9-desaturase)

NM_005063 Stearoyl-CoA desaturase (delta-9-desaturase)

AK127392 RAP1 B, member of RAS oncogene family

AK125931 Ribosomal protein S21

NM_002375 Microtubule-associated protein 4

AL833282 B-cell receptor-associated protein 31

AK097384 Cathepsin B

AK097384 Cathepsin B

AF285758 Lysyl-tRNA synthetase

NM_004446 Glutamyl-prolyl-tRNA synthetase

NM_004446 Glutamyl-prolyl-tRNA synthetase

NM_004446 Glutamyl-prolyl-tRNA synthetase

NM_004905 Peroxiredoxin 6

NM_004905 Peroxiredoxin 6

AK098311 Protein phosphatase 1 , catalytic subunit, alpha isoform

AK025927 Hypothetical protein MGC8721

AK131563 S-adenosylhomocysteine hydrolase-like 1

AK131563 S-adenosylhomocysteine hydrolase-like 1

AK131563 S-adenosylhomocysteine hydrolase-like 1

NM_014761 KIAA0174 gene product

BQ064399 Guanine nucleotide binding protein (G protein), beta polypeptide 2

AK056803 H2A histone family, member Z

AF087856 Nuclear receptor co-repressor 1

AF087856 Nuclear receptor co-repressor 1 AF087856 Nuclear receptor co-repressor 1

AF087856 Nuclear receptor co-repressor 1

BG033629 Ribosomal protein S8

NM_001456 Filamin A, alpha (actin binding protein 280)

NM_016284 Kl AA1007 protein

NM_016284 KIAA1007 protein

BC011669 24-dehydrocholesterol reductase

BC013348 RAB11 A, member RAS oncogene family

BC013348 RAB11A, member RAS oncogene family

BC007612 Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy)

AL031685 zinc finger protein 313

NM_018683 Zinc finger protein 313

CR619918 Ribosomal protein L18a

BM994403 Serine/threonine kinase receptor associated protein

BC007612 Prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy)

CD388106 S100 calcium binding protein A10 (annexin Il ligand, calpactin I, light polypeptide (p11))

BC012584 Chaperonin containing TCP1 , subunit 8 (theta)

BX641071 Nucleolar protein 5A (56kDa with KKE/D repeat)

BX641071 Nucleolar protein 5A (56kDa with KKE/D repeat)

AK125435 Proteasome (prosome, macropain) subunit, beta type, 1

NM_006430 Chaperonin containing TCP1 , subunit 4 (delta)

NMJD01430 Endothelial PAS domain protein 1

NM_001430 Endothelial PAS domain protein 1

AK095541 DnaJ (Hsp40) homolog, subfamily A, member 1

AK095541 DnaJ (Hsp40) homolog, subfamily A, member 1

BF206537 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

AK094006 Ubiquinol-cytochrome c reductase core protein Il

BF341561 Creatine kinase, brain

NM_005167 Protein phosphatase 2a, catalytic subunit, zeta isoform

AK125057 Phosphoglycerate mutase 1 (brain)

NM_007315 Signal transducer and activator of transcription 1 , 91 kDa

AK095288 Ribosomal protein L23

NM_003144 Signal sequence receptor, alpha (translocon-associated protein alpha)

NM_003144 Signal sequence receptor, alpha (translocon-associated protein alpha)

NM_003144 Signal sequence receptor, alpha (translocon-associated protein alpha)

CR749214 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)

CR749214 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)

NM_002014 FK506 binding protein 4, 59kDa

NM_002014 FK506 binding protein 4, 59kDa

NM_004494 Hepatoma-derived growth factor (high-mobility group protein 1-like)

NM_016081 Palladin

AF036144 Meningioma expressed antigen 5 (hyaluronidase)

AF036144 Meningioma expressed antigen 5 (hyaluronidase)

BC024206 Mannose-6-phosphate receptor (cation dependent)

BC024206 Mannose-6-phosphate receptor (cation dependent)

BF240785 15 kDa selenoprotein

AK097610 S-adenosylhomocysteine hydrolase

X56841 Major histocompatibility complex, class I, E X56841 Major histocompatibility complex, class I1 E

NM_016081 Palladin

NM_016081 Palladin

BM912995 Ribosomal protein, large P2

BM912995 Ribosomal protein, large P2

AL833197 Chaperonin containing TCP1 , subunit 3 (gamma)

AF049910 Transforming, acidic coiled-coil containing protein 1

BC039344 Eukaryotic translation initiation factor 4A, isoform 2

NM_177983 Protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform

BX537523 Kinectin 1 (kinesin receptor)

NM_004986 kinectin 1 (kinesin receptor)

CR620277 Transgelin 2

BC013583 Signal recognition particle receptor ('docking protein')

BC013583 Signal recognition particle receptor ('docking protein')

NM_198040 Polyhomeotic-like 2 (Drosophila)

BC009050 B-cell translocation gene 1, antiproliferative

BC009050 B-cell translocation gene 1, antiproliferative

BG 116085 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1

BC015761 Lectin, galactoside-binding, soluble, 3 binding protein

AK025584 Solute carrierfamily 3 (activators of dibasic and neutral amino acid transport), member 2

BM704057 Cytochrome c oxidase subunit Via polypeptide 1

AK125939 Ribosomal protein S23

AL162081 RAB14, member RAS oncogene family

NM_006827 Transmembrane trafficking protein

NM_014000 Vinculin

AK022171 Dynactin 2 (p50) '

BM994563 Ribosomal protein S4, X-linked

BX641063 DEK oncogene (DNA binding)

M84739 Calreticulin

BG033603 Ribosomal protein L8

BX648424 Ribosomal protein L5

NM_012102 Arginine-glutamic acid dipeptide (RE) repeats

BX648254 Heat shock factor binding protein 1

NMJD01537 Homo sapiens heat shock factor binding protein 1 (HSBP1), mRNA

CR616640 High-mobility group nucleosome binding domain 1

CR616640 High-mobility group nucleosome binding domain 1

AK128047 SEC31-like 1 (S. cerevisiae)

NM_005271 Glutamate dehydrogenase 1

NM_005271 Glutamate dehydrogenase 1

BM919311 Myeloid leukemia factor 2

AK094652 Ribosomal protein S20

BE870210 Actin related protein 2/3 complex, subunit 1A, 41kDa

NM_001759 Cyclin D2

BX537369 Inner membrane protein, mitochondrial (mitofilin)

M86737 Structure specific recognition protein 1

M86737 Structure specific recognition protein 1

AK128645 Syndecan binding protein (syntenin)

CR602284 Fusion (involved in t(12;16) in malignant liposarcoma) CR599555 Clathrin, light polypeptide (Lea)

NM_012248 Selenophosphate synthetase 2

CR595Q74 Ribosomal protein L31

CR595074 Ribosomal protein L31

BC009900 Ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)

NM_001003408 Actin binding LIM protein 1

AK098778 Aldolase A, fructose-bisphosphate

BG288717 Peptidylprolyl isomerase B (cyclophilin B)

BG288717 Peptidylprolyl isomerase B (cyclophilin B)

AK125413 Stress-associated endoplasmic reticulum protein 1

AK125413 Stress-associated endoplasmic reticulum protein 1

AK125413 Stress-associated endoplasmic reticulum protein 1

AK027793 Transmembrane 4 superfamily member 8

AK027793 Transmembrane 4 superfamily member 8

BX647362 Actin, alpha 2, smooth muscle, aorta

NM_000310 Palmitoyl-protein thioesterase 1 (ceroid-lipofuscinosis, neuronal 1, infantile)

NM_006024 Taxi (human T-cell leukemia virus type I) binding protein 1

NM_006024 Taxi (human T-cell leukemia virus type I) binding protein 1

AL832067 Malate dehydrogenase 1, NAD (soluble)

AK131477 FLJ 16518 protein

BG036317 Pyruvate dehydrogenase (lipoamide) alpha 1

NM_080425 GNAS complex locus

NM_001155 Annexin A6

NM_203330 GD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30,

EL32 and G344)

NM_203330 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30,

EL32 and G344)

NM_203330 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30,

EL32 and G344)

CR614379 Serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)

NM_176863 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)

NM_176863 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)

NM_001530 Hypoxia-inducible factor 1 , alpha subunit (basic helix-loop-helix transcription factor)

X97548 Tripartite motif-containing 28

NMJ014748 Sorting nexin 17

AK074908 lmportin 7

AK074908 lmportin 7

AK074908 lmportin 7

AK074908 lmportin 7

BC044590 ARP3 actin-related protein 3 homolog (yeast)

AK094046 RNA binding motif protein 4

NM_006825 Cytoskeleton-associated protein 4

NM_006825 Cytoskeleton-associated protein 4

NM_001605 Alanyl-tRNA synthetase

NM_199203 Ubiquitin-conjugating enzyme E2 variant 1

NM_199203 Ubiquitin-conjugating enzyme E2 variant 1

NM_199203 Ubiquitin-conjugating enzyme E2 variant 1 AK057117 Signal sequence receptor, delta (translocon-associated protein delta)

AK025016 CD9 antigen (p24)

AK095278 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme

A hydratase (trifunctional protein), beta subunit

NM_006472 Thioredoxin interacting protein

NM_006472 Thioredoxin interacting protein

NM_006472 Thioredoxin interacting protein

AK097792 Ribophorin I

AK074480 Annexin A1

BX538303 Phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase

BX538303 Phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase

BX648177 Junction plakoglobin

NM_001412 Eukaryotic translation initiation factor 1A, X-linked

NM_001412 Eukaryotic translation initiation factor 1A, X-linked

NM_001412 Eukaryotic translation initiation factor 1A, X-linked

NM_001412 Eukaryotic translation initiation factor 1A, X-linked

CR622695 Tyrosine 3-monoαxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide

BG254735 Destrin (actin depolymerizing factor)

BG254735 Destrin (actin depolymerizing factor)

NM_005642 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55kDa

AB018284 Eukaryotic translation initiation factor 5B

AB018284 Eukaryotic translation initiation factor 5B

AB018284 Eukaryotic translation initiation factor 5B

AB018284 Eukaryotic translation initiation factor 5B

BF125416 CD99 antigen

BF125416 CD99 antigen

BG110199 Lactate dehydrogenase B

BX647205 Heterogeneous nuclear ribonucleoprotein H1 (H)

AK093009 Bladder cancer associated protein

BF570115 Ribosomal protein, large, PO

BX538224 Adducin 3 (gamma)

AK096018 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain

AK096018 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain

AK126153 Phosphofructokinase, platelet

AK127498 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A

BF343783 RAD23 homolog A (S. cerevisiae)

AK126708 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2

AK127679 Dual specificity phosphatase 1

AL031651 gb:AL031651 /DB_XREF=gi:6065866 /FEA=FLmRNA /CNT=453 /TID=Hs.8265.0

/TIER=Stack /STK=206 /UG=Hs.8265 /LL=7052/UG_GENE=TGM2 /UG_TITLE=transglutaminase 2 (C polypeptide, protein-glutamine-gamma- glutamyltransferase) /DEF=Human DNA sequence from clone RP5-1054A22 on chromosome 20q11.22-12 Contains two isoforms of the gene for TGM2 (transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase), ESTs, STSs, GSSs and a CpG island /FL=gb:M55153.1 gb:NM_004613.1

AK127498 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A AK127679 Dual specificity phosphatase 1

BF343783 RAD23 homolog A (S. cerevisiae)

NMJD02869 RAB6A, member RAS oncogene family

NMJD02869 RAB6A, member RAS oncogene family

BX537589 Ribosomal protein S18

BX648310 Phospholipase D3

AK127498 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member A

NM_006814 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31)

NM_006814 Proteasome (prosome, macropain) inhibitor subunit 1 (PI31)

NM_006805 Heterogeneous nuclear ribonucleoprotein AO

NM__006805 Heterogeneous nuclear ribonucleoprotein AO

NM_004487 Golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1

NM_004487 Golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1

BM701565 Myosin, light polypeptide 9, regulatory

M98343 Cortactin

NM_004099 Stomatin

M81635 stomatin

AK126419 Reticulocalbin 1, EF-hand calcium binding domain

AK125926 PoIy(A) binding protein, cytoplasmic 4 (inducible form)

NM_032999 General transcription factor II, i

BF569085 Cytochrome c-1

NM_002803 Proteasome (prosome, macropain) 26S subunit, ATPase, 2

NMJD02803 Proteasome (prosome, macropain) 26S subunit, ATPase, 2

AL832088 Matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)

NM_012433 Splicing factor 3b, subunit 1, 155kDa

NM_012433 Splicing factor 3b, subunit 1, 155kDa

NM_003074 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1

NM_003074 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1

NM_003074 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1

NM_003074 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1

AK124020 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)

AK124020 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)

NM_004800 Transmembrane 9 superfamily member 2

BC000407 Synaptogyrin 2

NM_003559 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta

NM_003559 Phosphatidylinositol-4-phosphate 5-kinase, type II, beta

NM_004082 Dynactin 1 (p150, glued homolog, Drosophila)

NM_014739 BCL2-associated transcription factor 1

NM_014739 BCL2-associated transcription factor 1

NM_058183 SON DNA binding protein

NM_058183 SON DNA binding protein

AK128712 Paxillin

BC067848 Karyopherin alpha 2 (RAG cohort 1, importin alpha 1)

NM_001693 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 AK094717 Tubulin, alpha, ubiquitous

BX647444 Chromobox homolog 3 (HP1 gamma homolog, Drosophila)

AK127332 Retinoblastoma binding protein 7

AK131478 Succinate dehydrogenase complex, subunit A, flavoprotein (Fp)

BM922591 Ribosomal protein S29

BC002726 Death-associated protein

BC016325 ADP-ribosylation factor 4

BC016325 ADP-ribosylation factor 4

AK128561 Coatomer protein complex, subunit beta 2 (beta prime)

NM_004652 Ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)

NM_004652 Ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)

NM_014739 BCL2-associated transcription factor 1

NM_001002021 Phosphofructokinase, liver

BE299495 gb:BE299495 /DB_XREF=gi:9183243 /DB_XREF=600944774T1 /CLONE=IMAGE:2960610 /FEA=FLmRNA /CNT=240 /TID=Hs.218329.0 /TIER=Stack /STK=62 /UG=Hs.218329 /LL=25832 /UG_GENE=DJ328E19.C1.1 /UG_TITLE=hypothetical protein /FL=gb:NM_015383.1

AL117237 Hypothetical protein DJ328E19.C1.1

BF570935 Lectin, galactoside-binding, soluble, 1 (galectin 1)

BG115861 Glutathione peroxidase 4 (phospholipid hydroperoxidase)

NM_003246 Thrambospondin 1

NM_003246 Thrombospondin 1

NM_003246 Thrombospondin 1

NM_003246 Thrombospondin 1

NM_001316 CSE1 chromosome segregation 1-like (yeast)

NM_001316 CSE1 chromosome segregation 1-like (yeast)

BM922354 Tu translation elongation factor, mitochondrial

AK127210 Proteasome (prosome, macropain) subunit, alpha type, 7

AK025276 Polymerase (DNA directed), delta 2, regulatory subunit 5OkDa

NM_001873 Carboxypeptidase E

NM_001873 Carboxypeptidase E

NM_002631 Phosphogluconate dehydrogenase

BM919236 Cytochrome c oxidase subunit 8A (ubiquitous)

NM_006667 Progesterone receptor membrane component 1

NM_006667 Progesterone receptor membrane component 1

BM696167 Eukaryotic translation initiation factor 5A

BM696167 Eukaryotic translation initiation factor 5A

AK091595 Integrin, beta 5

AK091595 Integrin, beta 5

AK094130 Mannosyl (alpha-1 ,3-)-glycoprotein beta-1 ,2-N-acetylglucosaminyltransferase

NM_001096 ATP citrate lyase

NM_001096 ATP citrate lyase

NM_006276 Splicing factor, arginine/serine-rich 7, 35kDa

CR624721 Heterogeneous nuclear ribonucleoprotein H2 (H')

NM_014819 Praja 2, RING-H2 motif containing

CR599916 Cytochrome c oxidase subunit VIIc

NM_004092 Enoyl Coenzyme A hydratase, short chain, 1, mitochondrial

BF214130 Proteolipid protein 2 (colonic epithelium-enriched) BC013184 Major histocompatibility complex, class II, DP beta 1

AK124811 Sjogren syndrome antigen B (autoantigen La)

AK124811 Sjogren syndrome antigen B (autoantigen La)

BM720015 RAB5C, member RAS oncogene family

BC032783 Glycoprotein (transmembrane) nmb

NM_004094 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa

NM_004094 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa

NM_004094 Eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa

BQ277134 HS1 binding protein

BX647407 Nuclear factor (erythroid-derived 2)-like 2

AB051444 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)

AB051444 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)

AB051444 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)

AB051444 Tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)

NM_021038 Muscleblind-like (Drosophila)

NMJ521038 Muscleblind-like (Drosophila)

NM_021038 Muscleblind-like (Drosophila)

CR615743 Ribosomal protein L4

D86987 Mitofusin 2

BM720015 RAB5C, member RAS oncogene family

NM_021079 N-myristoyltransferase 1

NM_021079 N-myristoyltransferase 1

NM_003651 Cold shock domain protein A

NM_003651 Cold shock domain protein A

BX648756 Insulin-like growth factor binding protein 7

BX648756 Insulin-like growth factor binding protein 7

AF315592 PRO0611 protein

AF315592 PRO0611 protein

AF315592 PRO0611 protein

BM994500 Rho GDP dissociation inhibitor (GDI) alpha

BM994500 Rho GDP dissociation inhibitor (GDI) alpha

NM_003670 Basic helix-loop-helix domain containing, class B, 2

BQ230447 ATPase, H+ transporting, lysosomal 9kDa, VO subunit e

BQ230447 ATPase, H+ transporting, lysosomal 9kDa, VO subunit e

BG121847 Nuclear distribution gene C homolog (A. nidulans)

AF289599 Telomeric repeat binding factor 2, interacting protein

BF242985 Thioredoxin-related transmembrane protein 2

BX640860 Archain 1

AK124730 SUMO-1 activating enzyme subunit 2

BX648151 F-box protein 7

NM_006496 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3

NM_006496 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3

NM_006496 _ Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3

BC038596 Chromodomain helicase DNA binding protein 4

BC038596 Chromodomain helicase DNA binding protein 4

BC038596 Chromodomain helicase DNA binding protein 4

BC031082 Protease, serine, 11 (IGF binding)

BC007841 Low density lipoprotein receptor-related protein associated protein 1 NMJD02224 Inositol 1,4,5-triphosphate receptor, type 3

BC045108 Phosphatidyliπositol transfer protein, alpha

BC045108 Phosphatidylinositol transfer protein, alpha

BC045108 Phosphatidylinositol transfer protein, alpha

AF020038 lsocitrate dehydrogenase 1 (NADP+), soluble

BF341549 Selenoprotein W, 1

AF104032 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 5

BC041345 Adenosylmethionine decarboxylase 1

BC041345 Adenosylmethionine decarboxylase 1

NM_002807 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1

NMJ302807 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 1

NMJ303851 Cellular repressor of E1A-stimulated genes 1

CR591371 Cystatin B (stefin B)

BE896331 Proliferating cell nuclear antigen

AB037819 Ribosome binding protein 1 homolog 18OkDa (dog)

AB037819 Ribosome binding protein 1 homolog 18OkDa (dog)

AB037819 Ribosome binding protein 1 homolog 18OkDa (dog)

AB037819 Ribosome binding protein 1 homolog 18OkDa (dog)

BG003694 Tumor necrosis factor, alpha-induced protein 1 (endothelial)

BX648622 Histone deacetylase 1

NM_001356 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked

NM_001356 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked

BX161434 Legumain

BC051689 Protein phosphatase 1, regulatory subunit 7

BC056898 Plastin 3 (T isoform)

CR623789 Chromosome 12 open reading frame 8

AL832757 Ribosomal protein L3

AL832108 C-terminal binding protein 2

AL832108 C-terminal binding protein 2

AL832108 C-terminal binding protein 2

AL832819 Small nuclear ribonucleoprotein 7OkDa polypeptide (RNP antigen)

NM_002874 RAD23 homolog B (S. cerevisiae)

NM_002874 RAD23 homolog B (S. cerevisiae)

NM_005839 Serine/arginine repetitive matrix 1

NM_005839 Serine/arginine repetitive matrix 1

BM994351 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa

BM994351 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa

AF099149 Ariadne homolog 2 (Drosophila)

AF099149 Ariadne homolog 2 (Drosophila)

AF099149 Ariadne homolog 2 (Drosophila)

AK090592 Enolase 1, (alpha)

NM_175932 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 13

NM_175932 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 13

BU738798 Integrin-linked kinase

NM_006763 BTG family, member 2

AV685920 capping protein (actin filament) muscle Z-line, alpha 2

NM_006136 Capping protein (actin filament) muscle Z-line, alpha 2

AK091429 KIAA0102 gene product AK091429 KIAA0102 gene product

NM_004939 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1

NM_001677 ATPase, Na+/K+ transporting, beta 1 polypeptide

NM_001677 ATPase, Na+/K+ transporting, beta 1 polypeptide

NM_002880 V-raf-1 murine leukemia viral oncogene homolog 1

AK091830 OTU domain, ubiquitin aldehyde binding 1

AK091830 OTU domain, ubiquitin aldehyde binding 1

BC051385 Sterol regulatory element binding transcription factor 2

BC051385 Sterol regulatory element binding transcription factor 2

NM_006516 Solute carrier family 2 (facilitated glucose transporter), member 1

NM_182470 Pyruvate kinase, muscle

CR611800 Proteasome (prosome, macropain) 26S subunit, ATPase, 4

AK097691 GDP-diacylglycerol-inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)

BM994553 Ribosomal protein S6

NM_004639 HLA-B associated transcript 3

AK130281 Cytochrome c oxidase subunit Vila polypeptide 2 like

BI087817 Ribosomal protein S3A

AK055869 Ribosomal protein S16

AK128299 Synaptophysin-like protein

AK128299 Synaptophysin-like protein

BC004244 Biglycan

BC004244 Biglycan

NM_003191 threonyl-tRNA synthetase

AK023303 Coatomer protein complex, subunit epsilon

NM_003330 Thioredoxin reductase 1

NMJ302804 Proteasome (prosome, macropain) 26S subunit, ATPase, 3

BG114681 Non-metastatic cells 2, protein (NM23B) expressed in

AB028991 Kl AA1068 protein

AF116649 RNA binding protein (autoantigenic, hnRNP-associated with lethal yellow)

BF131618 Aldo-keto reductase family 1 , member B1 (aldose reductase)

BC064351 Signal recognition particle 9kDa

AL833149 Proteasome (prosome, macropain) subunit, alpha type, 5

AK021828 Farnesyl diphosphate synthase (farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase)

BX537408 RAB5B, member RAS oncogene family

AK123488 Heterogeneous nuclear ribonucleoprotein A/B

NM_001343 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

NM_001343 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

NM_001343 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

CR749213 Adhesion regulating molecule 1

NM_002541 Oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)

J03068 N-acylaminoacyl-peptide hydrolase

BC000362 N-acylaminoacyl-peptide hydrolase

AK127030 Makorin, ring finger protein, 1

Z48199 syndecan 1

AJ551176 Syndecan 1

AK125625 Rho GDP dissociation inhibitor (GDI) beta

Y11307 Cysteine-rich, angiogenic inducer, 61 6 008055

CR749656 Signal peptidase complex (18kD)

NM_001067 Topoisomerase (DNA) Il alpha 17OkDa

NM_001067 Topoisomerase (DNA) Il alpha 17OkDa

AK130101 Peptidylprolyl isomerase A (cyclophilin A)

NM_134264 WD repeat and SOCS box-containing 1

NM_134264 WD repeat and SOCS box-containing 1

NM_134264 WD repeat and SOCS box-containing 1

AK123865 MOB1 , Mps One Binder kinase activator-like 1 B (yeast)

AK123865 MOB1, Mps One Binder kinase activator-like 1B (yeast)

AK123865 MOB1, Mps One Binder kinase activator-like 1B (yeast)

NM_000311 Prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia)

BX641114 Annexin A4

BX641114 Annexin A4

CR749455 DEAD (Asp-Glu-Ala-Asp) box polypeptide 48

BF576548 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa

AV712577 acidic (leucine-rich) nuclear phosphoprotein 32 family, member B

BF683719 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member B

CR627457 Septin H

CR627457 Septin H

CR749489 Chromosome 5 open reading frame 13

CR749489 Chromosome 5 open reading frame 13

AK024892 SH3 domain binding glutamic acid-rich protein like

AK024892 SH3 domain binding glutamic acid-rich protein like

AK124656 Enolase 2 (gamma, neuronal)

AK125895 Serine/threonine kinase 25 (STE20 homolog, yeast)

BM993772 Interferon induced transmembrane protein 2 (1-8D)

BX641097 Proteasome (prosome, macropain) subunit, alpha type, 2

BX641097 Proteasome (prosome, macropain) subunit, alpha type, 2

BF694761 Myosin regulatory light chain MRCL3

BF694761 Myosin regulatory light chain MRCL3

BG292067 Myosin, light polypeptide 6, alkali, smooth muscle and non-muscle

NM_003075 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2

BG177099 ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

CR605987 EBNA1 binding protein 2

NM_001423 Epithelial membrane protein 1

NM_001423 Epithelial membrane protein 1

BE737030 chaperonin containing TCP1 , subunit 6A (zeta 1 )

AB063318 Chaperonin containing TCP1 , subunit 6A (zeta 1 )

NMJD05239 V-ets erythroblastosis virus E26 oncogene homolog 2 (avian)

NM_002887 Arginyl-tRNA synthetase

NM_003153 Signal transducer and activator of transcription 6, interleukin-4 induced

NM_003153 Signal transducer and activator of transcription 6, interleukin-4 induced

AF180681 Rho guanine nucleotide exchange factor (GEF) 12

NM_004781 Vesicle-associated membrane protein 3 (cellubrevin)

NM_004781 Vesicle-associated membrane protein 3 (cellubrevin)

AL832728 General transcription factor IHA BX537619 Sterol carrier protein 2

AF059611 Ectodermal-neural cortex (with BTB-like domain)

AF059611 Ectodermal-neural cortex (with BTB-like domain)

BU603692 Small nuclear ribonucleoprotein polypeptide C

NWM81838 Ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)

NM_181838 Ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)

NM_181838 Ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast)

AK128511 Adiponectin receptor 2

AK024386 Glyoxylate reductase/hydroxypyruvate reductase

NM_002084 Glutathione peroxidase 3 (plasma)

NM_004475 Flotillin 2

NMJ39312 YME1-like 1 (S. cerevisiae)

NMJ39312 YME1-like 1 (S. cerevisiae)

NM_013449 Bromodomain adjacent to zinc finger domain, 2A

BF129339 gb:BF129339 /DB_XREF=gi:10968379 /DB_XREF=601810961 R1

/CLONE=IMAGE:4053975 /FEA=FLmRNA /CNT=330 /TID=Hs.288883.0 /TIER=Stack

/STK=72 /UG=Hs.288883 /LL=10291 /UG_GENE=SF3A1 /UG_TITLE=splicing factor 3a, subunit 1, 120kD /FL=gb:NMJ)05877.1

NM_005877 Splicing factor 3a, subunit 1, 12OkDa

NM_016451 Coatomer protein complex, subunit beta

NM_016451 Coatomer protein complex, subunit beta

BX647523 Cystatin C (amyloid angiopathy and cerebral hemorrhage)

BC001309 Hypothetical protein MGC5508

NM_016389 Influenza virus NS1A binding protein

NM_016389 Influenza virus NS1A binding protein

BX648172 Ornithine decarboxylase antizyme 2

BX648172 Ornithine decarboxylase antizyme 2

NM_004034 Annexin A7

NM_006887 Zinc finger protein 36, C3H type-like 2

NM_006887 Zinc finger protein 36, C3H type-like 2

NM_006887 Zinc finger protein 36, C3H type-like 2

NM_003590 Cullin 3

NM_003590 Cullin 3

NM_201380 Plectin 1 , intermediate filament binding protein 50OkDa

CR624064 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform

CR624064 Protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform

AK001364 Heterogeneous nuclear ribonucleoprotein F

NM_014847 Ubiquitin associated protein 2-like

NM_014847 Ubiquitin associated protein 2-like

AK125263 Tumor protein D52-like 2

NM_006371 Cartilage associated protein

AK093425 Siah-interacting protein

BC012847 Homo sapiens, Similar to next to the Brcai, clone 1MAGE:3858519, mRNA

NM_031858 Membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen

CA125)

BC047577 DEAH (Asp-Glu-Ala-His) box polypeptide 15

BC047577 DEAH (Asp-Glu-Ala-His) box polypeptide 15

AK055249 Ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) D67025 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3

BX647780 Integrin, alpha 5 (fibronectin receptor, alpha polypeptide)

CR598133 Casein kinase 2, beta polypeptide

BX648257 TNF receptor-associated protein 1

NM_000876 Insulin-like growth factor 2 receptor

NM_000876 Insulin-like growth factor 2 receptor

AF091263 RNA binding motif protein 5

AF091263 RNA binding motif protein 5

NM_003021 Small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha

AK093306 Phosphoglycerate dehydrogenase

BC032018 Translocation associated membrane protein 1

BC032018 Translocation associated membrane protein 1

BI333607 Proteasome (prosome, macropain) subunit, beta type, 3

BX537737 Microsomal glutathione S-transferase 3

BG000268 proteasome (prosome, macropain) subunit, beta type, 2

BM542040 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)

AK096711 Ribosomal protein L36a

NM_002709 Protein phosphatase 1, catalytic subunit, beta isoform

NM_002709 Protein phosphatase 1, catalytic subunit, beta isoform

NM_002709 Protein phosphatase 1, catalytic subunit, beta isoform

AK093730 Pleckstrin homology domain containing, family B (evectins) member 2

AK093730 Pleckstrin homology domain containing, family B (evectins) member 2

AY358399 Low density lipoprotein receptor-related protein 10

AL713635 Hydroxysteroid (17-beta) dehydrogenase 4

AK095320 Nucleosome assembly protein 1-like 4

BC007927 Glutathione synthetase

NM_003107 SRY (sex determining region Y)-box 4

NM_003107 SRY (sex determining region Y)-box 4

NM_004656 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)

NM_024102 MEP50 protein

NM_024102 MEP50 protein

AK123477 Interferon, gamma-inducible protein 30

AL833355 Cullin 4A

AL833355 Cullin 4A

NM_000690 Aldehyde dehydrogenase 2 family (mitochondrial)

AK093924 Vimentin

BC030009 Selenoprotein P, plasma, 1

BC067789 Ribosomal protein L37a

BC077077 Dihydropyrimidinase-like 3

BC077077 Dihydropyrimidinase-like 3

NM_001752 Catalase

BC004192 Phosphatidylserine synthase 1

AK128840 Tetratricopeptide repeat domain 1

BC035166 Eukaryotic translation initiation factor 4E

BC035166 Eukaryotic translation initiation factor 4E

BC035166 Eukaryotic translation initiation factor 4E

NM_004369 Collagen, type Vl, alpha 3

AK025330 Golgi-specific brefeldin A resistance factor 1 NM_004818 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23

CD517959 Cytochrome c oxidase subunit Vib polypeptide 1 (ubiquitous)

AK075382 ATPase, H+ transporting, lysosomal accessory protein 2

AK075382 ATPase, H+ transporting, lysosomal accessory protein 2

NM_001839 Calponin 3, acidic

NMJD22173 TIA1 cytotoxic granule-associated RNA binding protein

NM_022173 TIA1 cytotoxic granule-associated RNA binding protein

NM_022173 TIA1 cytotoxic granule-associated RNA binding protein

NM_022173 TIA1 cytotoxic granule-associated RNA binding protein

NM_022173 TIA1 cytotoxic granule-associated RNA binding protein

AK125446 Ras homolog enriched in brain

NM_006310 Aminopeptidase puromycin sensitive

NM_006310 Aminopeptidase puromycin sensitive

BX647392 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)

BX647392 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)

BX647392 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)

AK057498 RuvB-like 2 (E. coli)

NM_004759 Mitogen-activated protein kinase-activated protein kinase 2

NM_004759 Mitogen-activated protein kinase-activated protein kinase 2

NM_014766 Secernin 1

AK130060 Transaldolase 1

NMJ302228 V-jun sarcoma virus 17 oncogene homolog (avian)

NM_002228 V-jun sarcoma virus 17 oncogene homolog (avian)

NM_002228 V-jun sarcoma virus 17 oncogene homolog (avian)

NM_000903 NAD(P)H dehydrogenase, quinone 1

NM_000903 NAD(P)H dehydrogenase, quinone 1

BX647149 SHG (Src homology 2 domain containing) transforming protein 1

BQ224776 Glutathione S-transferase omega 1

BG017222 Sequestosome 1

U96759 Von Hippel-Lindau binding protein 1

CR601699 Jun B proto-oncogene

M59911 Integrin, alpha 3 (antigen GD49C, alpha 3 subunit of VLA-3 receptor)

AK122956 Methionine-tRNA synthetase

AK122695 Ribonucleotide reductase M1 polypeptide

AK122695 Ribonucleotide reductase M1 polypeptide

BC009928 Dyskeratosis congenita 1, dyskerin

BC009928 Dyskeratosis congenita 1, dyskerin

AK091476 Suppressor of Ty 5 homolog (S. cerevisiae)

BC017045 Phosphorylase, glycogen; brain

NM_002826 Quiescin Q6

BM994535 Suppressor of Ty 4 homolog 1 (S. cerevisiae)

BM994535 Suppressor of Ty 4 homolog 1 (S. cerevisiae)

AK126522 Reticulocalbin 2, EF-hand calcium binding domain

AK126522 Reticulocalbin 2, EF-hand calcium binding domain

BX537913 Cathepsin C

BC010132 KH domain containing, RNA binding, signal transduction associated 1

NM_005729 Peptidylprolyl isomerase F (cyclophilin F)

NM_005729 Peptidylprolyl isomerase F (cyclophilin F) BF686657 AHA1 , activator of heat shock 9OkDa protein ATPase homolog 1 (yeast)

BU533672 Ribosomal protein L41

AF315591 Vacuolar protein sorting 35 (yeast)

NM_199418 Prolylcarboxypeptidase (angiotensinase C)

NM_003470 Ubiquitin specific protease 7 (herpes virus-associated)

NM_003470 Ubiquitin specific protease 7 (herpes virus-associated)

AF070599 Protein phosphatase 1 , regulatory (inhibitor) subunit 11

AK124242 G-rich RNA sequence binding factor 1

BM908726 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

BG500067 Ras-GTPase-activating protein SH3-domain-binding protein

NM_004622 Translin

NM_002291 Laminin, beta 1

BC026352 Transforming growth factor, beta-induced, 68kDa

AK093558 Prefoldin 1

CR603382 Insulin-like growth factor binding protein 4

BQ051868 lsocitrate dehydrogenase 3 (NAD+) beta

CR594232 Angio-associated, migratory cell protein

BC065555 Translocase of outer mitochondrial membrane 70 homolog A (yeast)

NM_004622 Translin

AK128316 Ras-GTPase-activating protein SH3-domain-binding protein

NM_004622 Translin

BF669714 Spermidine synthase

BX537372 Nuclear cap binding protein subunit 2, 2OkDa

NM_006807 Chromobox homolog 1 (HP1 beta homolog Drosophila )

BC065555 Translocase of outer mitochondrial membrane 70 homolog A (yeast)

AK124242 G-rich RNA sequence binding factor 1

BX537372 Nuclear cap binding protein subunit 2, 2OkDa

BX648788 SNRPN upstream reading frame

NM_003348 Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)

NM_003348 Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)

BU726293 Apolipoprotein D

BM906964 ADP-ribosylation factor 5

BM907716 ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F

NM_002945 Replication protein A1 , 7OkDa

NM_002945 Replication protein A1 , 7OkDa

BG033657 Eukaryotic translation initiation factor 4A, isoform 1

CR597101 Zinc finger protein 36, C3H type, homolog (mouse)

CR606347 Proteasome (prosome, macropain) subunit, alpha type, 3

BX648430 Catenin (cadherin-associated protein), beta 1, 88kDa

BC044582 Ubiquitin-like 3

BC044582 Ubiquitin-like 3

NM_004090 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1 -related)

NM_004090 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1 -related)

NM_004090 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1 -related)

AK122708 Four and a half LIM domains 1

AK122708 Four and a half LIM domains 1

BM807959 Zinc finger, HIT domain containing 1

NMJD20150 SARIa gene homolog 1 (S. cerevisiae) NM_020150 SARIa gene homolog 1 (S. cerevisiae)

BF675004 poly(A) binding protein, nuclear 1

NM_004643 PoIy(A) binding protein, nuclear 1

NMJD04238 Homo sapiens thyroid hormone receptor interactor 12 (TRIP12), mRNA

NM_006618 Jumonji, AT rich interactive domain 1 B (RBP2-like)

NM_006618 Jumonji, AT rich interactive domain 1 B (RBP2-like)

CR606241 Actin, gamma 1

BC025335 Lysosomal-associated membrane protein 1

BC025335 Lysosomal-associated membrane protein 1

BC025335 Lysosomal-associated membrane protein 1

CR601242 Glycogenin

NMJ302388 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)

NM_014232 Vesicle-associated membrane protein 2 (synaptobrevin 2)

NM_014232 Vesicle-associated membrane protein 2 (synaptobrevin 2)

AK126Q24 RAE1 RNA export 1 homolog (S. pombe)

AL117424 Chloride intracellular channel 4

AL117424 Chloride intracellular channel 4

AB020718 Calsyntenin 1

NMJ303104 Sorbitol dehydrogenase

NM_003104 Sorbitol dehydrogenase

NMJ303088 Fascin homolog 1 , actin-bundling protein (Strongylocentrotus purpuratus)

CR623038 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein

CR623038 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein

NM_002078 Golgi autoantigen, golgin subfamily a, 4

BM701597 Low molecular mass ubiquinone-binding protein (9.5kD)

AK124895 CGI-51 protein

AK124895 CGI-51 protein

NM_001921 DCMP deaminase

NM_001921 DCMP deaminase

BC014269 Eukaryotic translation termination factor 1

BC014269 Eukaryotic translation termination factor 1

AF045184 SKI interacting protein

AK126979 Galactosidase, beta 1

BM809638 Non-metastatic cells 1, protein (NM23A) expressed in

NM_005245 FAT tumor suppressor homolog 1 (Drosophila)

BC044777 Hypothetical protein DJ971N18.2

BC044777 Hypothetical protein DJ971 N18.2

AL121900 Sec23 homolog B (S. cerevisiae)

BC005404 Sec23 homolog B (S. cerevisiae)

CR592759 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39

AK095702 Splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)

AK095702 Splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)

L76191 lnterleukin-1 receptor-associated kinase 1

BX640857 Thioredoxin-like 1

NM_006306 SMC1 structural maintenance of chromosomes 1-like 1 (yeast)

BF242966 Annexin A2

AK001505 Nischarin

AK093128 Eukaryotic translation initiation factor 3, subunit 3 gamma, 4OkDa NM_018471 Likely ortholog of mouse immediate early response, erythropoietin 4

AF200478 Protein phosphatase 4, regulatory subunit 1

NM_018471 Likely ortholog of mouse immediate early response, erythropoietin 4

CR616919 Keratin 18

BF210089 Cytochrome c oxidase subunit Vila polypeptide 2 (liver)

Y14385 Inositol polyphosphate phosphatase-like 1

BC016928 Ornithine aminotransferase (gyrate atrophy)

BF204697 Repressor of estrogen receptor activity

BF210063 Interferon induced transmembrane protein 1 (9-27)

AF458589 Protein phosphatase 1 , regulatory (inhibitor) subunit 12A

AF458589 Protein phosphatase 1, regulatory (inhibitor) subunit 12A

AF458589 Protein phosphatase 1, regulatory (inhibitor) subunit 12A

NM_004368 Calponin 2

BM457614 Nuclear phosphoprotein similar to S. cerevisiae PWP1

BM457614 Nuclear phosphoprotein similar to S. cerevisiae PWP1

BM457614 Nuclear phosphoprotein similar to S. cerevisiae PWP1

NM_170705 lsoprenylcysteine carboxyl methyltransferase

NM_170705 lsoprenylcysteine carboxyl methyltransferase

NM_000696 Aldehyde dehydrogenase 9 family, member A1

BX647488 RuvB-like 1 (E. coli)

NM_033138 Caldesmon 1

NM_033138 Caldesmon 1

NM_033138 Caldesmon 1

AL157437 GPAA1 P anchor attachment protein 1 homolog (yeast)

BF667541 Peroxiredoxin 3

NM_003791 Membrane-bound transcription factor protease, site 1

NIVM 82744 Neuroblastoma, suppression of tumorigenicity 1

NM_014390 Staphylococcal nuclease domain containing 1

NM_001349 Aspartyl-tRNA synthetase

NM_001349 Aspartyl-tRNA synthetase

NM_198336 Insulin induced gene 1

NM_198336 Insulin induced gene 1

NM_198336 Insulin induced gene 1

U41654 Ras-related GTP binding A

NM_177554 Acid phosphatase 1, soluble

NM_177554 Acid phosphatase 1, soluble

BM994398 Immediate early response 3

CR624872 Eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa

AW235051 cytochrome b5 outer mitochondrial membrane precursor

BX647922 Hypothetical protein LOC283852

AY341428 Fragile X mental retardation, autosomal homolog 1

AY341428 Fragile X mental retardation, autosomal homolog 1

AY341428 Fragile X mental retardation, autosomal homolog 1

BC017232 Cleavage and polyadenylation specific factor 1, 16OkDa

AF037339 Cleft lip and palate associated transmembrane protein 1

BU739064 Bone marrow stromal cell antigen 2

NM_005534 Interferon gamma receptor 2 (interferon gamma transducer 1)

NM_016604 Jumonji domain containing 1B AK096752 Tissue specific transplantation antigen P35B

NM_002160 Tenascin C (hexabrachion)

NM_005506 Scavenger receptor class B, member 2

NM_005506 Scavenger receptor class B, member 2

BX648044 Janus kinase 1 (a protein tyrosine kinase)

AK093462 UbiqUitin-conjugating enzyme E2L 6

BG292068 Keratin 19

NM_007229 Protein kinase C and casein kinase substrate in neurons 2

BX648542 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)

BF102713 Cornichon homolog (Drosophila)

M85289 Heparan sulfate proteoglycan 2 (perlecan)

M85289 Heparan sulfate proteoglycan 2 (perlecan)

X53586 Integrin, alpha 6

BX537387 ADP-ribosylation factor-like 1

BX537387 ADP-ribosylation factor-like 1

BX537387 ADP-ribosylation factor-like 1

NM_004457 Acyl-CoA synthetase long-chain family member 3

NM_004457 Acyl-CoA synthetase long-chain family member 3

NM_004457 Acyl-CoA synthetase long-chain family member 3

NM_005496 SMC4 structural maintenance of chromosomes 4-like 1 (yeast)

NM_005496 SMC4 structural maintenance of chromosomes 4-like 1 (yeast)

BM918752 Ribosomal protein S17

BM994443 Tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)

NM_000165 Gap junction protein, alpha 1 , 43kDa (connexin 43)

NM_002356 Myristoylated alanine-rich protein kinase C substrate

NM_002356 Myristoylated alanine-rich protein kinase C substrate

NM_002356 Myristoylated alanine-rich protein kinase C substrate

AK095516 Ubiquitin specific protease 14 (tRNA-guanine transglycosylase)

AK095516 Ubiquitin specific protease 14 (tRNA-guanine transglycosylase)

NM_002103 Glycogen synthase 1 (muscle)

BC036702 A kinase (PRKA) anchor protein 1

BF673978 Proteasome (prosome, macropain) subunit, alpha type, 1

A1937543 Transcribed locus

BC050686 DC 12 protein

NM_182800 Arsenate resistance protein ARS2

NM_182800 Arsenate resistance protein ARS2

NM_004747 Discs, large homolog 5 (Drosophila)

AK057656 Peptidase (mitochondrial processing) beta

AB018280 Chromosome 14 open reading frame 92

AB018280 Chromosome 14 open reading frame 92

AB018280 Chromosome 14 open reading frame 92

NM_006595 Apoptosis inhibitor 5

NMJD06595 Apoptosis inhibitor 5

NM_147160 Opioid receptor, sigma 1

AV733950 early growth response 1

NM_001964 Early growth response 1

AK126154 Nucleoside phosphorylase

CR595944 Splicing factor, arginine/serine-rich 4 NM_001379 DNA (cytosine-5-)-methyltransferase 1

CR591670 Splicing factor, arginine/serine-rich 9

AK127456 Proteasome (prosome, macropain) 26S subunit, ATPase, 6

AK096276 Cyclin D3

AK094949 Progesterone receptor membrane component 2

NM_002714 Protein phosphatase 1, regulatory subunit 10

AK124625 Ectonucleoside triphosphate diphosphohydrolase 6 (putative function)

BG121813 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)

NM_002857 Peroxisomal biogenesis factor 19

NM_002857 Peroxisomal biogenesis factor 19

NM_003634 Nipsnap homolog 1 (C. elegans)

NM_003634 Nipsnap homolog 1 (C. elegans)

NMJD06267 RAN binding protein 2

NMJ306267 RAN binding protein 2

NM_006267 RAN binding protein 2

NM_001070 Tubulin, gamma 1

NM_014977 Apoptotic chromatin condensation inducer 1

AK128179 Sorting nexin 1

AK123252 Mitochondrial ribosomal protein L49

AK127088 Erythrocyte membrane protein band 4.1-like 2

AK127088 Erythrocyte membrane protein band 4.1-like 2

NM_020474 UDP-N-acetyl-alpha-D-galactosamineipolypeptide N-acetylgalactosaminyltransferase 1

(GaINAc-TI)

NM_020474 UDP-N-acetyl-alpha-D-galactosamineφolypeptide N-acetylgalactosaminyltransferase 1

(GaINAc-TI)

NM_020474 UDP-N-acetyl-alpha-D-galactosamineipolypeptide N-acetylgalactosaminyltransferase 1

(GaINAc-TI)

AK023925 Chromosome 10 open reading frame 7

NMJ301419 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)

NM_001419 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)

NM_014680 K1AA0100 gene product

NM__003292 Translocated promoter region (to activated MET oncogene)

NM_003292 Translocated promoter region (to activated MET oncogene)

BX647119 Chloride channel 3

BX647119 Chloride channel 3

NM_005885 Membrane-associated RING-CH protein Vl

NM_005885 Membrane-associated RING-CH protein Vl

BU739860 Translation factor sui1 homolog

BX649005 Serum/glucocorticoid regulated kinase

BG115841 NADH dehydrogenase (ubiquinone) Fe-S protein 3, 3OkDa (NADH-coenzyme Q reductase)

AK126318 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)

BG 114678 Lumican

NM_198974 PTK9 protein tyrosine kinase 9

NM_000546 Tumor protein p53 (Li-Fraumeni syndrome)

CR749251 Scaffold attachment factor B

CR749251 Scaffold attachment factor B

BX648351 Endothelin converting enzyme 1

BX648351 Endothelin converting enzyme 1 CR596979 KIAA0063 gene product

BX538224 Adducin 3 (gamma)

BX538224 Adducin 3 (gamma)

AK128382 Cytochrome c oxidase subunit VIc

BG 107669 Replication protein A2, 32kDa

BM704055 NADH dehydrogenase (ubiquinone) Fe-S protein 5, 15kDa (NADH-coenzyme Q reductase)

AK128742 Tumor susceptibility gene 101

NM_018639 WD repeat and SOCS box-containing 2

BC015062 Methylene tetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase

CR618033 Proteasome (prosome, macropain) activator subunit 2 (PA28 beta)

AB015051 Death-associated protein 6

AK056442 Hypothetical protein MGC5576

BX537989 Hexosaminidase A (alpha polypeptide)

BC042491 EIaC homolog 2 (E. coli)

AK128594 Enthoprotin

AK128594 Enthoprotin

BM803674 Small nuclear ribonucleoprotein polypeptide A

NM_005698 Secretory carrier membrane protein 3

BC042404 Ornithine decarboxylase antizyme inhibitor

BC075794 Activity-dependent neuroprotector

D63880 Chromosome condensation-related SMC-associated protein 1

AB007963 KIAA0494 gene product

AB007963 KIAA0494 gene product

AB007963 K1AA0494 gene product

NM_014774 Homo sapiens KIAA0494 gene product (KIAA0494), mRNA

NM_007282 Ring finger protein 13

NMJD07282 Ring finger protein 13

BG913006 Aryl hydrocarbon receptor interacting protein

BG913006 Aryl hydrocarbon receptor interacting protein

BC033522 V-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3, p65 (avian)

AK094549 Small acidic protein

X79448 Adenosine deaminase, RNA-specific

AK128725 Fibulin 1

NM_007372 DEAD (Asp-Glu-Ala-Asp) box polypeptide 42

BC000054 7-dehydrocholesterol reductase

BC000054 7-dehydrocholesterol reductase

NM_001129 AE binding protein 1

NM_173156 Chromosome 1 open reading frame 16

NM_002296 Lamin B receptor

X59303 VaIyMRNA synthetase 2

AF182316 Fer-1-like 3, myoferlin (C. elegans)

AF185696 Oxysterol binding protein

AF185696 Oxysterol binding protein

AK090615 Solute carrier family 29 (nucleoside transporters), member 1

BC023503 Polymerase (RNA) Il (DNA directed) polypeptide B, 14OkDa

BM703883 Cytoskeleton associated protein 1 BU739444 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit

AY188338 Ataxin 2-like

BX647725 Vacuolar protein sorting 26 (yeast)

NM_000118 Endoglin (Osler-Rendu-Weber syndrome 1)

NM_000118 Endoglin (Osler-Rendu-Weber syndrome 1 )

AK098488 SH3-domain binding protein 5 (BTK-associated)

AK098488 SH3-domain binding protein 5 (BTK-associated)

BG473946 Translocase of outer mitochondrial membrane 7 homolog (yeast)

NM_014744 TBC1 domain family, member 5

NM_014744 TBC1 domain family, member 5

NM_014744 TBC1 domain family, member 5

AK125036 Glioblastoma amplified sequence

NM_014671 Homo sapiens ubiquitin protein ligase E3C (UBE3C), mRNA

AK090444 Hypothetical protein FLJ 12443

AK023485 Scavenger receptor class B, member 1

AK023063 Translocase of inner mitochondrial membrane 17 homolog A (yeast)

AK023063 Translocase of inner mitochondrial membrane 17 homolog A (yeast)

NM_004290 Ring finger protein 14

NM_004290 Ring finger protein 14

NM_016002 CGI-49 protein

NM_016002 CGI-49 protein

NM_003077 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2

BM808256 CAAX box 1

BX537509 Neuroepithelial cell transforming gene 1

BX537509 Neuroepithelial cell transforming gene 1

AL832010 Vesicle docking protein p115

AL832010 Vesicle docking protein p115

BC031055 Histone deacetylase 2

BC001823 Protein kinase, AMP-activated, beta 1 non-catalytic subunit

BC001823 Protein kinase, AMP-activated, beta 1 non-catalytic subunit

AB018307 SPTF-associated factor 65 gamma

AB018307 SPTF-associated factor 65 gamma

BQ643397 Neural precursor cell expressed, developmentally down-regulated 8

BM541936 Heat shock 27kDa protein 1

NM_004105 EGF-containing flbuHn-like extracellular matrix protein 1

NM_004105 EGF-containing fibulin-like extracellular matrix protein 1

AB029551 RING1 and YY1 binding protein

AB029551 RING1 and YY1 binding protein

AB029551 RING1 and YY1 binding protein

AK091558 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease)

U15174 BCL2/adenovirus E1 B 19kDa interacting protein 3

NM_004052 Homo sapiens BCL2/adenovirus E1 B 19kDa interacting protein 3 (BNIP3), nuclear gene encoding mitochondrial protein, mRNA

BF690828 Capping protein (actin filament), gelsolin-like

AK130943 SH3-domain GRB2-like 1 .

NM_000090 Collagen, type 111, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant)

NM_021874 Cell division cycle 25B CR749457 KIAA0431 protein

CR749457 KIAA0431 protein

BC000376 zinc finger RNA binding protein

NM_016107 Zinc finger RNA binding protein

CD359027 Proteoglycan 1 , secretory granule

CD359027 Proteoglycan 1, secretory granule

BX641021 Plasminogen activator, tissue

AJ223075 Leucine rich repeat (in FLII) interacting protein 1

AJ223075 Leucine rich repeat (in FLII) interacting protein 1

BM923512 Family with sequence similarity 32, member A

AK131466 GDP dissociation inhibitor 1

NM_000176 Nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)

NM_000176 Nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)

Y12781 Transducin (beta)-like 1X-linked

Y12781 Transducin (beta)-like 1 X-linked

NM_006809 Translocase of outer mitochondrial membrane 34

BC032689 ORF

NM_002940 ATP-binding cassette, sub-family E (OABP), member 1

NM_002940 ATP-binding cassette, sub-family E (OABP), member 1

NM_003953 Myelin protein zero-like 1

NM_003953 Myelin protein zero-like 1

AK054688 Paraoxonase 2

NM_002719 Protein phosphatase 2, regulatory subunit B (B56), gamma isoform

BX641117 Ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

BX641117 Ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

BX641117 Ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

BX641117 Ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)

NM_001497 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1

NM_007326 Diaphorase (NADH) (cytochrome b-5 reductase)

NM_025230 WD repeat domain 23

Y10659 lnterleukin 13 receptor,.alpha 1

Y10659 lnterleukin 13 receptor, alpha 1

BC024200 Family with sequence similarity 3, member C

AK123010 Ribonucleotide reductase M2 polypeptide

AK022379 Beta-2-microglobulin

BM554073 IMP (inosine monophosphate) dehydrogenase 2

NMJD01920 Decorin

NM_001920 Decorin

NM_001654 V-raf murine sarcoma 3611 viral oncogene homolog 1

BC001425 CDC28 protein kinase regulatory subunit 1 B

BQ278454 CDC28 protein kinase regulatory subunit 1 B

BC042021 Ubiquitin-conjugating enzyme E2A (RAD6 homolog)

BC042021 Ubiquitin-conjugating enzyme E2A (RAD6 homolog)

BM994518 Aldo-keto reductase family 1 , member A1 (aldehyde reductase)

BX647456 YY1 transcription factor

L16842 Ubiquinol-cytochrome c reductase core protein I

BF031714 chromosome 3 open reading frame 8

NM_005808 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like D86963 Dishevelled, dsh homolog 3 (Drosophila)

NM_005766 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)

NM_005766 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)

AK095367 G1 to S phase transition 1

BC067254 Coenzyme A synthase

NM_007214 SEC63-like (S. cerevisiae)

NM_007214 SEC63-like (S. cerevisiae)

NM_007214 SEC63-like (S. cerevisiae)

AL049246 Hypothetical protein FLJ 10618

AL049246 Hypothetical protein FLJ 10618

AL049246 Hypothetical protein FLJ10618

NM_005415 Solute carrier family 20 (phosphate transporter), member 1

AK095452 Guanine nucleotide binding protein (G protein), gamma 10

BF215849 TGF beta-inducible nuclear protein 1

BM674623 Peroxiredoxin 4

NM_005935 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

2

NM_000574 Decay accelerating factor for complement (CD55, Cramer blood group system)

NM_000574 Decay accelerating factor for complement (CD55, Cramer blood group system)

NM_003628 Plakophilin 4

NM_003628 Plakophilin 4

NM_003628 Plakophilin 4

NM_005915 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)

CR592726 Electron-transfer-flavoprotein, alpha polypeptide (glutaric aciduria II)

AK125827 MUF1 protein

NM_002768 Procollagen (type III) N-endopeptidase

AK123860 Hypothetical protein PRO2730

BX647897 Eukaryotic translation initiation factor 4 gamma, 3

BX647897 Eukaryotic translation initiation factor 4 gamma, 3

AK023005 Aspartyl aminopeptidase

NM_004642 CDK2-associated protein 1

AF059617 Polo-like kinase 2 (Drosophila)

NM_001304 Carboxypeptidase D

NM_001304 Carboxypeptidase D

NM_001304 Carboxypeptidase D

NM_001304 Carboxypeptidase D

AF378118 Hexosaminidase B (beta polypeptide)

NM_002569 Furin (paired basic amino acid cleaving enzyme)

AF026166 Chaperonin containing TCP1 , subunit 2 (beta)

AF026166 Chaperonin containing TCP1, subunit 2 (beta)

AK130697 Guanine nucleotide binding protein-like 2 (nucleolar)

AK126650 Capping protein (actin filament) muscle Z-line, beta

AK126650 Capping protein (actin filament) muscle Z-line, beta

AL833702 Activated leukocyte cell adhesion molecule

AL833702 Activated leukocyte cell adhesion molecule

BM691008 Calcium and integrin binding 1 (calmyrin)

BM907771 Actin related protein 2/3 complex, subunit 1B, 41kDa

AL137784 cyclin C AK023953 Glycerophosphate O-acyltransferase

AF075587 MYC binding protein 2

AF075587 MYC binding protein 2

NM_194358 Ring finger protein 41

NM_194358 Ring finger protein 41

NM_021122 fatty-acid-Coenzyme A ligase, long-chain 2

AB014525 Senataxin

AB014525 Senataxin

CR601041 NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)

BX648535 RNA binding motif protein 6

NM_002633 Phosphoglucomutase 1

NM_172164 Nuclear autoantigenic sperm protein (histone-binding)

NM_172164 Nuclear autoantigenic sperm protein (histone-binding)

NM_001690 ATPase, H+ transporting, lysosomal 7OkDa, V1 subunit A

NM_001690 ATPase, H+ transporting, lysosomal 7OkDa, V1 subunit A

AK000993 Chromosome 7 open reading frame 28B

NM_002956 Restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)

AB018342 Myosin X

NMJJ14773 KIAA0141 gene product

NM_014773 KIAA0141 gene product

AK123720 Protein phosphatase 5, catalytic subunit

NM_012425 Ras suppressor protein 1

NM_002581 Pregnancy-associated plasma protein A, pappalysin 1

NMJ302581 Pregnancy-associated plasma protein A, pappalysin 1

NMJD05228 Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)

NM_005228 Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)

D83780 KIAA0196 gene product

AB011165 Thyroid hormone receptor associated protein 1

AB011165 Thyroid hormone receptor associated protein 1

AF039081 CAMP responsive element binding protein-like 2

AF039081 CAMP responsive element binding protein-like 2

AF039081 CAMP responsive element binding protein-like 2

NM_004521 Kinesin family member 5B

NM_004521 Kinesin family member 5B

NM_005463 Heterogeneous nuclear ribonucleoprotein D-like

BC035249 Mortality factor 4 like 2

BX538229 Exostoses (multiple) 1

NM_015001 SMART/HDAC1 associated repressor protein

NM_015001 SMART/HDAC1 associated repressor protein

AK128726 Sialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase)

AK026669 T-complex-associated-testis-expressed 1-like 1

BM709562 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa

BM709562 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa

AK092405 Acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase)

AK023394 Succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa

BC050008 Protein tyrosine phosphatase, non-receptor type 12 BC045606 Nidogen (enactin)

BC045606 Nidogen (enactin)

NM_007284 PTK9L protein tyrosine kinase 9-like (A6-related protein)

BC034973 Zinc finger protein 410

NM_003257 Tight junction protein 1 (zona occludens 1)

NM_000401 Exostoses (multiple) 2

NM_000401 Exostoses (multiple) 2

AK001361 Protein phosphatase 1 , regulatory (inhibitor) subunit 15A

AK055108 Mesoderm specific transcript homolog (mouse)

NM_000120 Epoxide hydrolase 1 , microsomal (xenobiotic)

NM_006055 LanC lantibiotic synthetase component C-like 1 (bacterial)

NM_006055 LanC lantibiotic synthetase component C-like 1 (bacterial)

AL050005 Putative translation initiation factor

BF345592 Aldolase C, fructose-bisphosphate

BU739702 ArsA arsenite transporter, ATP-binding, homolog 1 (bacterial)

AK127051 Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase)

BF131606 Succinate dehydrogenase complex, subunit D, integral membrane protein

CR627445 Chromosome 22 open reading frame 5

AK097905 Ribosomal protein L38

AK097905 Ribosomal protein L38

BG115993 Branched chain alpha-ketoacid dehydrogenase kinase

BX537624 WIPI49-like protein 2

NM_006122 Mannosidase, alpha, class 2A, member 2

NM_014781 RB1 -inducible coiled-coil 1

NM_014781 RB1-inducible coiled-coil 1

BC036503 Secreted frizzled-related protein 1

BC036503 Secreted frizzled-related protein 1

BC036503 Secreted frizzled-related protein 1

NM_004788 Ubiquitination factor E4A (UFD2 homolog, yeast)

AK126861 TGFB1-induced anti-apoptotic factor 1

NM_005056 Jumonji, AT rich interactive domain 1A (RBBP2-like)

BQ050043 Fibroblast growth factor (acidic) intracellular binding protein

AK000498 Histidyl-tRNA synthetase

CR591649 Spermine synthase

NM_024342 Glucocorticoid receptor DNA binding factor 1

NM_014292 Chromobox homolog 6

NM_005095 Zinc finger protein 262

NM_005095 Zinc finger protein 262

NM_005095 Zinc finger protein 262

AB037755 Retinoic acid induced 14

U46689 Aldehyde dehydrogenase 3 family, member A2

U46689 Aldehyde dehydrogenase 3 family, member A2

AK128280 Karyopherin alpha 1 (importin alpha 5)

AK128280 Karyopherin alpha 1 (importin alpha 5)

AK128280 Karyopherin alpha 1 (importin alpha 5)

AK128280 Karyopherin alpha 1 (importin alpha 5)

BC058914 SH2 domain binding protein 1 (tetratricopeptide repeat containing)

NM_005065 SeM suppressor of lin-12-like (C. elegans) NM_005065 Sel-1 suppressor of lin-12-like (C. elegans)

NM_005065 Sel-1 suppressor of lin-12-like (C. elegans)

NM_003626 Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein

(liprin), alpha 1

NM_003626 Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein

(liprin), alpha 1

BX648281 Low density lipoprotein receptor (familial hypercholesterolemia)

BX648281 Low density lipoprotein receptor (familial hypercholesterolemia)

AK123316 lsocitrate dehydrogenase 3 (NAD+) alpha

AK123316 lsocitrate dehydrogenase 3 (NAD+) alpha

NM_002999 Syndecan 4 (amphiglycan, ryudocan)

AB044547 Heterogeneous nuclear ribonucleoprotein L

AV757675 optineurin

BC032762 Optineurin

AK097009 Phospholipid transfer protein

BC028578 Baculoviral IAP repeat-containing 2

BE547177 NADH dehydrogenase (ubiquinone) 1 , alpha/beta subcomplex, 1 , 8kDa

NM_003653 COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)

AB028965 OGT(O-GIc-NAc transferase)-interacting protein 106 KDa

AB028965 OGT(O-GIc-NAc transferase)-interacting protein 106 KDa

NM_004907 Immediate early response 2

CR627306 SEC14-like 1 (S. cerevisiae)

CR627306 SEC14-like 1 (S. cerevisiae)

CR627306 SEC14-like 1 (S. cerevisiae)

BC027592 Tight junction protein 2 (zona occludens 2)

AK055599 Cathepsin L

CD514114 Transcribed locus

NM_012319 Solute carrier family 39 (zinc transporter), member β

BF341533 Ubiquinol-cytochrome c reductase (6.4kD) subunit

NM_012106 ADP-ribosylation factor-like 2 binding protein

NMJ319088 Hypothetical protein F23149_1.

