WO2008056961A1 - A novel fusion protein, cell lines expressing the same and preparation method thereof - Google Patents

Abstract

Provided is an albumin-EPO fusion protein wherein human albumin and human erythropoietin (EPO) are linked to each other via a linker, an expression vector capable of expressing the same, a recombinant cell line which is capable of achieving high-efficiency expression of the fusion protein via transfection with the same vector, and a method for preparing the same recombinant cell line. The erythropoietin fusion protein of the present invention secures flexibility capable of ensuring the erythropoietic potency of human EPO, via the incorporation of a linker including a GG&GG-repeated amino acid sequence, and has various advantages associated with high productivity, stability and purity, due to the use of human albumin. The fusion protein of the present invention exhibits an about 3 -fold increased in vivo half-life and superior erythroid progenitor production-promoting activity, as compared to conventional EPO. Accordingly, the fusion protein of the present invention is therapeutically effective for prevention or treatment of anemia.

Description

A NOVEL FUSION PROTEIN, CELL LINES EXPRESSING THE SAME AND PREPARATION METHOD THEREOF

TECHNICAL FIELD The present invention relates to an albumin-EPO fusion protein wherein human albumin and human erythropoietin (EPO) are linked to each other via a linker, an expression vector capable of expressing the same, a recombinant cell line which is capable of achieving high- efficiency expression of the fusion protein via transfection with the same vector, and a method for preparing the same recombinant cell line.

BACKGROUND ART

Erythropoiesis is the production of red blood cells, which occurs to offset cell destruction after a certain period of time. Erythropoiesis continues throughout life. Erythropoiesis is a tightly controlled physiological mechanism that enables sufficient red blood cells to be available for proper tissue oxygenation without interference of the blood circulation. Normal erythropoiesis is largely under control of erythropoietin (EPO) which is a hormone secreted by bone marrow. EPO is a hematopoietic factor that binds to receptors on erythroid progenitor cells to thereby stimulate production and differentiation of red blood cells. Erythropoietin stimulates a rise in intracellular free calcium ion concentration, DNA biosynthesis, and hemoglobin formation. Therefore, EPO can be useful for diagnosis and treatment of hematological diseases characterized by insufficiency or deficiency in the production of red blood cells (RBCs) or erythrocytes. That is, EPO is used for treatment of anemia associated with various pathogenic factors such as renal failure, prematurity, hypothyroidism, malnutrition, cancer, rheumatoid arthritis, chronic renal dysfunction, AIDS, and bone marrow transplantation (Carnot et al, Comp. Rend., 143:384, 1906; Winearles et al., Lancett, 22:1175, 1986; and Winearles et al., Lancet, 22:1175, 1986).

EPO is an acidic glycoprotein of approximately 30-34 kDa and may occur in three natural forms: alpha, beta, and asialo. EPO contains various glycosylation sites: for example, three N-linked sugar chains at Asn 24, 38 and 83, and an O-linked mucin-type sugar chain at

Ser 126. The protein fraction of EPO has a molecular weight of about 18 kDa and an intrinsic isoelectric point (Wang et al., Endocrinology, 116, 2286, 1985). In vivo biological activity of EPO is proportional to its in vivo half-life which has been known to be related with a content of sialic acid located at the terminus of sugar chains in EPO. Thus, the in vivo biological activity of EPO is greatly dependent upon the presence or absence of the sugar chains.

Therefore, in cases of E. coli having no glycosylation capacity, or yeast or insect cells having glycosylation capacity but mainly producing high mannose-type glycoproteins, the formulation of such a host cell is too low to produce sialic acid-rich glycoproteins such as human EPO, or it can only produce high mannose type glycoprotein. Therefore, they are not promising candidates for production of human EPO proteins. For these reasons, it is necessary to select a mammalian cell line capable of producing a glycoprotein structure that has a protein structure similar to that of human glycoproteins, no antigenicity in vivo, stability, stability and high in vivo activity, as a host cell. When the desired protein is recombinantly produced in host cells such as E. coli or yeast cells, the thus-produced protein has no in vivo stability or biological activity. Accordingly, it is known that production of a recombinant protein via transfection of an expression vector into a Chinese hamster ovary (hereinafter, referred to as CHO) cell line as an animal cell line is most appropriate.

However, such human EPO is readily cleared when it is administered to the body, so it cannot exert long-term erythropoietic potency thereof. Particularly in chronic renal insufficiency patients, the EPO protein is excreted via the urinary pathway, not being filtered by the renal glomeruli, or is otherwise recognized as an antigen in the blood and then cleared. Further, the EPO protein is destroyed by a mannose receptor in the liver. Thus, EPO therapy necessitates frequent administrations which is then regarded as a burden to both patients and caregivers.

Human albumin is a simple protein widely found in various cells and body fluid. It accounts for about 60% of the total proteins, is most abundant in plasma and is synthesized in the liver. It participates in maintenance of osmotic pressure of plasma collagen, counteraction of poison and maintenance of acid-base equilibrium, and is known to have excellent in vivo stability and a long half-life. It also plays a role in transportation of numerous drugs or chemical substances by binding thereto non-specifically. When the human albumin is linked with a physiologically active peptide to form a fusion protein, a half life of the conjugated physiologically active peptide increases (see Korean Patent No. 10-0227167)

As a result of a variety of extensive and intensive studies and experiments to solve the problems as described above and to develop a novel method capable of enhancing in vivo activity of EPO, the inventors of the present invention have constructed an albumin-EPO fusion protein by linking a human intact albumin or domain region thereof with EPO to prepare an albumin-EPO conjugate. For this purpose, two proteins, that is albumin and EPO, were linked via a linker including a (GGS'GG)-repeated amino acid sequence to physically isolate two proteins albumin and EPO, such that binding of EPO to an in vivo receptor is not interfered, simultaneously with minimized adverse effects on intrinsic nature and tertiary structure of the EPO protein. The present inventors have discovered that the thus-prepared fusion protein has an about 3 -fold increased in vivo half-life while showing erythropoietic efficacy comparable to that of Standard EPO (EPO standard of the European Pharmacopoeia), and erythropoiesis-stimulating capacity of EPO is remarkably increased. The present invention has been completed based on these findings.

DISCLOSURE OF THE INVENTION

TECHNICAL PROBLEM Therefore, the present invention has been made in view of the above problems, and it is an object of the present invention to provide an albumin-EPO fusion protein comprising a linker including an amino acid sequence of (GGSGG)_n which links human albumin and human erythropoietin (EPO), wherein n is an integer from 3 to 5.

It is another object of the present invention to provide a nucleic acid encoding the aforesaid fusion protein.

It is a further object of the present invention to provide an expression vector capable of expressing the aforesaid fusion protein.

It is a still further object of the present invention to provide a cell line transfected with the aforesaid expression vector. It is yet another object of the present invention to provide a method for producing the fusion protein, comprising constructing and culturing the aforesaid cell line.

It is yet another object of the present invention to provide a pharmaceutical composition for treatment of anemia, comprising the aforesaid fusion protein.

It is yet another object of the present invention to provide a use of a pharmaceutical composition comprising the aforesaid fusion protein.

It is yet another object of the present invention to provide a method for prevention or treatment of anemia, comprising administrating to a mammal a pharmaceutical composition comprising the aforesaid fusion protein.

TECHNICAL SOLUTION

For the purposes of the present invention, it is noted that, as used in this specification, the singular forms "a," "an," and "the" include plural referents unless expressly and unequivocally limited to one referent.

The term "or" is used interchangeably with the term "and/or" unless the context clearly indicates otherwise.

The term "fusion protein" refers to a protein or polypeptide that has an amino acid sequence derived from two or more proteins. The fusion protein may also include linking regions of amino acids between amino acid portions derived from separate proteins.

"Protein" and "Polypeptide" are used interchangeably herein to describe protein molecules that may comprise either partial or full-length proteins.

A "nucleic acid" is a polynucleotide such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The term is used to include single-stranded nucleic acids, double-stranded nucleic acids, and RNA and DNA made from nucleotide or nucleoside analogues. In accordance with an aspect of the present invention, the above and other objects can be accomplished by the provision of an albumin-EPO fusion protein comprising a linker including an amino acid sequence of (GGSGG)_n which links human albumin and human erythropoietin (EPO), wherein n is an integer from 3 to 5. In the amino acid sequence of (GGSGG)_n, the subscript n means a repeating number of the amino acid sequence. In one embodiment of the present invention, the subscript n may have a value of 4.

As used herein, a "linker" comprises a polypeptide that joins two proteins or polypeptides together.

As used herein, the term "human albumin" refers to a full-length human albumin protein having one or more functional activities (for example, biological activities) of human albumin, or a portion or variant thereof.