BM909357 Baculoviral IAP repeat-containing 5 (survivin)

BX537892 Benzodiazepine receptor (peripheral)

NM_005124 Nucleoporin 153kDa

AK123352 HMT1 hnRNP methyltransferase-like 1 (S. cerevisiae)

AK127675 V-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)

AK127675 V-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)

AF386649 Bromodomain containing 4

AF386649 Bromodomain containing 4

AK127827 Spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive)

AK054596 Immunoglobulin (CD79A) binding protein 1

NM_005895 Golgi autoantigen, golgin subfamily a, 3

NM_004526 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)

BC004305 Peptidase D

NM_012402 ADP-ribosylation factor interacting protein 2 (arfaptin 2)

BF240399 Cytochrome c oxidase subunit VIIb

BC009434 Solute carrier family 4, anion exchanger, member2 (erythrocyte membrane protein band 3- like i ) AF043453 sorting nexin 2

NM_003100 Sorting nexin 2

BX648399 DKFZP564C186 protein

BX641135 D4, zinc and double PHD fingers family 2

NM_004308 Rho GTPase activating protein 1

NM_003909 Copine III

NM_003909 Copine III

BM809524 Adaptor-related protein complex 2, sigma 1 subunit

BM542499 Putative breast adenocarcinoma marker (32kD)

NM_005817 Mannose-6-phosphate receptor binding protein 1

NM_005157 V-abl Abelson murine leukemia viral oncogene homolog 1

AV705253 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3

NM_015049 Amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3

NM_003913 PRP4 pre-mRNA processing factor 4 homolog B (yeast)

NM_003913 PRP4 pre-mRNA processing factor 4 homolog B (yeast)

AB002315 KIAA0317

NM_145906 RIO kinase 3 (yeast)

NM_145906 RIO kinase 3 (yeast)

NIVM45906 RIO kinase 3 (yeast)

AL833852 Transcriptional co-activator with PDZ-binding motif (TAZ)

AL833852 Transcriptional co-activator with PDZ-binding motif (TAZ)

BC010090 ARP1 actin-related protein 1 homolog B, centractin beta (yeast)

NM_006624 Zinc finger, MYND domain containing 11

NM_006624 Zinc finger, MYND domain containing 11

AF116615 JTV1 gene

BF034089 Aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)

AK122860 CDC-like kinase 3

NM_198189 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)

NM_198189 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)

NM_198189 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)

CR599886 Adenylosuccinate lyase

BF969813 Lymphocyte antigen 6 complex, locus E

BC001272 Interferon-related developmental regulator 1

BC001272 Interferon-related developmental regulator 1

NM_006907 Pyrroline-5-carboxylate reductase 1

AU 36139 neural precursor cell expressed, developmentally down-regulated 9

BX647463 Ubiquitin associated domain containing 1

BF204700 Upstream transcription factor 2, c-fos interacting

AK125857 Nucleoporin 62kDa

AK122757 Tubulin, beta, 4

D14689 Nucleoporin 214kDa

AF090693 CUG triplet repeat, RNA binding protein 2

AF090693 CUG triplet repeat, RNA binding protein 2

AF090693 CUG triplet repeat, RNA binding protein 2

BC043565 Phenylalanine-tRNA synthetase-like, alpha subunit

NM_004380 CREB binding protein (Rubinstein-Taybi syndrome)

BC040061 Protein kinase N1

NM_004779 CCR4-NOT transcription complex, subunit 8 NM_004779 CCR4-NOT transcription complex, subunit 8

NM_004779 CCR4-NOT transcription complex, subunit 8

NM_006241 Protein phosphatase 1 , regulatory (inhibitor) subunit 2

NM_006241 Protein phosphatase 1 , regulatory (inhibitor) subunit 2

AF319947 MMS19-like (MET18 homolog, S. cerevisiae)

BC033320 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa

BX537665 Aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase

BX537665 Aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase

BX648862 Zinc finger protein 161

BX648862 Zinc finger protein 161

BX648862 Zinc finger protein 161

NM_006197 Pericentriolar material 1

AB095813 Chondroitin polymerizing factor

AK127469 Excision repair cross-complementing rodent repair deficiency, complementation group 3

(xeroderma pigmentosum group B complementing)

AK126533 Growth arrest-specific 6

BC004486 Bleomycin hydrolase

NM_017458 Major vault protein

BC064697 KIAA0247

BC039907 GCN5 general control of amino-acid synthesis 5-like 2 (yeast)

BC004352 Kinesin family member 22

AK001676 Nucleoporin 133kDa

NM_001084 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3

NM_006243 Protein phosphatase 2, regulatory subunit B (B56), alpha isoform

AK056637 Nucleoporin 93kDa

NM_002819 Polypyrimidine tract binding protein 1

CR616080 Cleavage stimulation factor, 3' pre-RNA, subunit 1 , 5OkDa

NM_005890 growth arrest-specific 7

NMJJ16733 LIM domain kinase 2

AL117354 CGl-100 protein

BC070051 CGI-100 protein

NM_015881 Dickkopf homolog 3 (Xenopus laevis)

NM_021090 Myotubularin related protein 3

AJ318054 SFRS protein kinase 1

AJ318054 SFRS protein kinase 1

BF341546 Bitiverdin reductase B (flavin reductase (NADPH))

BC066552 Laminin, alpha 4

NM_001144 Autocrine motility factor receptor

BC026019 Vasodilator-stimulated phosphoprotein

NM_005737 ADP-ribosylation factor-like 7

NM_005737 ADP-ribosylation factor-like 7

NMJD05737 ADP-ribosylation factor-like 7

AK092130 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae)

AL832530 ADP-ribosylation factor GTPase activating protein 3

AK096320 Pescadillo homolog 1 , containing BRCT domain (zebrafish)

BX537641 Cullin 4B

BX537641 Cullin 4B

AK055329 Nuclear transcription factor Y, gamma AK055329 Nuclear transcription factor Y, gamma

AK127364 Chromosome 21 open reading frame 33

BX640945 Fatty acid desaturase 2

NM_005629 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8

NM_014949 Homo sapiens KIAA0907 protein (KIAA0907), mRNA

AV727101 E1A binding protein p300

NM_002219 integral membrane protein 1

BC008506 V-crk sarcoma virus CT10 oncogene homolog (avian)

BC008506 V-crk sarcoma virus CT10 oncogene homolog (avian)

BC008506 V-crk sarcoma virus CT10 oncogene homolog (avian)

NM_139199 Bromodomain containing 8

AK025552 Stromal cell derived factor receptor 1

NM_006387 Calcium homeostasis endoplasmic reticulum protein

AK123310 Dendritic cell protein

AK123310 Dendritic cell protein

BF127835 Ubiquinol-cytochrome c reductase hinge protein

NM_003051 Solute carrier family 16 (monocarboxylic acid transporters), member 1

NM_003051 Solute carrier family 16 (monocarboxylic acid transporters), member 1

NM_003051 Solute carrier family 16 (monocarboxylic acid transporters), member 1

AK097984 Nicotinamide N-methyltransferase

AK097984 Nicotinamide N-methyltransferase

AF158255 Poly (ADP-ribose) polymerase family, member 4

NM_005030 Polo-like kinase 1 (Drosophila)

NM_025195 Tribbles homolog 1 (Drosophila)

CR601408 Proteasome (prosome, macropain) subunit, beta type, 4

CR601408 Proteasome (prosome, macropain) subunit, beta type, 4

BC035638 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)

BM467999 Cyclin-dependent kinase 4

BX648105 Metastasis associated 1

NM_015726 WD repeat domain 42A

NM_015726 WD repeat domain 42A

BC001954 PRP3 pre-mRNA processing factor 3 homolog (yeast)

AK128675 RAB13, member RAS oncogene family

AK127033 Dynamin 2

AK122930 Signal-induced proliferation-associated 1 like 1

AK122930 Signal-induced proliferation-associated 1 like 1

AB033004 CD2 antigen (cytoplasmic tail) binding protein 2

AB033004 CD2 antigen (cytoplasmic tail) binding protein 2

U50531 Phosphonoformate immuno-associated protein 5

U50531 Phosphonoformate immuno-associated protein 5

NM_003165 Syntaxin binding protein 1

CR608392 Transcription factor-like 1

BM460795 Dimethylarginine dimethylaminohydrolase 2

AK123705 NAD(P)H:quinone oxidoreductase type 3, polypeptide A2

BC047528 Translocase of outer mitochondrial membrane 40 homolog (yeast)

NM_005180 B lymphoma Mo-MLV insertion region (mouse)

BC017553 TRAF and TNF receptor associated protein

U50939 Amyloid beta precursor protein binding protein 1, 59kDa 55

M55542 Guanylate binding protein 1 , interferon-inducible, 67kDa

M55542 Guanylate binding protein 1 , interferon-inducible, 67kDa

AB007952 F-box protein 28

AB007952 F-box protein 28

BC032224 Platelet-derived growth factor receptor, beta polypeptide

BF965163 Actin, gamma 2, smooth muscle, enteric

NM_000402 Glucose-6-phosphate dehydrogenase

AK094899 Split hand/foot malformation (ectrodactyly) type 1

NM_006415 Serine palmitoyltransferase, long chain base subunit 1

NM_006415 Serine palmitoyltransferase, long chain base subunit 1

AK092779 Chromosome 14 open reading frame 2

AK127351 Cyclin G associated kinase

BQ940058 Hydroxyacyl-Coenzyme A dehydrogenase, type Il

BM918904 Serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1

NM_078467 Cyclin-dependent kinase inhibitor 1A (p21, Cip1)

J04152 tumor-associated calcium signal transducer 2

U88966 FK506 binding protein 12-rapamycin associated protein 1

AF528099 Transforming, acidic coiled-coil containing protein 2

NM_014891 PDGFA associated protein 1

CR623037 Matrix GIa protein

CR605682 Lysophospholipase Il

BC064699 Stromal antigen 1

BC064699 Stromal antigen 1

CR749582 Cathepsin H

AK095750 RER1 homolog (S. cerevisiae)

AK095750 RER1 homolog (S. cerevisiae)

BM918631 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 , 7.5kDa

BU733265 Hepatitis B virus x interacting protein

BU733265 Hepatitis B virus x interacting protein

NM_198261 Similar to splicing factor, arginine/serine-rich 4

NM_198261 Similar to splicing factor, arginine/serine-rich 4

NM_003601 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

BX648141 Fibronectin type III domain containing 3

BC047020 Fasciculation and elongation protein zeta 2 (zygin II)

BM919120 Polymerase (RNA) Il (DNA directed) polypeptide G

BX648013 Transporter 1 , ATP-binding cassette, sub-family B (MDR/TAP) NM_001005291 Sterol regulatory element binding transcription factor 1

BC050420 Methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase

Z74615 Collagen, type I1 alpha 1

Z74615 Collagen, type I, alpha 1

NM_002717 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform

AK091323 Cytochrome P450, family 51, subfamily A, polypeptide 1

NM_004327 Breakpoint cluster region

NM_006048 Ubiquitination factor E4B (UFD2 homolog, yeast)

NM_006048 Ubiquitination factor E4B (UFD2 homolog, yeast) AK126921 SUMOI/sentrin specific protease 6

AK126921 SUMOI/sentrin specific protease 6

CR627430 General transcription factor IiIC, polypeptide 1 , alpha 22OkDa

CR603114 Geranylgeranyl diphosphate synthase 1

CR603114 Geranylgeranyl diphosphate synthase 1

AB043587 Acyl-Coenzyme A binding domain containing 3

AB043587 Acyl-Coenzyme A binding domain containing 3

CF993935 ATP synthase, H+ transporting, mitochondrial FO complex, subunit F6

NM_006709 HLA-B associated transcript 8

L33243 Polycystic kidney disease 1 (autosomal dominant)

AK127672 C-src tyrosine kinase

NM_003362 Uracil-DNA glycosylase

BF206112 Branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)

NM_152221 Casein kinase 1 , epsilon

NM_003337 Ubiquitin-conjugating enzyme E2B (RAD6 homolog)

NM_003337 Ubiquitin-conjugating enzyme E2B (RAD6 homolog)

NMJD03337 Ubiquitin-conjugating enzyme E2B (RAD6 homolog)

NM_000919 Peptidylglycine alpha-amidating monooxygenase

BM703860 Polyamine-modulated factor 1

BF683703 Thymidine kinase 1 , soluble

BX648728 Symplekin

AF220018 Tripartite motif-containing 2

AF220018 Tripartite motif-containing 2

BM912880 Cytochrome c oxidase subunit Vb

AK125467 Heat shock transcription factor 1

BG282526 Fatty acid binding protein 5 (psoriasis-associated)

CR605719 Huntingtin interacting protein 2

CR605719 Huntingtin interacting protein 2

NM_000113 Dystonia 1 , torsion (autosomal dominant; torsin A)

NMJ300113 Dystonia 1 , torsion (autosomal dominant; torsin A)

BX648291 Matrilin 2

NM 002210 Integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)

NM_002816 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

NM_002816 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 12

NM_002096 General transcription factor HF, polypeptide 1, 74kDa

NM_002096 General transcription factor HF, polypeptide 1, 74kDa

NM_002096 General transcription factor HF, polypeptide 1 , 74kDa

NM_001710 B-factor, properdin

XM_374949 Sorting nexin 19

NM_014758 Homo sapiens sorting nexin 19 (SNX19), mRNA

NM_014757 Mastermind-like 1 (Drosophila)

AL832110 FLJ44715 gene product

AK094737 RAP1A, member of RAS oncogene family

BC030691 Sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)

NM_130439 MAX interactor 1

BC070088 Hypothetical protein MGC5139

NM_181552 Cut-like 1 , CCAAT displacement protein (Drosophila)

NM_012288 Translocation associated membrane protein 2 NM_012288 Translocation associated membrane protein 2

NM_001755 Core-binding factor, beta subunit

AK093021 Transcription elongation factor A (Sl l)-like 4

BF240652 hypothetical protein FU 10326

BC036513 Rab3 GTPase-activating protein, non-catalytic subunit (15OkD)

BC036513 Rab3 GTPase-activating protein, non-catalytic subunit (15OkD)

BC035761 SEC24 related gene family, member D (S. cerevisiae)

NM_001003679 Leptin receptor

NM_001003679 Leptin receptor

BX957215 Natural killer-tumor recognition sequence

BX957215 Natural killer-tumor recognition sequence

NM_003816 A disintegrin and metalloproteinase domain 9 (meltrin gamma)

AJ002231 Glucosamine-6-phosphate deaminase 1

NM_004187 Jumonji, AT rich interactive domain 1 C (RBP2-like)

BX537490 Treacher Collins-Franceschetti syndrome 1

BX537490 Treacher Collins-Franceschetti syndrome 1

NM_014647 Limkain b1

BM799512 BCL2-associated athanogene

BC042755 Regulator of G-protein signalling 2, 24kDa

NM_006317 Brain abundant, membrane attached signal protein 1

NM_014338 Phosphatidylserine decarboxylase

S81439 TGFB inducible early growth response

AK097073 ATP-binding cassette, sub-family F (GCN20), member 3

AF135168 N-ethylmaleimide-sensitive factor

AF017789 Transcription elongation regulator 1

BX647782 Nuclear transport factor 2

NM_005829 Adaptor-related protein complex 3, sigma 2 subunit

NM_005829 Adaptor-related protein complex 3, sigma 2 subunit

BC052572 Serum response factor (c-fos serum response element-binding transcription factor)

AK096313 Cysteinyl-tRNA synthetase

J03464 Collagen, type I, alpha 2

J03464 Collagen, type I, alpha 2

BC030025 TIA1 cytotoxic granule-associated RNA binding protein-like 1

BC030025 TIA1 cytotoxic granule-associated RNA binding protein-like 1

AK128544 PRP31 pre-mRNA processing factor 31 homolog (yeast)

AK128544 PRP31 pre-mRNA processing factor 31 homolog (yeast)

BQ053892 Interferon, alpha-inducible protein 27

BC050525 Ubiquitin specific protease 1

BC050525 Ubiquitin specific protease 1

NM_000123 Excision repair cross-complementing rodent repair deficiency, complementation group 5

(xeroderma pigmentosum, complementation group G (Cockayne syndrome))

BG121845 Hsp70-interacting protein

BX647209 DnaJ (Hsp40) homolog, subfamily C, member 7

AK056204 Kelch-like ECH-associated protein 1

CR627476 Yip1 interacting factor homolog (S. cerevisiae)

AK126679 Follicular lymphoma variant translocation 1

L13848 DEAH (Asp-Glu-Ala-His) box polypeptide 9

NM_022977 Acyl-CoA synthetase long-chain family member 4 U47742 MYST histone acetyltransferase (monocytic leukemia) 3

BM809871 Mitogen-activated protein kinase kinase 2

NM_000944 Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)

AK131081 Retinoid X receptor, alpha

CR607153 DKFZP564B 167 protein

BQ278412 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)

NM_000944 Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)

AB006746 Phospholipid scramblase 1

NM_002467 V-myc myelocytomatosis viral oncogene homolog (avian)

BC028049 Protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)

AK124975 Solute carrier family 35, member B1

NM_000104 Cytochrome P450, family 1 , subfamily B, polypeptide 1

NM_000104 Cytochrome P450, family 1 , subfamily B, polypeptide 1

NM_000104 Cytochrome P450, family 1 , subfamily B, polypeptide 1

NM_000104 Cytochrome P450, family 1 , subfamily B, polypeptide 1

AK055600 MRNA; cDNA DKFZp564C063 (from clone DKFZp564C063)

BX647357 lduronate 2-sulfatase (Hunter syndrome)

NM_005418 Suppression of tumorigenidty 5

AK127017 Chromosome 10 open reading frame 69

BX647735 Adaptor-related protein complex 3, sigma 1 subunit

NM_024408 Notch homolog 2 (Drosophila)

AK127017 Chromosome 10 open reading frame 69

NM_024408 Notch homolog 2 (Drosophila)

AB006746 Phospholipid scramblase 1

BM920635 2,4-dienoyl CoA reductase 1 , mitochondrial

BC052563 Chromosome 9 open reading frame 60

AK131081 Retinoid X receptor, alpha

NM_000396 Cathepsin K (pycnodysostosis)

NM_005316 General transcription factor HH, polypeptide 1 , 62kDa

NMJ305316 General transcription factor HH, polypeptide 1 , 62kDa

M34309 V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)

NM_139205 Histone deacetylase 5

NM 000944 Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)

NM_007173 Protease, serine, 23

NM_014646 Lipin 2

NM_014646 Lipin 2

BC000494 Eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa

NM_014829 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46

NM_003926 Methyl-CpG binding domain protein 3

BC042656 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3

AK097705 Procollagen C-endopeptidase enhancer

AF089896 Polymerase (DNA directed) sigma

BX648602 Thyroid receptor interacting protein 15

AK123916 Catenin (cadherin-associated protein), alpha-like 1

NM_007007 Cleavage and polyadenylation specific factor 6, 68kDa

NM_007007 Cleavage and polyadenylation specific factor 6, 68kDa

BC008758 lsocitrate dehydrogenase 3 (NAD+) gamma

BX648475 Mannose phosphate isomerase L20010 Host cell factor C1 (VP16-accessory protein)

NM_006326 seven transmembrane domain protein

AK092113 Tubulin, gamma complex associated protein 2

AK092113 Tubulin, gamma complex associated protein 2

NM_021643 Tribbles homolog 2 (Drosophila)

AK001497 Death effector domain containing

BX648476 Dehydrogenase/reductase (SDR family) member 3

AK094410 RAN binding protein 1

NM_003927 Methyl-CpG binding domain protein 2

BC065016 AFG3 ATPase family gene 3-like 2 (yeast)

AL110212 H2A histone family, member V

AF153419 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein

BX537984 Hypothetical protein FLJ22169

CR617834 Peptidylprolyl isomerase E (cyclophilin E)

BC017479 Tubulin-specific chaperone c

NM_014329 Autoantigen

M20681 Solute carrier family 2 (facilitated glucose transporter), member 3

M20681 Solute carrier family 2 (facilitated glucose transporter), member 3

M20681 Solute carrier family 2 (facilitated glucose transporter), member 3

BC040494 DnaJ (Hsp40) homolog, subfamily B, member 2

BC007318 Microtubule-associated protein, RP/EB family, member 2

NM_000016 Acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain

AY358648 KIAA0101

AK095316 Small nuclear ribonucleoprotein polypeptide B"

BX648182 Sperm specific antigen 2

NM_006291 Tumor necrosis factor, alpha-induced protein 2

NM_004849 APG5 autophagy 5-like (S. cerevisiae)

NM_004849 APG5 autophagy 5-like (S. cerevisiae)

L76702 Protein phosphatase 2, regulatory subunit B (B56), delta isoform

AL831922 DKFZP586B0319 protein

AL831922 DKFZP586B0319 protein

AL831922 DKFZP586B0319 protein

AK123497 B-cell CLL/lymphoma 7B

AF245480 Mix interactor

BX648844 MutL homolog 1 , colon cancer, nonpolyposis type 2 (E. coli)

NM_006565 CCCTC-binding factor (zinc finger protein)

AL031591 phosphotidylinositol transfer protein, beta

BX647129 SMAD, mothers against DPP homolog 4 (Drosophila)

BX647129 SMAD, mothers against DPP homolog 4 (Drosophila)

AK057302 Galactose-4-epimerase, UDP- • •

CR609147 Phosphoribosyl pyrophosphate synthetase-associated protein 1

NM_001315 Mitogen-activated protein kinase 14

BC009483 Interferon regulatory factor 1

NM_000791 Dihydrofolate reductase

NM_000791 Dihydrofolate reductase

NM_000791 Dihydrofolate reductase

NM_003824 Fas (TNFRSFΘ)-associated via death domain AK002165 DKFZP564O123 protein

AK002165 DKFZP564O123 protein

AK002165 DKFZP5640123 protein

NM_000859 3-hydroxy-3-methylglutaryl-Coenzyme A reductase

NM_000859 3-hydroxy-3-methylglutaryl-Coenzyme A reductase

AK095951 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)

AK095951 Small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)

BX647679 Giia maturation factor, beta

BX647679 GHa maturation factor, beta

BX648030 Rho guanine nucleotide exchange factor (GEF) 7

BX648030 Rho guanine nucleotide exchange factor (GEF) 7

NM_004738 VAMP (vesicle-associated membrane protein)-associated protein B and C

BG546884 cysteine-rich motor neuron 1

AF167706 Cysteine-rich motor neuron 1

BC015824 GCIP-interacting protein p29

NM_000849 Glutathione S-transferase M3 (brain)

NM_053025 Myosin, light polypeptide kinase

AK123187 Microspherule protein 1

NM_006948 Stress 70 protein chaperone, microsome-associated, 6OkDa

NM_006948 Stress 70 protein chaperone, microsome-associated, 6OkDa

AK095230 DKFZP547E1010 protein

AK095230 DKFZP547E1010 protein

AF082557 Tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

NM_007176 Chromosome 14 open reading frame 1

BC048419 ADP-ribosylation factor-like 2

NM_021738 Supervillin

NM_021738 Supervillin

NM_004175 Small nuclear ribonucleoprotein D3 polypeptide 18kDa

NM_002376 MAP/microtubule affinity-regulating kinase 3

NM_002376 MAP/microtubule affinity-regulating kinase 3

AB023181 Discs, large (Drosophila) homolog-associated protein 4

AB023181 Discs, large (Drosophila) homolog-associated protein 4

AB023181 Discs, large (Drosophila) homolog-associated protein 4

AF001177 Casein kinase 1 , gamma 2

AF001177 Casein kinase 1 , gamma 2

BG329043 Cellular retinoic acid binding protein 2

NM_007242 DEAD (Asp-Glu-Ala-As) box polypeptide 19

CR749227 FLJ 11126 protein

CR749227 FLJ 11126 protein

NM_006353 High mobility group nucleosomal binding domain 4

NM_202002 Forkhead box M1

BC063507 Heat shock 7OkDa protein 1 B

BC052781 RAN binding protein 9

BC052781 RAN binding protein 9

NM_002504 Nuclear transcription factor, X-box binding 1

NMJD02504 Nuclear transcription factor, X-box binding 1

BM919305 Polymerase (RNA) Il (DNA directed) polypeptide L, 7.6kDa

BC036803 Adenylate kinase 1 BQ056428 Thymidylate synthetase

AL574319 pyruvate dehydrogenase kinase, isoenzyme 2

BC008402 Single-stranded DNA binding protein 1

BM549702 Biogenesis of lysosome-related organelles complex-1 , subunit 1

NM_016641 Membrane interacting protein of RGS16

AF063605 Leptin receptor overlapping transcript-like 1

AF063605 Leptin receptor overlapping transcript-like 1

NM_207043 Endosulfine alpha

NM_005979 S100 calcium binding protein A13

NM_003489 Nuclear receptor interacting protein 1

NM_003489 Nuclear receptor interacting protein 1

NM_014500 HIV TAT specific factor 1

NM_014500 HIV TAT specific factor 1

NM_001110 A disintegrin and metalloproteinase domain 10

NM_001110 A disintegrin and metalloproteinase domain 10

AK096764 Glucuronidase, beta

BX538296 Tousled-like kinase 1

NM_001543 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

NM_004447 Epidermal growth factor receptor pathway substrate 8

AB006651 Cofactor required for Sp1 transcriptional activation, subunit 2, 15OkDa

AB006651 Cofactor required for Sp1 transcriptional activation, subunit 2, 15OkDa

BC009408 CTP synthase

BC016949 Solute carrier family 30 (zinc transporter), member 9

AK098019 Guanine nucleotide binding protein (G protein), q polypeptide

NM_004992 Methyl CpG binding protein 2 (Rett syndrome)

NIVM82943 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2

NM_182943 Procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2

AK057577 Interferon regulatory factor 3

NM_002973 Ataxin 2

AY157300 Chromosome 14 open reading frame 11

AB002328 Calcineurin binding protein 1

BC059394 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog

BC059394 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog

BX649164 Serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type

1), member 1

BX649164 Serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type

1), member 1

NM_006380 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2

NM_006380 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2

NM_006380 Amyloid beta precursor protein (cytoplasmic tail) binding protein 2 AK098268 ' Candidate tumor suppressor in ovarian cancer 2

D87448 Topoisomerase (DNA) Il binding protein 1

AL558030 polymerase (RNA) Il (DNA directed) polypeptide K, 7.OkDa

BI758413 Polymerase (RNA) Il (DNA directed) polypeptide K, 7.OkDa

NM_005667 Ring finger protein 103

BC015969 Intercellular adhesion molecule 1 (CD54), human rhinovirus receptor

AK025300 RAN binding protein 3

NM_004311 ADP-ribosylation factor-like 3 AF110377 Transformation/transcription domain-associated protein

BC064689 Tumor necrosis factor, alpha-induced protein 3

BC064689 Tumor necrosis factor, alpha-induced protein 3

NM_130803 Multiple endocrine neoplasia I

CR749378 Upstream of NRAS

X02751 Neuroblastoma RAS viral (v-ras) oncogene homolog

BF683700 Ribosomal protein S19

BF683700 Ribosomal protein S19

BC042942 KIAA0195 gene product

NM_014873 Homo sapiens KIAA0205 gene product (KIAA0205), mRNA

L77864 Amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)

AK124225 Axotrophin

AK124225 Axotrophin

BC033055 Arginine-rich, mutated in early stage tumors

XM_376059 SERTA domain containing 2

NM_014755 Homo sapiens transcriptional regulator interacting with the PHS-bromodomain 2 (TRIP-Br2), mRNA

AK094173 Peroxisomal biogenesis factor 11 B

BM675396 Proteasome (prosome, macropain) subunit, beta type, 10

NM_002223 Inositol 1 ,4,5-triphosphate receptor, type 2

NM_003387 Wiskott-Aldrich syndrome protein interacting protein

NM_003387 Wiskott-Aldrich syndrome protein interacting protein

NM_003387 Wiskott-Aldrich syndrome protein interacting protein

NM_178042 Actin-like 6A

NM_006979 Solute carrier family 39 (zinc transporter), member 7

NM_002755 Mitogen-activated protein kinase kinase 1

NM_003681 Pyridoxal (pyridoxine, vitamin B6) kinase

AK123699 Activating transcription factor 3

BF217743 Dolichyl-phosphate mannosyltransferase polypeptide 1 , catalytic subunit

NM_005358 LIM domain 7

BQ073692 Succinate dehydrogenase complex, subunit B, iron sulfur (Ip)

CR611266 FAST kinase

CR749722 RAS p21 protein activator (GTPase activating protein) 1

BG485455 General transcription factor HA, 2, 12kDa

NM_000271 Niemann-Pick disease, type C1

CR606311 General transcription factor ME, polypeptide 2, beta 34kDa

NM_003363 Ubiquitin specific protease 4 (proto-oncogene)

NM_003363 Ubiquitin specific protease 4 (proto-oncogene)

AF067791 RNA (guanine-7-) methyltransferase

AF067791 RNA (guanine-7-) methyltransferase

NMJ321913 AXL receptor tyrosine kinase

NM_021913 AXL receptor tyrosine kinase

NM_013286 Chromosome 3p21.1 gene sequence

CR613811 Small nuclear ribonucleoprotein D1 polypeptide 16kDa

CR613811 Small nuclear ribonucleoprotein D1 polypeptide 16kDa

BC042297 Upstream binding transcription factor, RNA polymerase I

BX537586 Serine/threonine kinase 17a (apoptosis-inducing)

BX537586 Serine/threonine kinase 17a (apoptosis-inducing) BC008726 Oxidative-stress responsive 1

BX537360 Cleavage and polyadenylation specific factor 5, 25 kDa

AK027136 Cytochrome c oxidase subunit IV isoform 1

NM_006129 Bone morphogenetic protein 1

BC024039 Tripartite motif-containing 26

CR627368 Dual specificity phosphatase 11 (RNA/RNP complex 1 -interacting)

BC031406 Transducer of ERBB2, 1

AK023404 Cyclin B2

NM_000373 Uridine monophosphate synthetase (orotate phosphoribosyl transferase and orotidine-5'- decarboxylase)

BC069193 Histone 2, H2be

BC035281 Fibromodulin

CR749267 BET1 homolog (S. cerevisiae)

NM_004429 Ephrin-B1

XM_375074 KIAA0391

BC065510 Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

AK125862 Protein tyrosine phosphatase, non-receptor type 1

AK095082 CDC16 cell division cycle 16 homolog (S. cerevisiae)

NM_015641 Testis derived transσipt (3 LIM domains)

NM_015641 Testis derived transσipt (3 LlM domains)

AF445027 Glutamine-fructose-6-phosphate transaminase 1

AF445027 Glutamine-fructose-6-phosphate transaminase 1

NM_002015 Forkhead box O1A (rhabdomyosarcoma)

NM_002015 Forkhead box 01 A (rhabdomyosarcoma)

NM_000937 Polymerase (RNA) Il (DNA directed) polypeptide A, 22OkDa

AK127636 Interferon gamma receptor 1

NM_206943 Latent transforming growth factor beta binding protein 1

NM_206943 Latent transforming growth factor beta binding protein 1

BX537500 Programmed cell death 4 (neoplastic transformation inhibitor)

BX537500 Programmed cell death 4 (neoplastic transformation inhibitor)

NM_181805 Protein kinase (cAMP-dependent, catalytic) inhibitor gamma

BC017062 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide

Il

AF502289 Thyroid hormone receptor interactor 10

BE253850 Emopamil binding protein (sterol isomerase)

BQ056526 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)

BQ056526 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae)

NM_000293 Phosphorylase kinase, beta

NM_000293 Phosphorylase kinase, beta

BM463034 Aminoacylase 1

BX537705 Protein kinase, cAMP-dependent, catalytic, beta

BX537705 Protein kinase, cAMP-dependent, catalytic, beta

NM_006749 Solute carrier family 20 (phosphate transporter), member 2

D29956 Ubiquitin specific protease 8

NM_004120 Guanylate binding protein 2, interferon-inducible

BM455163 Tryptophan rich basic protein

AL050258 Tuftelin interacting protein 11

AK124742 Proteasome regulatory particle subunit p44S10 BX538168 R3H domain (binds single-stranded nucleic acids) containing

NM_002081 Glypican 1

NM_002081 Glypican 1

AK091056 Cofactor of BRCA1

BM455790 Regulatory factor X-associated ankyrin-containing protein

AJ303079 PALM2-AKAP2 protein

AJ 303079 PALM2-AKAP2 protein

NM_015180 Spectrin repeat containing, nuclear envelope 2

AB014519 Rho-associated, coiled-coil containing protein kinase 2

NM_004346 Caspase 3, apoptosis-related cysteine protease

AK098480 Stromal interaction molecule 1

X63556 Fibrillin 1 (Marfan syndrome)

X63556 Fibrillin 1 (Marfan syndrome)

AK097626 Acid phosphatase 2, lysosomal

BC036724 FBJ murine osteosarcoma viral oncogene homolog B

AK092638 Cyclin G2

AK092638 Cyclin G2

NM_014745 Hypothetical protein LOC348180

BG033588 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase (hydroxymethylglutaricaciduria)

CR627024 Splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)

CR627024 Splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)

AK123702 Estrogen receptor binding protein

BC044752 Soc-2 suppressor of clear homolog (C. elegans)

BX648905 Zinc finger protein 198

BM479313 Ubiquitin-conjugating enzyme E2S

NM_000436 3-oxoacid CoA transferase 1

CR623148 Skeletal muscle and kidney enriched inositol phosphatase

CR623148 Skeletal muscle and kidney enriched inositol phosphatase

NM_012343 Nicotinamide nucleotide transhydrogenase

NM_012343 Nicotinamide nucleotide transhydrogenase

AK056039 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa

AK126343 Serine threonine kinase 39 (STE20/SPS1 homolog, yeast)

BC068497 Mitogen-activated protein kinase-activated protein kinase 3

BC068497 Mitogen-activated protein kinase-activated protein kinase 3

AL022394 triple homeobox 1

AB014585 KIAA0685

BX647983 Putative protein similar to nessy (Drosophila)

AK093560 Inositol polyphosphate-1 -phosphatase

AB051449 Tara-like protein

AB028952 Synaptopodin

CR749564 SAC1 suppressor of actin mutations 1-like (yeast)

AJ 131245 SEC24 related gene family, member B (S. cerevisiae)

BQ876313 CIpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)

AK131561 Protein kinase, cAMP-dependent, catalytic, alpha

BM992995 Deoxyhypusine synthase

NMJ304996 ATP-binding cassette, sub-family C (CFTR/MRP), member 1

NM_004996 ATP-binding cassette, sub-family C (CFTR/MRP), member 1

AK125417 Drebrin 1 AK097926 Target of myb1 (chicken)

NM_017787 Chromosome 10 open reading frame 26

CR749376 Hypothetical protein FLJ21919

AK127132 Developmental^ regulated GTP binding protein 1

AK023768 STAM binding protein

NM_000152 Glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II)

U38847 TAR (HlV) RNA binding protein 1

AB021179 HMBA-inducible

AB021179 HMBA-inducible

NM_005637 Synovial sarcoma translocation, chromosome 18

NM_005637 Synovial sarcoma translocation, chromosome 18

AK096079 Transcription elongation factor B (SIII), polypeptide 3 (11OkDa, elongin A)

AK096079 Transcription elongation factor B (SIII), polypeptide 3 (11OkDa, elongin A)

NM_001621 Aryl hydrocarbon receptor

CR749509 LIM domain containing preferred translocation partner in lipoma

CR749509 LIM domain containing preferred translocation partner in lipoma

N89607 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)

AK057889 Transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)

BC043280 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4

AU149305 matrix metalloproteinase 14 (membrane-inserted)

NM_004995 Matrix metalloproteinase 14 (membrane-inserted)

BC056141 Synaptobrevin-like 1

NM_181453 GRIP and coiled-coil domain containing 2

NM_000029 Angiotensinogen (serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 8)

BM564448 Thioredoxin-like 4A

AK122620 FLN29 gene product

BC017338 Fucosidase, alpha-L- 1, tissue

BQ421940 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa

BC046099 TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa

AF172453 Opioid growth factor receptor

AK092204 DnaJ (Hsp40) homolog, subfamily B, member 9

AK092204 DnaJ (Hsp40) homolog, subfamily B, member 9

NM_006788 RaIA binding protein 1

NM_006788 RaIA binding protein 1

NM_002642 Phosphatidylinositol glycan, class C

AK129934 Phosphoenolpyruvate carboxykinase 2 (mitochondrial)

BX648715 ATP-binding cassette, sub-family D (ALD), member 3

S59184 RYK receptor-like tyrosine kinase

NM_000194 Hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)

AK127319 Solute carrier family 16 (monocarboxylic acid transporters), member 3

AK127319 Solute carrier family 16 (monocarboxylic acid transporters), member 3

BM993001 Transmembrane protein 4

AL832781 U2(RNU2) small nuclear RNA auxiliary factor 1

NM_000584 lnterleukin 8

NM_014856 Homo sapiens KIAA0476 gene product (KIAA0476), mRNA

CR605525 Fumarylacetoacetate hydrolase (fumarylacetoacetase)

AK160379 Nuclear antigen Sp100 AK160379 Nuclear antigen Sp100

NM_001002762 DnaJ (Hsp40) homolog, subfamily B, member 12

NM_001002762 DnaJ (Hsp40) homolog, subfamily B, member 12

BM920817 Processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)

BG256659 CDC20 cell division cycle 20 homolog (S. cerevisiae)

BC001769 TNF receptor-associated factor 4

BX648079 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1

BX648079 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C, isoform 1

X59842 Pre-B-cell leukemia transcription factor 2

X59842 Pre-B-cell leukemia transcription factor 2

AK123894 Pleckstrin homology, Sec7 and coiled-coil domains 1(cytohesin 1)

BX647552 Nucleolar protein 7, 27kDa

T79584 protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform

BX648952 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform

BX648952 Protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform

AF335324 DNA-damage-inducible transcript 4

BC058928 Alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150)

BC046149 Nitrilase l

NM_004661 CDC23 (cell division cycle 23, yeast, homolog)

AF020202 Unc-13 homolog B (C. elegans)

NM_004444 EPH receptor B4

BC038510 Protein tyrosine phosphatase, non-receptor type substrate 1

NM_004648 protein tyrosine phosphatase, non-receptor type substrate 1

BC038510 Protein tyrosine phosphatase, non-receptor type substrate 1

NM_014654 Homo sapiens syndecan 3 (N-syndecan) (SDC3), mRNA

AK091927 Splicing factor, arginine/serine-rich 3

NM_002532 Nucleoporin 88kDa

AU 153477 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)

AK024217 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)

BX640816 Nijmegen breakage syndrome 1 (nibrin)

BX640816 Nijmegen breakage syndrome 1 (nibrin)

BX640816 Nijmegen breakage syndrome 1 (nibrin)

BC069213 Wolfram syndrome 1 (wolframin)

AY178832 EPM2A (laforin) interacting protein 1

NM_078481 CD97 antigen

BC071594 MutS homolog 6 (E. coli)

CR603703 Adrenomedullin

BC057394 Rho guanine nucleotide exchange factor (GEF) 11

AB007944 Family with sequence similarity 20, member B

AB007944 Family with sequence similarity 20, member B

NM_015387 Preimplantation protein 3

NM_015387 Preimplantation protein 3

NM_001148 Ankyrin 2, neuronal

NM_001148 Ankyrin 2, neuronal

AK094940 Glutamate-cysteine ligase, catalytic subunit

AK094940 Glutamate-cysteine ligase, catalytic subunit

NM_015909 Neuroblastoma-amplified protein AK092970 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1

BC008834 PHD finger protein 1

BM918886 D-dopachrome tautomerase

AB035863 Succinate-CoA ligase, ADP-forming, beta subunit

AK127325 Bridging integrator 1

NM_005433 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1

NM_005433 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1

NM_000189 Hexokinase 2

NM_000346 SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal)

AL022316 CGI-96 protein

NM_005857 Zinc metalloproteinase (STE24 homolog, yeast)

BQ279253 NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa

AL833205 Electron-transfer-flavoprotein, beta polypeptide

NM_000262 N-acetylgalactosaminidase, alpha-

NM_000262 N-acetylgalactosaminidase, alpha-

NM_004957 Folylpolyglutamate synthase

NM_014962 BTB (POZ) domain containing 3

CR609866 Glycophorin C (Gerbich blood group)

M27492 lnterleukin 1 receptor, type I

BC036085 Four and a half LIM domains 2

BX649061 Crystallin, zeta (quinone reductase)

NM_007271 Serine/threonine kinase 38

AK024385 A disintegrin and metalloproteinase domain 12 (meltrin alpha)

BC032677 Ubiquitin-conjugating enzyme E2C

NM_006421 ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)

NM_006421 ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)

AK124015 Hematopoietic cell-specific Lyn substrate 1

NM_002833 Protein tyrosine phosphatase, non-receptor type 9

BX647789 Methylmalonyl Coenzyme A mutase

BX647789 Methylmalonyl Coenzyme A mutase

AK123419 ATP synthass, H+ transporting, mitochondrial FO complex, subunit f, isoform 2

NM_000449 Regulatory factor X, 5 (influences HLA class Il expression)

NM_000449 Regulatory factor X, 5 (influences HLA class Il expression)

CR749474 Glutathione S-transferase A4

NM_006482 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

NM_006482 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

NM_006482 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

NM_006482 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

XM_376328 Family with sequence similarity 13, member A1

NM_014883 Homo sapiens family with sequence similarity 13, member A1 (FAM13A1), mRNA

AK093702 Membrane protein, palmitoylated 1 , 55kDa

NM_014899 Rho-related BTB domain containing 3

NM_014899 Rho-related BTB domain containing 3

BC060807 HCF-binding transcription factor Zhangfei

BC060807 HCF-binding transcription factor Zhangfei

BX647064 Seven in absentia homolog 1 (Drosophila)

BX647064 Seven in absentia homolog 1 (Drosophila)

NM_006821 Peroxisomal long-chain acyl-coA thioesterase BC044659 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3

NM_004873 BCL2-associated athanogene 5

NM_004873 BCL2-associated athanogene 5

BX647212 Aryl-hydrocarbon receptor nuclear translocator 2

BC009895 Phosphorylase, glycogen; liver (Hers disease, glycogen storage disease type Vl)

AL831952 START domain containing 3

NM_006844 HvB (bacterial acetolactate synthase)-like

Z95331 fibulin 1

AK128725 Fibulin 1

CR620867 Polymerase (DNA-directed), delta 4

NM_002318 Lysyl oxidase-like 2

NM_002318 Lysyl oxidase-like 2

NM_016201 Angiomotin like 2

BC054520 MADS box transcription enhancer factor 2, polypeptide D (myocyte enhancer factor 2D)

AK128019 Lymphotoxin beta receptor (TNFR superfamily, member 3)

NM_005539 Inositol polyphosphate-5-phosphatase, 4OkDa

NM_006330 Lysophospholipase I

BF240423 Thioredoxin domain containing 9

BC008381 Inositol(myo)-1(or 4)-monophosphatase 1

BM994378 Ribosomal protein L23a

BC000721 Suppressor of S. cerevisiae gcr2

AB051446 RUN and TBC1 domain containing 3

AB023140 Synovial sarcoma, X breakpoint 2 interacting protein

AB023140 Synovial sarcoma, X breakpoint 2 interacting protein

AB023140 Synovial sarcoma, X breakpoint 2 interacting protein

AB007940 RAB GTPase activating protein 1-like

CR619517 Ribonuclease H2, large subunit

BQ934366 Hypothetical protein HSPC111

NM 020199 Chromosome 5 open reading frame 15

BF686123 ARD1 homolog, N-acetyltransferase (S. cerevisiae)

NM_014872 Zinc finger and BTB domain containing 5

AY203927 Mevalonate (diphospho) decarboxylase

AK097127 Cytochrome b-245, alpha polypeptide

AK092076 Uroporphyrinogen III synthase (congenital erythropoietic porphyria)

U59309 Fumarate hydratase

U59309 Fumarate hydratase

AK125453 Hypothetical protein MGC10850

NM_006099 Protein inhibitor of activated STAT, 3

AB007889 Metastasis suppressor 1

CR749277 Protein tyrosine phosphatase, receptor type, K

BC030833 NADH dehydrogenase (ubiquinone) Fe-S protein 1 , 75kDa (NADH-coenzyme Q reductase)

BX647328 Hydroxymethylbilane synthase

BX648255 Lysosomal-associated membrane protein 2

BX648255 Lysosomal-associated membrane protein 2

AB018328 Zinc finger, BED domain containing 1

BC046247 Carbohydrate (chondroitin) synthase 1

BQ073581 Ninjurin 1 BC050557 Timeless homolog (Drosophila)

NM_005990 Serine/threonine kinase 10

AB002370 KIAA0372

AB002370 KIAA0372

AF078776 Tumor protein p53 binding protein, 1

AB023162 Bromo adjacent homology domain containing 1

BC022880 Breast carcinoma amplified sequence 2

L41143 T-cell leukemia translocation altered gene

BC064996 Rho guanine nucleotide exchange factor (GEF) 1

NM_012231 PR domain containing 2, with ZNF domain

NM_004670 3'-phosphoadenosine 5'-phosphosulfate synthase 2

NM_004670 3'-phosphoadenosine 5'-phosphosulfate synthase 2

AF074331 3'-phosphoadenosine 5'-phosphosulfate synthase 2

NM_014641 Homo sapiens mediator of DNA damage checkpoint 1 (MDC1), mRNA

AK126377 Protein phosphatase 1 F (PP2C domain containing)

NMJ81430 Forkhead box K2

NM_001753 Caveolin 1 , caveolae protein, 22kDa

NM_014863 B cell RAG associated protein

AK057123 Pyruvate dehydrogenase complex, component X

NM_014851 Homo sapiens KIAA0469 gene product (KIAA0469), mRNA

BC034038 Synaptic vesicle glycoprotein 2A

NM_004998 Myosin IE

AL832190 Component of oligomeric golgi complex 2

BC073755 Annexin A8

NM_005901 SMAD, mothers against DPP homolog 2 (Drosophila)

NM_005901 SMAD, mothers against DPP homolog 2 (Drosophila)

NM_005901 SMAD, mothers against DPP homolog 2 (Drosophila)

NM_003591 Cullin 2

NM_003591 Cullin 2

AB040909 Bromodomain adjacent to zinc finger domain, 2B

NM_020248 Catenin, beta interacting protein 1

BC043345 BMS1-like, ribosome assembly protein (yeast)

NM_003247 Thrombospondin 2

NM_000660 Transforming growth factor, beta 1 (Camurati-Engelmann disease)

AK057153 Putative dimethyladenosine transferase

BC047544 Kinesin heavy chain member 2

BX537531 Fibulin 5

NM_013247 Protease, serine, 25

BM704290 Stromal cell-derived factor 2

NM_003902 Far upstream element (FUSE) binding protein 1

CR627419 Translocase of inner mitochondrial membrane 44 homolog (yeast) " "

CR627419 Translocase of inner mitochondrial membrane 44 homolog (yeast)

NM_001003690 MAD2L1 binding protein

NM_001005369 Mitochondrial translational initiation factor 2

XM_376350 Rap guanine nucleotide exchange factor (GEF) 2

NM_014247 Homo sapiens PDZ domain containing guanine nucleotide exchange factor (GEF) 1

(PDZGEF1), mRNA

NM_170751 Chromodomain protein, Y-like NM_170751 Chromodomain protein, Y-like

NM_002408 Mannosyl (alpha-1 ,6-)-glycoprotein beta-1 ^-N-acetylglucosaminyltransferase

NM_014502 PRP19/PSO4 homolog (S. cerevisiae)

NM_012062 Dynamin 1-like

BX648347 Vacuolar protein sorting 41 (yeast)

BF972117 Ribosomal protein S2

BC042436 Retinoic acid induced 3

BM423509 Ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)

BC036651 PTK2B protein tyrosine kinase 2 beta

AK126056 Wolf-Hirschhom syndrome candidate 2

BC046445 Eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)

BE779521 Sjogren's syndrome/scleroderma autoantigen 1

BX571744 Ferrochelatase (protoporphyria)

BX571744 Ferrochelatase (protoporphyria)

BX648106 Ubiquitin specific protease 52

AK127262 Proprotein convertase subtilisin/kexin type 7

AK025974 Hypothetical protein MGC2574

NM_005426 Tumor protein p53 binding protein, 2

AK126524 Tetratricopeptide repeat domain 15

NM_000617 Solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2

NM_000617 Solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2

BM924855 lnositol(myo)-1 (or 4)-monophosphatase 2

NM_004863 Serine palmitoyltransferase, long chain base subunit 2

NM_006206 Platelet-derived growth factor receptor, alpha polypeptide

L41870 Retinoblastoma 1 (including osteosarcoma) . . .

BM701413 Sec61 beta subunit

BC048259 Phosphatidylinositol binding clathrin assembly protein

M55654 TATA box binding protein

BE779053 Rab acceptor 1 (prenylated)

CR627456 Wilms tumor 1 associated protein

AK127840 Histone acetyltransf erase 1

NM_004938 Death-associated protein kinase 1

BX649185 B-cell CLL/lymphoma 6 (zinc finger protein 51 )

BC038444 Adaptor-related protein complex 3, beta 1 subunit

BC038444 Adaptor-related protein complex 3, beta 1 subunit

T79953 Transcribed locus

NM__014788 Tripartite motif-containing 14

NM_014788 Tripartite motif-containing 14

CR600069 Poliovirus receptor-related 2 (herpesvirus entry mediator B)

AL832249 Rab9 effector p40

NM_002373 ' Microtubule-associated protein 1 A

AK123768 Mitochondrial ribosomal protein L40

AK095515 Interferon-induced protein with tetratricopeptide repeats 1

NMJ312432 SET domain, bifurcated 1

AF176555 A kinase (PRKA) anchor protein 11

CR749593 Glutaminase

CR749593 Glutaminase

CR749593 Glutaminase NM_003958 Ring finger protein (C3HC4 type) 8

BC014141 Katanin p80 (WD repeat containing) subunit B 1

BC014141 Katanin p80 (WD repeat containing) subunit B 1

D88152 Solute carrier family 33 (acetyl-CoA transporter), member 1

D88152 Solute carrier family 33 (acetyl-CoA transporter), member 1

BC000991 Craniofacial development protein 1

NM_003255 Tissue inhibitor of metalloproteinase 2

NM_004381 CAMP responsive element binding protein-like 1

NM_014785 Homo sapiens KIAA0258 (KIAA0258), mRNA

AB007869 KIAA0409 protein

BC067272 Fragile X mental retardation, autosomal homolog 2

BC050464 Esophageal cancer associated protein

BM912141 Ras homolog gene family, member G (rho G)

NM_003201 Transcription factor A, mitochondrial

NM_003201 Transcription factor A, mitochondrial

NIVM47131 Galactose-1 -phosphate uridylyltransferase

AF198444 Aldehyde dehydrogenase 1 family, member A3

U88666 SFRS protein kinase 2

NM_003138 SFRS protein kinase 2

NM_003076 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1

AY154470 Ras association (RalGDS/AF-6) domain family 2

CF619147 S100 calcium binding protein A4 (calcium protein, calvasculin, metastasin, murine placental homolog)

NM_001380 Dedicator of cytokinesis 1

NM_006876 UDP-GlcNAc:betaGal beta-1 ,3-N-acetylglucosaminyltransferase 6

AK002110 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)

AK002110 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)

BC043423 ATP-binding cassette, sub-family B (MDR/TAP), member 6

NM_005387 Nucleoporin 98kDa

NM_005387 Nucleoporin 98kDa

NM_005845 ATP-binding cassette, sub-family C (CFTR/MRP), member 4

AK092734 Hypothetical protein FLJ20580

NM_001261 Cyclin-dependent kinase 9 (CDC2-related kinase)

BC054816 5-methyltetrahydrofolate-homocysteine methyltransferase reductase

BC054816 5-methyltetrahydrofolate-homocysteine methyltransferase reductase

NM_000303 Phosphomannomutase 2

NM_007043 HIV-1 rev binding protein 2

NM_007043 HIV-1 rev binding protein 2

AB014577 Jumonji domain containing 2A

BF214329 likely ortholog of chicken chondrocyte protein with a poly-proline region

NM_014637 Likely ortholog of chicken chondrocyte protein with a poly-proline region

NM_181578 Replication factor C (activator 1) 5, 36.5kDa

NM_201278 Myotubularin related protein 2

NM_201278 Myotubularin related protein 2

CR603310 Cell division cycle 2, G1 to S and G2 to M

CR603310 Cell division cycle 2, G1 to S and G2 to M

NM_004999 Myosin Vl NM_004999 Myosin Vl

AK127346 Sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)

BC032539 Mitogen-activated protein kinase 9

CR622599 Adenine phosphoribosyltransferase

NM_005077 Transducin-like enhancer of split 1 (E(sp1 ) homolog, Drosophila)

NM_005077 Transducin-like enhancer of split 1 (E(sp1 ) homolog, Drosophila)

NM_004703 Rabaptin, RAB GTPase binding effector protein 1

NM_018339 Riboflavin kinase

NM_018339 Riboflavin kinase

BX647402 Sarcoma amplified sequence

BX647402 Sarcoma amplified sequence

BM904583 Platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa

AK091036 CDC-like kinase 2

NM_004421 Dishevelled, dsh homolog 1 (Drosophila)

NM_000332 Ataxin 1

NM_000332 Ataxin 1

NM_000418 lnterleukin 4 receptor

BC007348 Uridine phosphorylase 1

BC067281 Thimet oligopeptidase 1

NM_000435 Notch homolog 3 (Drosophila)

AK160386 CCR4-NOT transcription complex, subunit 3

NM_003369 UV radiation resistance associated gene

AL833286 LIM protein (similar to rat protein kinase C-binding enigma)

AL833286 LIM protein (similar to rat protein kinase C-binding enigma)

NM_000319 Peroxisomal biogenesis factor 5

BC002791 homologous to yeast nitrogen permease (candidate tumor suppressor)

BC050412 Tumor suppressor candidate 4

NM_006965 Zinc finger protein 24 (KOX 17)

BC070071 RNA binding motif protein 16

BQ059612 Tumor suppressor deleted in oral cancer-related 1

AB007893 KIAA0433 protein

AB028950 Talin 1

BC043258 F-box protein 11

AK124296 MGC4707 protein

BM994482 DR1 -associated protein 1 (negative cofactor 2 alpha)

AK128067 Chromosome 6 open reading frame 74

AK128067 Chromosome 6 open reading frame 74

BM711013 Dynactin δ

CR612868 Family with sequence similarity 50, member A

NM_015185 Homo sapiens Cdc42 guanine nucleotide exchange factor (GEF) 9 (ARHGEF9), mRNA

AK131544 Mitogen-activated protein kinase kinase 4

AK131544 Mitogen-activated protein kinase kinase 4

AK055873 Developmentally regulated GTP binding protein 2

NM_003580 Neutral sphingomyelinase (N-SMase) activation associated factor

AK126180 Deoxythymidylate kinase (thymidylate kinase)

BM695081 Tumor suppressor candidate 2

BM695081 Tumor suppressor candidate 2 BU738664 Coagulation factor Vlll-associated (intronic transcript)

BX648934 Interferon regulatory factor 2

BC052951 Lamin B1

NM_213566 DNA fragmentation factor, 45kDa, alpha polypeptide

BX648236 BRAF35/HDAC2 complex (80 kDa)

NM_014674 ER degradation enhancer, mannosidase alpha-like 1

NM_003335 Ubiquitin-activating enzyme E1-like

AK125918 Glucan (1 ,4-alpha-), branching enzyme 1 (glycogen branching enzyme, Andersen disease, glycogen storage disease type IV)

NM_012262 Heparan sulfate 2-O-sulfotransferase 1

NM_012262 Heparan sulfate 2-O-sulfotransferase 1

NM_012262 Heparan sulfate 2-O-sulfotransferase 1

BC063297 Ring finger protein 44

AB002353 KIAA0355

BX648258 Chromosome 16 open reading frame 35

BC035590 CCR4-NOT transcription complex, subunit 4

AK056701 Vacuolar protein sorting 11 (yeast)

X71661 Lectin, mannose-binding, 1

X71661 Lectin, mannose-binding, 1

NM_004973 Jumonji, AT rich interactive domain 2

AF251295 adaptor-related protein complex 1 , sigma 2 subunit

BX647483 Adaptor-related protein complex 1 , sigma 2 subunit

AK126664 Cyclin D binding myb-like transcription factor 1

CD014015 Deoxycytidine kinase

BC000968 T-complex-associated-testis-expressed 1-like

CR606572 BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)

NM_006416 Solute carrier family 35 (CMP-sialic acid transporter), member A1

AK095071 Guanine nucleotide binding protein-like 1

NM_000195 Hermansky-Pudlak syndrome 1

NM_000195 Hermansky-Pudlak syndrome 1

NM_007269 Syntax'n binding protein 3

BC030291 ADP-ribosylation factor 6

BC030291 ADP-ribosylaf on factor 6

NIVM 70695 TGFB-induced factor (TALE family homeobox)

Y14391 GTP binding protein 6 (putative)

NM_003581 NCK adaptor protein 2

BC072433 Small nuclear ribonucleoprotein polypeptide E

AL137447 Zinc finger protein 148 (pHZ-52)

AL137447 Zinc finger protein 148 (pHZ-52)

AF055581 Lymphocyte adaptor protein

BC071589 KIAA0863 protein

BC071589 KIAA0863 protein

NM_001233 Caveolin 2

NM_001233 Caveolin 2

NM_000093 Collagen, type V, alpha 1

BX648462 Insulin-degrading enzyme

BX648462 Insulin-degrading enzyme

BC051651 Protein tyrosine phosphatase, receptor type, M BX537426 Syπtaxin 5A

AK122897 Kinesin-associated protein 3

BC038223 DEAH (Asp-Glu-Ala-His) box polypeptide 8

CR623416 Phytanoyl-CoA hydroxylase (Refsum disease)

AK022420 lntegrin beta 1 binding protein 1

AK022420 lntegrin beta 1 binding protein 1

BC056156 Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform

AJ496568 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12

AJ496568 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12

AK125997 CCAAT/enhancer binding protein zeta

BM909365 Translocase of inner mitochondrial membrane 17 homolog B (yeast)

AF061016 UDP-glucose dehydrogenase

NM_002894 Retinoblastoma binding protein 8

AJ010014 Likely ortholog of mouse metal response element binding transcription factor 2

AJ010014 Likely ortholog of mouse metal response element binding transcription factor 2

AJ010014 Likely ortholog of mouse metal response element binding transcription factor 2

NM_004454 Ets variant gene 5 (ets-related molecule)

NM_004454 Ets variant gene 5 (ets-related molecule)

NM_001128 Adaptor-related protein complex 1 , gamma 1 subunit

AK128860 Origin recognition complex, subunit 4-like (yeast)

AK128860 Origin recognition complex, subunit 4-like (yeast)

NM_015846 Methyl-CpG binding domain protein 1

NM_015310 Pleckstrin and Sec7 domain containing 3

NM_015310 Pleckstrin and Sec7 domain containing 3

NM_014296 Calpain 7

NM_014296 Calpain 7

AK095035 C-myc binding protein

AK095035 C-myc binding protein

BQ215664 MAD2 mitotic arrest deficient-like 1 (yeast)

NM_014741 KIAA0652 gene product

NM_014741 KIAA0652 gene product

BC050559 Polymerase (DNA directed), gamma

AK027210 Dual specificity phosphatase 14

AL050275 Cysteine-rich with EGF-like domains 1

AK131426 PDZ and LIM domain 7 (enigma)

BM552702 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa

AL161980 Suppressor of cytokine signaling 2

AL161980 Suppressor of cytokine signaling 2

M73047 Tripeptidyl peptidase Il

M73047 Tripeptidyl peptidase Il

BG528818 cell division cycle 40 homolog (yeast)

NM_015891 Cell division cycle 40 homolog (yeast)

BC065384 Pre-mRNA cleavage complex Il protein Pcf11

BX640605 Splicing factor, arginine/serine-rich 5

U51587 Golgi autoantigen, golgin subfamily a, 1

U51587 Golgi autoantigen, golgin subfamily a, 1

NM_201444 Diacylglycerol kinase, alpha 8OkDa

AB011175 TBC1 domain family, member 4 NM_014832 Homo sapiens TBC1 domain family, member 4 (TBC1 D4), mRNA

BX571741 Kinesin family member 3C

BM908616 FK506 binding protein 2, 13kDa

AL137653 C-terminal binding protein 1

NM_005524 Hairy and enhancer of split 1 , (Drosophila)

NM_005524 Hairy and enhancer of split 1 , (Drosophila)

BC030529 Proteasome (prosome, macropain) subunit, alpha type, 4

NM_002765 Phosphoribosyl pyrophosphate synthetase 2

NM_005977 Ring finger protein (C3H2C3 type) 6

BC052628 Armadillo repeat containing, X-linked 2

CR624273 Down syndrome critical region gene 2

NM_005926 Microfibrillar-associated protein 1

NM_002705 Periplakin

AK127242 Special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating

DNA's)

BC050455 Damage-specific DNA binding protein 2, 48kDa

BX648390 Adaptor-related protein complex 3, mu 2 subunit

NMJ 70707 Lamin A/C

BC026214 Leucine-zipper-like transcriptional regulator 1

NM_012329 Monocyte to macrophage differentiation-associated

AB033060 Programmed cell death 6

BC035456 CD53 antigen

BC028033 Microfibrillar-associated protein 2

CR604810 Cyclin A2

AJ007041 Myeloid/lymphoid or mixed-lineage leukemia 4

NM_016255 Family with sequence similarity 8, member A1

BC045666 Tumor protein p53 inducible protein 11

BF508021 Retinol binding protein 1 , cellular

NM_000599 Insulin-like growth factor binding protein 5

NM_000599 Insulin-like growth factor binding protein 5

NM_000599 Insulin-like growth factor binding protein 5

AK025738 ASF1 anti-silencing function 1 homolog A (S. cerevisiae)

AK025738 ASF1 anti-silencing function 1 homolog A (S. cerevisiae)

NM_016227 Chromosome 1 open reading frame 9

BQ722079 Heme binding protein 2

AL833062 Rho GTPase-activating protein

BC050383 Thymopoietin

AK054972 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)

NM_007289 Membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, CALLA, CD10)

AK095810 Ribonuclease P/MRP 3OkDa subunit BC035874 * Chromosome 17 open reading frame 35

AK027663 Stanniocalcin 2

AK027663 Stanniocalcin 2

BX538294 Cadherin 2, type 1 , N-cadherin (neuronal)

BX538294 Cadherin 2, type 1, N-cadherin (neuronal)

AK128679 Hypothetical protein FLJ35827

NM_005730 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2

NM_000276 Oculocerebrorenal syndrome of Lowe NM_005047 Hypothetical protein LOC253039

AK128828 Telomeric repeat binding factor (NIMA-interacting) 1

AK128828 Telomeric repeat binding factor (NIMA-interacting) 1

AK128685 PKD2 interactor, golgi and endoplasmic reticulum associated 1

NM_003893 LIM domain binding 1

AK075166 Beta-1 ,3-glucuronyltransferase 3 (glucuronosyltransferase I)

AK128210 ATX1 antioxidant protein 1 homolog (yeast)

BF680536 Spermidine/spermine N 1-acety transferase

BC021213 PRA1 domain family 2

AJ420529 Syntaxin 7

BU738862 Sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)

AK024387 Protein tyrosine phosphatase, receptor type, A

AK122722 Presenilin 1 (Alzheimer disease 3)

AK126670 Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa

NM_014964 Epsin 2

NM_014964 Epsin 2

BF242952 Mitochondrial ribosomal protein L19

AK123373 MpV17 transgene, murine homolog, glomerulosclerosis

AK094811 Phosphomannomutase 1

AK131531 Cyclin-dependent kinase (CDC2-like) 10

AK131531 Cyclin-dependent kinase (CDC2-like) 10

NM_006633 IQ motif containing GTPase activating protein 2

NM_006670 Trophoblast glycoprotein

NM_001855 Collagen, type XV, alpha 1

BM467531 NADH dehydrogenase (ubiquinone) 1 , subcomplex unknown, 1, 6kDa

NM_014928 KIAA1046 protein

NM_018121 Hypothetical protein LOC143286

NM_018121 Hypothetical protein LOC143286

BG827359 Sec61 gamma subunit

AL096748 Armadillo repeat containing 8

AL096748 Armadillo repeat containing 8

AK128704 CD27-binding (Siva) protein

D42054 Translokin

D42054 Translokin

D42054 Translokin

D42054 Translokin

NMJD14665 Leucine rich repeat containing 14

Y13467 PPAR binding protein

BX538246 Down syndrome critical region gene 1-like 1

NMJD04431 EPH receptor A2

BC002579 Glutaryl-Coenzyme A dehydrogenase

NM_006102 plasma glutamate carboxypeptidase

NM_199186 2,3-bisphosphoglycerate mutase

BC006327 Peroxisomal biogenesis factor 14

AF285167 ATP-binding cassette, sub-family A (ABC1), member 1

AF285167 ATP-binding cassette, sub-family A (ABC1 ), member 1

AF071309 Trinucleotide repeat containing 11 (THR-associated protein, 23OkDa subunit)

BC052977 Tumor necrosis factor receptor superfamily, member 1 B NM_000245 Met proto-oncogene (hepatocyte growth factor receptor)

AK094755 Trafficking protein particle complex 3

AK094755 Trafficking protein particle complex 3

NM_025137 Hypothetical protein FLJ21439

NM_203351 Mitogen-activated protein kinase kinase kinase 3

NM_006556 Phosphomevalonate kinase

NM_003098 Syntrophin, alpha 1 (dystrophin-associated protein A1, 59kDa, acidic component)

BC017271 Metaxin 2

NM_000081 Chediak-Higashi syndrome 1

AB037829 UPF2 regulator of nonsense transcripts homolog (yeast)

NM_014345 Zinc finger protein 318

AK127930 Copper chaperone for superoxide dismutase

AK055753 Mercaptopyruvate sulfurtransferase

NM_000038 Adenomatosis polyposis coli

NM_000038 Adenomatosis polyposis coli

NMJ316294 protein phosphatase 6, catalytic subunit

CR590461 Syntaxin 4A (placental)

NM_003478 Cullin 5

NM_003478 Cullin 5

NM_003478 Cullin 5

CR593275 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)

NM_004804 WD40 protein Ciaoi

NM_002767 Phosphoribosyl pyrophosphate synthetase-associated protein 2

NM_001745 Calcium modulating ligand

NM_001206 Basic transcription element binding protein 1

NM_001206 Basic transcription element binding protein 1

NM_003473 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 1

AK125912 Asparagine-linked glycosylation 8 homolog (yeast, alpha-1 ,3-glucosyltransferase)

AB018267 lmportin 13

U47924 CD4 antigen (p55)

NM_006589 Chromosome 1 open reading frame 2

AK124809 COX11 homolog, cytochrome c oxidase assembly protein (yeast)

NM_198794 Mitogen-activated protein kinase kinase kinase kinase 5

NM_198794 Mitogen-activated protein kinase kinase kinase kinase 5

BQ278502 Pituitary tumor-transforming 1

NM_014369 Protein tyrosine phosphatase, non-receptor type 18 (brain-derived)

BC042145 Zinc fingers and homeoboxes 2

BM550965 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1)

BC033647 Cullin 7

CD359152 Gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase)

NM_022549 Fasciculation and elongation protein zeta 1 (zygin I)

NM_021638 Hypothetical protein LOC254848

AJ007669 Fanconi anemia, complementation group G

BX537726 Menage a trais 1 (CAK assembly factor)

NM_000028 Amylo-1 , 6-glucosidase, 4-alpha-glucanotransferase (glycogen debranching enzyme, glycogen storage disease type III)

BX640949 Tripartite motif-containing 38 BX640949 Tripartite motif-containing 38

Y16355 Oral-facial-digital syndrome 1

BC068542 Lysyl oxidase-like 1

AL157440 Chromosome 10 open reading frame 116

NM_005641 TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 8OkDa

CR625243 Rab geranylgeranyltransferase, alpha subunit

NM_005384 Nuclear factor, interleukin 3 regulated

AK125922 Casein kinase 2, alpha prime polypeptide

AK023909 Branched chain aminotransferase 2, mitochondrial

XM_378195 General transcription factor HH, polypeptide 4, 52kDa

CR749291 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6

CR749291 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6

CR749291 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 6

AK094615 RAB4A, member RAS oncogene family

AK094615 RAB4A, member RAS oncogene family

BC039078 Unc-50 homolog (C. elegans)

AK057571 KIAA0103

BX537525 Zinc finger protein 185 (LIM domain)

U25771 ADP-ribosylation factor 4-like

NM_006286 Transcription factor Dp-2 (E2F dimerization partner 2)

NM_006141 Dynein, cytoplasmic, light intermediate polypeptide 2

BC005839 Follistatin-like 3 (secreted glycoprotein)

AF146277 CD2-associated protein

BM455885 RNA terminal phosphate cyclase domain 1

NM_012420 Interferon-induced protein with tetratricopeptide repeats 5

NM_012420 Interferon-induced protein with tetratricopeptide repeats 5

AF071185 WW domain binding protein 4 (formin binding protein 21)

AF071185 WW domain binding protein 4 (formin binding protein 21 )

AF071185 WW domain binding protein 4 (formin binding protein 21 )

AB000460 Chromosome 4 open reading frame 8

NM_003443 Zinc finger and BTB domain containing 17 .

NM_014795 Zinc finger homeobox 1b

XM_496278 Zinc finger protein 516

BC000652 Signal recognition particle 54kDa

BM919105 NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)

NM_014937 Inositol polyphosphate-5-phosphatase F

BX640949 Tripartite motif-containing 38

NM_005652 Telomeric repeat binding factor 2

AK095253 Bystin-like

AK098413 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa

NMJ321645 Similar to hypothetical protein B230397C21

CR601418 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1

CR627365 Polymerase (DNA directed), beta

NM_005229 ELK1 , member of ETS oncogene family

AB018312 FCH and double SH3 domains 2

BX648034 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa

NM_020143 Putatative 28 kDa protein

NM_017514 Plexin A3 L03426 DNA segment on chromosome X and Y (unique) 155 expressed sequence

BG165642 S-phase kinase-associated protein 2 (p45)

NM_000875 Insulin-like growth factor 1 receptor

NM_000875 Insulin-like growth factor 1 receptor

NM_006348 Component of oligomeric golgi complex 5

NM_006348 Component of oligomeric golgi complex 5

NM_016235 G protein-coupled receptor, family C, group 5, member B

AK172798 Carnitine palmitoyltransferase 1A (liver)

AK172798 Carnitine palmitoyltransferase 1A (liver)

AK126461 Down syndrome critical region gene 3

AF041210 Midline 1 (Opitz/BBB syndrome)

AF041210 Midline 1 (Opitz/BBB syndrome)

BE328496 muscleblind-like 2 (Drosophila)

BX649112 COBL-like 1

BX649112 COBL-like 1

NM_006494 Ets2 repressor factor

AB020679 HSV-1 stimulation-related gene 1

NM_004109 Ferredoxin 1

NM_004109 Ferredoxin 1

D86972 TatD DNase domain containing 2

BM809431 Protein C receptor, endothelial (EPCR)

AB002303 Zinc finger, FYVE domain containing 16

AK092015 Mitogen-activated protein kinase kinase kinase 11

BC010385 Coilin

BC010385 Coilin

CR591751 X-ray repair complementing defective repair in Chinese hamster cells 1

NM_014845 KIAA0274

BC013359 Cathepsin F

NM_000387 Solute carrier family 25 (camitine/acylcamitine translocase), member 20

NM_213590 Ret finger protein 2

NM_006031 Pericentrin 2 (kendrin)

BM911641 Cytochrome c oxidase subunit Va

AK095788 Polymerase (RNA) Il (DNA directed) polypeptide D

BG165629 Heme oxygenase (decycling) 1

BX647204 Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)

AL353949 Tubulin-specific chaperone a

BX647111 Mannosidase, alpha, class 2C, member 1

BC023565 Diacylglycerol O-acyltransferase homolog 1 (mouse)

NM_000367 Thiopurine S-methyltransferase

NM_014877 Homo sapiens helicase with zinc finger domain (HELZ), mRNA

AK128739 Nucleobindin 2

NM_002076 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease HID)

BM450207 TAR (HIV) RNA binding protein 2

NM_014967 Homo sapiens KIAA1018 protein (KIAA1018), mRNA

BU736306 lnterleukin 1 receptor-like 1 ligand

AK122922 Isovaleryl Coenzyme A dehydrogenase

BM701452 Vascular endothelial growth factor B

NM_000633 B-cell CLUIymphoma 2 BF572325 N-methylpurine-DNA glycosylase

NM_000297 Polycystic kidney disease 2 (autosomal dominant)

NM_002024 Fragile X mental retardation 1

BC046634 Tubulin, gamma complex associated protein 3

NM_001949 E2F transcription factor 3

NM_001949 E2F transcription factor 3

BC008825 DEAH (Asp-Glu-Ala-His) box polypeptide 16

BX647389 Deafness, autosomal dominant 5

AL390133 Hypothetical protein FLJ20244

NM_002955 Ras responsive element binding protein 1

AB017365 Frizzled homolog 7 (Drosophila)

AB017365 Frizzled homolog 7 (Drosophila)

NM_005741 Zinc finger protein 263

AK124567 3-hydroxyisobutyryl-Coenzyme A hydrolase

AL832245 KIAA0020

U61232 Tubulin-specific chaperone e

U61232 Tubulin-specific chaperone e

NM_001935 Dipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)

NM_001935 Dipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)

BC050553 Neuropathy target esterase

AK092039 Excision repair cross-complementing rodent repair deficiency, complementation group 1

(includes overlapping antisense sequence)

AK092039 Excision repair cross-complementing rodent repair deficiency, complementation group 1

(includes overlapping antisense sequence)

BC001535 CGI-48 protein

NM_003748 . Aldehyde dehydrogenase 4 family, member A1

BC051716 Rap2 interacting protein x

CR612719 Growth arrest and DNA-damage-inducible, alpha

NM_006929 Superkiller viralicidic activity 2-like (S. cerevisiae)

CR627020 BCL2-antagonist/killer 1

BM556279 Epithelial membrane protein 3 r,

BX648490 Zinc finger protein 95 homolog (mouse)

BX648490 Zinc finger protein 95 homolog (mouse)

NM_016213 Thyroid hormone receptor interactor 4

AK124033 Dexamethasone-induced transcript

NM_018416 Forkhead box J2

N35896 PTPRF interacting protein, binding protein 1 (liprin beta 1)

NM_003622 PTPRF interacting protein, binding protein 1 (liprin beta 1)

AF325193 Peroxisome proliferative activated receptor, gamma, coactivator-related 1

BC032845 Hypothetical protein FLJ 11193

NM_006526 Zinc finger protein 217

BX537773 M-phase phosphoprotein 6

D25538 Adenylate cyclase 7

NM_003211 Thymine-DNA glycosylase

BX537505 High-mobility group box 3

CR749578 Holocytochrome c synthase (cytochrome c heme-lyase)

CR749578 Holocytochrome c synthase (cytochrome c heme-lyase)

BX648906 RNA binding motif, single stranded interacting protein 1 NM_000964 Retinoic acid receptor, alpha

NM_005354 Jun D proto-oncogene

AK095066 Transcription factor 4

AF053306 BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)

NM_014786 Rho guanine nucleotide exchange factor (GEF) 17

NM_001334 Cathepsin O

AK128605 Sialyltransferase 4C (beta-galactoside alpha-2,3-sialyltransferase)

BC040558 Dynein 2 light intermediate chain

BC040558 Dynein 2 light intermediate chain

NM_014750 Discs, large homolog 7 (Drosophila)

AK127212 Leiomodin 1 (smooth muscle)

M16505 Steroid sulfatase (microsomal), arylsulfatase C, isozyme S

M16505 Steroid sulfatase (microsomal), arylsulfatase C, isozyme S

M16505 Steroid sulfatase (microsomal), arylsulfatase C, isozyme S

BX647539 Biliverdin reductase A

BX647539 Biliverdin reductase A

U73338 5-methyltetrahydrofolate-homocysteine methyltransferase

NMJD14251 Solute carrier family 25, member 13 (citrin)

U66359 G patch domain and KOW motifs

CR593942 Ribosomal protein S6 kinase, 7OkDa, polypeptide 2

BC015743 Mannosidase, beta A, lysosomal

AK094440 Mitochondrial ribosomal protein L33

NM_005035 Polymerase (RNA) mitochondrial (DNA directed)

NM_018380 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28

BM712315 Tumor protein D52-like 1

BC041991 Single-stranded DNA binding protein 2

NM_006379 Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

NMJ306379 Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

BF217184 Heat-responsive protein 12

AJ005821 Dmx-like 1

NM_007144 Ring finger protein 110

NM_007144 Ring finger protein 110

NM_003607 CDC42 binding protein kinase alpha (DMPK-like)

NM_020993 B-cell CLL/lymphorπa 7A

AY314007 Type I transmembrane C-type lectin receptor DCL-1

BM704058 Mitochondrial ribosomal protein S14

BM704058 Mitochondrial ribosomal protein S14

AK126375 Williams Beuren syndrome chromosome region 2OA

AB020715 Prenylcysteine oxidase 1

NM_016424 Cisplatin resistance-associated overexpressed protein

AK122839 V-akt murine thymoma viral oncogene homolog 2

AK122839 V-akt murine thymoma viral oncogene homolog 2

BG252490 DnaJ (Hsp40) homolog, subfamily B, member 4

NM_007034 DnaJ (Hsp40) homolog, subfamily B, member 4

AB011538 Slit homolog 3 (Drosophila)

AB011538 Slit homolog 3 (Drosophila)

AK056981 NAD(P)H dehydrogenase, quinone 2

CR749711 Glutathione S-transferase theta 1 BU734722 Deoxyguanosine kinase

BC047620 Guanylate cyclase 1 , soluble, beta 3

AK128438 Splicing factor 3a, subunit 3, 6OkDa

U43188 E74-like factor 2 (ets domain transcription factor)

AK128127 Regulator of G-protein signalling 3

NM_007371 Bromodomain containing 3

NM_017983 WD40 repeat protein Interacting with phospholnositides of 49kDa

AK074228 Elongation protein 4 homolog (S. cerevisiae)

BC016953 Protein kinase Njmu-R1

NM_014925 Homo sapiens KIAA1002 protein (KIAA1002), mRNA

CD388516 Small nuclear ribonucleoprotein polypeptide F

NM_006464 Trans-golgi network protein 2

NM_006464 Trans-golgi network protein 2

BC052210 Glycoprotein A repetitions predominant

U67156 Mitogen-activated protein kinase kinase kinase 5

U67156 Mitogen-activated protein kinase kinase kinase 5

NM_005781 Activated Cdc42-associated kinase 1

U79751 Basic leucine zipper nuclear factor 1 (JEM-1)

AB025186 Microtubule-associated protein, RP/EB family, member 3

AK124543 Ribosomal protein S6 kinase, 9OkDa, polypeptide 3

NM_003884 P300/CBP-associated factor

NM_012210 Tripartite motif-containing 32

BM913156 Insulin-like growth factor binding protein 6

NM_017411 Survival of motor neuron 1 , telomeric

AK122686 I factor (complement)

NM_014969 . KIAA0893 protein

AK054963 For protein disulfide isomerase-related

NM_001303 COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase

(yeast)

NM_002579 Paralemmin

AL122056 Prcpionyl Coenzyme A carboxylase, alpha polypeptide

NM_015833 Adenosine deaminase, RNA-specific, B1 (RED1 homolog rat)

CR749464 Vascular cell adhesion molecule 1

NM_022832 Ubiquitin specific protease 46

NM_022832 Ubiquitin specific protease 46

CR626749 SUMO1/sentrin/SMT3 specific protease 3

NM_003069 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1

NM_003069 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1

AF370417 Matrix metalloproteinase 11 (stromelysin 3)

NM_005026 Phosphoinositide-3-kinase, catalytic, delta polypeptide

BU506590 COX17 homolog, cytochrome c oxidase assembly protein (yeast)

NM_004010 Dystrophin (muscular dystrophy, Duchenne and Becker types)

BC035716 Interferon-stimulated transcription factor 3, gamma 48kDa

AB023158 RAB11 family interacting protein 2 (class I)

AB023158 RAB11 family interacting protein 2 (class I)

BC009109 RAB21 , member RAS oncogene family NM_001004019 Rbulin 2

AK057017 Secretory granule, neuroendocrine protein 1 (7B2 protein)

AK027590 Death-associated protein kinase 3

AK027590 Death-associated protein kinase 3

BF035171 WAP four-disulfide core domain 2

BC033320 TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa

BC051890 Tubulin, gamma 2

NM_000933 Phospholipase C, beta 4

NM_020424 Hypothetical protein A-211C6.1

BQ183329 Transcribed locus

BC052570 Calcitonin gene-related peptide-receptor component protein

NM_024547 KIAA0467 protein

BC038582 Mitogen-activated protein kinase kinase kinase 7 interacting protein 1

AY358990 Hephaestin

BC044763 Poly(A)-specific ribonuclease (deadenylation nuclease)

AY653734 IQ motif and Sec7 domain 1

NM_003759 Solute carrier family 4, sodium bicarbonate cotransporter, member 4

BC035029 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 6

NM_004815 PTPL1-associated RhoGAP 1

BC028092 Deoxyribonuclease l-like 1

BC052780 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2

BC050623 Transcription elongation factor A (SII), 2

AK122661 Nuclear receptor subfamily 1 , group H, member 3

AB021124 Carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2

BC032720 Cytochrome b-245, beta polypeptide (chronic granulomatous disease)

NM_002061 Glutamate-cystelne ligase, modifier subunit

BC050458 ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit

BM557512 Mitochondrial ribosomal protein L12

BC017508 Major histocompatibility complex, class II, DM beta

BC051360 RAB11 family interacting protein 3 (class II)

BC036748 Activin A receptor, type.!

BC006093 Matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

BC065937 δ'-nucleotidase, ecto (CD73)

NM_014909 KIAA1036

BC016687 Hypothetical protein FLJ10871

NM_004798 Kinesin family member 3B

BC016661 Butyrophilin, subfamily 2, member A1

BC029050 Arginase, type Il

BC029050 Arginase, type Il

AK091059 Hypothetical protein LOC283267

BC036307 Calponin 1 , basic, smooth muscle

BX538263 Activating transcription factor 6

NM_014811 KIAA0649

NM_014941 Homo sapiens zinc finger, CW type with coiled-coil domain 1 (ZCWCC1), mRNA

NM_198258 E2F transcription factor 6

AK128270 Chromosome 1 open reading frame 41

NM_001218 Carbonic anhydrase XII

AK124323 N-myc (and STAT) interactor NM_006676 Ubiquitin specific protease 20

AK124299 Protein phosphatase 1 A (formerly 2C), magnesium-dependent, alpha isoform

NM_001254 CDC6 cell division cycle 6 homolog (S. cerevisiae)

NM_001254 CDC6 cell division cycle 6 homolog (S. cerevisiae)

BX648803 Peroxisomal biogenesis factor 3

NM_001859 Solute carrier family 31 (copper transporters), member 1

BX648803 Peroxisomal biogenesis factor 3

BM923704 CCAAT/enhancer binding protein (C/EBP), delta

NM_012080 Haloacid dehalogenase-like hydrolase domain containing 1A

BE733681 Nucleotide binding protein 1 (MinD homolog, E. coli)

NM_020326 ATP-binding cassette, sub-family D (ALD), member 4

BX537610 Translin-associated factor X

NM_001229 Caspase 9, apoptosis-related cysteine protease

AK074821 Zinc finger protein 212

CR627383 Genethonin 1

BX538222 Frizzled homolog 6 (Drosophila)

AJ536056 Fucosyltransferase 8 (alpha (1 ,6) fucosyltransferase)

NM_001992 Coagulation factor Il (thrombin) receptor

CR749602 Ubiquitously transcribed tetratricopeptide repeat, X chromosome

CR749602 Ubiquitously transcribed tetratricopeptide repeat, X chromosome

CR749602 Ubiquitously transcribed tetratricopeptide repeat, X chromosome

BX538227 Synaptotagmin I

AK092059 Guanine nucleotide binding protein (G protein), beta 5

CR624760 Small nuclear RNA activating complex, polypeptide 3, 5OkDa

AK125326 Nucleoporin like 2

AK027848 CDNA FLJ14942 fis, A-PLACE1011185

AK095165 PRKC, apoptosis, WT1 , regulator

BM541924 Dynein, axonemal, light polypeptide 4

NM_033360 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog

NM_033360 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog

BX648582 Sprouty homolog 2 (Drosophila)

NM_014793 Leucine carboxyl methyltransferase 2

BU739742 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3

AK123829 SH3 domain containing, Ysc84-like 1 (S. cerevisiae)

BC036087 Purine-rich element binding protein A

BC036087 Purine-rich element binding protein A

NM_007014 WW domain containing E3 ubiquitin protein ligase 2

N M_002916 Replication factor C (activator 1 ) 4, 37kDa

AF061326 Chromosome 8 open reading frame 1

AK055180 Programmed cell death 2

NM_001005414 ZW10 interactor

BC054492 RAB GTPase activating protein 1

BX648179 Schwannomin interacting protein 1

AK094109 Poly(rC) binding protein 2

BC028477 Breast cancer anti-estrogen resistance 3

NM_004237 Thyroid hormone receptor interactor 13

BM698722 Ethylmalonic encephalopathy 1

BC022509 Secretogranin Il (chromogranin C) BC036034 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2

BC036034 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2

BC036034 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2

BC050283 WAS protein family, member 3

AK090801 Quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase

(carboxylating))

BM690957 Transcription elongation factor A (Sll)-like 1

NMJD14721 Homo sapiens phosphatase and actin regulator 2 (PHACTR2), mRNA

NM_014721 Homo sapiens phosphatase and actin regulator 2 (PHACTR2), mRNA

NM_014721 Homo sapiens phosphatase and actin regulator 2 (PHACTR2), mRNA

CR599555 Clathrin, light polypeptide (Lea)

AF026692 Secreted frizzled-related protein 4

AF026692 Secreted frizzled-related protein 4

NM_000314 Phosphatase and tensin homolog (mutated in multiple advanced cancers 1)

NM_000314 Phosphatase and tensin homolog (mutated in multiple advanced cancers 1)

AL049699 RWD domain containing 2

NM_002395 Malic enzyme 1 , NADP(+)-dependent, cytosolic

NM_005044 Protein kinase, X-linked

AB014523 Unc-51-like kinase 2 (C. elegans)

AB014523 Unc-51-like kinase 2 (C. elegans)

AF033827 Carbohydrate sulfotransferase 10

AK127068 Trinucleotide repeat containing 17

L31573 Sulfite oxidase

AK131363 Serine/threonine kinase 3 (STE20 homolog, yeast)

CR749827 Meisi , myeloid ecotropic viral integration site 1 homoiog (mouse)

AK123723 Retinoic acid receptor responder (tazarotene induced) 3

NM_005802 Topoisomerase I binding, arginine/serine-rich

U50534 Hypothetical protein CG003

AB023171 Chromosome 11 open reading frame 9

XM_375682 Glycine-, glutamate-, thienylcyclohexylpiperidine-binding protein

NM_014704 Homo sapiens glycine-, glutamate-, thienylcyclohexylpiπ°ridine-binding protein (KIAA0562), mRNA

AB002390 Ectonudeoside triphosphate diphosphohydrolase 4

AB002390 Ectonudeoside triphosphate diphosphohydrolase 4

NMJD06455 Synaptonemal complex protein SC65

AK057171 Tyrosylprotein sulfotransferase 2

NM_006195 Pre-B-cell leukemia transcription factor 3

CR590682 Tropomyosin 2 (beta)

AF068227 Ceroid-lipofuscinosis, neuronal 5

AF068227 Ceroid-lipofuscinosis, neuronal 5

U83993 Purinergic receptor P2X, ligand-gated ion channel, 4

NMJ305922 Mitogen-activated protein kinase kinase kinase 4

BF316165 Phosphodiesterase 6D, cGMP-specific, rod, delta

AK094534 Cyclin H

AB014569 KIAA0669 gene product

NM_006532 Elongation factor RNA polymerase Il

NM_016024 RNA binding motif protein, X-linked 2

NM_016024 RNA binding motif protein, X-linked 2 BX648385 SW1/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3

NM_001961 Eukaryotic translation elongation factor 2

U44755 Small nuclear RNA activating complex, polypeptide 2, 45kDa

BC038448 Testis-specific kinase 1

BC039244 Nuclear transcription factor Y, alpha

NM_006895 Histamine N-methyltransferase

NM_006895 Histamine N-methyltransferase

NM_006895 Histamine N-methyltransferase

NM_198700 CUG triplet repeat, RNA binding protein 1

BX648241 Nidogen 2 (osteonidogen)

BF971151 Guanine nucleotide binding protein (G protein), gamma 11

NM_002726 Prolyl endopeptidase

NM_001123 Adenosine kinase

NM_001123 Adenosine kinase

NMJD16013 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1

CR749565 Replication factor C (activator 1 ) 3, 38kDa

CR749565 Replication factor C (activator 1 ) 3, 38kDa

NMJD04326 B-cell CLUIymphoma 9

BX649171 Forkhead box O3A

BX649171 Forkhead box O3A

NM_182909 Downregulated in ovarian cancer 1

L02870 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive)

AL832142 Transmembrane 7 superfamily member 1 (upregulated in kidney)

NM_198055 Zinc finger protein 42 (myeloid-specific retinoic acid-responsive)

NM_003596 Tyrosylprotein sulfotransferase 1

BM470828 Tubulin, beta polypeptide

AK127219 RTS beta protein

AK127219 RTS beta protein

NM_004204 Phosphatidylinositol glycan, class Q

BU72rø,53 FSHD region gene 1 /.,.

CR625391 RAD51 associated protein 1

NM_007111 Transcription factor Dp-1

BC078169 POM (POM121 homolog, rat) and ZP3 fusion

NM_000850 Glutathione S-transferase M4

AK095239 Aldo-keto reductase family 1 , member C1 (dihydrodiol dehydrogenase 1 ; 20-alpha (3-alpha)- hydroxysteroid dehydrogenase)

CR607883 Cysteine dioxygenase, type I

AL832068 KIAA0999 protein

AL832068 KIAA0999 protein

BC032465 T-cell, immune regulator 1 , ATPase, H+ transporting, lysosomal VO protein a isoform 3

AK091170 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)

AB020686 Ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function)

AL050138 Elastin microfibril interfacer 1

BC044591 WAS protein family, member 1

N M_014963 Homo sapiens Kl AA0963 (Kl AA0963), m RNA

NM_000060 Biotinidase

BX538128 Microsomal glutathione S-transferase 2 NM_000883 IMP (inosine monophosphate) dehydrogenase 1

BQ898943 CDC28 protein kinase regulatory subunit 2

AK091503 Ribosomal protein S6 kinase, 7OkDa, polypeptide 1

BC023551 Coproporphyrinogen oxidase

BQ673169 Myosin light chain 1 slow a

BU 198818 Arachidonate 5-lipoxygenase-activating protein

BM675389 Zinc finger protein 593

NM_014458 Kelch-like ECT2 interacting protein

NM_014458 Kelch-like ECT2 interacting protein

BC000488 RNA binding motif protein 14

BF670653 Myoglobin

AF049907 Zinc finger protein 297B

AF049907 Zinc finger protein 297B

BC030707 Peptidylprolyl isomerase D (cyclophilin D)

BC030707 Peptidylprolyl isomerase D (cyclophilin D)

BM994423 Guanosine monophosphate reductase

BC072462 Retinoic acid receptor, gamma

AL832776 Chromosome 13 open reading frame 22

NM_000629 Interferon (alpha, beta and omega) receptor 1

NM_152253 Carnitine palmitoyltransferase 1 B (muscle)

NM_206866 BTB and CNC homology 1, basic leucine zipper transcription factor 1

NM_004350 Runt-related transcription factor 3

U12128 Protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)

NM_017604 KIAA1023 protein

NM_001806 CCAAT/enhancer binding protein (C/EBP), gamma

AK131071 Solute carrier family 31 (copper transporters), member 2

AK092614 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G

NM_020310 MAX binding protein

BX537450 RNA guanylyltransferase and 5'-phosphatase

BC042043 Phosphate cytidylyltransferase 1 , choline, alpha isoform

BC042043 Phosphate cytidylyltransferase 1, choline, alpha isoform

NM_002759 Protein kinase, interferon-inducible double stranded RNA dependent

AK126206 Peroxisomal acyl-CoA thioesterase

AK026490 RAB32, member RAS oncogene family

AK054776 Chromosome 7 open reading frame 23

NM_024824 Nuclear protein UKp68

NM_005619 Reticulon 2

BF131607 DKFZP564M082 protein

AK124201 Proteasome (prosome, macropain) 26S subunit, ATPase, 1

CR613297 GLI pathogenesis-related 1 (glioma)

CR613297 GLI pathogenesis-related 1 (glioma)

NM_002725 Proline arginine-rich end leucine-rich repeat protein

U66097 GTP cyclohydrolase 1 (dopa-responsive dystonia)

NM_006037 Histone deacetylase 4

NM_014393 Staufen, RNA binding protein, homolog 2 (Drosophila)

U80628 Thymidine kinase 2, mitochondrial

CA455267 Peptidyl prolyl isomerase H (cyclophilin H) CB529629 Fc fragment of IgE, high affinity I1 receptor for; gamma polypeptide

AK054792 Choline kinase alpha

AL833722 Zinc finger protein 195

BC068525 GULP, engulfment adaptor PTB domain containing 1

BX647094 Friend leukemia virus integration 1

BC068525 GULP, engulfment adaptor PTB domain containing 1

BU729882 Chromosome 6 open reading frame 108

AL833191 SMC2 structural maintenance of chromosomes 2-like 1 (yeast)

BX640768 Acyl-Coenzyme A oxidase 3, pristanoyl

NM_012421 Rearranged L-myc fusion sequence

NM_006716 Activator of S phase kinase

AF001175 Ribonuclease P 14kDa subunit

BM920638 Dynactin 3 (p22)

AK026533 Cyclin-dependent kinase 5

BC063426 Guanine nucleotide binding protein (G protein), alpha 11 (Gq class)

AB028975 KIAA1052 protein

AB028975 KIAA1052 protein

NM_001798 Cyclin-dependent kinase 2

NM_000376 Vitamin D (1 ,25- dihydroxyvitamin D3) receptor

NM_000376 Vitamin D (1 ,25- dihydroxyvitamin D3) receptor

NM_000376 Vitamin D (1 ,25- dihydroxyvitamin D3) receptor

AK027031 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)

AK091608 Fatty acid desaturase 3

NMJD01270 Chromodomain helicase DNA binding protein 1

BC006365 Presenilin 2 (Alzheimer disease 4)

NM_000098 Carnitine palmitoyltransferase Il

NM_000098 Carnitine palmitoyltransferase Il

BG680024 S100 calcium binding protein A2

AB007977 KIAA0508 protein

BC022506 Estrogen receptor binding site associated, antigen, 9

NM_005632 Small optic lobes homolog (Drosophila)

BE895437 thymidine kinase 2, mitochondrial

BE895437 thymidine kinase 2, mitochondrial

BC022506 Estrogen receptor binding site associated, antigen, 9

BX641100 Proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2)

CR749478 Phenylalanine-tRNA synthetase 1 (mitochondrial)

CR749478 Phenylalanine-tRNA synthetase 1 (mitochondrial)

BX537399 Protein phosphatase 1 , regulatory (inhibitor) subunit 3C

D90070 Phorbol-12-myristate-13-acetate-induced protein 1

D90070 Phorbol-^-myristate-IS-acetate-induced protein 1

NM_021069 Arg/Abl-interacting protein ArgBP2

NMJ305589 Aldehyde dehydrogenase 6 family, member A1

BC047318 N-sulfoglucosamine sulfohydrolase (sulfamidase)

BM923055 Surfeit 1

AK090567 Phosphoinositide-3-kinase, class 3

NM_002317 Lysyl oxidase

NM_021993 gb:NM_021993.1 /DEF=Homo sapiens TLS-associated serine-arginine protein 2 (TASR2), mRNA. /FEA=mRNA /GEN=TASR2 /PROD=TLS-associated serine-arginine protein 2 /DB_XREF=gi: 12056475 /UG=Hs.353O TLS-associated serine-arginine protein 2 /FL=gb:NM_021993.1 gb:BC005039.1 gb:AF067730.1

BX537555 PET112-like (yeast)

NM_014772 KIAA0427

NM_014772 KIAA0427

AK130369 CD151 antigen

NM_014844 Homo sapiens KIAA0329 (KIAA0329), mRNA

L13436 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)

AK126342 CAMP responsive element binding protein 1

AK126342 CAMP responsive element binding protein 1

AK126342 CAMP responsive element binding protein 1

BU587578 Regulator of G-protein signalling 10

BU587578 Regulator of G-protein signalling 10

NM_080629 Collagen, type Xl, alpha 1

NMJD02499 Neogenin homolog 1 (chicken)

NM_014498 Golgi phosphopratein 4

M89914 Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)

NM_002450 metallothionein 1X

AF027219 Zinc finger protein 202

BU149479 Mitochondrial ribosomal protein S12

BU 149479 Mitochondrial ribosomal protein S12

NM_000027 Aspartylglucosaminidase

NM_000027 Aspartylglucosaminidase

BX537890 Kruppel-like factor 7 (ubiquitous)

NM_018074 Hypothetical protein FLJ10374

CR591957 Regulator of G-protein signalling 19

AL514445 regulator of G-protein signalling 4

NM_005613 Regulator of G-protein signalling 4

NMJ305613 Regulator of G-protein signalling 4

CR613909 Chromosome X open reading frame 12

BX537711 Tripartite motif-containing 16

NM_013386 Solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24

AK127355 Sec23 homolog A (S. cerevisiae)

NM_001856 Collagen, type XVI, alpha 1

NMJI70715 Ras association (RalGDS/AF-6) domain family 1

AK026966 Adenylate kinase 3

AK026966 Adenylate kinase 3

AK123613 Cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa

AK123613 Cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa

BC032830 TNF receptor-associated factor 5

AK001230 POT1 protection of telomeres 1 homolog (S. pombe)

AK001230 POT1 protection of telomeres 1 homolog (S. pombe)

BC038417 DEAH (Asp-Glu-Ala-His) box polypeptide 30

AK125156 LIM domain kinase 1

NM_013231 Fibronectin leucine rich transmembrane protein 2

NMJD13231 Fibronectin leucine rich transmembrane protein 2

NM_000263 N-acetylglucosaminidase, alpha- (Sanfilippo disease IIIB) NM_003930 Src family associated phosphoprotein 2

NM_003930 Src family associated phosphoprotein 2

NM_001993 Coagulation factor III (thromboplastin, tissue factor)

BX647092 General transcription factor HIC, polypeptide 2, beta 11OkDa

D28588 Sp2 transcription factor

NM_006218 Phosphoinositide-3-kinase, catalytic, alpha polypeptide

NM_006831 ATP/GTP-binding protein

NM_003685 KH-type splicing regulatory protein (FUSE binding protein 2)

NM_014810 Centrosome-associated protein 350

AK130330 Low density lipoprotein receptor-related protein 3

AK123115 Embryo brain specific protein

CR602190 DiGeorge syndrome critical region gene 14

NM_024026 Mitochondrial ribosomal protein 63

NM_024026 Mitochondria] ribosomal protein 63

NM_015905 Transcriptional intermediary factor 1

AK094026 Calcium/calmodulin-dependent protein kinase I

NM_003627 Solute carrier family 43, member 1

NM_005308 G protein-coupled receptor kinase 5

NM_005864 Embryonal Fyn-associated substrate

CR594348 Chromosome 22 open reading frame 3

AK001640 KIAA0738 gene product

NM_001046 Solute carrier family 12 (sodium/potassium/chloride transporters), member 2

AK057153 Putative dimethyladenosine transferase

NM_003594 Transcription termination factor, RNA polymerase Il

NM_014481 APEX nuclease (apurinic/apyrimidinic endonuclease) 2

BM458012 Interferon, alpha-inducible protein (clone IFI-6-16)

NM_000153 Galactosylceramidase (Krabbe disease)

BI911084 Glutathione S-transferase M2 (muscle)

NM_005438 FOS-like antigen 1

NM_002006 Fibroblast growth factor 2 (basic)

NM_0020(96 Fibroblast growth factor 2 (basic)

NM_013255 Muskelin 1 , intracellular mediator containing kelch motifs

NM_006815 Coated vesicle membrane protein

NM_006815 Coated vesicle membrane protein

BC035878 Solute carrier family 2 (facilitated glucose/fructose transporter), member 5

NM_006943 SRY (sex determining region Y)-box 12

NM_006038 Spermatogenesis associated 2

NM_014778 Homo sapiens nucleoporin like 1 (NUPL1), mRNA

NM_025201 PH domain-containing protein

NM_004233 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)

NM_002689 Polymerase (DNA-directed), alpha (7OkD)

BC014210 Arylsulfatase A

NM_004523 Kinesin family member 11

NM_005388 Phosducin-like

NM_005388 Phosducin-like

AB017363 Frizzled homolog 1 (Drosophila)

AB017363 Frizzled homolog 1 (Drosophila)

BC036656 Zinc finger protein 84 (HPF2) BQ279187 Leucine zipper, down-regulated in cancer 1

NM_002048 Growth arrest-specific 1

AK127898 Lysophospholipase 3 (lysosomal phospholipase A2)

AK095684 Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa

AK125316 RAD1 homolog (S. pombe)

AK125316 RAD1 homolog (S. pombe)

NM_006517 Solute carrier family 16 (monocarboxylic acid transporters), member 2

BX537573 Endothelin receptor type A

NM_004692 internexin neuronal intermediate filament protein, alpha

BF032655 Chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)

NM_005261 GTP binding protein overexpressed in skeletal muscle

NM_014630 Homo sapiens zinc finger protein 592 (ZNF592), mRNA

BC013875 Matrix metalloproteinase 1 (interstitial collagenase)

NM_002871 RAB interacting factor

NM_002871 RAB interacting factor

AK091034 Osteoclast stimulating factor 1

AK022885 Chromosome 9 open reading frame 16

NM_001003694 Bromodomain and PHD finger containing, 1

NM_001976 Enolase 3, (beta, muscle)

AK001893 Target of myb1-like 1 (chicken)

NM_014908 Transmembrane protein 15

NM_000610 CD44 antigen (homing function and Indian blood group system)

NM_000610 CD44 antigen (homing function and Indian blood group system)

AK057062 BH3 interacting domain death agonist

AK128205 DKFZP434H 132 protein

AK128205 DKFZP434H132 protein

NM_014574 Striatin, calmodulin binding protein 3

NM_001116 Adenylate cyclase 9

NM_001116 Adenylate cyclase 9

AB028958 ATP/GTP binding protein 1

NM_002514 Nephroblastoma overexpressed gene

BC027913 Protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin

B, type I)

BC027913 Protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, alpha isoform (calcineurin

B, type I)

NM_001218 Carbonic anhydrase XII

NM_017689 hypothetical protein FLJ20151

NM_002114 Human immunodeficiency virus type I enhancer binding protein 1

CR627420 Ataxin 7

BE962749 peptidylprolyl isomerase C (cyclophilin C)

BG761203 Peptidylprolyl isomerase C (cyclophilin C)

BX640795 Bromodomain containing 1

CR623239 Protein predicted by clone 23733

AK122741 Zinc finger protein 140 (clone pHZ-39)

BC033494 3-phosphoinositide dependent protein kinase-1

U90942 Myosin VA (heavy polypeptide 12, myoxin)

AL162068 Nucleosome assembly protein 1-like 1

BC010954 Chemokine (C-X-C motif) ligand 10 NM_005612 RE1-silencing transcription factor

NM_021990 Gamma-aminobutyric acid (GABA) A receptor, epsilon

AK160377 Nuclear pore complex interacting protein

NM_181507 Hermansky-Pudlak syndrome 5

BC033487 Peroxisomal biogenesis factor 6

NM_014732 Homo sapiens KIAA0513 gene product (KIAA0513), mRNA

AK095782 RAB40B, member RAS oncogene family

NM_014002 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon

BQ880398 Glutathione S-transferase M1

AA355179 inositol polyphosphate-4-phosphatase, type 1, 107kDa

AL109928 chromosome 20 open reading frame 177

NM_198968 DAZ interacting protein 1

NM_198968 DAZ interacting protein 1

AK127573 LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae)

NM_006315 Ring finger protein 3

BM725199 Thioesterase superfamily member 2

NM_003620 Protein phosphatase 1 D magnesium-dependent, delta isoform

AK131251 KIAA0831

NM_016513 Intestinal cell (MAK-like) kinase

BM726594 Cytochrome c oxidase subunit Vila polypeptide 1 (muscle)

BM807602 Protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)

NM_021151 Carnitine O-octanoyltransferase

BC030206 • Matrix metalloproteinase 19

AB014543 Clusterin associated protein 1

AB014543 Clusterin associated protein 1

AF078544 Solute carrier family 25 (mitochondrial carrier, brain), member 14

NM_003982 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 7

AB011109 AMP-activated protein kinase family member 5

NM_019008 Hypothetical protein FLJ20232

NM_013298 hypothetical protein FLJ20232

NM_003-155 Stanniocalcin 1

BM912866 Mitochondrial ribosomal protein L28

CR594190 Dickkopf homolog 1 (Xenopus laevis)

AB020641 PFTAIRE protein kinase 1

AK090727 Cell growth regulator with ring finger domain 1

AY203938 Argininosuccinate lyase

BM913968 Hepatitis delta antigen-interacting protein A

BC045619 Protein phosphatase 2, regulatory subunit B (B56), beta isoform

NM_006823 Protein kinase (cAMP-dependent, catalytic) inhibitor alpha

BC012609 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2

BX537663 Isopentenyl-diphosphate delta isomerase

AK093882 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)

AK023726 POT1 and TIN2 organizing protein

BC036080 GA binding protein transcription factor, beta subunit 2, 47kDa

NM_004385 Chondroitin sulfate proteoglycan 2 (versican)

NM_004385 Chondroitin sulfate proteoglycan 2 (versican)

NMJD00053 ATPase, Cu++ transporting, beta polypeptide (Wilson disease)

NM_001003828 Parvin, beta BC040072 Golgi SNAP receptor complex member 1

BX510904 Myosin, heavy polypeptide 2, skeletal muscle, adult

AJ010119 Ribosomal protein S6 kinase, 9OkDa, polypeptide 4

L20321 NlMA (never in mitosis gene a)-related kinase 4

NM_004755 Ribosomal protein S6 kinase, 9OkDa, polypeptide 5

BM809993 Adenosine deaminase

AK125087 Speckle-type POZ protein

BC043502 NIMA (never in mitosis gene a)-related kinase 2

BX648174 Cyclin T2

U20938 Dihydropyrimidine dehydrogenase

AK124450 Homer homolog 3 (Drosophila)

AK125244 Amyloid beta (A4) precursor protein-binding, family B, member 3

AK128326 Nuclear respiratory factor 1

AK128326 Nuclear respiratory factor 1

AL138752 SHB (Src homology 2 domain containing) adaptor protein B

AK096227 SHB (Src homology 2 domain containing) adaptor protein B

BC069011 Transformer-2 alpha

NM_005262 Growth factor, augmenter of liver regeneration (ERV1 homolog, S. cerevisiae)

NM_014711 CP110 protein

BC022472 Malic enzyme 3, NADP(+)-dependent, mitochondrial

CR749219 Hypothetical protein FLJ21168

AL031670 ring finger protein 24

AL832657 Ring finger protein 24

BX641007 Ankyrin repeat domain 6

NM_014942 Homo sapiens ankyrin repeat domain 6 (ANKRD6), mRNA

AF052126 Steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4- dehydrogenase alpha 1)

AK093383 DKFZP564K2062 protein

AL833343 Potassium channel, subfamily K, member 1

NM_000428 Latent transforming growth factor beta binding protein 2

NM_005544 Insulin receptor substrate 1

CR622102 Sarcoglycan, epsilon

CR623485 Syntaxin 8

NM_152243 CDC42 effector protein (Rho GTPase binding) 1

CR749825 Hypothetical protein MGC29875

CR749825 Hypothetical protein MGC29875

AK091531 Stomatin (EPB72)-like 1

NM_004289 Nuclear factor (erythroid-derived 2)-like 3

AK126668 Tetratricopeptide repeat domain 10

BC028032 Inositol polyphosphate-5-phosphatase, 72 kDa

NM_138555 Kinesin family member 23

BX537624 WIPI49-like protein 2

NM_015368 Pannexin 1

NM_005436 Coiled-coil domain containing 6

NM_007168 ATP-binding cassette, sub-family A (ABC1 ), member 8

NM_006153 NCK adaptor protein 1

BX538273 Cadherin 13, H-cadherin (heart)

NM_003243 Transforming growth factor, beta receptor III (betaglycan, 30OkDa) NM_001656 Tripartite motif-containing 23

NM_006202 Phosphodiesterase 4A, cAMP-specific (phosphodiesterase E2 dunce homolog, Drosophila)

BC030695 Centromere protein C 1

BC012797 Connector enhancer of kinase suppressor of Ras 1

NM_013417 Isoleucine-tRNA synthetase

BG612801 Metallothionein 1G

AF026939 Interferon-induced protein with tetratricopeptide repeats 3

NM_000963 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)

NM_004538 Nucleosome assembly protein 1-like 3

AK001980 Poly (ADP-ribose) polymerase family, member 2

AK125170 Chromosome condensation 1-like

M24898 Nuclear receptor subfamily 1 , group D, member 1

NM_014688 Homo sapiens USP6 N-terminal like (USP6NL), mRNA

BM455743 Nudix (nucleoside diphosphate linked moiety X)-type motif 1

NM_004111 Flap structure-specific endonuclease 1

NM_000544 Transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)

NM_007344 Transcription termination factor, RNA polymerase I

NM_007344 Transcription termination factor, RNA polymerase I

BC003110 lnterleukin 11 receptor, alpha

AK128297 Ecotropic viral integration site 2A

NM_004502 Homeo box B7

NM_004502 Homeo box B7

NM_000043 Tumor necrosis factor receptor superfamily, member 6

NM_000043 Tumor necrosis factor receptor superfamily, member 6

BX641078 Myeloid leukemia factor 1

BX641078 Myeloid leukemia factor 1

L41944 Interferon (alpha, beta and omega) receptor 2

AK094855 Protoporphyrinogen oxidase

AF010193 SMAD, mothers against DPP homolog 7 (Drosophila)

BC026074 Nuclear receptor subfamily 2, group C, member 1

NM_014714 KIAA0590 gene product

NM_014710 G protein-coupled receptor associated sorting protein 1

AK131382 Proline rich 3

NM_004434 Echinoderm microtubule associated protein like 1

NM_004434 Echinoderm microtubule associated protein like 1

AK023701 Hypothetical protein FLJ13639

BC010861 Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)

BQ071860 H1 histone family, member X

AK096962 Major histocompatibility complex, class I, F

BX647170 Transmembrane protein 5

BX647170 Transmembrane protein 5

AL136922 CIpX caseinolytic protease X homolog (E. coli)

AK124791 Mitogen-activated protein kinase 10

NM_004463 FYVE, RhoGEF and PH domain containing 1 (faciogenital dysplasia)

NM_006994 Butyrophilin, subfamily 3, member A3

NM_006994 Butyrophilin, subfamily 3, member A3

NM_003318 TTK protein kinase

AJ488201 Neuron navigator 3 NM_014791 Maternal embryonic leucine zipper kinase

AK096155 RAD9 homolog A (S. pombe)

CR607340 Pregnancy specific beta-1 -glycoprotein 5

BF512174 Transcribed locus

NM_004329 Bone morphogenetic protein receptor, type IA

NM_004707 APG12 autophagy 12-like (S. cerevisiae)

BC033820 Fibrinogen-like 2

NM_015458 Myotubularin related protein 9

NM_014381 MutL homolog 3 (E. coli)

BM995033 Processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)

NM_003566 Early endosome antigen 1, 162kD

NM_003566 Early endosome antigen 1, 162kD

BC002763 Protein kinase, cAMP-dependent, regulatory, type II, alpha

NM_001977 Glutamyl aminopeptidase (aminopeptidase A)

NM_001977 Glutamyl aminopeptidase (aminopeptidase A)

U69274 Zinc finger and BTB domain containing 11

BC065520 Transcription factor-like 5 (basic helix-loop-helix)

AK126766 Leprecan-like 2

BC009964 MAD1 mitotic arrest deficient-like 1 (yeast)

AK057214 Endothelial cell growth factor 1 (platelet-derived)

NIVM 81861 Apoptotic protease activating factor

BC071555 lnterleukin 6 signal transducer (gp130, oncostatin M receptor)

BC071555 lnterleukin 6 signal transducer (gp130, oncostatin M receptor)

NM_014735 ' PHD finger protein 16

BU739721 Immature colon carcinoma transcript 1

CR749553 Transducin-like enhancer of split 4 (E(sp1 ) homolog, Drosophila)

AB008112 Peroxisome biogenesis factor 1

AL832654 GDP-mannose 4,6-dehydratase

CR618411 O-6-methylguanine-DNA methyltransferase

AK095381 UDP-glucose ceramide glucosyltransferase

CR619988 HUS1 checkpoint homolog (S. pombe)

CR619988 HUS1 checkpoint homolog (S. pombe)

NM_014264 Polo-like kinase 4 (Drosophila)

BX647371 Neuralized-like (Drosophila)

AY062434 Eukaryotic translation elongation factor 1 alpha 1

NM_004799 Zinc finger, FYVE domain containing 9

NM_000958 Prostaglandin E receptor 4 (subtype EP4)

BC016757 Sin3-associated polypeptide, 3OkDa

AK125277 APG4 autophagy 4 homolog B (S. cerevisiae)

BF185032 Eukaryotic translation elongation factor 1 epsilon 1

AK095751 Ribosomal protein S6 kinase, 9OkDa, polypeptide 2

BC064993 B-cell CLL/lymphoma 3

AK127278 Tripartite motif-containing 3

BG036385 Receptor (calcitonin) activity modifying protein 1

NM_004529 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

3

NM_004529 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

3 NM_001875 Carbamoyl-phosphate synthetase 1 , mitochondrial

NM_004937 Cystinosis, nephropathic

BX648811 Inhibin, beta A (activin A, activin AB alpha polypeptide)

NM_019848 Solute carrier family 10 (sodium/bile acid cotransporter family), member 3

BG535701 Vesicle-associated membrane protein 5 (myobrevin)

AF083957 BCL2/adenovirus E1B 19kDa interacting protein 1

NM_198392 Transcription factor 21

NM_002546 Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)

NM_002546 Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)

BX641169 Zinc finger protein 274

NM_002841 Protein tyrosine phosphatase, receptor type, G

BM994488 Follistatin

AL137656 Intercellular adhesion molecule 3

AB023172 Caspase recruitment domain family, member 8

NM_006307 Sushi-repeat-containing protein, X-linked

NM_002451 Methylthioadenosine phosphorylase

NM_002553 Origin recognition complex, subunit 5-like (yeast)

BM911202 Centromere protein A, 17kDa

NM_005086 Sarcospan (Kras oncogene-associated gene)

NM_005086 Sarcospan (Kras oncogene-associated gene)

NMJ301703 Brain-specific angiogenesis inhibitor 2 ' .

BC047109 Radixin

NM_002359 V-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian)

BQ015859 Cystatin A (stefin A)

AK096403 Epithelial membrane protein 2

AK091430 Hypothetical protein LOC286505

AL833534 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10

AK094681 Splicing factor, arginine/serine-rich 16 (suppressor-of-white-apricot homolog, Drosophila)

NM_004898 Clock homolog (mouse)

AF030302 Solute carrier family 22 (organic cation transporter), member 18

AF030186 Glypican 4

AF030186 Glypican 4

BM701569 Hypothetical protein MGC2650

AF061943 TAO kinase 2

BC043646 Profilin 2

AK122952 Myxovirus (influenza virus) resistance 2 (mouse)

AB073613 Activating transcription factor 5

AB073613 Activating transcription factor 5

NM_004808 N-myristoyltransferase 2

NM_004808 N-myristoyltransferase 2

NM_019067 Hypothetical protein FLJ 10613

CR614453 Hydroxyacylglutathione hydrolase

NMJ44778 Muscleblind-like 2 (Drosophila)

NM_005757 muscleblind-like 2 (Drosophila)

NM_005738 ADP-ribosylation factor-like 4A

NM_005197 Checkpoint suppressor 1

NM_012448 Signal transducer and activator of transcription 5B

NM_005204 Mitogen-activated protein kinase kinase kinase 8 X17033 Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)

NM_057749 Cyclin E2

BC047999 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1

AK093177 LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae)

BX537634 RAB, member of RAS oncogene family-like 4

NM_005476 Glucosamine (UDP-N-acetylJ-Σ-epimerase/N-acetylmannosamine kinase

NM_133436 Asparagine synthetase

NM_003832 phosphoserine phosphatase-like

BC071593 V-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog

AK124142 AU RNA binding protein/enoyl-Coenzyme A hydratase

L25851 Integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1 ; alpha polypeptide)

NM_000203 Iduronidase, alpha-L-

NM_000203 Iduronidase, alpha-L-

BC050560 Poly (ADP-ribose) glycohydrolase

BX649106 Exosome component 9

NM_002892 AT rich interactive domain 4A (RBP1-like)

BC028095 Survival of motor neuron protein interacting protein 1

NM_006208 Ectonucleotide pyrophosphatase/phosphodiesterase 1

BC008678 lnterleukin 1 , beta

NM_015071 Rho GTPase activating protein 26

NM_019071 ' Inhibitor of growth family, member 3

NM_022550 X-ray repair complementing defective repair in Chinese hamster cells 4

AK128610 Solute carrier family 22 (organic cation transporter), member 5

BM558246 Phosphatidylinositol glycan, class F

BM558246 Phosphatidylinositol glycan, class F

AF093419 Multiple PDZ domain protein

BC030234 Retinoic acid receptor, beta

NM_001159 Aldehyde oxidase 1

NM_001159 Aldehyde oxidase 1

BX537729 B-cell receptor-associated protein 29

BX648581 RWD domain containing 3

BX537560 Chromosome X open reading frame 6

NM_003416 Zinc finger protein 7 (KOX 4, clone HF.16)

AK092889 N-acetylglucosamine-1 -phosphodiester alpha-N-acetylglucosaminidase

L36140 RecQ protein-like (DNA helicase Q1 -like)

NM_000286 Peroxisomal biogenesis factor 12

NM_014833 gb:NM_014833.1 /DEF=Homo sapiens KIAA0618 gene product (KIAA0618), mRNA.

/FEA=mRNA /GEN=KIAA0618 /PROD=KIAA0618 gene product /DB_XREF=gi:7662205 /UG=Hs.295112 KIAA0618 gene product /FL=gb:AB014518.1 gb:NM_014833.1

NM_000112 Solute carrier family 26 (sulfate transporter), member 2

BC000012 Glutamine-fructose-6-phosphate transaminase 2

AF187733 Syntaphilin

BX537791 Mannosidase, alpha, class 2A, member 1

AK127124 Rho guanine nucleotide exchange factor (GEF) 4

AB040949 Phospholipase C, epsilon 1

NM_000426 Laminin, alpha 2 (merosin, congenital muscular dystrophy)

NM_000232 Sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)

NM_000232 Sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) NM_003692 Transmembrane protein with EGF-like and two follistatin-like domains 1

NM_003692 Transmembrane protein with EGF-like and two follistatin-like domains 1

BX647927 Phospholipase C, delta 1

BC036434 Vaccinia related kinase 2

NM_000962 Prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

NM_000962 Prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

BM556130 Nucleophosmin/nucleoplasmin, 3

AK131542 Renal tumor antigen

BM719769 Stem cell growth factor; lymphocyte secreted C-type lectin

BC009978 Actin, alpha, cardiac muscle

BU517060 Heat shock 1OkDa protein 1 (chaperonin 10)

NM_012345 Nuclear fragile X mental retardation protein interacting protein 1

NM_012345 Nuclear fragile X mental retardation protein interacting protein 1

AB020316 Uronyl-2-sulfotransferase

AB020316 Uronyl-2-sulfotransferase

AK126321 Fucose-1 -phosphate guanylyltransferase

NM_194430 Angiogenin, ribonuclease, RNase A family, 5

BC025358 ATP-binding cassette, sub-family D (ALD), member 1

AK123974 Myosin, light polypeptide 5, regulatory

AK123974 Myosin, light polypeptide 5, regulatory

NM_020039 Amiloride-sensitive cation channel 2, neuronal

NM_194430 Angiogenin, ribonuclease, RNase A family, 5

BC070085 Colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)

AL360141 Peroxisomal biogenesis factor 11A

AK056931 Cockayne syndrome 1 (classical)

AK123190 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)

AK128124 Calpain 5

BX537651 Discoidin domain receptor family, member 2

BC037284 Retinoblastoma binding protein 5

NM_005419 Signal transducer and activator of transcription 2, 113kDa

BX648614 Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)

BM908253 Clathrin, light polypeptide (Lcb)

AK125710 CD58 antigen, (lymphocyte function-associated antigen 3)

BC047756 Glutaminyl-peptide cyclotransferase (glutaminyl cyclase)

CR596268 lntegrin beta 3 binding protein (beta3-endonexin)

NM_006910 Retinoblastoma binding protein 6

AY261373 Zinc finger protein 193

NM_001001419 SMAD, mothers against DPP homolog 5 (Drosophila)

NM_001001419 SMAD, mothers against DPP homolog 5 (Drosophila)

BC015748 Fanconi anemia, complementation group C

AJ007590 Retinitis pigmentosa 2 (X-linked recessive)

BX537439 Phosphoserine phosphatase

BU729913 Adaptor-related protein complex 1, sigma 1 subunit

BU729913 Adaptor-related protein complex 1, sigma 1 subunit

L06133 ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome)

CR749292 Tetranectin (plasminogen binding protein)

M57609 GLl-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)

CR615194 Protein-L-isoaspartate (D-aspartate) O-methyltransferase BE781314 Neuromedin B

NM_000216 Kallmann syndrome 1 sequence

BM906445 lnterleukin 6 (interferon, beta 2)

BC040531 Activin A receptor, type IB

NM_004292 Ras and Rab interactor 1

BC052561 Serine/threonine kinase 17b (apoptosis-inducing)

CB959370 Translocase of inner mitochondrial membrane 8 homolog A (yeast)

BC016761 Polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa

NM_001001556 Galactokinase 2

BC038948 Enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase

NM_006207 Platelet-derived growth factor receptor-like

NM_002182 lnterleukin 1 receptor accessory protein

NM_002898 RNA binding motif, single stranded interacting protein 2

BX647281 Rabphilin 3A homolog (mouse)

AL832126 Epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)

BC001158 Platelet-activating factor acetylhydrolase 2, 4OkDa

AK091279 Solute carrier family 16 (monocarboxylic acid transporters), member 4

AB033337 M-phase phosphoprotein 1

NM_003102 Superoxide dismutase 3, extracellular

NM_013296 G-protein signalling modulator 2 (AGS3-like, C. elegans)

BQ231362 SCO cytochrome oxidase deficient homolog 2 (yeast)

AK093866 Peroxisome biogenesis factor 13

NM_005128 Chromosome 21 open reading frame 5

NM_014684 KIAA0373 gene product

NM_022817 Period homolog 2 (Drosophila)

AL834166 Transcription factor 7 (T-cell specific, HMG-box)

NM_001635 Amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)

CA450153 Acylphosphatase 1 , erythrocyte (common) type

AF082283 B-cell CLLVIymphoma 10

NM_012099 CD3-epsilon-associated protein; antisense to ERCC-1

AY603755 Aortic preferentially expressed protein 1

NM_002309 Leukemia inhibitory factor (cholinergic differentiation factor)

NM_014968 pitrilysin metalloproteinase 1

NM_012231 PR domain containing 2, with ZNF domain

NM_000824 Glycine receptor, beta

NM_000824 Glycine receptor, beta

BC038236 Phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria)

NM_004631 Low density lipoprotein receptor-related protein 8, apolipoprotein e receptor

AB008226 Fukuyama type congenital muscular dystrophy (fukutin)

CR618407 Bone morphogenetic protein 2

CR618407 Bone morphogenetic protein 2

BX537494 Heterogeneous nuclear ribonucleoprotein A2/B1

AK098403 BAh -associated protein 2

U90550 Butyrophilin, subfamily 2, member A2

NM_180699 U11/U12 snRNP 35K

NM_016819 8-oxoguanine DNA glycosylase

BC035905 CGI-62 protein

NM_012066 hypothetical protein 20D7-FC4 BC035134 Syntrophin, beta 2 (dystrophin-associated protein A1, 59kDa, basic component 2)

NM_001415 Eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa

AK125603 Metal-regulatory transcription factor 1

AK125603 Metal-reguiatory transcription factor 1

NM_177439 FtsJ homolog 1 (E. coli)

M93415 Activin A receptor, type Il

NM_003794 Sorting nexin 4

NM_002430 Meningioma (disrupted in balanced translocation) 1

BF204671 Signal recognition particle 19kDa

NM_003035 TAL1 (SCL) interrupting locus

BC062554 EH-domain containing 2

AK127322 Sialyltransferase 4B (beta-galactoside alpha-2,3-sialyltransferase)

NM_000821 Gamma-glutamyl carboxylase

NM_005025 Homo sapiens serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1

(SERPINI1 ), mRNA

BM921938 Prostatic binding protein

BM541904 Guanidinoacetate N-methyltransferase

NM_001609 Acyl-Coenzyme A dehydrogenase, short/branched chain

BC049199 Ubiquitin specific protease 13 (isopeptidase T-3)

NM_031850 Angiotensin Il receptor, type 1

U41816 Prefoldin 4

U41816 Prefoldin 4

BC033517 Acyl-Coenzyme A oxidase 2, branched chain

NM_156036 Homeo box B6

NM_001918 Dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)

NM_001918 Dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)

NM_001918 Dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)

NM_002655 Pleomorphic adenoma gene 1

BX649090 Inositol polyphosphate-4-phosphatase, type II, 105kDa

BE727298 Carbonyl reductase 3

AK126148 Leucine rich repeat containing 17

BX647778 Zinc finger and BTB domain containing 20

M92424 Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)

NM_001274 CHK1 checkpoint homolog (S. pombe)

NM_001274 CHK1 checkpoint homolog (S. pombe)

NM_005591 MRE11 meiotic recombination 11 homolog A (S. cerevisiae)

CR749287 SMAD, mothers against DPP homolog 3 (Drosophila)

NM_005902 SMAD, mothers against DPP homolog 3 (Drosophila)

NM_004734 Doublecortin and CaM kinase-like 1

NM_003659 Alkylglycerone phosphate synthase

BM805032 Protease, serine, 2 (trypsin 2)

NM_004633 lnterleukin 1 receptor, type Il

BM994393 Hydroxysteroid (11-beta) dehydrogenase 1

NM_003966 Sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A AK092112 Sperm autoantigenic protein 17

BX648668 Reversion-inducing-cysteine-rich protein with kazal motifs

BX648210 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

10

BX537444 ATPase, Ca++ transporting, plasma membrane 4

BC063853 Acetyl-Coenzyme A acetyltransferase 1 (acetoacetyl Coenzyme A thiolase)

BC022245 Ataxin 3

BC022245 Ataxin 3

NM_004393 Dystroglycan 1 (dystrophin-associated glycoprotein 1)

BC031606 Peroxisomal biogenesis factor 7

AK095102 Integrin, beta-like 1 (with EGF-like repeat domains)

NM_001127 Adaptor-related protein complex 1 , beta 1 subunit

NM_005338 Huntingtin interacting protein 1

NM_005649 Zinc finger protein 354A

NM_016447 Membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)

CD014090 Butyrylcholinesterase

AK124872 AP2 associated kinase 1

BM917453 H2A histone family, member X

CD013992 Glutathione S-transferase theta 2

BC038945 Hypothetical protein FLJ22709

NM_021647 Homo sapiens KIAA0626 gene product (KIAA0626), mRNA

NMJD03082 Small nuclear RNA activating complex, polypeptide 1, 43kDa

BX648469 Activating transcription factor 2

NM_006301 Mitogen-activated protein kinase kinase kinase 12

NM_006301 Mitogen-activated protein kinase kinase kinase 12

NM_013299 Likely ortholog of mouse Sac3 homology domain 1 (S. cerevisiae)

CR591869 Phosphatidylinositol glycan, class B

NMJD02145 Homeo box B2

NM_024294 Chromosome 6 open reading frame 106

NMJD06861 RAB35, member RAS oncogene family

CR749837 Hippocalcin-like 1

NM_002607 Platelet-derived growth factor alpha polypeptide

BC023567 Cytokine receptor-like factor 3

BC067829 Scrapie responsive protein 1

NM_002658 Plasminogen activator, urokinase

BX537559 UDP-glucose pyrophosphorylase 2

BC012767 Sorting nexin 15

BQ279256 Interferon, alpha-inducible protein (clone IFI-15K)

NMJD06426 Dihydropyrimidinase-like 4

BC052997 Zinc finger protein 175

NM_000163 Growth hormone receptor

AL110206 Sushi-repeat-containing protein, X-linked 2

AK098543 CDNA FLJ25677 fis, clone TST04054

BX538306 Protein tyrosine phosphatase, non-receptor type 14

NMJD01490 Glucosaminyl (N-acetyl) transferase 1, core 2 (beta-i.β-N-acetylglucosaminyltransferase)

BC067122 Sodium channel, voltage-gated, type I, beta

NM_004208 Programmed cell death 8 (apoptosis-inducing factor)

AK095504 Zinc finger protein 415 NM_003619 Protease, serine, 12 (neurotrypsin, rnotopsin)

AK124335 CDKN1A interacting zinc finger protein 1

NM_003570 Homo sapiens mRNA for CMP-N-acetylneuraminic acid hydroxylase, complete cds.

AK023235 Endonuclease G-like 1

NM_001884 Hyaluronan and proteoglycan link protein 1

NM_018495 caldesmon 1

CR600129 Katanin p60 (ATPase-containing) subunit A 1

NM_015487 gem (nuclear organelle) associated protein 4

NM_004349 Core-binding factor, runt domain, alpha subunit 2; translocated to, 1 ; cyclin D-related

NM_004349 Core-binding factor, runt domain, alpha subunit 2; translocated to, 1 ; cyclin D-related

BC011890 Electron-transferring-flavoprotein dehydrogenase

NM_004932 Cadherin 6, type 2, K-cadherin (fetal kidney)

NM_004932 Cadherin 6, type 2, K-cadherin (fetal kidney)

NM_032456 BH-protocadherin (brain-heart)

NM_032456 BH-protocadherin (brain-heart)

NM_016656 Ras-related GTP binding B

BC036077 G1 to S phase transition 2

BF673939 Six transmembrane epithelial antigen of the prostate

NM_014278 Heat shock protein (hsp110 family)

BM458671 DnaJ (Hsp40) homolog, subfamily C1 member 8

NM_003331 Tyrosine kinase 2

AL832809 Transgelin

BU730087 BTG family, member 3

CR627176 Brain and reproductive organ-expressed (TNFRSF1A modulator)

NM_006200 Proprotein convertase subtilisin/kexin type 5

NM_006200 Proprotein convertase subtilisin/kexin type 5

NM_024681 Hypothetical protein FLJ12242

CR600741 Ribonuclease P/MRP 38kDa subunit

AK128079 Frataxin

CR749694 Abhydrolase domain containing 2

NM_003654 Carbohydrate (keratan sulfate Gal-6) sulfotransferase 1

AK090485 Phosphatidylinositol-4-phosphate 5-kinase, type II, alpha

NIVM45197 Lipoyltransferase 1

NMJ315976 Sorting nexin 7

NM_006129 Bone morphogenetic protein 1

M97639 Receptor tyrosine kinase-like orphan receptor 2

NM_000861 Histamine receptor H1

AK026671 Chromosome X open reading frame 45

AK026671 Chromosome X open reading frame 45

BC077733 FGFR1 oncogene partner

AF081195 RAS guanyl releasing protein 1 (calcium and DAG-regulated)

BC051283 SMAD specific E3 ubiquitin protein ligase 2

M92299 Homeo box B5

M92299 Homeo box B5

BC030979 Pregnancy specific beta-1 -glycoprotein 7

Y15909 Diaphanous homolog 2 (Drosophila)

BX647352 Ezrin-binding partner PACE-1

BX648814 Angiopoietin 1 BX648814 Angiopoietin 1

NM_007351 Multimerin 1

BC030786 Proline rich GIa (G-carboxyglutamic acid) 1

BC040125 Coagulation factor X

BX537699 AIkB, alkylation repair homolog (E. coli)

NM_000947 Primase, polypeptide 2A, 58kDa

NM_000688 Aminolevulinate, delta-, synthase 1

AK123290 Leukocyte receptor cluster (LRC) member 4

AL137634 Aldehyde dehydrogenase 3 family, member B1

BM543095 Small nuclear ribonucleoprotein polypeptide G

BC078170 Wingless-type MMTV integration site family member 2

BC039353 Tubulin tyrosine ligase-like family, member 1

AJ459808 Histone deacetylase 9

NM_025207 FAD-synthetase

CR606056 B9 protein

BC037913 KIN, antigenic determinant of recA protein homolog (mouse)

AF089749 Transmembrane 4 superfamily member tetraspan NET-5

AK091067 Xeroderma pigmentosum, complementation group A

AK095311 Deleted in lymphocytic leukemia, 1

BG567934 Apolipoprotein M

CR627367 Chromosome 9 open reading frame 55

AK124139 Similar to ubiquitin binding protein

BM925852 Maternal G10 transcript

NM_003725 3-hydroxysteroid epimerase

NM_006390 lmportin 8

AK126773 Putative homeodomain transcription factor 1

NM_012463 ATPase, H+ transporting, lysosomal VO subunit a isoform 2

AB028997 Ankyrin repeat domain 26

BF131627 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1

NM_004334 Bone marrow stromal cell antigen 1

AL110179 Mitochondrial carrier family protein

AB002325 Protocadherin gamma subfamily C, 3

NM_000277 Phenylalanine hydroxylase

Y15909 Diaphanous homolog 2 (Drosophila)

NM_003999 Oncostatin M receptor

BX537751 Actin binding LIM protein family, member 3

NM_006540 Nuclear receptor coactivator 2

BG336702 Fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)

NM_024321 Hypothetical protein MGC10433

NM_001390 Dystrobrevin, alpha

BX537926 SH3 and cysteine rich domain

U92649 A disintegrin and metalloproteinase domain 17 (tumor necrosis factor, alpha, converting enzyme)

U92649 A disintegrin and metalloproteinase domain 17 (tumor necrosis factor, alpha, converting enzyme)

BM558798 Ring finger protein 126

AK124783 Biphenyl hydrolase-like (serine hydrolase; breast epithelial mucin-associated antigen)

NM_000132 Coagulation factor VIII, procoagulant component (hemophilia A) NM_016819 8-oxoguanine DNA glycosylase

AW242981 protein similar to E.coli yhdg and R. capsulatus nifR3

NM_006773 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

NM_002932 Homo sapiens regulator of mitotic spindle assembly 1 (RMSA1), mRNA

BC035691 Glutathione reductase

BC001261 Family with sequence similarity 50, member B

AB018551 Chromosome 16 open reading frame 7

NM_002009 Fibroblast growth factor 7 (keratinocyte growth factor)

CR627446 KIAA0663 gene product

CR627446 KIAA0663 gene product

AJ316284 Neurexin 3

BC030582 Hypothetical protein FLJ11336

AK124429 lnterleukin 7 receptor

NM_003304 Transient receptor potential cation channel, subfamily C, member 1

NM_003304 Transient receptor potential cation channel, subfamily C, member 1

CR627309 Receptor tyrosine kinase-like orphan receptor 1

NM_020127 Tuftelin 1

NM_032468 Aspartate beta-hydroxylase

BX640852 Wiskott-Aldrich syndrome-like

NM_007215 Polymerase (DNA directed), gamma 2, accessory subunit

BC058861 Sulfotransferase family, cytosolic, 1 C, member 2

BX537620 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)

AB096250 Heat shock 27kDa protein 2

BC052289 Carboxypeptidase A4

CR627037 YTH domain containing 2

BC041005 Ubiquinol-cytochrome c reductase binding protein

BQ071537 Non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)

NM_003324 Tubby like protein 3

AK123681 Solute carrier family 14 (urea transporter), member 1 (Kidd blood group)

BC060828 AT rich interactive domain 3A (BRIGHT- like)

NM_002834 Protein tyrosine phosphatase, non-receptor type 11 (Noonan syndrome 1)

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

AL832404 Phosphatidylinositol glycan, class L

NM_002310 Leukemia inhibitory factor receptor

NM_017590 Rotavirus X protein associated with NSP3

BC044788 Protein kinase D1

AK128267 Zinc finger protein 74 (Cos52)

BX538224 Adducin 3 (gamma)

NM_000885 Integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)

NM_000885 Integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)

NM_002439 MutS homolog 3 (E. coli)

AK172851 Adenosine A2b receptor

D21262 Nucleolar and coiled-body phosphoprotein 1

NM_003059 Solute carrier family 22 (organic cation transporter), member 4

AK094237 MHC class I polypeptide-related sequence A

AK094237 MHC class I polypeptide-related sequence A

NM_002692 Polymerase (DNA directed), epsilon 2 (p59 subunit)

NM_003417 Homo sapiens zinc finger protein 264 (ZNF264), mRNA U79716 Reelin

AK002107 RAB3B, member RAS oncogene family

AK002107 RAB3B, member RAS oncogene family

NM_005815 Zinc finger protein 443

NM_005513 General transcription factor HE, polypeptide 1 , alpha 56kDa

NM_002448 Msh homeo box homolog 1 (Drosophila)

NM_001451 Forkhead box F1

NM_006569 Cell growth regulator with EF hand domain 1

NM_000565 lnterleukin 6 receptor

M33987 Carbonic anhydrase I

AB018349 Leucine-rich repeats and immunoglobulin-like domains 2

NM_018336 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa

NM_004682 PC4 and SFRS1 interacting protein 2

NM_005147 DnaJ (Hsp40) homolog, subfamily A, member 3

AK095759 Zinc finger protein 426

NM_005645 Homo sapiens TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor,

18kDa (TAF13), mRNA

CD048335 Histone 1, H4c

NM_022549 Fasciculation and elongation protein zeta 1 (zygin I)

BC030128 Inhibitor of growth family, member 1-like

NM_003392 Wingless-type MMTV integration site family, member 5A

NM_006902 Paired related homeobox 1

AK122993 lnterleukin 15

AK127429 T-box 2

NM_013411 Adenylate kinase 2

NM_017460 Cytochrome P450, family 3, subfamily A, polypeptide 4

NM_014645 Homo sapiens KIAA0635 gene product (KIAA0635), mRNA

NM_014895 Homo sapiens chromosome 6 open reading frame 84 (C6orf84), mRNA

NM_004132 Hyaluronan binding protein 2

AB028964 Forkhead box J3

BC000972 Chromosome X open reading frame 37

NM_016387 suppressor of cytokine signaling 4

BC063836 SCAN domain containing 2

X65724 Norrie disease (pseudoglioma)

BC039384 Tumor necrosis factor, alpha-induced protein 6

BC039384 Tumor necrosis factor, alpha-induced protein 6

BE786876 S100 calcium binding protein A3

BC029128 Aspartoacylase (aminoacylase 2, Canavan disease)

BC005139 Ubiquitin specific protease 5 (isopeptidase T)

NM_002908 V-rel reticuloendotheliosis viral oncogene homolog (avian)

BC051670 Nuclear receptor subfamily 2, group C, member 2

AK094927 RAB33A, member RAS oncogene family

BX648788 SNRPN upstream reading frame

NM_004333 V-raf murine sarcoma viral oncogene homolog B1

AK091800 A disintegrin and metalloproteinase domain 23

AK095144 Ribonuclease/angiogenin inhibitor

AK094257 Stem-loop (histone) binding protein

NM_014930 Homo sapiens zinc finger protein 510 (ZNF510), mRNA AK090986 Small nuclear ribonucleoprotein polypeptide A'

NM_003430 Zinc finger protein 91 (HPF7, HTF10)

NM_177438 Diceri , Dcr-1 homolog (Drosophila)

BC073161 RAD51 homolog C (S. cerevisiae)

L25110 Wilms tumor 1

NM_005233 EPH receptor A3

BU739829 High mobility group AT-hook 1

NM_177559 Casein kinase 2, alpha 1 polypeptide

AB014602 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 1

NM_001902 Cystathionase (cystathionine gamma-lyase)

NM_000410 Hemochromatosis

NM_000410 Hemochromatosis

NM_002381 Matrilin 3

AL157435 Tumor necrosis factor receptor superfamily, member 6b, decoy

NM_007116 tenascin XB

BC011409 UDP glycosyltransferase 1 family, polypeptide A9

AK125834 FUS interacting protein (serine-arginine rich) 1

NM_003420 Zinc finger protein 35 (clone H F.10)

NM_006626 Zinc finger protein 482

AB011792 Extracellular matrix protein 2, female organ and adipocyte specific

NM_021067 Homo sapiens KIAA0186 gene product (KIAA0186), mRNA

AL022328 mitogen-activated protein kinase 12

NM_006275 Splicing factor, arginine/serine-rich 6

NM_004162 RAB5A, member RAS oncogene family

NM_004430 Early growth response 3

BX648171 Tropomyosin 1 (alpha)

BX648171 Tropomyosin 1 (alpha)

NM_005230 ELK3, ETS-domain protein (SRF accessory protein 2)

NM_000046 Arylsulfatase B

BX537952 Mutated in colorectal cancers

BX649188 XIAP associated factor-1

BC040300 Phosphatidylinositol 4-kinase, catalytic, beta polypeptide

BC040300 Phosphatidylinositol 4-kinase, catalytic, beta polypeptide

NM_014484 Molybdenum cofactor synthesis 3

BC040497 Sex comb on midleg-like 2 (Drosophila)

BX647374 Pentaxin-related gene, rapidly induced by IL-1 beta

BF680546 Zinc finger protein 9 (a cellular retroviral nucleic acid binding protein)

NM_006536 Chloride channel, calcium activated, family member 2

BX537691 Rho GTPase activating protein 6

U70981 lnterleukin 13 receptor, alpha 2

BC036080 GA binding protein transcription factor, beta subunit 2, 47kDa

BF664863 Protein phosphatase 6, catalytic subunit

NM_001718 Bone morphogenetic protein 6

NM_023931 Hypothetical protein MGC2474

BC042636 Zinc finger protein 134 (clone pHZ-15)

NM_005207 V-crk sarcoma virus CT10 oncogene homolog (avian)-like

BC075814 Prostaglandin I2 (prostacyclin) receptor (IP)

NM_014789 Homo sapiens zinc finger protein 623 (ZNF623), mRNA AW299598 homeo box C6

NM_003551 Non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)

NM_145869 Annexin AH

BC025674 Phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)

NM_005428 Vav 1 oncogene

BU839412 Cystatin SN

AF097159 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6

BC045610 Matrix metalloproteinase 17 (membrane-inserted)

NM_002312 Ligase IV, DNA, ATP-dependent

AK127531 YY1 associated factor 2

AK123008 Zinc finger protein 136 (clone pHZ-20)

NM_016389 Influenza virus NS1A binding protein

BC044218 MHC class I polypeptide-related sequence B

AL050284 Coiled-coil domain containing 9

NM_005674 Zinc finger protein 239

M12272 Alcohol dehydrogenase 1C (class I), gamma polypeptide

M55632 Flavin containing monooxygenase 4

BC068487 Toll-like receptor 3

BX358091 S-phase response (cyclin-related)

NM_014675 Ciliary rootlet coiled-coil, rootletin

BX538021 Flavoprotein oxidoreductase MICAL2

NM_002760 Protein kinase, Y-linked

BM908253 Clathrin, light polypeptide (Lcb)

NM_002141 Homeo box A4

CR627366 Regulator of G-protein signalling 7

BC047096 Rho GTPase activating protein 22

AF087142 Transmembrane protein 28

NM_199040 Nudix (nucleoside diphosphate linked moiety X)-type motif 4

NM_199040 Nudix (nucleoside diphosphate linked moiety X)-type motif 4

NM_004472 Forkhead box D1

BX537961 DNA (cytαsine-5-)-rr«ethyltransferase 2

AY280798 Zinc finger protein 167

NM_004750 Cytokine receptor-like factor 1

NM_014708 Kinetochore associated 1

AJO01189 Oligophrenin 1

BX641139 Src homology 2 domain containing transforming protein C3

AF208043 Interferon, gamma-inducible protein 16

AK131096 Galactosamine (N-acetyl)-6-sulfate sulfatase (Morquio syndrome, mucopolysaccharidosis type IVA)

BM994397 Chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)

BX647357 lduronate 2-sulfatase (Hunter syndrome)

NM_153818 Peroxisome biogenesis factor 10

NM_153818 Peroxisome biogenesis factor 10

AK025840 Optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)

NM_003955 Suppressor of cytokine signaling 3

XM_375825 Kinesin family member 14

NM_001452 Forkhead box F2

BC067220 Secretoglobin, family 2A, member 2 NM_170735 Brain-derived neurotrophic factor

NM_203505 Ras-GTPase activating protein SH3 domain-binding protein 2

NM_020987 Ankyrin 3, node of Ranvier (ankyrin G)

AK093960 Retinoic acid receptor responder (tazarotene induced) 1

NM_004170 Solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1

D14838 Fibroblast growth factor 9 (glia-activating factor)

BX647719 Ubiquitin specific protease 6 (Tre-2 oncogene)

NM_005246 Fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94)

NM_003887 Development and differentiation enhancing factor 2

NM_003305 Transient receptor potential cation channel, subfamily C, member 3

NM_198868 KIAA0676 protein

NM_005328 Hyaluronan synthase 2

AK124968 COMM domain containing 4

CR622298 HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae)

BC025748 Hypothetical protein FLJ10560

NM_178001 Protein phosphatase 2A, regulatory subunit B' (PR 53)

BF674156 Metallothionein 1H

NM_015935 CGl-01 protein

NM_012067 Aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)

AB046767 Transducin-like enhancer of split 3 (E(sp1 ) homolog, Drosophila)

AK056736 Membrane-bound transcription factor protease, site 2

NM_002595 PCTAIRE protein kinase 2

AL832772 LlM domain binding 2

AK123456 N-elhylmaleimide-sensitive factor attachment protein, alpha

AK092726 RNA, U17D small nucleolar

BC050384 Suppressor of Ty 3 homolog (S. cerevisiae)

NM_014724 Zinc finger protein 305

NM_001167 Baculoviral IAP repeat-containing 4

BC035939 Muscle RAS oncogene homolog

BC028370 Galactosidase, beta 1-like

X72889 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

X72889 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

BX648466 DRE1 protein

AK122967 SET domain and mariner transposase fusion gene

BX640898 THUMP domain containing 1

NM_001403 gb:NM_001403.1 /DEF=Homo sapiens eukaryotic translation elongation factor 1 alpha 1-like 14 (EEF1A1L14), mRNA. /FEA=mRNA /GEN=EEF1A1L14 /PROD=eukaryotic translation elongation factor 1 alpha1-like 14 /DB_XREF=gi:4503472 /UG=Hs.274466 eukaryotic translation elongation factor 1 alpha 1-like 14 /FL=gb:NM_001403.1

BX647478 Casein kinase 1, alpha 1

NM_016436 Chromosome 20 open reading frame 104

NM_145686 Mitogen-activated protein kinase kinase kinase kinase 4

BC036394 Zinc finger protein 85 (HPF4, HTF1 )

AK098186 EGF-containing fibulin-like extracellular matrix protein 2

L03427 Basonuclin 1 AK097159 Hypothetical protein FLJ20344

BM918324 Lymphocyte antigen 96

BC027591 Chaperonin containing TCP1 , subunit 6B (zeta 2)

NM_000795 Dopamine receptor D2

NM_003938 Adaptor-related protein complex 3, delta 1 subunit

AK124518 Surfeit 5

NM_005681 TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa

BC032495 Growth differentiation factor 5 (cartilage-derived morphogenetic protein-1 )

NM_022170 Williams-Beuren syndrome chromosome region 1

NM_000956 Prostaglandin E receptor 2 (subtype EP2), 53kDa

AK024854 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B

NM_000867 5-hydroxytryptamine (serotonin) receptor 2B

NM_006521 Transcription factor binding to IGHM enhancer 3

AK025490 Polymerase (RNA) III (DNA directed) polypeptide G (32kD)

BC000353 myogenic factor 3

AK125636 Glutaredoxin (thioltransferase)

AY491779 BCL2-like 1

NM_004866 Secretory carrier membrane protein 1

NM_004866 Secretory carrier membrane protein 1

BC067106 Putative G protein coupled receptor

Z19588 SKI-like

BM474848 Cleavage and polyadenylation specific factor 4, 3OkDa

NM_182710 HIV-1 Tat interacting protein, 6OkDa

NM_003423 Zinc finger protein 43 (HTF6)

BC035514 TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal)

BC051691 Hypothetical protein LOC158563

NM_002527 Neurotrophin 3

AL832598 Erythrocyte membrane protein band 4.1-like 3

AL049687 Hypothetical protein LOC57821

NM_003655 Chromobox homolog 4 (Pc class homolog, Drosophila)

NM_003772 Jerky homolog-like (mouse)

BG545333 Apolipoprotein C-IV

AF327452 Sperm associated antigen 9

NM 019886 Carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7

AK124747 Phosphodiesterase 5A, cGMP-specific

AL831860 RNA binding motif, single stranded interacting protein

CR749816 Solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GIcNAc) transporter), member A3

NM_001612 Acrosomal vesicle protein 1

BU739822 DnaJ (Hsp40) homolog, subfamily C, member 4

NM_001755 Core-binding factor, beta subunit

AK055348 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1 , 7kDa

AK095384 Phosphodiesterase 4C, cAMP-specific (phosphodiesterase E1 dunce homolog, Drosophila)

AF100779 WNT1 inducible signaling pathway protein 1

NM_006080 Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A

NM_005758 heterogeneous nuclear ribonucleoprotein A3

BC032517 Nerve growth factor, beta polypeptide

NM_017649 Cyclin M2

NM_000916 Oxytocin receptor AL832422 Zinc finger protein 430

NM_001108 acylphosphatase 2, muscle type

NM_194352 Ring finger protein 40

AL137696 Histone deacetylase 6

AL121964 mitogen-activated protein kinase kinase kinase 7

BX648277 Mitogen-activated protein kinase kinase kinase 7

AK127945 Hyaluronoglucosaminidase 2

AK026273 FK506 binding protein 1 B, 12.6 kDa

NM_153693 Homeo box C6

AL136892 Hypothetical protein FLJ20323

BC042194 CGG triplet repeat binding protein 1

AL834206 Cadherin 4, type 1, R-cadherin (retinal)

AL138761 Ste20-related serine/threonine kinase

D86959 STE20-like kinase (yeast)

AK125851 Actinin, alpha 3

NM_003811 Tumor necrosis factor (ligand) superfamily, member 9

AK098766 Claudin 11 (oligodendrocyte transmembrane protein)

NM_000353 Tyrosine aminotransferase

NM_006572 Guanine nucleotide binding protein (G protein), alpha 13

NM_006047 RNA binding motif protein 12

NM_021795 ELK4, ETS-domain protein (SRF accessory protein 1)

NM_002737 Protein kinase C, alpha

NM_205843 Nuclear factor I/C (CCAAT-binding transcription factor)

NM_003956 Cholesterol 25-hydroxylase

NM_022335 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa . . .

BC025680 RUN and SH3 domain containing 1

NM_002977 Sodium channel, voltage-gated, type IX, alpha

AF104266 Latrophilin 2

NM_000711 bone gamma-carboxyglutamate (gla) protein (osteocalcin)

AK092586 UPF3 regulator of nonsense transcripts homolog A (yeast)

AK092586 UPF3 regulator of nonsense transcripts homolog A (yeast)

AK097385 Ubiquitin specific protease 49

NM_007249 Kruppel-like factor 12

BC041070 Keratin, hair, acidic, 4

BX648623 Heat shock 105kDa/110kDa protein 1

NM_004719 Splicing factor, arginine/serine-rich 2, interacting protein

BC011549 ATP synthase, H+ transporting, mitochondrial FO complex, subunit s (factor B)

BC011549 ATP synthase, H+ transporting, mitochondrial FO complex, subunit s (factor B)

CB959353 Cystatin S

NM_005605 Protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)

CR749329 Pleomorphic adenoma gene-like 1

NM_002821 PTK7 protein tyrosine kinase 7

AL832595 Matrix metalloproteinase 16 (membrane-inserted)

AL832595 Matrix metalloproteinase 16 (membrane-inserted)

CR749526 Heat shock transcription factor 2 binding protein

NMJD00421 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris)

CR749222 KIT ligand BM470905 Cysteine and glycine-rich protein 2

NM_001189 Bagpipe homeobox homolog 1 (Drosophila)

AB007295 GLI-Kruppel family member GLI2

BM719878 Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)

NM_003932 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)

NM_006610 Mannan-binding lectin serine protease 2

CR749669 Solute carrier family 6 (neurotransmitter transporter, glycine), member 9

NM_004731 Solute carrier family 16 (monocarboxylic acid transporters), member 7

AF022158 Zinc finger protein 37 homolog (mouse)

NM_005585 SMAD, mothers against DPP homolog 6 (Drosophila)

BX538349 Aconitase 1 , soluble

AK027126 Argininosuccinate synthetase

AK093892 Mediator of RNA polymerase Il transcription, subunit 6 homolog (yeast)

NM_058004 Phosphatidylinositol 4-kinase, catalytic, alpha polypeptide

BC016473 Solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11

NM_033540 Mitofusin 1

CR749485 Vesicle-associated membrane protein 1 (synaptobrevin 1)

AB028967 Potassium voltage-gated channel, Shal-related subfamily, member 2

NM_005027 Phosphoinositide-3-kinase, regulatory subunit 2 (p85 beta)

AJ627032 Nipped-B homolog (Drosophila)

NM_006258 Protein kinase, cGMP-dependent, type I

AK126957 Hypothetical zinc finger protein FLJ14011

NM_002748 Mitogen-activated protein kinase 6

BC052280 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2

AK092059 Guanine nucleotide binding protein (G protein), beta 5

AK091411 Heterogeneous nuclear ribonucleoprotein H3 (2H9)

NM_013361 Zinc finger protein 223

BC035341 Gamma-glutamyltransferase 1

AK024094 Prefoldin 5

AF410901 Neurotrophic tyrosine kinase, receptor, type 2

AK130581 Glomulin, FKBP associated protein

BM701411 Guanine nucleotide binding protein (G protein), gamma 5

AK094289 Mucoepidermoid carcinoma translocated 1

BX647722 V-akt murine thymoma viral oncogene homolog 1

AF032862 Hyaluronan-mediated motility receptor (RHAMM)

CR749528 H2A histone family, member Y

NM_013994 Discoidin domain receptor family, member 1

AK123080 LETM1 domain containing 1

D21255 Cadherin 11 , type 2, OB-cadherin (osteoblast)

D21255 Cadherin 11, type 2, OB-cadherin (osteoblast)

BC042665 CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)

NM_000959 Prostaglandin F receptor (FP)

NM_006410 HIV-1 Tat interactive protein 2, 3OkDa

U 67206 Caspase 7, apoptosis-related cysteine protease

NM_182641 Fetal Alzheimer antigen

AK074668 Immunoglobulin superfamily containing leucine-rich repeat

NM_006058 TNFAIP3 interacting protein 1

AK098109 LIM and senescent cell antigen-like domains 1 NM_001817 Carcinoembryonic antigen-related cell adhesion molecule 4

AF290204 Dombrock blood group

CR749471 ROD1 regulator of differentiation 1 (S. pombe)

NM_016952 Cell adhesion molecule-related/down-regulated by oncogenes

BC063882 Zinc finger DAZ interacting protein 3

NM_198159 Microphthalmia-associated transcription factor

NM_033018 PCTAIRE protein kinase 1

BC047553 Calmodulin 2 (phosphorylase kinase, delta)

BU739742 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3

BU739742 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3

NM_016837 RNA binding motif, single stranded interacting protein 1

AK125205 Abl interactor 2

NM_015858 cell division cycle 42 (GTP binding protein, 25kDa)

NM_001995 Acyl-CoA synthetase long-chain family member 1

NM_020217 Hypothetical protein DKFZp547IO14

NM_000231 Sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)

AK091734 Phosphodiesterase 1 C, calmodulin-dependent 7OkDa

AK127739 Zinc finger protein 45 (a Kruppel-associated box (KRAB) domain polypeptide)

NM_014939 KIAA1012

NM_006566 CD226 antigen

NM_003718 Cell division cycle 2-like 5 (cholinesterase-related cell division controller)

NM_003718 Cell division cycle 2-like 5 (cholinesterase-related cell division controller)

AF061939 Staufen, RNA binding protein (Drosophila)

BC001188 Transferrin receptor (p90, CD71 )

BX648313 Transforming growth factor, beta receptor Il (70/8OkDa)

BU858880 ATP synthase, H+ transporting, mitochondrial FO complex, subunit e

NM_003454 Zinc finger protein 200

BM994488 Follistatin

NM_000124 Excision repair cross-complementing rodent repair deficiency, complementation group 6

AK125853 Ligase 111 , DNA, ATP-dependent

AK092254 Vesicle-associated membrane protein 4

NM_198321 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10

(GaINAc-TIO)

NM_033044 Microtubule-actin crosslinking factor 1

NM_172200 lnterleukin 15 receptor, alpha

BX648583 EGF-like repeats and discoidin l-like domains 3

NM_004820 Cytochrome P450, family 7, subfamily B, polypeptide 1

AK128627 Smoothelin

NM_003557 Phosphatidylinositol-4-phosphate 5-kinase, type I, alpha

CR601384 Asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)

AF076838 RAD17 homolog (S. pombe)

AK130497 Solute carrier family 22 (organic cation transporter), member 14

BC034489 Zinc finger protein 177

AK096924 Ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)

AJ312319 MLL septin-like fusion

NM_003326 Tumor necrosis factor (ligand) superfamily, member 4 (tax-transcriptionally activated glycoprotein 1 , 34kDa)

AK000081 Cell division cycle 2-like 1 (PITSLRE proteins) NMJD03676 Degenerative spermatocyte homolog, lipid desaturase (Drosophila)

AB016092 Serine/arginine repetitive matrix 2

NM_014896 sorbin and SH3 domain containing 1

BG421329 RNA, U transporter 1

D84454 Solute carrier family 35 (UDP-galactose transporter), member A2

D84454 Solute carrier family 35 (UDP-galactose transporter), member A2

BQ687514 Protease, serine, 3 (mesotrypsin)

NM_173060 Calpastatin

BX537579 Pirin (iron-binding nuclear protein)

NIVM 70677 Meisi, myeloid ecotropic viral integration site 1 homolog 2 (mouse)

NM_018448 TBP-interacting protein

BC065567 Butyrophilin, subfamily 3, member A1

AK126784 Chimerin (chimaerin) 2

BX537681 RAB28, member RAS oncogene family

BC045635 Smooth muscle cell associated protein-1

BF670597 ATP synthase, H+ transporting, mitochondrial FO complex, subunit c (subunit 9) isoform 3

BF670597 ATP synthase, H+ transporting, mitochondrial FO complex, subunit c (subunit 9) isoform 3

NM_000710 Bradykinin receptor B1

AF025771 Zinc finger protein 189

CR613447 Polymerase (RNA) I polypeptide C, 3OkDa

BG494940 Sjogren syndrome antigen A2 (6OkDa, ribonucleoprotein autoantigen SS-A/Ro)

BC075855 Suppression of tumorigenicity 7

NM_005716 Regulator of G-protein signalling 19 interacting protein 1

NM_014331 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11

S76638 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)

BC073788 Exosome component 10

BX648829 Procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide

I

NM_001005743 Numb homolog (Drosophila)

BX537451 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)

NM_078628 Male-specific lethal 3-like 1 (Drosophila)

NM_201636 Thromboxane A2 receptor

U94905 Diacylglycerol kinase, zeta 104kDa

AK127829 Paired-like homeodomain transcription factor 2

X95808 Zinc finger protein 261

NMJD03605 O-linked N-acetylglucosamine (GIcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-

N-acetylglucosaminyl transferase)

NM_003605 O-linked N-acetylglucosamine (GIcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-

N-acetylglucosaminyl transferase)

AF031469 Major histocompatibility complex, class l-related

BF698866 ATP synthase, H+ transporting, mitochondrial FO complex, subunit g

AK129595 Growth arrest and DNA-damage-inducible, beta

BU902070 Ribosomal protein L36a-like

NM_003871 myelin transcription factor 2

NM_203446 Synaptojanin 1

NM_006129 Bone morphogenetic protein 1

CR749256 X-ray repair complementing defective repair in Chinese hamster cells 2

NM_003615 Solute carrier family 4, sodium bicarbonate cotransporter, member 7 AL834250 Rho GTPase activating protein 12

NM_003592 Cullin 1

NM_004180 TRAF family member-associated NFKB activator

AK096210 BCS1-like (yeast)

AF035582 Calcium/calmodulin-dependent serine protein kinase (MAGUK family)

BC007572 Phosphatidylethanolamine N-methyltransferase

NM_007189 ATP-binding cassette, sub-family F (GCN20), member 2

AJ238395 Retinitis pigmentosa GTPase regulator

U03494 Transcription factor CP2

AK126224 Williams Beuren syndrome chromosome region 22

BC020567 Rho/rac guanine nucleotide exchange factor (GEF) 2

NM_183013 CAMP responsive element modulator

NMJ305592 Muscle, skeletal, receptor tyrosine kinase

NM_002772 Protease, serine, 7 (enterokinase)

NM_001065 Tumor necrosis factor receptor superfamily, member 1 A

BC036212 Chromodomain helicase DNA binding protein 1-like

NM_001938 Down-regulator of transcription 1, TBP-binding (negative cofactor 2)

AK124768 Transportin 1

NM_014631 Homo sapiens SH3 multiple domains 1 (SH3MD1), mRNA

NM_003813 A disintegrin and metalloproteinase domain 21

AK093838 Mitogen-activated protein kinase kinase 3

AK127433 Thioredoxin domain containing 7 (protein disulfide isomerase)

NM_005538 Inhibin, beta C

NM_005538 Inhibin, beta C

AY229977 T-box 10

NM_013227 Aggrecan 1 (chondroitin sulfate proteoglycan 1, large aggregating proteoglycan, antigen identified by monoclonal antibody A0122)

N M_181659 Nuclear receptor coactivator 3

NM_025176 KIAA0980 protein

AK095629 SEC13-like 1 (S. cerevisiae)

AK125874 Chromosome 20 open reading frame 18

NM_004353 serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1 ,

(collagen binding protein 1)

NM_004572 Plakophilin 2

AB022657 KARP-1-binding protein

AK054976 Histidine triad nucleotide binding protein 1

AK056818 BTB (POZ) domain containing 2

NMJD14946 Spastic paraplegia 4 (autosomal dominant; spastin)

NM_012222 MutY homolog (E. coli)

NMJD18005 Homo sapiens cDNA FLJ10139 fis, clone HEMBA1003175.

NM_017932 hypothetical protein FLJ20700

M94890 Pregnancy specific beta-1 -glycoprotein 9

AB011159 NCK-associated protein 1

AK125857 Nucleoporin 62kDa

CR610258 Docking protein 4

NM_002718 Protein phosphatase 2 (formerly 2A), regulatory subunit B", alpha

AJ276316 Zinc finger protein 304

NMJD25017 gb:NM_025017.1 /DEF=Homo sapiens hypothetical protein FLJ13892 (FLJ13892), mRNA. /FEA=mRNA /GEN=FLJ13892 /PROD=hypothetical protein FLJ13892 /DB_XREF=gi:13376536 /UG=Hs.2876O8 hypothetical protein FLJ13892 /FL=gb:NM_025017.1

AF125672 Nuclear receptor co-repressor 2

AK024409 DKFZP586A0522 protein

NM_025182 KIAA1539

CR598805 Polyglutamine binding protein 1

AK122722 Presenilin 1 (Alzheimer disease 3)

NM_017627 tumor protein, translationally-controlled 1

AK126357 Recombining binding protein suppressor of hairless (Drosophila)

BC067260 Vinexin beta (SH3-containing adaptor molecule-1 )

AK123525 RAB1A, member RAS oncogene family

NM_014868 Ring finger protein 10

NM_002813 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9

M14338 Protein S (alpha)

AK090462 ATPase, H+ transporting, lysosomal accessory protein 1

NM_015530 Golgi reassembly stacking protein 2, 55kDa

BC034763 Ferredoxin reductase

NM_000667 Alcohol dehydrogenase 1A (class I), alpha polypeptide

NM_153831 PTK2 protein tyrosine kinase 2

AK097472 MYC-associated zinc finger protein (purine-binding transcription factor)

BM906235 Inhibitor of DNA binding 3, dominant negative helix-loop-helix protein

NM_005196 centromere protein F, 350/400ka (mitosin)

AF083957 BCL2/adenovirus E1B 19kDa interacting protein 1

NM_138558 Protein phosphatase 1 , regulatory (inhibitor) subunit 8

BM992995 Deoxyhypusine synthase

AK124859 RNA binding protein with multiple splicing

BC043384 Chromosome 9 open reading frame 127

BC044656 Cancer susceptibility candidate 3

BM714384 Cytochrome b-5

BE785946 Anaphase promoting complex subunit 10

J05581 Mucin 1 , transmembrane

AB018304 Mid-1-related chloride channel 1

AB037839 Hypothetical protein FLJ20297

BC075855 Suppression of tumorigenicity 7

AF146692 Filamin C, gamma (actin binding protein 280)

NM_017518 Homo sapiens three prime repair exonuclease 2 (TREX2), transcript variant 5, mRNA

D50810 Leucyl/cystinyl aminopeptidase

X59739 Zinc finger protein, X-linked

AL832319 Macrophage erythroblast attacher

AK097738 Ret finger protein-like 3

AK092131 RNA binding protein S1, serine-rich domain

CR749443 RNA-binding region (RNP1 , RRM) containing 2

CR749329 Pleiomorphic adenoma gene-like 1

NM_006188 Oncomodulin

AK128863 Casein kinase 1 , delta

NM_020987 Ankyrin 3, node of Ranvier (ankyrin G)

AL137201 Androgen-induced proliferation inhibitor NM_012277 Homo sapiens pancreatic beta cell growth factor (INGAP), mRNA

AK027032 Golgi apparatus protein 1

AB011154 KIAA0582

NM_006930 S-phase kinase-associated protein 1 A (p19A)

NM_006079 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2

CR627425 Stromal antigen 2

AK095244 Cytochrome b-561

BF240734 Actin related protein 2/3 complex, subunit 2, 34kDa

NM_000480 Adenosine monophosphate deaminase (isoform E)

NM_007236 Calcium binding protein P22

NM_181862 Brain acyl-CoA hydrolase

AF346509 Nuclear factor of activated T-cells 5, tonicity-responsive

AK128274 SP110 nuclear body protein

NM_002913 Replication factor C (activator 1) 1, 145kDa

NM_003671 CDC14 cell division cycle 14 homolog B (S. cerevisiae)

AK098780 DiGeorge syndrome critical region gene 6

X92518 High mobility group AT-hook 2

BC038117 Lysosomal associated protein transmembrane 4 beta

BC042998 Adducin 1 (alpha)

NM_006885 AT-binding transcription factor 1

NM_003048 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 2

NM_013303 fetal hypothetical protein

AF045451 NGFI-A binding protein 1 (EGR1 binding protein 1)

NM_006451 PoIy(A) binding protein interacting protein 1

BX537563 Hect domain and RLD 4

NM_015877 Homo sapiens Kruppel-associated box protein (LOC51045), mRNA

NM_015879 Sialyltransferase 8C (alpha2,3Galbeta1 ,4GlcNAcalpha 2,8-sialyltransferase)

BC021000 General transcription factor HB

AF078695 REV3-like, catalytic subunit of DNA polymerase zeta (yeast)

D84294 Tetratricopeptide repeat domain 3

BM809524 Adaptor-related protein complex 2, sigma 1 subunit

CA406688 Histone 1, H4d

BX647794 Transcription factor 8 (represses interleukin 2 expression)

NM_003158 serine/threonine kinase 6

NM_030757 Makorin, ring finger protein, 4 (MKRN4), mRNA

BX537910 Tudor domain containing 3

AK126848 Hypothetical protein DKFZp564K0822

AK055334 Family with sequence similarity 49, member A

AL832648 NudE nuclear distribution gene E homolog like 1 (A. nidulans)

CR620805 Hypothetical protein MGC10471

NM_172171 Calcium/calmodulin-dependent protein kinase (CaM kinase) Il gamma

NM_030755 Thioredoxin domain containing

BC011620 Chromosome 9 open reading frame 74

AL832664 Acidic (leucine-rich) nuclear phosphoprotein 32 family, member E

NM_030935 TSC-22-like

BC020652 Pregnancy specific beta-1-glycoprotein 6

AK124613 EH-domain containing 1

NM_030979 PoIy(A) binding protein, cytoplasmic 3 AL096734 Hypothetical protein FLJ12671

AK025599 Mannosidase, alpha, class 1A, member 1

CR627440 LAT1-3TM protein

NM_031221 gb:NM_031221.1 /DEF=Homo sapiens hypothetical protein FKSG63 (FKSG63), mRNA.

/FEA=mRNA /GEN=FKSG63 /PROD=hypothetical protein FKSG63 /DB_XREF=gi:13654297

/FL=gb:NM_031221.1

NM_144949 Suppressor of cytokine signaling 5

NM_000961 Prostaglandin I2 (prostacyclin) synthase

BC042295 HLA-B associated transcript 2

BC022316 Pregnancy specific beta-1 -glycoprotein 2

BC028590 Zinc finger protein 611

BQ064822 Hypothetical protein MGC4293

CD013969 Cytochrome P450, family 2, subfamily C, polypeptide 8

NM_006386 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17

BX648405 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21

BX647893 Oxysterol binding protein-like 1A

AK090845 U2(RNU2) small nuclear RNA auxiliary factor 1-like 2

NM_007118 Triple functional domain (PTPRF interacting)

BF676144 Histone 1, H4h

BC063127 Pregnancy specific beta-1 -glycoprotein 4

NM_003409 Zinc finger protein 161 homolog (mouse)

BC043166 Potassium voltage-gated channel, shaker-related subfamily, beta member 1

NM_023028 Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss ' syndrome)

NM_013957 Neuregulin 1

NM_013394 fibroblast growth factor 1 (acidic)

NM_017618 Homo sapiens hypothetical protein FLJ20006 (FLJ20006), mRNA

BX647107 Amyloid beta (A4) precursor-like protein 2

BC033675 TDP-glucose 4,6-dehydratase

L14723 Pregnancy specific beta-1 -glycoprotein 1

AK074456 Eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa

BC012166 Arginyl aminopeptidase (aminopeptidase B)

BM712658 CMT1A duplicated region transcript 1

BC036648 Deleted in azoospermia 2

NM_004879 Etoposide induced 2.4 mRNA

NM_001969 Eukaryotic translation initiation factor 5

AK097284 Tumor necrosis factor, alpha-induced protein 8

AF008915 Ecotropic viral integration site 5

NM_002842 Protein tyrosine phosphatase, receptor type, H

BQ067599 Major histocompatibility complex, class II, DR beta 4

BX641158 Glucose phosphate isomerase

NM_006785 Mucosa associated lymphoid tissue lymphoma translocation gene 1

BX647421 Follistatin-like 1

NM_004630 Splicing factor 1

AF110908 TNF receptor-associated factor 3

NM_000276 Oculocerebrorenal syndrome of Lowe

BX647914 RNA binding motif (RNP1, RRM) protein 3 BX537506 Sialyltransferase 4A (beta-galactoside alpha-2,3-sialyltransferase)

NM_006738 A kinase (PRKA) anchor protein 13

AL831995 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A)

BC034484 Glycoprotein, synaptic 2

NM_002745 Mitogen-activated protein kinase 1

BX537545 Polymerase (RNA) III (DNA directed) polypeptide D, 44kDa

BC002579 Glutaryl-Coenzyme A dehydrogenase

AY325903 Down syndrome critical region gene 1

BC002922 Ring finger protein 1

BX648738 Capping protein (actin filament) muscle Z-line, alpha 1

NM_004464 Fibroblast growth factor 5

Y18880 Midline 2

AK128274 SP110 nuclear body protein

U63139 RAD50 homolog (S. cerevisiae)

NM_007036 Endothelial cell-specific molecule 1

NM_005019 Phosphodiesterase 1A, calmodulin-dependent

AK054852 TBP-like 1

BC036092 MAX protein

BC040317 CD164 antigen, sialomucin

AF062341 Catenin (cadherin-associated protein), delta 1

D79984 Suppressor of Ty 6 homolog (S. cerevisiae)

NM_020313 Cytokine induced apoptosis inhibitor 1

NM_002255 Killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4

NM_000051 Ataxia telangiectasia mutated (includes complementation groups A, C and D)

NM_023005 Bromodomain adjacent to zinc finger domain, 1B

NM_002764 Phosphoribosyl pyrophosphate synthetase 1

BC063289 Complement component 4B

NM_006523 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble

AK091342 Plasma glutamate carboxypeptidase

CR592913 Related RAS viral (r-ras) oncogene homolog 2

AB018288 Exportin 7

BX647761 Zinc finger protein, subfamily 1A, 4 (Eos)

BF983096 BCL2-associated X protein

AJ633621 Keratin, hair, acidic, 3A

NM_003879 CASP8 and FADD-like apoptosis regulator

NM_000798 Dopamine receptor D5

BC056264 Histone 1, H2bg

NM_021167 Ocular development-associated gene

AK123253 Peroxisome proliferative activated receptor, gamma

BC036452 Potassium voltage-gated channel, Isk-related family, member 1

BX537826 Basic transcription factor 3

BP362977 Histone 1 , H2be

NM_006989 RAS p21 protein activator 4

NM_021039 Homo sapiens S100 calcium binding protein A11 pseudogene (S100A11P), mRNA

NM_003201 Transcription factor A, mitochondrial

BX436525 Histone 1 , H2bh

NM_016171 prothymosin, alpha (gene sequence 28)

R76859 H2B histone family, member S BM458221 Metallothionein 1X

NM_021631 Apoptosis inhibitor

NM_005703 gb:NM_005703.2 /DEF=Homo sapiens upstream regulatory element binding protein 1

(UREB1), mRNA. /FEA=CDS /GEN=UREBI /PROD=upstream regulatory element binding protein 1 /DB_XREF=gi:6692990 /UG=Hs.3383 upstream regulatory element binding protein

1 /FL=gb:NM_005703.2 NM_019105 Tenascin XB

AB016092 Serine/arginine repetitive matrix 2

BC034956 Spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)

AK075455 Glucose regulated protein, 58kDa

AF043045 Filamin B, beta (actin binding protein 278)

AF043045 Filamin B, beta (actin binding protein 278)

NM_003479 Protein tyrosine phosphatase type IVA, member 2

NM_003479 Protein tyrosine phosphatase type IVA, member 2

NM_003479 Protein tyrosine phosphatase type IVA, member 2

BC050530 Damage-specific DNA binding protein 1 , 127kDa

CR624156 Poly(rC) binding protein 1

AF351612 Villin 2 (ezrin)

AF351612 Villin 2 (ezrin)

AF351612 Villin 2 (ezrin)

NM_182917 Eukaryotic translation initiation factor 4 gamma, 1

NIVM82917 Eukaryotic translation initiation factor 4 gamma, 1

BC015041 Vesicle amine transport protein 1 homolog (T californica)

CR601484 LOC442610

BF525416 Nuclease sensitive element binding protein 1

NM_000182 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme

A hydratase (trifunctional protein), alpha subunit NM_000182 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme

A hydratase (trifunctional protein), alpha subunit NM_000182 Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme

A hydratase (trifunctional protein), alpha subunit NM_014868 Ring finger protein 10

NM_033044 Microtubule-actin crosslinking factor 1

NM_033044 Microtubule-actin crosslinking factor 1

AK096699 Nascent-polypeptide-associated complex alpha polypeptide

BX641076 Actinin, alpha 1

BX641076 Actinin, alpha 1

AK125449 ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2

AK127433 Thioredoxin domain containing 7 (protein disulfide isomerase)

NM_198829 Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rad)

NM_198829 Ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rad)

BX647578 X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 8OkDa) BX647578 X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 8OkDa)

NM_001618 Poly (ADP-ribose) polymerase family, member 1

AF116710 PRO2640

AF116710 PRO2640 AK098208 Farnesyl-diphosphate farnesyltransferase 1

NMJ307126 Valosin-containing protein

NM_007126 Valosin-containing protein

BX640662 Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform

BC040317 CD164 antigen, sialomucin

BC040317 CD164 antigen, sialomucin

AK123540 Cyclin I

AK123540 Cyclin I

AJ312319 MLL septin-like fusion

NM_004911 Protein disulfide isomerase related protein (calcium-binding protein, intestinal-related)

BG164246 Chloride intracellular channel 1

N M_198324 Citrate synthase

D84294 Tetratricopeptide repeat domain 3

D84294 Tetratricopeptide repeat domain 3

D84294 Tetratricopeptide repeat domain 3

D84294 Tetratricopeptide repeat domain 3

NM_003932 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)

NM 003932 Suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)

BQ051103 High-mobility group nucleosomal binding domain 2

NM_014335 CREBBP/EP300 inhibitor 1

NM_014335 CREBBP/EP300 inhibitor 1

AF087902 Tumor differentially expressed 2

AK091927 Splicing factor, arginine/serine-rich 3

AK091927 Splicing factor, arginine/serine-rich 3

AK090466 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase

AK090466 Dolichyl-diphosphooligosaccharide-pratein glycosyltransferase

CR591089 Proliferation-associated 2G4, 38kDa

NM_001728 Basigin (OK blood group)

BF214530 ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1

BF240734 Actin related protein 2/3 complex, subunit 2, 34kDa

B F185567 Peroxiredoxin 1

AK092463 Melanoma antigen, family D, 2

AK124751 Calpain 2, (m/ll) large subunit

NMJD04371 Coatomer protein complex, subunit alpha

NM_005104 Bromodomain containing 2

NM_005104 Bromodomain containing 2

NM_006597 Heat shock 7OkDa protein 8

AK126670 Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa

AK123690 Ribophorin Il

AK091847 PDZ and LIM domain 1 (elfin)

BC001188 Transferrin receptor (p90, CD71)

BF303909 Ribosomal protein S3

NM_002047 Glycyl-tRNA synthetase

NM_006904 Protein kinase, DNA-activated, catalytic polypeptide

AK098280 Ribosomal protein L39

AK124354 Chaperonin containing TCP1 , subunit 5 (epsilon)

AK124178 Eukaryotic translation initiation factor 3, subunit 6 48kDa

NM_007363 Non-POU domain containing, octamer-binding BX649193 Transketolase (Wernicke-Korsakoff syndrome)

BX649193 Transketolase (Wernicke-Korsakoff syndrome)

BX647107 Amyloid beta (A4) precursor-like protein 2

BX647107 Amyloid beta (A4) precursor-like protein 2

BX647107 Amyloid beta (A4) precursor-like protein 2

NM_001969 Eukaryotic translation initiation factor 5

NM_001969 Eukaryotic translation initiation factor 5

NM_001969 Eukaryotic translation initiation factor 5

AL832897 Nardilysin (N-arginine dibasic convertase)

NM_003938 Adaptor-related protein complex 3, delta 1 subunit

NMJD53056 Cyclin D1 (PRAD1: parathyroid adenomatosis 1)

NM_053056 Cyclin D1 (PRAD1 : parathyroid adenomatosis 1)

NM_007040 Heterogeneous nuclear ribonucleoprotein U-like 1

AK055875 NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa

BF680501 Putative membrane protein

BF680501 Putative membrane protein

BX248001 Oxidase (cytochrome c) assembly 1 -like

Z97056 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3

NM_006386 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17

CR749443 RNA-binding region (RNP1 , RRM) containing 2

BC045686 Anaphase promoting complex subunit 5

BC045686 Anaphase promoting complex subunit 5

NM_004651 Ubiquitin specific protease 11

AK123525 RAB1A, member RAS oncogene family

BX648379 Eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa

BC018266 Cell division cycle 42 (GTP binding protein, 25kDa)

BC018266 Cell division cycle 42 (GTP binding protein, 25kDa)

AK124160 Major histocompatibility complex, class I, B

AL137321 RAB2, member RAS oncogene family

AL137321 RAB2, member RAS oncogene family

AL137321 RAB2, member RAS oncogene family

AL137321 RAB2, member RAS oncogene family

AL137321 RAB2, member RAS oncogene family

NM_005730 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2

BU729755 Actin related protein 2/3 complex, subunit 3, 21kDa

CR607789 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1

NM_006937 SMT3 suppressor of mif two 3 homolog 2 (yeast)

NM_006937 SMT3 suppressor of mif two 3 homolog 2 (yeast)

AK126385 Sin3-associated polypeptide, 18kDa

AK126385 Sin3-associated polypeptide, 18kDa

AK126385 ' Sin3-associated polypeptide, 18kDa

NM_003404 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide

BX648623 Heat shock 105kDa/110kDa protein 1

BF698866 ATP synthase, H+ transporting, mitochondrial FO complex, subunit g

BF698866 ATP synthase, H+ transporting, mitochondrial FO complex, subunit g

AK126711 Complement component 1, s subcomponent

AF089750 Flotillin 1 AF089750 Flotillin 1

AK023803 ADP-ribosylation factor 1

AK123456 N-ethylmaleimide-sensitive factor attachment protein, alpha

AL162068 Nucleosome assembly protein 1-like 1

AL162068 Nucleosome assembly protein 1-like 1

AL162068 Nucleosome assembly protein 1-like 1

CR621187 H3 histone, family 3A

BM542041 Eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa

BX640856 Gp25L2 protein

CR606023 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase

BC047621 Nicastrin

BC069256 Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)

BF214482 SMT3 suppressor of mif two 3 homolog 1 (yeast)

BF214482 SMT3 suppressor of mif two 3 homolog 1 (yeast)

NM_198057 Delta sleep inducing peptide, immunoreactor

CR593432 ATP synthase, H+ transporting, mitochondrial FO complex, subunit c (subunit 9), isoform 2

BX647784 Heterogeneous nuclear ribonucleoprotein R

BX647784 Heterogeneous nuclear ribonucleoprotein R

BC038117 Lysosomal associated protein transmembrane 4 beta

NM_000983 Ribosomal protein L22

CR627373 Eukaryotic translation initiation factor 4E binding protein 2

BC032528 Leukotriene A4 hydrolase

NM_020690 Eukaryotic translation initiation factor 4E binding protein 3

NM_020690 Eukaryotic translation initiation factor 4E binding protein 3

AK128863 Casein kinase 1 , delta

AL833550 Exportin 1 (CRM1 homolog, yeast)

NM_002815 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11

X52882 T-complex 1

NM_013994 Discoidin domain receptor family, member 1

NM_003574 VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa

BC016863 Sorting nexin 3

BX647421 Follistatin-like 1

BX537451 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)

BM670875 Kelch domain containing 3

BM907914 Transcribed locus

BC041874 Microtubule-associated protein 1 light chain 3 beta

BM541805 Mitochondrial ribosomal protein L3

AL833001 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)

NM_012232 Polymerase I and transcript release factor

NM_012232 Polymerase I and transcript release factor

NM_203339 Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone- repressed prostate message 2, apolipoprotein J)

NM_203339 Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone- repressed prostate message 2, apolipoprotein J)

NM_003072 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

NM_003072 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

NM_182776 MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)

NM_004060 Cyclin G1

BX648160 Golgin-67

BX648160 Golgin-67

BC004146 proteasome (prosome, macropain) subunit, beta type, 5

NM_006947 Signal recognition particle 72kDa

NM_006947 Signal recognition particle 72kDa

NM_006947 Signal recognition particle 72kDa

NM_006947 Signal recognition particle 72kDa

AL031681 splicing factor, arginine/serine-rich 6

BF303891 Proteasome (prosome, macropain) subunit, alpha type, 6 NM_001005273 Chromodomain helicase DNA binding protein 3 NM_001005273 Chromodomain helicase DNA binding protein 3

CR600021 High-mobility group box 2

AL136632 Chromosome 6 open reading frame 62

AL832124 DnaJ (Hsp40) homolog, subfamily B, member 6

AL832124 DnaJ (Hsp40) homolog, subfamily B, member 6

BF341582 Major histocompatibility complex, class I, C

BM994502 Glutamic-oxaloacetic transaminase 1 , soluble (aspartate aminotransferase 1 )

NM_002154 Heat shock 7OkDa protein 4

M62898 Annexin A2 pseudogene 2

AL390148 Catechol-O-methyltransferase

AL390148 Catechol-O-m ethyltransferase

AK095221 RAB8A, member RAS oncogene family

NM_153831 PTK2 protein tyrosine kinase 2

BM564070 Small nuclear ribonucleoprotein polypeptides B and B1

CR615460 Death associated protein 3

NMJ333018 PCTAIRE protein kinase 1

NM_033018 PCTAIRE protein kinase 1

BM994378 Ribosomal protein L23a

AK054976 Histidine triad nucleotide binding protein 1

BF698890 Proteasome (prosome, macropain) subunit, beta type, 6

AK092840 Polymerase (DNA directed), epsilon 3 (p17 subunit)

NMJD03190 TAP binding protein (tapasin)

D79984 Suppressor of Ty 6 homolog (S. cerevisiae)

D79984 Suppressor of Ty 6 homolog (S. cerevisiae)

NM_013236 Ataxin 10

NM_013236 Ataxin 10

BC001865 ribosomal protein L23a

NM_016424 Cisplatin resistance-associated overexpressed protein

AK094673 ATPase, Na+/K+ transporting, beta 3 polypeptide

AK075529 Chromosome 15 open reading frame 22

NM_018448 TBP-interacting protein

NM_018448 TBP-interacting protein

NM_203505 Ras-GTPase activating protein SH3 domain-binding protein 2

NM_203505 Ras-GTPase activating protein SH3 domain-binding protein 2

NM_015530 Golgi reassembly stacking protein 2, 55kDa NM_015530 Golgi reassembly stacking protein 2, 55kDa

BC002456 gb:BC002456.1 /DEF=Homo sapiens, voltage-dependent anion channel 3, clone MGC:1966, mRNA, complete cds. /FEA=mRNA /PROD=voltage-dependent anion channel 3 /DB_XREF=gi:12803280 /UG=Hs.7381 voltage-dependent anion channel 3 /FL=gb:BC002456.1 gb:U90943.1 gb:AF038962.1 gb:NM_005662.1

BC002456 gb:BC002456.1 /DEF=Homo sapiens, voltage-dependent anion channel 3, clone MGC:1966, mRNA, complete cds. /FEA=mRNA /PROD=voltage-dependent anion channel 3 /DB_XREF=gi:12803280 /UG=Hs.7381 voltage-dependent anion channel 3 /FL=gb:BC002456.1 gb:U90943.1 gb:AF038962.1 gb:NM_005662.1

AK095798 Voltage-dependent anion channel 3

NM_000671 Alcohol dehydrogenase 5 (class III), chi polypeptide

NM_000671 Alcohol dehydrogenase 5 (class III), chi polypeptide

AK090996 Thy-1 cell surface antigen

AK090996 Thy-1 cell surface antigen

NM_001746 Calnexin

NM_001746 Calnexin

BC035578 Serine/threonine kinase 24 (STE20 homolog, yeast)

BC035578 Serine/threonine kinase 24 (STE20 homolog, yeast)

BF570115 Ribosomal protein, large, PO

CR615194 Protein-L-isoaspartate (D-aspartate) O-methyltransferase

AK022790 Likely ortholog of mouse membrane bound C2 domain containing protein

NM_138271 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)

NM_138271 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)

NM_138271 Alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae)

AF062341 Catenin (cadherin-associated protein), delta 1

AK126318 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)

BM810480 Thioredoxin

CR602716 Full-length cDNA clone CS0DJ012YP16 of T cells (Jurkat cell line) Cot 10-normalized of

Homo sapiens (human)

CR602716 Full-length cDNA clone CS0DJ012YP16 of T cells (Jurkat cell line) Cot 10-normalized of

Homo sapiens (human)

AF119911 gb:AF119911.1 /DEF=Homo sapiens PRO2975 mRNA, complete cds. /FEA=mRNA

/PROD=PRO2975 /DB_XREF=gi:7770258 /UG=Hs.144477 hypothetical protein PRO2975 /FL=gb:AF119911.1

BX648781 GABA(A) receptor-associated protein like 1

BX648781 GABA(A) receptor-associated protein like 1

BF131627 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1

BC051795 Dentatorubral-pallidoluysian atrophy (atrophin-1 )

BX648005 Chromosome 5 open reading frame 18

BX648005 Chromosome 5 open reading frame 18

NM_178001 Protein phosphatase 2A, regulatory subunit B1 (PR 53)

NM_002577 P21 (CDKN 1A)-activated kinase 2

NM_002577 P21 (CDKN 1A)-activated kinase 2

NM_002577 P21 (CDKN 1A)-activated kinase 2

NM_002577 P21 (CDKN 1A)-activated kinase 2

NM_012469 Chromosome 20 open reading frame 14

NM_012469 Chromosome 20 open reading frame 14

BX537663 Isopentenyl-diphoεphate delta isomerase NM_015902 E3 identified by differential display

NM_015902 E3 identified by differential display

NM_015902 E3 identified by differential display

NM_005318 H1 histone family, member 0

CR613864 Eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa

XM_371474 Plexin B2

BC037236 Dual specificity phosphatase 6

BC037236 Dual specificity phosphatase 6

NM_006773 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

NM_006773 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

NM_006773 DEAD (Asp-Glu-Ala-Asp) box polypeptide 18

CR612882 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D

CR612882 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D

NM_003286 Topoisomerase (DNA) I

NM_003286 Topoisomerase (DNA) I

BC066124 FLJ46061 protein

BQ278352 Ribosomal protein S28

NMJ318947 Cytochrome c, somatic

CR618858 Bernardinelli-Seip congenital lipodystrophy 2 (seipin)

AK126124 Mitochondrial ribosomal protein S18B

NM_173060 Calpastatin

BM912157 Ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1

BM464229 Complement component 1, q subcomponent binding protein

CR596462 Pyruvate dehydrogenase (lipoamide) beta

NM_033133 2',3'-cyclic nucleotide 3' phosphodiesterase

NM_015044 Golgi associated, gamma adaptin ear containing, ARF binding protein 2

NM_015044 Golgi associated, gamma adaptin ear containing, ARF binding protein 2

NM_015044 Golgi associated, gamma adaptin ear containing, ARF binding protein 2

U53347 Solute carrier family 1 (neutral amino acid transporter), member 5

NM_023018 NAD kinase

NM_023018 NAD kinase

NM_023018 NAD kinase

NM_003130 Sorcin

NM_003130 Sorcin

BC028041 Nuclear RNA export factor 1

AK127094 Cytoplasmic FMR1 interacting protein 1

NM_014372 Ring finger protein 11

BX647535 Chromosome 3 open reading frame 4

CR597671 Sialidase 1 (lysosomal sialidase)

BF673888 speckle-type POZ protein

CD014011 P450 (cytochrome) oxidoreductase

AK095954 Ribosomal protein L13

NM_012218 lnterleukin enhancer binding factor 3, 9OkDa

AF147209 interleukin enhancer binding factor 3, 9OkDa

CR623362 Protein phosphatase 4 (formerly X), catalytic subunit

XM_375853 Protein BAP28

NM_006499 Lectin, galactoside-binding, soluble, 8 (galectin 8)

L78132 lectin, galactoside-binding, soluble, 8 (galectin 8) NM_006499 Lectin, galactoside-binding, soluble, 8 (galectin 8)

BG165657 Inhibitor of DNA binding 1, dominant negative helix-loop-helix protein

NM_005973 Papillary renal cell carcinoma (translocation-associated)

AK125066 Selenophosphate synthetase 1

AK125066 Selenophosphate synthetase 1

AK125066 Selenophosphate synthetase 1

BX537668 Translocation protein 1

BX537668 Translocation protein 1

D50683 transforming growth factor, beta receptor Il (70/8OkDa)

BX647788 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein)

BX647788 Beclin 1 (coiled-coil, myosin-like BCL2 interacting protein)

AF061939 Staufen, RNA binding protein (Drosophila)

AK091776 Lectin, galactoside-binding, soluble, 3 (galectin 3)

AK092507 Aldehyde dehydrogenase 7 family, member A1

AK092507 Aldehyde dehydrogenase 7 family, member A1

XM_040265 KIAA0217

XM_040265 KIAA0217

XM_040265 KIAA0217

NM_001948 DUTP pyrophosphatase

NM_001948 DUTP pyrophosphatase

NM_015051 Thioredoxin domain containing 4 (endoplasmic reticulum)

U51869 Core promoter element binding protein

U51869 Core promoter element binding protein

NM_013402 Fatty acid desaturase 1

NM_013402 Fatty acid desaturase 1

NM_013402 Fatty acid desaturase 1

AF208043 Interferon, gamma-inducible protein 16

AF208043 Interferon, gamma-inducible protein 16

NM_013411 Adenylate kinase 2

NM 020313 Cytokine induced apoptosis inhibitor 1

BM546373 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa

BX647308 Uroporphyrinogen decarboxylase

BX647308 Uroporphyrinogen decarboxylase

BF569083 ATP synthase, H+ transporting, mitochondrial FO complex, subunit c (subunit 9), isoform 1

BM544109 Prion protein interacting protein

L38951 Karyopherin (importin) beta 1

L38951 Karyopherin (importin) beta 1

BX648521 Tubulin, beta, 2

AK091845 Cysteine-rich protein 2

AF208227 Nuclear receptor coactivator 6

M26880 ubiquitin C

NM_005676 RNA binding motif protein 10

AK074456 Eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa

NM_207037 Transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)

BC047486 F-box and leucine-rich repeat protein 11

BC047486 F-box and leucine-rich repeat protein 11

BC047486 F-box and leucine-rich repeat protein 11

AK091411 Heterogeneous nuclear ribonucleoprotein H3 (2H9) NIVM 39276 Signal transducer and activator of transcription 3 (acute-phase response factor)

NM_139276 Signal transducer and activator of transcription 3 (acute-phase response factor)

U40763 Peptidyl-prolyl isomerase G (cyclophilin G)

U40763 Peptidyl-prolyl isomerase G (cyclophilin G)

U40763 Peptidyl-prolyl isomerase G (cyclophilin G)

BC003159 Polymerase (RNA) Il (DNA directed) polypeptide C, 33kDa

AK025742 Uncoupling protein 2 (mitochondrial, proton carrier)

AF179995 Septin 8

AF179995 Septin 8

AK001285 Anaphase promoting complex subunit 13

AF370415 Kl AA1536 protein

BC016473 Solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11

NM_033535 F-box and leucine-rich repeat protein 5

NM_033535 F-box and leucine-rich repeat protein 5

BC041843 NPD014 protein

BC041843 NPD014 protein

CR607281 Keratin 8

AK021825 Esterase D/formylglutathione hydrolase

NM_007118 Triple functional domain (PTPRF interacting)

NM_007118 Triple functional domain (PTPRF interacting)

NM_001005333 Melanoma antigen, family D, 1

AL832124 DnaJ (Hsp40) homolog, subfamily B, member 6

AK128505 Keratin 7

U02389 Protease, serine, 15

AK172749 PTEN induced putative kinase 1

AK172749 PTEN induced putative kinase 1

AL133000 Chromosome 20 open reading frame 111

NM_014741 KIAA0652 gene product

CR627425 Stromal antigen 2

CR627425 Stromal antigen 2

BC032643 Synaptotagmin binding, cytoplasmic RNA interacting protein

BC032643 Synaptotagmin binding, cytoplasmic RNA interacting protein

AK098772 Beta 5-tubulin

AK126803 Abl-interactor 1

AK126803 Abl-interactor 1

CR605577 COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)

D86550 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A

NM_006813 Proline-rich nuclear receptor coactivator 1

BM473044 Midkine (neurite growth-promoting factor 2)

AK128072 Malate dehydrogenase 2, NAD (mitochondrial)

AK124613 EH-domain containing 1

AK124613 EH-domain containing 1

AK124613 EH-domain containing 1

BM466221 Proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)

AK122700 Ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)

AK122700 Ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)

NM_005443 3'-phosphoadenosine 5'-phosphosulfate synthase 1

AK097315 Splicing factor 3b, subunit 4, 49kDa BX537682 X-prolyl aminopeptidase (aminopeptidase P) 1 , soluble

BC040312 GABA(A) receptor-associated protein-like 2

NM_183047 Protein kinase C binding protein 1

BC001004 protein kinase C binding protein 1

AB037729 RaI guanine nucleotide dissociation stimulator

NM_014919 Wolf-Hirschhom syndrome candidate 1

NM_014919 Wolf-Hirschhom syndrome candidate 1

AW268817 CDC5 cell division cycle 5-like (S. pombe)

AW268817 CDC5 cell division cycle 5-like (S. pombe)

AB007892 CDC5 cell division cycle 5-like (S. pombe)

AK125725 Endothelial differentiation-related factor 1

AK125725 Endothelial differentiation-related factor 1

NM_181659 Nuclear receptor coactivator 3

NM_181659 Nuclear receptor coactivator 3

NM_181659 Nuclear receptor coactivator 3

XM_371024 Similar to poly(A) binding protein interacting protein 1 isoform 1; polyadenylate binding protein-interacting protein 1; PABC1-interacting protein 1

NM_006451 PoIy(A) binding protein interacting protein 1

BC041005 Ubiquinol-cytochrome c reductase binding protein

BC041005 Ubiquinol-cytochrome c reductase binding protein

NM_005463 Heterogeneous nuclear ribonucleoprotein D-like

NM_005463 Heterogeneous nuclear ribonucleoprotein D-like

BX537379 H3 histone, family 3B (H3.3B)

NM_003617 Regulator of G-protein signalling 5 NM_001005743 Numb homolog (Drosophila)

AK057251 Iron-sulfur cluster assembly enzyme

NM_019613 WDR45-like

AL022313 thioredoxin 2

AK123361 Thioredoxin 2

AB002325 Protocadherin gamma subfamily C, 3

AJ010841 Thioredoxin-like 2

AF018081 Collagen, type XVIII, alpha 1

AF018081 Collagen, type XVIII, alpha 1

L14922 replication factor C (activator 1) 1, 145kDa

L14922 replication factor C (activator 1 ) 1 , 145kDa

AF108461 Ubinuclein 1

NMJ304162 RAB5A, member RAS oncogene family

AL049597 SH3-domain GRB2-like endophilin B1

AB007960 SH3-domain GRB2-like endophilin B1

AK001488 Chromosome 17 open reading frame 25

M16328 Glucosidase, beta; acid (includes glucosylceramidase)

AL078459 dimethylarginine dimethylaminohydrolase 1

NM_000108 Dihydrolipoamide dehydrogenase (E3 component of pyruvate dehydrogenase complex, 2- oxo-glutarate complex, branched chain keto acid dehydrogenase complex)

AK094617 Ubiquitin-conjugating enzyme E2 variant 2

AF003837 Jagged 1 (Alagille syndrome)

AF003837 Jagged 1 (Alagille syndrome)

Y12395 Interferon-related developmental regulator 2 NM_001901 Connective tissue growth factor

NM_012257 HMG-box transcription factor 1

BX648483 Ubiquitin fusion degradation 1-like

BQ642604 Nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)

NM_147223 Nuclear receptor coactivator 1

NM_147223 Nuclear receptor coactivator 1

NM_147223 Nuclear receptor coactivator 1

NM_003270 Transmembrane 4 superfamily member 6

NM_003270 Transmembrane 4 superfamily member 6

BC040989 RaI guanine nucleotide dissociation stimulator-like 2

BM667062 Ring finger protein 5

NM_004064 Cyclin-dependent kinase inhibitor 1 B (p27, Kip1 )

AF370429 High-mobility group 2OB

AK097164 Ubiquitin-activating enzyme E1C (UBA3 homolog, yeast)

U79458 WW domain binding protein 2

BM994522 Tubulin, alpha 3

AV703465 nuclear receptor subfamily 2, group F, member 2

AV703465 nuclear receptor subfamily 2, group F, member 2

BC042897 Nuclear receptor subfamily 2, group F, member 2

NM_001122 Adipose differentiation-related protein

AK124952 Quinoid dihydropteridine reductase

AK124685 Myeloid differentiation primary response gene (88)

AB020880 Squamous cell carcinoma antigen recognised by T cells 3

AB020880 Squamous cell carcinoma antigen recognised by T cells 3

CR749505 Thyroid hormone receptor interactor 6

BC022890 Synaptosomal-associated protein, 23kDa

BC022890 Synaptosomal-associated protein, 23kDa

AK124968 COMM domain containing 4

BM994553 Ribosomal protein S6

NM_032468 Aspartate beta-hydroxylase

AK055375 Ubiquitin specific protease 10

AK055375 Ubiquitin specific protease 10

AK128542 Protein kinase, interferon-inducible double stranded RNA dependent activator

AK124160 Major histocompatibility complex, class I, B

NM_003342 Ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans)

NM_003342 Ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans)

BU729579 Chloride channel, nucleotide-sensitive, 1A

CR623543 Sterol-C4-methyl oxidase-like

AK124204 Phosphatide acid phosphatase type 2A

NM_021976 Retinoid X receptor, beta

BX161390 Transmembrane 9 superfamily member 1

BX161390 Transmembrane 9 superfamily member 1

NM_003200 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)

NM_003200 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)

NM_003200 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)

AK001327 Taxi (human T-cell leukemia virus type I) binding protein 3

BX648078 5'-nucleotidase, cytosolic Il

AK128695 Collagen, type Vl, alpha 2 BC015809 DnaJ (Hsp40) homolog, subfamily A, member 2

BC036615 Hypothetical protein LOC284356

BQ939577 Aldo-keto reductase family 1 , member C3 (3-alpha hydroxysteroid dehydrogenase, type II)

NM_004697 PRP4 pre-mRNA processing factor 4 homolog (yeast)

NM_004697 PRP4 pre-mRNA processing factor 4 homolog (yeast)

AK095244 Cytochrome b-561

AK095244 Cytochrome b-561

AK057229 Apoptosis antagonizing transcription factor

U68382 Mannosidase, alpha, class 2B, member 1

BM698821 lnosine triphosphatase (nucleoside triphosphate pyrophosphatase)

NM_016343 Centromere protein F, 350/400ka (mitosin)

NM_017730 FLJ20259 protein

BX649119 SEC23 interacting protein

BX649119 SEC23 interacting protein

NM_199417 Nuclear protein E3-3

NM_014003 DEAH (Asp-Glu-Ala-His) box polypeptide 38

AK123290 Leukocyte receptor cluster (LRC) member 4

AK128861 Rab geranylgeranyltransferase, beta subunit

AK128861 Rab geranylgeranyltransferase, beta subunit

AB022718 Chromosome 10 open reading frame 10

AB022718 Chromosome 10 open reading frame 10

BF700086 insulin receptor substrate 2

NM_003749 Insulin receptor substrate 2

BX648282 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2

NM_001938 Down-regulator of transcription 1 , TBP-binding (negative cofactor 2)

NM_001938 Down-regulator of transcription 1 , TBP-binding (negative cofactor 2)

BX647104 V-fos FBJ murine osteosarcoma viral oncogene homolog

NM_005219 Diaphanous homolog 1 (Drosophila)

AK092677 Tubulin beta MGC4083

NM_002648 Pim-1 oncogene

BG567463 Centrin, EF-hand protein, 2

NM_015270 Adenylate cyclase 6

AF447870 Chromosome 6 open reading frame 11

NM_152280 Synaptotagmin Xl

NM_152280 Synaptotagmin Xl

AL833268 MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C)

CR749646 Exostoses (multiple)-like 3

BC002327 ribosomal protein L30

NM_006769 LIM domain only 4

NM_006769 LIM domain only 4

AV701283 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)

AK023270 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)

BM542186 Mannose-P-dolichol utilization defect 1

CR749486 Pleckstrin homology domain containing, family C (with FERM domain) member 1

CR749486 Pleckstrin homology domain containing, family C (with FERM domain) member 1

AF132818 Kruppel-like factor 5 (intestinal)

AF132818 Kruppel-like factor 5 (intestinal)

BM810059 Carbonyl reductase 1 BX648769 Ewing sarcoma breakpoint region 1

D44658 Tetracycline transporter-like protein

BC035979 WD repeat domain 45

BC035979 WD repeat domain 45

BX647605 Squalene epoxidase

BC011600 RD RNA binding protein

NM_144498 Oxysterol binding protein-like 2

NM_144498 Oxysterol binding protein-like 2

BM703525 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa

AK124768 Transportin 1

AK124768 Transportin 1

BX641112 Tumor suppressor candidate 3

BX641112 Tumor suppressor candidate 3

AB029038 KIAA1115

BQ010652 P8 protein (candidate of metastasis 1 )

AK126469 Dynactin 4

AK126469 Dynactin 4

AK026468 C2f protein

NM_015074 Kinesin family member 1 B

BE966922 syntaxin 3A

NM_003998 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 (p105)

NM_003605 O-linked N-acetylglucosamine (GIcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-

N-acetylglucosaminyl transferase)

BC034673 Misshapen/NIK-related kinase

AL042588 paternally expressed 3

AB014606 Kinesin family member 1C

NM_007189 ATP-binding cassette, sub-family F (GCN20), member 2

NM_014394 Growth hormone inducible transmembrane protein

NM_014394 Growth hormone inducible transmembrane protein

NMJ303676 Degenerative spermatocyte homolog, lipid desaturase (Drosophila)

BM911034 Tubulin alpha 6

NM_012208 Histidyl-tRNA synthetase-like

BC067260 Vinexin beta (SH3-containing adaptor molecule-1)

D87454 KIAA0265 protein

D87454 KIAA0265 protein

D87454 KIAA0265 protein

AF020043 Chondroitin sulfate proteoglycan 6 (bamacan)

AF020043 Chondroitin sulfate proteoglycan 6 (bamacan)

AF020043 Chondroitin sulfate proteoglycan 6 (bamacan)

BC002669 Nuclear receptor subfamily 2, group F, member 6

AK126635 Transmembrane 4 superfamily member 7

AK126635 Transmembrane 4 superfamily member 7

AK097873 Methyltransferase like 3

NM_022154 Solute carrier family 39 (zinc transporter), member 8

BC028382 Vacuolar protein sorting 45A (yeast)

AB032251 fetal Alzheimer antigen

AF045451 NGFI-A binding protein 1 (EGR1 binding protein 1)

NM_030940 HESB like domain containing 2 NM_030940 HESB like domain containing 2

AK090709 Ceroid-lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)

AK125636 Glutaredoxin (thioltransferase)

AK129833 Tissue factor pathway inhibitor 2

AK129833 Tissue factor pathway inhibitor 2

AK026549 NAD(P) dependent steroid dehydrogenase-like

AB014609 Mannose receptor, C type 2

NM_001001323 ATPase, Ca++ transporting, plasma membrane 1

AK095884 Protein kinase D2

BU734674 Crystallin, alpha B

AF180425 Retinoblastoma-associated protein 140

AF180425 Retinoblastoma-associated protein 140

NM_006449 CDC42 effector protein (Rho GTPase binding) 3

NM_006449 CDC42 effector protein (Rho GTPase binding) 3

NM_006449 CDC42 effector protein (Rho GTPase binding) 3

BX537698 Nuclear factor I/B

BX537698 Nuclear factor I/B

BM701438 Inhibitor of DNA binding 4, dominant negative helix-loop-helix protein

BM701438 Inhibitor of DNA binding 4, dominant negative helix-loop-helix protein

NM_003842 Tumor necrosis factor receptor superfamily, member 10b

NM_177968 Protein phosphatase 1 B (formerly 2C), magnesium-dependent, beta isoform

AF064244 lntersectin 1 (SH3 domain protein)

AF064244 lntersectin 1 (SH3 domain protein)

AK094805 DKFZP566B 183 protein

CR590527 Polymerase (RNA) Il (DNA directed) polypeptide H

AB062482 NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase)

AK129595 Growth arrest and DNA-damage-indυcible, beta

AK129595 Growth arrest and DNA-damage-inducible, beta

AB014540 SWAP-70 protein

AB014540 SWAP-70 protein

AK125533 BCL2/adenovirus E1B 19kDa interacting protein 2

AL050391 Caspase 4, apoptosis-related cysteine protease

NM_004050 BCL2-like 2

BU729752 XPA binding protein 1

NM_006620 HBS1-like (S. cerevisiae)

NM_006620 HBS1-like (S. cerevisiae)

CR613447 Polymerase (RNA) I polypeptide C, 3OkDa

CR749329 Pleomorphic adenoma gene-like 1

AK128334 Adenylate cyclase 3

AK128334 Adenylate cyclase 3

AB037720 SH2-B homolog

BX641144 Protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of

(P58 repressor)

D84454 Solute carrier family 35 (UDP-galactose transporter), member A2

BC000587 hypothetical protein MGC2198

AL832723 Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1 , 37kDa)

BC036092 MAX protein

BC036092 MAX protein NM_002813 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9

NM_001920 Decorin

BX649155 PC4 and SFRS1 interacting protein 1

U03494 Transcription factor CP2

NM_005067 Seven in absentia homolog 2 (Drosophila)

NM_003115 UDP-N-acteylglucosamine pyrophosphorylase 1

NM_001556 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta

NM_001556 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta

AK056565 Tropomyosin 4

NM_018425 Phosphatidylinositol 4-kinase type Il

BC081542 V-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)

U63139 RAD50 homolog (S. cerevisiae)

AL157493 G protein pathway suppressor 2

BC042437 Keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)

AY706204 SIN3 homolog B, transcriptional regulator (yeast)

AK 124010 Tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)

AF480883 Phosphatidic acid phosphatase type 2B

AK098186 EGF-containing fibulin-like extracellular matrix protein 2

NM_006079 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2

BX647568 TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa

NM_001001890 Runt-related transcription factor 1 (acute myeloid leukemia 1; aml1 oncogene)

NM_020418 Poly(rC) binding protein 4

NM_004264 SRB7 suppressor of RNA polymerase B homolog (yeast)

NM_004264 SRB7 suppressor of RNA polymerase B homolog (yeast)

AK023420 BCL2-antagonist of cell death

AK097205 Extracellular matrix protein 1

BM714384 Cytochrome b-5

AK098000 Syntaxin binding protein 2

CR601701 Annexin A3

BM470828 Tubulin, beta polypeptide

AK125647 BENE protein

NM_004628 Xeroderma pigmentosum, complementation group C

NM_004719 Splicing factor, arginine/serine-rich 2, interacting protein

BX648085 High mobility group nucleosomal binding domain 3

AF241785 KIAA1128

AF241785 KIAA1128

AF146074 ATP-binding cassette, sub-family C (CFTR/MRP), member 5

BM562780 Splicing factor 3a, subunit 2, 66kDa

BC002586 Polymerase (RNA) III (DNA directed) polypeptide C (62kD)

S62138 DNA-damage-inducible transcript 3

NM_007198 Proline synthetase co-transcribed homolog (bacterial)

NM_007198 Proline synthetase co-transcribed homolog (bacterial)

AL832780 Transmembrane 4 superfamily member 1

M90657 transmembrane 4 superfamily member 1

NM_032632 PoIy(A) polymerase alpha

BQ278412 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)

NM_000368 Tuberous sclerosis 1

CR625100 Dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit AK124910 Ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin)

AK027239 Eukaryotic translation initiation factor 4E member 2

BC010089 Acetylserotonin O-methyltransferase-like

BC000147 Malic enzyme 2, NAD(+)-dependent, mitochondrial

BC002649 histone 1 , H1c

D87328 Holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)

NM_005072 Solute carrier family 12 (potassium/chloride transporters), member 4

NM_005072 Solute carrier family 12 (potassium/chloride transporters), member 4

BC047739 TBC1 domain family, member 3

NM_181836 CGI-109 protein

AK124890 Family with sequence similarity 3, member A

AK023735 BCL2-associated athanogene 2

BX648503 Deformed epidermal autoregulatory factor 1 (Drosophila)

NM_006845 Kinesin family member 2C

D86962 Growth factor receptor-bound protein 10

D86962 Growth factor receptor-bound protein 10

AW008018 golgi associated, gamma adaptin ear containing, ARF binding protein 3

NM_003274 Transmembrane protein 1

AK095873 UDP-Gal:betaGlcNAc beta 1 ,4- galactosyltransferase, polypeptide 2

AB033068 Fizzy/cell division cycle 20 related 1 (Drosophila)

AB033068 Fizzy/cell division cycle 20 related 1 (Drosophila)

BU733169 Interferon-induced protein 35

AB023200 Chromosome 22 open reading frame 19

CR615854 Sphingomyelin phosphodiesterase 1 , acid lysosomal (acid sphingomyelinase)

NM_000251 MutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)

AL109965 chromosome 20 open reading frame 104

NM_016436 Chromosome 20 open reading frame 104

CR616479 Alpha-methylacyl-CoA racemase

CR616479 Alpha-methylacyl-CoA racemase

CR616479 Alpha-methylacyl-CoA racemase

AK128627 Smoothelin

AK124141 Zinc finger protein-like 1

CR616878 Eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa

NM_003972 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 17OkDa (Mot1 homolog,

S. cerevisiae)

NM_014323 Zinc finger protein 278

NM_006368 CAMP responsive element binding protein 3

NM_002703 Phosphoribosyl pyrophosphate amidotransferase

NM_002703 Phosphoribosyl pyrophosphate amidotransferase

BC000265 rho/rac guanine nucleotide exchange factor (GEF) 2

AL096700 phosphorylase kinase, alpha 2 (liver)

NMJ300292 Phosphorylase kinase, alpha 2 (liver)

NM_002764 Phosphoribosyl pyrophosphate synthetase 1

NM_020987 Ankyrin 3, node of Ranvier (ankyrin G)

NM_021159 RAP1 , GTP-GDP dissociation stimulator 1

AK001665 Hypothetical protein FLJ 10803

NM_182961 Spectrin repeat containing, nuclear envelope 1 NM_006410 HIV-1 Tat interactive protein 2, 3OkDa

BM470590 LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)

AK054823 O-sialoglycoprotein endopeptidase

NM_004180 TRAF family member-associated NFKB activator

BC042390 Vesicle transport through interaction with t-SNAREs homolog 1 B (yeast)

NM_003047 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)

AF142482 TEA domain family member 3

NM_012300 F-box and WD-40 domain protein 11

NM_012300 F-box and WD-40 domain protein 11

NM_004419 Dual specificity phosphatase 5

NM_020686 4-aminobutyrate aminotransferase

NM_020686 4-aminobutyrate aminotransferase

BM926633 WD repeat domain 18

BF217719 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 2OkDa

CR624136 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)

CR624136 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)

BX648559 MAP kinase interacting serine/threonine kinase 1

AF077820 Low density lipoprotein receptor-related protein 5

BC037295 Famesyltransferase, CAAX box, alpha

CR627392 Kynurenine aminotransferase III

AF106069 Ubiquitin specific protease 15

NM 030755 Thioredoxin domain containing

BQ059597 Emerin (Emery-Dreifuss muscular dystrophy)

BM906370 Stimulated by retinoic acid 13

AK092592 Chromosome 6 open reading frame 80

AF226044 SNF-1 related kinase

BM718048 Processing of precursor 7, ribonuclease P subunit (S. cerevisiae)

AF255793 DKFZP566O1646 protein

BX647893 Oxysterol binding protein-like 1A

AK026909 Disrupter of silencing 10

AK124859 RNA binding protein with multiple splicing

AK124859 RNA binding protein with multiple splicing

BF037182 Transcribed locus

NM_138934 Palmitoyl-protein thioesterase 2

BU858880 ATP synthase, H+ transporting, mitochondrial FO complex, subunit e

NM_014323 Zinc finger protein 278

NM_007186 Centrosomal protein 2

AK095158 RNA binding motif protein 30

BC017503 Cerebellar degeneration-related protein 2, 62kDa

AK098403 BAM -associated protein 2

AF035309 proteasome (prosome, macropain) 26S subunit, ATPase, 5

NM_005654 Nuclear receptor subfamily 2, group F, member 1

NM_005654 Nuclear receptor subfamily 2, group F, member 1

BF217712 Replication protein A3, 14kDa

NM_001382 Dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1

(GlcNAc-1-P transferase)

NM_007218 Ring finger protein 139 AL832562 Polymerase (RNA) Il (DNA directed) polypeptide F

AY093428 Chromosome 9 open reading frame 99

AY093428 Chromosome 9 open reading frame 99

NM_004580 RAB27A, member RAS oncogene family

NM_004580 RAB27A, member RAS oncogene family

BC073806 SMYD family member 5

BC015936 Ash2 (absent, small, or homeotic)-like (Drosophila)

NM_003076 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1

D32002 Nuclear cap binding protein subunit 1 , 8OkDa

NM_000755 Carnitine acetyltransferase

NM_003184 TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 15OkDa

AL133102 Hepatoma-derived growth factor, related protein 3

AL133102 Hepatoma-derived growth factor, related protein 3

AL133102 Hepatoma-derived growth factor, related protein 3

AK092727 Exosome component 2

AK023912 KIAA0683 gene product

NM_001513 Glutathione transferase zeta 1 (maleylacetoacetate isomerase)

AJ238243 Phospholipase A2-activating protein

NM_006738 A kinase (PRKA) anchor protein 13

AF127481 A kinase (PRKA) anchor protein 13

AF320070 EH-domain containing 4

BC045681 Exostoses (multiple)-like 2

BQ214781 Zinc finger protein 32 (KOX 30)

BC039856 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6

AY358814 Receptor-interacting serine-threonine kinase 2

NM_145343 Apolipoprotein L, 1

BU734722 Deoxyguanosine kinase

NM_002487 Necdin homolog (mouse)

AK098486 Hypothetical protein MGC11061

BX647915 Kl <\A0804 protein

CR749465 CD36 antigen (collagen type I receptor, thrombospondin receptor)

BC024592 Neurochondrin

NM_007112 Thrombospondin 3

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

BM924989 Zinc finger protein 183 (RING finger, C3HC4 type)

BX647805 Insulin induced gene 2

NM_015169 RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)

AF186780 RaI guanine nucleotide dissociation stimulator-like 1

BC034227 DNA segment on chromosome 4 (unique) 234 expressed sequence

CR611416 CBF1 interacting corepressor

NIVM52991 Embryonic ectoderm development

NM_001003674 Chromosome 18 open reading frame 1

AK124057 I nterleukin 10 receptor, beta

BC026326 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1

AK093328 Phosphate cyBdylyltransferase 2, ethanolamine

NM_015227 Protein O-fucosyltransferase 2

AF072250 Methyl-CpG binding domain protein 4 AF072250 Methyl-CpG binding domain protein 4

BQ931456 HRAS-like suppressor 3

NM_001004196 CD200 antigen

AK094570 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3C

AL050356 Multiple inositol polyphosphate histidine phosphatase, 1

AF051907 TcD37 homolog

NM_014506 Torsin family 1 , member B (torsin B)

M94890 Pregnancy specific beta-1 -glycoprotein 9

CR609785 General transcription factor MF, polypeptide 2, 3OkDa

AF245505 Adlican

XM_376764 Paraneoplastic antigen MA2

AF051907 TcD37 homolog

BC008767 Acyl-Coenzyme A oxidase 1 , palmitoyl

CR592939 Thiosulfate sulfurtransferase (rhodanese)

AK122733 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3

BQ057453 Acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)

NM_031420 Mitochondrial ribosomal protein L9

BQ054939 Transcribed locus

BX641105 Alcohol dehydrogenase IB (class I), beta polypeptide

BX641105 Alcohol dehydrogenase IB (class I), beta polypeptide

BX641105 Alcohol dehydrogenase IB (class I), beta polypeptide

NM_002576 P21/Cdc42/Rac1 -activated kinase 1 (STE20 homolog, yeast)

AB005289 ATP-binding cassette, sub-family B (MDR/TAP), member 7

BX648290 PDZ and LIM domain 3

AK094987 Methylcrotonoyl-Coenzyme A carboxylase 2 (beta)

BC071849 Phosphatidylinositol glycan, class H

NM_145323 Oxysterol binding protein-like 3

NM_145323 Oxysterol binding protein-like 3

NM_018698 Nuclear transport factor 2-like export factor 2

NM_018698 Nuclear transport factor 2-like export factor 2

AK095377 F-box and WD-40 domain protein 2

U87460 F-box and WD-40 domain protein 2

NM_002718 Protein phosphatase 2 (formerly 2A), regulatory subunit B", alpha

NM_002718 Protein phosphatase 2 (formerly 2A)1 regulatory subunit B", alpha

BU729913 Adaptor-related protein complex 1 , sigma 1 subunit

NM_033238 Promyelocytic leukemia

AF038440 Phospholipase D2

BM719878 Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)

NM_000692 Aldehyde dehydrogenase 1 family, member B1

NMJD00692 Aldehyde dehydrogenase 1 family, member B1

NM_144949 Suppressor of cytokine signaling 5

NM_144949 Suppressor of cytokine signaling 5

NM_005843 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

AK122975 Transforming growth factor beta 1 induced transcript 1

AK023843 Placental growth factor, vascular endothelial growth factor-related protein

NM_002268 Karyopherin alpha 4 (importin alpha 3)

XM_029101 KIAA0947 protein

BC039242 Transmembrane 4 superfamily member 10 BC039242 Transmembrane 4 superfamily member 10

NM_004506 Heat shock transcription factor 2

AK095082 CDC16 cell division cycle 16 homolog (S. cerevisiae)

AK095082 CDC16 cell division cycle 16 homolog (S. cerevisiae)

BF218841 Centrin, EF-hand protein, 3 (CDC31 homolog, yeast)

BX641103 Cytochrome b-561 domain containing 2

AL133012 Conserved helix-loop-helix ubiquitous kinase

BF033242 carboxylesterase 2 (intestine, liver)

NM_003869 Carboxylesterase 2 (intestine, liver)

AK074970 PA1-1 mRNA-binding protein

AK125915 Cryptochrome 1 (photolyase-like)

NM_007040 Heterogeneous nuclear ribonucleoprotein U-like 1

AL080215 Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)

NM_002740 Protein kinase C, iota

NM_002740 Protein kinase C, iota

BC045658 Hypothetical protein from clone 643

AJ237724 Solute carrier family 19 (thiamine transporter), member 2

CR627153 Cas-Br-M (murine) ecotropic retroviral transforming sequence b

NM_018993 Ras and Rab interactor 2

BX647204 Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1 )

AK124683 Hypothetical protein FLJ 10996

AK124683 Hypothetical protein FLJ10996

CR610258 Docking protein 4

CR610258 Docking protein 4

NM_198187 Astrotactin 2

BG249563 6-pyruvoyltetrahydropterin synthase

AK128380 Protein tyrosine phosphatase type IVA, member 3

NM_000507 Fructose-1 ,6-bisphosphatase 1

AK091128 Aldo-keto reductase family 1 , member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type 111)

AB042555 FLJ39739 protein

NM_173060 Calpastatin

XM_051200 Fatso

AJ010014 Likely ortholog of mouse metal response element binding transcription factor 2

NM_006167 NK3 transcription factor related, locus 1 (Drosophila)

BX648473 Phosphatidylinositol glycan, class K

CR624520 Monooxygenase, DBH-like 1

AF032862 Hyaluronan-mediated motility receptor (RHAMM)

AK127845 GATA binding protein 2

D87449 Solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1

D87449 Solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1

BQ056337 Cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase)

CR605673 Chromobox homolog 5 (HP1 alpha homolog, Drosophila)

M37435 colony stimulating factor 1 (macrophage)

AF008915 Ecotropic viral integration site 5

BX648701 HOM-TES-103 tumor antigen-like NM_004155 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9

NM_003409 Zinc finger protein 161 homolog (mouse)

AY358967 Carbonic anhydrase Xl

AK122829 Growth arrest-specific 2 like 1

BQ067653 Nth endonuclease Ill-like 1 (E. coli)

NM_005127 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2

(activation-induced)

AL034399 hypothetical protein LOC286440

NM_012301 Atrophin-1 interacting protein 1

BC020652 Pregnancy specific beta-1 -glycoprotein 6

NM_004650 Patatin-like phospholipase domain containing 4

AB040887 Zinc finger protein 291

NM_031483 Itchy homolog E3 ubiquitin protein ligase (mouse)

BC043272 Coenzyme Q7 homolog, ubiquinone (yeast)

NM_014946 Spastic paraplegia 4 (autosomal dominant; spastin)

BC070035 Nuclear receptor subfamily 1, group D, member 2

AF291676 hypothetical protein FLJ31100

BC050383 Thymopoietin

BC050383 Thymopoietin

AF288395 Nicotinamide nucleotide adenylyltransferase 2

NM_003480 Microfibrillar associated protein 5

CR600516 Dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)

AL136932 KIAA0922 protein

AK128274 SP110 nuclear body protein

AK128274 SP110 nuclear body protein

Y13786 A disintegrin and metalloproteinase domain 19 (meltrin beta)