As used herein, "human erythropoietin" refers to a full-length human EPO protein having one or more functional activities (for example, biological activities) of human EPO, or a portion or variant.

Particularly in the present invention, the portion of albumin refers to an albumin moiety having a length or structure sufficient to stabilize and extend a half life of EPO in the fusion protein in vivo, as compared to that of non-fused EPO in vivo. Preferably, the human albumin portion comprises more than about 1/3 length of full-length albumin from an N-terminal of the full-length albumin protein, more preferably one or more domains. When the human albumin portion is used in formation of the fusion protein, it may be preferred to lower a molecular weight of the entire protein and improve recombination yield.

Even though removal of one or more amino acid residues from the N-terminal or C- terminal of a protein may result in modification or loss of one or more biological functions of EPO or albumin protein or a fusion protein, other therapeutic activities or functional activities (for example, biological activity, multiple binding capacity, ligand binding capacity, etc.) may be still retained. As will be confirmed in the following Examples of the present invention, intact activity of an EPO fusion protein is retained even though a signal peptide or translation stop codon of the protein is eliminated for preparation of the fusion protein. Whether a certain polypeptide lacking N-terminal or C-terminal residue(s) retains intact activity or not can be easily determined by a method disclosed in the present specification and conventional methods know in the art.

The use of the linker can provide flexibility to the fusion protein of the present invention, and therefore has no adverse effects on inherent properties and tertiary structure of the EPO protein.

The fusion protein of the present invention may be prepared by linking the C-terminal of human albumin to the N-terminal of human EPO through the above-mentioned linker, or vice versa. In embodiments of the present invention, the fusion protein is a protein in which the C- terminal of human albumin is joined via the linker to the N-terminal of human EPO.

In one embodiment of the present invention, the fusion protein may have an amino acid sequence as set forth in SEQ ID NO: 2.

In another embodiment of the present invention, the fusion protein may have an amino acid sequence as set forth in SEQ ID NO: 4.

In another embodiment of the present invention, the fusion protein may have an amino acid sequence as set forth in SEQ ID NO: 6.

In accordance with another aspect of the present invention, there is provided a nucleic acid encoding the aforesaid fusion protein.

In one embodiment of the present invention, the fusion protein-encoding nucleic acid may have a nucleotide sequence as set forth in SEQ ID NO: 1.

In another embodiment of the present invention, the fusion protein-encoding nucleic acid may have a nucleotide sequence as set forth in SEQ ID NO: 3. In another embodiment of the present invention, the fusion protein-encoding nucleic acid may have a nucleotide sequence as set forth in SEQ ID NO: 5.

Since there is a multiplicity of codons that are capable of encoding one amino acid, the nucleotide sequence encoding the fusion protein of the present invention encompasses all the nucleotide sequences which code for the fusion protein of the present invention by any other codon, not by the above-exemplified nucleotide sequences.

In accordance with another aspect of the present invention, there is provided an expression vector comprising a human albumin gene, a linker including a nucleotide sequence of (GGAGGAAGCGGAGGA)_n wherein n is an integer from 3 to 5 and a human erythropoietin gene, and capable of expressing the aforesaid fusion protein.

As used herein, the term "vector" refers to a nucleic acid molecule that may be used to transport a second nucleic acid molecule into a cell. In one embodiment, the vector may comprise an expression vector capable of producing a protein derived from at least part of a nucleotide sequence inserted into the vector. Examples of the vector may include plasmids, cosmids, bacteriophages, and viral vectors such as adeno-associated virus. Preferred is a plasmid vector.

An optimal expression vector may comprise expression regulatory elements such as a promoter, an initiation codon, a stop codon, a polyadenylation signal and an enhancer, as well as a signal sequence or leader sequence for membrane-targeting or secretion, and may be prepared in various forms, depending upon desired applications and uses. The initiation codon and stop codon are usually regarded as a portion of the target protein-encoding nucleotide sequence, and must be functional in a subject, when a gene construct is administered. These initiation and stop codons should be contained in frame with the coding sequence.

A common promoter may be constitutive or inducible. Examples of prokaryotic promoters may include, but are not limited to, lac, tac, T3 and T7 promoters. Examples of eukaryotic promoters may include, but are not limited to, Simian Virus 40 (SV 40), Mouse

Mammary Tumor Virus (MMTV) promoter, Human Immunodeficiency Virus (HIV), e.g. the long terminal repeat (LTR) promoter of HIV, Molony virus, Cytomegalovirus (CMV), Epstein Barr virus (EBV), Rous Sarcoma Virus (RSV) promoter, as well as β-actin promoter, human hemoglobin, human muscle creatine, and human metalloprotein-derived promoter. In addition, when regulatory sequences are compatible with a host cell system, it is also possible to use a promoter or regulatory sequence which is normally related to a desired gene sequence.

Further, the expression vector may comprise a selectable marker for selection of a vector-carrying host cell, and comprise an origin of replication when the vector is a replicable expression vector. A gene encoding an antibiotic or drug resistance-conferring product is used as a common selectable marker. A β-lactamase gene (ampicillin resistance) and a Tet gene (tetracycline resistance) may be used for prokaryotic cells, whereas neomycin (G418 or geneticin), gpt (mycophenolic acid), ampicillin and hygromycin resistance gene may be used for eukaryotic cells. Dihydrofolate reductase marker genes permit selection with methotrexate in a variety of hosts. Genes encoding the gene product of auxotrophic markers of the host (e.g., LEU2, URA3, and HIS3) are often used as selectable markers in yeast. Use of viral (e.g., baculovirus) or phage vectors, and vectors which are capable of integrating into the genome of the host cell, such as retroviral vectors, are also contemplated.

In one embodiment of the present invention, the expression vector may be an Albumin Full Linker EPO (hereinafter, referred to as AFLE) expression vector, or an Albumin Domainl

Linker EPO (hereinafter, referred to as ADLE) or Albumin Domain2 Linker EPO (hereinafter, referred to as ADLE2) expression vector, which comprises an intact albumin gene or domain gene with deletion of a stop codon, a linker including a nucleotide sequence of

(GGAGGAAGCGGAGGA)_n, a human EPO gene with deletion of a signal sequence, and a Zeocin-resistance gene.

In one embodiment of the present invention, the expression vector may comprise a nucleotide sequence as set forth in SEQ ID NO: 1.

In another embodiment of the present invention, the expression vector may comprise a nucleotide sequence as set forth in SEQ ID NO: 3. In another embodiment of the present invention, the expression vector may comprise a nucleotide sequence as set forth in SEQ ID NO: 5.

In another embodiment of the present invention, the expression vector may further comprise a dihydrofolate reductase (DHFR)-encoding gene. The expression vector may be a vector with insertion of a dihydrofolate reductase (DHFR) gene as shown in a gene map of the vector of FIG 3.

In accordance with yet another aspect of the present invention, there is provided a cell line transfected with the aforesaid expression vector.

The cell line of the present invention may be a prokaryotic or eukaryotic cell line, preferably an animal cell line. Examples of the animal cell line may include, but are not limited to, Chinese hamster ovary (CHO) cell line, C0S7 (African Green Monkey SV40- transfd kidney fibroblast cell line), NSO cell line, SPO/2 cell line, W138, a baby hamster kidney (BHK) cell line, MDCK, myeloma cell line, HuT 78 cell and 293 cell line.

In one embodiment of the present invention, the cell line may be a cell line comprising a human albumin gene, a linker including a nucleotide sequence of (GGAGGAAGCGGAGGA)_n wherein n is an integer from 3 to 5, and a human erythropoietin gene, and transfected with an expression vector capable of expressing the fusion protein.

When it is difficult to achieve high productivity of a desired protein due to a low expression level in association with transfection to produce a recombinant protein in the animal cell line, gene amplification in the cell line is employed. The most representative is a gene amplification technique utilizing dihydrofolate reductase or glutamine synthetase. In one embodiment of the present invention, a cell line with significantly increased production of a recombinant protein in accordance with the present invention was established by transfection of the host cell with an expression vector comprising a human albumin gene, a linker including a nucleotide sequence of (GGAGGAAGCGGAGGA)_n and a human erythropoietin gene and with a DHFR-expressing gene. These cell lines were deposited with the Korean Collection for Type Cultures (KCTC), the Korean Research Institute of Bioscience and Biotechnology (KRIBB, Daejon, Korea), under Accession Numbers KCTC 11014BP (ADLE- expressing cell line) and KCTC 11015BP (AFLE-expressing cell line) (deposited on October 27, 2006), respectively.

In accordance with a further aspect of the present invention, there is provided a cell line transfected with an expression vector comprising a human albumin gene, a linker including a nucleotide sequence of (GGAGGAAGCGGAGGA)_n wherein n is an integer from 3 to 5 and a human erythropoietin gene, and capable of expressing the fusion protein, and with an expression vector comprising a DHFR-encoding gene.