AF118073 peroxiredoxin 3

L20860 Glycoprotein Ib (platelet), beta polypeptide

BC065567 Butyrophilin, subfamily 3, member A1

AK123010 Ribonucleotide reductase M2 polypeptide

BC053653 Chemokine (C-X-C motif) ligand 2

Y12490 Thyroid hormone receptor interactor 11

AL831969 Putative homeodomain transcription factor 2

BX537666 KH domain containing, RNA binding, signal transduction associated 3

BM470972 D site of albumin promoter (albumin D-box) binding protein

NM_006353 High mobility group nucleosomal binding domain 4

NM_006353 High mobility group nucleosomal binding domain 4

AB011097 Type 1 tumor necrosis factor receptor shedding aminopeptidase regulator

AK124711 Coronin, actin binding protein, 2B

NM_001226 Caspase 6, apoptosis-related cysteine protease

BM993001 Transmembrane protein 4

BM993001 Transmembrane protein 4

D83243 Nuclear protein, ataxia-telangiectasia locus

NM_206907 Protein kinase, AMP-activated, alpha 1 catalytic subunit

BM914760 Pleckstrin homology-like domain, family A, member 2

BM914760 Pleckstrin homology-like domain, family A, member 2

BC031832 PMS2 postmeiotic segregation increased 2 (S. cerevisiae)

BU500887 Histone 1, H2bk BX537794 Nuclear factor I/X (CCAAT-binding transcription factor)

NM_198219 Inhibitor of growth family, member 1

AJ006591 Zinc finger protein 330

NM_000264 Patched homolog (Drosophila)

BC028049 Protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)

AK091242 Hyaluronan binding protein 4

AK095076 Transducin (beta)-like 3

NM_003383 Very low density lipoprotein receptor

BX640859 Uridine-cytidine kinase 2

AB002384 Chromosome 6 open reading frame 32

BC014513 Solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2

AF060222 Deoxyribonuclease II, lysosomal

AL832705 CASP2 and RIPK1 domain containing adaptor with death domain

NM_000610 CD44 antigen (homing function and Indian blood group system)

AF060511 similar to MyO16 protein

BX640759 Adaptor-related protein complex 4, mu 1 subunit

BX648602 Thyroid receptor interacting protein 15

NMJD18334 Leucine rich repeat neuronal 3

AK127030 Makorin, ring finger protein, 1

BC067086 Butyrophilin, subfamily 3, member A2

BC073161 RAD51 homolog C (S. cerevisiae)

BC005406 CDC42 effector protein (Rho GTPase binding) 2

NIVM 76863 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)

NM_176863 Proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)

AK023052 Metallophosphoesterase 1

NM_004034 Annexin A7

AK125296 Methionyl aminopeptidase 2

D42054 Translokin

NM_012083 Frequently rearranged in advanced T-cell lymphomas 2

CR749816 Solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GIcNAc) transporter), member A3

BX648906 RNA binding motif, single stranded interacting protein 1

NM_017649 Cyclin M2

BF698898 Secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)

NM_057169 G protein-coupled receptor kinase interactor 2

BC033522 V-rel reticuloendotheliosis viral oncogene homolog A, nuclear factor of kappa light polypeptide gene enhancer in B-cells 3, p65 (avian)

BC029782 Selectin P ligand

BU624194 Ras-like without CAAX 1

AF288389 Glycosyltransferase 25 domain containing 2

NM_003615 Solute carrier family 4, sodium bicarbonate cotransporter, member 7

BF684890 Ras homolog gene family, member D

BX649011 Transmembrane 4 superfamily member 9 NM_001003679 Leptin receptor

AF119855 protein tyrosine phosphatase, non-receptor type 11 (Noonan syndrome 1 )

AF119855 protein tyrosine phosphatase, non-receptor type 11 (Noonan syndrome 1)

AF055585 Slit homolog 2 (Drosophila)

NM_006277 lntersectin 2

AF114818 Fuse-binding protein-interacting repressor NM_003051 Solute carrier family 16 (monocarboxylic acid transporters), member 1

NM_001184 Ataxia telangiectasia and Rad3 related

NM_001184 Ataxia telangiectasia and Rad3 related

NM_006277 lntersectin 2

M19154 Transforming growth factor, beta 2

BC042589 Histone 1 , H2bd

AB007875 Forkhead box K1

AB007875 Forkhead box K1

NM_018706 Dehydrogenase E1 and transketolase domain containing 1

BC068535 TP53 activated protein 1

BC035341 Gamma-glutamyltransferase 1

NM_001204 Bone morphogenetic protein receptor, type Il (serine/threonine kinase)

NM_014331 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11

AK095230 DKF2P547E1010 protein

BC067827 Musculin (activated B-cell factor-1 )

NM_003639 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma

AK026273 FK506 binding protein 1B, 12.6 kDa

NMJD01948 DUTP pyrophosphatase

NM_014382 ATPase, Ca++ transporting, type 2C, member 1

NM_014382 ATPase, Ca++ transporting, type 2C, member 1

AF091263 RNA binding motif protein 5

NMJ303879 CASP8 and FADD-like apoptosis regulator

NM_001003935 Poly (ADP-ribose) polymerase family, member 3

AK096523 Receptor (TNFRSF)-interacting serine-threonine kinase 1

BC032641 F-box and leucine-rich repeat protein 4

BC034973 Zinc finger protein 410

BX640779 Glycogen synthase kinase 3 beta

NM_005429 Vascular endothelial growth factor C

NM_014847 Ubiquitin associated protein 2-like

NM_007065 CDC37 cell division cycle 37 homolog (S. cerevisiae)

NM_005637 Synovial sarcoma translocation, chromosome 18

BX648358 Fibroblast activation protein, alpha

X16323 hepatocyte growth factor (hepapoietin A; scatter factor)

BX647297 RAD51 -like 3 (S. cerevisiae)

D14826 cAMP responsive element modulator

NM_007315 Signal transducer and activator of transcription 1 , 91 kDa

CR592117 Caspase 1 , apoptosis-related cysteine protease (interleukin 1 , beta, convertase)

AF116615 JTVI gene

AF116615 JTVI gene

BX647392 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast)

NM_000773 Cytochrome P450, family 2, subfamily E, polypeptide 1

AL023553 ortholog of rat pippin

AB037901 Jumonji domain containing 2C

AF317549 Zinc finger protein 268

AF056085 G protein-coupled receptor 51

AL833956 Phosphatidylinositol glycan, class O

AK127621 Suppressor of cytokine signaling 1

X95701 GATA binding protein 6 BC022295 Oxidised low density lipoprotein (lectin-like) receptor 1

BC068438 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase

BM696950 DKFZP564O243 protein

BU149479 Mitochondrial ribosomal protein S12

BC034762 Golgi SNAP receptor complex member 2

L75823 Solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1

BX648769 Ewing sarcoma breakpoint region 1

AF023266 isocitrate dehydrogenase 3 (NAD+) beta

NM_006785 Mucosa associated lymphoid tissue lymphoma translocation gene 1

NM_006785 Mucosa associated lymphoid tissue lymphoma translocation gene 1

AK125742 Likely ortholog of mouse nervous system polycomb 1

AK002088 Ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast)

AY028896 Caspase recruitment domain family, member 10

CR611116 APEX nuclease (multifunctional DNA repair enzyme) 1

NM_181837 Origin recognition complex, subunit 3-like (yeast)

BX648424 Ribosomal protein L5

AL117443 Phosphoglucomutase 3

NM_001336 Cathepsin Z

AK127371 Isocitrate dehydrogenase 2 (NADP+), mitochondrial

AK126942 N-ethylmaleimide-sensitive factor attachment protein, gamma

NM_012112 TPX2, microtubule-associated protein homolog (Xenopus laevis)

NM_006951 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 10OkDa

CR749640 Chromosome 4 open reading frame 15

NM_002754 Mitogen-activated protein kinase 13

NM_002754 Mitogen-activated protein kinase 13

BC048798 Zinc finger protein 589

BC032624 Membrane-associated RING-CH protein Il

AK074970 PAM mRNA-binding protein

BC043166 Potassium voltage-gated channel, shaker-related subfamily, beta member 1

NM_003953 Myelin protein zero-like 1

BU736020 Myosin, light polypeptide 4, alkali; atrial, embryonic

BM914866 Mago-nashi homolog, proliferation-associated (Drosophila)

BM914866 Mago-nashi homolog, proliferation-associated (Drosophila)

AF196185 Par-3 partitioning defective 3 homolog (C. elegans)

BX640961 Insulin-like growth factor binding protein 3

AF130102 retinoic acid repressible protein

AB007960 SH3-domain GRB2-like endophilin B1

AY366508 Loss of heterozygosity, 11 , chromosomal region 2, gene A

AK093892 Mediator of RNA polymerase Il transcription, subunit 6 homolog (yeast)

BX537571 FYN oncogene related to SRC, FGR, YES

AK091411 Heterogeneous nuclear ribonucleoprotein H3 (2H9)

D87454 KIAA0265 protein

NM_000195 Hermansky-Pudlak syndrome 1

BC063847 Inversin

BQ216858 Ribosomal protein L39-like

NM_003114 Sperm associated antigen 1

BC022507 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 NM_004263 Sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F

BM474651 Barrier to autointegration factor 1

AK023394 Succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa

BG485598 Chemokine (C-C motif) ligand 11

CR627018 Myelin basic protein

NM_001921 DCMP deaminase

AK094559 Regulator of G-protein signalling 20

AL833462 Peripheral myelin protein 22

AF089750 Flotillin 1

NM_007193 Annexin AIO

AK125705 Chromosome 22 open reading frame 4

M68874 Phospholipase A2, group IVA (cytosolic, calcium-dependent)

BU754005 ATP synthase, H+ transporting, mitochondrial FO complex, subunit d

AF186774 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3

NM_006847 Leukocyte irnmunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4

BC000147 Malic enzyme 2, NAD(+)-dependent, mitochondrial

BC000147 Malic enzyme 2, NAD(+)-dependent, mitochondrial

CR615194 Protein-L-isoaspartate (D-aspartate) O-methyltransferase

BC021287 Platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 3OkDa

NM_006162 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1

BX648290 PDZ and LIM domain 3

AK125834 FUS interacting protein (serine-arginine rich) 1

CR749214 Splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)

AF112222 small EDRK-rich factor 2

BG107659 FK506 binding protein 1A, 12kDa

AK126773 Putative homeodomain transcription factor 1

NM_007366 Phospholipase A2 receptor 1 , 18OkDa

L14723 Pregnancy specific beta-1 -glycoprotein 1

NM_007014 WW domain containing E3 ubiquitin protein ligase 2

AK127325 Bridging integrator 1

AK127325 Bridging integrator 1

NM_004639 HLA-B associated transcript 3

NM_003953 Myelin protein zero-like 1

AK056446 Heat shock 9OkDa protein 1 , alpha

D16474 Mature T-cell proliferation 1

BQ278496 lntegrin beta 4 binding protein

AK125316 RAD1 homolog (S. pombe)

AK160379 Nuclear antigen Sp100

BC052266 Frizzled homolog 2 (Drosophila)

AF031469 Major histocompatibility complex, class l-related

AF031469 Major histocompatibility complex, class l-related

BC003629 Homo sapiens hypothetical gene supported by AK027091 ; AL833005 (LOC348264), mRNA

NM_003011 SET translocation (myeloid leukemia-associated)

NM_002182 lnterleukin 1 receptor accessory protein

NM_003626 Protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein

(liprin), alpha 1

BC068535 TP53 activated protein 1 NM_175898 Hypothetical protein LOC283687

AK056851 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3

CR599886 Adenylosuccinate lyase

BC051716 Rap2 interacting protein x

NM_006410 HIV-1 Tat interactive protein 2, 3OkDa

BX248766 RAD51-like 1 (S. cerevisiae)

BX537641 Culliπ 4B

AK097284 Tumor necrosis factor, alpha-induced protein 8

AK123409 Potassium channel, subfamily K, member 2

AF119043 Tripartite motif-containing 33

NM_032456 BH-protocadherin (brain-heart)

BX648551 Zinc finger, A20 domain containing 2

AB051449 Tara-like protein

AK056928 Adaptor-related protein complex 4, sigma 1 subunit

AK056928 Adaptor-related protein complex 4, sigma 1 subunit

NM_006451 PoIy(A) binding protein interacting protein 1

NM_145342 Mitogen-activated protein kinase kinase kinase 7 interacting protein 2

CR627456 Wilms tumor 1 associated protein

NM_003615 Solute carrier family 4, sodium bicarbonate cotransporter, member 7

NM_003450 Zinc finger protein 174

BC005404 Sec23 homolog B (S. cerevisiae)

AL832262 Peroxisomal membrane protein 3, 35kDa (Zellweger syndrome)

AK122708 Four and a half LIM domains 1

AK122708 Four and a half LIM domains 1

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

NM_004464 Fibroblast growth factor 5

NM_004464 Fibroblast growth factor 5

BQ228222 lntraflagellar transport protein 1FT20

NM_006761 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide

D89377 Msh homeo box homolog 2 (Drosophila)

NM_152300 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52

NM_000337 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)

NM_000337 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)

BM909357 Baculoviral IAP repeat-containing 5 (survivin)

AK022089 Peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor

NM_198055 Zinc finger protein 42 (myeloid-specific retinoic acid-responsive)

NM_001096 ATP citrate lyase

NM_006597 Heat shock 7OkDa protein 8

BC028573 CDC-like kinase 1

AK127286 Spermine oxidase

U43188 E74-like factor 2 (ets domain transcription factor)

NM_033238 Promyelocyte leukemia

NM_001001890 Runt-related transcription factor 1 (acute myeloid leukemia 1 ; aml1 oncogene)

AK127663 Prostaglandin E synthase

AB002325 Protocadherin gamma subfamily C, 3

AK125399 Retinoblastoma binding protein 4

BM712315 Tumor protein D52-like 1 NM_005229 ELK1 , member of ETS oncogene family

BM559272 Sjogren's syndrome nuclear autoantigen 1

BX538296 Tousled-like kinase 1

AB011097 Type 1 tumor necrosis factor receptor shedding aminopeptidase regulator

BC035616 Metaxin 1

NM_016261 Tubulin, delta 1

AF116676 myosin, light polypeptide 4, alkali; atrial, embryonic

CR627440 LAT1-3TM protein

NM_003842 Tumor necrosis factor receptor superfamily, member 10b

AL136727 RAB6C, member RAS oncogene family

AK124299 Protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform

BC040300 Phosphatidylinositol 4-kinase, catalytic, beta polypeptide

AF023265 isocitrate dehydrogenase 3 (NAD+) beta

BF242966 Annexin A2

AK097197 Hepatocyte growth factor-regulated tyrosine kinase substrate

BQ062593 Jumping translocation breakpoint

BC012584 Chaperonin containing TCP1 , subunit 8 (theta)

NM 004600 Sjogren syndrome antigen A2 (6OkDa, ribonucleopratein autoantigen SS-A/Ro)

AF172453 Opioid growth factor receptor

BF698866 ATP synthase, H+ transporting, mitochondrial FO complex, subunit g

NM_004180 TRAF family member-associated NFKB activator

BF206537 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

AL390133 Hypothetical protein FLJ20244

CR624760 Small nuclear RNA activating complex, polypeptide 3, 5OkDa

AK074970 PAI-1 mRNA-binding protein

NM_007363 Non-POL) domain containing, octamer-binding

BC043166 Potassium voltage-gated channel, shaker-related subfamily, beta member 1

M37712 G protein-coupled receptor 125

NM_033536 Cell division cycle 2-like 2

NM_004999 Myosin Vl

AK025177 Mitogen-activated protein kinase kinase 5

AF130095 fibronectin 1

AF119846 Homo sapiens similar to PRO1474 (LOC351982), mRNA

CR617834 Peptidylprolyl isomerase E (cyclophilin E)

CR749333 Neuropilin 1

BX648811 Inhibin, beta A (activin A, activin AB alpha polypeptide)

BC058855 Vascular endothelial growth factor

BC058855 Vascular endothelial growth factor

AK093478 HLA-G histocompatibility antigen, class I, G

NM_005100 A kinase (PRKA) anchor protein (gravin) 12

AK124734 Cadherin 8, type 2

NM_000903 NAD(P)H dehydrogenase, quinone 1

AF078844 metallothionein 1 F (functional)

NM_006001 Tubulin, alpha 2

AK001640 KIAA0738 gene product

AK092779 Chromosome 14 open reading frame 2

CR606056 B9 protein

BC062618 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 NM_006510 Ret finger protein

NM_006904 Protein kinase, DNA-activated, catalytic polypeptide

U46689 Aldehyde dehydrogenase 3 family, member A2

AL832108 C-terminal binding protein 2

NM_004555 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3

CR603310 Cell division cycle 2, G1 to S and G2 to M

NM_134264 WD repeat and SOCS box-containing 1

NM_003879 CASP8 and FADD-like apoptosis regulator

BG165642 S-phase kinase-associated protein 2 (p45)

L36140 RecQ protein-like (DNA helicase Q1-like)

CR749466 Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase)

BC002586 Polymerase (RNA) III (DNA directed) polypeptide C (62kD)

BG121847 Nuclear distribution gene C homolog (A. nidulans)

AK122733 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 3

NM_016733 LIM domain kinase 2

AF412024 Inhibin, beta E

AK091411 Heterogeneous nuclear ribonucleoprotein H3 (2H9)

BC062626 Glucosidase, beta; acid, pseudogene

BF680536 Spermidine/spermine N1-acetyltransferase

NM_003953 Myelin protein zero-like 1

BC060842 Implantation-associated protein

XM_291106 KIAA0232 gene product

NMJ304932 Cadherin 6, type 2, K-cadherin (fetal kidney)

NM_004932 Cadherin 6, type 2, K-cadherin (fetal kidney)

AK092157 Milk fat globule-EGF factor 8 protein

CR609170 Fms-related tyrosine kinase 3 ligand

NM_004881 Tumor protein p53 inducible protein 3

BX648749 Synaptojanin 2

NM_004711 Synaptogyrin 1

AK128047 SEC31-like 1 (S. cerevisiae)

CR749722 RAS p21 protein activator (GTPase activating protein) 1

AK131531 Cyclin-dependent kinase (CDC2-like) 10

NM_006844 UvB (bacterial acetolactate synthase)-like

BC036702 A kinase (PRKA) anchor protein 1

NMJD06302 Glucosidase I

NM_003573 Latent transforming growth factor beta binding protein 4

NM_000421 Keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris)

NM_014458 Kelch-like ECT2 interacting protein

NM_033480 F-box protein 9

NM_004849 APG5 autophagy 5-like (S. cerevisiae)

D84294 Tetratricopeptide repeat domain 3

AK056837 Ribosomal protein L13a

BC036742 Phospholipase A2, group Vl (cytosolic, calcium-independent)

BC016863 Sorting nexin 3

NM_006015 AT rich interactive domain 1 A (SWI- like)

BC034481 Branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)

BX649171 Forkhead box O3A NM_015044 Golgi associated, gamma adaptin ear containing, ARF binding protein 2

AL080215 Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)

AL080215 Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)

AK127364 Chromosome 21 open reading frame 33

BX648258 Chromosome 16 open reading frame 35

NM_002849 Protein tyrosine phosphatase, receptor type, R

NM_005054 RAN binding protein 2-like 1

BC019292 i-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)

BC002629 Homo sapiens transcribed sequence with strong similarity to protein ref:NP_066273.1

(H.sapiens) B-cell CLL/lymphoma 7A; B-cell CLL/lymphoma-7 [Homo sapiens]

AF106069 Ubiquitin specific protease 15

NM_006048 Ubiquitination factor E4B (UFD2 homolog, yeast)

BC001407 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16

AK093425 Siah-interacting protein

NM_014096 Solute carrier family 43, member 3

U13395 WW domain containing oxidoreductase

NM_000961 Prostaglandin I2 (prostacyclin) synthase

BX647152 Tripartite motif-containing 5

AL832657 Ring finger protein 24

U38980 postmeiotic segregation increased 2-like 5

AK127479 Serine protease inhibitor, Kunitz type, 2

NM_002956 Restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)

AF370429 High-mobility group 2OB

AK023706 Amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein

BC069004 Hypothetical protein MGC4771

NM_006499 Lectin, galactoside-binding, soluble, 8 (galectin 8)

BC032018 Translocation associated membrane protein 1

BC036092 MAX protein

NM_001218 Carbonic anhydrase XII

NM_003759 Solute carrier family 4, sodium bicarbonate cotransporter, member 4

AK024887 Inositol 1 ,3,4-triphosphate 5/6 kinase

NM_013994 Discoidin domain receptor family, member 1

BC058880 Regucalcin (senescence marker protein-30)

AF213668 Transcription factor-like 4

BC059394 V-yes-1 Yamaguchi sarcoma viral related oncogene homolog

NM_024408 Notch homolog 2 (Drosophila)

NM_001343 Disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)

BX649155 PC4 and SFRS1 interacting protein 1

BF673978 Proteasome (prosome, macropain) subunit, alpha type, 1

NM_182643 Deleted in liver cancer 1

Y11307 Cysteine-rich, angiogenic inducer, 61

NM_001316 CSE1 chromosome segregation 1-like (yeast)

BF680501 Putative membrane protein NM_001001930 Peroxisome proliferative activated receptor, alpha

AL162047 Nuclear receptor coactivator 4

NM_001229 Caspase 9, apoptosis-related cysteine protease

NM_003200 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)

AK024501 MAX dimerization protein 4 BC028095 Survival of motor neuron protein interacting protein 1

BM719769 Stem cell growth factor; lymphocyte secreted C-type lectin

BX647094 Friend leukemia virus integration 1

AF140507 calcium/calmodulin-dependent protein kinase kinase 2, beta

BU541074 Dehydrogenase/reductase (SDR family) member 7

NM_020150 SARIa gene homolog 1 (S. cerevisiae)

AK128704 CD27-binding (Siva) protein

NM_005387 Nucleoporin 98kDa

BC051294 Maternally expressed 3

AK057153 Putative dimethyladenosine transferase

NM_004731 Solute carrier family 16 (monocarboxylic acid transporters), member 7

D13666 Periostin, osteoblast specific factor

BC000979 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49

AK095244 Cytochrome b-561

NM_005831 Nuclear domain 10 protein

BC043272 Coenzyme Q7 homolog, ubiquinone (yeast)

AF130103 stomatin

AF076838 RAD17 homolog (S. pombe)

BC041991 Single-stranded DNA binding protein 2

AK054688 Paraoxonase 2

AL832108 C-terminal binding protein 2

NM_000020 Activin A receptor type ll-like 1

AK124910 Ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin)

NM_003870 IQ motif containing GTPase activating protein 1

AL833606 Neuropilin 2

U03100 Catenin (cadherin-associated protein), alpha 1 , 102kDa

CR601067 Plasminogen activator, urokinase receptor

AF187554 glucose phosphate isomerase

BX648347 Vacuolar protein sorting 41 (yeast)

AJ007714 Aminoadipate-semialdehyde synthase

NM_005629 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8

NM_000051 Ataxia telangiectasia mutated (includes complementation groups A, C and D)

AK090709 Ceroid-lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease)

AK027031 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)

AB023140 Synovial sarcoma, X breakpoint 2 interacting protein

BX647794 Transcription factor 8 (represses interleukin 2 expression)

M62896 Annexin A2 pseudogene 1

NM_016604 Jumonji domain containing 1B

AB020664 RAB11 family interacting protein 5 (class I)

NM_005864 Embryonal Fyn-associated substrate

AB029037 Trophinin

BC068535 TP53 activated protein 1

NM_032999 General transcription factor II, i

NM_032999 General transcription factor II, i

NM_032468 Aspartate beta-hydroxylase

Y10659 Interleukin 13 receptor, alpha 1

BC002506 Programmed cell death 10 AK024094 Prefoldin 5

BC078169 POM (POM121 homolog, rat) and ZP3 fusion

NM_000850 Glutathione S-transferase M4

NM_000610 CD44 antigen (homing function and Indian blood group system)

XM_496601 Similar to FKSG30

BQ062593 Jumping translocation breakpoint

BC004908 hypothetical protein MGC4655

BX648190 WD repeat domain 1

CR749468 Sialyltransferase 10 (alpha-2,3-sialyltransferase Vl)

NM_000081 Chediak-Higashi syndrome 1

AK074037 Calpain 3, (p94)

AK124204 Phosphatidic acid phosphatase type 2A

NM_002439 MutS homolog 3 (E. coli)

BX648075 Eukaryotic translation initiation factor 3, subunit 8, 110kDa

AK098208 Farnesyl-diphosphate farnesyltransferase 1

NM_004580 RAB27A, member RAS oncogene family

AF052126 Steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4- dehydrogenase alpha 1)

NM_147171 A kinase (PRKA) anchor protein (yotiao) 9

AB018274 Likely ortholog of mouse Ia related protein

NM_020532 Reticulon 4

NM_006256 Protein kinase N2

XM_371835 Inhibitor of Bruton agammaglobulinemia tyrosine kinase

CR749855 Aryl hydrocarbon receptor nuclear translocator-like

BC018128 Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)

NMJ303938 Adaptor-related protein complex 3, delta 1 subunit

CR611266 FAST kinase

AK126020 Phosphofructokinase, muscle

CR620277 Transgelin 2

NM_004315 N-acylsphingosine amidohydrolase (acid ceramidase) 1

NM_002082 G protein-coupled receptor kinase 6

AK160379 Nuclear antigen Sp100

BX648171 Tropomyosin 1 (alpha)

M19267 gb:M19267.1 /DEF=Human tropomyosin mRNA, complete cds. /FEA=mRNA

/DB_XREF=gi:339943 /UG=Hs.77899 tropomyosin 1 (alpha) /FL=gb:M19267.1

AF051907 TcD37 homolog

BC066552 Laminin, alpha 4

BC066552 Laminin, alpha 4

NM_005900 SMAD, mothers against DPP homolog 1 (Drosophila)

NM_001656 Tripartite motif-containing 23

NM_006761 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide

NM_000601 Hepatocyte growth factor (hepapoietin A; scatter factor)

D86962 Growth factor receptor-bound protein 10

BC071555 lnterleukin 6 signal transducer (gp130, oncostatin M receptor)

NM_004613 Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)

AL137634 Aldehyde dehydrogenase 3 family, member B1

AK023456 Zinc finger protein 271 NM_033238 Promyelocytic leukemia

NM_033238 Promyelocytic leukemia

NM_033238 Promyelocytic leukemia

NM_002154 Heat shock 7OkDa protein 4

NM_002154 Heat shock 7OkDa protein 4

NM_181826 Neurofibromin 2 (bilateral acoustic neuroma)

BC035638 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase)

BE279113 Alpha thalassemia/mental retardation syndrome X-!inked (RAD54 homolog, S. cerevisiae)

CR596462 Pyruvate dehydrogenase (lipoamide) beta

BM912880 Cytochrome c oxidase subunit Vb

NM_007283 Monoglyceride lipase

NM_001556 Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta

NM_003388 Cytoplasmic linker 2

BC031606 Peroxisomal biogenesis factor 7

AB014514 AF-1 specific protein phosphatase

BC045686 Anaphase promoting complex subunit 5

AK090414 Hypothetical protein MGC12760

BC006329 gb:BC006329.1 /DEF=Homo sapiens, Similar to melanoma adhesion molecule, clone

MGC:12808, mRNA, complete cds. /FEA=mRNA /PROD=Similar to melanoma adhesion molecule /DB_XREF=gi:13623456 /FL=gb:BC006329.1

BM908253 Clathrin, light polypeptide (Lcb)

BM809524 Adaptor-related protein complex 2, sigma 1 subunit

NM_004911 ' Protein disulfide isomerase related protein (calcium-binding protein, intestinal-related)

NM_005993 Tubulin-specific chaperone d

AF052126 Steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4- dehydrogenase alpha 1)

AK094717 Tubulin, alpha, ubiquitous

AL157437 GPAA1 P anchor attachm ent protein 1 homolog (yeast)

NM_002408 Mannosyl (alpha-1 ,6-)-glycoprotein beta-1 ,2-N-acetylglucosaminyltransferase

AK127844 Carboxypeptidase Z

NNL006153 NCK adaptor protein 1 NMJ301002021 Phosphofructokinase, liver

AB002325 Protocadherin gamma subfamily C, 3

XM_495809 K1AA0592 protein

BF214482 SMT3 suppressor of mif two 3 homolog 1 (yeast)

BQ278412 Diazepam binding inhibitor (GABA receptor modulator, acyl-Coenzyme A binding protein)

BC022448 ALL1 -fused gene from chromosome 1q

AKQ94717 Tubulin, alpha, ubiquitous

AL832757 Ribosomal protein L3

AF000381 gb:AF000381.1 /DEF=Homo sapiens non-functional folate binding protein mRNA, complete cds. /FEA=mRNA /PROD=non-functional folate binding protein /DB_XREF=gi:2565195

/FL=gb:AF000381.1

NM_001777 CD47 antigen (Rh-related antigen, integrin-associated signal transducer)

BX538296 Tousled-like kinase 1

BC043502 NIMA (never in mitosis gene a)-related kinase 2

NJVM 98794 Mitogen-activated protein kinase kinase kinase kinase 5

NM_005813 Protein kinase D3

NM_006282 Serine/threonine kinase 4 Z25431 NIMA (never in mitosis gene a)-related kinase 1

BC036321 NIMA (never in mitosis gene a)-related kinase 3

Z25435 PRP4 pre-mRNA processing factor 4 homolog B (yeast)

NM_181826 Neurofibromin 2 (bilateral acoustic neuroma)

BC003111 pre-B-cell leukemia transcription factor 2

BF680501 Putative membrane protein

NM_006162 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1

BC028095 Survival of motor neuron protein interacting protein 1

BC028095 Survival of motor neuron protein interacting protein 1

AK055944 Docking protein 1, 62kDa (downstream of tyrosine kinase 1)

BX648217 Solute carrier family 5 (sodium iodide symporter), member 5

BM470905 Cysteine and glycine-rich protein 2

AF037339 Cleft lip and palate associated transmembrane protein 1

NM__014382 ATPase, Ca++ transporting, type 2C, member 1

AF045451 NGFI-A binding protein 1 (EGR1 binding protein 1)

J03866 dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)

NM_013247 Protease, serine, 25

L76702 Protein phosphatase 2, regulatory subunit B (B56), delta isoform

BX641076 Actinin, alpha 1

AF130082 gb:AF130082.1 /DEF=Homo sapiens clone FLC1492 PRO3121 mRNA, complete cds.

/FEA=mRNA /PROD=PRO3121 /DB_XREF=gi:11493468 /UG=Hs.119571 collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) /FL=gb:AF130082.1

BC039817 Regulator of nonsense transcripts 1

AB020593 Phosphodiesterase 10A

AB020593 Phosphodiesterase 10A

AF152929 A kinase (PRKA) anchor protein 7

AB051439 Thioredoxin reductase 2

AU 10135 Hypothetical protein FLJ14753

NM_006618 Jumonji, AT rich interactive domain 1 B (RBP2-like)

AF035582 Calcium/calmodulin-dependent serine protein kinase (MAGUK family)

NM_00?553 Origin recognition complex, subunit 5-like (yeast)

AF076838 RAD17 homolog (S. pombe)

AB002382 catenin (cadherin-associated protein), delta 1

M62895 Annexin A2 pseudogene 3

AK055329 Nuclear transcription factor Y, gamma

AK001497 Death effector domain containing

U90142 butyrophilin, subfamily 2, member A1

AF273049 NP220 nuclear protein

NM_002819 Polypyrimidine tract binding protein 1

NM_002819 Polypyrimidine tract binding protein 1

NM_201444 Diacylglycerol kinase, alpha 8OkDa

CR601242 Glycogenin

NM_002087 Granulin

NM_130839 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome)

NM_033536 Cell division cycle 2-like 2

BF572347 Ubiquitin C

NM_001799 Cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase) NM_004475 Flotillin 2

NM_000546 Tumor protein p53 (Li-Fraumeni syndrome)

NM_003879 CASP8 and FADD-like apoptosis regulator

U85943 RAE1 RNA export 1 homolog (S. pombe)

BG339256 RPL13-2 pseudogene

NM_000410 Hemochromatosis

AF144244 hemochromatosis

NM_000410 Hemochromatosis

NM_000410 Hemochromatosis

AK127306 Gamma tubulin ring complex protein (76p gene)

D13720 IL2-inducible T-cell kinase

NM_006500 Melanoma cell adhesion molecule

BC004354 gb:BC004354.1 /DEF=Homo sapiens, trinucleotide repeat containing 11 (THR-associated protein, 230 kDa subunit), clone MGC:3120, mRNA, complete cds. /FEA=mRNA /PROD=trinucleotide repeat containing 11 (THR-associated protein, 230 kDa subunit) /DB_XREF=gi:13279313 /UG=Hs.2116O7 trinucleotide repeat containing 11 (THR-associated protein, 230 kDa subunit) /FL=gb:BC004354.1

NM_005203 Collagen, type XIII, alpha 1

AF119850 gb:AF119850.1 /DEF=Homo sapiens PRO1608 mRNA, complete cds. /FEA=mRNA

/PROD=PRO1608 /DB_XREF=gi:7770136 /UG=Hs.2186 eukaryotic translation elongation factor 1 gamma /FL=gb:AF119850.1

NM_005073 Solute carrier family 15 (oligopeptide transporter), member 1

U80737 nuclear receptor coactivator 3

NM_001003679 Leptin receptor

AK124335 CDKN1A interacting zinc finger protein 1

CR592117 Caspase 1 , apoptosis-related cysteine protease (interleukin 1 , beta, convertase)

CR592117 Caspase 1 , apoptosis-related cysteine protease (interleukin 1 , beta, convertase)

CR592117 Caspase 1 , apoptosis-related cysteine protease (interleukin 1 , beta, convertase)

U71088 mitogen-activated protein kinase kinase 5

BC006365 Presenilin 2 (Alzheimer disease 4)

NM_012218 Interleukin enhancer binding factor 3, 9OkDa

AF258584 Chromosome 10 open reading frame 86

BC001224 peptidylprolyl isomerase A (cydophilin A)

BC028571 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransf erase, polypeptide 3

NM_006258 Protein kinase, cGMP-dependent, type I

AF528099 Transforming, acidic coiled-coil containing protein 2

AK128194 WD repeat domain 37

BC052280 Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2

AF254087 zinc finger protein 278

AF167079 Variable charge, X-linked 2

BX647107 Amyloid beta (A4) precursor-like protein 2

AF119875 HSPC039 protein

M33374 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa

AF069469 Sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, fungal)-like

NM_025182 KIAA1539

NM_032031 FKSG17

BC071594 MutS homolog 6 (E. coli)

AJ223075 Leucine rich repeat (in FLII) interacting protein 1 AK122839 V-akt murine thymoma viral oncogene homolog 2

AF336878 gb:AF336878.1 /DEF=Homo sapiens FKSG51 (FKSG51) mRNA, complete cds. /FEA=mRNA

/GEN=FKSG51 /PROD=FKSG51 /DB_XREF=gi:13384184 /UG=Hs.326752 Homo sapiens

FKSG51 (FKSG51) mRNA, complete cds /FL=gb:AF336878.1

XM_496446 Similar to 60S ribosomal protein L35

AF180519 LOC440308

BX537698 Nuclear factor I/B

BC004948 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6

BM799512 BCL2-associated athanogene

NM_001935 Dipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)

BC004886 gb:BC004886.1 /DEF=Homo sapiens, ribosomal protein S17, clone MGC:11144, mRNA, complete cds. /FEA=mRNA /PROD=ribosomal protein S17 /DB_XREF=gi:13436139

/UG=Hs.5174 ribosomal protein S17 /FL=gb:BC004886.1

AK126670 Eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa

AB020641 PFTAIRE protein kinase 1

AL162081 RAB14, member RAS oncogene family

AB014519 Rho-associated, coiled-coil containing protein kinase 2

AF061939 Staufen, RNA binding protein (Drosophila)

NM_020532 Reticulon 4

AF172453 Opioid growth factor receptor

BC058855 Vascular endothelial growth factor

AK093478 HLA-G histocompatibility antigen, class I, G

AK093478 HLA-G histocompatibility antigen, class I, G

AK093478 HLA-G histocompatibility antigen, class I, G

BC018128 Fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)

BX648277 Mitogen-activated protein kinase kinase kinase 7

BX648277 Mitogen-activated protein kinase kinase kinase 7

U56725 heat shock 7OkDa protein 2

BC004334 gb:BC004334.1 /DEF=Homo sapiens, ribosomal protein S10, clone MGC:10943, mRNA, complete cds. /FEA=mRNA /PROD=riboεomal protein S10 /DB_XREF=gi:13279259

/UG=Hs.7623O ribosomal protein S10 /FL=gb:BC004334.1

AF238870 Synuclein, alpha (non A4 component of amyloid precursor)

NM_000430 Platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa

BM992995 Deoxyhypusine synthase

AK092638 Cyclin G2

L35253 mitogen-activated protein kinase 14

AB006572 chromosome 19 open reading frame 2

NM_003687 PDZ and LiM domain 4

U19178 brain and reproductive organ-expressed (TNFRSF1A modulator)

AK096018 L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain

NMJ304385 Chondroitin sulfate proteoglycan 2 (versican)

NM_004613 Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)

BX537451 Membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)

AF116702 ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome)

AK091503 Ribosomal protein S6 kinase, 7OkDa, polypeptide 1

NMJD00212 Integrin, beta 3 (platelet glycoprotein IHa, antigen CD61)

D83243 Nuclear protein, ataxia-telangiectasia locus NM_000719 Calcium channel, voltage-dependent, L type, alpha 1 C subunit

BC065499 Microtubule associated serine/threonine kinase 2

NM_031420 Mitochondrial ribosomal protein L9

AK027059 Mitochondrial ribosomal protein S11

BC071561 Leucine-rich repeats and immunoglobulin-like domains 1

U20489 protein tyrosine phosphatase, receptor type, O

U51007 proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

LJ51869 Core promoter element binding protein

LJ62858 interleukin 13 receptor, alpha 1

AY289212 Leucine-rich PPR-motif containing

NM_000621 5-hydroxytryptamine (serotonin) receptor 2A

NM_000044 Androgen receptor (dihydrotestosterone receptor; testicular feminization; spinal and bulbar muscular atrophy; Kennedy disease)

M33384 ADP-ribosylation factor 3

M30448 fibrillarin

J04755 Ferritin, heavy polypeptide pseudogene 1

L42531 glutathione synthetase

NM_001497 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1

NM_002291 Laminin, beta 1

AK091128 Aldo-keto reductase family 1 , member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)

L19185 peroxiredoxin 2

BM454597 Voltage-dependent anion channel 2

M61900 prostaglandin D2 synthase 21kDa (brain)

113858 Son of sevenless homolog 2 (Drosophila)

AL832757 Ribosomal protein L3

NM_002658 Plasminogen activator, urokinase

NM_000176 Nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)

BC065423 Actin related protein 2/3 complex, subunit 4, 2OkDa

AF034374 Molybdenum cofactor synthesis 1

NM_199072 )-mfa domain-containing protein

AK127636 Interferon gamma receptor 1

AF090934 maternally expressed 3

AL833286 LIM protein (similar to rat protein kinase C-binding enigma)

AK055491 Dyneϊn, cytoplasmic, intermediate polypeptide 2

BC039740 RNA binding protein

AF332558 BCL2 binding component 3

BM811415 Hemoglobin, beta

NM_020143 Putatative 28 kDa protein

NM_014335 CREBBP/EP300 inhibitor 1

AB029037 Trophinin

AB029037 Trophinin

NM_032582 Ubiquitin specific protease 32

AK094638 Beta-amyloid binding protein precursor

NM_019003 Spindlin family, member 2

D25278 IQ motif containing B1

BM719769 Stem cell growth factor; lymphocyte secreted C-type lectin

CR615743 Ribosomal protein L4 NM_000314 Phosphatase and tensin homolog (mutated in multiple advanced cancers 1)

AY358648 KIAA0101

AK098772 Beta 5-tubulin

BM994500 RhO GDP dissociation inhibitor (GDI) alpha

CR627413 Hypothetical protein MGC15396

NM_212482 Fibronectin 1

BF570115 Ribosomal protein, large, PO

AL136892 Hypothetical protein FLJ20323

BC005884 BH3 interacting domain death agonist

AK124809 COX11 homolog, cytochrome c oxidase assembly protein (yeast)

BX647539 Biliverdin reductase A

BM919305 Polymerase (RNA) Il (DNA directed) polypeptide L, 7.6kDa

NM_006895 Histamine N-methyltransferase

BX537619 Sterol carrier protein 2

CR624136 Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1 )

CR605198 Islet cell autoantigen 1 , 69kDa

NM_006495 Ecotropic viral integration site 2B

AK125710 CD58 antigen, (lymphocyte function-associated antigen 3)

BF673978 Proteasome (prosome, macropain) subunit, alpha type, 1

AK024217 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae)

BM805807 Prostaglandin D2 synthase 21 kDa (brain)

NM_004781 Vesicle-associated membrane protein 3 (cellubrevin)

BM911034 Tubulin alpha 6

AK127759 NADH dehydrogenase (ubiquinone) Fe-S protein 7, 2OkDa (NADH-coenzyme Q reductase)

BC024741 ' Solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17

BM917376 ATP synthase, H+ transporting, mitochondrial FO complex, subunit b, isoform 1

BF240423 Thioredoxin domain containing 9

BM703883 Cytoskeleton associated protein 1

AK092254 Vesicle-associated membrane protein 4

AK093425 Siah-interacting protein

BC067848 Karyopherin alpha 2 (RAG cohort 1 , importin alpha 1 )

NM_003337 Ubiquitin-conjugating enzyme E2B (RAD6 homolog)

AF127771 Ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)

AK130101 Peptidylprolyl isomerase A (cyclophilin A)

NMJ306811 Tumor differentially expressed 1

XMJD32397 DKFZP564I122 protein

AL832598 Erythrocyte membrane protein band 4.1-like 3

AK022284 Zinc finger protein 339

AB020706 Adaptor-related protein complex 2, alpha 2 subunit

NM_004082 Dynactin 1 (p150, glued homolog, Drosophila)

BX648105 Metastasis associated 1

BC006181 splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)

BG033657 Eukaryotic translation initiation factor 4A, isoform 1

AK091170 Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)

AK125205 AbI interactor 2

BC028083 T-cell receptor active beta-chain

AK055329 Nuclear transcription factor Y, gamma BF341582 Major histocompatibility complex, class I, C

NM_003363 Ubiquitin specific protease 4 (proto-oncogene)

NM_033540 Mitofusin 1

NM_001798 Cyclin-dependent kinase 2

BX648299 Solute carrier family 8 (sodium/calcium exchanger), member 1

NM_000153 Galactosylceramidase (Krabbe disease)

NM_001920 Decorin

NM_033004 NACHT, leucine rich repeat and PYD containing 1

BX648769 Ewing sarcoma breakpoint region 1

XM_039796 TRAF2 and NCK interacting kinase

BF983096 BCL2-associated X protein

AB014602 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 1

AF155810 solute carrier family 25 (mitochondrial carrier, brain), member 14

NM_080425 GNAS complex locus

NM_003879 CASP8 and FADD-like apoptosis regulator

NM_000410 Hemochromatosis

AF182316 Fer-1-like 3, myoferlin (C. elegans)

AB033068 Fizzy/cell division cycle 20 related 1 (Drosophila)

NM_000410 Hemochromatosis

AK092059 Guanine nucleotide binding protein (G protein), beta 5

AF217500 MYST histone acetyltransferase (monocytic leukemia) 4

NM_000961 Prostaglandin I2 (prostacyclin) synthase

NM_001920 Decorin

L32662 gb:L32662.1 /DEF=Human prostaglandin E2 receptor EP3 subtype isoform IV mRNA, complete cds. /FEA=CDS /PROD=prostaglandin E2 receptor /DB_XREF=gi:484163

/FL=gb:L32662.1

AK124160 Major histocompatibility complex, class I, B

L08961 c-mer proto-oncogene tyrosine kinase

BM472931 Prothymosin, alpha (gene sequence 28)

NM_001752 Catalase

CR601067 Plasminogen activator, urokinase receptor , *

NM_002473 Myosin, heavy polypeptide 9, non-muscle

BM458036 Transcribed locus

NM_001376 Dynein, cytoplasmic, heavy polypeptide 1

BX647217 Heterogeneous nuclear ribonucleoprotein A3

BX647217 Heterogeneous nuclear ribonucleoprotein A3

BX647217 Heterogeneous nuclear ribonucleoprotein A3

BX647217 Heterogeneous nuclear ribonucleoprotein A3

BX647217 Heterogeneous nuclear ribonucleoprotein A3

NM_198335 Glucosidase, alpha; neutral AB

BC010281 ADP-ribosylation factor-like 6 interacting protein

NM_005347 Heat shock 7OkDa protein 5 (glucose-regulated protein, 78kDa)

NM_001417 Eukaryotic translation initiation factor 4B

NMJD01417 Eukaryotic translation initiation factor 4B

BX537826 Basic transcription factor 3

BM907805 H3 histone, family 3B (H3.3B)

BM921938 Prostatic binding protein

AK056837 Ribosomal protein L13a BG033621 Tumor protein, translationally-controlled 1

NM_015172 HBxAg transactivated protein 2

BG500301 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2,

MSK12)

NM_015172 HBxAg transactivated protein 2

NM_015172 HBxAg transactivated protein 2

NM_015172 HBxAg transactivated protein 2

AF348492 Retinoblastoma-associated factor 600

D21262 Nucleolar and coiled-body phosphoprotein 1

NM_002271 RAN binding protein 5

NM_002271 RAN binding protein 5

NM_002271 RAN binding protein 5

NM_002271 RAN binding protein 5

AL050005 Putative translation initiation factor

NM_000599 Insulin-like growth factor binding protein 5

NM_000599 Insulin-like growth factor binding protein 5

AK000826 RAB7, member RAS oncogene family

AK000826 RAB7, member RAS oncogene family

X79067 zinc finger protein 36, C3H type-like 1

BC034231 Actin related protein 2/3 complex, subunit 5, 16kDa

NM_001846 Collagen, type IV, alpha 2

X79067 zinc finger protein 36, C3H type-like 1

NM_001846 Collagen, type IV, alpha 2

AK075420 Pro-oncosis receptor inducing membrane injury gene

AK056446 Heat shock 9OkDa protein 1 , alpha

AK056446 Heat shock 9OkDa protein 1 , alpha

CR606241 Actin, gamma 1

AY289212 Leucine-rich PPR-motif containing

BF570115 Ribosomal protein, large, PO

AK126357 Recombining binding protein suppressor of hairless (Drosophila)

BE299671 zinc finger protein 289, ID1 regulated

AK026168 Hypothetical LOC401255

AK024651 LOC441469

AK130101 Peptidylprolyl isomerase A (cyclophilin A)

AK024651 LOC441469

NM_001845 Collagen, type IV, alpha 1

NM_001845 Collagen, type IV, alpha 1

AB002368 Exportin 6

CR606241 Actin, gamma 1

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

M80902 AHNAK nucleoprotein (desmoyokin)

BX640880 Topoisomerase (DNA) Il beta 18OkDa

BC069196 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1

BC069196 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1

BQ057412 Major histocompatibility complex, class II, DP alpha 1 AJ296290 Protein kinase, lysine deficient 1

AJ296290 Protein kinase, lysine deficient 1

AJ296290 Protein kinase, lysine deficient 1

CR606241 Actin, gamma 1

D86974 PI-3-kinase-related kinase SMG-1-like

BX537379 H3 histone, family 3B (H3.3B)

BX537379 H3 histone, family 3B (H3.3B)

BX537379 H3 histone, family 3B (H3.3B)

AK074842 Splicing factor, arginine/serine-rich 14

AJ295987 Putative MAPK activating protein PM20.PM21

AJ295987 Putative MAPK activating protein PM20.PM21

AJ295987 Putative MAPK activating protein PM20.PM21

AJ295987 Putative MAPK activating protein PM20.PM21

BX647216 UBX domain containing 2

BX647216 UBX domain containing 2

BX647216 UBX domain containing 2

BC039299 Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein)

AK096865 Hypothetical protein H41

XM_056455 Melanoma associated gene

XM_056455 Melanoma associated gene

NM_000610 CD44 antigen (homing function and Indian blood group system)

AA679988 polypyrimidine tract binding protein 1

AA679988 polypyrimidine tract binding protein 1

AL833819 Hypothetical protein LOC130074

AK025446 DKFZP564M182 protein

AK025446 DKFZP564M 182 protein

NM_002417 Antigen identified by monoclonal antibody Ki-67

U80184 flightless I homolog (Drosophila)

U80184 flightless I homolog (Drosophila)

AB028990 Exocyst complex component 7

AL832314 RNA binding motif protein 25

AL832314 RNA binding motif protein 25

AL832314 RNA binding motif protein 25

AL832314 RNA binding motif protein 25

BI912738 Prostate tumor overexpressed gene 1

AL832314 RNA binding motif protein 25

AB028990 Exocyst complex component 7

Y09703 Pinin, desmosome associated protein

Y09703 Pinin, desmosome associated protein

AK122953 Voltage-dependent anion channel 1

AL832757 Ribosomal protein L3

NM_006464 Trans-golgi network protein 2

AK128641 ATPase, H+ transporting, lysosomal 38kDa, VO subunit d isoform 1

BM555701 Ribosomal protein L7

NM_006464 Trans-golgi network protein 2

AK125453 Hypothetical protein MGC10850

AK027032 Golgi apparatus protein 1

BX537897 Mitogen-activated protein kinase 3 CR595664 Ring finger protein 167

AK125213 Tyrosyl-tRNA synthetase

BC025965 WIRE protein

BC025965 WIRE protein

BC025965 WIRE protein

NM_198868 KIAA0676 protein

BC036520 KIAA0251 protein

NM_198868 KIAA0676 protein

BF689173 DKFZP586M1523 protein

NM_014615 KIAA0182 protein

NM_014615 KIAA0182 protein

XM_031553 U2-associated SR140 protein

AL096738 Transient receptor potential cation channel, subfamily C, member 4 associated protein

XM_031553 U2-associated SR140 protein

XM_030577 ATPase, Class II, type 9A

NM_000610 CD44 antigen (homing function and Indian blood group system)

AK092265 Similar to lymphocyte antigen 6 complex, locus G5B; G5b protein; open reading frame 31

AB011142 Ubiquitin specific protease 34

AB011142 Ubiquitin specific protease 34

AK094009 Complement component 1 , r subcomponent

XM_497080 KIAA0515

XM_497080 KIAA0515

BE968833 spectrin, beta, non-erythrocytic 1

NM_177559 Casein kinase 2, alpha 1 polypeptide

NM_177559 Casein kinase 2, alpha 1 polypeptide

BX640866 Unc-84 homolog A (C. elegans)

NM_177559 Casein kinase 2, alpha 1 polypeptide

NM_033138 Caldesmon 1

L04731 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)

L04731 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)

L04731 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)

AF129756 lymphocyte antigen 6 complex, locus G6D

BG292067 Myosin, light polypeptide 6, alkali, smooth muscle and non-muscle

NM_144582 Testis expressed sequence 261

NM_144582 Testis expressed sequence 261

CR593822 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6

NM_170707 Lamin A/C

BX537542 Era G-protein-like 1 (E. coli)

AK091455 Peptidase (mitochondrial processing) alpha

NMJ 70707 Lamin A/C

AK127640 Glutamate receptor, ionotropic, N-methyl D-asparate-assodated protein 1 (glutamate binding)

X99135 collagen, type Vl, alpha 1 NM_001001927 Mitochondrial tumor suppressor 1

XM_499343 Paternally expressed 10 NM_001001927 Mitochondrial tumor suppressor 1 NM_001001927 Mitochondrial tumor suppressor 1

NM_001753 Caveolin 1 , caveolae protein, 22kDa BX647087 Hypothetical protein LOC151162

NM_004040 Ras homolog gene family, member B

Z93241 polymerase delta interacting protein 46

NM_012316 Karyopherin alpha 6 (importin alpha 7)

NM_012316 Karyopherin alpha 6 (importin alpha 7)

NM_012316 Karyopherin alpha 6 (importin alpha 7)

AL049748 RNA binding motif protein 9

L13848 DEAH (Asp-Glu-Ala-His) box polypeptide 9

L13848 DEAH (Asp-Glu-Ala-His) box polypeptide 9

AB088120 Expressed in T-cells and eosinophils in atopic dermatitis

AB037847 Chromosome 16 open reading frame 34

AK172810 Solute carrier family 39 (zinc transporter), member 14

AL035306 Syntaxin 12

AL035306 Syntaxin 12

AK056642 Similar to microtubule-associated proteins 1A/1B light chain 3

AB037847 Chromosome 16 open reading frame 34

NM_006510 Ret finger protein

BM558246 Phosphatidylinositol glycan, class F

NM_006510 Ret finger protein

BM558246 Phosphatidylinositol glycan, class F

BM558246 Phosphatidylinositol glycan, class F

AK128834 Chromosome 10 open reading frame 61

BM558246 Phosphatidylinositol glycan, class F

AK128834 Chromosome 10 open reading frame 61

NM_020338 Retinoic acid induced 17

BC041396 Ran GTPase activating protein 1

AK095108 CDNA clone IMAGE:4842353, partial cds

BC041396 Ran GTPase activating protein 1

NM_004393 Dystroglycan 1 (dystrophin-associated glycoprotein 1)

AY732242 Non imprinted in Prader-Willi/Angelman syndrome 2

AL050005 Putative translation initiation factor

AK127401 Chromosome 19 open reading frame 13

AK127401 Chromosome 19 open reading frame 13

AY732242 Non imprinted in Prader-Willi/Angelman syndrome 2

CR749783 Pleckstrin homology-like domain, family B, member 1

BX537444 ATPase, Ca++ transporting, plasma membrane 4

BX537444 ATPase, Ca++ transporting, plasma membrane 4

AB018274 Likely ortholog of mouse Ia related protein

NM_015200 SCC-112 protein

XM_045792 GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

NM_015200 SCC-112 protein

NM_005914 MCM4 minichromosorne maintenance deficient 4 (S. cerevisiae)

BX640961 Insulin-like growth factor binding protein 3

AL021707 unc-84 homolog B (C. elegans)

AK128683 Mitochondrial ribosomal protein S27

BC040441 Pleckstrin homology domain containing, family M (with RUN domain) member 2

CR749446 Pre-B-cell leukemia transcription factor 1

AA805651 KIAA0143 protein AA805651 KIAA0143 protein

CR749446 Pre-B-cell leukemia transcription factor 1

NM_006015 AT rich interactive domain 1A (SWI- like)

NM_002998 Syndecan 2 (heparan sulfate proteoglycan 1 , cell surface-associated, fibroglycan)

BC012758 Hypothetical protein LOC149603

BX537404 Vacuolar protein sorting 39 (yeast)

NM_002998 Syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycan)

NM_002998 Syndecan 2 (heparan sulfate proteoglycan 1, cell surface-associated, fibroglycan)

AB020706 Adaptor-related protein complex 2, alpha 2 subunit

NM_007235 Exportin, tRNA (nuclear export receptor for tRNAs)

AB020706 Adaptor-related protein complex 2, alpha 2 subunit

XM_291015 Likely homolog of rat kinase D-interacting substance of 220 kDa

XM_291015 Likely homolog of rat kinase D-interacting substance of 220 kDa

NM_138391 Chromosome 1 open reading frame 37

NM_138391 Chromosome 1 open reading frame 37

AB018288 Exportin 7

AK024025 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1

NM_006047 RNA binding motif protein 12

AK075331 FK506 binding protein 9, 63 kDa

NM_006047 RNA binding motif protein 12

BC058855 Vascular endothelial growth factor

AK023758 adenylate kinase 2

AK023758 adenylate kinase 2

AK023758 adenylate kinase 2

AK023758 adenylate kinase 2

AK025621 Chromosome 6 open reading frame 111

AK025621 Chromosome 6 open reading frame 111

NM_172020 POM121 membrane glycoprotein (rat)

AK025621 Chromosome 6 open reading frame 111

NMJ305207 v-crk sarcoma virus CT10 oncogene homolog (avian)-like

NWM 99040 Nudix (nucleoside diphosphate linked moiety X)-type motif 4

NM_199040 Nudix (nucleoside diphosphate linked moiety X)-type motif 4

NM__145342 Mitogen-activated protein kinase kinase kinase 7 interacting protein 2

BF131637 Metallothionein 2A

NM_198839 Acetyl-Coenzyme A carboxylase alpha

BM805807 Prostaglandin D2 synthase 21 kDa (brain)

AF359381 Potassium channel tetramerisation domain containing 12

BX648010 Component of oligomeric golgi complex 4

BX647459 Serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type

1), member 2

AK095954 Ribosomal protein L13

AF359381 Potassium channel tetramerisation domain containing 12

AB018274 Likely ortholog of mouse Ia related protein

AL049539 transmembrane 9 superfamily protein member 4

BC071555 lnterleukin 6 signal transducer (gp130, oncostatin M receptor)

BC071555 lnterleukin 6 signal transducer (gp130, oncostatin M receptor)

AB020671 Myosin phosphatase-Rho interacting protein AL049539 transmembrane 9 superfamily protein member 4

AF258591 PP784 protein

AB014592 KIAA0692 protein

AB014592 KIAA0692 protein

NM_015497 DKFZP564G2022 protein

BF965170 Interferon induced transmembrane protein 3 (1-8U)

NM_015497 DKFZP564G2022 protein

AL110212 H2A histone family, member V

AL110212 H2A histone family, member V

NM_015335 Thyroid hormone receptor associated protein 2

NM_015335 Thyroid hormone receptor associated protein 2

NM_015335 Thyroid hormone receptor associated protein 2

NM_032217 Ankyrin repeat domain 17

XM_291222 DKFZP586J0619 protein

NM_130837 Optic atrophy 1 (autosomal dominant)

AB007896 Putative prolyl oligopeptidase

AB007896 Putative prolyl oligopeptidase

AB007896 Putative prolyl oligopeptidase

NM_033480 F-box protein 9

NM_014614 Proteasome (prosome, macropain) activator subunit 4

NM_014614 Proteasome (prosome, macropain) activator subunit 4

AK055600 MRNA; cDNA DKFZp564C063 (from clone DKFZp564C063)

NM_014614 Proteasome (prosome, macropain) activator subunit 4

AK055600 MRNA; cDNA DKFZp564C063 (from clone DKFZp564C063)

NM_000689 Aldehyde dehydrogenase 1 family, member A1

AL050005 Putative translation initiation factor

AF480883 Phosphatide acid phosphatase type 2B

AL050005 Putative translation initiation factor

AC004382 hypothetical protein DKFZp434K046

NM_033624 F-box protein 21

AF480883 Phosphatidic acid phosphatase type 2B

NM_033624 F-box protein 21

AB023231 Formin binding protein 4

NM_005909 Microtubule-associated protein 1B

NM_015103 Plexin DI

NM_015338 Additional sex combs like 1 (Drosophila)

NM_015338 Additional sex combs like 1 (Drosophila)

NM_181523 Phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha)

NM_181523 Phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha)

NM_015532 Glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A

AK054731 Tubulin, alpha 1 (testis specific)

NM_015532 Glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A

NM_015532 Glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A

AL833900 Multiple coagulation factor deficiency 2

AL833900 Multiple coagulation factor deficiency 2

D86978 Nucleoporin 205kDa

BC045642 LYRIC/3D3

NM_181523 Phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha) BC045642 LYRIC/3D3

BC045642 LYRIC/3D3

NM_006549 Calcium/calmodulin-dependent protein kinase kinase 2, beta

NM_183380 Dystonin

NM_014382 ATPase, Ca++ transporting, type 2C, member 1

NM_198321 UDP-N-acetyl-alpha-D-galactosamineipolypeptide N-acetylgalactosaminyltransferase 10

(GaINAc-TIO)

X72889 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

NM_020524 Pre-B-cell leukemia transcription factor interacting protein 1

NM_015575 Trinucleotide repeat containing 15

NM_015575 Trinucleotide repeat containing 15

AF142419 quaking homolog, KH domain RNA binding (mouse)

AF142419 quaking homolog, KH domain RNA binding (mouse)

AB065003 KIAA0261

AF142419 quaking homolog, KH domain RNA binding (mouse)

BX640605 Splicing factor, arginine/serine-rich 5

AB065003 KIAA0261

CR626605 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1

AJ010089 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein

BF970890 Ribosomal protein L17

NM_002745 Mitogen-activated protein kinase 1

NM_080425 GNAS complex locus

AK127039 Lipin 1

AK127039 Lipin 1

NM_004687 Myotubularin related protein 4

BC045655 Hypothetical protein MAC30

AB023160 autophagin-1

BC045655 Hypothetical protein MAC30

BC045655 Hypothetical protein MAC30

BG033621 Tumor protein, translationally-controlled 1

AB191264 Agrin

AY533564 Ankyrin repeat domain 12

D63881 Joined to JAZF1

AL049935 Formin binding protein 1

AY533564 Ankyrin repeat domain 12

NM_003045 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1

NM_003045 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1

NM_198268 Homeodomain interacting protein kinase 1

NM_018841 Guanine nucleotide binding protein (G protein), gamma 12

NM_003045 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1

AK055128 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14

NM__024524 ATPase family homolog up-regulated in senescence cells

CR749333 Neuropilin 1

AB082526 NIMA (never in mitosis gene a)- related kinase 9

AL049795 taxilin

D87440 KIAA0252

D87440 KIAA0252 BG255575 KH-type splicing regulatory protein (FUSE binding protein 2)

XM_371369 C219-reactive peptide

CR626991 Cytoplasmic linker associated protein 2

NM_003605 O-linked N-acetylglucosamine (GIcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-

N-acetylglucosaminyl transferase)

CR626991 Cytoplasmic linker associated protein 2

XM_371369 C219-reactive peptide

BC060867 KIAA0746 protein

AL117381 cytochrome c oxidase subunit IV isoform 2

BC042050 Hypothetical protein MGC29816

BC060867 KIAA0746 protein

NM_012470 Transportin 3

NM_012470 Transportin 3

AK098772 Beta 5-tubulin

AB033078 Sphingosine-1-phosphate lyase 1

AB033078 Sphingosine-1-phosphate lyase 1

AJ608774 Vacuolar protein sorting 13D (yeast)

XM_044461 KIAA1102 protein

D83782 SREBP CLEAVAGE-ACTIVATING PROTEIN

NM_007111 Transcription factor Dp-1

BC034490 Retinoblastoma-like 2 (p130)

BC034490 Retinoblastoma-like 2 (p130)

AK096187 DKFZP564F0522 protein

NM_002076 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease MID)

NM_002076 Glucosamine (N-acetyl)-6-sulfatase (Sanfilippo disease IHD)

BX537978 Erythrocyte membrane protein band 4.1-like 1

BC042980 Hypothetical protein FLJ35801

AB018270 Myosin ID

AL117461 Hypothetical protein MGC21416

AL117461 Hypothetical protein MGC21416

AL117461 Hypothetical protein MGC21416

AL117461 Hypothetical protein MGC21416

AF545571 Sulfatase 1

CR749563 CAMP responsive element binding protein 3-like 2

AK024501 MAX dimerization protein 4

AK024501 MAX dimerization protein 4

AL831896 Amine oxidase (flavin containing) domain 2

AF375884 Protein O-fucosyltransferase 1

NM_015173 TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1

BC050476 Eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa

NM_006827 Transmembrane trafficking protein

AF545571 Sulfatase 1

AF545571 Sulfatase 1

AK123513 Chromosome 14 open reading frame 124

BF790262 Transcribed locus

AK094738 CLI P-170-related protein

AL133662 KIAA0913

NM_004037 Adenosine monophosphate deaminase 2 (isoform L) BX648282 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2

BX648282 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2

CR606241 Actin, gamma 1

NM_012223 Myosin IB

NM_012223 Myosin IB

XM_048070 Zinc finger protein 292

AL833264 Fem-1 homolog b (C. elegans)

XM_048070 Zinc finger protein 292

NM_133476 Zinc finger protein 384

NM_001005751 Similar to KIAA0592 protein

NM_016076 CGI-146 protein

NM_005964 Myosin, heavy polypeptide 10, non-muscle

AL833264 Fem-1 homolog b (C. elegans)

AL833264 Fem-1 homolog b (C. elegans)

AY044869 E1A binding protein p400

NM_024408 Notch homolog 2 (Drosophila)

BC068438 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase

BC068438 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase

AK124393 KIAA0082

XM_371254 Ubiquitin specific protease 24

AK095066 Transcription factor 4

AK125927 ATPase, H+ transporting, lysosomal VO subunit a isoform 1

AK095066 Transcription factor 4

AK095066 Transcription factor 4

AK095066 Transcription factor 4

XM_371254 Ubiquitin specific protease 24

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

BM911048 Similar to ribosomal protein S3a; 40S ribosomal protein S3a; v-fos transformation effector protein 1

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

NM_002972 SET binding factor 1

BX648708 KIAA0090 protein

BX648708 KIAA0090 protein

BX648708 KIAA0090 protein

AL137751 radixin

AL137751 radixin

AK126479 Vestigial like 4 (Drosophila)

AK074108 Hypothetical protein MGC50853

NM_033536 Cell division cycle 2-like 2 "

AY283618 KIAA0853

NM_183414 Ubiquitin protein ligase E3B

NWM83414 Ubiquitin protein ligase E3B

NM_015935 CGI-01 protein

AB028973 Myelin transcription factor 1

NM_015935 CGI-01 protein

NM_015602 Lamina-associated polypeptide 1B NM_015602 Lamina-associated polypeptide 1B

BX641028 EF hand domain family A1

CR619192 U3 snoRNP protein 4 homolog

AL833286 UM protein (similar to rat protein kinase C-binding enigma)

NWM 45799 Septin 6

NM_145799 Septin 6

NMJ 45799 Septin 6

NM_004866 Secretory carrier membrane protein 1

NM_004866 Secretory carrier membrane protein 1

BC010575 E74-like factor 1 (ets domain transcription factor)

BC028617 Chromosome 10 open reading frame 56

BC010575 E74-like factor 1 (ets domain transcription factor)

AB023147 Chromosome 22 open reading frame 9

D80007 Programmed cell death 11

BC028617 Chromosome 10 open reading frame 56

IMMJD04866 Secretory carrier membrane protein 1

NM_006826 Tyrosine 3-monαoxygenaseΛryptophan 5-monooxygenase activation protein, theta polypeptide

XM_036708 KIAA0368

XM_036708 K1AA0368

AW194657 general transcription factor NIC, polypeptide 2, beta 11OkDa

AL109955 RlslA-binding region (RNP1 , RRM) containing 1

BC051025 KIAA0194 protein

AK098475 GrpE-like 1 , mitochondrial (E. coli)

BF972117 Ribosσmal protein S2

AK098475 GrpE-like 1, mitochondrial (E. coli)

AL080216 MRNA; cDNA DKFZp586K1123 (from clone DKFZp586K1123)

AL109804 heat shock 7OkD protein 12B

BC017890 Putative nucleic acid binding protein RY- 1

CR621384 GDP-mannose pyrophosphorylase B

BC017890 Putative nucleic acid binding protein RY-1

XM_291106 K1AA0232 gene product

NM_203463 LAG1 longevity assurance homolog β (S. cerevisiae)

BC042436 Retinoic acid induced 3

AB007899 Neural precursor cell expressed, developmentally down-regulated 4-like

NMJ203463 LAG1 longevity assurance homolog 6 (S. cerevisiae)

AB040922 Kelch repeat and BTB (POZ) domain containing 2

NM_006330 Lysophospholipase I

NM_014701 KIAA0256 gene product

NM_014701 KIAA0256 gene product

AF217500 MYST histone acetyltransferase (monocytic leukemia) 4

BC006427 KIAA1279

NMJD05463 Heterogeneous nuclear ribonucleoprotein D-like

AB075846 Splicing factor YT521-B

AK125717 KIAA0664 protein

NM_006521 Transcription factor binding to IGHM enhancer 3

BX538326 Sprouty-related, EVH1 domain containing 2

BC068602 Succinate-CoA ligase, GDP-forming, beta subunit BC068480 Chromosome 14 open reading frame 147 BM911974 Full-length cDNA clone CS0DC018YD17 of Neuroblastoma Cot 25-normalized of Homo sapiens (human)

AF217500 MYST histone acetyltransferase (monocytic leukemia) 4 NM_203330 CD59 antigen p18-20 (antigen identified by monoclonal antibodies 16.3A5, EJ16, EJ30,

EL32 and G344)

NM_212482 Fibronectin 1

NM_032233 Chromosome 14 open reading frame 154

AK127112 DnaJ (Hsp40) homolog, subfamily C, member 13

AF327452 Sperm associated antigen 9

AF327452 Sperm associated antigen 9

BE965029 flavoprotein oxidoreductase MICAL2

BE965029 flavoprotein oxidoreductase MICAL2

AL833560 KIAA0241 protein

BC060767 Centaurin, beta 2

AL832022 Hypothetical protein FLJ13910

AK056565 Tropomyosin 4

AL832022 Hypothetical protein FLJ13910

AJ627032 Nipped-B homolog (Drosophila)

AK057616 Mouse Mammary Turmor Virus Receptor homolog 1

NM_001002909 KIAA0553 protein

BX537571 FYN oncogene related to SRC, FGR, YES

NM_000093 Collagen, type V, alpha 1

NM_000093 Collagen, type V, alpha 1

BM458671 DnaJ (Hsp40) homolog, subfamily C, member 8

BM458671 DnaJ (Hsp40) homolog, subfamily C, member 8

AB020683 Jumonji domain containing 2B

BX649110 Huntingtin interacting protein B

AB028998 Tensin like C1 domain containing phosphatase

AB020683 Jumonji domain containing 2B

AB020683 Jumonji domain containing 2B

BC015621 Chromosome 14 open reading frame 32

NM_005885 Membrane-associated RlNG-CH protein Vl

BC015621 Chromosome 14 open reading frame 32

NM_032804 Chromosome 10 open reading frame 22

BC021931 CCAAT/enhancer binding protein (C/EBP), beta

NM_032804 Chromosome 10 open reading frame 22

AB023151 KIAA0934

AB023151 KIAA0934

AB020699 K1AA0892

BC048259 Phosphatidylinositol binding clathrin assembly protein

BX647728 RW1 protein

NM_022151 Modulator of apoptosis 1

AK055128 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 14

BC048259 Phosphatidylinositol binding clathrin assembly protein

NMJ 99141 Coactivator-associated arginine methyltransferase 1

NM_015017 Ubjquitin specific protease 33

NM 001356 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked NM_001356 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked

AL132773 attractin

NM_012398 Phosphatidylinositol-4-phosphate 5-kinase, type I, gamma

AK022062 Ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)

NM_003072 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

NM_173457 Phosphodiesterase 8A

NM_173457 Phosphodiesterase 8A

XM_291253 KIAA0146 protein

BM917453 H2A histone family, member X

NM_015087 Spastic paraplegia 20, spartin (Troyer syndrome)

AL023553 ortholog of rat pippin

AL023553 ortholog of rat pippin

BC044587 Hypothetical protein FLJ30656

BC043003 NIMA (never in mitosis gene a)-related kinase 7

BC044587 Hypothetical protein FLJ30656

BX641032 WEE1 homolog (S. pombe)

NM_006965 Zinc finger protein 24 (KOX 17)

AL831995 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A)

XM__087254 ATPase, Class Vl , type 11 B

BF970890 Ribosomal protein L17

AB028981 Dedicator of cytokinesis 9

BC036212 Chromodomain helicase DNA binding protein 1-like

BM906315 Cell division cycle 34

NM_025207 FAD-synthetase

NM_017934 Pleckstrin homology domain interacting protein

XM_166300 Absent in melanoma 1

BC040477 Thyroid hormone receptor interactor 3

XM_093839 KIAA0826

BC065204 FLJ35348

XM_093839 KIAA0826

NM_012448 Signal transducer and activator of transcription 5B

NM_006366 CAP, adenylate cyclase-associated protein, 2 (yeast)

BE617588 hippocalcin-like 1

BX641025 KIAA0460 protein

NMJ306366 CAP, adenylate cyclase-associated protein, 2 (yeast)

NM_182706 Scribbled homolog (Drosophila)

BX648336 KIAA1702 protein

NM_024034 Ganglioside-induced differentiation-associated protein 1-like 1

NM_015213 RAB6 interacting protein 1

BG684874 Transcribed locus

AB023182 Serine/threonine kinase 38 like

NMJ302375 Microtubule-associated protein 4

NM_002375 Microtubule-associated protein 4

NM_001931 Dihydrolipoamide S-acetyitransferase (E2 component of pyruvate dehydrogenase complex)

XM_113962 KIAA0650 protein

XM_290546 KIAA0830 protein

XM_370738 Chromodomain helicase DNA binding protein 8 AB023182 Serine/threonine kinase 38 like