The cell line may be a CHO/dhfr- cell line which is dh/r-dcficicnt

In accordance with a further aspect of the present invention, there is provided a cell line deposited under Accession No. KCTC 11014BP or Accession No. KCTC 11015BP.

In accordance with a further aspect of the present invention, there is provided a method for producing a fusion protein, comprising: cloning a fusion protein-encoding gene into an expression vector; transfecting a cell line with the expression vector; and culturing the cell line.

Transfection of the cell line in the present invention includes any method for introduction of nucleic acid into organisms, cells, tissues or organs and may be carried out by any standard technique as known in the art, depending upon kinds of cell lines to be used. Examples of the cell transfection technique may include, but are not limited to, calcium phosphate precipitation, lipofectamine transfection and freeze-dry method transfection. Further, cultivation of the cell line may be carried out using suitable culture media and under culture conditions, as known in the art. Those skilled in the art will appreciate that cell culture processes can be readily and appropriately selected depending upon cell lines to be selected. The culture process can be easily modified or adjusted by those skilled in the art. The cell culture is divided into suspension culture and adhesion culture, depending upon cell growth methods, and is divided into batch, fed-batch and continuous culture, depending upon culture methods. The culture method to be selected should meet the requirements for a certain cell line used in cell culture. In the cell culture, the culture medium contains various carbon sources, nitrogen sources and trace elements. Examples of the carbon source that can be used in the present invention may include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose; fats such as soybean oil, sunflower oil, castor oil and coconut oil; fatty acids such as palmitic acid, stearic acid and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These carbon source materials may be used alone or in any combination thereof. Examples of the nitrogen source that can be used in the present invention may include organic nitrogen sources such as peptone, yeast extracts, meat broth, maltose extract, corn steep liquor (CSL) and soybean meal; and organic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. These nitrogen source materials may be used alone or in any combination thereof. The culture medium may further contain amino acids, vitamins and appropriate precursor materials.

A dihydrofolate reductase inhibitor such as methotrexate (MTX) may be added to the culture medium.

In one embodiment of the present invention, the present invention provides a method for high expression of a fusion protein, comprising transfecting a d/z/r-deficient cell line with a vector comprising a fusion protein-encoding gene and with a vector comprising a DHFR- encoding gene, and culturing the transfected cell line in a medium containing methotrexate.

In Examples of the present invention which will follow, the present inventors constructed and confirmed two forms of mammalian expression vectors of the above- mentioned Albumin Full Linker EPO (AFLE) and Albumin Domainl Linker EPO or Albumin Domain2 Linker EPO (ADLE or ADLE2) as shown in FIG. 2. For this purpose, the above- constructed expression vectors and an expression vector with insertion of a dhfr gene were transfected and expressed into CHO DUKK-Il which is a dihydrofolate reductase-deficient CHO cell line (CHO-dhfr(-)). Thereafter, the cells were subjected to selective culture in a medium containing a high concentration of methotrexate, and a cell line (ADLE-expression cell line, deposited under Accession No. KCTC 11014BP) and a cell line (AFLE-expression cell line, deposited under KCTC 11015BP), each exhibiting stable and high expression of EPO, were established. Then, the cell lines with high expression of the recombinant Albumin FuIl- Linker-EPO or Albumin Domain-Linker-EPO fusion protein were cultured in a roller bottle to thereby secure large amounts of cell cultures which were then purified by an ion exchange resin to obtain a recombinant protein of the present invention. Albumin-EPO fusion proteins prepared as above were estimated using the EPO-dependent F-36E cell line, and compared with that of Standard EPO (EPO standard of the European Pharmacopoeia). As a result, the thus-constructed fusion protein of the present invention exhibited an about 3 -fold increased in vivo half-life and superior erythroid progenitor production-promoting activity while showing an erythropoietic potency comparable to that of Standard EPO.

In accordance with a further aspect of the present invention, there is provided a pharmaceutical composition comprising the aforesaid fusion protein.

For purpose of desired administration, the pharmaceutical composition of the present invention may be formulated into a variety of dosage forms by further inclusion of one or more pharmaceutically acceptable carriers in addition to the above-mentioned fusion protein.

The pharmaceutical composition can be administered via a conventional route, for example intravenously, intraarterially, percutaneously, intradermally, intramuscularly, intraperitoneally, intrasternally, intranasally, locally, rectally, orally, intraocularly, or by inhalation.

When the composition of the present invention is formulated into an injectable preparation, buffer for injection and other additive components may be added which are well- known in the art. The injectable preparation of the present composition may comprise additive components such as solubilizers, pH-adjusting agents, suspending agents, etc., besides the buffer for injection. As the buffer for injection, physiological saline may be used.

Dosage forms of the composition of the present invention may include granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juice, suspensions, emulsions, and sustained-release formulations of an active compound. For formulation of the composition into a tablet or capsule, the active ingredient may be combined with any oral, non-toxic and pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. If desired or necessary, suitable binders, lubricants, disintegrants and colorants may be added. Examples of the suitable binder may include, but are not limited to, naturally-occurring sugars such as starch, gelatin, glucose, and beta-lactose; natural and synthetic gum such as corn sweetener, acacia, tragacanth, and sodium oleate; sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Examples of the disintegrant may include, but are not limited to, starch, methyl cellulose, agar, bentonite, and xanthan gum.

For formulation of the composition into a liquid preparation, a pharmaceutically acceptable carrier which is sterile and biocompatible may be used such as saline, sterile water, Ringer's solution, buffered physiological saline, albumin infusion solution, dextrose solution, maltodextrin solution, glycerol, or ethanol. These materials may be used alone or in any combination thereof. If necessary, other conventional additives may be added such as antioxidants, buffers, bacteriostatic agents, and the like. Further, diluents, dispersants, surfactants, binders and lubricants may be additionally added to the composition to prepare injectable formulations such as aqueous solutions, suspensions, and emulsions, or parenteral formulations such as pills, capsules, granules, and tablets. Furthermore, the composition may be preferably formulated into a desired dosage form, depending upon diseases to be treated and ingredients, using any appropriate method known in the art, as disclosed in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA.

The pharmaceutical composition of the present invention can be used for prevention or treatment of anemia associated with various pathogenic factors such as renal failure, prematurity, hypothyroidism, malnutrition, cancer, rheumatoid arthritis, chronic renal dysfunction, AIDS, and bone marrow transplantation.

Further, the present invention provides a use of the fusion protein for preparing a medicament for prevention or treatment of anemia. The pharmaceutical composition comprising the fusion protein of the present invention can be used for preparation of such a drug. Further, the present invention provides a method for prevention or treatment of anemia, comprising administering to a mammal a pharmaceutical composition containing a therapeutically effective amount of the fusion protein.

As used herein, the term "mammal" refers to a subject that is in need of treatment, examination or experiment, preferably human.

As used herein, the term "therapeutically effective amount" refers to an amount of an active ingredient or pharmaceutical composition that will elicit the biological or medical response of a tissue system, animal or human that is being sought by a researcher, veterinarian, medical practitioner or clinician, and encompasses an amount of the active ingredient or pharmaceutical composition which will relieve the symptoms of the disease or disorder being treated.

As will be apparent to those skilled in the art, the therapeutically effective dose and the number of administration times of the active ingredient in accordance with the present invention may vary depending upon desired therapeutic effects. Therefore, an optimal dose of the active drug to be administered can be easily determined by those skilled in the art. For example, an effective dose of the drug is determined taking into consideration various factors such as kinds of disease, severity of disease, contents of active ingredients and other components contained in the composition, kinds of formulations, age, weight, health, sex and dietary habits of patients, administration times and routes, release rates of the composition, treatment duration, and co-administered drugs. For adults, EPO may be preferably administered at a dose of 0.2 μg/kg to 20 μg/kg once or several times a day. In addition, the pharmaceutical composition may be administered in combination with a known anti-anemia drug. ADVANTAGEOUS EFFECTS

As will be demonstrated hereinafter, an erythropoietin fusion protein of the present invention secures flexibility capable of ensuring the erythropoietic potency of human EPO, via the incorporation of a linker including a GGSGG-repeated amino acid sequence, and has various advantages such as high productivity, stability and purity, due to the use of human albumin. The fusion protein of the present invention exhibits an about 3 -fold increased in vivo half-life and superior erythroid progenitor production-promoting activity, as compared to conventional EPO. Further, the fusion protein of the present invention is safe due to a maximum decrease of antigenicity or carcinogenicity which was confirmed in polyethylene glycol-niodified erythropoietin (PEG-modified EPO) or glycosylation-modified erythropoietin (EPO), which is a modified version of human EPO. Accordingly, the fusion protein of the present invention is therapeutically effective for prevention or treatment of anemia.

DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram of a human albumin-linker-EPO fusion gene;

FIG. 2 is a construction map of an expression vector comprising the fusion gene of FIG. 1;

FIG. 3 is a gene map of an expression vector with insertion of a dihydrofolate reductase

(DHFR) gene;

FIG. 4 is an electrophoretic pattern of the linker-EPO expression vector pcDNA3.1/Zeo(+)-LE of FIG. 2, after cleavage of the expression vector with restriction endonucleases BamHI and Apal;

FIG. 5A is an electrophoretic pattern of a human intact albumin gene or domain gene, and FIG. 5B is an electrophoretic pattern of an expression vector of a human intact albumin or albumin domain-linker-EPO fusion gene (AFLE and ADLE) as shown in FIG. 2, after cleavage of the expression vector with restriction endonucleases Nhel and EcoRI;

FIG. 6 is a schematic diagram showing an induction process of a cell line with high- expression of an albumin-linker-EPO fusion protein, using methotrexate (MTX);

FIG. 7A is a graph showing an expression level of a human albumin-EPO recombinant fusion protein by the ADLE2 clone, and FIG. 7B is a graph showing an expression level of a human albumin-EPO recombinant fusion protein by the ADLE clone, as constructed according to a method of FIG. 6;

FIG. 8 is a graph showing an expression level of a human albumin-EPO recombinant fusion protein by the ADLE clone, as constructed according to a method of FIG. 6;

FIG. 9 A shows the results of Western blot analysis for intact albumin or domain-linker-

EPO (AFLE and ADLE) fusion proteins, and FIG. 9B shows the results of Western blot analysis for intact albumin or domain-linker-EPO (AFLE, ADLE and ADLE2) fusion proteins;

FIG. 1OA is a graph showing the results of cell viability for each experimental group of Standard EPO (EPO standard of the European Pharmacopoeia), AFLE and ADLE, using a F-

36E cell line, and FIG. 1OB is a graph showing the results of cell viability for each experimental group of Standard EPO (EPO standard of the European Pharmacopoeia), AFLE,

ADLE and ADLE2, using a UT-7 cell line;

FIG. 11 is a graph showing the ELISA results of blood EPO levels in experimental groups with administration of Standard EPO (EPO standard of the European Pharmacopoeia), Darbepoietin-α, AFLE, ADLE and ADLE2;

FIG. 12 is a graph showing increases of erythroid progenitor cells in experimental groups with administration of Standard EPO (EPO standard of the European Pharmacopoeia) and Darbepoietin-α, as measured using a Fluorescence-activated Cell Sorter (FACS);

FIG. 13 is a graph showing increases of erythroid progenitor cells in experimental groups with administration of Standard EPO (EPO standard of the European Pharmacopoeia) and AFLE, as measured using a FACS;

FIG. 14 is FIG. 13 is a graph showing increases of erythroid progenitor cells in experimental groups with administration of Standard EPO (EPO standard of the European Pharmacopoeia) and ADLE, as measured using a FACS; and

FIG. 15 is FIG. 13 is a graph showing increases of erythroid progenitor cells in experimental groups with administration of Standard EPO (EPO standard of the European Pharmacopoeia) and ADLE2, as measured using a FACS.

MODE FOR INVENTION

The present invention will be described in more detail with reference to the following Examples. These Examples illustrate a method for producing a fusion protein comprising a linker-mediated human albumin/human erythropoietin conjugate, by construction of an expression vector comprising a human albumin-linker-EPO fusion gene as shown in FIG. 1, and establishment of a recombinant cell line transfected with the same expression vector.

These and other objects, advantages and features of the present invention will become apparent from the detailed embodiments given below which are made in conjunction with the following Examples. The present invention may be embodied in different forms and should not be misconstrued as being limited to the embodiments set forth herein, and those skilled in the art will appreciate that various modifications, additions and substitutions are possible without departing from the scope and spirit of the invention as disclosed in the accompanying claims. Therefore, it should be understood that the embodiments disclosed herein are provided only for illustrating the present invention and should not be construed as limiting the scope and spirit of the present invention.

<Examples 1 to 3> Construction of a vector comprising a nucleotide sequence having a human albumin gene and a human erythropoietin gene linked via a linker

Example 1 is construction of a vector pcDNA3.1/Zeo(+)-ADLE comprising a nucleotide sequence having a human albumin domain gene (SEQ ID NO: 10) and a human erythropoietin gene linked via a linker, Example 2 is construction of a vector pcDNA3.1/Zeo(+)-AFLE comprising a nucleotide sequence having an intact human albumin gene (SEQ ID NO: 7) and a human erythropoietin gene linked via a linker, and Example 3 is construction of a vector pcDNA3.1/Zeo(+)-ADLE2 comprising a nucleotide sequence having a human albumin domain gene (SEQ ID NO: 12) and a human erythropoietin gene linked via a linker.

For convenience and brevity, Examples 1 to 3 will be described together as they are very similar.

(1) Preparation of an intact human albumin gene with deletion of a translation stop codon mRNA was isolated from the HepG2 (human hepatic fibroblastoma) cell line, using a RNA isolation kit (QIAGEN), and cDNA of an intact human albumin gene was synthesized from the mRNA using reverse transcriptase (Invitrogen).

Reverse Transcription-Polymerase Chain Reaction (RT-PCR): For synthesis of cDNA

RT-PCR buffer (5X): 10 μi Oligo dT primer: 5 nM

DTT: 1 mM Total RNA: 2 AS RTase: 5 units

For fusion of a human EPO protein to the C-terminal of a human albumin protein, an intact human albumin gene (SEQ ID NO: 7, nt 7-1833) with deletion of a translation stop codon was prepared. For this purpose, an upstream primer (SEQ ID NO: 8) with attachment of an Nhel recognition sequence and a downstream primer (SEQ ID NO: 9) with attachment of a HindIII recognition sequence and deletion of a stop codon were synthesized respectively, and PCR was carried out using these primers.

ALB-DsF (SEQ ID NO: 8): GCT AGC ATG AAG TGG GTA ACC TTT ATT TCC (The sequence underlined is the Nhel recognition sequence)

ALB-DfR (SEQ ID NO: 9): AAG CTT GTA AGC CTA AGG CAG CTT GAC TTG (The sequence underlined is the HindIII recognition sequence)

Gene PCR PCR buffer (10X): 2 μi dNTPs 25 mM each: 2 μl Upstream primer (10 pmol): 0.5 pmol Downstream primer (10 pmol): 0.5 pmol Template cDNA: 100 pg

Taq polymerase: 1 unit

The resulting intact human albumin gene containing Nhel and HindIII recognition sites with deletion of the stop codon was cloned and ligated into a cloning vector (T Easy vector, Promega), via complementary binding of a terminal TA base pair of the PCR gene product. The recombinant vector was introduced into E. coli strain DH5α in a thermal shock procedure to result in insertion of the gene. 100 βglvnL of ampicillin was added to an LB medium, and the E. coli strain harboring the cloning vector having the intact human albumin gene (SEQ ID NO: 7, nt.7-1833) with deletion of a translation stop codon was selected via selective culture.

(2) Preparation of a human albumin domain gene with deletion of a translation stop codon

In order to obtain a human albumin domain gene with deletion of a translation stop codon (SEQ ID NO: 10, nt.7-639), PCR was carried out using an upstream primer (SEQ ID NO: 8) with attachment of an Nhel recognition sequence and a downstream primer (SEQ ID NO: 11) with attachment of a HindIII recognition sequence and deletion of a stop codon, according to the same procedure as in Section (1). Thereafter, the E. coli strain harboring the cloning vector having the human albumin domain gene with deletion of a translation stop codon (SEQ ID NO: 10, nt.7-639) was selected as described above.

ALB-DlR (SEQ ID NO: 11): AAG CTT GAT CCC GAA GTT CAT CGA GCT TTG (The sequence underlined is the HindIII recognition sequence)

Further, in order to obtain a human albumin domain gene with deletion of a translation stop codon (SEQ ID NO: 12, nt.7-1216), PCR was carried out using an upstream primer (SEQ

ID NO: 8) with attachment of an Nhel recognition sequence and a downstream primer (SEQ

ID NO: 13) with attachment of a HindIII recognition sequence and deletion of a stop codon, according to the same procedure as in Section (1). Thereafter, the E. coli strain harboring the cloning vector having the human albumin domain gene with deletion of a translation stop codon (SEQ ID NO: 12, nt 7-1216) was selected as described above.