XM_290546 KIAA0830 protein

AC004528 glutamate receptor, ionotropic, N-methyl-D-aspartate 3B

AB011116 Mahogunin, ring finger 1

XMJ 13962 K1AA0650 protein

BQ054641 Similar to 4OS ribosomal protein S17

XMJ 13962 K1AA0650 protein

NMJ 73060 Calpastatin

BF983396 Glycera)dehyde-3-phosphate dehydrogenase

NM_02Q841 Oxysterol binding protein-like 8

AB011132 Aquarius homolog (mouse)

NM_020841 Oxysterol binding protein-like 8

NMJ 73060 Calpastatin

CR592913 Related RAS viral (r-ras) oncogene homolog 2

CR592913 Related RAS viral (r-ras) oncogene homolog 2

BU608657 Transcribed locus

BX537500 Programmed cell death 4 (neoplastic transformation inhibitor)

BX537500 Programmed cell death 4 (neoplastic transformation inhibitor)

AK125855 DAZ associated protein 2

NM_005487 High-mobility group protein 2-like 1

NM_005487 High-mobility group protein 2-like 1

AF326917 Autism susceptibility candidate 2

AV727381 ubiqυinol-cytochrome c reductase core protein Il

NM_015113 Zinc finger, ZZ-type with EF hand domain 1

NM_014991 WD repeat and FYVE domain containing 3

BF694005 Mitochondrial ribosomal protein S31

BF694005 Mitochondrial ribosomal protein S31

AF034176 Nudix (nucleoside diphosphate linked moiety X)-type motif 3

NM_014991 WD repeat and FYVE domain containing 3

BX537630 V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)

AF034176 Nudix (nucleoside diphosphate linked moiety X)-type motif 3

BX537630 V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)

NM_002834 Protein tyrosine phosphatase, non-receptor type 11 (Noonan syndrome 1 )

AK074166 Deltex 4 homolog (Drosophila)

D31888 REST corepressor 1

AL832681 AT rich interactive domain 5B (MRF1-like)

AY647157 Chromodαmain helicase DNA binding protein 9

AY647157 Chromodomain helicase DNA binding protein 9

XM_043118 KIAA0286 protein

XM_042833 Zinc finger protein 609

BC035034 K1AA0033 protein

BC035034 KIAA0033 protein

BF339445 chimerin (chimaerin) 1

BQ057394 Syntaxin 10

AK126950 Heterogeneous nuclear ribonucleoprotein C (C1/C2)

AK090511 Exosome component 7

NMJ306256 Protein kinase N2

NM_006256 Protein kinase N2 AK074086 SEC6-like 1 (S. cerevisiae)

AJ420529 Syntaxin 7

AJ420529 Syntaxin 7

AW298092 KIAA0776 protein

AW298092 KIAA0776 protein

AK124768 Transportin 1

AL031781 quaking homolog, KH domain RNA binding (mouse)

NM_007013 WW domain containing E3 ubiquitin protein ligase 1

NM_007013 WW domain containing E3 ubiquitin protein ligase 1

AL581768 tubulin, alpha, ubiquitous

NM_198402 Protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b

AL023584 human immunodeficiency virus type I enhancer binding protein 2

BC015621 Chromosome 14 open reading frame 32

BC015621 Chromosome 14 open reading frame 32

CR627176 Brain and reproductive organ-expressed (TNFRSF1A modulator)

AL833173 Raft-linking protein

BF965156 Related RAS viral (r-ras) oncogene homolog

BX649135 DEAH (Asp-Glu-Ala-His) box polypeptide 29

BX649135 DEAH (Asp-Glu-Ala-His) box polypeptide 29

AY331186 EH domain binding protein 1

NM_014836 Rho-related BTB domain containing 1

NM_003794 Sorting nexin 4

AY331186 EH domain binding protein 1

CR590682 Tropomyosin 2 (beta)

AB011151 Zinc finger, CCHC domain containing 14

CR622683 Ts translation elongation factor, mitochondrial

AY309920 Lipoma HMGIC fusion partner-like 2

D87076 PHD finger protein 15

BF242969 Similar to peptidylprolyl isomerase A isoform 1; cyclophilin A; peptidyl-prolyl cis-trans isomerase A; T cell cyclophilin; rotamase; cyclosporin A-binding protein

NM_006505 Poliovirus receptor

XM_376903 KIAA0674

CR749647 TCDD-inducible poly(ADP-ribose) polymerase

NM_020429 SMAD specific E3 ubiquitin protein ligase 1

AK126525 Secreted protein, acidic, cysteine-rich (osteonectin)

NM_172171 Calcium/calmodulin-dependent protein kinase (CaM kinase) Il gamma

U82828 ataxia telangiectasia mutated (includes complementation groups A, C and D)

D42084 Methionyl aminopeptidase 1

BC038417 DEAH (Asp-Glu-Ala-His) box polypeptide 30

AB011154 KIAA0582

M89914 Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)

AB011154 KIAA0582

M89914 Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)

BQ073342 Protein phosphatase 1 , regulatory (inhibitor) subunit 14B

AL832598 Erythrocyte membrane protein band 4.1-like 3

BC014652 Hypothetical protein BC002942

AK026529 Transducin (beta)-like 2

AK098109 LIM and senescent cell antigen-like domains 1 CR749357 Phosphoinositide-3-kinase, catalytic, beta polypeptide

BX640698 Jumonji domain containing 1A

XM_291291 DDHD domain containing 2

BX537662 CDNA FLJ11519 fis, clone HEMBA1002348

AF503925 MDN1 , midasin homolog (yeast)

AL831978 Propionyl Coenzyme A carboxylase, beta polypeptide

AK128038 Ring finger protein 4

AK091125 Hypothetical protein LOC162427

NM_144710 Septin 10

BE222801 secretory carrier membrane protein 5

BC073970 Bicaudal D homolog 2 (Drosophila)

NM_015059 Talin 2

BX648248 Zinc finger, CCHC domain containing 11

AY203925 Patatin-like phospholipase domain containing 2

NM_006989 RAS p21 protein activator 4

NM_006989 RAS p21 protein activator 4

CR749360 Hypothetical protein LOC339287

XM_113678 Nucleoporin 16OkDa

AJ519841 Calmodulin regulated spectrin-associated protein 1

AJ519841 Calmodulin regulated spectrin-associated protein 1

AJ519841 Calmodulin regulated spectrin-associated protein 1

BC035560 Microfibrillar-associated protein 4

NM_199188 C-MpI binding protein

XM_032996 KIAA0819 protein

BM551450 Eukaryotic translation initiation factor 3 subunit k

BC064361 Pleckstrin homology domain containing, family M (with RUN domain) member 1

NM_032632 PoIy(A) polymerase alpha

AB011178 Pleckstrin homology domain containing, family E (with leucine rich repeats) member 1

NM_032632 PoIy(A) polymerase alpha

AF459094 Splicing factor, arginine/serine-rich 12

AB011157 Phosphatidylserine receptor

AB011157 Phosphatidylserine receptor

X97758 Ras homolog gene family, member E

BC042980 Hypothetical protein FLJ35801

AB033058 Discs, large homolog 3 (neuroendocrine-dlg, Drosophila)

AB002351 Desmuslin

BC035087 Hypothetical protein LOC157567

AF447875 Maternally expressed 3

XM_032901 KIAA0226 gene product

AK095954 Ribosomal protein L13

XM_032901 Kl AA0226 gene product

AK092923 Hypothetical gene BC008967

BF107506 Chorionic somatomammotropin hormone 2

CR592051 Non-metastatic cells 4, protein expressed in

Y08991 Phosphoinositide-3-kinase, regulatory subunit 4, p150

AK123395 Zinc finger protein 364

NM_033028 Bardet-Biedl syndrome 4

NM_033028 Bardet-Biedl syndrome 4 AB022657 KARP-1 -binding protein

NM_015245 Ankyrin repeat and sterile alpha motif domain containing 1

NM_020831 Megakaryoblastic leukemia (translocation) 1

AK091501 Ring finger and CHY zinc finger domain containing 1

NM_003348 Ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast)

NM_015282 Cytoplasmic linker associated protein 1

NM_006315 Ring finger protein 3

XM_051091 KIAA1040 protein

BX647467 Chromosome 6 open reading frame 133

NMjI 72171 Calcium/calmodulin-dependent protein kinase (CaM kinase) Il gamma

U19969 transcription factor 8 (represses interleukin 2 expression)

AL832656 Transcription factor 7-like 2 (T-cell specific, HMG-box)

BX647467 Chromosome 6 open reading frame 133

AL832656 Transcription factor 7-like 2 (T-cell specific, HMG-box)

AL832656 Transcription factor 7-like 2 (T-cell specific, HMG-box)

NM_203459 KIAA1078 protein

U 19969 transcription factor 8 (represses interleukin 2 expression)

NM_203459 KIAA1078 protein

AL096734 Hypothetical protein FLJ 12671

BC040198 Shadow of prion protein

AB046767 Transducin-like enhancer of split 3 (E(sp1 ) homolog, Drosophila)

AL050367 Chromosome 10 open reading frame 38

NM_001606 ATP-binding cassette, sub-family A (ABC1 ), member 2

NM_014765 Translocase of outer mitochondrial membrane 20 homolog (yeast)

AJ223321 - zinc finger protein 238

XM_051017 . KIAA0657 protein

XM_051017 KIAA0657 protein

AL833457 Son of sevenless homolog 1 (Drosophila)

BC028418 KIAA0602 protein

XM_371706 KIAA1109

AL833457 Son of sevenless homolog 1 (Drosophila)

NM_006910 Retinoblastoma binding protein 6

BU739767 Polymerase (RNA) Il (DNA directed) polypeptide J, 13.3kDa

NM_006910 Retinoblastoma binding protein 6

NM_015125 Capicua homolog (Drosophila)

BC066945 HDCMA18P protein

AB002348 KIAA0350 protein

XMJ085151 YLP motif containing 1

BF244604 Ferritin, light polypeptide

AK124878 KIAA0056 protein

AK056837 Ribosomal protein L13a

AK096303 Hypothetical protein FLJ38984

XM_371891 KIAA0877 protein

AL833083 Dishevelled associated activator of morphogenesis 2

NM_015275 KIAA1033 protein

NM_015275 KIAA1033 protein

AB028978 KIAA1055 protein

AK001740 Ankyrin repeat and MYND domain containing 2 AF038202 Clone 23570 mRNA sequence

AF038202 Clone 23570 mRNA sequence

NM_015635 DKFZP434C212 protein

NM_005967 NGFI-A binding protein 2 (EGR1 binding protein 2)

NM_015635 DKFZP434C212 protein

XM_041018 KIAA0367

XM_041018 KIAA0367

NM_002959 Sortilin 1

NM_032815 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein

NM_032815 Nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein

AK126636 Solute carrier family 1 (glutamate/neutral amino acid transporter), member 4

AK126636 Solute carrier family 1 (glutamate/neutral amino acid transporter), member 4

AK026295 CDNA: FLJ22642 fis, clone HSI06970

NM_032801 Junctional adhesion molecule 3

BC024325 KIAA0828 protein

AL834463 DJ467N11.1 protein

L00972 Cystathionine-beta-synthase

NM_012266 DnaJ (Hsp40) homolog, subfamily B, member 5

NM_016114 Ankyrin repeat and SOCS box-containing 1

NM_016114 Ankyrin repeat and SOCS box-containing 1

NM_015263 Rabconnectin-3

XM_087386 HEG homolog

U69127 Far upstream element (FUSE) binding protein 3

BX640616 PAX transcription activation domain interacting protein 1 like

CR593822 Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6

BX648749 Synaptojanin 2

AK023329 CDNA FLJ 13267 fis, clone OVARC1000964

XM_376905 EGF-like-domain, multiple 5

D43948 KIAA0097 gene product

BX648087 Hypothetical protein BC017169

NM_152300 DEAD (Asp-Glu-Ala-Asp) box polypeptide 52 ,

NM_032182 KIAA0157

NM_006591 Polymerase (DNA-directed), delta 3, accessory subunit

NM_032182 KIAA0157

AL833283 Dynamin binding protein

AK024044 Sjogren syndrome antigen A2 (6OkDa, ribonucleoprotein autoantigen SS-A/Ro)

XM_087353 KIAA0794 protein

BC021714 PTPRF interacting protein, binding protein 2 (liprin beta 2)

NM_005054 RAN binding protein 2-like 1

AB028976 Sterile alpha motif domain containing 4

XM_371417 KIAA0179

AF114264 Nexilin (F actin binding protein)

AF043897 Chromosome 9 open reading frame 3

BX537944 KIAA0276 protein

AK024044 Sjogren syndrome antigen A2 (6OkDa, ribonucleoprotein autoantigen SS-A/Ro)

BX537944 KIAA0276 protein

AB051480 Hypothetical gene supported by AB051480; NM_017940

BX537944 KIAA0276 protein BX537584 Activated RNA polymerase Il transcription cofactor 4

BU535774 Metallothionein 1E (functional)

BC066776 Zinc finger, DHHC domain containing 18

BM548204 Hypothetical protein MGC11308

Y16521 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2

BF337195 C-terminal binding protein 1

Y16521 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2

NM_006540 Nuclear receptor coactivator 2

BG033621 Tumor protein, translationally-controlled 1

AK021897 Chromosome 14 open reading frame 138

AK122767 Mitogen-activated protein kinase-activated protein kinase 5

AK097385 Ubiquitin specific protease 49

AP001745 PR domain containing 15

BC062618 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4

AK125022 Kinesin 2 60/7OkDa

AK125022 Kinesin 2 60/7OkDa

NM_015285 WD repeat domain 7

AK022481 Protein inhibitor of activated STAT, 4

AB062478 Kelch-like 18 (Drosophila)

NM_005791 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)

AK127355 Sec23 homolog A (S. cerevisiae)

NM_177438 Diceri , Dcr-1 homolog (Drosophila)

AK128263 Hypothetical protein MGC15523

BQ052504 Growth arrest and DNA-damage-inducible, gamma interacting protein 1

D30612 Zinc finger protein 282

AK074119 Zinc finger, ZZ domain containing 3

NM_003171 Suppressor of var1 , 3-like 1 (S. cerevisiae)

AK124547 Active BCR-related gene

BC065258 KIAA0052

NM_015076 Cyclin-dependent kinase (CDC2-like) 11

BC013121 KIAA0406 gene product

NM_015076 Cyclin-dependent kinase (CDC2-like) 11

AJ131244 SEC24 related gene family, member A (S. cerevisiae)

AJ131244 SEC24 related gene family, member A (S. cerevisiae)

BC031301 KIAA1185 protein

NM_015235 Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant

BX647120 Solute carrier family 30 (zinc transporter), member 1

AL833299 KIAA0962 protein

NM_020457 THAP domain containing 11

AL833299 KIAA0962 protein

AK095751 Ribosomal protein S6 kinase, 9OkDa, polypeptide 2

XM_041363 PDZ domain containing RING finger 3

BC053861 PHD finger protein 8

BF219234 RecQ protein-like (DNA helicase Q1-like)

BF219234 RecQ protein-like (DNA helicase Q1-like)

NM_152624 Decapping enzyme hDcp2

BG285188 Transcribed locus

BC049367 SET and MYND domain containing 2 CR598210 Chromosome 6 open reading frame 145

AB011166 SMC5 structural maintenance of chromosomes 5-like 1 (yeast)

AB011166 SMC5 structural maintenance of chromosomes 5-like 1 (yeast)

AL050331 TSPY-like 4

XM_495809 KIAA0592 protein

NM_001001323 ATPase, Ca++ transporting, plasma membrane 1

NM_005650 Transcription factor 20 (AR1 )

BC071602 RAB3 GTPase-ACTIVATING PROTEIN

AK095954 Ribosomal protein L13

BX647876 Hypothetical protein LOC137886

BX538123 Hypothetical protein FLJ12078

NM_001848 Collagen, type Vl, alpha 1

NM_001848 Collagen, type Vl, alpha 1

NM_001848 Collagen, type Vl, alpha 1

AB103330 KIAA1199

AB011100 KIAA0528 gene product

AK055913 Mitochondrial ribosomal protein S6

XM_031689 MAX gene associated

XM_038664 KIAA0564 protein

AL831849 Calmodulin binding transcription activator 2

BC066121 G protein-coupled receptor 116

BE251303 calreticulin

BE251303 calreticulin

NM_003845 Dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4

BU598062 Polymerase (RNA) Il (DNA directed) polypeptide I, 14.5kDa

XM_093895 KIAA0882 protein

AU154785 hypothetical protein LOC92249

NM_000919 Peptidylglycine alpha-amidating monooxygenase

NM_024312 MGC4170 protein

U66042 Chromosome X open reading frame 40

AK128870 Hypothetical protein FLJ 13511

AK094638 Beta-amyloid binding protein precursor

NM_015094 Hypermethylated in cancer 2

AL162068 Nucleosome assembly protein 1-like 1

BC050399 Radical fringe homolog (Drosophila)

AK128679 Hypothetical protein FLJ35827

AL080130 Full-length cDNA clone CS0DC015YK09 of Neuroblastoma Cot 25-normalized of Homo sapiens (human)

AK096313 Cysteinyl-tRNA synthetase

BC015529 Ribose 5-phosphate isomerase A (ribose 5-phosphate epimerase)

BC036661 Chemokine orphan receptor 1

BF791738 KIAA0738 gene product

BF791738 KIAA0738 gene product

NM_015336 Zinc finger, DHHC domain containing 17

BQ650835 V-Ha-ras Harvey rat sarcoma viral oncogene homolog

BE786164 activating transcription factor 2

AL080130 Full-length cDNA clone CS0DC015YK09 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) BC060511 Tousled-like kinase 2

NM_033480 F-box protein 9

CR606241 Actin, gamma 1

NM_147156 Transmembrane protein 23

NM_203446 Synaptojanin 1

XM_290629 Chromosome 14 open reading frame 78

AK094914 MRNA; cDNA DKFZp667B1718 (from clone DKFZp667B1718)

NM_020449 THO complex 2

BM911054 Hypothetical protein FLJ14346

AF231919 Chromosome 21 open reading frame 108

BC060511 Tousled-like kinase 2

AP000693 nuclear matrix protein NXP2

NM_012098 Angiopoietin-like 2

BF347326 myristoylated alanine-rich protein kinase C substrate

NM_012098 Angiopoietin-like 2

BX648931 Ankyrin repeat domain 15

BM923704 CCAAT/enhancer binding protein (C/EBP), delta

NM_015294 Tripartite motif-containing 37

BQ073453 Protein kinase C, delta binding protein

BM913099 Triosephosphate isomerase 1

NM_198400 Neural precursor cell expressed, developmentally down-regulated 4

NM_020235 Bobby sox homolog (Drosophila)

NM_020235 Bobby sox homolog (Drosophila)

AL534702 abhydrolase domain containing 3

NM_021167 Ocular development-associated gene

BX537405 RAN binding protein 6

BC040072 Golgi SNAP receptor complex member 1

BC040072 Golgi SNAP receptor complex member 1

NM_007124 Utrophin (homologous to dystrophin)

BF593908 TATA element modulatory factor 1

AL134904 " hypothetical protein FLJ20274

NM_004707 APG12 autophagy 12-like (S. cerevisiae)

NM_004600 Sjogren syndrome antigen A2 (6OkDa, ribonucleoprotein autoantigen SS-A/Ro)

BX537698 Nuclear factor l/B

AB007932 Plexin A2

AK090406 Hypothetical protein FLJ14888

BX537698 Nuclear factor l/B

BX537698 Nuclear factor l/B

AL832068 KIAA0999 protein

AB002377 Ankyrin repeat domain 28

AF061939 Staufen, RNA binding protein (Drosophila)

AK127045 Rho/rac guanine nucleotide exchange factor (GEF) 18

BC050458 ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit

NM_014815 Thyroid hormone receptor associated protein 4

NM_005406 Rho-associated, coiled-coil containing protein kinase 1

NM_004643 PoIy(A) binding protein, nuclear 1

NM_003011 SET translocation (myeloid leukemia-associated)

NM_003011 SET translocation (myeloid leukemia-associated) AY596970 GTPase activating Rap/RanGAP domain-like 1

NM_020119 Zinc finger CCCH type, antiviral 1

BC002763 Protein kinase, cAMP-dependent, regulatory, type II, alpha

XM_114303 FERM domain containing 4B

AF070584 ATP synthase mitochondrial F1 complex assembly factor 2

AL033538 Homo sapiens cDNA FLJ30991 fis, clone HLUNG1000041.

BC015781 CAMP responsive element binding protein 3-like 1

AK092915 N-terminal asparagine amidase

AK092915 N-terminal asparagine amidase

NM_183387 Echinoderm microtubule associated protein like 5

NM_183387 Echinoderm microtubule associated protein like 5

NMJ 44982 Hypothetical protein MGC23401

NM_005964 Myosin, heavy polypeptide 10, non-muscle

XM_087386 HEG homolog

BX648778 Phosphoinositide-3-kinase, class 2, alpha polypeptide

BM708212 Transcribed locus

NM_015346 Zinc finger, FYVE domain containing 26

NM_017934 Pleckstrin homology domain interacting protein

BC060788 Inositol 1 ,4,5-trisphosphate 3-kinase C

CR627037 YTH domain containing 2

BM993884 Hypothetical protein DT1 P 1A10

BX648424 Ribosomal protein L5

NMJ305453 Zinc finger protein 297

AK024841 Solute carrier family 35, member D2

AK024841 Solute carrier family 35, member D2

BM994378 Ribosomal protein L23a

BX647478 Casein kinase 1 , alpha 1

BC046445 Eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)

AK094162 DnaJ (Hsp40) homolog, subfamily C, member 9

NM_003185 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa

AK094162 DnaJ (Hsp40) homolog, subfamily C, member 9

NM_002737 Protein kinase C, alpha

AL033377 G protein-coupled receptor 126

BC032854 Zuotin related factor 1

BF510484 RCD1 required for cell differentiationi homolog (S. pombe)

BC028714 K1AA0759

AB096256 Unc-5 homolog B (C. elegans)

BC044590 ARP3 actin-related protein 3 homolog (yeast)

BC044590 ARP3 actin-related protein 3 homolog (yeast)

AA128023 START domain containing 13

AL031709 hypothetical protein MGC24381

AL031709 hypothetical protein MGC24381

XM_039796 TRAF2 and NCK interacting kinase

XMJD39796 TRAF2 and NCK interacting kinase

NM_033380 Collagen, type IV, alpha 5 (Alport syndrome)

NMJ315040 Phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinaser type III

BC017222 Sequestosome 1

NM_014096 Solute carrier family 43, member 3 AL031177 hypothetical protein MGC44287

BC036321 NIMA (never in mitosis gene a)-related kinase 3

AL713669 Kelch-like 9 (Drosophila)

XM_045423 KIAA0701 protein

BX537963 Solute carrier family 36 (proton/amino acid symporter), member 1

NM_033512 TS PY-I ike 5

BE222709 microfibrillar-associated protein 3

AW007573 DKFZP586L151 protein

BM457975 Mediator of RNA polymerase Il transcription, subunit 8 homolog (yeast)

BM457975 Mediator of RNA polymerase Il transcription, subunit 8 homolog (yeast)

NM_130839 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome)

AF116725 Glycine cleavage system protein H (aminomethyl carrier)

NM_014279 Olfactomedin 1

AL022237 malonyl-CoA:acyl carrier protein transacylase (malonyltransferase)

AF116725 Glycine cleavage system protein H (aminomethyl carrier)

BU730087 BTG family, member 3

NM_003253 T-cell lymphoma invasion and metastasis 1

NM_002828 Protein tyrosine phosphatase, non-receptor type 2

NM_002828 Protein tyrosine phosphatase, non-receptor type 2

NM_003068 Snail homolog 2 (Drosophila)

NM_198935 Synovial sarcoma translocation gene on chromosome 18-like 1

BC062616 Protein serine kinase H 1

AK126364 Hypothetical protein LOC54103

BC034762 Golgi SNAP receptor complex member 2

CR589998 F-box and leucine-rich repeat protein 14

AA521267 KIAA0346 protein

AW299740 dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)

BX648365 CDC10 cell division cycle 10 homolog (S. cerevisiae)

NM_032102 Splicing factor, arginine/serine-rich, 46kD

XM_037523 KIAA1076 protein

BC073970 Bicaudal D homolog 2 (Drosophila)

BC016962 Homo sapiens, clone IMAGE:4214654, mRNA

BC016962 Homo sapiens, clone IMAGE:4214654, mRNA

AK096156 Tropomodulin 1

AK055913 Mitochondrial ribosomal protein S6

NM_014810 Centrosome-associated protein 350

AK090531 CDNA FLJ33212 fis, clone ADRGL2009533

CR749323 Sp3 transcription factor

AK022877 Clone TUA8 Cri-du-chat region mRNA

NM_015696 Glutathione peroxidase 7

AF233450 Pecanex homolog (Drosophila)

AL049650 small nuclear ribonucleoprotein polypeptides B and B1

NM_015133 Mitogen-activated protein kinase 8 interacting protein 3

BG289914 RCD1 required for cell differentiationi homolog (S. pombe)

BC034762 Golgi SNAP receptor complex member 2

AF034374 Molybdenum cofactor synthesis 1

BG714000 Cyclin-dependent kinase inhibitor 1 C (p57, Kip2) BG714000 Cydin-dependent kinase inhibitor 1C (p57, Kip2)

BC030705 SUMO1/sentrin specific protease 5

BC063882 Zinc finger DAZ interacting protein 3

BG538564 ferritin, light polypeptide

AY302110 MYC induced nuclear antigen

AY302110 MYC induced nuclear antigen

AK126661 Component of oligomeric golgi complex 7

BC035331 TIR domain containing adaptor inducing interferon-beta

AL031447 hypothetical protein MGC33488

BX436497 T cell receptor beta chain BV20S1 BJ1 -5 BC1

NM_133631 Roundabout, axon guidance receptor, homolog 1 (Drosophila)

BC042947 Hypothetical protein LOC201229

AB002324 Zinc finger protein 629

BC040531 Activin A receptor, type IB

AK024763 Small nuclear RNA activating complex, polypeptide 5, 19kDa

BC034762 Golgi SNAP receptor complex member 2

XM_166479 KIAA0240

BC008785 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa

NM_198181 Similar to golgi autoantigen, golgin subfamily a, 2; SY11 protein

CR606241 Actin, gamma 1

NM_005829 Adaptor-related protein complex 3, sigma 2 subunit

AL832741 Zinc finger protein 187

AK125829 Hypothetical protein LOC92482

AB096248 Salt-inducible serine/threonine kinase 2

AL049593 phospholipase C, beta 1 (phosphoinositide-specific)

NM_000991 Ribosomal protein L28

AK125829 Hypothetical protein LOC92482

NM_177968 Protein phosphatase 1 B (formerly 2C), magnesium-dependent, beta isoform

BX649106 Exosome component 9

AK094949 Progesterone receptor membrane component 2

NM_177438 . Diceri, Dcr-1 homolog (Drosophila)

BC047534 Paraneoplastic antigen

AA460694 KIAA1354 protein

XM_370682 Serotonin-7 receptor pseudogene

AC002550 hypothetical protein MGC35048

NM_015278 SAM and SH3 domain containing 1

AC002550 hypothetical protein MGC35048

AJ441078 ATPase, Class V, type 10D

AF330046 Chromosome 13 open reading frame 24

AF030339 Plexin C1

XM_208766 KIAA0284

NM_017890 Cohen syndrome 1

AK091166 Secretory carrier membrane protein 4

BU739864 Chromosome 14 open reading frame 109

AK075234 Chromosome 9 open reading frame 13

AL577024 hypothetical protein LOC221362

AB020647 F-box and leucine-rich repeat protein 7

AV712064 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

BX647371 Neuralized-like (Drosophila)

AL833191 SMC2 structural maintenance of chromosomes 2-like 1 (yeast)

XM_039385 KIAA1093 protein

BC047569 Membrane-associated RING-CH protein III

AJ290445 Sterile alpha and TIR motif containing 1

AL080215 Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)

NM_001453 Forkhead box C1

XM_047357 Lupus brain antigen 1

NM_014363 Spastic ataxia of Charlevoix-Saguenay (sacsin)

NMJ306301 Mitogen-activated protein kinase kinase kinase 12

NM_006301 Mitogen-activated protein kinase kinase kinase 12

AK127306 Gamma tubulin ring complex protein (76p gene)

BC030287 Membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)

NM_015018 KIAA1117

CR596615 Promethin

BE875786 cathepsin B

BE875786 cathepsin B

NM_015458 Myotubularin related protein 9

AK126383 Dehydrogenase/reductase (SDR family) member 1

BE327172 v-jun sarcoma virus 17 oncogene homolog (avian)

XM_291339 Spermidine/spermine N1-acety] transferase-like 1

NM_005407 Sal-like 2 (Drosophila)

NM_016107 Zinc finger RNA binding protein

X14487 keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris)

NM_138799 O-acyltransferase (membrane bound) domain containing 2

XM_291339 Spermidine/spermine N1-acetyl transferase-like 1

AK128695 Collagen, type Vl, alpha 2

NM_130839 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman syndrome)

BC050289 Sorting nexin 13

BC035582 Tripartite motif-containing 22

BX647651 Hypothetical protein FLJ38348

AB020656 Cylindromatosis (turban tumor syndrome)

NM_153818 Peroxisome biogenesis factor 10

BQ642604 Nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)

NM_205843 Nuclear factor I/C (CCAAT-binding transcription factor)

XM_290517 KIAA0404 protein

NM_015905 Transcriptional intermediary factor 1

NM_012393 Phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

NM_015898 Zinc finger and BTB domain containing 7

BX648723 KIAA0423

NM_002719 Protein phosphatase 2, regulatory subunit B (B56), gamma isoform

AF093419 Multiple PDZ domain protein

NM_012309 SH3 and multiple ankyrin repeat domains 2

NM_012309 SH3 and multiple ankyrin repeat domains 2

BC054491 Eukaryotic translation initiation factor 2C, 2

AK095785 KIAA1049 protein BC054492 RAB GTPase activating protein 1

AK024130 Chromosome 6 open reading frame 162

AK055235 Chromosome X open reading frame 40

AL050154 CDNA FLJ23620 fis, clone ADSE00903

NM_004639 HLA-B associated transcript 3

AL551971 protein arginine N-methyltransf erase 3{hnRNP methyltransferase S. cerevisiae)-like 3

AL031778 nuclear transcription factor Y, alpha

NM__017590 Rotavirus X protein associated with NSP3

BC001336 Poliovirus receptor-related 3

CR749485 Vesicle-associated membrane protein 1 (synaptobrevin 1)

AF022789 Ubiquitin specific protease 12

AL050385 NIMA (never in mitosis gene a)-related kinase 1

AB007925 Formin binding protein 2

BC039299 Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein)

AL050385 NIMA (never in mitosis gene a)-related kinase 1

AL031290 placenta-specific 3

AK128072 Malate dehydrogenase 2, NAD (mitochondria))

AF319573 Three prime repair exonuclease 2

BM696912 Ras-induced senescence 1

AB007964 KIAA0495

NM_020177 Fem-1 homolog c (C.elegans)

AI745185 Yes-associated protein 1 , 65kDa '

BC033391 Hypothetical protein PP1665

BM917453 H2A histone family, member X

BC048011 Hypothetical protein BC015148

BM994563 Ribosomal protein S4, X-linked

BG714000 Cyclin-dependent kinase inhibitor 1C (p57, Kip2)

CR749206 KIAA0779 protein

AK130324 Ribosomal protein S11

CR749206 KIAA0779 protein

CR749206 KIAA0779 protein

NM_018672 ATP-binding cassette, sub-family A (ABC1 ), member 5

BF206515 Heterogeneous nuclear ribonucleoprotein A1

AK055106 General transcription factor HH, polypeptide 5

AK131528 KIAA0802

AL832723 Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1 , 37kDa)

XM_290401 Hypothetical protein LOC340318

BC028694 Tudor domain containing 7

AK128179 Sorting nexin 1

N64622 similar to RIKEN cDNA 4933424N09 gene

AV711183 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1

NM_00i 005159 Scm-like with four mbt domains 1

BC047510 Progestin and adipoQ receptor family member III

BF439983 caspase 8, apoptosis-related cysteine protease

AK124567 3-hydroxyisobutyryl-Coenzy me A hydrolase

XM_375086 Zinc finger and BTB domain containing 1

AK096147 Ribosomal protein S12

AK023076 Hypothetical protein CL640 N91149 Transcribed locus

AB014585 KIAA0685

AK126784 Chimerin (chimaerin) 2

AK094413 MRNA full length insert cDNA clone EUROIMAGE 1585492

H15535 Homo sapiens mRNA; cDNA DKFZp586H823 (from clone DKFZp586l1823)

AB028987 Chromosome 19 open reading frame 7

BX538174 Hypothetical protein LOC286148

AF520570 Hypothetical protein MGC35048

NM_007202 A kinase (PRKA) anchor protein 10

NM_194430 Angiogenin, ribonuclease, RNase A family, 5

AK123513 Chromosome 14 open reading frame 124

AK123690 Ribophorin Il

Y12781 Transducin (beta)-like 1X-linked

BC077728 Hypothetical protein LOC126208

BF033683 gb:BF033683 /DB_XREF=gi:10741395 /DB_XREF=601453992F1 /CLONE=IMAGE:3857711 /FEA=EST /CNT=88 /TID=Hs.279903.2 fTIER=ConsEnd /STK=O /UG=Hs.2799O3 /LL=6009 /UG_GENE=RHEB2 /UG_TITLE=Ras homolog enriched in brain 2

NM_020673 RAB22A, member RAS oncogene family

BX647823 KIAA0931 protein

CR601335 Hypothetical protein LOC220686

AK125446 Ras homolog enriched in brain

NM_015608 Chromosome 10 open reading frame 137

NM_006873 TFIIA-alpha/beta-like factor

BF683700 Ribosomal protein S19

NM_000885 Integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)

U62325 amyloid beta (A4) precursor protein-binding, family B, member 2 (Fe65-like)

NM_198963 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

BQ687514 Protease, serine, 3 (mesotrypsin)

AK095966 Hypothetical protein MGC3047

BX641112 Tumor suppressor candidate 3

AI968085 wingless-type MMTV integration site family, member 5A

NM_001233 Caveolin 2

BE786348 Ribonuclease P 4OkDa subunit

NM_001848 Collagen, type Vl, alpha 1

AL049974 CDNA FLJ26539 fis, clone KDN09310

NM_194356 Epimorphin

AB028957 SATB family member 2

NM_001005388 Neurofascin

AK123525 RAB1A, member RAS oncogene family

NM_003870 IQ motif containing GTPase activating protein 1

NM_130839 Ubiquitin protein ligase E3A (human papilloma virus E6-associated protein, Angelman ' syndrome)

BC035616 Metaxin 1

BM691419 Transcribed locus

AK123011 Zinc finger protein 184 (Kruppel-like)

BF983396 Glyceraldehyde-3-phosphate dehydrogenase

NM_198544 Cortistatin

AK126071 Hypothetical protein BC001096 AB016816 Malignant fibrous histiocytoma amplified sequence 1

AL117583 Williams Beuren syndrome chromosome region 2OC

AI800983 cleavage and polyadenylation specific factor 5, 25 kDa

BC084565 Neuronal PAS domain protein 2

AB023191 KIAA0974

BC051689 Protein phosphatase 1 , regulatory subunit 7

BX648642 GPI deacylase

BF983406 heterogeneous nuclear ribonucleoprotein H1 (H)

NM_006768 BRCA1 associated protein

AK055201 Potassium channel tetramerisation domain containing 7

AK122757 Tubulin, beta, 4

AY062434 Eukaryotic translation elongation factor 1 alpha 1

AB028949 KIAA1026 protein

AK092254 Vesicle-associated membrane protein 4

AK057718 KIAA0073 protein

NMJD33450 ATP-binding cassette, sub-family C (CFTR/MRP), member 10

BC007318 Microtubule-associated protein, RP/EB family, member 2

BM809871 Mitogen-activated protein kinase kinase 2

AK123690 Ribophorin ll

BX647456 YY1 transcription factor

AW592563 plasticity related gene 1

BC015781 CAMP responsive element binding protein 3-like 1

AL110129 Mitochondrial ribosomal protein S22

BC008767 Acyl-Coenzyme A oxidase 1 , palmitoyl

BE908217 annexin A2

BM542040 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)

AK074842 Splicing factor, arginine/serine-rich 14

BE965369 coagulation factor Il (thrombin) receptor-like 1

L38951 Karyopherin (importin) beta 1

BC068480 Chromosome 14 open reading frame 147

NM_003869 Carboxylesterase 2 (intestine, liver)

AJ012755 TL132 protein

NM_176789 Myotubularin related protein 1

BF240734 Actin related protein 2/3 complex, subunit 2, 34kDa

AK094109 Poly(rC) binding protein 2

NM_002740 Protein kinase C, iota

NM_000426 Laminin, alpha 2 (merosin, congenital muscular dystrophy)

NM_014369 Protein tyrosine phosphatase, non-receptor type 18 (brain-derived)

BC035498 Cyclin E1

CD511787 Putative lymphocyte G0/G1 switch gene

CR612042 Protein F25965 '

AK122680 Similar to hypothetical protein MGC13138

CR609500 Hypothetical protein MGC9084

AK122680 Similar to hypothetical protein MGC13138

BC071602 RAB3 GTPase-ACTIVATING PROTEIN

BC071602 RAB3 GTPase-ACTIVATING PROTEIN

AK092982 Hypothetical protein LOC285148

BC069256 Ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) NM_058183 SON DNA binding protein

NM_000337 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)

BC016863 Sorting nexin 3

XM_371617 TBP-interacting protein

AK096865 Hypothetical protein H41

BC030593 Solute carrier family 18 (vesicular monoamine), member 2

NM_007144 Ring finger protein 110

NM_015554 Glucuronyl C5-epimerase

AK096865 Hypothetical protein H41

AL049699 RWD domain containing 2

AK129550 Sim ilar to R28379J

BX647605 Squalene epoxidase

BE042354 lactate dehydrogenase B

AK055675 Clone 23728 mRNA sequence

AK074518 Odd-skipped-related 2A protein

AK027239 Eukaryotic translation initiation factor 4E member 2

AK027239 Eukaryotic translation initiation factor 4E member 2

CR626605 Serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1

L38951 Karyopherin (importin) beta 1

L38951 Karyopherin (importin) beta 1

BX647605 Squalene epoxidase

NM_004329 Bone morphogenetic protein receptor, type IA

U01877 E1 A binding protein p300

AK055180 Programmed cell death 2

AY062434 Eukaryotic translation elongation factor 1 alpha 1

XM_379527 Hypothetical gene LOC155065

BF572302 Ribosomal protein L14

AK092512 Solute carrier family 16 (monocarboxylic acid transporters), member 5

AK125834 FUS interacting protein (serine-arginine rich) 1

NM_003607 CDC42 binding protein kinase alpha (DMPK-like)

AK057153 Putative dimethyladenosine transferase >

BQ218042 Opa-interacting protein 5

AA425633 KIAA0545 protein

AK096924 Ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)

AK096079 Transcription elongation factor B (SIlI), polypeptide 3 (11 OkDa, elongin A)

BM994500 Rho GDP dissociation inhibitor (GDI) alpha

BX647173 MRNA; cDNA DKFZp686L22239 (from clone DKFZp686L22239)

AL050258 Tuftelin interacting protein 11

XM_496399 Chomosome one amplified sequence 1 cyclophilin

CR599412 HepG23' region Mbol cDNA, clone hmd6a12m3.

CR595055 Chromosome 18 open reading frame 10

CR595055 Chromosome 18 open reading frame 10

BX647205 Heterogeneous nuclear ribonucleoprotein H1 (H)

BC041479 Collagen, type IX, alpha 2

BC045542 Kinesin family member 3A

AK096144 Sphingomyelin phosphodiesterase, acid-like 3A

CR625010 Zinc finger protein 307

AL833393 Carbonic reductase 4 AK092463 Melanoma antigen, family D, 2

NM_013296 G-protein signalling modulator 2 (AGS3-like, C. elegans)

BU742440 Metallothionein 1 F (functional)

XM_374432 Similar to Kl AA0363

AK098239 Dihydroorotate dehydrogenase

AL031588 hypothetical protein FLJ10140

CR749251 Scaffold attachment factor B

BF509224 Transcribed locus

AB011129 Zinc finger protein 500

NM_002317 Lysyl oxidase

BE312027 ribosomal protein L27

AK056117 Hypothetical protein MGC33887

AK094717 Tubulin, alpha, ubiquitous

AK090511 Exosome component 7

NM_006200 Proprotein convertase subtilisin/kexin type 5

BC041094 TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa

NM_006761 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide

AK125022 Kinesin 2 60/7OkDa

AK160373 Hypothetical protein DKFZp547K1113

BX640676 Regeneration associated muscle protease

NM_004170 Solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1

NMJ 45799 Septin 6

AK126486 Williams-Beuren Syndrome critical region protein 20 copy B

AK122956 Methionine-tRNA synthetase

AK128814 CDNA FLJ25106 fis, clone CBR01467

CR749432 PMS1 postmeiotic segregation increased 1 (S. cerevisiae)

NM_152275 Hypothetical protein FLJ13946

AL389951 Nucleoporin 5OkDa

AK09R079 Transcription elongation factor B (SlII), polypeptide 3 (11OkDa, elopgin A)

AF070595 Clone 24583 mRNA sequence

AK095570 Ribosomal protein L35a

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

U66589 Hypothetical LOC388650

J05581 Mucin 1 , transmembrane

NM_018364 Round spermatid basic protein 1

BM457975 Mediator of RNA polymerase Il transcription, subunit 8 homolog (yeast)

BC042172 Hypothetical protein MGC14276

BQ573872 Transcribed locus

BX537653 Centrosome protein cep290

NM_004315 N-acylsphingosine amidohydrolase (acid ceramidase) 1

AA129753 Rab geranylgeranyltransferase, beta subunit

NM_005911 Methionine adenosyltransferase II, alpha

AF213668 Transcription factor-like 4

BC041409 Basic helix-loop-helix domain containing, class B, 9

BC047523 Calmodulin 1 (phosphorylase kinase, delta)

NM_003004 Secreted and transmembrane 1 NM_003072 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

BX647541 Hypothetical protein LOC283824

AA515698 tubulin, beta, 2

AK023052 Metallophosphoesterase 1

BC025335 Lysosomal-associated membrane protein 1

XM_371575 Formin binding protein 3

NM_003200 Transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)

NM_018639 WD repeat and SOCS box-containing 2

BM912880 Cytochrome c oxidase subunit Vb

BX100675 Transcribed locus

CR627212 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1 , cardiac muscle

AK128280 Karyopherin alpha 1 (importin alpha 5)

BX648174 Cyclin T2

NM_001456 Filamin A, alpha (actin binding protein 280)

XM_084529 KIAA0298 gene product

CA432604 Full length insert cDNA YH77E09

BU738852 Similar to Eukaryotic translation initiation factor 5A (elF-5A) (elF-4D) (Rev-binding factor)

NM_006451 PoIy(A) binding protein interacting protein 1

AK125467 Heat shock transcription factor 1

BU738852 Similar to Eukaryotic translation initiation factor 5A (elF-5A) (elF-4D) (Rev-binding factor)

BC028355 Nuclear protein double minute 1

BX647131 RNA binding motif protein, X-linked

NM_003480 Microfibrillar associated protein 5

NM_003480 Microfibrillar associated protein 5

BC063426 Guanine nucleotide binding protein (G protein), alpha 11 (Gq class)

AK126375 Williams Beuren syndrome chromosome region 2OA

CR749322 Zinc finger protein 638

NM_016599 Myozenin 2

NMJ306024 Taxi (human T-cell leukemia virus type I) binding protein 1

BE253850 Emopamil binding protein (sterol isomerase)

BC065204 FLJ35348

AK024385 A disintegrin and metalloproteinase domain 12 (meltrin alpha)

AK091563 Proenkephalin

X02160 Insulin receptor

NM_004272 Homer homolog 1 (Drosophila)

AK124318 Chromosome 14 open reading frame 120

AK024387 Protein tyrosine phosphatase, receptor type, A

NM_006367 CAP, adenylate cyclase-associated protein 1 (yeast)

AK024387 Protein tyrosine phosphatase, receptor type, A

NM_000186 Complement factor H

BM554167 Laminin receptor 1 (ribosomal protein SA, 67kDa)

NM_003619 Protease, serine, 12 (neurotrypsin, motopsin)

L38951 Karyopherin (importin) beta 1

AI039084 Homo sapiens cDNA FLJ35942 fis, clone TESTI2011712.

AK024375 Abhydrolase domain containing 5

NM_000245 Met proto-oncogene (hepatocyte growth factor receptor) AK091800 A disintegrin and metalloproteinase domain 23

BG393795 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)

NM_006549 Calcium/calmodulin-dependent protein kinase kinase 2, beta

AK124305 Chromosome 19 open reading frame 29

AL049435 CDNA FLJ13601 fis, clone PLACE1010069

AK097024 START domain containing 5

NM_183414 Ubiquitin protein ligase E3B

BM907805 H3 histone, family 3B (H3.3B)

BM907805 H3 histone, family 3B (H3.3B)

AL157435 Tumor necrosis factor receptor superfamily, member 6b, decoy

AF070632 Clone 24405 mRNA sequence

AL524262 mitochondrial GTP binding protein

NM_017983 WD40 repeat protein Interacting with phospholnositides of 49kDa

BC052781 RAN binding protein 9

NM_005629 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8

BM920882 Homeo box A5

CR599916 Cytochrome c oxidase subunit VIIc

X93921 Dual specificity phosphatase 7

M64930 Protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform

NMJD04719 Splicing factor, arginine/serine-rich 2, interacting protein

BX648562 Similar to RIKEN cDNA 1810038N08 gene

AK075009 RNA binding motif protein 8A

AK123087 Zinc finger, CSL domain containing 3

NM_001777 CD47 antigen (Rh-related antigen, integrin-associated signal transducer)

NM_003601 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

BX647478 Casein kinase 1 , alpha 1

NM_206914 Hepatocellularcarcinoma-associated antigen HCA557a

AL162068 Nucleosome assembly protein 1-like 1

NM_080927 Discoidin, CUB and LCCL domain containing 2

AK055119 Pyruvate dehydrogenase kinase, isoenzyme 2

NM_014629 Rho guanine nucleotide exchange factor (GEF) 10

AK090996 Thy-1 cell surface antigen

AL136632 Chromosome 6 open reading frame 62

NM_080927 Discoidin, CUB and LCCL domain containing 2

AL136632 Chromosome 6 open reading frame 62

AK090845 U2(RNU2) small nuclear RNA auxiliary factor 1-like 2

BU603847 Transcription elongation factor B (Sill), polypeptide 2 (18kDa, elongin B)

L36140 RecQ protein-like (DNA helicase Q1-like)

NM_006937 SMT3 suppressor of mif two 3 homolog 2 (yeast)

NM_006937 SMT3 suppressor of mif two 3 homolog 2 (yeast)

AK094638 Beta-amyloid binding protein precursor

AK094638 Beta-amyloid binding protein precursor

AK127278 Tripartite motif-containing 3

AK122813 Polymerase (RNA) Il (DNA directed) polypeptide E, 25kDa

AL832404 Phosphatidylinositol glycan, class L

AK055869 Ribosomal protein S16

AK095066 Transcription factor 4 CR622599 Adenine phosphoribosyltransferase

AA161026 Homo sapiens transcribed sequence with strong similarity to protein pir:JC2399 (H.sapiens)

JC2399 PMS4 homolog mismatch repair protein - human

NM_001423 Epithelial membrane protein 1

AB023191 KIAA0974

AK128774 Mitochondrial ribosomal protein L23

AK125296 Methionyl aminopeptidase 2

AL832604 RNA binding motif protein 9

NM_004315 N-acylsphingosine amidohydrolase (acid ceramidase) 1

AA845258 serologically defined colon cancer antigen 33

XM_034274 V-myb myeloblastosis viral oncogene homolog (avian)-like 1

BC048987 Hypothetical protein LOC339005

NIVM30830 Leucine rich repeat containing 15

AK056803 H2A histone family, member Z

NM_021143 Zinc finger protein 20 (KOX 13)

AJ627032 Nipped-B homolog (Drosophila)

BU739822 DnaJ (Hsp40) homolog, subfamily C, member 4

NM_173500 Tau tubulin kinase 2

NM_002886 RAP2B, member of RAS oncogene family

NM_004504 HIV-1 Rev binding protein

N51708 APG12 autophagy 12-like (S. cerevisiae)

CR623038 Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein

AK125608 Major histocompatibility complex, class I, A

NIVM98715 Prostaglandin E receptor 3 (subtype EP3)

BX537507 Zinc finger protein 19 (KOX 12)

AK024375 Abhydrolase domain containing 5

NM_177439 FtsJ homolog 1 (E. coli)

BC051716 Rap2 interacting protein x

AL049935 Formin binding protein 1

BF570942 Ribosomal protein S7

AB011539 EGF-like-domain, multiple 3 .

CR619156 Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila)

BC063426 Guanine nucleotide binding protein (G protein), alpha 11 (Gq class)

BE964655 GT198, complete ORF

NM_014810 Centrosome-associated protein 350

NM_014810 Centrosome-associated protein 350

CR749645 KIAA1005 protein

T87225 Homo sapiens LOC342202 (LOC342202), mRNA

BM907839 Ribosomal protein L29

XM_496203 Similar to KIAA0160 gene product is novel.

AK124335 CDKN1 A interacting zinc finger protein 1

AK124335 CDKN1A interacting zinc finger protein 1

AL137653 C-terminal binding protein 1

AU 37653 C-terminal binding protein 1

AB007940 RAB GTPase activating protein 1-like

NM_015200 SCC-112 protein

AK090400 Chromosome 19 open reading frame 6

BF680536 Spermidine/spermine N1-acetyltransferase BC011549 ATP synthase, H+ transporting, mitochondrial FO complex, subunit s (factor B)

NM_006386 DEAD (Asp-Glu-Ala-Asp) box polypeptide 17

AK098486 Hypothetical protein MGC11061

BU587578 Regulator of G-protein signalling 10

BI254120 Ribosomal protein S10

BG292067 Myosin, light polypeptide 6, alkali, smooth muscle and non-muscle

AK094652 Ribosomal protein S20

AK126479 Vestigial like 4 (Drosophila)

NM_000821 Gamma-glutamyl carboxylase

NM_000821 Gamma-glutamyl carboxylase

NM_198974 PTK9 protein tyrosine kinase 9

BQ934366 Hypothetical protein HSPC111

AK095702 Splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)

NM_194428 DEAH (Asp-Glu-Ala-His) box polypeptide 34

AK091595 Integrin, beta 5

AK091595 Integrin, beta 5

BF210063 Interferon induced transmembrane protein 1 (9-27)

BE501352 myc-induced nuclear antigen, 53 kDa

AK125313 Similar to Group X secretory phospholipase A2 precursor (Phosphatidylcholine 2- acylhydrolase GX) (GX SPLA2) (sPLA2-X)

BC000972 Chromosome X open reading frame 37

BC038117 Lysosomal associated protein transmembrane 4 beta

AK125819 Gelsolin (amyloidosis, Finnish type)

BC067789 Ribosomal protein L37a

AL832147 Myelodysplasia syndrome 1

NM_006859 Lipoic acid synthetase

AF072250 Methyl-CpG binding domain protein 4

BC029803 Hypothetical protein MGC39900

NM_015172 HBxAg transactivated protein 2

NM_015172 HBxAg transactivated protein 2

NM_021960 Myeloid cell leukemia sequence 1 (BCL2-related)

NM_021960 Myeloid cell leukemia sequence 1 (BCL2-related)

BC008402 Single-stranded DNA binding protein 1

AK056434 Unknown MGC21654 product

L13436 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)

M98343 Cortactin

M98343 Cortactin

BU502624 Secreted protein of unknown function

AK054814 Meisi , myeloid ecotropic viral integration site 1 homolog 4 (mouse)

NMJD02743 Protein kinase C substrate 80K-H

NM_002719 Protein phosphatase 2, regulatory subunit B (B56), gamma isoform

NM_007043 H1V-1 rev binding protein 2

AK001980 Poly (ADP-ribose) polymerase family, member 2

AW149846 glutathione peroxidase 3 (plasma)

AK074842 Splicing factor, arginine/serine-rich 14

NM_003902 Far upstream element (FUSE) binding protein 1

AK055053 Serine hydroxymethyltransferase 2 (mitochondrial)

AK055053 Serine hydroxymethyltransferase 2 (mitochondrial) AK125931 Ribosomal protein S21

NM_006310 Aminopeptidase puromycin sensitive

AK095302 G protein-coupled receptor 161

AL832654 GDP-mannose 4,6-dehydratase

AK021884 Hypothetical protein FLJ11822

AF467287 LPS-responsive vesicle trafficking, beach and anchor containing

BF195104 Homo sapiens, similar to lymphocyte-specific protein 1; Lymphocyte-specific protein pp52, clone IMAGE:4801360, mRNA

AK055235 Chromosome X open reading frame 40

AK075009 RNA binding motif protein 8A

AK023141 FAST kinase

NM_000060 Biotinidase

NM_006197 Pericentriolar material 1

BG107659 FK506 binding protein 1A, 12kDa

AK131426 PDZ and LIM domain 7 (enigma)

AL043487 FGFR1 oncogene partner

AK091407 Mitochondrial carrier triple repeat 1

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

NM_014644 Phosphodiesterase 4D interacting protein (myomegalin)

BC031224 Nudix (nucleoside diphosphate linked moiety X)-type motif 13

NM_016374 AT rich interactive domain 4B (RBP1- like)

NM_152707 Solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16

NM_006276 Splicing factor, arginine/serine-rich 7, 35kDa

CR608385 Ribosomal protein L24

AK095788 Polymerase (RNA) Il (DNA directed) polypeptide D

BQ230447 ATPase, H+ transporting, lysosomal 9kDa, VO subunit e

BQ230447 ATPase, H+ transporting, lysosomal 9kDa, VO subunit e

CR591869 Phosphatidylinositol glycan, class B

CR591869 Phosphatidylinositol glycan, class B

NM_199188 C-MpI binding protein

NM_080425 GNAS complex locus

NM_001218 Carbonic anhydrase XII

BM456985 Sim ilar to BLOCK 23

NMJD03257 Tight junction protein 1 (zona occludens 1)

U59309 Fumarate hydratase

S59184 RYK receptor-like tyrosine kinase

NM_003796 Chromosome 19 open reading frame 2

NM_003687 PDZ and LIM domain 4

NM_020524 Pre-B-cell leukemia transcription factor interacting protein 1

AK090459 Nuclear factor (erythroid-derived 2)-like 1

AF318353 Mannosidase, alpha, class 1C, member 1

BC030291 ADP-ribosylation factor 6

CR749825 Hypothetical protein MGC29875

NM_000391 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)

NM_012432 SET domain, bifurcated 1

BC040500 DiGeorge syndrome critical region gene 2

NM_001848 Collagen, type Vl, alpha 1

BC042295 HLA-B associated transcript 2 N21364 Homo sapiens cDNA FLJ38835 fls, clone MESAN2002424.

AJ010841 Thioredoxin-like 2

BM994491 Ferritin, heavy polypeptide 1

CR749486 Pleckstrin homology domain containing, family C (with FERM domain) member 1

BM464229 Complement component 1 , q subcomponent binding protein

BX648323 X (inactive)-specific transcript

BE674061 protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin)

XM_038664 KIAA0564 protein

BX537676 Cytochrome P450, family 3, subfamily A, polypeptide 5

S78234 Cell division cycle 27

NM_007144 Ring finger protein 110

BM994351 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa

BQ230447 ATPase, H+ transporting, lysosomal 9kDa, VO subunit e

NMJD00080 Cholinergic receptor, nicotinic, epsilon polypeptide

IMM_015881 Dickkopf homolog 3 (Xenopus laevis)

AV700514 ceroid-lipofuscinosis, neuronal 5

AB051358 ATPase, Class V, type 10A

AK023270 SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)

NM_182710 HI V-1 Tat interacting protein, 6OkDa

BF034089 Aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)

NM_198189 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)

CR610258 Docking protein 4

AL832321 Chromosome 14 open reading frame 143

AK131426 PDZ and LIM domain 7 (enigma)

NM__004687 Myotubularin related protein 4

AB025186 Microtubule-associated protein, RP/EB family, member 3

AK057602 Ribosomal protein L12

BX648258 Chromosome 16 open reading frame 35

AK127051 Acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase)

AK124809 COX11 homolog, cytochrome c oxidase assembly protein (yeast)

BF208515 Heterogeneous nuclear ribonucleoprotβin A1 ,

AK091501 Ring finger and CHY zinc finger domain containing 1

BQ228222 lntraflagellar transport protein IFT20

AK125435 Proteasome (prosome, macropain) subunit, beta type, 1

BX648801 Histone 2, H2aa

CR627457 Septin H

X96753 Chortdroitin sulfate proteoglycan 4 (melanoma-associated)

NM_145799 Septin 6

NM_012433 Splicing factor 3b, subunit 1 , 155kDa

NIvM 30837 Optic atrophy 1 (autosomal dominant)

BG469559 Transcribed locus

AK124141 Zinc finger protein-like 1

BE138647 translation initiation factor IF2

BE 138647 translation initiation factor I F2

M84739 Calreticulin

M84739 Calreticuϋπ

AK095055 Ribosomal protein S9

NM_002514 Nephroblastoma overexpressed gene AK092586 UPF3 regulator of nonsense transcripts homolog A (yeast)

BG033621 Tumor protein, translationally-controlled 1

AK093128 Eukaryotic translation initiation factor 3, subunit 3 gamma, 4OkDa

AW474434 tumor necrosis factor (ligand) superfamlly, member 10

AF070584 ATP synthase mitochondrial F1 complex assembly factor 2

AK125855 DAZ associated protein 2

NM_004371 Coatomer protein complex, subunit alpha

AK095954 Ribosomal protein L13

NM_033360 V-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog

XM_496933 CTAGE family, member 4

XM_036708 KIAA0368

AY359878 Heat shock 9OkDa protein 1 , beta

BX537365 Matrin 3

NMJ 82501 Hypothetical protein MGC61716

BM670875 Kelch domain containing 3

NM_005504 Branched chain aminotransferase 1 , cytosolic

BC046445 Eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)

BC046445 Eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)

BC082985 Nucleolar protein 1, 12OkDa

BC063289 Complement component 4B

NM_004685 Myotubularin related protein 6

NM_000169 Galactosidase, alpha

NM_003875 Guanine monphosphate synthetase

BC032997 Selenium binding protein 1

XM_048898 Heat shock 7OkDa protein 12A

NM_005402 V-ral simian leukemia viral oncogene homolog A (ras related)

AK096492 F-box and leucine-rich repeat protein 2

AK055053 Serine hydroxymethyltransferase 2 (mitochondrial)

NMJD21958 H2.0-like homeo box 1 (Drosophila)

AK127325 Bridging integrator 1

BC013732 N-acetyltransferase 1 (arylamine N-acetyltransferase)

BC039118 Syntaxin θ

CR749597 Protein inhibitor of activated STAT, 2

NM_006505 Poliovirus receptor

BX538289 Elongation factor, RNA polymerase II, 2

AK095329 Ras homolog gene family, member Q

NM_005504 Branched chain aminotransferase 1 , cytosolic

BX537508 Interferon-induced protein 44

AK172763 A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2

BF238649 Histone 1 , H2bc

NM_006735 Homeo box A2 • "

BF341582 Major histocompatibility complex, class I, C

AK024356 Suppressor of cytokine signaling 6

NM_003607 CDC42 binding protein kinase alpha (DMPK-like)

CR621744 Postmeiotic segregation increased 2-like 3

NM_005399 Protein kinase, AMP-activated, beta 2 non-catalytic subunit

AK096509 ADP-ribosylation factor interacting protein 1 (arfaptin 1)

NM_147160 Opioid receptor, sigma 1 NM_000337 Sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)

NM_005200 spastic paraplegia 7, paraplegin (pure and complicated autosomal recessive)

AF217500 MYST histone acetyltransferase (monocytic leukemia) 4

NM_014739 BCL2-associated transcription factor 1

CR749528 H2A histone family, member Y

CR749528 H2A histone family, member Y

AK122708 Four and a half LIM domains 1

BX537584 Activated RNA polymerase Il transcription cofactor 4

AK126342 CAMP responsive element binding protein 1

NM_014381 MutL homolog 3 (E. coli)

NM_005394 gb:NM_005394.1 /DB_XREF=gi:4885550 /GEN=PMS2L8 /FEA=FLmRNA /CNT=3

/TlD=Hs.323954.0 /TIER=FL /STK=O /UG=Hs.323954 /LL=5386 /DEF=Homo sapiens postmeiotic segregation increased 2-like 8 (PMS2L8), mRNA. /PROD=postmeiotic segregation increased 2-like 8 /FL=gb:NM_005394.1

CR598805 Polyglutamine binding protein 1

AK128179 Sorting nexin 1

AK172763 A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2

AF142421 quaking homolog, KH domain RNA binding (mouse)

BC022890 Synaptosomal-associated protein, 23kDa

NM_007198 Proline synthetase co-transcribed homolog (bacterial)

NMJD80425 GNAS complex locus

NM_012470 Transportin 3

NM_004703 Rabaptin, RAB GTPase binding effector protein 1

AL833077 Cyclic AMP phosphoprotein, 19 kD

V00541 Interferon, alpha 5

NM_005909 Microtubule-associated protein 1B

NM_005406 Rho-associated, coiled-coil containing protein kinase 1

BC063583 Hypothetical protein dJ462O23.2

BE568134 tumor necrosis factor receptor superfamily , member 21

NM_000753 phosphodiesterase 3B, cGMP-inhibited

NM_006511 Regulatory solute carrier protein, family 1 , member 1

AK093057 Vacuolar protein sorting 52 (yeast)

AF170702 Collagen, type VlII, alpha 1

R38475 microfibrillar-associated protein 3

AF127771 Ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)

AK128536 ATPase, Class I, type 8B, member 1

AK128721 Potassium voltage-gated channel, subfamily G, member 1

AL833289 TEA domain family member 1 (SV40 transcriptional enhancer factor)

AK075130 G protein-coupled receptor 1

NM_000919 Peptidylglycine alpha-amidating monooxygenase

NM_198335 Glucosidase, alpha; neutral AB

NMJ320532 Reticulon 4

AL833606 Neuropilin 2

S79869 Homeo box AI

AK127325 Bridging integrator 1

NM_201278 Myotubularin related protein 2

BC068013 Myosin IC

AF001893 Trophoblast-derived noncoding RNA BG286537 CGI-109 protein

AC007956 ZAP3 protein

BX648284 Integrin, alpha 1

XM_035572 Chromosome 4 open reading frame 9

XM_087089 WD repeat domain 43

NM_015375 Receptor interacting protein kinase 5

NM_007236 Calcium binding protein P22

NM_004136 Iron-responsive element binding protein 2

BC045666 Tumor protein p53 inducible protein 11

AF334405 Chromosome 13 open reading frame 1

AA653300 zinc finger protein 36 (KOX 18)

AB023215 KIAA0998 protein

XM_496642 Ubiquitin specific protease 19

X59739 Zinc finger protein, X-linked

AL110227 Guanine nucleotide binding protein (G protein), alpha 11 (Gq class)

L33243 Polycystic kidney disease 1 (autosomal dominant)

BC028573 CDC-like kinase 1

AL831995 MADS box transcription enhancer factor 2, polypeptide A (myocyte enhancer factor 2A)

AA868898 Transcribed locus

AK098778 Aldolase A, fructose-bisphosphate

CR749553 Transducin-like enhancer of split 4 (E(sp1 ) homolog, Drosophila)

AK094142 TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa

AL833610 Hypothetical protein Kl AA1164

XM_496394 AG1

NM_014847 Ubiquitin associated protein 2-like

AF070569 Homo sapiens clone 24659 mRNA sequence

CR749471 ROD1 regulator of differentiation 1 (S. pombe)

CR749471 ROD1 regulator of differentiation 1 (S. pombe)

BX537624 WIPI49-like protein 2

NM_018151 Telomere-associated protein RIF1 homolog

NM_212482 Fibronectin 1

NM_212482 Fibronectin 1

AW954107 mannosidase alpha class 2B member 2

NM_003454 Zinc finger protein 200

BX537523 Kinectin 1 (kinesin receptor)

NM_031966 Cyclin B1

BC034962 Hypothetical protein 15E 1.2

BC051847 Zinc finger protein 394

NM_198893 Zinc finger protein 160

BX641162 BMP2 inducible kinase

NM_021167 Ocular development-associated gene

NM_144710 Septin 10

BC002774 CDC42 effector protein (Rho GTPase binding) 4

BX537434 Sim ilar to NOTCH2 protein

NM_033425 DIX domain containing 1

BC042998 Adducin 1 (alpha)

NM_003072 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 AK027032 Golgi apparatus protein 1

NM_138473 Sp1 transcription factor

BC042998 Adducin 1 (alpha)

AK126950 Heterogeneous nuclear ribonucleoprotein C (C1/C2)

AB082526 NIMA (never in mitosis gene a)- related kinase 9

AL137527 Leucine-rich repeats and calponin homology (CH) domain containing 3

AK057343 Zinc finger protein 131 (clone pHZ-10)

NlVM 81552 Cut-like 1, CCAAT displacement protein (Drosophila)

AK021960 CDNA FLJ11898 fis, clone HEMBA1007322

AK131441 Likely ortholog of mouse zinc finger protein EZI

U50531 Phosphonoformate immuπo-associated protein 5

AK097018 Armadillo repeat containing, X-linked 6

BE541042 Homo sapiens similar to hypothetical protein FLJ10891 (LOC284375), mRNA

NM_001456 Filamin A, alpha (actin binding protein 280)

AK074143 UDP-N-acteylglucosamine pyrophosphoryfase 1-like 1

BC038996 Postmeiotic segregation increased 2-like 1

CR627456 Wilms tumor 1 associated protein

NM_015069 Zinc finger protein 423

NIVM30463 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2

AB007976 KIAA0507 protein

AK025371 N-acylsphingosine amidohydrolase (acid ceramidase)-like

NM_175865 ELYS transcription factor-like protein TMBS62

BQ022450 Heat shock protein, alpha-crystallin-related, B6

AB020671 Myosin phosphatase-Rho interacting protein

XM_039515 G2 protein

BX648646 Putative MAPK activating protein

AY280362 EGF-like-domain, multiple 4

AB051446 RUN and TBC1 domain containing 3

NM_004145 Myosin IXB

NM_145869 Annexin A11

AB002368 Exportin 6

AF337532 Vacuolar protein sorting 13A (yeast)

AL833317 C-myc promoter binding protein

NM_032102 Splicing factor, arginine/serine-rich, 46kD

NM_138402 Hypothetical protein BC004921

AI955119 vesicle-associated membrane protein 2 (synaptobrevin 2)

BF669264 proliferation-associated 2G4, 38kDa

BX537826 Basic transcription factor 3

AF464140 AF464140

BF344237 Homo sapiens mRNA; cDNA DKFZp564N1116 (from clone DKFZp564N1116)

BG033657 Eukaryotic translation initiation factor 4A, isoform 1

NM_001714 Bicaudal D homolog 1 (Drosophila)

AL080095 MRNA; cDNA DKFZp564O0862 (from clone DKFZp564O0862)

AU147851 Homo sapiens cDNA FLJ11958 fis, clone HEMBB1000996.

D80006 disco-interacting protein 2 (Drosophila) homolog

NM_033656 Chromosome 21 open reading frame 107

AJ007714 Aminoadipate-semialdehyde synthase

BC050349 Solute carrier family 38, member 6 BC068602 Succinate-CoA ligase, GDP-forming, beta subunit

AK092215 Hypothetical protein LOC375035

NM_015017 Ubiquitin specific protease 33

CR601525 Docking protein 5

NM_001219 Calumenin

BC051814 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

NIVM73562 Chromosome 6 open reading frame 69

NM_021652 SMA4

BX647149 SHC (Src homology 2 domain containing) transforming protein 1

AY596970 GTPase activating Rap/RanGAP domain-like 1

AK024386 Glyoxylate reductase/hydroxypyruvate reductase

CR601067 Plasminogen activator, urokinase receptor

NM_015635 DKFZP434C212 protein

AC002045 gb:AC002045 /DB_XREF=gi:2951945 /FEA=DNA_2 /CNT=IO /TID=Hs.251928.3

/TIER=ConsEnd /STK=O /UG=Hs.251928 /LL=9284 /UG_GENE=NPIP /UG_TITLE=nuclear pore complex interacting protein /DEF=Human Chromosome 16 BAC clone CIT987SK-A-

589H1

BX647107 Amyloid beta (A4) precursor-like protein 2

BC039271 Tubulin, gamma complex associated protein 5

BX647089 Zinc finger protein 37a (KOX 21 )

BF204700 Upstream transcription factor 2, c-fos interacting

BC042297 Upstream binding transcription factor, RNA polymerase I

NM_003016 Splicing factor, arginine/serine-rich 2

XM_496727 DKFZP564J102 protein

XM_496727 DKFZP564J102 protein

NM_033044 Microtubule-actin crosslinking factor 1

NM_001110 A disintegrin and metalloproteinase domain 10

AL080232 FLJ42393 protein

BM460795 Dimethylarginine dimethylaminohydrolase 2

NM_005104 Bromodomain containing 2

NM 014243 A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3

NM_020690 Eukaryotic translation initiation factor 4E binding protein 3

AB028965 OGT(O-GIc-NAc transferase)-interacting protein 106 KDa

AL359052 integrin, beta-like 1 (with EGF-like repeat domains)

AC005070 SFRS protein kinase 2

AA769818 calcium channel, voltage-dependent, PIQ type, alpha 1A subunit

NM_198531 ATPase, Class II, type 9B

NM_006197 Pericentriolar material 1

AK122825 High-mobility group box 1

AB018275 Chromosome 17 open reading frame 31

AK130437 KIAA0117 protein

NM_001005751 Similar to KIAA0592 protein

AL050136 MRNA; cDNA DKFZp586L141 (from clone DKFZp586L141)

AL050136 MRNAr cDNA DKFZp586L141 (from clone DKFZp586L141)

AL050358 Solute carrier family 26, member 10

BX537935 Amyloid beta (A4) precursor protein (protease nexin-ll, Alzheimer disease)

XMJ 71054 KIAA0527 protein NM_006595 Apoptosis inhibitor 5

NM_006595 Apoptosis inhibitor 5

NM_152339 Hypothetical protein MGC26885

NM_002994 Chemokine (C-X-C motif) ligand 5

NM_176789 Myotubularin related protein 1

AF070571 Clone 24739 mRNA sequence

NM_058183 SON DNA binding protein

AB051473 Pleckstrin homology domain containing, family A member 5

AD000092 syntrophin associated serine/threonine kinase

AB020714 KIAA0907 protein

AB020714 KIAA0907 protein

AL117593 fasciculation and elongation protein zeta 2 (zygin II)

AL161952 Glutamate-ammonia ligase (glutamine synthase)

AC004475 splicing factor 4

U92014 yeast Sec31 p homolog

AK092726 RNA, U17D small nucleolar

AL512727 MRNA; cDNA DKFZp547P042 (from clone DKFZp547P042)

NM_183380 Dystonin

AK025526 Chromosome 1 open reading frame 39

AW474158 KIAA1827 protein

AF123462 neurexin 3

AF123462 neurexin 3

BG429214 zinc finger protein 11b (KOX 2)

AC000064 peroxisome biogenesis factor 1

AK124242 G-rich RNA sequence binding factor 1

AK022442 Homo sapiens cDNA FLJ12380 fis, clone MAMMA1002556.

AL832780 Transmembrane 4 superfamily member 1

U72398 BCL2-like 1

BX649110 Huntingtin interacting protein B

NM_005843 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 2

AL133053 hypothetical protein FLJ23861 ,

NM_004759 Mitogen-activated protein kinase-activated protein kinase 2

AK074082 Erythropoietin receptor

AK123535 F-box and leucine-rich repeat protein 18

NMJ304808 N-myristoyltransferase 2

AL353759 histone 1 , H2bd

BC042897 Nuclear receptor subfamily 2, group F, member 2

NM_002086 Growth factor receptor-bound protein 2

NM_000090 Collagen, type HI, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant)

AL833001 ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)

AL031427 hypothetical protein MGC8974

AL109730 DKFZP434H 132 protein

BM805992 Transcribed locus

NM_005676 RNA binding motif protein 10

AK021884 Hypothetical protein FLJ11822

AL832728 General transcription factor HIA

U82671 NAD(P) dependent steroid dehydrogenase-like AK021825 Esterase D/formylglutathione hydrolase

AK021825 Esterase D/formylglutathione hydrolase

NM_021976 Retinoid X receptor, beta

XM_378914 K1AA0492 protein

NM_183422 Transforming growth factor beta 1 induced transcript 4

CR626749 SUMO1/sentrin/SMT3 specific protease 3

BX648906 RNA binding motif, single stranded interacting protein 1

AC002550 hypothetical protein MGC35048

AC002550 hypothetical protein MGC35048

XM_371783 Similar to KIAA0752 protein

AK023005 Aspartyl aminopeptidase

AK096810 Exosome component 8

AB028966 KIAA1043 protein

NM_004886 Amyloid beta (A4) precursor protein-binding, family A, member 3 (X11-like 2)

BC041863 PoIy(A) binding protein, cytoplasmic 1

AK001497 Death effector domain containing

BX647173 MRNA; cDNA DKFZp686L22239 (from clone DKFZp686L22239)

AL441988 Homo sapiens cDNA FLJ27509 fis, clone TST08220

NM_000373 Uridine monophosphate synthetase (orotate phosphoribosyl transferase and orotidine-5'- decarboxylase)

AB006651 Cofactor required for Sp1 transcriptional activation, subunit 2, 15OkDa

AK023063 Translocase of inner mitochondrial membrane 17 homolog A (yeast)

AV724215 Homo sapiens transcribed sequence with moderate similarity to protein ref:NP_286085.1 (E. coli) beta-D-galactosidase [Escherichia coli O157:H7 EDL933]

AK023843 Placental growth factor, vascular endothelial growth factor-related protein

AL050122 MRNA; cDNA DKFZp586E121 (from clone DKFZp586E121)

NMJD02737 Protein kinase C, alpha

XM_372205 Similar to hypothetical protein, MGC:7199

S72422 Dihydrolipoamide S-succinyltransferase pseudogene (E2 component of 2-oxo-glutarate complex)

AC004144 DKFZP434J046 protein

NM_003292 Translocated promoter region (to activated MET oncogene)

NM_033044 Microtubule-actin crosslinking factor 1

BM994509 Superoxide dismutase 2, mitochondrial

NM_177554 Acid phosphatase 1, soluble

BF965850 Full-length cDNA clone CS0DB007YN01 of Neuroblastoma Cot 10-normalized of Homo sapiens (human)

BC034956 Spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)

BC048259 Phosphatidylinositol binding clathrin assembly protein

NM_002024 Fragile X mental retardation 1

AY325903 Down syndrome critical region gene 1

BC009240 Transcriptional adaptor 3 (NGG1 homolog, yeast)-like

BC041875 Hypothetical protein LOC339290

AK126773 Putative homeodomain transcription factor 1

AL831969 Putative homeodomain transcription factor 2

AL049261 FGF receptor activating protein 1

NM_003069 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 U37025 gb:U37025 /DB_XREF=gi:1353413 /FEA=DNA /CNT=4 /TID=Hs.142.1 /TIER=ConsEnd

/STK=O /UG=Hs.142 /LL=6817 /UG_GENE=SULTΪA1 /UG_TITLE=sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 /DEF=Human phenol sulfotransferase (STP1) gene, last exon and partial cds

AF052152 Clones 24632 and 24634 mRNA sequence

M73746 Luteinizing hormone/choriogonadotropin receptor

AK125608 Major histocompatibility complex, class 1, A

AL049782 Hypothetical gene CG012

BQ880398 Glutathione S-transferase M1

AF 176555 A kinase (PRKA) anchor protein 11

BX957215 Natural killer-tumor recognition sequence

BC069058 Proline-, glutamic acid-, leucine-ricri protein 1

Z93241 polymerase delta interacting protein 46

BX640705 Hypothetical protein DKFZp686L21136

AL353943 sorting nexin 13

BC050346 PR/SET domain containing protein 8

AK022357 CDNA FLJ12295 fis, clone MAMMA1001818

BF570959 Chromosome 7 open reading frame 24

AL137312 Spastic paraplegia 21 (autosomal recessive, Mast syndrome)

BC016755 Complement factor H-related 1

U66061 Homo sapiens transcribed sequence with strong similarity to protein sp:P07478 (H.sapiens)

TRY2J-tUMAN Trypsin Il precursor (Anionic trypsinogen)

AI68390Q amplified in osteosarcoma

AK024388 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome)

AB017005 Postmeiotic segregation increased 2-like 2

AL008730 chromosome 6 open reading frame 4

AB017005 Postmeiotic segregation increased 2-!ike 2

AC004472 stomatin (EPB72)-like 2

AF045184 SKl interacting protein

AV684285 Transcribed locus

AK023959 hypothetical protein MGC10940

AK095367 G1 to S phase transition 1

XM_043653 Brain expressed X-linked-like 1

AF007136 Clone 23605 mRNA sequence

L16895 gb:L16895 /DB_XREF=gi:292923 /FEA=DNA /CNT=3 /TID=Hs.102267.3 /TΪER=ConsEnd

/STK=O /UG=Hs.102267 /LL=4015 /UG_GENE=LOX /UG_TITLE=lysyl oxidase

/DEF=Human lysyl oxidase (LOX) gene, exon 7

BC072433 Small nuclear ribonucleoproteiπ polypeptide E

AL031133 Homo sapiens transcribed sequence with moderate similarity to protein pir:JC4760

(H.sapiens) JC4760 SMT3 protein - human

NM_020429 SMAD specific E3 ubiquitin protein ligase 1

BX640795 Bromodomain containing 1

AK001327 Taxi {human T-cell leukemia virus type I) binding protein 3

U21915 general transcription factor HH, polypeptide 2, 44kDa

AJ011307 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa

AK124450 Homer homolog 3 (Drosophila)

AL121936 butyrophilin, subfamily 2, member A1

AB028960 WD and tetratricopeptide repeats 1 AK093838 Mitogen-activated protein kinase kinase 3

AK093838 Mitogen-activated protein kinase kinase 3

BC031405 Dual specificity phosphatase 10

AL049985 RAB22A, member RAS oncogene family

NM_005650 Transcription factor 20 (AR1 )

NM_005885 Membrane-associated RING-CH protein Vl

AL049925 Pygopus 1

AI590053 disco-interacting protein 2 (Drosophila) homolog

NM_000135 Fanconi anemia, complementation group A

XMJD47550 Zinc finger protein 492

NM_006048 Ubiquitination factor E4B (UFD2 homolog, yeast)

AK056346 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)

AJ012008 dimethylarginine dimethylaminohydrolase 2

NM_005219 Diaphanous homolog 1 (Drosophila)

AK129947 Sed family domain containing 1

AC005587 similar to Meningioma-expressed antigen 6/11 (MEA6) (MEA11)

AK026803 Homo sapiens transcribed sequences

CR605682 Lysophospholipase Il

AC004883 gb:AC004883 /DB_XREF=gi:4263746 /FEA=DNA_1 /CNT=3 /TID=Hs.283912.0

/TIER=ConsEnd /STK=O /UG=Hs.283912 /UG_TITLE=Homo sapiens PAC clone RP4-771 P4 from 7q11.21-q11.23 /DEF=Homo sapiens PAC clone RP4-771 P4 from 7q11.21-q11.23

AC005614 hypothetical protein LOC284323

AK022062 Ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)

AU 63248 zinc finger protein 294

AK097594 F-box and WD-40 domain protein 12

NM_178037 Rab6-interacting protein 2

AU145711 Homo sapiens cDNA FLJ11754 fis, clone HEMBA1005588.

BX640662 Protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform

CR620223 Breast cancer metastasis suppressor 1

NM_152754 Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D

NM_004385 Chondroitin sulfate proteoglycan 2 (versican)

BC038996 Postmeiotic segregation increased 2-like 1

AL096741 ASC-1 complex subunit P100

AL157437 GPAA1 P anchor attachment protein 1 homolog (yeast)

AK128270 Chromosome 1 open reading frame 41

AL512707 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27

NM_003918 Glycogenin 2

XM_088459 KIAA0310

NM_005056 Jumonji, AT rich interactive domain 1A (RBBP2-like)

BC073825 Zyxin

NM_000311 Prion protein (p27-30) (Creutzfeld-Jakob disease, Gerstmann-Strausler-Scheinker syndrome, fatal familial insomnia)

AL121975 Homo sapiens transcribed sequence with strong similarity to protein sp:P49643 (H.sapiens)

PRI2_HUMAN DNA primase large subunit (DNA primase 58 kDa subunit) (P58)

AF254822 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

L14561 ATPase, Ca++ transporting, plasma membrane 1 AI949220 PHD finger protein 3

NM_000043 Tumor necrosis factor receptor superfamily, member 6

AK090986 Small nuclear ribonucleoprotein polypeptide A'

BC068976 Phospholipase D1 , phophatidylcholine-spedfic

BM714384 Cytochrome b-5

AL031848 brain acyl-CoA hydrolase

AC005600 tuberous sclerosis 2

BF204700 Upstream transcription factor 2, c-fos interacting

BC046634 Tubulin, gamma complex associated protein 3

CR600741 Ribonuclease P/MRP 38kDa subunit

CR602284 Fusion (involved in t(12;16) in malignant liposarcoma)

D44658 Tetracycline transporter-like protein

AK124755 Golgi reassembly stacking protein 1, 65kDa

NM_005506 Scavenger receptor class B, member 2

AK024293 Hypothetical gene supported by AK024293

AC007204 hypothetical protein FU12488

AC005390 KIAA0963 protein

AB020706 Adaptor-related protein complex 2, alpha 2 subunit

AL096729 Glutathione S-transferase A1

BC068602 Succinate-CoA ligase, GDP-forming, beta subunit

AK001980 Poly (ADP-ribose) polymerase family, member 2

AJ006206 B1 for mucin

Z95126 Homo sapiens similar to protein phosphatase 2A inhibitor-2 I-2PP2A (LOC286454), mRNA

NM_000478 Alkaline phosphatase, liver/bone/kidney

BC021008 Cytoplasmic FMR1 interacting protein 2

AF306695 DnaJ (Hsp40) homolog, subfamily C, member 11

AC006144 glutamate dehydrogenase 2

AB007867 Plexin B1

U41163 Homo sapiens cDNA FLJ43855 fis, clone TESTI4007163, highly similar to Sodium- and chloride-dependent creatine transporter 2

NM_000962 Prostaglendin-encloperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)

M23575 Pregnancy specific beta-1 -glycoprotein 3

U64661 ring finger protein 12

AF070579 Clone 24487 mRNA sequence

BC048259 Phosphatidylinositol binding clathrin assembly protein

AB002325 Protocadherin gamma subfamily C, 3

AU 146050 Homo sapiens cDNA FLJ11844 fis, clone HEMBA1006665.

AL050025 adaptor-related protein complex 1 , gamma 1 subunit

BC036484 TGF-betallR beta

NM_033450 ATP-binding cassette, sub-family C (CFTR/MRP), member 10 XM_379359 ' Hypothetical gene supported by AK022326

AF189009 Ubiquilin 2

AF022790 ubiquitin specific protease 12 like 1

AK127910 GM2 ganglioside activator

AK022061 CDNA FLJ11999 fis, clone HEMBB1001527

BC065499 Microtubule associated serine/threonine kinase 2

AK123103 U5 snRNP-specific 40 kDa protein (hPrp8-binding)

AL157418 cholinergic receptor, nicotinic, epsilon polypeptide BC068525 GULP, engulfment adaptor PTB domain containing 1

NM_003128 Spectrin, beta, non-erythrocytic 1

NM_203356 CTAGE family, member 5

BC015110 Hematopoietically expressed homeobox

NM_015275 KIAA1033 protein

AF220018 Tripartite motif-containing 2

BC035151 Ornithine decarboxylase antizyme 1

AJ133355 Zinc finger protein 237

BC035151 Ornithine decarboxylase antizyme 1

AK124305 Chromosome 19 open reading frame 29

Z98200 similar to ribosomal protein L3; 60S ribosomal protein L3; HIV-1 TAR RNA-binding protein B

AK126171 Hypothetical protein LOC152719

AL049547 dom-3 homolog Z (C. elegans)

NM_005671 Reproduction 8

AL121845 hypothetical protein FLJ 14972

AK055123 HLA complex group 8

NM_198868 KIAA0676 protein

BX537641 Cullin 4B

NM_002160 Tenascin C (hexabrachion)

U43604 Unidentified mRNA, partial sequence.

AL034396 zinc finger, X-linked, duplicated B

M61855 Cytochrome P450, family 2, subfamily C, polypeptide 9

AL049980 DKFZP564C152 protein

BM994415 Serologically defined breast cancer antigen 84

BX537571 FYN oncogene related to SRC, FGR, YES

AL832656 Transcription factor 7-like 2 (T-cell specific, HMG-box)

AB028960 WD and tetratricopeptide repeats 1

AL832656 Transcription factor 7-like 2 (T-cell specific, HMG-box)

NM_002087 Granulin

U66589 Hypothetical LOC388650 ,

NM_Q1489,9 Rho-related BJB domain containing 3

X58851 myosin, light polypeptide 4, alkali; atrial, embryonic

NM_014992 Dishevelled associated activator of morphogenesis 1

NM_000027 Aspartylglucosaminidase

AF132033 trinucleotide repeat containing 11 (THR-associated protein, 23OkDa subunit)

AC004770 fatty acid desaturase 3

AL078633 proteasome (prosome, macropain) subunit, alpha type, 7

NM_033637 Beta-transducin repeat containing

Y18483 Solute carrier family 7 (cationic amino acid transporter, y+ system), member 8

NM_176789 Myotubularin related protein 1

NM_015602 ' Lamina-associated polypeptide 1B

X86428 protein phosphatase 2A, regulatory subunit B' (PR 53)

U38979 postmeiotic segregation increased 2-like 9

BC052781 RAN binding protein 9

BC034236 Hypothetical gene supported by NM_182576

AK023757 CDNA FLJ13695 fis, clone PLACE2000124

AK025271 Coiled-coil-helix-coiled-coil-helix domain containing 3

AW582267 Homo sapiens similar to ribosomal protein L29 (LOC127875), mRNA AF222691 LOC440203

AD001527 cytoskeleton-associated protein 1

AL109942 mitogen-activated protein kinase kinase kinase 4

NM_004863 Serine palmitoyltransferase, long chain base subunit 2

D86987 Mitofusin 2

AB051449 Tara-like protein

AJ010395 Homo sapiens transcribed sequences

AL049748 RNA binding motif protein 9

AK127752 Adenosine A1 receptor

AF315591 Vacuolar protein sorting 35 (yeast)

A1561354 myosin X

M59917 sphingomyelin phosphodiesterase 1 , acid lysosomal (acid sphingomyelinase)

AK022379 Beta-2-microglobulin

XM_045792 GCN1 general control of amino-acid synthesis 1-like 1 (yeast)

M20681 Solute carrier family 2 (facilitated glucose transporter), member 3

NM_006739 MCM5 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae)

AK129745 Pvt1 oncogene homolog, MYC activator (mouse)

BX538034 Transcription elongation factor A (SII), 1

BE735782 Similar to uroplakin IHb

AK094652 Ribosomal protein S20

AK094652 Ribosomal protein S20

X77598 leupaxin

D63487 . . KIAA0153 protein

NM_000043 Tumor necrosis factor receptor superfamily, member 6

N73272 parvin, beta

NM_177438 Diceri, Dcr-1 homolog (Drosophila)

AI151479 integrin, beta 3 (platelet glycoprotein IHa, antigen CD61)

AL050318 TGFB-induced factor 2 (TALE family homeobox)

X79683 laminin, beta 2 (laminin S)

NM_006421 ADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)

NM_007,024 Placental protein 6 . .

AF003837 Jagged 1 (Alagille syndrome)

AC004794 hypothetical protein FLJ 13511

AK128870 Hypothetical protein FLJ 13511

CR749656 Signal peptidase complex (18kD)

BC003159 Polymerase (RNA) Il (DNA directed) polypeptide C, 33kDa

XM_371706 KIAA1109

X81636 H.sapiens clathrin light chain a gene

AK125829 Hypothetical protein LOC92482

AJ295618 YME1-like 1 (S. cerevisiae)

AC005034 chromosome 2 open reading frame 3

NM_002819 Polypyrimidine tract binding protein 1

AK024386 Glyoxylate reductase/hydroxypyruvate reductase

AL121873 gb:AL121873 /DB_XREF=gi:8218071 /FEA=DNA /CNT=I /TID=Hs.283845.0

/TIER=ConsEnd /STK=O /UG=Hs.283845 /UG_TITLE=Human DNA sequence from clone RP13-362E11 on chromosome X. Contains a pseudogene similar to mouse GEG-154 and mosquito MRRG, a pseudogene similar to human MMS2 and chicken CROC-1B, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP13-362E11 on chromosome X. Contains a pseudogene similar to mouse GEG-154 and mosquito MRRG, a pseudogene similar to human MMS2 and chicken CROC-1 B, ESTs, STSs and

NM_000176 Nuclear receptor subfamily 3, group C1 member 1 (glucocorticoid receptor)

AK125710 CD58 antigen, (lymphocyte function-associated antigen 3)

K03460 gb:K03460 /DB_XREF=gi:340016 /FEA=DNA /CNT=I /TID=Hs.75318.1 /TIER=ConsEnd

/STK=O /UG=Hs.75318 /LL=7277 /UG_GENE=TUBA1 /UG_TITLE=tubulin, alpha 1 (testis specific) /DEF=Human alpha-tubulin isotype H2-alpha gene, last exon

AF059650 histone deacetylase 3

BC050280 Integrin, alpha 7

NM_019105 Tenascin XB

AL031602 hypothetical protein FLJ90005

AK021433 Chromosome 6 open reading frame 109

AF086641 tenascin XB

AL121916 gb:AL121916 /DB_XREF=gi:7406639 /FEA=DNA_2 /CNT=I /TID=Hs.283838.0

/TIER=ConsEnd /STK=O /UG=Hs.283838 /UG_TITLE=Human DNA sequence from clone RP1-189G13 on chromosome 20. Contains an RPL7A (60S ribosomal protein L7A) (SURF3) pseudogene, part of an RPS4 (40S ribosomal protein S4) pseudogene, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP1-189G13 on chromosome 20. Contains an RPL7A (60S ribosomal protein L7A) (SURF3) pseudogene, part of an RPS4 (40S ribosomal protein S4) pseudogene, ESTs, STSs and

AL049693 gb:AL049693 /DB_XREF=gi:7378744 /FEA=DNA_1 /CNT=I /TID=Hs.283833.0

/TIER=ConsEnd /STK=O /UG=Hs.283833 /UG_TlTLE=Human DNA sequence from clone RP4-753D5 on chromosome 6p12.1-12.3. Contains the 3 end of the TFAP2B gene for transcription factor AP-2 beta (activating enhancer-binding protein 2 beta), the gene for a novel protein similar to RPS17 (4OS ribosomal protein S17), a pseudogene similar to part of nuclear transport receptor MTR10A, an FTH 1 (ferritin, heavy polypeptide 1 ) pseudogene, ESTs, STSs and GSSs

AF152509 protocadherin gamma subfamily C, 3

AC005011 gb:AC005011 /DB_XREF=gi:4753254 /FEA=DNA /CNT=I /TID=Hs.283909.0

/TIER=ConsEnd /STK=O /UG=Hs.2839O9 /UG_TITLE=Homo sapiens BAC clone GS1- 111 G"i4 from 7qH /DEF=Homo sapiens BAC clone GS1-111G14 from 7q11

AL035413 aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)

U52111 gb:U52111 /DB_XREF=gi:8331754 /FEA=DNA_2 /CNT=I /TID=Hs.283952.0

/TIER=ConsEnd /STK=O /UG=Hs.283952 /UG_TITLE=Homo sapiens X28 region near ALD locus containing dual specificity phosphatase 9 (DUSP9), ribosomal protein L18a (RPL18a), Ca2+Calmodulin-dependent protein kinase I (CAMKI), creatine transporter (CRTR), CDM protein (CDM), adrenoleukodystrophy protein (ALD), plexin-related protein (PLXB3), muscle- specific serine kinase (MSSK), NAD-isocitrate dehydrogenase (IDH), translocon-associated protein delta (

AF257099 gb:AF257099 /DB_XREF=gi:8037944 /FEA=DNA /CNT=I /TID=Hs.283947.0

/TIER=ConsEnd /STK=O /UG=Hs.283947 /UG_TITLE=Homo sapiens prothymosin alpha (PTMA) gene, complete cds /DEF=Homo sapiens prothymosin alpha (PTMA) gene, complete cds

AL353580 gb:AL353580 /DB_XREF=gi:9944152 /FEA=DNA_2 /CNT=I /TID=Hs.326589.0

/TIER=ConsEnd /STK=O /UG=Hs.326589 /UG_TITLE=Human DNA sequence from clone RP11-248N6 on chromosome 13 Contains ESTs, STSs and GSSs. Contains two olfactory receptor pseudogenes, an NPM1 (nucleophosmin, nucleolar phosphoprotein B23, numatrin) pseudogene and a BCR (breakpoint cluster region) pseudogene /DEF=Human DNA sequence from clone RP11-248N6 on chromosome 13 Contains ESTs, STSs and GSSs. Contains two olfactory receptor pseudogenes, an N

BX649119 SEC23 interacting protein

NM_004879 Etoposide induced 2.4 mRNA

NM_015201 Block of proliferation 1

AB040887 Zinc finger protein 291

AK128439 Hypothetical protein FLJ 10305

AK057362 Hypothetical protein FLJ32800

AL121886 gb:AL121886 /DB_XREF=gi:8247022 /FEA=DNAJ /CNT=I /TID=Hs.287772.0

/TIER=ConsEnd /STK=O /UG=Hs.287772 /UG_TITLE=Human DNA sequence from clone RP5-1028D15 on chromosome 20. Contains the 3 end of the gene for CGI-53 protein (ortholog of rodent NGD5), a (possibly pseudo) gene for a protein similar to RPL27A (ribosomal protein L27a), the MYBL2 gene for v-myb avian myeloblastosis viral oncogene homolog-like 2, a novel gene, ESTs, STSs, GSSs and three CpG islands /DEF=Human DNA sequence from clone RP5-1028D15 on

AL136460 gb:AL136460 /DB_XREF=gi:9650519 /FEA=DNA /CNT=I /TID=Hs.287770.0

/TIER=ConsEnd /STK=O /UG=Hs.28777O /UG_TITLE=Human DNA sequence from clone RP11-102J14 on chromosome 20. Contains a novel gene and a novel pseudogene similar to the mouse PLFAP gene for proliferation associated protein 1. Contains ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP11-102J14 on chromosome 20. Contains a novel gene and a novel pseudogene similar to the mouse PLFAP gene for proliferation associated protein 1. Contains ESTs

CR749375 Enhancer of polycomb homolog 1 (Drosophila)

AL133228 gb:AL133228 /DB_XREF=gi:8217426 /FEA=DNA /CNT=I /TID=Hs.288031.2

/TIER=ConsEnd /STK=O /UG=Hs.288O31 /LL=6309 /UG_GENE=SC5DL /UG_TITLE=sterol- C5-desaturase (fungal ERG3, delta-5-desaturase)-like /DEF=Human DNA sequence from clone RP5-1071L10 on chromosome 20 Contains part of a gene for a new member of the thymosininterferon-inducible multigene family, ESTs, STSs and GSSs

NM_212482 Fibronectin 1

AL833556 Leucine rich repeat containing 28

AL833556 Leucine rich repeat containing 28

AK026080 splicing factor 3a, subunit 1, 12OkDa

AJ488201 Neuron navigator 3

AF009664 gb:AF009664 /DB_XREF=gi:2275594 /FEA=DNAJ /CNT=3 /TID=Hs.303157.10

/TIER=ConsEnd /STK=O /UG=Hs.3O3157 /LL=6957 /UG_GENE=TRB@ /UGJTTLE=T cell receptor beta locus /DEF=Homo sapiens T cell receptor beta locus, 3 trypsinogen repeats

BX648210 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

10

AC005339 chromosome 19 open reading frame 10

NM_004494 Hepatoma-derived growth factor (high-mobility group protein 1-like)

AL133267 gb:ALi33267 /DB_XREF=gi:10185396 /FEA=DNA_2 /CNT=I /TID=Hs.302087.0 '

/TIER=ConsEnd /STK=O /UG=Hs.302087 /UGJ"ITLE=Human DNA sequence from clone RP3-408B20 on chromosome 6 Contains ESTs, STSs and GSSs. Contains a gene and two pseudogenes for novel 7 transmembrane receptors (olfactory family) and a gene for a novel protein similar to 60S acidic ribosomal protein P2 (RPLP2) /DEF=Human DNA sequence from clone RP3-408B20 on chromosome 6 Contains ESTs, STSs and GSSs. Contains a gene and two pseudogenes for novel

AL390738 gb:AL390738 /DB_XREF=gi:9650602 /FEA=DNA_2 /CNT=I /TID=Hs.287788.0 /TIER=ConsEnd /STK=O /UG=Hs.287788 /UG_TITLE=Human DNA sequence from clone RP11-438F9 on chromosome 13 Contains the gene for the ortholog of mouse homeobox protein GSH1 , the 3 end of the gene for a novel protein similar to heterogeneous nuclear ribonucleoprotein A1 (HNRP A1 ), ESTs, STSs, GSSs and three CpG islands /DEF=Human DNA sequence from clone RP11-438F9 on chromosome 13 Contains the gene for the orthoiog of mouse homeobox protein GSH 1 ,

AL118502 chromosome 20 open reading frame 55

BX648210 Myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to,

10

AC007277 gb:AC007277 /DB_XREF=gi:5091647 /FEA=DNA /CNT=I /TID=Hs.283906.0

/TIER=ConsEnd /STK=O /UG=Hs.2839O6 /UG_TITLE=Homo sapiens BAC clone RP11- 244E6 from 2 /DEF=Homo sapiens BAC clone RP11-244E6 from 2

AJ270770 transcription factor 7-like 2 (T-cell specific, HMG-box)

AL121585 gb:AL121585 /DB_XREF=gi:8248733 /FEA=DNA_1 /CNT=I /TID=Hs.283864.0

/TIER=ConsEnd /STK=O /UG=Hs.283864 /UG_TITLE=Human DNA sequence from clone RP11-504H3 on chromosome 20 Contains the SNX5 gene (sorting nexin 5), a gene similar to PTMA (prothymosin-alpha), the 3 end of a gene encoding a Zinc-finger protein, two CpG islands, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP11-504H3 on chromosome 20 Contains the SNX5 gene (sorting nexin 5), a gene similar to PTMA (prothymosin-alpha), the 3 end of a ge

AF072098 tumor protein, translationally-controlled 1

S72931 gb:S72931 /DB_XREF=gi:639612 /FEA=DNA /CNT=I /TID=Hs.301927.3 /TIER=ConsEnd

/STK=O /UG=Hs.3O1927 /LL=79184 /UG_GENE=C6.1A /UG_TITLE=c6.1A /DEF=Homo sapiens T-cell receptor alpha chain-c6.1A fusion protein (C6.1A-TCRC) gene, partial cds

CR621744 Postmeiotic segregation increased 2-like 3

BF341582 Major histocompatibility complex, class I, C

U73479 membrane-bound transcription factor protease, site 2

AL138831 gb:AL138831 /DB_XREF=gi:9863510 /FEA=DNA /CNT=I /TID=Hs.302081.0

/TIER=ConsEnd /STK=O /UG=Hs.3O2O81 /UG_TITLE=Human DNA sequence from clone RP3-406P24 on chromosome 6 Contains a thioredoxin-like pseudogene, 2 CpG islands, ESTs, STSs and GSSs /DEF=Human DNA sequence from done RP3-406P24 on chromosome 6 Contains a thioredoxin-like pseudogene, 2 CpG islands, ESTs, STSs and GSSs

AL353681 gb:AL353681 /DB_XREF=gi:9801361 /FEA=DNA /CNT=I /TID=Hs.302094.0

/TIER=ConsEnd /STK=O /UG=Hs.3O2O94 /UG_TITLE=Human DNA sequence from clone RP1-158P9 on chromosome 1. Contains a putative novel gene, a laminin receptor 1 (67kD, ribosomal protein SA) (LAMR1) pseudogene, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP1-158P9 on chromosome 1. Contains a putative novel gene, a laminin receptor 1 (67kD, ribosomal protein SA) (LAMR1) pseudogene, ESTs, STSs and GSSs

AY533564 Ankyrin repeat domain 12

U88968 enolase 1, (alpha)

AL135926 gb:AL135926 /DB_XREF=gi:9801286 /FEA=DNAJ /CNT=I /TID=Hs.3O2113.0

/TIER=ConsEnd /STK=O /UG=Hs.3O2113 /UG_TITLE=Human DNA sequence from clone RP11-375F2 on chromosome 1 Contains a pseudogene similar to UBL1 (ubiquitin-like 1 (sentrin)), a pseudogene similar to ribosomal protein L29, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP11-375F2 on chromosome 1 Contains a pseudogene similar to UBL1 (ubiquitin-like 1 (sentrin)), a pseudogene similar to ribosomal protein L29, ESTs, STSs and GSSs

AL050348 WAP four-disulfide core domain 3

AY533564 Ankyrin repeat domain 12

AU 21994 gb:AL121994 /DB_XREF=gi:8648917 /FEA=DNA /CNT=I /TID=Hs.3O2117.0

/TIER=ConsEnd /STK=O /UG=Hs.3O2117 /UG_TITLE=Human DNA sequence from clone RP4-781 L3 on chromosome 1p34.3-36.11 Contains a pseudogene similar to IFITM3 (interferon inducedntransmembrane protein 3 (1-8U)), STSs and GSSs /DEF=Human DNA sequence from done RP4-781L3 on chromosome 1p34.3-36.11 Contains a pseudogene similar to IF1TM3 (interferon inducedntransmembrane protein 3 (1-8U)), STSs and GSSs

U72237 gb:U72237 /DB_XREF=gi:1778305 /FEA=DNA /CNT=I /TID=Hs.247985.0 /TIER=ConsEnd

/STK=O /UG=Hs.247985 /LL=56677 /UG_GENE=FABP3P2 /UG_TITLE=fatty acid binding protein 3, pseudogene 2 /DEF=Homo sapiens fatty acid-binding protein (FABP3-ps) pseudogene, complete cds

AL096829 gb:AL096829 /DB_XREF=gi:6634461 /FEA=DNA /CNT=I /TID=Hs.302120.0

/TIER=ConsEnd /STK=O /UG=Hs.3O212O /UG_TITLE=Human DNA sequence from clone RP4-595K12 on chromosome 1p31.2-31.3 Contains a pseudogene similar to 60S RPL29 (ribosomal protein L29 (cell surface heparin binding protein HIP)), a chromosome 1 specific mRNA (KIAA0499), a novel mRNA (KIAA0433), ESTs, STSs, GSSs and a CpG Island /DEF=Human DNA sequence from clone RP4-595K12 on chromosome 1p31.2-31.3 Contains a pseudogene similar to 60S RPL29 (ribosom

J 04742 ribulose-5-phosphate-3-epim erase

AF080579 gb:AF080579 /DB_XREF=gi:3406740 /FEA=DNA /CNT=I /TID=Hs.247725.0

/TIER=ConsEnd /STK=O /UG=Hs.247725 /UG_TITLE=Homo sapiens integral membrane protein subunit of complex Il (CII-3) pseudogene, complete sequence /DEF=Homo sapiens integral membrane protein subunit of complex Il (CII-3) pseudogene, complete sequence

AB000359 gb:AB000359 /DB_XREF=gi:2547040 /FEA=DNA /CNT=I /TlD=Hs.3O6173.0

/TIER=ConsEnd /STK=O /UG=Hs.3O6173 /LL=5280 /UG_GENE=PIGCP1 /UG_TITLE=phosphatidylinositol glycan, class C, pseudogene 1 /DEF=Homo sapiens PIGCP1 pseudogene

AK095239 Aldo-keto reductase family 1 , member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)- hydroxysteroid dehydrogenase)

BU570769 Chemokine (C-C motif) ligand 2

AD000092 syntrophin associated serine/threonine kinase

AL050332 gb:AL050332 /DB_XREF=gi:6010176 /FEA=DNAJ /CNT=I /TID=Hs.306238.0

/TIER=ConsEnd /STK=O /UG=Hs.3O6238 /LL=80734 /UG_GENE=APT /UG_TITLE=acyl- protein /DEF=Human DNA sequence from clone RP4-570F3 on chromosome 6 Contains a gene similar to Rattus norvegicus synaptic ras GTPase-activating protein p135, the CICK0721Q.5 (polypeptide from patented cDNA Em:E06811) gene, the PHF1 (PHD finger protein 1) gen...

U40053 gb:U40053 /DB_XREF=gi:1184068 /FEA=DNA /CNT=I /TID=Hs.226213.1 /TIER=ConsEnd

/STK=O /UG=Hs.226213 /LL=1595 /UG_GENE=CYP51 /UG_TITLE=cytochrome P450, 51 (lanosterol 14-alpha-demethylase) /DEF=Human lanosterol 14-alpha demethylase (CYP51P2) processed pseudogene, complete cds

BM810480 Thioredoxin

NM_014629 Rho guanine nucleotide exchange factor (GEF) 10

NM_001497 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1

AK026926 gb:AK026926.1 /DB_XREF=gi:10439898 /FEA=mRNA /CNT=I /TID=Hs.182429.2

/TIER=ConsEnd /STK=O /UG=Hs.182429 /LL=10130 /UG_GENE=P5 /UG_TITLE=pratein disulfide isomerase-related protein /DEF=Homo sapiens cDNA: FLJ23273 fis, clone HEP02611 , highly similar to HSU79278 Human protein disulfide isomerase-related protein P5 mRNA.

AL008627 gb:AL008627 /DB_XREF=gi:2769539 /FEA=DNA /CNT=I /TID=Hs.166181.0

/TIER=ConsEnd /STK=O /UG=Hs.166181 /UG_TITLE=Human DNA sequence from PAC 130G2 on chromosome 6p22.2-22.3. Contains ribosomal protein L29 pseudogene, ESTs and STSs /DEF=Human DNA sequence from PAC 130G2 on chromosome 6p22.2-22.3. Contains ribosomal protein L29 pseudogene, ESTs and STSs

NM_001938 Down-regulator of transcription 1 , TBP-binding (negative cofactor 2)

M61855 Cytochrome P450, family 2, subfamily C, polypeptide 9

AK000773 WD repeat domain 10

NM_005637 Synovial sarcoma translocation, chromosome 18

NM_002451 Methylthioadenosine phosphorylase

NM_004308 Rho GTPase activating protein 1

AL133102 Hepatoma-derived growth factor, related protein 3

NM_004606 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 25OkDa

AF388384 Cerebral cavernous malformations 1

AK098055 Glycine amidinotransferase (L-arginine:glycine amidinotransferase)

AK024527 CDNA: FLJ20874 fis, clone ADKA02818

AK025325 CDNA: FLJ21672 fis, clone COL09025

AL833286 LIM protein (similar to rat protein kinase C-binding enigma)

AL136306 . ' . gb:AL136306 /DB_XREF=gi:10045289 /FEA=DNA_2 /CNT=I /TID=Hs.3O7103.0

/TIER=ConsEnd /STK=O /UG=Hs.3O71O3 /UG_TITLE=Human DNA sequence from clone RP3-334F4 on chromosome 6 Contains ESTs, STSs and GSSs. Contains a LAMR1 (laminin receptor 1, ribosomal protein SA) pseudogene and an RPL10 (ribosomal protein L10) pseudogene /DEF=Human DNA sequence from clone RP3-334F4 on chromosome 6 Contains ESTs, STSs and GSSs. Contains a LAMR1 (laminin receptor 1 , ribosomal protein SA) pseudogene and an RPL10 (ribosomal protein

XM_088636 Cylicin, basic protein of sperm head cytoskeleton 1

AL356115 gb:AL356115 /DB_XREF=gi:9795038 /FEA=DNAJ /CNT=I /TID=Hs.307132.0

/TIER=ConsEnd /STK=O /UG=Hs.3O7132 /UG_TITLE=Human DNA sequence from clone RP11-486O22 on chromosome 10 Contains the 3part of a gene for KIAA1128 protein, a novel pseudogene, a gene for protein similar to RPS3A (ribosomal protein S3A), ESTs, STSs1 GSSs and CpG islands /DEF=Human DNA sequence from clone RP11-486O22 on chromosome 10 Contains the 3part of a gene for KIAA1128 protein, a novel pseudogene, a gene for protein similar to RPS3A (rib

AK055944 Docking protein 1, 62kDa (downstream of tyrosine kinase 1)

AK131568 V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)

NM_000426 Laminin, alpha 2 (merosin, congenital muscular dystrophy)

BM994509 Superoxide dismutase 2, mitochondrial

U38964 gb:U38964 /DB_XREF=gi:1055353 /FEA=DNA /CNT=I /TID=Hs.323954.1 /TlER=ConsEnd

/STK=O /UG=Hs.323954 /LL=5386 /UG_GENE=PMS2L8 /UG_TITLE=postmeiotic segregation increased 2-like 8 /DEF=Human PMS2 related (hPMSR2) gene, complete cds

AK091091 Growth differentiation factor 11

Z24459 mature T-cell proliferation 1

AC004542 KIAA0852 protein

XM_499092 Hypothetical gene supported by AK097459 AF264787 Deleted in lymphocytic leukemia, 2

AB032963 ATPase, Class I, type 8B, member 2

BF316165 Phosphodiesterase 6D, cGMP-specific, rod, delta

AK026481 H326

D64137 cyclin-dependent kinase inhibitor 1 C (p57, Kip2)

AC003999 src family associated phosphoprotein 2

AF001549 gb:AF001549 /DB_XREF=gi:3355302 /FEA=DNA_2 /CNT=I /TΪD=Hs.110103.2

/TIER=ConsEnd /STK=O /UG=Hs.11O1O3 /LL=54700 /UG_GENE=RRN3 /UG_TITLE=RNA polymerase I transcription factor RRN3 /DEF=Human Chromosome 16 BAC clone C1T987SK-A-270G1

BC004216 Calcium binding atopy-related autoantigen 1

S69182 protein tyrosine phosphatase, non-receptor type 12

AK094142 TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa

AK125710 CD58 antigen, (lymphocyte function-associated antigen 3)

D26070 Inositol 1 ,4,5-triphosphate receptor, type 1

M94363 gb:M94363 /DB_XREF=gi:186920 /FEA=DNA /CNT=I /TlD=Hs.76084.1 /TIER=ConsEnd

/STK=O /UG=Hs.76O84 /LL=3999 /UG_GENE=LMNB2 /UG_TITLE=lamin B2 /DEF=Human lamin B2 (LAMB2) gene and ppv1 gene sequence

BF965152 ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit (oligomycin sensitivity conferring protein)

AK122922 ■ Isovaleryi Coenzyme A dehydrogenase

AL049646 zinc finger protein 133 (clone pHZ-13)

M69039 gb:M69039.1 /DB_XREF=gi:338042 /FEA=mRNA /CNT=I /TID=Hs.78614.5 /TIER=ConsEnd

7STK=O /UG=Hs.78614 /LL=708 /UG_GENE=C1QBP /UG_TITLE=complement component 1 , q subcomponent binding protein /DEF=Human pre-mRNA splicing factor SF2p32, complete sequence. .

Z54367 plectin 1 , intermediate filament binding protein 50OkDa

S49765 homeo box B7

S59184 RYK receptor-like tyrosine kinase

AK090986 Small nuclear ribonucleoprotein polypeptide A'

L48722 protein tyrosine phosphatase type IVA, member 2

AK001516 KIAA0971

AL358975 gb:AL358975 /DB_XREF=gi:11602548 /FEA=DNA_2 /CNT=I /TID=Hs.83958.2

/TIER=ConsEnd /STK=O /UG=Hs.83958 /LL=7091 /UG_GENE=TLE4 /UG_TITLE=transducin-like enhancer of split 4, homolog of Drosophila E(sp1) /DEF=Human DNA sequence from clone RP11-375018 on chromosome 9 Contains ESTs, STSs, GSSs and a CpG island. Contains the KIAA1261 gene for a novel transducin-like enhancer of split (TLE) and a putative novel gene

AY560601 A disintegrin and metalloproteinase domain 15 (metargidin)

AC004522 zinc finger protein 36 (KOX 18)

XM_371680 Hypothetical LOC389177

AL137162 gb:AL137162 /DB_XREF=gi:11190480 /FEA=DNA /CNT=I /TID=Hs.3O2114.0

/TIER=ConsEnd /STK=O /UG=Hs.3O2114 /UG_TITLE=Human DNA sequence from clone RP5-843L14 on chromosome 20. Contains ESTs, STSs and GSSs. Contains a novel gene and the 5 part of a gene for a novel protein similar to X-linked ribosomal protein 4 (RPS4X) /DEF=Human DNA sequence from clone RP5-843L14 on chromosome 20. Contains ESTs, STSs and GSSs. Contains a novel gene and the 5 part of a gene for a novel protein similar to X-linked ribosomal prate AK125417 Drebrin 1

AC004941 gb:AC004941 /DB_XREF=gi:4454517 /FEA=DNA /CNT=I /TID=Hs.283758.0

/TIER=ConsEnd /STK=O /UG=Hs.283758 /UG_TITLE=Homo sapiens PAC clone RP5- 979P20 from 7q33-q35 /DEF=Homo sapiens PAC clone RP5-979P20 from 7q33-q35

NM_002530 Neurotrophic tyrosine kinase, receptor, type 3

NM_033540 Mitofusin 1

AL136967 natural cytotoxicity triggering receptor 2

XM_376328 Family with sequence similarity 13, member A1

AK024108 Homo sapiens cDNA FLJ 14046 fis, clone HEMBA1006461.

M87312 Dystrophia myotonica-protein kinase

AK054685 Homer homolog 2 (Drosophila)

AL031589 gb:AL031589 /DB_XREF=gi:4914506 /FEA=DNA /CNT=I /TID=Hs.247871.0

/TIER=ConsEnd /STK=O /UG=Hs.247871 /UG_TITLE=Human DNA sequence from clone RP6-11O7 on chromosome 22 Contains an RPL7 (60S Ribosomal Protein L7) pseudogene, part of a putative novel gene, ESTs and GSSs /DEF=Human DNA sequence from clone RP6-11O7 on chromosome 22 Contains an RPL7 (60S Ribosomal Protein L7) pseudogene, part of a putative novel gene, ESTs and GSSs

AL109923 itchy homolog E3 ubiquitin protein ligase (mouse)

AC004990 putative homeodomain transcription factor 2

AF258545 gem (nuclear organelle) associated protein 4

XM_087353 KIAA0794 protein

AK057153 Putative dimethyladenosine transferase

AL035603 gb:AL035603 /DB_XREF=gi:4775596 /FEA=DNA /CNT=I /TID=Hs.247869.0

/TlER=ConsEnd /STK=O /UG=Hs.247869 /UG_TlTLE=Human DNA sequence from clone 179E13 on chromosome 6q22.1-22.33. Contains an RPS4 (4OS Ribosomal protein S4) pseudogene, ESTS, an STS and GSSs /DEF=Human DNA sequence from clone 179E13 on chromosome 6q22.1-22.33. Contains an RPS4 (4OS Ribosomal protein S4) pseudogene, ESTS, an STS and GSSs

XM_168578 Mucin 3A, intestinal

AB023147 Chromosome 22 open reading frame 9

AL031282 gb:AL031282 /DB_XREF=gi:3860395 /FEA=DNA_6 /CNT=I /TID=Hs.214646.2

/TIER=ConsEnd /STK=O /UG=Hs.214646 /LL=9906 /UG_GENE=KIAA0447 /UG_TITLE=KIAA0447 gene product /DEF=Human DNA sequence from clone 283E3 on chromosome 1p36.21 -36.33. Contains the alternatively spliced gene for Matrix Metalloproteinase in the Female Reproductive tract MIFR1, -2, MMP2122A, -B and -C, a novel gene, the alternatively spliced CDC2L2 ...

AL354872 cystathionase (cystathionine gamma-lyase)

AK095713 Calcium/calmodulin-dependent protein kinase IG

AF072164 Chromosome 9 open reading frame 33

NM_000767 Cytochrome P450, family 2, subfamily B, polypeptide 6

AJ002428 gb:AJ002428 /DB_XREF=gi:3183956 /FEA=DNA /CNT=I /TID=Hs.2O1553.0

/TIER=ConsEnd /STK=O /UG=Hs.2O1553 /LL=10065 /UG_GENE=VDAC1 P /UG_TITLE=voltage-dependent anion channel 1 pseudogene /DEF=Homo sapiens VDAC1 pseudogene

AL035687 gb:AL035687 /DB_XREF=gi:5295830 /FEA=DNA /CNT=I fi"ID=Hs.247893.0

/TIER=ConsEnd /STK=O /UG=Hs.247893 /UG_TITLE=Hurnan DNA sequence from clone RP1-142O9 on chromosome 6p11.1-12.3. Contains an EEF1A1 (eukaryotic translation elongation factor 1 alpha 1) pseudogene, a pseudogene similar to part of ZNF216, ESTs, STSs, GSSs and an aat repeat polymorphism /DEF=Human DNA sequence from clone RP1-

14209 on chromosome 6p11.1-12.3. Contains an EEF1A1 (eukaryotic translation elongation factor 1 alpha 1) pseudogene, a pseu

X04801 gb:X04801 /DB_XREF=gi:37581 /FEA=DNA /CNT=I /TID=Hs.247891.0 /TIER=ConsEnd

/STK=O /UG=Hs.247891 /UG_TITLE=Homo sapiens UBBP1 pseudogene for ubiquitin UBB

/DEF=Homo sapiens UBBP1 pseudogene for ubiquitin UBB

NIVM81826 Neurofibromin 2 (bilateral acoustic neuroma)

M10943 metallothionein 1 F (functional)

AF217990 Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1

BX648281 Low density lipoprotein receptor (familial hypercholesterolemia)

X59739 Zinc finger protein, X-linked

Z95118 gb:Z95118 /DB_XREF=gi:3821018 /FEA=DNA /CNT=I /TID=Hs.211509.0 /TIER=ConsEnd

/STK=O /UG=Hs.211509 /LL=10729 /UG_GENE=ZNF259P /UG_TITLE=zinc finger protein

259, pseudogene /DEF=Human DNA sequence from clone 354J5 on chromosome 6q21-22.

Contains pseudogene similar to zinc finger protein (ZPR1 ), EST, STS, GSS

AC007182 chromosome 14 open reading frame 1 AF042163 gb:AF042163 /DB_XREF=gi:3861484 /FEA=DNA /CNT=I /TID=Hs.248205.0

/TIER=ConsEnd /STK=O /UG=Hs.2482O5 /LL=9384 /UG_GENE=COX6CP1

/UG_TITLE=cytochrome c oxidase subunit VIc pseudogene 1 /DEF=Homo sapiens cytochrome c oxidase subunit VIc (COX6CP1) pseudogene, complete sequence

NM_203459 KIAA1078 protein U06715 gb:U06715.1 /DB_XREF=gi:476590 /GEN=B561 /FEA=mRNA /CNT=I /TID=Hs.153028.3

/TIER=ConsEnd /STK=O /UG=Hs.153028 /LL=1534 /DEF=Human cytochrome B561 ,

HCYTO B561 , mRNA, partial cds. /PROD=HCYTO B561

U08626 gb:U08626 /DB_XREF=gi:551473 /FEA=DNA /CNT=I /TID=Hs.247984.0 /TIER=ConsEnd

/STK=O /UG=Hs:247984 /UG_TITLE=Human glutamine synthetase pseudogene

/DEF=Human glutamine synthetase pseudogene

AU 21981 discs, large homolog 1 (Drosophila) D50604 gb:D50604 /DB_XREF=gi:2094759 /FEA=DNA /CNT=I /TID=Hs.248007.0 /TIER=ConsEnd

/STK=O

actin (ACTBP9) pseudogene

/DEF=Human beta-cytoplasmic actin (ACTBP9) pseudogene

AC006530 mutL homolog 3 (E. coli)

XM_376189 DKFZP586K1520 protein

NM_005676 RNA binding motif protein 10

AL512687 pM5 protein

NM_006902 Paired related homeobox 1

AF351612 Villin 2 (ezrin)

AC004544 Homo sapiens similar to Cytochrome c oxidase subunit VIIA-L related protein, mitochondrial precursor (LOC345363), mRNA

Z98950 gb:Z98950 /DB_XREF=gi:3036783 /FEA=DNA /CNT=I /TID=Hs.248094.0 /TIER=ConsEnd

/STK=O /UG=Hs.248O94 /UG_TITLE=Human DNA sequence from PAC 507115 on chromosome Xq26.3-27.3. Contains 60S ribosomal protein L44 (L41, L36) like gene, ESTs,

STSs and a polymorphic CA repeat /DEF=Human DNA sequence from PAC 507115 on chromosome Xq26.3-27.3. Contains 60S ribosomal protein L44 (L41 , L36) like gene, ESTs,

STSs and a polymorphic CA repeat

Z97353 gb:Z97353 /DB_XREF=gi:4455632 /FEA=DNA /CNT=I /TID=Hs.247851.0 /TIER=ConsEnd

/STK=O /UG=Hs.247851 /UG_TITLE=Human DNA sequence from clone RP1-90L6 on chromosome 22q11.21-11.23 Contains an RPL15 (60S Ribosόmal Protein L15) pseudogene, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP1-90L6 on chromosome 22q11.21-11.23 Contains an RPL15 (60S Ribosomal Protein L15) pseudogene, ESTs, STSs and GSSs

AP001672 protease, serine, 7 (enterokinase)

AC005393 gb:AC005393 /DB_XREF=gi:3399665 /FEA=DNA_1 /CNT=I /TID=Hs.249140.0

/TIER=ConsEnd /STK=O /UG=Hs.24914O /UG_TITLE=Homo sapiens chromosome 19, CIT- HSP BAC 470n8 /DEF=Homo sapiens chromosome 19, CIT-HSP BAC 470n8

BC001805 NDRG family member 3

U88968 enolase 1 , (alpha)

NM_004145 Myosin IXB

BX640816 Nijmegen breakage syndrome 1 (nibrin)

AK125399 Retinoblastoma binding protein 4

AK126461 Down syndrome critical region gene 3

AC004692 gb:AC004692 /DB_XREF=gi:3135282 /FEA=DNA /CNT=I /TID=Hs.247699.0

/TIER=ConsEnd /STK=O /UG=Hs.247699 /UG_TITLE=Homo sapiens PAC clone RP5- 1107K12 from 7p12-p14 /DEF=Homo sapiens PAC clone RP5-1107K12 from 7p12-p14

AF041080 D15F37 (pseudogene)

AF042164 gb:AF042164 /DB_XREF=gi:3861485 /FEA=DNA /CNT=I /TID=Hs.247765.0

/TlER=ConsEnd /STK=O /UG=Hs.247765 /UG_TITLE=Homo sapiens cytochrome c oxidase subunit Vllb (COX7BP1) pseudogene, complete sequence /DEF=Homo sapiens cytochrome c oxidase subunit VIIb (COX7BP1) pseudogene, complete sequence

AU 18510 gb:AL118510 /DB_XREF=gi:6572394 /FEA=DNA /CNT=I /TID=Hs.2723O1.0

/TIER=ConsEnd /STK=O /UG=Hs.2723O1 /UG_TITLE=Human DNA sequence from clone RP5-858M22 on chromosome 20 Contains a pseudogene similar to 4OS ribosomal protein S10, STSs and GSSs /DEF=Human DNA sequence from clone RP5-858M22 on chromosome 20 Contains a pseudogene similar to 4OS ribosomal protein S10, STSs and GSSs

AL021877 gb:AL021877 /DB_XREF=gi:3820976 /FEA=DNA /CNT=I /TID=Hs.247772.0

/TIER=ConsEnd /STK=O /UG=Hs.247772 /UG_TlTLE=Human DNA sequence from clone RP1-101G11 on chromosome 22q12 Contains an ACO2 (Mitochondrial Aconitate Hydratase (Aconitase, Citrate Hydro-Lyase, EC 4.2.1.3)) pseudogene, ESTs, STSs, GSSs and a CpG islandn /DEF=Human DNA sequence from clone RP1-101G11 on chromosome 22q12 Contains an ACO2 (Mitochondrial Aconitate Hydratase (Aconitase, Citrate Hydro-Lyase, EC 4.2.1.3)) pseudogene, ESTs, STSs, GSSs an

AL021395 gb:AL021395 /DB_XREF=gi:6249356 /FEA=DNA_2 /CNT=2 /TID=Hs.272279.0

/TIER=ConsEnd /STK=O /UG=Hs.272279 /UG_TITLE=Human DNA sequence from clone RP1-269M15 on chromosome 20q12-13.12 Contains a gene similar to peptidylprolyl isomerase (cyclophilin), part of the gene for receptor protein tyrosine phosphatase (RPTP- rho), ESTs, STSs, GSSs and CpG Islands /DEF=Human DNA sequence from clone RP1- 269M15 on chromosome 20q12-13.12 Contains a gene similar to peptidylprolyl isomerase (cyclophilin), part of the gene for r

Z82202 gb:Z82202 /DB_XREF=gi:4107193 /FEA=DNA /CNT=I /TID=Hs.247778.0 /TIER=ConsEnd

/STK=O /UG=Hs.247778 /UG_TITLE=Human DNA sequence from clone RP1-34P24 on chromosome 22 Contains a pseudogene similar to ribosomal protein L35, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP1-34P24 on chromosome 22 Contains a pseudogene similar to ribosomal protein L35, ESTs, STSs and GSSs

AL022097 gb:AL022097 /DB_XREF=gi:3169107 /FEA=DNA /CNT=I /Tl D=Hs.166203.0 /TIER=ConsEnd /STK=O /UG=Hs.166203 /UG_TlTLE=Homo sapiens DNA sequence from PAC 256G22 on chromosome 6p24.1-25.3. Contains a HNRNP Core Protein A1 LIKE pseudogene and an exon with similarity to yeast and fly phenylalanyl tRNA synthetase PHERS. Contains ESTs and GSSs /DEF=Homo sapiens DNA sequence from PAC 256G22 on chromosome 6p24.1-25.3. Contains a HNRNP Core Protein A1 LIKE pseudogene and an exon with similarity to yeast and fly phenylalany

NM_000291 Phosphoglycerate kinase 1

AL031313 gb:AL031313 /DB_XREF=gi:4038573 /FEA=DNA_2 /CNT=I /TID=Hs.247783.0

/TIER=ConsEnd /STK=O /UG=Hs.247783 /UG_TITLE=Human DNA sequence from clone 581F12 on chromosome Xq21. Contains Eukaryotic Translation Initiation Factor EIF3 P35 Subunit and 60S Ribosomal protein L22 pseudogenes. Contains ESTs /DEF=Human DNA sequence from clone 581 F12 on chromosome Xq21. Contains Eukaryotic Translation Initiation Factor E1F3 P35 Subunit and 60S Ribosomal protein L22 pseudogenes. Contains ESTs

AL022101 hypothetical protein LOC343071

NM_015035 Zinc fingers and homeoboxes 3

AJ275383 gb:AJ275383 /DB_XREF=gi:7573027 /FEA=DNA /CNT=I /TID=Hs.272358.0

/TIER=ConsEnd /STK=O /UG=Hs.272358 /UG_TITLE=Homo sapiens partial IGVH3 gene for immunoglobulin heavy chain V region, case 1 , cell Mo IV 72 /DEF=Homo sapiens partial IGVH3 gene for immunoglobulin heavy chain V region, case 1 , cell Mo IV 72

CR602284 Fusion (involved in t(12;16) in malignant liposarcoma)

Y09908 gb:Y09908.1 /DB_XREF=gi:2143255 /GEN=IL-15 /FEA=mRNA /CNT=I /TID=Hs.168132.2

/TIER=ConsEnd /STK=O /UG=Hs.168132 /LL=3600 /DEF=H.sapiens mRNA for interleukin- 15. /PROD=interleukin-15

AL121934 ' . gb:AL121934 /DB_XREF=gi:9795199 /FEA=DNA /CNT=I /TID=Hs.272340.0

/TIER=ConsEnd /STK=O /UG=Hs.27234O /UG_TITLE=Human DNA sequence from clone RP11-209A2 on chromosome 6. Contains an RPLI 0 (60S ribosomal protein L10) pseudogene, ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP11-209A2 on chromosome 6. Contains an RPL10 (60S ribosomal protein L10) pseudogene, ESTs, STSs and GSSs

NM_000291 Phosphoglycerate kinase 1

AL109622 gb:AL109622 /DB_XREF=gi:6002166 /FEA=DNA /CNT=I /TID=Hs.272352.0

/TIER=ConsEnd /STK=O /UG=Hs.272352 /UG_TlTLE=Human DNA sequence from clone RP3-526F5 on chromosome Xq26.3-28. Contains the gene for a novel protein similar to UBE2N (ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)), ESTs, STSs and GSSs /DEF=Human DNA sequence from clone RP3-526F5 on chromosome Xq26.3-28. Contains the gene for a novel protein similar to UBE2N (ubiquitin-conjugating enzyme E2N (homologous to yeast UBC13)), ESTs, ST

BF983396 Glyceraldehyde-3-phosphate dehydrogenase

AL034410 gb:AL034410 /DB_XREF=gi:4678510 /FEA=DNA /CNT=I /TID=Hs.247846.0

/TIER=ConsEnd /STK=O /UG=Hs.247846 /UG_TITLE=Human DNA sequence from clone 774G10 on chromosome Xp11.23-11.3 Contains a pseudogene similar to cyclin protein, ESTs, STS and GSSs /DEF=Human DNA sequence from clone 774G10 on chromosome Xp11.23-11.3 Contains a pseudogene similar to cyclin protein, ESTs, STS and GSSs

AC074331 zinc finger protein 233

AK126124 Mitochondrial ribosomal protein S18B

AK000918 VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa

AB191264 Agrin Y15916 gb:Y15916.1 /DB_XREF=gi:3288488 /FEA=mRNA /CNT=I /TID=Hs.172928.1

/TIER=ConsEnd /STK=O /UG=Hs.172928 /LL=1277 /UG_GENE=COL1A1 /DEF=Homo sapiens mRNA for chimaeric transcript of collagen type 1 alpha 1 and platelet derived growth factor beta, 189 bp. /PROD=COL1A1 and PDGFB fusion transcript

BX647357 lduronate 2-sulfatase (Hunter syndrome)

M80469 gb:M80469 /DB_XREF=gi:188483 /FEA=DNA /CNT=3 /TID=Hs.85242.0 /TIER=ConsEnd /STK=O /UG=Hs.85242 /LL=3137 /UG_GENE=HLA-J /UG_TITLE=major histocompatibility complex, class I, J (pseudogene) /DEF=Human MHC class I HLA-J gene, exons 1-8 and complete cds

AF049910 Transforming, acidic coiled-coil containing protein 1

BC068438 Phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase

AL080160 MRNA; cDNA DKFZp434M054 (from clone DKFZp434M054)

AL117508 Similar to Epidermal Langerhans cell protein LCP1

AL137284 MRNA; cDNA DKF2p434D1516 (from clone DKFZp434D1516)

Y15014 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2

X56841 Major histocompatibility complex, class I, E

NM_021159 RAP1 , GTP-GDP dissociation stimulator 1

AB011159 NCK-associated protein 1

L48784 ribosomal protein S2

NM_000106 Cytochrome P450, family 2, subfamily D, polypeptide 6

X76775 major histocompatibility complex, class II, DM alpha

NM_000651 Complement component (3b/4b) receptor 1 , including Knops blood group system

BC038996 Postmeiotic segregation increased 2-like 1

AF042165 cytochrome c oxidase subunit VIIc

BC038293 Phosphatase and tensin homolog (mutated in multiple advanced cancers 1), pseudogene 1

BC038293 Phosphatase and tensin homolog (mutated in multiple advanced cancers 1), pseudogene 1

BX648462 Insulin-degrading enzyme

BU729834 Olfactory receptor, family 7, subfamily E, member 38 pseudogene

BC030025 TIA1 cytotoxic granule-associated RNA binding protein-like 1

AI339732 WD40 protein Ciaoi

BC052561 Serine/threonine kinase 17b (apoptosis-inducing)

BC041875 Hypothetical protein LOC339290

BC084579 Chromosome 18 open reading frame 25

XM_211305 Hypothetical protein LOC284021

BC045653 Potassium channel, subfamily V, member 2

BX647908 Olfactomedin-like 1

AI478300 hypothetical protein FLJ14639

AI478300 hypothetical protein FLJ14639

BE547674 hypothetical protein FLJ20013

NM_014853 RUN and TBC1 domain containing 1

BM683085 Transcribed locus

BG290532 hypothetical protein LOC125893

BE930512 Transcribed locus

BE890314 membrane-bound transcription factor protease, site 1

AK093669 TRAF6-inhibitory zinc finger protein

BF979770 Ribosomal protein L10-like

NMJ304898 Clock homolog (mouse) NM_001875 Carbamoyl-phosphate synthetase 1 , mitochondrial

N35922 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_062553.1

(H.sapieπs) hypothetical protein FLJ11267 [Homo sapiens]

Z19588 SKI-like

NM_199072 l-mfa domain-containing protein

BM661690 Transcribed locus

AW408767 hypothetical LOC133993

AK122813 Polymerase (RNA) Il (DNA directed) polypeptide E, 25kDa

BC035101 Hypothetical LOC389372

BC064962 Zinc finger protein 573

NWM44567 Similar to RIKEN cDNA 2610307121

BF035279 hypothetical protein FLJ10613

BC050559 Polymerase (DNA directed), gamma

AK126976 Full length insert cDNA clone ZE05A03

CR603105 Chromosome 14 open reading frame 112

BX648809 FXYD domain containing ion transport regulator 5

BQ938746 Transcribed locus

AL157466 Regulatory factor X, 3 (influences HLA class Il expression)

AA650558 Transcribed locus

NM_014331 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11

AI683552 gb:AI683552 /DB_XREF=gi:4893734 /DBJXREF=tx67h02.x1 /CLONE=I MAGE:2274675

/FEA=EST /CNT=3 /TID=Hs.2O1605.0 /TlER=ConsEnd /STK=3 /UG=Hs.2O16O5

/UGJnTLE=ESTs, Moderately similar to ALU8_HUMAN ALU SUBFAMILY SX SEQUENCE

CONTAMINATION WARNING ENTRY (H.sapiens)

BG036319 Similar to 60S ribosomal protein L10 (QM protein homolog)

AL832650 PRO0149 protein

CR749634 Adenylate cyclase 2 (brain)

AK127319 Solute carrier family 16 (monocarboxylic acid transporters), member 3

AK074803 Spondin 1, extracellular matrix protein

AI535683 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

AA126763 Homo sapiens transcribed sequence with weak similarity to protein ref:NP_060312.1

(H.sapiens) hypothetical protein FLJ20489 [Homo sapiens]

BX647885 Stathmin 1/oncoprotein 18

NM_013336 Sec61 alpha 1 subunit (S. cerevisiae)

NM_003404 Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide

NM_014052 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide

AK056129 Eukaryotic translation initiation factor 3, subunit 6 interacting protein

BQ071916 Coiled-coil-helix-coiled-coil-helix domain containing 2

BX648365 CDC10 cell division cycle 10 homolog (S. cerevisiae)

NM_016645 Mesenchymal stem cell protein DSC92

AK074970 PAI-1 mRNA-binding protein

AK074970 PAI-1 mRNA-binding protein

AK025956 Coatomer protein complex, subunit zeta 1

BC041367 Vacuolar protein sorting 35 (yeast)

BM904612 S100 calcium binding protein A6 (calcyclin)

AK095154 Amino-terminal enhancer of split AK090618 PP1201 protein

BX537657 Integral membrane protein 2B

BX537657 Integral membrane protein 2B

BM994413 Thymosin, beta 10

NM_018031 WD repeat domain 6

AF116615 JTV1 gene

AB037790 Heme-regulated initiation factor 2-alpha kinase

BM703857 Chromosome 20 open reading frame 43

NM_005746 Pre-B-cell colony enhancing factor 1

NM_005746 Pre-B-cell colony enhancing factor 1

BX641050 Ribosomal protein L7a

BX648551 Zinc finger, A20 domain containing 2

AK091453 VVW domain containing adaptor with coiled-coil

NMJD18247 Transmembrane protein 3OA

AL832743 PERP, TP53 apoptosis effector

BC012731 Mak3 homolog (S. cerevisiae)

NM_013374 Programmed cell death 6 interacting protein

AK095055 Ribosomal protein S9

AK124455 Adiponectin receptor 1

NM_016128 Coatomer protein complex, subunit gamma

AK091644 Hypothetical protein FLJ13855

BF972232 Glutathione S-transferase kappa 1

AK024471 CNDP dipeptidase 2 (metallopeptidase M20 family)

NM_001148 Ankyrin 2, neuronal

AK125595 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56

BC039343 Hematological and neurological expressed 1

BM926308 Small EDRK-rich factor 2

AF269150 SM-11044 binding protein

NM_017583 Tripartite motif-containing 44

NM_017583 Tripartite motif-containing 44

AK127473 Membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1

NMJ306868 RAB31 , member RAS oncogene family

NM_006868 RAB31 , member RAS oncogene family

NM_006868 RAB31 , member RAS oncogene family

AK122664 Nuclear receptor binding protein

AY071927 Small membrane protein 1

AK129516 Chromosome 14 open reading frame 166

BF572299 Chromosome 13 open reading frame 12

AK123590 Phosphatidylinositol glycan, class T

NM_016548 Golgi phosphoprotein 2

AY380792 Mitochondrial carrier homolog 2 (C. elegans)

BX538277 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa

BM908838 Hypothetical protein HSPC152

AK001494 DKFZP564M1462 protein

AK001494 DKFZP564M1462 protein

BX648759 Butyrate-induced transcript 1

BC047288 Solute carrier family 39 (zinc transporter), member 1

NM_017761 Proline-rich nuclear receptor coacfjvator 2 AK091030 PTD008 protein

AF205632 SH3-domain binding protein 3

NM_212492 G protein pathway suppressor 1

AK025730 Yippee-like 5 (Drosophila)

NM_006555 SNARE protein Ykt6

NM_006555 SNARE protein Ykt6

NM_006109 SKB1 homolog (S. pombe)

BC041120 UDP-N-acetyl-alpha-D-galactosamineipolypeptide N-acetylgalactosaminyltransferase 2

(GalNAc-T2)

BC041120 UDP-N-acetyl-alpha-D-galactosamineipolypeptide N-acetylgalactosaminyltransferase 2

(GalNAc-T2)

NM_021249 Sorting nexin 6

NM_007107 Signal sequence receptor, gamma (translocon-associated protein gamma)

AK126355 Aldehyde dehydrogenase 18 family, member A1

AK054634 Sorting nexin 5

BE906094 DKFZp564J 157 protein

AK074073 Hypothetical protein MGC3222

AK024398 Nuclear protein localization 4

BM992899 Ufrn1 -conjugating enzyme 1

BX641116 CCR4-NOT transcription complex, subunit 2

NM_003344 Ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)

AK124884 Nedd4 family interacting protein 1

CR595852 ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit

AF130080 Nuclear ubiquitous casein kinase and cyclin-dependent kinase substrate

AK128510 Golgi phosphoprotein 3 (coat-protein)

NM_012218 lnterleukin enhancer binding factor 3, 9OkDa

NM_012218 lnterleukin enhancer binding factor 3, 9OkDa

NM_015584 Polymerase (DNA-directed), delta interacting protein 2

AK024486 Glioma tumor suppressor candidate region gene 2

AY524429 Mitogen-activated protein kinase associated protein 1

AK027837 Basic leucine zipper and W2 domains 2

NM_020117 Leucyl-tRNA synthetase

NM_016275 Selenoprotein T

NM_016258 YTH domain family 2

AU 36719 Spindlin

NM_020198 GK001 protein

NM_007192 Suppressor of Ty 16 homolog (S. cerevisiae)

BX647886 PEST-containing nuclear protein

BC065423 Actin related protein 2/3 complex, subunit 4, 2OkDa

BC065423 Actin related protein 2/3 complex, subunit 4, 2OkDa NM_001002296 Golgi autoantigen, golgin subfamily a, 7

NM_018212 Enabled homolog (Drosophila)

BC023532 WW domain binding protein 11

BC023532 WW domain binding protein 11

NM_016021 Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)

NMJD16021 Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)

NMJ316021 Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)

NM_016021 Ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) AL137312 Spastic paraplegia 21 (autosomal recessive, Mast syndrome)

AK055195 Hypothetical protein FLJ13213

AK057698 Ubiquitin specific protease 39

AL109658 NS FL1 (p97) cofactor (p47)

AK128722 NS FL1 (p97) cofactor (p47)

BC032643 Synaptotagmin binding, cytoplasmic RNA interacting protein

BC032643 Synaptotagmin binding, cytoplasmic RNA interacting protein

BC032643 Synaptotagmin binding, cytoplasmic RNA interacting protein

BG482041 Chromosome 20 open reading frame 24

BC025272 YY1 associated protein

NM_016079 Vacuolar protein sorting 24 (yeast)

AL133642 Enah/Vasp-like

AK123588 TRK-fused gene

AK091545 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41

AK095005 Protein phosphatase methylesterase-1

BC041001 LUC7-like 2 (S. cerevisiae)

AK001934 Vitamin D receptor interacting protein

AF229162 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

AL833541 Likely ortholog of mouse hypoxia induced gene 1

BC000394 Glutaminyl-tRNA synthetase

AK127102 Pyrophosphatase (inorganic)

NM_006035 CDC42 binding protein kinase beta (DMPK-like)

NM_206825 Nucleostemin

BC013969 Chromosome 20 open reading frame 45

BC063125 ADP-ribosylation factor-like 10C

CR749644 Tensin-like SH2 domain containing 1

AK122813 Polymerase (RNA) Il (DNA directed) polypeptide E, 25kDa

AK126927 Calcium binding protein Cab45 precursor

NM_016607 Armadillo repeat containing, X-linked 3

AY358687 Solute carrier family 39 (zinc transporter), member 9

AK091719 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa

BC036185 Prolactin regulatory element binding

AK128379 Protein inhibitor of activated STAT, 1

AK128379 Protein inhibitor of activated STAT, 1

AK128379 Protein inhibitor of activated STAT, 1

AL831873 Ring finger protein 130

BX537888 Pre-mRNA cleavage factor I, 59 kDa subunit

NM_012105 Beta-site APP-cleaving enzyme 2

BX647201 DORA reverse strand protein 1

BX537496 Hydroxysteroid (17-beta) dehydrogenase 12

AK025258 UMP-CMP kinase

BQ056329 Macrophage migration inhibitory factor (glycosylation-inhibiting factor)

BF312426 Hypothetical protein FLJ20643

NM_016289 Calcium binding protein 39

AK125502 Succinate-CoA ligase, GDP-forming, alpha subunit

NM_020182 Transmembrane, prostate androgen induced RNA

BC017337 General transcription factor IHC, polypeptide 5, 63kDa

NM_021639 Hypothetical protein SP192 S78234 Cell division cycle 27

S78234 Cell division cycle 27

S78234 Cell division cycle 27

S78234 Cell division cycle 27

AK022202 30 kDa protein

BF572337 Chromosome 2 open reading frame 25

BC035558 N-acetyltransferase-like protein

AL834323 lmportin 9

BF213575 epidermal growth factor receptor pathway substrate 15

NM_001981 Epidermal growth factor receptor pathway substrate 15

BC000786 ADP-ribosylation factor GTPase activating protein 1

AL136693 Cytochrome b reductase 1

AL832682 Parvin, alpha

AK023930 Hypothetical protein FLJ 13868

BX647194 Epithelial protein lost in neoplasm beta

AK092624 Hypothetical protein FLJ12666

NM_016121 Potassium channel tetramerisation domain containing 3

NM_017952 FLJ20758 protein

AK023291 NEFA-interacting nuclear protein NIP30

BF965128 Chromosome 15 open reading frame 24

AK074981 Hypothetical protein FLJ20254

NM_018060 Mitochondrial isoleucine tRNA synthetase

NM_001943 Desmoglein 2

NM_004667 Hect domain and RLD 2

NM_013403 Striatin, calmodulin binding protein 4

AF201468 Beta-site APP-cleaving enzyme 1

AK023143 Chromosome 10 open reading frame 119

AK056298 Kelch domain containing 2

BM994368 Mitochondrial ribosomal protein L18

AF116725 Glycine cleavage system protein H (aminomethyl carrier)