ALB-D2R (SEQ ID NO: 13): AAG CTT GAG GTT TAA ATT CAT CGA ACA CTT T

(The sequence underlined is the HindIII recognition sequence)

(3) Preparation of a human erythropoietin gene with deletion of a protein signal sequence Since a human EPO protein which will be fused with a C-terminal of the human albumin protein via a linker does not need a protein signal sequence, a human erythropoietin gene (SEQ ID NO: 14) consisting of 501 oligonucleotides and having deletion of a protein signal sequence was cloned from a human fetal liver genomic DNA library (deposited under ATCC Accession No. 37333).

For cloning of the human erythropoietin gene, the following protein signal sequence primers (SEQ ID NO: 15 and 16) for cDNA synthesis were used with reference to the EPO genomic gene sequence as published by Lin et al (Proc. Natl. Acad. Sci. USA, 82:7580, 1985).

EcoR V/EPO-F (SEQ ID NO: 15): GAT ATC GCC CCA CCA CGC CTC ATC TGT

(The sequence underlined is the EcoRV recognition sequence)

Apa I/EPO-R (SEQ ID NO: 10): GGG CCC ACC TGG TCA TCT GTC CCC TGT C (The sequence underlined is the Apal recognition sequence)

The human erythropoietin gene was inserted and ligated into a cloning vector (T- vector) using EcoRV and Apal, and the sequence was confirmed by dye-termination sequencing (SEQ ID NO: 14).

Next, the cloning vector (T-vector) was restricted with EcoRV and Apal to cleave the human erythropoietin gene, and simultaneously an animal cell expression vector pcDNA3.1/Zeo(+) was restricted with EcoRV and Apal. The target gene band was confirmed by agarose gel electrophoresis and the isolated human erythropoietin gene was inserted into the vector pcDNA3.1/Zeo(+), followed by ligation using a ligase to construct a vector pcDNA3.1/Zeo(+)-EPO with incorporation of the EPO gene.

After ligation was complete, the thus-constructed human erythropoietin gene and a portion of pcDNA3.1/Zeo(+) sequence were analyzed by dye-termination sequencing, and then treated with restriction endonucleases to cleave the human erythropoietin gene, followed by electrophoresis to confirm a molecular weight of the gene. The results obtained are shown in FIG. 4 (Lane 1 represents a pcDNA3.1/Zeo(+) expression vector, Lane 2 represents a protein marker, and Lane 3 represents a linker-erythropoietin gene fragment).

For electrophoresis, a 1% agarose gel was prepared using Tris-acetate- ethylenediaminetetraacetic acid (TAE) buffer, and 10 μJt of the digestion product was electrophoresed on a 2% agarose gel at a voltage of 100 V.

(4) Preparation of a linker

A linker including an amino acid sequence of (GGSGG)₄ (SEQ ID NO: 18) was synthesized by TAKARA (Japan). The linker has a structure in which EcoRI and EcoRV recognition sequences are respectively attached to two terminals of a nucleotide sequence (SEQ ID NO: 17) of the linker, and is comprised of a 72-base nucleotide sequence including the restriction enzyme bases plus the nucleotide sequence (SEQ ID NO: 17) of the linker. The linker was inserted into pUCK19 to construct a pUCK19-linker (Takara, Japan).

Amino acid sequence of the linker: (ECORI)-GGSGGGGSGGGGSGGGGSGG-(ECORV) Nucleotide sequence of the linker:

GAATCC(EcoRI)-

GGAGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGAAGCGGAGGAGG AGGAAGCGGAGGA-GATATC(EcoRV)

(5) Linking of a human erythropoietin gene to a linker

The vector pcDNA3.1/Zeo(+)-EPO with insertion of a human erythropoietin gene and the pUCK19-linker with insertion of a linker were cleaved with EcoRI and EcoRV to obtain a linker and a linear pcDNA3.1/Zeo(+)-EPO expression vector. The linker and human erythropoietin gene bands were confirmed and isolated by agarose gel electrophoresis, and the linker was inserted between a promoter of the linear pcDNA3.1/Zeo(+)-EPO and a translation sequence of the erythropoietin protein. The resulting gene structure was digested with the restriction endonucleases EcoRI and EcoRV to confirm molecular weights of the linker and the linear pcDNA3.1/Zeo(+)-EPO expression vector. Finally, pcDNA3.1/Zeo(+)-LE with insertion of the linker-erythropoietin gene was constructed using dye-termination sequencing (see FIG. 2).

(6) Linking of a linker-erythropoietin to a human albumin gene

The cloning vector with insertion of a human albumin domain gene (SEQ ID NO: 10, nt. 7-639) constructed in Section (2) and the linker-erythropoietin expression vector pcDNA3.1/Zeo(+)-LE constructed in Section (5) were cleaved with the restriction endonucleases Nhel and Hindlll, and the human albumin domain gene was inserted between promoter of a linear pcDNA3.1/Zeo(+)-LE expression vector and upstream of the linker- erythropoietin. Then, the ligation step was performed using a ligase enzyme (see FIG. 2). In order to eliminate unnecessary amino acid residues and peptide shifts upon protein translation on the base sequence between genes, an unnecessary sequence between Hindlll and EcoRI sites present in pcDNA3.1/Zeo(+) was removed to thereby construct pcDNA3.1/Zeo(+)-ADLE. A fusion gene (ADLE) of a human albumin portion with the linker-erythropoietin was sequenced by dye-termination sequencing, (amino acid sequence of the ADLE gene: SEQ ID NO: 4, and nucleotide sequence of the ADLE fusion protein: SEQ ID NO: 3).

According to the same procedure as in construction of pcDNA3.1/Zeo(+)-ADLE, only the albumin domain gene (SEQ ID NO: 10, nt. 7-639) was digested and isolated from the human albumin domain-linker-erythropoietin gene expression vector pcDNA3.1/Zeo(+)- ADLE, using the restriction endonucleases Nhel and Hindlll, whereas the cloning vector with insertion of the intact albumin gene (SEQ ID NO: 7, nt. 7-1833) was digested with the restriction endonucleases Nhel and Hindlll and the intact human albumin gene was inserted and ligated into pcDNA3.1/Zeo(+)-LE to thereby construct pcDNA3.1/Zeo(+)-AFLE. A sequence of the fusion gene (AFLE) of the intact human albumin gene and the linker- erythropoietin was confirmed by dye-termination sequencing (amino acid sequence of the AFLE gene: SEQ ID NO: 2, and nucleotide sequence of the AFLE fusion protein: SEQ ID NO: 1).

According to the same procedure as in construction of pcDNA3.1/Zeo(+)-AFLE, the cloning vector with insertion of the albumin domain gene (SEQ ID NO: 12, nt. 7-1216) was digested with the restriction endonucleases Nhel and Hindlll, and the human albumin domain gene (SEQ ID NO: 12, nt. 7-1216) was inserted and ligated into pcDNA3.1/Zeo(+)-LE to thereby construct pcDNA3.1/Zeo(+)-ADLE2.

A sequence of the fusion gene (ADLE2) of the human albumin portion with the linker- erythropoietin was confirmed by dye-termination sequencing (amino acid sequence of the ADLE2 gene: SEQ ID NO: 6 and nucleotide sequence of the ADLE2 fusion protein: SEQ ID NO: 5).

FIG. 5 A is an electrophoretic pattern of a human intact albumin gene or domain gene

(AFLE, ADLE, or ADLE2), obtained by recovering mRNA from the albumin-expressing cell line, synthesizing an intact or domain gene for albumin, and cleaving the gene inserted into the T-EASY cloning vector with the restriction endonucleases, followed by 1% agarose gel electrophoresis (M represents a 1-kbp ladder, Lane 1 represents a human albumin domain gene (domainl), Lane 2 represents a human albumin domain gene (domain2), and Lane 3 represents the intact albumin gene). As a result, the presence of the human intact albumin or domain gene (AFLE, ADLE, and ADLE2) was confirmed.

FIG. 5 B shows an electrophoretic pattern of an expression vector of a human intact albumin or albumin domain-linker-EPO fusion gene (AFLE, and ADLE) on a 1% agarose gel, after cleavage of the expression vector with the restriction endonucleases Nhe I and EcoR I (Lane 1 represents a gene marker, Lane 2 represents a pcDNA3.1/Zeo(+) expression vector, Lane 3 represents the expression vector and linker-erythropoietin of Lane 2, Lane 4 represents an intact human albumin gene, and Lane 5 represents a human albumin domain gene (domainl). As a result, the molecular weight of ADLE and AFLE, and incorporation of the fusion gene into the mammalian expression vector pcDNA3.1/Zeo(+) were confirmed. Taken together, it was confirmed that an animal cell expression vector was cloned by which the human intact albumin or domain, linker peptide and erythropoietin are capable of being translated into a continuous fusion protein.

<Examples 4 to 6> Establishment of cell lines transfected with the vectors constructed in Examples 1 to 3

Example 4 is establishment of a CHO cell line transfected with the vector pcDNA3.1/Zeo(+)-ADLE constructed in Example 1, Example 5 is establishment of a CHO cell line transfected with the vector pcDNA3.1/Zeo(+)-AFLE constructed in Example 2, and Example 6 is establishment of a CHO cell line transfected with the vector pcDNA3.1/Zeo(+)-

ADLE2 constructed in Example 3.

For convenience and brevity, Examples 4 to 6 will be described together as they are very similar.

(1) Gene transfection of CHO cell line

Chinese hamster ovary (CHO) cells were transfected with the recombinant expression vector pcDNA3.1/Zeo(+)-ADLE, pcDNA3.1/Zeo(+)-ADLE2 or pcDNA3.1/Zeo(+)-AFLE constructed in Examples 1 to 3.

Specifically, a CHO (DUKX-Il) cell line (ATCC CRL-9096) which is a CHO cell line (CΑO-dhff) lacking a dihydrofolate reductase (DHFR) gene was pre-cultured, and inoculated at a cell density of 2 x 10⁵ to 10⁶ cells/mL in a 60 mm tissue culture dish, followed by overnight culture. 0.5 βg of the recombinant expression vector DNA constructed in Example 1 to 3 and 0.5 βg of the expression vector pSV2-DHFR with insertion of a DHFR gene were mixed in 50 βl of Opti-MEM, and 1.5 βi of Lipofectin™ (Gibco BRL) was mixed in 50 βi of Opti-MEM to prepare 100 βi of a transfection solution, followed by reaction at room temperature for 10 min. Two solutions were then mixed and allowed to react at room temperature for 20 min to thereby form a lipofectin-DNA complex. The resulting complex was treated on the CHO DUKX-Il cell line which was previously prepared on a 60 mm culture dish, and the cells were incubated in a CO₂ incubator at 37^°C for 6 hours. Thereafter, a 60 mm culture dish, containing the cell line which was challenged to be transfected, was treated with 2 mL of Iscove's Modified Dulbecco's Medium (IMDM)/ 10% fetal bovine serum (FBS), and the cells were given a late protein expression of 24 hours to induce expression of the inserted gene. After the cell culture was complete, the cells were desorbed using trypsin-EDTA and recovered by centrifugation. 10³ cells/well were seeded on a selective medium supplemented with 2 nM IMDM/10% FBS/2 nM MTX and 50 μg/mL of Zeocin in a 96-well culture dish and cultured for about 7 days. Selective markers used in the cell selection were Zeocin and methotrexate (MTX). Zeocin was used to confirm whether an albumin-EPO gene construct was inserted into the vector, whereas MTX was used to render the cells susceptible to MTX at an early stage of selective culture, which will be a tool to subsequently establish a cell line with high expression of a desired protein. Using enzyme- linked immunosorbent assay (ELISA) (hereinafter, the same manner as will be used in Example 8), protein expression of ADLE, ADLE2 and AFLE was confirmed for each culture well to thereby screen recombinant cell lines.

(2) Selection of human albumin erythropoietin-expressing cell lines from transfected cells by ELISA

A recombinant protein expression level in the cell line acquired in Section (1) was examined by ELISA. For this purpose, anti-EPO monoclonal antibodies (MoAbs) at a concentration of 2 βg/mL were diluted in a coating buffer prior to 24 hours and 100 //£/well of a sample was aliquoted into a maxisop plate (NUNC), followed by reaction at 4 ^°C . Then, the plate was gently washed with PBST containing 0.05% Tween 20 (PBST).

100 μi of EPO-BRP (EPO standard of the European Pharmacopoeia) and 100 μi of the transfectant culture samples were added to each well of the anti-EPO MoAbs-bound plate, followed by homogeneous mixing and reaction at room temperature for 2 hours. After the reaction was complete, the residual reaction solution was removed from each well which was then washed three times with 200 μl of a wash solution. Then, for each well, 100 mL of rabbit anti-EPO antibodies (R&D System, U.S.A.) at a concentration of 1/zg/mL was diluted in a reaction solution containing 5% skim milk, prior to use.

Primary antibodies were added to the reaction solution, followed by reaction at room temperature for 10 min. After the reaction was complete, the reaction solution was removed and the well plate was washed three times with 200 μl of a wash solution to completely remove the residual solution, followed by addition of 100 μ£/well of enzyme-conjugated anti- rabbit antibodies and reaction at room temperature for 10 min. Again after reaction and removal of the reaction solution were carried out, the well plate was washed three times with 200 μJt of a wash solution to completely remove the residual solution, followed by addition of 100 μΛ of a substrate solution (TMB, available from KPL, MD, USA) and reaction at room temperature for 10 min. After the substrate reaction, 100 μH/well of 1 N sulfuric acid was added to stop the enzymatic reaction. Absorbance was determined at 450 nm.

The standard calibration curve was plotted based on a titer (ng/mL) of the standard solution as the x-axis and the absorbance (A450 nm) as the y-axis. The contents (ng/mL) of human EPO in Standard EPO (BRP) and transfectant culture samples with respect to the absorbance were interpolated from the standard calibration curve. This method is a method of selecting the cell line as well as a basic method of confirming a protein expression rate of high-expression cell lines.

As a result, the cell lines were selected which exhibit normal expression of the albumin- linker-erythropoietin.

(3) Induction of high-expression cell lines using MTX

The transfectant cell line from which expression of the recombinant protein was confirmed according to Section (2) was exposed to MTX. For treatment of cells with MTX, the MTX concentration was increased to 2- to 4-fold according to the method shown in FIG. 6, and the cells were cultured for about 3 weeks at each concentration such that the cells are allowed to acclimate to increasing MTX concentrations without being killed. The cells were cultured with the MTX concentration of up to approximately 1 to 2 μM, and a concentration of the recombinant protein/cell, expressed during the cell culture, was determined by ELISA (the same manner as will be used in Example 8). The concentration of the protein was calculated in terms of the Q-value as follows.

Q = (AFLE, ADLE or ADLE2 ng/Cells/day) The results obtained are shown in FIGS. 7 and 8.

As can be seen from FIGS. 7 and 8, all of the ADLE2-expressing cell line (FIG. 7A), ADLE2-expressing cell line (FIG. 7B) and AFLE-expressing cell line (FIG. 8) exhibited an increased Q-value over time.

The thus-obtained cell lines exhibiting a high expression level of the intact albumin- linker-EPO fusion protein were deposited with the Korean Collection for Type Cultures

(KCTC), the Korean Research Institute of Bioscience and Biotechnology (KRIBB, Daejon, Korea), under Accession Numbers KCTC 11014BP (ADLE-expressing cell line) and KCTC

11015BP (AFLE-expressing cell line) (deposited on October 27, 2006), respectively.

<Examples 7 to 9> Production of an albumin-EPO fusion protein comprising a linker- mediated human albumin/human erythropoietin conjugate

Example 7 is production of an albumin domain-EPO fusion protein (ADLE) from the human albumin-linker-human erythropoietin-expressing cell line of Example 4 transfected with the vector pcDNA3.1/Zeo(+)-ADLE, Example 8 is production of an intact albumin-EPO fusion protein (AFLE) from the human albumin-linker-human erythropoietin-expressing cell line of Example 5 transfected with the vector pcDNA3.1/Zeo(+)-AFLE, and Example 9 is production of an albumin domain-EPO fusion protein (ADLE2) from the human albumin- linker-human erythropoietin-expressing cell line of Example 6 transfected with the vector pcDNA3.1/Zeo(+)-ADLE2.

For convenience and brevity, Examples 4 to 6 will be described together as they are very similar.

(1) Production of protein

Using an ion exchange resin and an adsorption resin, the desired proteins were purified from cell line cultures of ADLE, ADLE2 and AFLE clones with induction of high-expression of MTX-selected CHO cells from cell line expressing the human albumin-linker-human erythropoietin (hereinafter, referred to as "ADLE/ADLE2/AFLE"). The thus-purified proteins were analyzed by protein electrophoresis and Western blot analysis.

Specifically, the cell lines were cultured in a roller bottle containing serum-free proCHO5 (Cambrex) which is FBS-deficient, and the cell culture obtained was centrifuged to isolate the bacterial mass and culture supernatant. The culture supernatant sample was mixed with 5X sample buffer (125 mM Tris-HCl, 5% SDS, 50% glycerol, and 1 mg/mL bromophenol blue) in a ratio of 1:4, and each well of 10% polyacrylamide gel was treated with 30 μl of the resulting mixture. The electrophoresis was performed in duplicate samples.