AF213668 Transcription factor-like 4

NM_013383 transcription factor-like 4

NM_004281 BCL2-associated athanogene 3

BC062566 PP3111 protein

AK092372 Vacuolar protein sorting 4A (yeast)

AB032995 Two pore segment channel 1

BF244626 Chromosome 15 open reading frame 15

CR749628 Family with sequence similarity 49, member B

AK096092 Dynein, cytoplasmic, light polypeptide 2A

AK096092 Dynein, cytoplasmic, light polypeptide 2A

CR749344 Mitochondrial ribosomal protein L42

BC052954 Mannosidase, alpha, class 1A, member 2

BC052954 Mannosidase, alpha, class 1A, member 2

BC052954 Mannosidase, alpha, class 1 A, member 2

AK092483 PEF protein with a long N-terminal hydrophobic domain (peflin)

NM_024294 Chromosome 6 open reading frame 106

BU729767 HSPC023 protein

CA453810 Signal peptidase 12kDa AB046778 Chromosome 11 open reading frame 23

AK127123 Toll interacting protein

AK124196 Trinucleotide repeat containing 5

CR626245 Mitochondrial ribosomal protein S7

BU738766 Leucine aminopeptidase 3

CR620798 STIP1 homology and U-Box containing protein 1

AK128252 Chromosome 20 open reading frame 44

AW044631 Rho GTPase activating protein 5

AK122588 Histone deacetylase 7A

NM_020122 Potassium channel modulatory factor 1

AL833962 Aftiphilin protein

AK058043 Hypothetical protein FLJ10769

NM_018695 Erbb2 interacting protein

BC028346 Mitochondrial ribosomal protein S35

AB033013 Hypothetical protein FLJ10350

CR749700 O-linked mannose beta1,2-N-acetylglucosaminyltransferase

AF355402 BTB (POZ) domain containing 1

NM_016402 SUMO-1 activating enzyme subunit 1

NM_017801 Chemokine-like factor super family 6

BM695125 DKFZP564B147 protein

CD251196 Vitamin K epoxide reductase complex, subunit 1

BC047314 Nitric oxide synthase interacting protein

BX648268 PHD finger protein 3

BX648268 PHD finger protein 3

BX648268 ' PHD finger protein 3

AL831982 BCL2-like 13 (apoptosis facilitator)

AF113125 E-1 enzyme

CR613931 Likely ortholog of mouse gene trap locus 3

BM691011 Trafficking protein particle complex 4

BM691011 Trafficking protein particle complex 4

BG283126 Translocase of outer mitochondrial membrane 22 homolog (yeast)

AK000558 Hypothetical protein FLJ20551

BG615971 Nucleolar protein family A, member 3 (H/ACA small nucleolar RNPs)

CR593909 Nerve growth factor receptor (TNFRSF16) associated protein 1

AK094819 Tetratricopeptide repeat domain 19

BX647066 Transcriptional regulator protein

AF288391 Chromosome 1 open reading frame 24

AF288391 Chromosome 1 open reading frame 24

BC007198 Chromosome 11 open reading frame2

AB033020 Carbon catabolite repression 4 protein

AK022313 Mitogen-activated protein kinase kinase 1 interacting protein 1

AK025271 Coiled-coil-helix-coiled-coil-helix domain containing 3

BM918881 Dicarbonyl/L-xylulose reductase

BF213234 WW domain binding protein 5

BX649189 Dynein, cytoplasmic, light intermediate polypeptide 1

BM548797 Selenoprotein X, 1

NM_017582 Ubiquitin-conjugating enzyme E2Q (putative)

AK128509 Transmembrane 4 superfamily member 13 BQ058130 Mitochondrial ribosomal protein L16

NM_012192 Fracture callus 1 homolog (rat)

NM_206839 Mortality factor 4 like 1

AK001769 Ribonuclease T2

AK001769 Ribonuclease T2

NM_013448 Bromodomain adjacent to zinc finger domain, 1 A

NM_013448 Bromodomain adjacent to zinc finger domain, 1A

AK000759 HCV NS3-transactivated protein 1

NM_182851 Cyclin B1 interacting protein 1

AY358553 Dehydrogenase/reductase (SDR family) member 8

BC003053 Guanosine monophosphate reductase 2

AK023883 Single stranded DNA binding protein 3

NM_024329 EF hand domain containing 2

AK096178 Methionine adenosyltransferase II, beta

AK123641 Hypothetical protein FLJ20542

AK130140 Sulfide quinone reductase-like (yeast)

AF220656 Pleckstrin homology-like domain, family A, member 1

AF220656 Pleckstrin homology-like domain, family A, member 1

AF220656 Pleckstrin homology-like domain, family A, member 1

AF220656 Pleckstrin homology-like domain, family A, member 1

AF220656 Pleckstrin homology-like domain, family A, member 1

CR623075 Mitochondrial ribosomal protein S2

BG112095 FK506 binding protein 3, 25kDa

BX641056 Hypothetical protein FLJ10276

BC041139 Zinc finger protein 22 (KOX 15)

BC041139 Zinc finger protein 22 (KOX 15)

BC047648 Ribosomal protein S27-like

AK023152 Hypothetical protein FLJ 10099

NM 003981 Protein regulator of cytokinesis 1

BU734647 Chromosome 20 open reading frame 149

BM703541 Ubiquitin-like 5

AY040871 TSPY-like 2

AK125973 Dynactin 4 (p62)

AF514995 Pericentrin 1

AB040885 Polymerase (RNA) III (DNA directed) polypeptide E (8OkD)

NM_025070 hypothetical protein FLJ32731

NM_021941 Homo sapiens chromosome 21 open reading frame 97 (C21orf97), mRNA

NM_021941 Homo sapiens chromosome 21 open reading frame 97 (C21orf97), mRNA

BX647574 Testis expressed sequence 27

BC015609 Dehydrogenase/reductase (SDR family) member 4

AK123892 Vaccinia related kinase 3

AF251040 Chromosome 5 open reading frame 6

BF698899 Brain protein 44-like

AF257175 Peroxisomal D3,D2-enoyl-CoA isomerase

BG614576 HSPC009 protein

BQ278804 Mitochondrial ribosomal protein L15

NM_016031 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1

NM_014030 G protein-coupled receptor kinase interactor 1 NM_018589 Homo sapiens chromosome 14 open reading frame 116 (C14orf116), mRNA

AF070673 stannin

CR624091 Tetratricopeptide repeat domain 11

AK094749 CGI-07 protein

AL832843 Chromosome 2 open reading frame 17

AF290612 Nucleolar and spindle associated protein 1

AL833950 Hypothetical protein FLJ10330

NM_018573 solute carrier family 38, member 2

AK094238 COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)

BX648471 5-azacytidine induced 2

BM423440 Parathymosin

AK025715 Mitochondrial ribosomal protein S16

AK124037 Oxysterol binding protein-like 9

BX647275 COMM domain containing 3

AK123239 Mitochondrial ribosomal protein L13

AK095490 Ubiquitin-fold modifier 1

AK091962 Hypothetical protein FLJ12442

AK074159 ATPase ty pe 13A

NM_017892 formin binding protein 3

AL834138 WD repeat domain 41

AF173003 Bifunctional apoptosis regulator

NM_006067 Neighbor of COX4

BX647189 CXXC finger 1 (PHD domain)

BC035233 HSPC038 protein

AK126223 Hypothetical protein FLJ13154

B1224374 Male-enhanced antigen

BC002774 CDC42 effector protein (Rho GTPase binding) 4

AK001594 A kinase (PRKA) anchor protein 8-like

BC040124 Chromosome 11 open reading frame 15

NM_006598 Solute carrier family 12 (potassium/chloride transporters), member 7

BC071587 Hypothetical protein FLJ10154

BC035140 Hypothetical protein FLJ22301

NM_205847 GDP-mannose pyrophosphorylase A

BC015715 Makorin, ring finger protein, 2

AK055668 COMM domain containing 9

AL354613 Hypothetical protein FLJ10407

BU 154803 CGI-128 protein

AK094302 Achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)

AK125358 Rho GTPase activating protein 17

BE542551 zinc finger, DHHC domain containing 3

AF247703 Zinc finger, DHHC domain containing 3

AF268387 Zinc finger protein 403

NM_007051 Fas (TNFRSF6) associated factor 1

AK124341 Chromosome 20 open reading frame 27

CR749798 Upstream binding protein 1 (LBP-Ia)

AK057049 Prostaglandin E synthase 2

BX648809 FXYD domain containing ion transport regulator 5

NM_015961 hypothetical protein HSPC177 AK054950 Neural proliferation, differentiation and control, 1

AK092808 Ras-related GTP binding C

NM_015511 Chromosome 20 open reading frame 4

AL137699 WD repeat domain 11

NM_004504 HIV-1 Rev binding protein

NM_004504 HIV-1 Rev binding protein

BC034813 Ankyrin repeat domain 10

AL390160 Chromosome 20 open reading frame 35

AK123358 TPA regulated locus

BX640918 Acid acyltransferase-epsilon

AK094695 CUE domain containing 2

NM_006420 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)

NM_018469 Uncharacterized hypothalamus protein HT008

NM_018010 Estrogen-related receptor beta like 1

NM_004549 NADH dehydrogenase (ubiquinone) 1 , subcomplex unknown, 2, 14.5kDa

BC041328 CGI-26 protein

AF327355 FtsJ homolog 3 (E. coli)

AK000294 Testis expressed sequence 10

NM_146388 Mitochondrial ribosomal protein L4

AF113220 Mitochondrial ribosomal protein S10

BC063817 WD repeat domain 26

NM_018108 Chromosome 14 open reading frame 130

BC030542 Hypothetical protein FLJ 14153

AK124990 Cytidine monophosphate N-acetylneuraminic acid synthetase

BF206087 Mitochondrial ribosomal protein S34

AF137030 Transmembrane protein 2

BM909565 ASF1 anti-silencing function 1 homolog B (S. cerevisiae)

AK097577 Chromosome 9 open reading frame 78

BU729963 Ring-box 1

BM700226 Translocase of inner mitochondrial membrane 23 homolog (yeast)

BM700226 Translocase of inner mitochondrial membrane 23 homolog (yeast)

BG115862 Heme oxygenase (decycling) 2

BG115862 Heme oxygenase (decycling) 2

AK027599 SUMO1/sentrin/SMT3 specific protease 2

AK055328 Chromosome 21 open reading frame 59

BC068517 Hypothetical protein FLJ20296

BC065295 Hypothetical protein FLJ 10853

AK123282 Hypothetical protein FLJ 10579

NM_006166 Nuclear transcription factor Y, beta

NM_006166 Nuclear transcription factor Y, beta

NM_006166 Nuclear transcription factor Y, beta

AK090484 Hypothetical protein MGC4368

AK125974 P66 alpha

AK054944 Leukocyte receptor cluster (LRC) member 5

AK127110 N1F3 NGG1 interacting factor 3-like 1 (S. pombe)

AL136933 RNA binding motif protein 22

AL834128 PTX1 protein

AK127666 Mitochondrial solute carrier protein BC036123 Stromal membrane-associated protein 1

NM_018848 McKusick-Kaufman syndrome

NM_018229 Chromosome 14 open reading frame 108

AK055102 Signal recognition particle receptor, B subunit

CR627060 Cereblon

AK096794 Secretory carrier membrane protein 2

AK025709 Chromosome 14 open reading frame 173

AY247738 Tribbles homolog 3 (Drosophila)

AF176777 Glycosyltransferase AD-017

AF176777 Glycosyltransferase AD-017

NM_017606 hypothetical protein DKFZp434K1210

AK054652 ADP-ribosylation factor-like 5

CR625605 G protein-coupled receptor 172A

NM_018200 High-mobility group 2OA

BX648882 Hypothetical protein FLJ12118

NM_018128 Hypothetical protein FLJ 10534

NM_018128 Hypothetical protein FLJ10534

NM_020239 CDC42 small effector 1

NM_012096 Adaptor protein containing pH domain, PTB domain and leucine zipper motif 1

BM450548 Chromosome 20 open reading frame 116

BM704035 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa

AK075544 Olfactomedin-like 3

BF029426 Malignant T cell amplified sequence 1

AK125807 Sperm protein SSP411

BX640719 Hypothetical protein FLJ 11730

AF227948 Hepatitis B virus x associated protein

AK126146 Hypothetical protein LOC51321

AK126466 Chaperone, ABC1 activity of bd complex like (S. pombe)

AK128439 Hypothetical protein FLJ 10305

NM_016048 CGI-111 protein

NM_004869 Vacuolar protein sorting 4B (yeast)

NM_018630 hypothetical protein MGC3067

AL832397 Chromosome 10 open reading frame 57

AK125866 Limkain beta 2

BQ279149 Melanoma antigen, family F, 1

BM451314 CHMP1.5 protein

BM451314 CHMP1.5 protein

BX647127 FLJ 12716 protein

AK122903 EPS8-like 2

NM_017792 hypothetical protein FLJ20373

NM_013399 Chromosome 16 open reading frame 5

NM_020245 Tubby like protein 4

NM_018120 Armadillo repeat containing 1

BX648996 Hypothetical protein FLJ20989

NM_012458 Translocase of inner mitochondrial membrane 13 homolog (yeast)

AK091184 N-acetylneuraminic acid synthase (sialic acid synthase)

BF965131 Ubiquinol-cytochrome c reductase complex (7.2 kD)

AK021916 Chromosome 6 open reading frame 209 BX537544 Inositol hexaphosphate kinase 2

AB097020 CGM 41 protein

BF792390 Small fragment nuclease

AK022972 Chromosome 6 open reading frame 211

BC059412 Osteopetrosis associated transmembrane protein 1

NM_018002 oxidation resistance 1

AF427340 DEAH (Asp-Glu-Ala-His) box polypeptide 32

NM_022917 Nucleolar protein family 6 (RNA-associated)

AK098095 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa

AK098095 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 2, 8kDa

AK095007 Mitochondrial ribosomal protein L44

AK097252 Asparagine-linked glycosylate 5 homolog (yeast, dolichyl-phosphate beta- glucosyltransferase)

AJ292348 FYVE and coiled-coil domain containing 1

NM_199054 MAP kinase interacting serine/threonine kinase 2

BC041022 SCAN domain containing 1

AK126188 PQ loop repeat containing 1

NM_018170 Hypothetical protein FLJ 10656

AL136631 Fructosamine-3-kinase-related protein

AK126211 Molybdenum cofactor synthesis 2

CD049126 Chromosome 11 open reading frame 10

BM911475 Hypothetical protein FLJ11773

AK091535 Nuclear receptor subfamily 1 , group H, member 2

BM907906 ADP-ribosylation-like factor 6 interacting protein 4

AK124440 Serine carboxypeptidase 1

BX649010 DIP13 beta

NM_018697 LanC lantibiotic synthetase component C-like 2 (bacterial)

BF341574 Chromosome 12 open reading frame 10

NM_001668 Aryl hydrocarbon receptor nuclear translocator

AK125609 CK2 interacting protein 1; HQ0024c protein

NM_006029 Paraneoplastic antigen MA1

AK131241 Likely ortholog of mouse signaling intermediate in Toll pathway-evolutionarily conserved

BM919388 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa

AK124460 Nucleotide binding protein 2 (MinD homolog, E. coli)

NMJ325235 Tankyrase, TRF1 -interacting ankyrin-related ADP-ribose polymerase 2

NM_017542 Pogo transposable element with KRAB domain

AK096509 ADP-ribosylation factor interacting protein 1 (arfaptin 1)

AL832837 N-acetylglucosamine kinase

NM_017601 chromosome 6 open reading frame 49

NM_198287 Inhibitor of growth family, member 4

AK023587 Comparative gene identification transcript 94

NM_005813 Protein kinase D3

AK024263 Solute carrier family 38, member 1

AK001548 GTP binding protein 4

AK001548 GTP binding protein 4

BC063498 NFKB inhibitor interacting Ras-like 2

NM_005113 Golgi autoantigen, golgin subfamily a, 5

NM_017635 Suppressor of variegation 4-20 homolog 1 (Drosophila) AF312367 RUN and FYVE domain containing 1

CR627363 Nucleolar protein 8

AK126536 Likely ortholog of chicken tsukushi

NM_016626 Ring finger and KH domain containing 2

CR749358 FLJ22794 protein

BX647270 Zinc finger, DHHC domain containing 6

BC060852 CCR4-NOT transcription complex, subunit 7

NMJ321242 MIDI interacting protein 1 (gastrulation specific G12-like (zebrafish))

NM_018204 Cytoskeleton associated protein 2

AF220417 Lϊgatin

AK056821 SARIa gene homolog 2 (S. cerevisiae)

AK096322 Fibrosin 1

NM_017426 Nucleoporin 54kDa

BC041098 UDP-glucose ceramide glucosyltransferase-like 1

AK097973 Polymerase (RNA) I polypeptide D, 16kDa

NM_014048 MKL/myocardin-like 2

AL832922 Cross-immune reaction antigen PCIA1

AK122692 Hypothetical protein FLJ22318

AK126323 Transposon-derived Busteri transposase-like protein gene

AK092054 BRCA2 and CDKN 1 A interacting protein

BX648787 SECIS binding protein 2

NM_014286 Frequenin homolog (Drosophila)

NM_016550 cyclin-dependent kinase 2-interacting protein

AY333753 TBC1 domain family, member 15

NM_013235 Nuclear RNase 111 Drosha

BM701213 Mitochondrial ribosomal protein L24

AK024765 Presenilin associated, rhomboid-like

AK127928 Hypothetical protein FLJ20699

NM_018444 Protein phosphatase 2C, magnesium-dependent, catalytic subunit

AL833378 Salvador homolog 1 (Drosophila)

AF260270 DEAH (Asp-Glu-Ala-His) box polypeptide 40

CR625671 Hypothetical protein FU10439

BX648801 Histone 2, H2aa

AF151876 Mitochondrial ribosomal protein L48

BC001371 Chromosome 20 open reading frame 31

BQ278408 Synovial sarcoma translocation gene on chromosome 18-like 2

NM_015400 Homo sapiens DKFZP586N0721 protein (DKFZP586N0721), mRNA

AK128463 Dehydrogenase/reductase (SDR family) member 6

NM_183063 Ring finger protein 7

NM_012199 Eukaryotic translation initiation factor 2C, 1

AK055972 Hypothetical protein MDS025

NiVM 98329 Ubiquitin-activating enzyme E1-domain containing 1

AK092742 Pleckstrin homology domain containing, family J member 1

BQ931262 Mitogen-activated protein-binding protein-interacting protein

AK130536 Protein kinase, AMP-activated, gamma 2 non-catalytic subunit

AL389951 Nucleoporin 5OkDa

AL389951 Nucleoporin 5OkDa

BC067799 Chromosome 10 open reading frame 97 BX647492 Chromosome 14 open reading frame 159

AF264781 Chromosome 11 open reading frame 24

AK130805 Arginyl aminopeptidase (aminopeptidase B)-like 1

NM_018468 presenilin enhancer 2

AK025986 Hypothetical protein LOC51315

AF392454 Oxysterol binding protein-like 11

AK094897 lmportin 4

NM_003922 Hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHCI)-like domain (RLD) 1

AK002026 Hypothetical protein FLJ 11164

CR604926 Calcium/calmodulin-dependent protein kinase Il

AJ250042 RAB guanine nucleotide exchange factor (GEF) 1

BC071579 Mitogen-activated protein kinase kinase kinase kinase 3

AK160376 Hypothetical protein FLJ 12895

BC047468 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7

(GalNAc-T7)

BX538107 Hypothetical protein FLJ 10726

NM_016408 CDK5 regulatory subunit associated protein 1

BG719789 Translocase of inner mitochondrial membrane 9 homolog (yeast)

BM909368 Hypothetical protein MGC5178

BC064663 Nemo like kinase

AF302505 Pellino homolog 1 (Drosophila)

BQ278575 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11 , 17.3kDa

NM_016086 Map kinase phosphatase-like protein MK-SPr-X

AJ496730 Ras homolog gene family, member T1

AL833614 Spermatogenesis associated, serine-rich 2

NM_018490 G protein-coupled receptor 48

NM_004782 Synaptosomal-associated protein, 29kDa

AK128853 Coenzyme Q4 homolog (yeast)

NM_012406 PR domain containing 4

NM_018162 neuron navigator 2

NM_017782 Homo sapiens hypothetical protein FLJ20360 (FLJ20360), mRNA

BM804232 Brain expressed, X-linked 1

BM478493 Derlin-2

BM698744 Ngg1 interacting factor 3 like 1 binding protein 1

AL137262 TN FAl P3 interacting protein 2

BF203500 Prefoldin 2

NM_022749 Retinoic acid induced 16

AK097880 Mitochondrial ribosomal protein L22

NM_018227 Hypothetical protein FLJ10808

BM811169 Hypothetical protein FLJ11838

BC036952 General transcription factor NIC, polypeptide 3, 102kDa

AK125810 REST corepressor 3

AK127043 Sestrin i

AL833452 Hypothetical protein FLJ10900

NM_014153 Zinc finger CCCH type domain containing 7

BX640701 Zwilch

BF570966 Geminin, DNA replication inhibitor NM_017845 COMM domain containing 8

NM_018191 Regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1

NM_025226 regulator of G-protein signalling 5

AK126779 Hematopoietic stem/progenitor cells 176

AF071592 Kinesin family member 4A

NM_177442 FtsJ homolog 2 (E. coli)

BF972097 Translocase of inner mitochondrial membrane 8 homolog B (yeast)

AL713788 Hypothetical protein MGC11256

AL136915 Chromosome 20 open reading frame 98

NM_020673 RAB22A, member RAS oncogene family

NM_018178 GPP34-related protein

NM_014953 KIAA1008

AK056025 Chromosome 14 open reading frame 114

AK124432 Leucine rich repeat (in FLII) interacting protein 2

NM_018122 Hypothetical protein FLJ10514

CR612311 FLJ20859 gene

NM_012475 Ubiquitin specific protease 21

BM916267 Tumor necrosis factor receptor superfamily, member 12A

BX647916 Hypothetical protein FLJ12903

AL049263 Paraspeckle component 1

BC000647 Mediator subunit 25

AK123086 Fused toes homolog (mouse)

NM_020374 Chromosome 12 open reading frame 4

BM923755 Nudix (nucleoside diphosphate linked moiety X)-type motif 9

AK024500 NEDD9 interacting protein with calponin homology and LIM domains

CR592518 Chromosome 21 open reading frame 6

AK124753 PRKR interacting protein 1 (1L11 inducible)

NM_016090 RNA binding motif protein 7

NMJ321730 death effector filament-forming Ced-4-like apoptosis protein

BC030574 U2 (RNU2) small nuclear RNA auxiliary factor 2

BC030574 U2 (RNU2) small nuclear RNA auxiliary factor 2

AK097980 Chromosome 14 open reading frame 94

AL832316 Calcium regulated heat stable protein 1 , 24kDa

AK074642 Mitochondrial ribosomal protein S18A

NM_006447 Ubiquitin specific protease 16

BQ065293 6-phosphogluconolactonase

BQ065293 6-phosphogluconolactonase

BC068606 Likely ortholog of C. elegans anterior pharynx defective 1A

BF569053 EAP30 subunit of ELL complex

BC063241 Sideroflexin 1

BC002876 Smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)

AK054707 Leucine zipper domain protein

AK124075 ARP6 actin-related protein 6 homolog (yeast)

AJ608771 Vacuolar protein sorting 13C (yeast)

BC037570 Fanconi anemia, complementation group L

BX538300 Mitochondrial ribosomal protein S30

BG354577 Cell division cycle associated 4

BC060820 Zinc finger protein 281 BU729993 Hypothetical protein HSPC132

NM_013375 Activator of basal transcription 1

BU502624 Secreted protein of unknown function

BQ011318 Translocase of inner mitochondrial membrane 10 homolog (yeast)

CR613772 DnaJ (Hsp40) homolog, subfamily C, member 1

AF208857 MAP3K12 binding inhibitory protein 1

NM_016328 GTF2I repeat domain containing 1

BC033900 NudE nuclear distribution gene E homolog 1 (A. nidulans)

AF308803 Vacuolar protein sorting 33B (yeast)

NM_015493 Ankyrin repeat domain 25

AK096631 Hypothetical protein MGC3123

AB107354 Chromosome 13 open reading frame 23

NM_022766 Ceramide kinase

BX648672 Chromosome 13 open reading frame 10

AK124436 Vacuolar protein sorting 54 (yeast)

AL833624 Dudulin 2

NM_207111 TRIAD3 protein

NM_207111 TRIAD3 protein

AY129014 Serologically defined colon cancer antigen 3

BC037734 REVMike (yeast)

AK096142 Hypothetical protein FLJ11286

CR749418 Hypothetical protein FLJ 12994

AK098254 Chromosome 14 open reading frame 133

BC039291 F-box protein 3

BX648891 Pantothenate kinase 3

BC036694 Acetoacetyl-CoA synthetase

CR624365 DnaJ (Hsp40) homolog, subfamily D, member 1

CR617127 Endoplasmic reticulum chaperone SIL1 , homolog of yeast

BC042483 Leucine zipper transcription factor-like 1

CR607989 Endothelial-derived gene 1

BC036897 COMM domain containing 10

BC042453 Methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)

NM_015540 RNA polymerase Il associated protein 1

AK025524 Tetratricopeptide repeat domain 4

AK124583 DAZ associated protein 1

NM_024105 Asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)

AK128119 Family with sequence similarity 18, member B

AK123983 DC13 protein

NM_017896 Chromosome 20 open reading frame 11

AK091635 Hypothetical protein FLJ 11200

AK131565 Heme binding protein 1

AK023780 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like

1

AK056242 NFS1 nitrogen fixation 1 (S. cerevisiae)

BX537569 C1q domain containing 1

NM_022471 Germ cell-less homolog 1 (Drosophila)-like

CR600139 Torsin family 3, member A

AK125479 Hypothetical protein FLJ20397 NM_016301 Protein x 0004

CR627468 RNA processing factor 1

AK095326 MUS81 eπdσnuciease homolog (yeast)

AK001562 Hypothetical protein FLJ 10700

AK001387 Transmembrane protein 33

AY129013 TBC1 domain family, member 17

BM809935 Tumor necrosis factor superfamily, member 5-induced protein 1

AY232290 Gremlin 1 homolog, cysteine knot superfamily (Xenopus laevis)

AY232290 Gremlin 1 homolog, cysteine knot superfamily (Xenopus laevis)

NM_015936 CGI-04 protein

AK095638 Bardet-Biedl syndrome 1

BX648284 Integrin, alpha 1

NM_024656 Glycosyltransferase 25 domain containing 1

AK000047 Potassium channel tetramerisation domain containing 5

AK094558 Protein-O-mannosyltransferase 1

BF690886 Transmembrane protein 14A

NM_017612 Zinc finger, CCHC domain containing 8

NM_022459 Exportin 4

NM_021831 Hypothetical protein FLJ21839

BF125446 Exosome component 5

AK095651 E(y)2 protein

NM_020153 Hypothetical protein FLJ21827

AK094275 NADH:ubiquinone oxidoreductase MLRQ subunit homolog

AK074929 Solute carrier family 35, member C1

BC063286 TGFB inducible early growth response 2

NM_001003945 Aminolevulinate, delta-, dehydratase

AK095730 Eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa

AK122855 Zinc finger protein 302

NM_014174 Thymocyte protein thy28

CR605890 THAP domain containing 7

BC001381 Chromosome 16 open reading frame 33

BC069276 SLC2A4 regulator

BE731794 Ubiquitously-expressed transcript

AK124435 Ribonuclease H1

AK124435 Ribonuclease H 1

AF081886 ERO1-like (S. cerevisiae)

BC070056 Mst3 and SOK1 -related kinase

AL833224 Rho guanine nucleotide exchange factor (GEF) 3

NM_014112 Trichorhinophalangeal syndrome I

NM_017794 KIAA1797

BF206518 Fυmarylacetoacetate hydrolase domain containing 2A

NM_018459 uncharacterized bone marrow protein BM045

BC008573 Hypoxia-inducible protein 2

AJ275986 Transcription factor SMIF

AK023117 Lipid phosphate phosphatase-related protein type 2

BC006525 Pyridoxine-5'-phosphate oxidase

AK056092 WD repeat domain 12

CR595986 Hypothetical protein FLJ11184 NM_018149 Hypothetical protein FLJ10587

BC062992 Chromosome 21 open reading frame 66

BC067814 Hypothetical protein FLJ20421

AK127326 PHD finger protein 17

AF251038 Chromosome 5 open reading frame 5

NM_017945 Solute carrier family 35, member A5

BC034950 TANK-binding kinase 1

NM_001001481 Hypothetical protein FLJ11011

BC067115 BPY2 interacting protein 1

BC080524 E4F transcription factor 1

AF395830 Hypoxia-inducible factor 1 , alpha subunit inhibitor

NM_014185 RAN guanine nucleotide release factor

AY302067 Aprataxin

NM_194328 Ring finger protein 38

AK094383 8D6 antigen

AB041046 Formin homology 2 domain containing 1

AY007143 Hypothetical protein FLJ21749

AL832438 Hypothetical protein FLJ20152

AK128082 Uridine-cytidine kinase 1-like 1

NM_018046 Angiogenic factor VG5Q

AK001697 RIO kinase 2 (yeast)

AF288288 MRS2-like, magnesium homeostasis factor (S. cerevisiae)

BM725522 Host cell factor C1 regulator 1 (XPO1 dependant)

AF288288 MRS2-like, magnesium homeostasis factor (S. cerevisiae)

NM_017943 F-box protein 34

NM_024328 thiamine triphosphatase

NM_018131 Chromosome 10 open reading frame 3

BC081541 Zinc finger CCCH type domain containing 1

NMJD05772 RNA terminal phosphate cyclase-like 1

AK092571 GGA binding partner

BX648507 Dehydrodolichyl diphosphate synthase

AL832608 Testis expressed sequence 264

AK000672 CGI-90 protein

AK023811 Leucine rich repeat containing 20

BX647186 Hypothetical protein FLJ 10948

BC001185 Potassium channel tetramerisation domain containing 15

NM_018489 Ash1 (absent, small, or homeotic)-like (Drosophila)

NMJD13366 Anaphase promoting complex subunit 2

CR621685 ORM1-like 2 (S. cerevisiae)

BU734634 Nitrilase family, member 2

BX648335 Mitochondrial ribosomal protein L39

AK094934 Chromosome 6 open reading frame 149

NM_018202 Hypothetical protein FLJ10747

BM805609 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa

AL110193 Chromosome 9 open reading frame 114

BX537692 Cysteine and histidine-rich domain (CHORD)-containing, zinc binding protein 1

AL833475 Dipeptidylpeptidase 3

BX640861 Hypothetical protein FLJ10842 AK091607 Kelch repeat and BTB (POZ) domain containing 4

AK091607 Kelch repeat and BTB (POZ) domain containing 4

BX161512 Chromosome 14 open reading frame 123

BX161512 Chromosome 14 open reading frame 123

AF143235 Melanoma antigen, family H, 1

AL713734 LIM and cysteine-rich domains 1

NM_022662 Anaphase promoting complex subunit 1

BC006286 Dual specificity phosphatase 12

AL390149 Hypothetical protein FLJ20331

NM_024529 Hyperparathyroidism 2 (with jaw tumor)

BM557781 Aurora-A kinase interacting protein

AK095409 Abhydrolase domain containing 4

NM_017824 Ring finger protein 153

NM_020640 RP42 homolog

AK128417 Hypothetical protein FLJ21127

NM_018270 Chromosome 20 open reading frame 20

AK126736 X 010 protein

CR749447 Chromosome 5 open reading frame 3

BC045651 Purinergic receptor P2Y, G-protein coupled, 5

BX640829 Progressive external ophthalmoplegia 1

BF569103 Cat eye syndrome chromosome region, candidate 5

AK001239 RNA binding motif protein 28

NM_018072 Homo sapiens hypothetical protein FLJ10359 (FLJ10359), mRNA

NM_018072 Homo sapiens hypothetical protein FLJ10359 (FLJ10359), mRNA

BF667441 Chromosome 10 open reading frame 70

BC068483 Rad50-interacting protein 1

NM_017645 Family with sequence similarity 29, member A

BC070068 Headcase homolog (Drosophila)

NM_014319 Integral inner nuclear membrane protein

AK026835 Transcription factor B2, mitochondrial

AK000286 Zinc finger, DHHC domain containing 7

CR749574 SDA1 domain containing 1

AY461712 Putative ATPase

BU739666 Nudix (nucleoside diphosphate linked moiety X)-type motif 2

BC006289 Hypothetical protein FLJ11151

NM_016545 Immediate early response 5

AK095568 Tumor suppressing subtransferable candidate 4

NM_018422 hypothetical protein DKFZp761 K1423

AB046771 Hypothetical protein FU20696

BC010070 Hypothetical protein FLJ10902

NMJD20395 Hypothetical nuclear factor SBBI22

AF074918 TRNA isopentenyltransferase 1

NM_022763 FAD104

BX537562 HemK methyltransferase family member 1

BU535474 Nucleoporin 37kDa

BC043401 Hypothetical protein MGC2752

BC033028 Eukaryotic translation initiation factor 4E nuclear import factor 1

AK094923 Hypothetical protein FLJ 11259 BQ067713 CGI-116 protein

NM_005631 Smoothened homolog (Drosophila)

CR606585 Hypothetical protein FLJ20345

BU739773 Arginine vasopressin-induced 1

AK096462 Hypothetical protein FLJ21156

AK002204 Hypothetical protein FLJ 11342

BM554089 Pleckstrin homology-like domain, family A, member 3

CR749534 Mannosidase, alpha, class 1 B, member 1

NMJD18439 Hypothetical protein IMPACT

AK024499 Spondin 2, extracellular matrix protein

NM_024613 Pleckstrin homology domain containing, family F (with FYVE domain) member 2

NM_023941 reticulon 3

AK098285 Coiled-coil-helix-coiled-coil-helix domain containing 7

BM550552 Postsynaptic protein CRIPT

BM913044 Pleckstrin 2

AK027128 Zinc finger protein (C2H2 type) 277

AL050368 Hypothetical protein FLJ20534

AK090770 Ischemia/reperfusion inducible protein

AK090443 Transducer of regulated cAMP response element-binding protein (CREB) 3

NM_004713 Serologically defined colon cancer antigen 1

NM_022775 hypothetical protein FLJ22127

NM_018357 Acheron

AK124537 . Hypothetical protein FLJ20265

BC047078 . . . Hypothetical protein LOC283507

BG421333 Mitochondria] ribosomal protein S33

NM_017748 Hypothetical protein FLJ20291

CR749848 Lipoma HMGIC fusion partner

NM_022899 ARP8 actin-related protein 8 homolog (yeast)

BX648218 Additional sex combs like 2 (Drosophila)

CR749599 Hypothetical protein FLJ14154

NM_022346 Chromosome condensation protein G

NM_022346 Chromosome condensation protein G

AK095099 Nuclear receptor binding factor 1

AB032417 Frizzled homolog 4 (Drosophila)

BC039048 Syntaxin 17

AK096611 Praja i

AY298955 RAP2C, member of RAS oncogene family

AY298955 RAP2C, member of RAS oncogene family

BC035964 Pseudouridylate synthase 1

NMJ78191 ATPase inhibitory factor 1

AK056322 Sodium channel modifier 1

AL122075 APG7 autophagy 7-like (S. cerevisiae)

BX641157 Hypothetical protein FLJ 13611

BX648199 Phosphatidylcholine transfer protein

NM_024609 Homo sapiens cDNA: FLJ21841 fis, clone HEP01831

AK091979 Vacuolar protein sorting 28 (yeast)

AF370428 Huntingtin interacting protein K

BU588938 Stromal cell-derived factor 2-like 1 AK001486 Solute carrier family 4 (anion exchanger), member 1 , adaptor protein

AB051232 Polypyrimidine tract binding protein 2

NM_018103 Leucine rich repeat containing 5

AK091468 Single-strand selective monofunctional uracil DNA glycosylase

AK056708 Rhomboid family 1 (Drosophila)

CR593561 DKFZP586B1621 protein

NM_022725 Fanconi anemia, complementation group F

NMJ303687 PDZ and LIM domain 4

AK093952 Hypothetical protein FLJ20366

AB039670 Armadillo repeat containing, X-linked 1

BM911415 Exosome component 4

NMJD04836 Eukaryotic translation initiation factor 2-alpha kinase 3

AJ242655 NCK interacting protein with SH3 domain

AF131812 Likely ortholog of mouse monocyte macrophage 19

NM_003929 RAB7, member RAS oncogene family-like 1

NM_003929 RAB7, member RAS oncogene family-like 1

NM_016Q27 Lactamase, beta 2

AK057587 SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)

AK130341 Sorting nexing 24

AK024966 HCV NS3-transactivated protein 2

BQ050485 NTF2-like export factor 1

BF541236 Chromosome 20 open reading frame 9

AK096943 Hypothetical protein FLJ20272

NM_004657 Serum deprivation response (phosphatidylserine binding protein)

AK092319 Hypothetical protein FLJ20508

CR749852 NMDA receptor-regulated gene 2

BC050677 Hypothetical protein MGC3121

AK126564 Hepatocellular carcinoma-associated antigen 66

AY078986 Mitochondrial translation optimization 1 homolog (S. cerevisiae)

AL833266 Platelet derived growth factor C

AK000171 Chromosome 1 open reading frame 27

CR600383 Hypothetical protein FLJ 12436

NM_021809 TGFB-induced factor 2 (TALE family homeobox)

NM_024698 Solute carrier family 25 (mitochondrial carrier: glutamate), member 22

BC063399 Hypothetical protein FLJ 10815

BX649076 HSPC163 protein

BQ029161 Latexiπ

NM_033014 Osteoglycin (osteoinductive factor, mimecan)

BX647177 Bcl-2 inhibitor of transcription

NM_018133 Hypothetical protein FLJ 10546

BX647309 Hypothetical protein FLJ 13848

NMJ314480 Zinc finger protein 544

NM_018183 Sno, strawberry notch homolog 1 (Drosophila)

NM_016271 Ring finger protein 138

AK024375 Abhydrolase domain containing 5

AF217982 CDK5 regulatory subunit associated protein 3

AK123479 Chromosome 22 open reading frame 18

BU739844 Hypothetical protein FLJ11749 AK096964 Hypothetical protein FLJ20422

AK098035 TAP binding protein-like

AK098035 TAP binding protein-like

NM_006544 SEC10-like 1 (S. cerevisiae)

NM_024959 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 6

AK128061 Hypothetical protein MGC5306

AK131383 F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)

AK054909 Hypothetical protein FLJ10307

NM_024654 Hypothetical protein FLJ23323

AK025790 Kinesin family member 2OA

NM_080632 UPF3 regulator of nonsense transcripts homolog B (yeast)

NM_004422 Dishevelled, dsh homolog 2 (Drosophila)

NM_015940 coenzyme Q6 homolog (yeast)

NM_017610 Ring finger protein 111

BX647083 Syntaxin 18

BC039889 Tryptophanyl tRNA synthetase 2 (mitochondrial)

AL136894 XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)

NM_020401 Nucleoporin 107kDa

NM_023039 Ankyrin repeat, family A (RFXANK-like), 2

AK091861 Hypothetical protein FLJ10315

AL442072 Pantothenate kinase 4

AK127575 Chromosome 9 open reading frame 87

CB994003 Methionine sulfoxide reductase B

AK090828 MRNA decapping enzyme

BX647378 BH3-only member B protein

NM_024956 Hypothetical protein FLJ23375

BM549819 Chromosome 8 open reading frame 20

NM_024624 SMC6 structural maintenance of chromosomes 6-like 1 (yeast)

CR749832 ATPase family, AAA domain containing 2

BC009918 DKFZP434B168 protein

AU 57469 RAB, member RAS oncogene family-like 5

AB007973 SET and MYND domain containing 3

CR597454 Hypothetical protein FLJ20010

AL136908 Chromosome 15 open reading frame 29

BX647757 Sex comb on midleg-like 1 (Drosophila)

AK000518 Thioredoxin-like 4B

AK131437 Sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)

NM_023008 Hypothetical protein FLJ12949

AY358864 Hypothetical protein FLJ 10349

AK023414 Hypothetical protein FLJ 13352

NM_020121 UDP-glucose ceramide glucosyltransferase-like 2

AK095936 Hypothetical protein FLJ20647

BC012072 Checkpoint with forkhead and ring finger domains

NM_153638 Pantothenate kinase 2 (Hallervorden-Spatz syndrome)

NM_025156 chromosome 7 open reading frame 19

AL832592 SH3-domain GRB2-like endophilin B2

BX649098 Hypothetical protein FLJ 10199

BC053883 Hypothetical protein FLJ22649 similar to signal peptidase SPC22/23 NM_004468 Four and a half LIM domains 3

AK128795 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26

BC043593 Chromosome 14 open reading frame 132

AL117436 Potassium channel tetramerisation domain containing 9

BC032508 Hypothetical protein FLJ 10781

AK128062 Solute carrier family 35, member F2

NM_018069 Centrosomal protein 192 kDa

AK055822 Phospholipid scramblase 3

BM685824 Ribosomal protein L26-like 1

AK074734 Fc fragment of IgG, receptor, transporter, alpha

NM_017870 Heat shock 7OkDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1

CR594375 Ribonuclease P 21kDa subunit

AK056566 Ubiquitin-conjugating enzyme HBUCE1

BC060805 Hypothetical protein FLJ12788

BC020977 NAD synthetase 1

NM_024095 Ankyrin repeat and SOCS box-containing 8

AK025561 Hypothetical protein FLJ21908

AK026015 Fibronectin type III domain containing 4

BX648953 Dual specificity phosphatase 22

NM_004830 Cofactor required for Sp1 transcriptional activation, subunit 3, 13OkDa

NM_006548 IGF-II mRNA-binding protein 2

BQ057555 Hypothetical protein MGC2655

BC014499 RelA-associated inhibitor

AK125901 LlM domains containing 1

BC037797 Chromosome 14 open reading frame 10

BC005700 Motile sperm domain containing 1

BC039245 Squamous cell carcinoma antigen recognized by T cells 2

AK056759 Seven transmembrane domain orphan receptor

NM_016629 tumor necrosis factor receptor superfamily, member 21

AK023916 DEP domain containing 6

NM_016649 Chromosome 20 open reading frame 6

AK074489 Hypothetical protein MGC3162

BC028167 Ring finger protein 25

BC012056 Ankyrin repeat and SOCS box-containing 13

NM_022648 Tensin

BF683481 Polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa

AK025068 Hypothetical protein FLJ21415

AK094095 Malonyl-CoA decarboxylase

BX647369 Chondroitin sulfate GalNAcT-2

NM_017710 hypothetical protein FLJ20203

AK055221 F-box protein 5

AF182423 Chromosome 6 open reading frame 75

NM_012238 Sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)

AK125015 Hypothetical protein FLJ12998

BX647822 FOS-like antigen 2

NM_006784 WD repeat domain 3

AF516710 MLF1 interacting protein

BX647242 Hypothetical protein FLJ13220 AK024865 UDP-N-acetyl-alpha-D-galactosamineφolypeptide N-acetylgalactosaminyltransferase 12

(GaINAc-TI 2)

AK000631 PAK1 interacting protein 1

NM_015950 Mitochondrial ribosomal protein L2

NM_018092 Neuropilin (NRP) and tolloid (TLL)-like 2

BC049850 Chromosome 10 open reading frame 117

NM_016622 Mitochondrial ribosomal protein L35

NM_024542 protocadherin 16 dachsous-like (Drosophila)

AK097280 Hypothetical protein FLJ23469

NM_018048 Hypothetical protein FLJ10292

BC007767 Hypothetical protein FLJ12455

AK125048 ELG protein

AK057313 Hypothetical protein MGC10993

AK125146 Membrane protein expressed in epithelial-like lung adenocarcinoma

BC028354 Phospholipid scramblase 4

NM_017617 Notch homolog 1 , translocation-associated (Drosophila)

CR625869 Hypothetical protein MGC2731

AK000972 Chromosome 9 open reading frame 40

AB161944 Hypothetical protein FLJ20530

NMJ312424 Ribosomal protein S6 kinase, 52kDa, polypeptide 1

AK096302 Hypothetical protein FLJ10375

BX640958 YEATS domain containing 4

BC014100 GRIP and coiled-coil domain containing 1

NM_181826 Neurofibromin 2 (bilateral acoustic neuroma)

NM_024671 Hypothetical protein FLJ23436

NM_006015 AT rich interactive domain 1A (SWI- like)

AF318353 Mannosidase, alpha, class 1C, member 1

AL833030 Hypothetical protein FLJ 14007

AK093427 Single Ig IL-1 R-related molecule

AW304174 spermatogenesis associated 1

BC024007 Chitobiase, di-N-acetyl-

BX648128 Myoneurin

BC015954 Carbohydrate (chondroitin 4) sulfotransferase 12

AF246705 Collaborates/cooperates with ARF (alternate reading frame) protein

NM_018374 Hypothetical protein FLJ11273

NM_017953 Hypothetical protein FLJ20729

BC051861 Spermatogenesis associated 5-like 1

AL832181 Heat shock 27kDa protein family, member 7 (cardiovascular)

NM_014600 EH-domain containing 3

AL832749 HSPC128 protein

AY279347 Zinc finger protein 434

NM_024326 Homo sapiens cDNA FLJ16137 fis, clone BRALZ2014316

AF061025 Leucine zipper-EF-hand containing transmembrane protein 1

AK021897 Chromosome 14 open reading frame 138

AK095377 F-box and WD-40 domain protein 2

AK125526 Phosphatidylinositol-4-phosphate 5-kinase, type II, gamma

BX537921 Hypothetical protein MGC2654

BX538347 HIRA interacting protein 5 AL122121 PAP associated domain containing 1

NM_018292 Glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1

NM__022481 ARF-GAP, RHO-GAP, ankyrin repeat and plekstrin homology domains-containing protein 3

AK090410 Hypothetical protein MGC3265

CR604537 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like

BC041762 Hypothetical protein FLJ 11848

AK094710 Hypothetical protein FLJ20850

BC013034 Polynucleotide kinase 3'-phosphatase

NM_022484 Hypothetical protein FLJ 13576

NM_001001484 Phosphodiesterase related

NM_018197 Zinc finger protein 64 homolog (mouse)

BC006120 Mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction

AK130435 CutC copper transporter homolog (E.coli)

AK124527 Tetratricopeptide repeat domain 17

AK056656 Elongation factor Tu GTP binding domain containing 1

BC014859 Hypothetical protein FLJ10159

AF177941 Collagen, type V, alpha 3

NM_Q21800 DnaJ (Hsp40) homolog, subfamily G1 member 12

AK023555 TRNA selenocysteine associated protein

AK022950 Chromosome 9 open reading frame 76

BC028409 ACN9 homolog (S. cerevisiae)

AK026553 Mitochondrial ribosomal protein S17

AF178985 Complement component 1 , r subcomponent-like

NMJ)19042 Hypothetical protein FLJ20485

NM_017631 Hypothetical protein FLJ20035

NM_018179 Activating transcription factor 7 interacting protein

NMJM 8656 Solute carrier family 35, member E3

BX537394 Solute carrier family 30 (zinc transporter), member 5

BX640831 Amplified in breast cancer 1

CR605803 Chromosome 9 open reading frame 46

NM_018146 Putative RNA methyltransferase

NM_022906 Homo sapiens hypothetical protein FLJ13195 similar to stromal antigen 3 (FLJ13195), mRNA

BM810210 TCF3 (E2A) fusion partner (in childhood Leukemia)

AK125471 RNA polymerase I associated factor 53

BC051827 Hypothetical protein FLJ20457

AK128762 Hypothetical protein FLJ 11000

BC001316 Defective in sister chromatid cohesion homolog 1 (S. cerevisiae)

NM_024345 Hypothetical protein MGC10765

AB058703 Hypothetical protein FLJ21901

BX640869 Mannosidase, endo-alpha

AK125043 Chromosome 21 open reading frame 45

CD555939 Chromosome 6 open reading frame 66

NWM 98887 Nucleoporin 43kDa

AK022410 Hypothetical protein FLJ21820

AK022216 Chromosome 14 open reading frame 93

BC024157 Pleckstrin homology domain containing, family A (phosphoinositide binding specific) member

4 AK128545 UDP-N-acetyl-alpha-D-galactosamineipolypeptide N-acetylgalactosamiπyltransferase 11

(GaINAc-TH)

AK056347 Glycosyltransferase 28 domain containing 1

NM_014948 Likely ortholog of mouse ubiquitiπ conjugating enzyme 7 interacting protein 5

AK000677 Ethanolamine kinase 1

BC050636 HS1-binding protein 3

AK094508 Ring finger protein 121

BC014661 Hypothetical protein FLJ12448

BX647702 Chromosome 4 open reading frame 16

BX647627 Pleckstrin homology domain containing, family A (phosphoinositide binding specific) member

1

BC051340 CD164 sialomucin-like 1

NM_170692 RAS protein activator like 2

NM_006901 Myosin IXA

BX538009 Homeodomain interacting protein kinase 2

BC013351 Hypothetical protein FLJ21657

AK097254 CGM21 protein

AB112439 Comparative gene identification transcript 37

AF303588 Opsin 3 (encephalopsin, panopsin)

NM_024615 Poly (ADP-ribose) polymerase family, member 8

BC006389 Poly (ADP-ribose) polymerase family, member 16

NM_194271 Ring finger protein 34

NM_024491 P10-binding protein

NM_016052 CGS-115 protein

NM_024657 Zinc finger, CW-type with coiled-coil domain 2

NM_013400 Replication initiator 1

BG421500 Phosducin-like 3

AK095303 Hypothetical protein FLJ 10916

BC047516 Hypothetical protein FLJ13479

NWM 76787 Phosphatidylinositol glycan, class N

BX649103 Chondroitin beta1,4 N-acetylgalactosaminyltransferase

AK057053 Chromosome 16 open reading frame 23

BC014993 Hermansky-Pudlak syndrome 6

NMJD17966 hypothetical protein FLJ20847

NM_024563 Hypothetical protein FLJ14054

NMJM8079 Hypothetical protein FLJ10379

AK124228 Hypothetical protein FLJ11712

AK074124 Lipocalin 7

AK001066 Hypothetical protein FLJ10204

BM918216 DNA segment on chromosome X (unique) 9879 expressed sequence NM_017742 " Zinc finger, CCHC domain containing 2

AK126087 Chromosome 1 open reading frame 35

AK022169 Chromosome 2 open reading frame 4

NM_021823 Hypothetical protein MDS018

AF258584 Chromosome 10 open reading frame 86

AKQ92833 ATPase family, AAA domain containing 3A

AL833977 Fetal globin-inducing factor

BM701238 Motile sperm domain containing 3 NM_016458 Brain protein 16

BC010017 B-cell CLL/lymphoma 7C

NM_017784 Oxysterol binding protein-like 10

AK001708 Transmembrane protein 34

BM454192 Peroxisomal membrane protein 2, 22kDa

AL832210 WW domain containing oxidoreductase

BC063474 G patch domain containing 2

AL832113 NADPH cytochrome B5 oxidoreductase

AK125332 CTP synthase Il

NM_020690 Eukaryotic translation initiation factor 4E binding protein 3

BX641074 Hypothetical protein FLJ10539

NM_022455 Nuclear receptor binding SET domain protein 1

AK093342 Chromosome 14 open reading frame 131

BC063114 Asporin (LRR class 1)

CR621953 Zinc finger protein 576

AL833544 Solute carrier family 24 (sodium/potassium/calcium exchanger), member 3

AK023527 Multimerin 2

AK024267 Chromosome 9 open reading frame 12

AK125359 Hypothetical protein FLJ20701

AL096748 Armadillo repeat containing 8

BX648276 Hypothetical protein MGC2747

NM_014520 MYB binding protein (P160) 1a

NM_020375 Chromosome 12 open reading frame 5

BM551311 Oligonucleotide/oligosaccharide-binding fold containing 1

AY195859 Reticulocalbin 3, EF-hand calcium binding domain

BC060786 Up-regulated in liver cancer 1

NM_016422 Ring finger protein 141

NM_014321 Origin recognition complex, subunit 6 homolog-like (yeast)

AL832131 DEAD (Asp-Glu-Ala-Asp) box polypeptide 27

CR749477 Sperm associated antigen 16

BF241566 Nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)

NM_024072 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54

AF117947 KIAA1961 protein

AK127002 G20 protein

AK001566 Chromosome 13 open reading frame 17

BC048292 FK506 binding protein 11 , 19 kDa

BC048292 FK506 binding protein 11 , 19 kDa

BX537999 LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae)

NM_017872 Interphase cyctoplasmic foci protein 45

NM_014519 Zinc finger protein 232

AK026916 Hypothetical protein FLJ23263

BC069245 Stromal cell protein

AJ420510 PHD finger protein 10

AK000565 Hypothetical protein FLJ20558

AL833381 Sin3A associated protein p30-like

BC075811 Hypothetical protein FLJ10287

AK074890 Transitional epithelia response protein

AK000611 Hypothetical protein FLJ20604 NM_022159 EGF, latrophilin and seven transmembrane domain containing 1

AL832177 Hypothetical protein FLJ 12681

NM_020194 Chromosome 2 open reading frame 33

BF572302 Ribosomal protein L14

BC025694 RAS-like, family 11 , member B

AK000381 Ribonuclease P 25kDa subunit

BC024328 Hypothetical protein FLJ22729

AK097144 Chromosome 9 open reading frame 95

NM_018492 T-LAK cell-originated protein kinase

NM_016216 Debranching enzyme homolog 1 (S. cerevisiae)

BC024281 RAB, member of RAS oncogene family-like 2B

BX641106 Hypothetical protein FLJ 13710

AK123864 Phosphatidylinositol transfer protein, cytoplasmic 1

AK123967 Synaptojanin 2 binding protein

NM_007246 Kelch-like 2, Mayven (Drosophila)

NM_057175 Transcriptional coactivator tubedown-100

AK126041 Chemokine-like factor

AK127603 Mitochondrial ribosomal protein L11

AK000086 Zinc finger protein 562

AK128275 Chromosome 14 open reading frame 103

NM_176871 PDZ and LIM domain 2 (mystique)

AK001425 Chromosome 14 open reading frame 104

BC059382 Rho GTPase activating protein 8

BU739337 Transcription factor B1, mitochondrial

AY032617 Fibroήectin type 3 and SPRY domain containing 1

BM906603 Ubiquitin domain containing 1

CR617782 Coiled-coil domain containing 2

AK128054 Solute carrier family 41, member 3

AK026208 Hypothetical protein FLJ22555

BX648902 BRIX

NMJ324638 Queuine tRNA-ribosyltransferase domain containing 1

NM_016651 Dapper homolog 1 , antagonist of beta-catenin (xenopus)

AK000702 Peroxisome biogenesis factor 26

AF246718 Carbohydrate (N-acetylglucosamine 6-0) sulfotransferase 5

BC002324 Translocase of inner mitochondrial membrane 22 homolog (yeast)

BC035196 Sirtuin (silent mating type information regulation 2 homolog) 5 (S. cerevisiae)

NM_020224 hypothetical protein DKFZp547O146

AL833017 LRP16 protein

AF370422 F-box and leucine-rich repeat protein 6

NM_018449 Ubiquitin associated protein 2

BX537655 Hypothetical protein FLJ 10233

BX537622 General transcription factor HIC, polypeptide 4, 9OkDa

AK026927 Hypothetical protein MGC5297

NM_020648 Twisted gastrulation homolog 1 (Drosophila)

NMJ324599 Rhomboid, veinlet-like 6 (Drosophila)

BQ054986 Chromosome 14 open reading frame 122

AK023169 Serine racemase

AK023169 Serine racemase AK127285 CGI-119 protein

NM_025083 Hypothetical protein FLJ21128

NM_022168 Interferon induced with helicase C domain 1

AL833365 RAB8B, member RAS oncogene family

BC026226 Heat shock 7OkDa protein 14

AK056079 Junctional adhesion molecule 2

NM_021163 RB-associated KRAB repressor

AK056900 Solute carrier family 39 (zinc transporter), member 4

AJ242682 ETAA16 protein

AK056980 Hypothetical protein FLJ23441

BQ918840 Hypothetical protein FLJ20512

AL110129 Mitochondrial ribosomal protein S22

NM_024724 hypothetical protein FLJ35036

AB020711 CDC2-related protein kinase 7

CR749560 Zinc finger protein 331

AF205074 Solute carrier organic anion transporter family, member 3A1

NM_024831 Nuclear receptor coactivator 6 interacting protein

NM_024583 Secernin 3

NM__023923 Phosphatase and actin regulator 4

BX537609 Hypothetical protein FLJ 14281

AK056539 Hypothetical protein FLJ20477

BC018424 Hypothetical protein FLJ 10997

NM_017857 Slingshot homolog 3 (Drosophila)

AK123837 Centrosome protein Cep63

BG328259 Mitochondrial ribosomal protein L46

AF380578 THUMP domain containing 2

AK092042 FK506 binding protein 10, 65 kDa

AB040902 Fibronectin leucine rich transmembrane protein 3

AK125062 Family with sequence similarity 51, member A1

NM_024121 family with sequence similarity 11 member B

BM923625 Hypothetical protein FLJ22222

AK074093 SH3 domain and tetratricopeptide repeats 1

AK095578 Sphingosine kinase 1

BF214525 Timeless-interacting protein

NM_203413 S-phase 2 protein

NMJD16433 Glycolipid transfer protein

BC010082 Ethanolamine kinase 2

BX640652 Hypothetical protein FLJ21616

BM455698 Hypothetical protein MGC4504

AK125034 Hypothetical protein FLJ10759

AK124774 Programmed cell death 5

BC071953 Chromosome 9 open reading frame 82

NM_004672 Mitogen-activated protein kinase kinase kinase 6

NM_017718 dedicator of cytokinesis protein 10

BC040270 Methionine sulfoxide reductase A

NM_015930 transient receptor potential cation channel, subfamily V, member 2

NM_014158 core 1 UDP-galactoseiN-acetylgalactosamine-alpha-R beta 1 ,3-galactosyltransferase 2

AK096705 HSPB (heat shock 27kDa) associated protein 1 BC042587 RNA binding motif protein 15

AK054684 Potassium large conductance calcium-activated channel, subfamily M, beta member 4

BM699794 Chromosome 3 open reading frame 14

AF462442 Hypothetical protein FLJ20718

BF698877 X 009 protein

NM_018105 THAP domain containing, apoptosis associated protein 1

NM_013341 Hypothetical protein PTD004

NM_018132 Chromosome 6 open reading frame 139

AY358557 Procollagen C-endopeptidase enhancer 2

BC036020 Zinc finger, DHHC domain containing 13

NM_019045 WD repeat domain 44

AK000779 Hypothetical protein FLJ20772

NM_024546 Chromosome 13 open reading frame 7

BC030645 DNA-damage inducible protein 1

NM_012168 F-box protein 2

NMJ320381 Chromosome 6 open reading frame 210

NMJD23929 Zinc finger and BTB domain containing 10

AB015427 Zinc finger protein 219

AY676494 Chromosome 16 open reading frame 30

BC032617 Polymerase (DNA directed) iota

AK094033 CGI-125 protein

NM_022474 Membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)

BX537591 WD repeat domain 8

AK057139 Hypothetical protein MGC3731

NMJ318696 EIaC homolog 1 (E. coli)

BC047933 UDP-GlcNAc:betaGal beta-1 ,3-N-acetylglucosaminyltransferase 1

BU733212 Chromosome 2 open reading frame 28

NM_024062 hypothetical protein MGC5338

AL832659 Hypothetical protein FLJ22833

CR749476 Armadillo repeat containing, X-linked 5

AK096409 Activating signal cointegrator 1 complex subunit 1

AK000163 Hypothetical protein FLJ20156

AF123761 Ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)

BC063284 O-acetyltransferase

CR598577 Cell division cycle 37 homolog (S. cerevisiae)-like 1

BU729871 CGM 43 protein

AY358127 Leucine rich repeat and fibronectin type III domain containing 3

AK001818 Nudix (nucleoside diphosphate linked moiety X)-type motif 15

AK074683 Uncharacterized hematopoietic stem/progenitor cells protein MDS032

NM_018303 SEC5-like 1 (S. cerevisiae)

AK001399 Diablo homolog (Drosophila)

AK098253 Spondyloepiphyseal dysplasia, late

NM_017687 hypothetical protein FLJ20147

BF790759 SNF7 domain containing 2

NM_014027 GTP binding protein 1

AK074155 Hypothetical protein FLJ22635

NM_024635 MAK10 homolog, amino-acid N-acetyltransferase subunit, (S. cerevisiae)

NM_015942 CGI-12 protein NMJ320371 Apoptosis, caspase activation inhibitor

BM549806 Kruppel-like factor 2 (lung)

AF332010 Carnitine deficiency-associated gene expressed in ventricle 1

BM665721 Dolichyl-phosphate mannosyltransferase polypeptide 3

AK025498 Asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)

AL832104 Choline/ethanolaminephosphotransferase

AY376736 Zinc finger protein 322A

AL157462 Chromosome 18 open reading frame 11

CR627327 Hypothetical protein FLJ22054

AB024313 Polymerase (DNA directed), eta

NM_013368 SERTA domain containing 3

AK001687 Adenosine deaminase, tRNA-specific 1

NM_020125 SLAM family member 8

AY358643 FK506 binding protein 14, 22 kDa

AK000296 Hypothetical protein FLJ 11029

BX537630 V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma)

AK090407 Phosphatidylglycerophosphate synthase

AK096309 Hypothetical protein FLJ 13448

BC043599 Cell death-inducing DFFA-iike effector c

BC053907 Lin-7 homoiog C (C. elegans)

NM_003632 Contactin associated protein 1

AJ277442 Xylosyltransferase Il

AK023846 Derlin-1

AF360739 Ring finger protein 137

BQ064229 Hypothetical protein MGC955

NM_024700 Smad nuclear interacting protein

BC040355 Hypothetical protein FU10134

AB007829 Scavenger receptor class A, member 3

AL050185 Hypothetical protein FLJ12610

AK023237 Hypothetical protein FLJ12439

BC015701 Osmesis responsive factor

NM_024852 Eukaryotic translation initiation factor 2C, 3

AY356402 Fat-like cadherin FATJ

AK023879 Peroxisomal membrane protein 4, 24kDa

NM_024306 Fatty acid 2-hydroxy)ase

NM_024605 Rho GTPase activating protein 10

NM_014556 Ellis van Creveld syndrome

NM_017745 BCL6 co-repressor

AL831955 Hypothetical protein FLJ22170

AY373756 Ankyrin repeat domain 11

AK023557 Core 1 UDP-galactose-.N-acetylgalactosamine-alpha-R beta 1 ,3-gaiactosyltransferase

NM_024652 Leucine-rich repeat kinase 1

BX640778 Chromosome 20 open reading frame 13

NM_021946 BCL6 co-repressor-like 1

AF182077 Glioma tumor suppressor candidate region gene 1

AK128102 Brain synembryn

AK092830 Solute carrier family 35, member C2

NM_017866 Hypothetical protein FLJ20533 NM_017866 Hypothetical protein FU20533

NM_016064 pilin-like transcription factor

AK090451 Ras and Rab interactor 3

AK090451 Ras and Rab interactor 3

NM_022072 NOL1/NOP2/Sun domain family 3

BX537447 Polymerase (RN A) 111 (DNA directed) polypeptide B

AK000514 Hypothetical protein FLJ20507

AL832539 Hypothetical protein FLJ22353

CR627424 Hypothetical protein FLJ20125

CR627470 CUE domain containing 1

NM_024606 dynein, cytoplasmic, heavy polypeptide 2

AK027859 Hypothetical protein MGC11266

AK096289 Thrombospondin, type I1 domain containing 1

BC0S1860 KDEL (Lys-Asp-GJu-Leu) containing 1

NM_005985 Snail homolog 1 (Drosophila)

NM__024525 Tetratricopeptide repeat domain 13

BC033799 Host cell factor C2

NM__002814 Proteasome (prosome, macropain) 26S subunit, noπ-ATPase, 10

NMJ)24685 Hypothetical protein FLJ23560

AK123230 Rhomboid, veinlet-like 2 (Drosophila)

NM_022836 DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)

NM_024036 Leucine rich repeat and fibronectin type III domain containing 4

AK130590 Cysteine-rich hydrophobic domain 2

NM_024745 ' SHC SH2-domain binding protein 1

NM_012415 ' Fibrinogen silencer binding protein

BC051903 Zinc finger protein 180 (HHZ168)

BC066772 Chromosome 2 open reading frame 26

AK097245 Cardiotrophin-like cytokine

BC068521 Hypothetical protein FLJ10094

AK001720 DNA glycosylase hFPG2

BU622462 Hypothetical protein FLJ23221

NMJ)16625 BM-011 protein

BC026011 Chromosome 20 open reading frame 172

NM_012098 Angiopoietin-like 2

BX648944 PR domain containing 10

AK126384 Elongation factor RNA polymerase ll-like 3

AK126384 Elongation factor RNA polymerase tl-Hke 3

NM_018458 KIAA1280 protein

AJ245599 Four jointed box 1 (Drosophila)

NM_018104 Homo sapiens hypothetical protein FLJ10474 (FLJ10474), mRNA

AK025455 Chromosome 14 open reading frame 169

AK125512 Hypothetical protein FLJ20605

BQ960229 Chloride intracellular channel 3

BX647125 Hypothetical protein FLJ21816

BG714000 Cyclin-dependeπt kinase inhibitor 1C (p57, Kip2)

NM_019069 WD repeat domain 5B

BQ057876 Gem (nuclear organelle) associated protein 6

AL832123 Zinc finger protein 267 AB049758 MAWD binding protein

NM_024808 FLJ22624 protein

BX641162 BMP2 inducible kinase

BX537557 COX15 homolog, cytochrome c oxidase assembly protein (yeast)

NM_006958 Zinc finger protein 16 (KOX 9)

NM_201428 Reticulon 3

AY509035 Roundabout, axon guidance receptor, homolog 3 (Drosophila)

NM_024500 Homo sapiens, clone IMAGE-.6196142, mRNA

NMJ313330 Non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)

AK023669 Uncharacterized bone marrow protein BM039

AK093229 Nuclear receptor interacting protein 3

NM_024524 ATPase family homolog up-regulated in senescence cells

CA310822 Coatomer protein complex, subυnit zeta 2

NM_024633 Chromosome 14 open reading frame 139

AL832998 Cytochrome P450, family 20, subfamily A, polypeptide 1

NMJ324310 Pleckstrin homology domain containing, family F (with FYVE domain) member 1

AY166853 Chromosome 20 open reading frame 23

NM_016265 Homo sapiens zinc finger protein 325 (ZNF325), mRNA

AF401638 Ca2+-dependent activator protein for secretion 2

NM_017640 Leucine rich repeat containing 16

NM_032382 Component of oligomeric golgi complex 8

NM_024765 hypothetical protein FLJ12649

NM_019112 ATP-binding cassette, sub-family A (ABC1 ), member 7

NM_013401 RAB3A interacting protein (rabin3)-like 1

AK027821 Likely homolog of yeast SEN2

AK124833 Opioid growth factor receptor-like 1

AF144487 Spermatogenesis associated 7

BX537845 More than blood homolog

AK125485 CGl-30 protein

AK127216 Solute carrier family 15, member 3

NMJJ20147 THAP domain containing 10

NMJM 6104 RWD domain containing 1

NM_018507 Homo sapiens hypothetical protein PRO1843 (PRO1843), mRNA

BX537378 Chromosome 21 open reading frame 4

BX648775 Zinc finger protein 226

NM_024862 hypothetical protein FLJ 13962

AF233396 Sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)

AK124007 Hypothetical protein FLJ23451

AK000528 lnterleukin-1 receptor-associated kinase 4

AK000252 Hypothetical protein FLJ20245

NM_024855 ARP5 actin-related protein 5 homolog (yeast)

BC038505 BCL2-associated athanogene 4

AK125387 Collagen, type IV, alpha 3 (Goodpasture antigen) binding protein

NM_024597 Homo sapiens hypothetical protein FLJ12649 (FLJ12649), mRNA

AK022762 Hypothetical protein FLJ 12700

AK122768 P53 target zinc finger protein

AK125027 Chromosome 22 open reading frame 8

NM_024937 suppression of tumorigenicity AK125126 Chromosome 20 open reading frame 121

AK127265 Carbohydrate (chondroitin 4) sulfotransferase 11

NM_025027 Zinc finger protein 606

AB058771 Hypothetical protein FLJ12584

AB058771 Hypothetical protein FLJ12584 .

AK091172 Poly (ADP-ribose) polymerase family, member 6

NM_017996 De-etiolated 1

BC053614 NY-REN-58 antigen

NM_207514 Hypothetical protein FLJ20186

BC082990 Hypothetical protein FLJ 10116

NM_013339 Asparagine-linked glycosylation 6 homolog (yeast, alpha-1 ,3-glucosyltransferase)

AY455942 Protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a

AK021870 Chromosome 7 open reading frame 10

BC030662 Kruppei-like factor 3 (basic)

AK127661 Hypothetical protein MGC5509

AK055839 2,4-dienoyl CoA reductase 2, peroxisomal

AK124446 Hypothetical protein FLJ22494

BC035177 UDP-glucuronate decarboxylase 1

NM_025106 SPRY domain-containing SOCS box protein SSB-1

AF395752 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)

NM_018604 WW domain-containing adapter with a coiled-coil region

NM_001002814 RAB11 family interacting protein 1 (class I)

NM_016569 T-box 3 (ulnar mammary syndrome)

NM_176824 Bardet-Biedl syndrome 7

AK026226 Hypothetical protein FLJ22573 .

NM_017654 Sterile alpha motif domain containing 9

BC022561 Family with sequence similarity 31 , member B

N M_022840 Methyltransferase like 4

AK002084 Meiosis-specific nuclear structural protein 1

AK124451 Chromosome 20 open reading frame 29

BM923666 Hypothetical protein MGC2494

NM_030641 Apolipoprotein L, 6

NM_017741 Hypothetical protein FLJ20280

AK090568 Hypothetical protein FLJ10986

AL832919 1-acylg]ycerol-3-phosphate O-acyltransferase 3

NM_024343 ectonudeoside triphosphate diphosphohydrolase 1

NM_203487 Protocadherin 9

AK023769 Zinc finger protein 552

BQ222060 Hypothetical protein MGC10772

AK024799 SH2 domain containing 4A

AK024801 Hypothetical protein FLJ21148

AK001878 Hypothetical protein FLJ11016

BX647387 Chromosome 14 open reading frame 101

BQ053688 Ribosomal protein L36

BC047501 Hypothetical protein FLJ12586

AK057604 Crystallin, zeta (quinone reductase)-like 1

AK126774 Glycosyltransferase-like 1

NM_017752 FLJ20298 protein AK057189 NADPH oxidase 4

AK124683 Hypothetical protein FLJ 10996

NM_012082 Zinc finger protein, multitype 2

AY260762 Zinc finger homeodomain 4

AF318348 F-box protein 31

AY376439 Epithelial cell transforming sequence 2 oncogene

NM_000908 Natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)

NM_024748 hypothetical protein FLJ 11539

NM_022133 Sorting nexin 16

BC016396 Hypothetical protein FLJ20257

AK096508 Zinc finger protein 34 (KOX 32)

AK125461 Hypothetical protein FLJ22028

AB188489 Synaptopodin 2-like

AK098204 FN5 protein

BC002482 Hypothetical protein FLJ20195

AK092367 Galactose-3-O-sulfotransferase 4

AL834198 RNA binding motif protein 23

NM_018025 G patch domain containing 1

BM725404 Mitochondrial ribosomal protein S28

BC041799 Cyclin-dependent kinase-like 3

AY608689 EF-hand domain (C-terminal) containing 1

NM_024744 Amyotrophic lateral sclerosis 2 (Juvenile) chromosome region, candidate 8

AK130321 Hypothetical protein FLJ12572

NM_005897 lntracisternal A particle-promoted polypeptide

NM_025174 hypothetical protein FLJ20203

AB018341 Zinc finger protein 432

AJ315544 Lymphocyte antigen 6 complex, locus G5C

BC027487 Hypothetical protein FLJ 10634

CR620704 Nuclear prelamin A recognition factor

NM_016613 Hypothetical protein DKFZp434L142

BF316150 Collectin sub-family member.11

NM_024628 Solute carrier family 12 (potassium/chloride transporters), member 8

NM_016076 CGI-146 protein

NM_022907 hypothetical protein FLJ23053

BC048970 Hypothetical protein FLJ23033

BX647081 Hypothetical protei