After the electrophoresis was complete, the developed protein gel was transferred to PVDF membrane (Invitrogen) using an electroblotter (Novagen). The protein-transferred PVDF membrane was placed and stirred in a reaction buffer (TBS containing 5% skim milk and 0.05% Tween 20) at room temperature for 2 hours and then washed three times with a wash solution (TBS containing 0.1% Tween 20) for 10 min. The washed PVDF membrane was reacted with anti-human EPO antibodies (R&D System) as a primary antibody against human EPO at room temperature for 1 hour, and washed with a wash solution (TBS containing 0.1% Tween 20), followed by reaction with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody(PIERCE) as a secondary antibody at room temperature for 1 hour.

After the reaction was complete, the membrane was washed three times with a wash solution, and a TMB substrate for Western blotting was added thereto. The membrane was shaken until a band was visible by naked eyes. When the color development was confirmed, the PVDF membrane was washed with distilled water to terminate the reaction, and the PVDF membrane was dried and analyzed.

FIG. 9A shows the results of Western blot analysis for an intact albumin or domain- linker-EPO (AFLE and ADLE) fusion protein. In FIG. 9A, Lane 1 represents a protein marker, Lane 2 represents the ADLE culture, Lane 3 represents purified ADLE, Lane 4 represents the AFLE culture, Lane 5 represents purified AFLE, and Lane 6 represents an EPO standard of the European Pharmacopoeia. FIG. 9B shows the results of silver staining (left) and Western blot analysis (right) of proteins, after electrophoresis (PAGE) of an intact albumin or domain-linker-EPO (AFLE, ADLE and ADLE2) fusion proteins. In FIG. 9B, M represents a protein marker, Lane 1 represents purified ADLE, Lane 2 represents purified ADLE2, Lane 3 represents purified AFLE, and Lane 4 represents an EPO standard of the European Pharmacopoeia.

As can be seen from the results of FIGS 9A and 9B, it was confirmed that the human albumin/erythropoietin fusion protein is stably expressed in the CHO cell line, and the molecular weight thereof is appearing at the expected position.

(2) Mass production of proteins via roller bottle culture

The cell line obtained in Section (3) of Examples 4 to 6 was cultured in a 175T cell culture flask and about 2 x 10⁷ cells were inoculated into a 2L roller bottle. About 150 mL of the culture medium containing 10% FBS, 50 μg/mL of Zeocin and MTX was suspended in IMDM and the cells were grown to adhere to a roller bottle for about 24 hours. When the cells adhered homogeneously to the bottle and proliferated to fill the bottle, the cell culture was washed twice with PBS. The culture medium was replaced with 200 mL of a serum-free medium (proCHO5), and the cells were cultured for about 3 days.

The roller bottle culture was carried out at rotating speed of 8 rph, a temperature of 37 ^°C and an about 5% CO₂ concentration.

As a result, even though there was a difference between the cell lines, it was confirmed that each 200 mL of the culture was recovered for three batches, and the recombinant proteins ADLE, ADLE2 and AFLE produced for each batch were recovered without a significant variation.

(3) Purification of recombinant human albumin/erythropoietin by chromatography

The recombinant human albumin/erythropoietin extracellularly secreted by CHO cells grown in a roller bottle as in Section (2) was appropriately concentrated (ADLE/ ADLE2 5- fold, AFLE 10-fold) and diafϊltered, followed by chromatography. The chromatography process was carried out as follows. First, the culture concentrates (ADLE, ADLE2 and AFLE) were subjected to strong anion exchange chromatography with an equilibration solvent (20 mM Tris, pH 9.0) and an elution solvent (20 mM Tris + 1 M sodium chloride, pH 9.0) via stepwise elution. When the elution solvent contains 0.3 M sodium chloride, almost all of the desired recombinant proteins were eluted.

As a result, it was confirmed that when a purity of the HPLC-purified recombinant proteins were measured, all of ADLE, ADLE2 and AFLE were the recombinant proteins having a purity of 95% or higher.

Effects of fusion proteins

(1) Tests for effects of fusion proteins in accordance with the present invention, using EPO-dependent cell lines F-36E and UT-7

The F-36E cell line was purchased from RJKEN Cell Line Bank (Tsukuba, Japan), and the UT-7 cell line was purchased from German Collection of Microorganisms and Cell Cultures (DSMZ). The F-36E cell line is an EPO-dependent cell line which can survive and proliferate only with provision of EPO at a concentration of about 5.0 IU/mL. The UT-7 cell line can survive and proliferate only when the granulocyte-macrophage colony stimulating factor (GM-CSF) is present at a concentration of 5 ng/mL. About 1 x 10 cells/well of the F- 36E cell line were seeded on a 96-well plate, and 100 //£/well of a conditioned culture medium containing 5% FBS in RPMI 1640 was used as a culture medium. The UT-7 cell line was also seeded at a cell density of about 1 x 10³ cells/well on a 96-well plate, and 100 /z-6/well of a conditioned culture medium containing 20% FBS in IMDM was used as a culture medium. For both the F-36E cell line and UT-7 cell line, PBS (Phosphate Buffered Saline) was used as a negative control group, and an EPO standard of the European Pharmacopoeia (BRP cat# El 515000, European Directorate for the Quality of Medicine & Healthcare (EDQM)) was used as a positive control group. In the case of F-36E, the cells were treated with Standard EPO, and the recombinant proteins AFLE and ADLE constructed in Section (3) of Examples 7 to 9 at concentrations of 0.15 to 100 IU/mL for 48 hours. This is because a doubling time of the F36E cell line was confirmed to have about 40 hours. In the case of UT-7, the cells were treated with Standard EPO, an EPO analog, /. e. Darbepoietin-α having a prolonged half-life via a modified glycosylation pattern, and the recombinant protein AFLE, ADLE or ADLE2 constructed in Section (3) of Examples 7 to 9 at concentrations of 1.2 to 0.15 ILVmL for 72 hours.

In order to test the cell viability of the cultured F36E and UT-7 cell line, 20 βi of an MTS/PMS (50:1) solution for cell viability assay was added to 100 μi of each culture and the cells were cultured for another 90 min. The cell viability of the experimental groups was determined in terms of the OD value at 490 nm.

The results obtained are shown in FIGS. 1OA and 1OB.

FIG. 1OA is a graph showing the results of cell viability for each experimental group of an EPO standard of the European Pharmacopoeia, AFLE and ADLE, using a F-36E cell line. FIG. 1OB is a graph showing the results of cell viability for each experimental group of an

EPO standard of the European Pharmacopoeia, Darbepoietin-α, AFLE, ADLE and ADLE2, using a UT-7 cell line.

As a result, it was confirmed that the recombinant proteins AFLE, ADLE and ADLE2 in accordance with the present invention exhibit an erythropoietic effects comparable to that of Standard EPO.

(2) Stability of rhAlbumin-EPO fusion proteins in vivo

6-week-old male SD-Rats weighing 200 to 250 g as experimental animals were purchased from the Hanlim Laboratory Animals Co. (HwaSung, Korea). The animals were housed in individual cages in a breeding room maintained at a 12-h light/dark (L/D) cycle (light from 6:00 a.m. to 6:00 p.m.), a temperature of 22±2^°C, and RH of 55±15%. All animals were allowed ad libitum access to water and standard laboratory chow throughout the study period.

The experimental group was divided into five groups, each consisting of 5 animals (n=5): Standard EPO (EPO standard of the European Pharmacopoeia), an EPO analog, i.e. Darbepoietin-α having a prolonged half-life via a modified glycosylation pattern, AFLE, ADLE2 and ADLE groups. AU experimental animals were intravenously administered with a drug sample at a dose of about 4 μg/kg via femoral vein cannulation, and a plasma EPO concentration was confirmed by ELISA. Blood samples were collected from the orbital sinus at 5, 15, 30, 60, 120, 240, 360 and 480 minutes after injection respectively. All blood samples were treated with heparin. The blood was allowed to stand at room temperature for 40 min, and centrifuged for 5 minute at 3000 rpm. For detection of plasma EPO concentration, the supernatant serum was diluted to 10-fold in PBS, followed by analysis.

As can be seen in FIG. 11, upon examination of the in vivo stability of Standard EPO

(•), Darbepoietin-α (•), AFLE ( f), ADLE2 (J ) and ADLE (■), the Standard EPO group exhibited a rapid decrease in the serum level over time, the ADLE group exhibited a serum level of about 0.4 ng/mL at a point of around 480 min after intravenous injection, the ADLE2 group exhibited a serum level of about 0.7 ng/mL, and the Darbepoietin-α and AFLE groups exhibited a serum level of 1.0 ng/mL. That is, the serum level of AFLE exhibited a slope similar to that of Darbepoietin-α. ADLE exhibited higher stability as compared to Standard EPO, but showed lower stability than AFLE and ADLE2. ADLE2 exhibited slightly lower stability as compared to AFLE, but superior stability to that of ADLE. Further, the recombinant human albumin-EPO exhibited an about 3 -fold increased in vivo half-life, as compared to that of Standard EPO.

(3) Effects of recombinant human albumin-EPO fusion protein on production of erythroid progenitor cells in vivo

Male normocythaemic mice (B6D2F1, weighing 20 to 30 g) were purchased from the Hanlim Laboratory Animals Co. (HwaSung, Korea). The experimental group was divided into five groups, each consisting of 8 animals (n-8): Standard EPO, AFLE, ADLE2, ADLE and Darbepoietin-α. AU experimental animals were subcutaneously injected with a drug sample at a dose of 80, 40 and 20 ILVmL. After 4 days, about 1 mL of blood was collected from the orbital sinus of each experimental animal group, and 2 μl of Reti-STAT™ was added to the blood sample, followed by vortex and reaction for 20 min. In order to confirm the production of erythroid progenitor cells, 3 x 10⁴ cells were collected and measured using a Coulter FACS (Beckman, USA). As a result, the production of erythroid progenitor cells in the Standard EPO group was increased by about 4 to 7% at a concentration of 80 IU versus the control. The AFLE group exhibited a 12% increase in the number of erythroid progenitors versus control at an EPO concentration of 80 IU. The Darbepoietin-α group exhibited an 11% increase under the same conditions. At concentrations of 40 and 20 IU, AFLE exhibited a significantly higher production level of erythroid progenitors as compared to Standard EPO. These results were analyzed in terms of the linearity of erythroid progenitor cell growth versus the administration unit, using PLA1.2 (Pla2.0). The results obtained are shown in FIGS. 12 to 15. Accordingly, it was confirmed that the erythropoietic potency was increased as follows: 12.7-fold increase for Darbepoietin (FIG. 12), 32-fold increase for AFLE (FIG. 13), about 9.2-fold increase for ADLE2 (FIG. 14), and about 3.6-fold increase for ADLE (FIG. 15), as compared to Standard EPO.

The efficacy of the recombinant human albumin-EPO fusion proteins was compared in

Table 1 below.

Standard EPO has a titer of 130,000 IU/mg, whereas AFLE, ADLE2 and ADLE have potency values of 4218991 IU/mg, 1196769 IU/mg and 408486 IU/mg at the same EPO concentration (see Table 1).

Table 1

INDUSTRIAL APPLICABILITY

As apparent from the above description, an erythropoietin fusion protein of the present invention secures flexibility capable of ensuring the erythropoietic potency of human EPO, via the incorporation of a linker including a GGSGG-repeated amino acid sequence, and has various advantages such as high productivity, stability and purity, due to the use of human albumin. The fusion protein of the present invention exhibits an about 3 -fold increased in vivo half-life and superior erythroid progenitor production-promoting activity, as compared to conventional EPO. Further, the fusion protein of the present invention is safe due to a maximum decrease of antigenicity or carcinogenicity which was confirmed in polyethylene glycol-modified erythropoietin (PEG-modified EPO) or glycosylation-modified erythropoietin (EPO), which is a modified version of human EPO. Accordingly, the fusion protein of the present invention is therapeutically effective for prevention or treatment of anemia.

<RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT>

INTERNATIONAL FORM

RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.i O : KtM, Sanglin

Boryung Pharm. Co., Ltd.

1123-3 Shingil-dcngi Danwσn-gu, Ansan-si, Gyeonggi-do 425-120

Republic of Korea

the

DESIGNATION ^■■ by:

identified under I above,

International Depositary to a deposit

having the power

Form BP/4 (KCTC Fom 17) sole page INTERNATIONAL FORM

RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 : HM, Sanglin

Boryung Pharm. Co., Ltd.

1123-3 Shingil-dong, Danwαn-gu, Ansan-si, Gyeonggi-do 425-120

Republic of Korea

I . E)ENTIFICATION OF THE MICROORGANISM

Identification reference given by the Accession number given by the DEPOSITOR: INTERNATIONAL DEPOSITARY AUTHORITY:

AFLE 550-64 (CHO cell line) KOTC 11015BP

π. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION I

The microorganism identified under I above was accompanied by-"

[ x ] a scientific description

[ ] a proposed taxonomic designation

{Mark with a cross where applicable) in. RECEIPT AND ACCEPTANCE

This International Depositary Authority accepts the micπ»rganism identified under I above, which was received by it on October 27, 2006.

IV. RECEIPT OF REQUEST FOR CONVERSION

The microorganism identified under I above was received by this International Depositary Authority on and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on

V. INTERNATIONAL DEPOSITARY AUTHORITY

Name: Korean Collection for Type Cultures Signature(s) of person(s) having the power to represent the International Depositary Authority of authorized offiάaKs):

Address: Korea Research Institute of Biosdence and Biotechnology (KRIBB)

#52, Oun-dong, Yusong-ku, Taejon 305-333, OH, Hee-Mock, Director Republic of Korea Date: November 7, 20O6

Fnm BPΛ (KCTC Faun 17) sole page

Claims

WHAT IS CLAIMED IS:

1. An albumin-EPO fusion protein comprising a linker including an amino acid sequence of (GGSGG)_n which links human albumin and human erythropoietin (EPO), wherein n is an integer from 3 to 5.

2. The albumin-EPO fusion protein according to claim 1, wherein n is 4.

3. The albumin-EPO fusion protein according to claim 1, wherein the protein has an amino acid sequence as set forth in SEQ ID NO: 2.

4. The albumin-EPO fusion protein according to claim 1, wherein the protein has an amino acid sequence as set forth in SEQ ID NO: 4.

5. The albumin-EPO fusion protein according to claim 1, wherein the protein has an amino acid sequence as set forth in SEQ ID NO: 6.

6. A nucleic acid encoding the albumin-EPO fusion protein of any one of claims 1 to 5.

7. The nucleic acid according to claim 6, wherein the nucleic acid has a nucleotide sequence as set forth in SEQ ID NO: 1.

8. The nucleic acid according to claim 6, wherein the nucleic acid has a nucleotide sequence as set forth in SEQ ID NO: 3.

9. The nucleic acid according to claim 6, wherein the nucleic acid has a nucleotide sequence as set forth in SEQ ID NO: 5.

10. An expression vector comprising a human albumin gene, a linker including a nucleotide sequence of (GGAGGAAGCGGAGGA)_n wherein n is an integer from 3 to 5, and a human erythropoietin gene, wherein the expression vector expresses the fusion protein of claim 1.

11. The expression vector according to claim 10, wherein the expression vector has a nucleotide sequence as set forth in SEQ ID NO: 1.

12. The expression vector according to claim 10, wherein the expression vector has a nucleotide sequence as set forth in SEQ ID NO: 3.

13. The expression vector according to claim 10, wherein the expression vector has a nucleotide sequence as set forth in SEQ ID NO: 5.

14. The expression vector according to claim 10, further comprising a gene encoding dehydrofolate reductase (DHFR).

15. A cell line transfected with the expression vector of claim 10.

16. A cell line transfected with the expression vector of claim 10 and with an expression vector including a gene encoding dehydrofolate reductase (DHFR).

17. A cell line transfected with the expression vector of claim 14.

18. The cell line according to any one of claims 15 to 17, wherein the cell line is a Chinese hamster ovary (CHO) cell line.

19. The cell line according to claim 16 or 17, wherein the cell line is CHO/dhfr- which is dhfr- deficient.

20. A cell line deposited under Accession No. KCTC 11014BP.

21. A cell line deposited under Accession No. KCTC 1 1015BP.

22. A method for producing the fusion protein of claim 1 or 2 comprising: cloning a gene encoding the fusion protein of claim 1 or 2 into an expression vector; transfecting a cell line with the expression vector; and culturing the cell line.

23. The method according to claim 22, wherein the cell line is d/z/r-deficient, the cell line is transfected with an expression vector including a gene encoding the fusion protein and with an expression vector including a gene encoding dehydrofolate reductase (DHFR), and the transfected cell line is cultured in a medium containing methotrexate.

24. A pharmaceutical composition comprising the fusion protein of any one of claims 1 to 5.

25. A pharmaceutical composition for prevention or treatment of anemia, comprising the fusion protein of any one of claims 1 to 5.

26. A use of a pharmaceutical composition for preparing a medicament for prevention or treatment of anemia, comprising the fusion protein of any one of claims 1 to 5.

27. A method for prevention or treatment of anemia, comprising administrating to a mammal a pharmaceutical composition comprising a therapeutically effective amount of the fusion protein of any one of claims 1 to 5.